DOCSLIB.ORG

GIGANTUS1 (GTS1), a Member of Transducin/WD40 Protein

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
GIGANTUS1 (GTS1), a Member of Transducin/WD40 Protein Gachomo et al. BMC Plant Biology 2014, 14:37 http://www.biomedcentral.com/1471-2229/14/37 RESEARCH ARTICLE Open Access GIGANTUS1 (GTS1), a member of Transducin/WD40 protein superfamily, controls seed germination, growth and biomass accumulation through ribosome-biogenesis protein interactions in Arabidopsis thaliana Emma W Gachomo1,2†, Jose C Jimenez-Lopez3,4†, Lyla Jno Baptiste1 and Simeon O Kotchoni1,2* Abstract Background: WD40 domains have been found in a plethora of eukaryotic proteins, acting as scaffolding molecules assisting proper activity of other proteins, and are involved in multi-cellular processes. They comprise several stretches of 44-60 amino acid residues often terminating with a WD di-peptide. They act as a site of protein-protein interactions or multi-interacting platforms, driving the assembly of protein complexes or as mediators of transient interplay among other proteins. In Arabidopsis, members of WD40 protein superfamily are known as key regulators of plant-specific events, biologically playing important roles in development and also during stress signaling. Results: Using reverse genetic and protein modeling approaches, we characterize GIGANTUS1 (GTS1), a new member of WD40 repeat protein in Arabidopsis thaliana and provide evidence of its role in controlling plant growth development. GTS1 is highly expressed during embryo development and negatively regulates seed germination, biomass yield and growth improvement in plants. Structural modeling analysis suggests that GTS1 folds into a β-propeller with seven pseudo symmetrically arranged blades around a central axis. Molecular docking analysis shows that GTS1 physically interacts with two ribosomal protein partners, a component of ribosome Nop16, and a ribosome-biogenesis factor L19e through β-propeller blade 4 to regulate cell growth development. Conclusions: Our results indicate that GTS1 mightfunctioninplantdevelopmentalprocessesbyregulating ribosomal structural features, activities and biogenesis in plant cells. Our results suggest that GIGANTUS1 might be a promising target to engineer transgenic plants with higher biomass and improved growth development for plant-based bioenergy production. Keywords: Arabidopsis, Gigantus1, Gene expression, Homology modeling, Docking * Correspondence: [email protected] †Equal contributors 1Department of Biology, Rutgers University, 315 Penn St., Camden, NJ 08102, USA 2Center for Computational and Integrative Biology (CCIB), Rutgers University, 315 Penn St., Camden, NJ 08102, USA Full list of author information is available at the end of the article © 2014 Gachomo et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Gachomo et al. BMC Plant Biology 2014, 14:37 Page 2 of 17 http://www.biomedcentral.com/1471-2229/14/37 Background highlighting the relevance of WD40 domains mediating In plants, growth development, cell patterning, yield, different biological functions [9]. Furthermore, in con- and biomass accumulation are controlled by functional trast to other members of the β-propeller family, and genetic networks of several orders of magnitude that will despite being crucial for and residing in enzymatic com- require various complementary research approaches to plexes, no WD40 protein has been reported to possess uncover the basis of this functional genetic complexity. catalytic activity. Using a combination of reverse genetic and computa- In order to fully understand the molecular- and tional protein modeling, we identified a protein, termed structural-based regulatory mechanisms of GTS1 and GIGANTUS1 (GTS1), a member of transducin/WD40 the transducin/WD40 protein family, we carried out a protein superfamily that regulates growth development comprehensive expression profiling, a mutational-based in plants. phenotypic characterization and a structural-based pro- Transducin/WD40 repeat proteins are prominent fea- tein modeling of functional features of GIGANTUS1 in tures within proteins that mediate diverse protein-protein Arabidopsis. This is the first study in which the inter- interactions, including those involved in scaffolding acting partners of Arabidosis GTS1 protein have been and the cooperative assembly and regulation of dynamic identified. A comprehensive molecular and structural multi-subunit complexes [1,2]. The common and defined analysis based on protein homology modeling, and a feature of these proteins are short ~40 amino acid motifs, docking interaction study to elucidate the functional typically ending by Trp-Asp sequence, and usually com- mechanisms of GTS1 protein in regulating growth de- posed of a 7-8 bladed beta-propeller fold. However, a di- velopment in Arabidopsis thaliana were carried out. versity of proteins has been found with 4 to 16 repeated We described the phenotypic characterization of a gts1 units [3]. The low level of sequence conservation and knockout mutant during growth development and assessed functional diversity of WD40 domains make their identi- the GTS1-3D molecular structure and its docking features fication difficult. to uncover the regulatory relationship of GTS1 with other Repeated WD40 domains play central roles in bio- proteins. logical processes such as cell division and cytokinesis, apoptosis, light signaling and vision, cell motility, flower- Methods ing, floral development, meristem organization, protein Plant material and GTS1 expression profiling analysis trafficking, cytoskeleton dynamics, chemotaxis, nuclear Arabidopsis thaliana (ecotype Col-0) and gts1 knock- export to RNA processing, chromatin modification, and out mutant (T-DNA SALK_010647) from Arabidopsis transcriptional mechanism [4]. They act as a site for Biological Research Center (ABRC) were used throughout protein-protein interaction, where the specificity of the this work. Appropriate seeds were sown on Murashige proteins is determined by the sequences outside the re- and Skoog (1 × MS) agar plates or soil and seedlings were peats themselves. Their functional importance resides allowed to grow under continuous illumination (120-150 − − largely on the protein surfaces. They serve as multi- μEm 2 s 1) at 24°C. Seedling samples were collected at interacting platforms in cellular networks for the assembly different developmental stages for gene expression profil- of protein complexes or mediators of transient interplay ing. To analyze the expression of GTS1 gene, total RNA among other proteins [5]. Structural studies suggest that was extracted with TRIzol reagent (Molecular Research this property stems from their ability to interact with di- Center) and then reversed transcribed using qScript verse proteins, peptides or nucleic acids using multiple sur- cDNA Supermix (Quanta BioSciences, Gaithersburg, MD, faces, where the most common peptide interaction site of USA) as previously described [10]. Thereafter, the cDNA WD40 proteins is located on the top surface of the propel- was used as the template for PCR using gene-specific ler close to the central channel [6]. primers (Table 1), running 20 or 25 amplification cycles Although WD40 proteins also are present in bacteria, (linear range of amplification) unless otherwise noted [11]. e.g. Thermomonospora curvata [7] and Cyanobacterium The linear range of amplification was determined by run- synechocystis [8], WD40 domains are among the ten ning increasing cycle numbers and analyzing the amount most abundant domain types across eukaryotic proteomes, of cDNA fragments. PCR fragments were separated on 1% and interactome studies suggest that they are among the agarose gels containing ethidium bromide. A cDNA most promiscuous interactors. Despite several WD40- fragment generated from ACTIN (AT3G18780) served containing proteins acting as key regulators of plant- as an internal control. T-DNA insertion in GIGANTUS1 specific developmental events, WD40 domains have been gene was PCR-confirmed using GIGANTUS1 gene specific given less research attention compared to other common primers and T-DNA left border (LB) primer (Table 1). The domains, for example kinase domains. Up to now, there expression of GTS1 gene in gts1 mutant background was have been no comprehensive 3D structural analyses of analyzed by extracting total RNA from the gts1 homozy- WD40 protein revealing the interacting partners and gous line as above described and reverse transcribed into Gachomo et al. BMC Plant Biology 2014, 14:37 Page 3 of 17 http://www.biomedcentral.com/1471-2229/14/37 Table 1 Sequences of oligonucleotide primers used in this study Name Primer sequence Description GTS1-F1 5’GAGGAGCTGCAGGGTTATTT3’ For RT-PCR GTS1-R1 5’CAAGACGGGTTAATCTGGGTAG3’ For RT-PCR TDNA-LB 5’CCGTCTCACTGGTGAAAAGAA3’ For TDNA insertion GTS1-F2 5’CTGAAACGGCAAATGGAAGAAG3’ For complementation test GTS1-R2 5’CTATGTTGCTGGAAGTCGGAT3’ For complementation test Act2-F 5’GCGGATCCATGGCTGAGGCTGATGATATTCAACC3’ For RT-PCR Act2-R 5’CGTCTAGACCATGGAACATTTTCTGTGAACGATTCC3’ For RT-PCR cDNA as previously described [10], and further used in ex- The conserved WD40 protein sequence from Arabi- pression analysis. dopsis thaliana was identified using ScanProsite and the Swiss-Prot/TrEMBLE
Load more

Recommended publications
  • Dynamic Control of Enhancer Activity Drives Stage-Specific Gene
    ARTICLE https://doi.org/10.1038/s41467-019-09513-2 OPEN Dynamic control of enhancer activity drives stage-specific gene expression during flower morphogenesis Wenhao Yan 1,7, Dijun Chen 1,2,7, Julia Schumacher 1,2, Diego Durantini2,5, Julia Engelhorn3,6, Ming Chen4, Cristel C. Carles 3 & Kerstin Kaufmann 1 fi 1234567890():,; Enhancers are critical for developmental stage-speci c gene expression, but their dynamic regulation in plants remains poorly understood. Here we compare genome-wide localization of H3K27ac, chromatin accessibility and transcriptomic changes during flower development in Arabidopsis. H3K27ac prevalently marks promoter-proximal regions, suggesting that H3K27ac is not a hallmark for enhancers in Arabidopsis. We provide computational and experimental evidence to confirm that distal DNase І hypersensitive sites are predictive of enhancers. The predicted enhancers are highly stage-specific across flower development, significantly associated with SNPs for flowering-related phenotypes, and conserved across crucifer species. Through the integration of genome-wide transcription factor (TF) binding datasets, we find that floral master regulators and stage-specific TFs are largely enriched at developmentally dynamic enhancers. Finally, we show that enhancer clusters and intronic enhancers significantly associate with stage-specific gene regulation by floral master TFs. Our study provides insights into the functional flexibility of enhancers during plant devel- opment, as well as hints to annotate plant enhancers. 1 Department for Plant Cell and Molecular Biology, Institute for Biology, Humboldt-Universität zu Berlin, 10115 Berlin, Germany. 2 Institute for Biochemistry and Biology, University of Potsdam, 14476 Potsdam, Germany. 3 Université Grenoble Alpes (UGA), CNRS, CEA, INRA, IRIG-LPCV, 38000 Grenoble, France, 38000 Grenoble, France.
    [Show full text]
  • An in Vivo Screen Identifies PYGO2 As a Driver for Metastatic Prostate Cancer
    Published OnlineFirst May 16, 2018; DOI: 10.1158/0008-5472.CAN-17-3564 Cancer Molecular Cell Biology Research An In Vivo Screen Identifies PYGO2 as a Driver for Metastatic Prostate Cancer Xin Lu1,2,3, Xiaolu Pan1, Chang-Jiun Wu4, Di Zhao1, Shan Feng2, Yong Zang5, Rumi Lee1, Sunada Khadka1, Samirkumar B. Amin4, Eun-Jung Jin6, Xiaoying Shang1, Pingna Deng1,Yanting Luo2,William R. Morgenlander2, Jacqueline Weinrich2, Xuemin Lu2, Shan Jiang7, Qing Chang7, Nora M. Navone8, Patricia Troncoso9, Ronald A. DePinho1, and Y. Alan Wang1 Abstract Advanced prostate cancer displays conspicuous chromosomal inhibits prostate cancer cell invasion in vitro and progression of instability and rampant copy number aberrations, yet the identity primary tumor and metastasis in vivo. In clinical samples, PYGO2 of functional drivers resident in many amplicons remain elusive. upregulation associated with higher Gleason score and metastasis Here, we implemented a functional genomics approach to identify to lymph nodes and bone. Silencing PYGO2 expression in patient- new oncogenes involved in prostate cancer progression. Through derived xenograft models impairs tumor progression. Finally, integrated analyses of focal amplicons in large prostate cancer PYGO2 is necessary to enhance the transcriptional activation in genomic and transcriptomic datasets as well as genes upregulated response to ligand-induced Wnt/b-catenin signaling. Together, our in metastasis, 276 putative oncogenes were enlisted into an in vivo results indicate that PYGO2 functions as a driver oncogene in the gain-of-function tumorigenesis screen. Among the top positive 1q21.3 amplicon and may serve as a potential prognostic bio- hits, we conducted an in-depth functional analysis on Pygopus marker and therapeutic target for metastatic prostate cancer.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • BOP1 (A-18): Sc-87884
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . BOP1 (A-18): sc-87884 BACKGROUND CHROMOSOMAL LOCATION Predominantly localized to the nucleolus, BOP1 (Block of proliferation 1 pro - Genetic locus: BOP1 (human) mapping to 8q24.3; Bop1 (mouse) mapping to tein) is a 746 amino acid highly conserved non-ribosomal protein that is in- 15 D3. volved in ribosome biogenesis. Truncation of the amino terminus of BOP1 leads to cell growth arrest in the G 1 phase and specific inhibition of 28S and SOURCE 5.8S rRNA synthesis, as well as a deficit in the cytosolic 60S ribosomal sub - BOP1 (A-18) is an affinity purified rabbit polyclonal antibody raised against a unit. This suggests that BOP1 is involved in the formation of mature rRNAs peptide mapping within an internal region of BOP1 of human origin. and in the biogenesis of the 60S ribosomal subunit. BOP1 physically inter acts with pescadillo (a protein involved in cell proliferation) and enables efficient PRODUCT incorporation of pescadillo into the nucleolar preribosomal complexes, there - by affecting rRNA maturation and the cell cycle. The BOP1-pescadillo com - Each vial contains 100 µg IgG in 1.0 ml of PBS with < 0.1% sodium azide plex is also necessary for biogenesis of 60S ribosomal subunits. Deregulation and 0.1% gelatin. of BOP1 may lead to colorectal tumorigenesis. Blocking peptide available for competition studies, sc-87884 P, (100 µg peptide in 0.5 ml PBS containing < 0.1% sodium azide and 0.2% BSA). REFERENCES 1. Strezoska, Z., Pestov, D.G. and Lau, L.F. 2000.
    [Show full text]
  • The Temporal Mutational and Immune Tumour Microenvironment
    www.nature.com/npjbcancer ARTICLE OPEN The temporal mutational and immune tumour microenvironment remodelling of HER2-negative primary breast cancers ✉ Leticia De Mattos-Arruda 1,2,3 , Javier Cortes 4,5,6,7,8, Juan Blanco-Heredia1,2, Daniel G. Tiezzi 3,9, Guillermo Villacampa10, Samuel Gonçalves-Ribeiro 10, Laia Paré11,12,13, Carla Anjos Souza1,2, Vanesa Ortega7, Stephen-John Sammut3,14, Pol Cusco10, Roberta Fasani10, Suet-Feung Chin 3, Jose Perez-Garcia4,5,6, Rodrigo Dienstmann10, Paolo Nuciforo10, Patricia Villagrasa12, Isabel T. Rubio10, Aleix Prat 11,12,13 and Carlos Caldas 3,14 The biology of breast cancer response to neoadjuvant therapy is underrepresented in the literature and provides a window-of- opportunity to explore the genomic and microenvironment modulation of tumours exposed to therapy. Here, we characterised the mutational, gene expression, pathway enrichment and tumour-infiltrating lymphocytes (TILs) dynamics across different timepoints of 35 HER2-negative primary breast cancer patients receiving neoadjuvant eribulin therapy (SOLTI-1007 NEOERIBULIN- NCT01669252). Whole-exome data (N = 88 samples) generated mutational profiles and candidate neoantigens and were analysed along with RNA-Nanostring 545-gene expression (N = 96 samples) and stromal TILs (N = 105 samples). Tumour mutation burden varied across patients at baseline but not across the sampling timepoints for each patient. Mutational signatures were not always conserved across tumours. There was a trend towards higher odds of response and less hazard to relapse when the percentage of 1234567890():,; subclonal mutations was low, suggesting that more homogenous tumours might have better responses to neoadjuvant therapy. Few driver mutations (5.1%) generated putative neoantigens.
    [Show full text]
  • Fanconi Anemia Protein FANCI Functions in Ribosome Biogenesis
    Fanconi anemia protein FANCI functions in ribosome biogenesis Samuel B. Sondallea, Simonne Longerichb,1, Lisa M. Ogawab, Patrick Sungb,c, and Susan J. Basergaa,b,c,2 aDepartment of Genetics, Yale School of Medicine, New Haven, CT 06520; bDepartment of Molecular Biophysics and Biochemistry, Yale School of Medicine, New Haven, CT 06520; and cDepartment of Therapeutic Radiology, Yale School of Medicine, New Haven, CT 06520 Edited by Joseph G. Gall, Carnegie Institution of Washington, Baltimore, MD, and approved December 28, 2018 (received for review July 8, 2018) Fanconi anemia (FA) is a disease of DNA repair characterized by bone responsible for the transcription of pre-ribosomal RNA (pre- marrow failure and a reduced ability to remove DNA interstrand rRNA) (33). The clear phenotypic overlap between FA and cross-links. Here, we provide evidence that the FA protein FANCI also bone marrow failure ribosomopathies and the connection between functions in ribosome biogenesis, the process of making ribosomes BRCA1 (FANCS) and RNAPI suggest a possible connection be- that initiates in the nucleolus. We show that FANCI localizes to the tween FA and defects in ribosome biogenesis. nucleolus and is functionally and physically tied to the transcription The process of making ribosomes in eukaryotes, termed ri- of pre-ribosomal RNA (pre-rRNA) and to large ribosomal subunit bosome biogenesis, initiates in the large nonmembrane-bound (LSU) pre-rRNA processing independent of FANCD2. While FANCI is nuclear organelle, the nucleolus (NO) (34, 35). In the NO, tan- known to be monoubiquitinated when activated for DNA repair, we dem repeats of ribosomal DNA (rDNA) (36) are transcribed by find that it is predominantly in the deubiquitinated state in the RNAPI, which generates a long pre-rRNA (37).
    [Show full text]
  • Sumoylation of PES1 Upregulates Its Stability and Function Via Inhibiting Its Ubiquitination
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 31 Research Paper SUMOylation of PES1 upregulates its stability and function via inhibiting its ubiquitination Shujing Li1, Miao Wang1, Xinjian Qu2, Zhaowei Xu1, Yangyang Yang1, Qiming Su2, Huijian Wu1,2 1School of Life Science and Biotechnology, Dalian University of Technology, Dalian, China 2School of Life Science and Medicine, Dalian University of Technology, Panjin, China Correspondence to: Huijian Wu, email: [email protected] Keywords: PES1, SUMOylation, breast cancer, ubiquitination Received: July 21, 2015 Accepted: June 15, 2016 Published: July 08, 2016 ABSTRACT PES1 is a component of the PeBoW complex, which is required for the maturation of 28S and 5.8S ribosomal RNAs, as well as for the formation of the 60S ribosome. Deregulation of ribosomal biogenesis can contribute to carcinogenesis. In this study, we showed that PES1 could be modified by the small ubiquitin-like modifier (SUMO) SUMO-1, SUMO-2 and SUMO-3, and SUMOylation of PES1 was stimulated by estrogen (E2). One major SUMOylation site (K517) was identified in the C-terminal Glu-rich domain of PES1. Substitution of K517 with arginine abolished the SUMOylation of PES1. SUMOylation also stabilized PES1 through inhibiting its ubiquitination. In addition, PES1 SUMOylation positively regulated the estrogen signaling pathway. SUMOylation enhanced the ability of PES1 to promote estrogen receptor α (ERα)- mediated transcription by increasing the stability of ERα, both in the presence and absence of E2. Moreover, SUMOylation of PES1 also increased the proportion of S-phase cells in the cell cycle and promoted the proliferation of breast cancer cells both in vitro and in vivo.
    [Show full text]
  • Overexpressed HSF1 Cancer Signature Genes Cluster in Human Chromosome 8Q Christopher Q
    Zhang et al. Human Genomics (2017) 11:35 DOI 10.1186/s40246-017-0131-5 PRIMARY RESEARCH Open Access Overexpressed HSF1 cancer signature genes cluster in human chromosome 8q Christopher Q. Zhang1,4, Heinric Williams3,4, Thomas L. Prince3,4† and Eric S. Ho1,2*† Abstract Background: HSF1 (heat shock factor 1) is a transcription factor that is found to facilitate malignant cancer development and proliferation. In cancer cells, HSF1 mediates a set of genes distinct from heat shock that contributes to malignancy. This set of genes is known as the HSF1 Cancer Signature genes or simply HSF1-CanSig genes. HSF1-CanSig genes function and operate differently than typical cancer-causing genes, yet it is involved in fundamental oncogenic processes. Results: By utilizing expression data from 9241 cancer patients, we identified that human chromosome 8q21-24 is a location hotspot for the most frequently overexpressed HSF1-CanSig genes. Intriguingly, the strength of the HSF1 cancer program correlates with the number of overexpressed HSF1-CanSig genes in 8q, illuminating the essential role of HSF1 in mediating gene expression in different cancers. Chromosome 8q21-24 is found under selective pressure in preserving gene order as it exhibits strong synteny among human, mouse, rat, and bovine, although the biological significance remains unknown. Statistical modeling, hierarchical clustering, and gene ontology-based pathway analyses indicate crosstalk between HSF1-mediated responses and pre-mRNA 3′ processing in cancers. Conclusions: Our results confirm the unique role of chromosome 8q mediated by the master regulator HSF1 in cancer cases. Additionally, this study highlights the connection between cellular processes triggered by HSF1 and pre-mRNA 3′ processing in cancers.
    [Show full text]
  • Genome-Wide Analyses of XRN1-Sensitive Targets in Osteosarcoma Cells Identifies Disease-Relevant 2 Transcripts Containing G-Rich Motifs
    Downloaded from rnajournal.cshlp.org on October 11, 2021 - Published by Cold Spring Harbor Laboratory Press 1 Genome-wide analyses of XRN1-sensitive targets in osteosarcoma cells identifies disease-relevant 2 transcripts containing G-rich motifs. 3 Amy L. Pashler, Benjamin P. Towler+, Christopher I. Jones, Hope J. Haime, Tom Burgess, and Sarah F. 4 Newbury1+ 5 6 Brighton and Sussex Medical School, University of Sussex, Brighton, BN1 9PS, UK 7 8 +Corresponding author: Prof Sarah Newbury, Medical Research Building, Brighton and Sussex 9 Medical School, University of Sussex, Falmer, Brighton BN1 9PS, UK. 10 Tel: +44(0)1273 877874 11 [email protected] 12 13 +Co-corresponding author: Dr Ben Towler, Medical Research Building, Brighton and Sussex Medical 14 School, University of Sussex, Falmer, Brighton BN1 9PS, UK. 15 Tel: +44(0)1273 877876 16 [email protected] 17 18 Running title: Genome-wide analyses of XRN1 targets in OS cells 19 20 Key words: XRN1, RNA-seq, Ewing sarcoma, lncRNAs, RNA degradation 21 22 23 24 25 26 27 28 29 30 31 32 33 Pashler et al 1 Downloaded from rnajournal.cshlp.org on October 11, 2021 - Published by Cold Spring Harbor Laboratory Press 34 35 ABSTRACT 36 XRN1 is a highly conserved exoribonuclease which degrades uncapped RNAs in a 5’-3’ direction. 37 Degradation of RNAs by XRN1 is important in many cellular and developmental processes and is 38 relevant to human disease. Studies in D. melanogaster demonstrate that XRN1 can target specific 39 RNAs, which have important consequences for developmental pathways.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Floral Induction in Arabidopsis by FLOWERING LOCUS T Requires Direct Repression of BLADE-ON-PETIOLE Genes by the Homeodomain Protein PENNYWISE1[OPEN]
    Floral Induction in Arabidopsis by FLOWERING LOCUS T Requires Direct Repression of BLADE-ON-PETIOLE Genes by the Homeodomain Protein PENNYWISE1[OPEN] Fernando Andrés, Maida Romera-Branchat, Rafael Martínez-Gallegos, Vipul Patel, Korbinian Schneeberger, Seonghoe Jang2, Janine Altmüller, Peter Nürnberg, and George Coupland* Max Planck Institute for Plant Breeding Research, D–50829 Cologne, Germany (F.A., M.R.-B., R.M.-G., V.P., K.S., S.J., G.C.); and Cologne Center for Genomics (J.A., P.N.), Institute of Human Genetics (J.A.), Center for Molecular Medicine Cologne (P.N.), and Cologne Excellence Cluster on Cellular Stress Responses in Aging- Associated Diseases (P.N.), University of Cologne, 50931 Cologne, Germany ORCID IDs: 0000-0003-4736-8876 (F.A.); 0000-0002-6685-5066 (M.R.-B.); 0000-0003-0012-5033 (R.M.-G.); 0000-0001-5018-3480 (S.J.); 0000-0001-6988-4172 (G.C.). Flowers form on the flanks of the shoot apical meristem (SAM) in response to environmental and endogenous cues. In Arabidopsis (Arabidopsis thaliana), the photoperiodic pathway acts through FLOWERING LOCUS T (FT) to promote floral induction in response to day length. A complex between FT and the basic leucine-zipper transcription factor FD is proposed to form in the SAM, leading to activation of APETALA1 and LEAFY and thereby promoting floral meristem identity. We identified mutations that suppress FT function and recovered a new allele of the homeodomain transcription factor PENNYWISE (PNY). Genetic and molecular analyses showed that ectopic expression of BLADE-ON-PETIOLE1 (BOP1) and BOP2, which encode transcriptional coactivators, in the SAM during vegetative development, confers the late flowering of pny mutants.
    [Show full text]
  • PDF of Eric Lecuyer's Talk
    Gene Expression Regulation in Subcellular Space Eric Lécuyer, PhD Associate Professor and Axis Director, RNA Biology Lab Systems Biology Axis, IRCM Associate Research Professor, Département de Biochimie Université de Montréal Associate Member, Division of Experimental Medicine, McGill University VizBi 2018 Meeting The Central Dogma in Subcellular Space Crick, Nature 227: 561 (1970) Biological Functions of Localized mRNAs mRNA Protein Extracellular Vesicles Cody et al. (2013). WIREs Dev Biol Raposo and Stoorvogel (2013) J Cell Biol Cis-Regulatory RNA Localization Elements Van De Bor and Davis, 2004. Curr.Opin.Cell.Biol. Global Screen for Localized mRNAs in Drosophila http://fly-fish.ccbr.utoronto.ca (Lécuyer et al. Cell, 2007) Diverse RNA Subcellular Localization Patterns RNA DNA Correlations in mRNA-Protein Localization Localization Patterns Terms Ontology Gene RNA Protein DNA (Lécuyer et al. Cell, 2007) Models and Approaches to Decipher the mRNA Localization Pathways Drosophila & RNA/Protein High-Content Screening Human Cell Models Imaging & RNA Sequencing + + Cell Fractionation and RNA Sequencing (CeFra-seq) to Study Global RNA Distribution Cell Fractionation-Seq to Study RNA Localization RNA and Protein Extraction, RiboDepletion or PolyA+ RNA-seq and MS profiling (K562, HepG2 and D17) Wang et al (2012) Cell https://www.encodeproject.org/ Lefebvre et al (2017) Methods Benoît Bouvrette et al (2018) RNA Interesting Examples of RNA Localization ANKRD52 (mRNA and ciRNA) Total Nuclear Cytosolic ciRNA Membrane Insoluble mRNA ANKRD52 DANCR
    [Show full text]