Determinants of Neutralization in Envelope Proteins of Hepatitis C Virus

DETERMINANTS OF NEUTRALIZATION IN ENVELOPE PROTEINS OF HEPATITIS C VIRUS

Lisa Naomi Wasilewski

A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy

Baltimore, Maryland

May 2016 ABSTRACT

Hepatitis C Virus (HCV) is a chronic viral infection of humans which poses a significant global health threat. Millions of affected individuals are at risk for cirrhosis and hepatocellular carcinoma and as yet, no vaccine exists.

Despite recent significant advances in HCV treatment, development of an HCV vaccine is a vital component in the effort to eradicate the virus. It has been demonstrated that broadly neutralizing antibodies (bNAbs) can prevent HCV infection despite a broad range of genetic variability and, as such, may serve as a useful tool for vaccine development. However, current understanding of bNAbs is still limited, particularly in regard to specific determinants of neutralization. In this thesis, we seek to gain a better understanding of viral polymorphisms which confer resistance to neutralization by both polyclonal plasma and broadly neutralizing monoclonal antibodies. Here, we identify a polymorphism which renders Bole1a, a computationally derived, ancestral genotype 1a HCV strain resistant to neutralization by both polyclonal plasma and multiple broadly neutralizing monoclonal antibodies.

A considerable amount of work has gone towards developing research models which effectively mimic aspects of the viral life cycle in infected individuals. It is critical to define the relative benefits and limitations of different model systems in order to understand the effects of each. Two commonly used models are the

HCV pseudoparticle system (HCVpp) and HCV cell culture (HCVcc). This thesis undertakes to describe the development of an efficient means by which to expand the repertoire of HCVcc constructs and to systematically compare the

ii relative fitness and neutralization resistance of HCV envelope proteins in both the HCVpp and HCVcc model systems. In doing so, we show differences in HCV envelope fitness measured using the two systems but demonstrate strong agreement between antibody neutralization measured using HCVpp or HCVcc.

iii

Stuart C. Ray, M.D. (Advisor, Reader)

Justin R. Bailey, M.D., Ph.D. (Committee Member, Reader)

Alan Scott, Ph.D. (Committee Member)

Joel Blankson, M.D., Ph.D. (Committee Member)

ACKNOWLEDGEMENTS

First I would like to thank my advisors, Stuart C. Ray and Justin R. Bailey for giving me the opportunity to learn and grow as a scientist under their guidance.

The privilege of working with people for whom I have such profound respect both professionally and personally has made my experience here deeply gratifying.

For their boundless patience, equanimity, and generosity, I am sincerely grateful.

I would also like to thank my classmates and labmates, both students and technicians, for their constant support and friendship. They have enriched my time at Hopkins both in and outside the lab and this sense of camaraderie has brought joy to my education.

Thank you to my coauthors and those who have laid the foundation for my project work. The members of the Viral Hepatitis Center have contributed invaluably over the years with thoughtful suggestions and contributions of their own time and expertise. Other members of the Hopkins community have been instrumental in bringing this work to bear, particularly John Gibas at the Ross

Fluorescence Imagine Center and Christopher Thorburn at the Human

Immunology Core.

For feedback, helpful suggestions, and flexibility in scheduling, I thank the members of my thesis committee, Alan Scott, PhD and Joel Blankson, MD, PhD.

Finally, the loving encouragement of my family throughout my life, in endeavors both academic and personal, has been the cornerstone of my every achievement.

TABLE OF CONTENTS

ABSTRACT ...... ii ACKNOWLEDGMENTS...... v LIST OF TABLES ...... vii LIST OF FIGURES ...... viii CHAPTER I: INTRODUCTION ...... 1 CHAPTER II: A HEPATITIS C VIRUS ENVELOPE POLYMORPHISM CONFERS RESISTANCE TO NEUTRALIZATION BY POLYCLONAL SERA AND BROADLY NEUTRALIZING MONOCLONAL ANTIBODIES ...... 11 ABSTRACT ...... 12 IMPORTANCE ...... 13 INTRODUCTION ...... 14 MATERIALS AND METHODS...... 16 RESULTS ...... 23 DISCUSSION ...... 30 FIGURES ...... 33 CHAPTER III: AGREEMENT BETWEEN HEPATITIS C VIRUS NEUTRALIZATION MEASURED USING REPLICATION COMPETENT VIRUS AND PSEUDOPARTICLES ...... 49 ABSTRACT ...... 50 IMPORTANCE ...... 52 INTRODUCTION ...... 53 MATERIALS AND METHODS...... 56 RESULTS ...... 62 DISCUSSION ...... 67 FIGURES ...... 73 CHAPTER IV: DISCUSSION ...... 88 APPENDIX REFERENCES ...... 92 CURRICULUM VITAE ...... 114

LIST OF TABLES

Table 3.1 E1E2-matched HCVpp and HCVcc IC50 values

Table 3.2 HCVpp Fraction Unaffected and HCVcc IC50 values

vii

LIST OF FIGURES

Figure 2.1 Codons 242, 424, and 570 show evidence of deep phylogenetic variation, and evolution at the 424 position is constrained

Figure 2.2 Mutation of arginine (R) 424 to serine (S) confers resistance to neutralization by plasma

Figure 2.3 Mutation of arginine (R) 424 to serine (S) confers resistance to neutralization by plasma

Figure 2.4 Mutation of arginine (R) 424 to serine (S) confers resistance to binding of plasma antibodies

Figure 2.5 Mutation of arginine 424 to serine confers resistance to neutralization by a diverse array of broadly neutralizing monoclonal antibodies

Figure 2.6 Mutation of arginine 424 to serine confers resistance to binding of broadly neutralizing monoclonal antibodies

Figure 2.7 Bole1a_S424 carries a fitness cost

Figure 3.1 Cloning strategy to generate HCVcc and HCVpp with matched E1E2 proteins

Figure 3.2 E1E2 genes used to generate E1E2-matched HCVcc and HCVpp are genetically diverse

Figure 3.3 No correlation between relative specific infectivities of E1E2-matched

HCVcc and HCVpp

viii

Figure 3.4 E1E2-matched HCVcc and HCVpp show the same hierarchy of neutralization resistance to a panel of broadly neutralizing antibodies targeting distinct epitopes

Figure 3.5 Positive correlation between the rank orders of IC50 values measured using E1E2-matched HCVpp and HCVcc

Figure 3.6 Positive correlation between the rank orders of Fraction Unaffected values measured using HCVpp and IC50 values measured using E1E2-matched

HCVcc

Supplemental Figure 3.1 All HCVcc and HCVpp neutralization curves used to calculate IC50 values

Supplemental Table 3.1 HCVcc and HCVpp specific infectivity measurements

CHAPTER I: INTRODUCTION

The natural history of hepatitis C virus

Hepatitis C Virus (HCV) is found in virtually every region of the world, posing an important global health problem and affecting an estimated 170 million people

(1). In the United States, there are approximately four million people with persistent hepatitis C infection and more than 10 thousand HCV-related deaths each year (2). Acute HCV infection progresses to chronic infection in 60-85% of cases. A large percentage of those who become infected will remain asymptomatic; however, of those chronically infected for two decades, 5-20% will develop cirrhosis of which 7% will annually progress to end-stage liver disease and hepatocellular carcinoma. HCV remains the leading indication for liver transplant in the United States, Japan, and Australia (3).

In a minority of cases, infected persons will spontaneously clear HCV infection.

Little is understood about why certain individuals become chronically infected while others spontaneously resolve the viral infection. Some predictors of the course of infection include co-infection with HIV, age, race, and gender. Genetic factors have also been implicated in disease progression. Multiple studies have published findings on a strong correlation between genetic polymorphisms in or near the IFNL3-IFNL4 locus and both spontaneous and treatment-induced HCV clearance (4-7). A single nucleotide polymorphism, rs12979860, three kilobases upstream of the gene encoding the type III interferon (IFN)- λ3, also known as

IL28B, and the C/C genotype are associated with spontaneous resolution of HCV infection (8). More recently, rs368234815, located in the first exon of IFNL4 has been identified as having a strong association with HCV clearance. The G allele

2 at this position causes a frameshift, creating a novel gene encoding the type III

IFN_ λ4protein (9). Also, HLA class I alleles HLA-B*27, HLA-B*57, and HLA-

Cw*01 are also associated with HCV clearance (10).

HCV transmission is typically blood borne via injection drug use or through blood transfusions and other procedures involving unscreened and infected donors

(11).

Current treatments

In recent years, HCV treatment has been significantly changed by the introduction of novel direct-acting antivirals (DAAs) such as sofosbuvir and simeprevir(12). Despite sustained virologic response, fewer adverse events than previous treatments, and cure rates approaching 100%, development of a preventative vaccine remains imperative (13-16). Not only are current treatment protocols expensive and largely inaccessible in much of the world, but slow disease progression has left many people undiagnosed and hence untreated and able to spread infection. Treatment is not protective against reinfection which happens frequently and the possibility of viral resistance mutations that can complicate treatment remains (17, 18). Not all patients respond to therapy with certain genotypes proving particularly difficult to treat.For those infected, once fibrosis has been established, the risk for liver disease remains even after the viral infection has been resolved (19-21) . For these reasons, it is critical that research on prophylactic vaccines continues.

Model systems

HCV research has been hindered by a limited number and availability of animal models and an early lack of in vitro systems with which to study the virus and develop prophylactics and therapies. Aside from humans, chimpanzees and tree shrews (Tupaia) are the only two animal species naturally permissive to infection by HCV (22-24). While the course of infection is similar between humans and chimpanzees, interestingly, chimpanzees are significantly more likely to spontaneously resolve HCV infection and have lower levels of liver inflammation and disease as compared to humans. While they have been used in a variety of studies and early work in this animal model helped move the field forward, their use in biomedical research is now restricted for ethical reasons. Only limited research on HCV pathogenesis in the tree shrew model is available (25).

An important advancement in studying HCV came with the development of the

HCV pseudoparticle (HCVpp) system (26-28). Originally developed for reverse genetic analysis of HIV, the ability to pseudotype HIV nucleocapsids with HCV glycoproteins E1 and E2 on the surface has proven useful in studying the molecular mechanisms of HCV entry as well as allowing for the assessment of antibody neutralization (29). The development of this model system has been particularly useful for considering the genetic diversity of the virus as patient- derived E1E2 sequences can be efficiently pseudotyped and large libraries of

HCVpp have been generated (30, 31).

Early cell culture-derived HCV (HCVcc) was difficult due to the absence of productive infection in hepatoma cells lines using HCV-infected patient isolates.

Significant progress was made in 2005 with the discovery of JFH1, a genotype

2a isolate from an infected patient which, uniquely, can efficiently complete the

HCV life cycle in Huh-7 hepatoma cell lines. This allowed for the discovery of new entry factors, the study of viral assembly and virion release, and a better understanding of the mechanisms of antiviral drugs (32-34).

The discovery of JFH1 soon led to development of intragenotypic chimeras, most notably J6/JFH1 and Jc1. From there, several intergenotypic chimeric viruses were constructed replacing various JFH1 genes with counterparts from other genotypes (33-35). These HCVcc have been used to further study viral entry pathways (32, 36-38) and to demonstrate that broadly neutralizing antibodies can prevent HCV infection in animal models (39-41).

Genetic diversity

A remarkable amount of genetic diversity is found within the HCV genome both within and between genotypes. HCV is from the Hepacivirus genus of the

Flaviviridae family, and is separated into 7 major genotypes further subdivided into 67 subtypes (3, 42). It is an enveloped virus with a 9.6kb positive-sense RNA genome which encodes a single open-reading frame. Post-translational modifications by both host and viral proteases generates 10 mature proteins, 3 structural (core, E1, E2) and 7 non-structural (p7, NS2, NS3, NS4A, NS4B,

NS5A, NS5B). The HCV capsid is surrounded by a host-derived lipoprotein envelope in which structural glycoproteins E1 and E2 are embedded and associate with serum lipoproteins such as apolipoprotein E (ApoE) (43). E1 and

E2, presented on the surface of the virion, mediate multiple functions including

HCV binding and entry into target cells (26, 27, 44) while the nonstructural proteins manage HCV replication via RNA synthesis, suppression of host defense mechanisms, and viral assembly (45, 46).

The high variability of this virus, which varies not only between people but also over time within an infected individual, presents a major challenge to the immune response. Within each infected person, HCV exists as a collection of genetically- related yet distinct variants known as a quasispecies (47-50). Genetic evolution of quasispecies variants is influenced by a balance between evasion of the host immune system and constraints on viral fitness (51-54).

Due in part to an RNA polymerase lacking proofreading function and a high replication rate in vivo, HCV has a high rate of evolution. In particular, the HCV

E1E2-coding region is extremely genetically diverse. While there are several highly conserved amino acid residues, many of them necessary for receptor interactions required for viral entry, there are also three particularly variable regions: HVR1, HVR2, and the intergenotypic variable region (IgVR) (55-57).

This variability is further strongly influenced by host immune pressures. This extraordinary genetic diversity and rapid viral evolution in infected individuals has complicated vaccine development.

HCV binding and entry

HCV entry and subsequent infection requires a number of virus/host cell interactions. First, in a process mediated through virion-associated ApoE (58-60) and cellular low-density lipoprotein receptor (LDL-R) (61-64), virions must bind to

6 heparan sulfate proteoglycans on hepatocytes (65-67). This association between

HCV particles and lipoproteins is critical for the initiation of viral entry (68).Other important binding receptors include scavenger receptor class B type I (SR-B1), which binds to virion-associated lipoproteins and E2, and cluster of differentiation

81 (CD81) which also binds to E2 (69). SR-B1 may facilitate binding by exposing areas of E2 that are involved with other binding factors such as CD81 which has later roles in activating signaling pathways (70-73).

Tight junction proteins claudin-1 (CLDN1) and occludin (OCLN) are other HCV entry factors. CLDN1 interacts with CD81 which, when complexed, mediates clathrin-dependent endocytosis and is taken into the clathrin-coated endosome along with the bound HCV particle (73-76). The role of OCLN, while critical for a late step of virus entry, has not yet been fully described (75, 77).

Once this series of virus-host binding reactions has occurred, the virion is internalized into early endosomes. Here, the low pH environment induces viral fusion to late endosome membranes which prompts the release of viral RNA into the cytosol (73, 78). HCV may also enter cells via cell-to-cell spread (79).

Immune response to HCV

Previous studies have shown that spontaneous clearance of HCV infection is associated with a broadly specific and robust cellular immune response (80-83) and rapid induction of neutralizing antibodies during the acute phase of infection

(84). By contrast, chronic infection tends to be characterized by low frequencies of specific CD8 T cells in peripheral blood (85-90).

Upon viral entry, the innate immune response is activated, acting as the host cell’s first line of defense against viral infections. Briefly, HCV is detected by germline-encoded pattern recognition receptors (PRRs) such as retinoic acid- inducible gene I (RIG-I)-like receptors (RLRs), Toll-like receptors (TLRs), nucleotide oligomerization domain-like receptors (NLRs), and cytosolic DNA sensors. TLR3 recognizes HCV double-stranded RNA intermediates, inducing the production of inflammatory cytokines upon detection (91). RIG-I recognizes the polyuridine-rich motif of the 3’ untranslated region (UTR), inducing the production of IFNs (92) .

As a means of evading the innate immune response, HCV NS3-4A protease can cleave the host adaptor proteins mitochondrial anti-viral-signaling proteins

(MAVS) and TIR-domain-containing adaptor-inducing IFN-β (TRIF). This inhibits the RIG-I like receptors and TLRs which mediate type I and type III IFN signaling pathways (93-95). NS4B has been shown to block IFN production by disrupting

STING interaction with MAVS and TBK1 (96, 97). Through these molecular mechanisms, HCV infection is able to persist in host cells.

Persistent HCV infection caused by the failure of the innate immune system induces the development of the adaptive immune response. This is characterized by the generation of an HCV-specific T-cell response and the production of HCV neutralizing antibodies (98).

HCV-specific CD8 T cells begin to appear 6-8 weeks following infection (54, 99), a delay attributed to priming of these cells (100). This delay in cellular immune

8 response is not associated with HCV clearance rates (54); rather, spontaneous resolution of infection is associated with robust HCV-specific CD8 T cells responses that include increased breadth and magnitude of recognized epitopes and enhanced cytokine production (101-104). At the same time, HCV-specific

CD4 T cells provide help through the secretion of cytokines and activation of antigen-presenting cells (105). These cells show high proliferative capacity during the acute phase of infection which aids in viral clearance (106).

Humoral responses, too, are delayed (107) and widely thought to play only a peripheral role in HCV control (80, 99, 108). However, recent studies suggest that B-cells and neutralizing antibodies may be more involved in spontaneous

HCV resolution than previously thought (31, 109, 110). In particular, antibodies have been shown to play a role in controlling HCV infection and in preventing reinfection and are being studied for use in both therapeutic and preventative vaccine design.

Neutralizing antibodies in vaccine development

An important goal in vaccine development is a vaccine that can stimulate broadly neutralizing antibodies (bNAbs) that target conserved epitopes across genetically diverse viral genotypes. As HCV humoral immune response work has progressed, broadly neutralizing antibodies have been shown to abrogate established HCV infection in animal models (111) and confer sterilizing immunity in animal-challenge experiments (109, 112, 113) prompting on-going work to identify the best antibody targets for vaccine design.

While antibodies produced during acute HCV infection target epitopes in both structural and non-structural proteins, all known neutralizing antibodies target epitopes on the HCV envelope glycoproteins E1 and E2. A number of studies have worked to identify monoclonal antibodies (mAbs) that target conserved epitopes across multiple HCV genotypes. Most of these conserved sites are located on either linear (114, 115) or conformational (109, 116-118) epitopes on the CD81-binding site or on the membrane proximal external region (110). These sites are all located on or close to the E2 ectodomain though there is also evidence that bNabs against the E1 domain, while less robust in eliciting of a humoral immune response, are also observed in patients with chronic HCV (119,

120).

Dissertation overview

Chapter two describes evaluation of a polymorphism that renders Bole1a, a computationally derived, ancestral genotype 1a HCV strain, resistant to neutralization by both polyclonal-HCV-infected plasma and multiple broadly neutralizing monoclonal antibodies with unique binding epitopes.

Chapter three describes an efficient strategy for cloning naturally-occurring E1E2 genes into a full-length HCV genome, producing replication-competent chimeric

HCVcc. We generated a panel of HCVpp and HCVcc expressing genetically identical E1E2 variants and assessed them for relative fitness and neutralization resistance to monoclonal antibodies.

CHAPTER II:

A hepatitis C virus envelope polymorphism offers resistance to

neutralization by polyclonal sera and broadly neutralizing antibodies

This chapter was accepted for publication in the Journal of Virology as: Wasilewski LN, El-Diwany R, Munshaw S, Snider AE, Brady JK, Osburn WO, Ray SC, & Bailey JR. 2016. “A hepatitis C virus envelope polymorphism confers resistance to neutralization by polyclonal sera and broadly neutralizing monoclonal antibodies.”

Abstract

Hepatitis C virus (HCV) infection is a global health problem with millions of chronically-infected individuals at risk for cirrhosis and hepatocellular carcinoma.

HCV vaccine development is vital in the effort toward disease control and eradication, an undertaking aided by an increased understanding of the mechanisms of resistance to broadly neutralizing antibodies (bNAbs). In this study, we identify HCV codons that vary deep in a phylogenetic tree of HCV sequences and show that a polymorphism at one of these positions renders

Bole1a, a computationally-derived, ancestral genotype 1a HCV virus, resistant to neutralization by both polyclonal HCV-infected plasma and multiple broadly neutralizing monoclonal antibodies with unique binding epitopes. This bNAb resistance mutation reduces replicative fitness, which may explain persistence of both neutralization sensitive and resistant variants in circulating viral strains. This work identifies an important determinant of bNAb resistance in an ancestral, representative HCV genome, which may inform HCV vaccine development.

Importance

Worldwide, more than 170 million people are infected with hepatitis C virus

(HCV), the leading cause of hepatocellular carcinoma and liver transplantation in the United States. Despite recent significant advances in HCV treatment, a vaccine is needed. Control of the HCV pandemic with drug treatment alone is likely to fail due to limited access to treatment, reinfections in high risk individuals, and potential for resistance to direct acting antivirals (DAAs). Broadly neutralizing antibodies (bNAbs) block infection by diverse HCV variants and therefore serve as a useful guide for vaccine development, but our understanding of resistance to bNAbs is incomplete. In this study, we identify a viral polymorphism conferring resistance to neutralization by both polyclonal plasma and broadly neutralizing monoclonal antibodies, which may inform HCV vaccine development.

Introduction

Hepatitis C virus (HCV) vaccine development has been complicated by the extraordinary genetic diversity of the virus and rapid viral evolution in infected individuals (121-127). The HCV genome is replicated by an error-prone NS5B polymerase (128), and past studies have demonstrated that cytotoxic T lymphocytes (CTL) and neutralizing antibodies (NAbs) against HCV exert selective pressure that results in selection of CTL and NAb escape mutations in the virus (54, 99, 129-133). While viral escape mutations allow for continued proliferation in the presence of CTL and NAbs, some of these mutations also carry a fitness cost, reducing the replication capacity of resistant viral variants

(54, 129, 130, 134, 135).

Many NAbs are HCV strain-specific, but broadly-neutralizing human monoclonal antibodies (bNAbs) capable of neutralizing multiple diverse HCV isolates have been isolated, proving that NAbs can also target relatively conserved regions of the envelope (E1 and E2) proteins (109, 110, 114, 116, 118, 130, 136-143).

Infusion of bNAbs is protective against infection in animal models of HCV (109,

112), and early high-titer bNAb responses against HCV are associated with viral clearance in humans (31, 84, 108, 123, 129, 144). Unfortunately, resistance to bNAbs can also develop, and multiple studies have demonstrated that this resistance sometimes results from mutations distant from bNAb binding sites

(130, 145-147). Since bNAbs may serve as a guide for HCV vaccine development, a more comprehensive understanding of resistance to bNAbs is essential.

Previously, our group generated a computationally derived, representative, subtype 1a HCV genome known as Bole1a using Bayesian phylogenetics, ancestral sequence reconstruction, and covariance analysis (148). We demonstrated that Bole1a is ancestral to most circulating genotype 1a HCV strains, it is representative of widely circulating strains, and the envelope genes are functional on lentiviral particles (148). This genome contains fewer CTL escape mutations than natural circulating strains, since phylogenetic reconstruction places more recent, host-specific changes, like escape mutations in HLA-restricted CTL epitopes, near the tips of the tree, while Bole1a falls near the root (149). This was confirmed in a prior study demonstrating that Bole1a contains more intact CTL epitopes than circulating HCV strains (149).

In contrast to changes near the tips of the tree, changes that occur deeper in the tree, closer to the Bole1a sequence, may represent selection that is less host- specific. We hypothesized that this could include changes that enhance viral replicative fitness or confer resistance to bNAbs. In generation of the Bole1a genome, our analysis predicted a single most likely ancestral amino acid at all positions across the genome, but at some positions, posterior probabilities of a single ancestral amino acid were relatively low, suggesting complex evolution at these positions deep in a phylogenetic tree of diverse genotype 1a sequences.

We examined 3 of these positions in the genes encoding E1 and E2 to determine whether variation at these positions could be explained by acquisition of E1E2 bNAb resistance, an increase in viral replicative fitness, or both (150).

Materials and Methods

Source of mAbs

CBH-5 (138), HC84.22, HC84.26 (118), and HC33.4 (140) were a gift of Steven

Foung (Stanford University School of Medicine, Stanford, California). AR3A

(109) and AR4A (110) were a gift from Mansun Law (The Scripps Research

Institute, La Jolla, California, USA).

Source of plasma

Plasma samples were obtained from the BBAASH (151) cohort (Andrea Cox,

Johns Hopkins University School of Medicine). Samples from each of the 18

HCV-infected subjects who had previously shown at least 50% neutralization by

1:100 plasma dilution of at least 2 HCVpp in the 19 HCVpp panel previously described (31) were selected.

HCVpp neutralization assays

HCVpp were generated by cotransfection of pNL4-3.Luc.R-E- plasmid and an expression plasmid containing the Bole1a HCV E1E2 as described elsewhere

(26, 108, 152). Virus-containing medium was collected at 48 and 72 hours, pooled, and stored at -4oC. For infectivity and neutralization testing of HCVpp

8,000 Hep3B cells (American Type Culture Collection) per well were plated in flat bottom 96 well tissue culture plates and incubated overnight at 37oC. The following day, HCVpp were mixed with either mAb (10μg/ml) or heat-inactivated plasma (1:100 dilution) then incubated at 37oC for 1 hour. Media was removed

16 from the cells and replaced with 50 µL of HCVpp mixture. The plates were placed

o in a CO2 incubator at 37 C for 5 hours, after which the HCVpp were removed and replaced with 100µL of phenol-free Hep3B media and incubated for 72 hours at

37oC. Media was removed from the cells and 50µL of 1x Cell Culture Lysis

Reagent (Promega) added and left to incubate for >5 minutes then 45µL from each well were then transferred to a white, low-luminescence 96-well plate

(Berthold) and luciferase activity measured in relative light units (RLUs) in a

Berthold Luminometer (Berthold Technologies Centro LB960). Pseudoparticle infection was measured in the presence of mAb/test plasma (HCVppRLUtest) or nonspecific IgG/HCV-negative normal human plasma (HCVppRLUcontrol) at the same dilution. The percentage of neutralization was calculated as 100% x [1-

(HCVppRLUtest /HCVppRLUcontrol)]. Each sample was tested in duplicate. A mock pseudoparticle (no envelope) was used as a negative control. Neutralization was tested only for HCVpp with infectivity at least 10X greater than typical mock pseudoparticle values.

Generation of site-directed mutants

E1E2 site-directed mutants were generated using a QuikChange Lightning Site-

Directed Mutagenesis Kit (Agilent Technologies).

HCV NS5A immunostaining

Human hepatoma Huh7.5.1 cells (a gift of Jake Liang, NIH, Bethesda, Maryland,

USA) were maintained in DMEM supplemented with 10% fetal bovine serum, 1%

17 sodium pyruvate, and 1% l-glutamate. 48 hours after infection, cells were fixed with 4% formaldehyde for 20 minutes and then stained for HCV NS5A using primary anti-NS5A antibody 9E10 (a gift of Charles Rice, The Rockefeller

University, New York City, New York, USA) at 1:10,000 dilution in PBS, 3% bovine serum albumin, and 0.3% Triton X-100 for 1 hour at room temperature.

Cells were washed twice with PBS and stained using secondary antibody Alexa

Daylight 488–conjugated goat anti-mouse IgG (Life Technologies) at 1:500 dilution in PBS, 3% bovine serum albumin, and 0.3% Triton X-100 for 1 hour at room temperature. Cells were washed twice in PBS and then stored covered in

100μl PBS at 4°C.

HCVcc neutralization assays

Huh7.5.1 cells were plated at 10,000 cells per well onto 96-well plates. On the following day, antibodies were serially diluted 2.5-fold in growth medium starting from 50μg/ml mAb. Controls were performed with a similar dilution series of nonspecific IgG. Viral supernatants diluted to fall in a linear range of infectivity were added to antibody dilutions in duplicate for 1 hour at 37°C. Medium was removed from cells, and the antibody-virus mix added onto cells and incubated overnight. Antibody-virus mix was replaced with 100μl fresh medium the following day. After 48 hours, medium was removed and cells were fixed and stained.

Images were acquired and spot forming units were counted in the presence of mAb (HCVccSpotstest) or nonspecific IgG (HCVccSpotscontrol) using an AID iSpot

Reader Spectrum 219 operating AID ELISpot Reader version 7.0. Percent

18 neutralization was calculated as 100% x [1-(HCVccSpotstest /HCVccSpotscontrol)].

HCVcc neutralization assays using human plasma were performed similarly using 1:100 dilutions of test plasma and HCV-negative normal human plasma.

HCV E1E2 ELISA

MAb or plasma binding to E1E2 was quantitated using an enzyme-linked immuosorbent assay (ELISA) as previously described (130). 293T cells were transfected with E1E2 expression constructs. 48 hours post-transfection cell lysates were harvested. Plates were coated with 500ng Galanthus nivalis (GNA) lectin (Sigma-Aldrich) and blocked with phosphate-buffered saline containing

0.5% Tween 20, 1% non-fat dry milk, and 1% goat serum. E1E2 cell lysates were added. mAb or plasma were assayed in duplicate 2.5-fold serial dilutions, starting at 10µg/ml or 1:100 dilution, respectively. Binding was detected using HRP- conjuagated anti-human IgG secondary antibody (BD Pharmingen no. 555788).

For ELISA performed under denaturing conditions, cells lysates were diluted in denaturing buffer (tris-buffered saline with 10% fetal bovine serum, 1.0% sodium dodecyl sulfate, and 50mM dithiothreitol) then boiled for 5 minutes. Lysates were cooled on ice then added to GNA-lectin coated plates. Assay was completed as described above.

HCV viral load quantitation

HCV RNA levels in infection supernatants were quantified using a process of

RNA extraction and utilization of commercial real time reagents (Abbot HCV Real

Time Assay) migrated onto a research based real time PCR platform (Roche 480

Lightcycler).

Generation of HCVcc chimeras

To introduce an AfeI restriction site, HCVcc chimera H77/JFH1 (153), a gift of

Jens Bukh (Copenhagen University Hospital, Copenhagen, Denmark), was amplified in three sections, using primers insert_R_new (CACCAGCTGATATAGCGTTTGTAATATGGCGACAGAGTC) insert_F_new

(GGATTCCGATCTACCAGCGCTTTGGAGAACCTCGTAATACTCAATGCAGCA

TCCCTGGCC) back_mid_F (CGGAATATGACCTGGAGCTAATAACATCC) backbone_outer_R (GGTGACATGGTAAAGCCCCG)

Back-mid_R (CCAGGTCATATTCCGGTCTGG)

Backbone_outer_F (CTGTCGCCATATTACAAACGC)

This omitted nucleotides 916 to 2579. Amplified sections were re-assembled using In-Fusion cloning (Clontech). This backbone was digested with enzyme

AfeI (New England Biolabs). E1E2 inserts were amplified from library plasmids using primers HCVcc_E1E2_1R (GAGGTTCTCCAAAGCCGCCTCCGC) and

HCVcc E1E2_1F (TGTGCCCGCTTCAGCCTACCAAG). The inserts were cloned into the digested HCVcc backbone using In-Fusion cloning.

To make HCVcc RNA, 2μg plasmid DNA was linearized using XBAI (New

England Biolabs). Linear DNA was used for in vitro RNA transcription using the

T7 MEGAscript kit (Ambion). RNA clean-up was performed using RNeasy mini kit

(Qiagen) and quantified using nanodrop. RNA products were then stored at –

80°C.

To transfect RNA, Nucelofector Kit T was used (Amaxa). 5µg of RNA was transfected into 1.8e6 Huh7.5.1 cells and plated in a 6-cm plate. Transfection supernatants were collected 4-6 days later, once cells had reached confluency and stored at -80 oC for titering by HCV NS5A immunostaining. High-titer transfection supernatants were used to infect Huh7.5.1 cells and infection supernatants collected, tittered, and stored at -80 oC for use in infectivity and neutralization experiments.

Western Blotting

HCVpp supernatants were concentrated and purified by ultracentrifugation through a 20% sucrose cushion (123 000g, 2h, 4ºC) with pellets resuspended in

TNE buffer. HCVpp and E1E2 lysates used in ELISAs were diluted then denatured and run on a 4-12% Bis-Tris gel. After transfer, blots were probed with

HC33.1.53 (140) (a gift of Dr. Steven Foung, Stanford University School of

Medicine, Stanford, California) and binding was detected with HRP-conjugated anti-human IgG secondary antibody (BD Pharmingen no. 555788). HCVpp western blots were also probed with a mouse anti-HIV1 p24 (ab9044, Abcam) followed by HRP-conjugated anti-mouse IgG secondary antibody (ab97265,

Abcam).

Statistical Analyses

In Figure 2.2, percent neutralization values were grouped by individual mutations and a one-way ANOVA with a Tukey test was performed to compare the significance of changes in neutralization mediated by different amino acid mutations at the same position. For each pair of R424S ELISAs, a two-way

ANOVA was performed to determine the significance of the change in binding between E1E2 lysates.

Results

Some polyprotein positions show evidence of deep phylogenetic variation.

Through the use of Bayesian phylogenetics, ancestral sequence reconstruction, and covariance analysis, the most likely ancestral genotype 1a amino acid was predicted at each position across the HCV polyprotein, generating the Bole1a genome (148). For the majority of polyprotein positions, the most likely ancestral amino acid could be determined with very high posterior probability ranging from

0.99 to 1, but for 94 of the 3012 codons analyzed, the posterior probability of the most likely ancestral codon was less than 0.99 (Figure 2.1A), suggesting complex evolution at these positions deep in the phylogenetic tree. We selected three of these positions for further analysis. At 242, which falls in HCV E1, leucine (L) was the most likely ancestral amino acid. At 424, which falls near the

CD81 binding site of E2, arginine (R) was the most likely ancestral amino acid. At

570, which falls in the intergenotypic variable region (igVR) (154) near the carboxy terminus of E2, asparagine (N) was most likely. We also determined the most common amino acids at these positions in circulating viral strains (Figure

2.1B). Circulating strains showed significant variability at the 242 and 570 positions, with 4 and 9 different amino acids observed at each position, respectively, in a reference alignment of 390 Genotype 1a sequences. In contrast, the 424 codon is highly constrained, with either R or S observed in 387 of 390 circulating strains in the reference alignment.

Mutation of arginine 424 to serine confers resistance to neutralization by plasma.

HCV pseudoparticles (HCVpp) with Bole1a E1E2_L242, R424, N570 or Bole1a

E1E2 with other naturally-occurring amino acids at these positions were generated by cotransfection of E1E2 expression plasmids with an HIV pNL4-

3.Luc.R-E- reporter construct. The amino acid polymorphisms to be tested were chosen based on the predicted ancestral sequence, the most common amino acids in circulating strains, and some additional less frequently observed amino acids. To efficiently measure the effect of mutations at each of the three positions in multiple experiments, thirteen HCVpp were generated with each mutation alone or combination with mutations at one or both of the other two positions.

These HCVpp were tested for sensitivity to neutralization by HCV-infected plasma samples, and all variants with the same amino acid at 242, 424, or 570 were grouped for analysis. (Figure 2.2). Mutation of L242 to valine (V) or methionine (M) and mutation of N570 to valine (V) or aspartic acid (D) did not have a significant effect on neutralization sensitivity, but mutation of arginine (R)

424 to serine (S) conferred a significant increase in resistance to neutralization by plasma. Since variation at positions 242 and 570 did not significantly affect

Bola1a neutralization sensitivity, subsequent experiments focused on variation at the 424 position, with L242 and N570 held constant.

To confirm the resistance phenotype of S424, Bole1a_R424 and Bole1a_S424

HCVpp were tested for neutralization by an additional panel of 19 HCV-infected plasma samples (Figure 2.3A). As in prior experiments, S424 was strongly associated with resistance to neutralization (median neutralization 91% for

Bole1a_R424 and 44% for Bole1a_S424, p=2E-10). Strikingly, for every plasma sample tested, Bole1a_S424 was more neutralization resistant than

Bole1a_R424, despite the fact that each plasma sample was from a different donor and each sample presumably contains polyclonal NAbs. This result was confirmed with replication competent cell culture virus (HCVcc) expressing either

Bole1a_R424 or Bole1a_S424 E1E2 (Figure 2.3B). In addition, mutation of R424 to S in two natural E1E2 variants isolated from HCV-infected donors (1a53 and

1a79) also conferred resistance to neutralization by heterologous HCV-infected plasma, and mutation of S424 to R in a third naturally occurring E1E2 variant

(H77) conferred increased sensitivity to neutralization (Figure 2.3C). To investigate whether changes in neutralization sensitivity observed in

Bole1a_R424 and Bole1a_S424 might be influenced by incorporation of different amounts of E2 per particle, we performed a Western blot using purified HCVpp

(Figure 2.3D). Both E2 and the p24 loading control of Bole1a_S424 HCVpp were approximately 2-fold less intense than the same proteins from Bole1a_R424

HCVpp, indicating that both HCVpp incorporate approximately equal amounts of

E2 protein per particle.

Mutation of arginine 424 to serine confers resistance to binding by antibodies in plasma.

To elucidate the mechanism of variable neutralization sensitivity between

Bole1a_R424 and Bole1a_S424 variants, the same panel of 19 HCV-infected

25 plasma samples was used in E1E2 binding assays. Lysates of cells transfected with Bole1a_R424 or Bole1a_S424 E1E2 expression constructs were used as the target antigen in enzyme-linked immunosorbent assays (ELISAs) with HCV- infected plasma (Figure 2.4A). Binding of plasma antibodies to the S424 E1E2 protein was significantly lower than binding to the R424 variant (median OD 1.44 for Bole1a_R424 and 0.0009 for Bole1a_S424, p=1E-05), suggesting that mutation of R424 to S confers neutralization resistance by reducing binding of

NAbs. To confirm that the reduced binding to Bole1a_S424 E1E2 relative to

Bole1a_R424 was not due to a difference in levels of expression of the two E1E2 proteins, we performed a Western blot with serial dilutions of both E1E2 lysate preparations, confirming that the quantity of each protein used in the ELISAs was similar (Figure 2.4B).

Mutation of arginine 424 to serine confers resistance to neutralization by a diverse array of broadly neutralizing monoclonal antibodies.

To further investigate the surprising result that an R424S mutation conferred resistance to polyclonal sera from numerous donors, we measured sensitivity of replication competent cell culture virus (HCVcc) expressing Bole1a_R424 or

Bole1a_S424 E1E2 to neutralization by a panel of some of the most broadly neutralizing human monoclonal antibodies (mAbs) described to date, including

CBH-5 (138), HC84.22, HC84.26 (118), HC33.4 (140), AR3A(109) and AR4A

(110). These mAbs were selected because they are broadly neutralizing and also

26 because they bind to distinct epitopes across E2. CBH-5, AR3A, HC84.22, and

HC84.26 bind to distinct epitopes at or near the CD81 binding site of E2, while

HC33.4 binds near the amino terminus of E2, and AR4A binds to E1 and the carboxy terminus of E2 (Figure 2.5A). Amino acid 424 is a known binding residue for AR3A as determined by alanine scanning mutagenesis (109), but it is not a known binding residue for any other mAbs in the panel. Despite the differences in E2 binding sites of these bNAbs, mutation of R424 to S conferred resistance to each antibody (Figure 2.5B). As shown in Figure 2.5C, 50% inhibitory concentration (IC50) of each mAb against Bole1a_R424 HCVcc was less than 2 µg/mL, while IC50 of the majority of mAbs against Bole1a_S424

HCVcc was 50 µg/mL or greater. Similar results were observed with HCVpp expressing Bole1a_R424 or S424 E1E2 and with HCVpp expressing R424 and

S424 variants of a naturally occurring HCV strain, 1a53 (Figures 2.5D and 2.5E).

Interestingly, no difference in mAb sensitivity was observed between R424 and

S424 variants of two other naturally occurring HCV strains, 1a79 and H77. Taken together, these results indicate that mutation of Bole1a_R424 to S confers resistance to bNAb neutralization, regardless of the antibody binding epitope.

Mutation of arginine 424 to serine confers resistance to binding of broadly neutralizing monoclonal antibodies.

Binding of mAbs to Bole1a_R424 and Bole1a_S424 E1E2 was measured using an E1E2 ELISA. MAbs HC84.22, CBH-5, AR3A, and HC33.4 showed greater

27 binding to the R424 E1E2 lysate than the S424 E1E2 lysate (Figures 2.6A and

2.6B). There was no detectable difference in binding of AR4A to either variant, suggesting either that the Bole1a_S424 resistance to neutralization by AR4A is not mediated by a reduction in binding of the mAb, or that the binding ELISA is not sensitive enough to detect changes in binding affinity sufficient to influence neutralization. Taken together, these results show a small but consistent reduction in binding of mAbs to S424 E1E2 relative to R424 E1E2, in agreement with the observed reduction in binding of plasma antibodies to the S424 E1E2 protein, suggesting that resistance to bNAb binding is a likely mechanism of the observed neutralization resistance of Bole1a_S424.

Since mutation of R424 to S conferred resistance to binding of mAbs for which

424 is not a known binding residue, we tested whether the effect is due to an induced structural change in the E1E2 proteins. We were able to test this directly for one mAb, HC33.4, since it binds to both native and denatured protein. Binding of HC33.4 to Bole1a_R424 and Bole1a_S424 E1E2 protein lysates was measured with the E1E2 protein in either native or denatured states (Figure

2.6B). Surprisingly, the difference in mAb HC33.4 binding to Bole1a_R424 and

Bole1a_S424 E1E2 was significantly more pronounced with the protein in a denatured state, suggesting that induction of a structural shift may not be the mechanism by which mutation of R424 to S reduces binding of HC33.4 Rather,

R424 could be a previously undetected HC33.4 binding residue.

We also measured binding of four mAbs to R424 and S424 variants of 1a53,

1a79, and H77 E1E2 proteins (Figure 2.6C). Introduction of S424 into 1a53

E1E2 reduced binding of all four mAbs, which is consistent with the observed resistance to these mAbs conferred to 1a53 HCVpp by S424. For 1a79 and H77

E1E2, S424 conferred resistance to binding by some mAbs but not others, which is also consistent with minimal resistance to mAb neutralization conferred to

1a79 and H77 HCVpp by S424.

Bole1a_S424 carries a fitness cost.

Despite the broad neutralization resistance conferred by S424, both R424 and

S424 variants are abundant in circulating virus populations, suggesting selection pressure favoring R424 acting in opposition to the bNAb selection pressure favoring S424. We examined the relative fitness of Bole1a_R424 HCVcc and

Bole1a_S424 HCVcc in the absence of antibody (Figure 2.7). Bole1a_R424

HCVcc showed higher specific infectivity than Bole1a_S424 HCVcc (18.9

SFU/105 IU for Bole1a_R424 vs. 5.4 SFU/105 IU for Bole1a_S424). Taken together, these results suggest that selection by bNAbs favors persistence of

S424 variants, while greater replicative fitness favors persistence of R424 variants.

Discussion

In this study, we identified a position in E2, codon 424, that varies deep in a phylogenetic tree of diverse genotype 1a sequences, yet is constrained to only two possible amino acids, arginine and serine, in circulating strains. Mutation of

R424 to S at this position in Bole1a, a representative, ancestral HCV virus, confers extremely broad resistance to neutralization by both polyclonal HCV- infected sera and a diverse array of broadly neutralizing mAbs. We showed that this neutralization resistance is due to a reduction in binding of NAbs. We also showed that the neutralization resistant Bole1a_S424 HCVcc variant has reduced replicative fitness relative to the R424 variant, providing an explanation for persistence of both R424 and S424 polymorphisms in circulating viral strains.

This work supports prior studies showing that HCV resistance to NAbs may arise from mutations distant from antibody binding sites (130, 145-147). The resistance conferred to Bole1a by S424 is exceptionally broad. This mutation conferred resistance to the polyclonal NAbs present in every plasma sample tested from dozens of unique donors, as well as a panel of bNAbs selected specifically because their binding epitopes are well-characterized and distant from each other. This work provides evidence that selective pressure from commonly expressed bNAbs and competing pressure for high replicative fitness may explain some amino acid changes deep in phylogenetic trees of diverse HCV sequences. Analysis of phylogenetically ancestral evolution may be a useful method to identify bNAb resistance mutations that are immunologically relevant at a population level.

It is interesting that the R424S mutation in Bole1a reduces binding of most mAbs and neutralization of all mAbs given that 424 is a known binding residue only for mAb AR3A. R424 may be a relatively minor, previously undetected binding residue for these mAbs with an unexpectedly significant influence on neutralizing activity. Alternatively, this mutation could influence glycosylation of the protein, although this seems less likely as it does fall at the first or third position of an N- linked glycosylation consensus sequence. It is also possible that the mutation alters the structure of E2, given the known structurally flexibility of the E2 protein in the region of 424 (155, 156). We were able to show for mAb HC33.4 that the reduction in binding to Bole1a_S424 was present even when Bole1a_R424 and

Bole1a_S424 E1E2 were denatured, making it less likely that the effect is mediated by a shift in structure. These binding experiments are technically challenging, however, and the possibility of mutation-mediated structural shifts remain an intriguing possibility that warrant further investigation.

This study showed consistent and broad neutralization resistance conferred to

Bole1a by R424S. The magnitude of the change in resistance to polyclonal serum antibodies was not large, but it was similar to the resistance described in a prior study of HCV neutralization escape (146). The effect of R424S was most striking for neutralization of Bole1a HCVcc by broadly neutralizing monoclonal antibodies (Figure 2.5C), as a more than 100-fold increase in resistance to some bNAbs was observed. It is particularly interesting that the resistance conferred by

S424 varied between Bole1a and other E1E2 variants. Work to understand the influence of combinations of polymorphisms on neutralization resistance of E1E2

31 is ongoing. A better understanding of polymorphisms modulating neutralization sensitivity of representative genomes like Bole1a is critical as work continues to identify the most representative and immunogenic HCV variants for inclusion in

HCV vaccines.

In conclusion, we have identified a neutralization resistance polymorphism using a unique strategy which identifies amino acid changes deep in a phylogenetic tree of diverse HCV sequences. This R424S polymorphism confers extremely broad resistance to neutralization by both polyclonal HCV-infected sera and a diverse array of broadly neutralizing mAbs with distinct binding epitopes. The neutralization resistant variant S424 has reduced replicative fitness which may explain the persistence of both S424 and the neutralization sensitive R424 variant in the population. A more complete understanding of determinants of bNAb resistance in candidate vaccine antigens like Bole1a should help to guide

HCV vaccine development.

Figure 2.1

Codons 242, 424, and 570 show evidence of deep phylogenetic variation, and evolution at the 424 position is constrained. (A) Using a reference alignment of 390 genotype 1a HCV genomes and Bayesian phylogenetics, a most likely ancestral amino acid at each position across the HCV genome was calculated, generating the Bole1a genome (148). The histogram depicts the distribution of posterior probabilities with which a single most likely ancestral amino acid could be predicted at each of 3012 codons. The posterior probabilities of leucine (L) at 242, arginine (R) at 424, and aspartic acid (D) at

570 are indicated. (B) Frequency of each observed amino acid at positions 242,

424, and 570 in a reference alignment of 390 genotype 1a sequences. Letters are standard IUPAC amino acid abbreviations.

Figure 2.1

Figure 2.2

Mutation of arginine (R) 424 to serine (S) confers resistance to neutralization by plasma. A panel of thirteen Bole1a E1E2 constructs encoding different combinations of amino acids at codons 242, 424, and 570 was generated using site-directed mutagenesis. Each Bole1a E1E2 variant construct was used to generate HCVpp. HCVpp were tested for neutralization by 5-10

HCV-infected plasma samples in duplicate, and reported values are an average of 1-4 independent experiments. HCVpp with the same amino acid polymorphism at 242, 424, or 570 were grouped for analysis. Horizontal lines indicate median percent neutralization. Significance was tested using one-way ANOVA with a

Tukey test for multiple comparisons (****, p<0.0001; ns, not significant). Samples with percent neutralization <0 are not shown.

Figure 2.2

Figure 2.3

Mutation of arginine (R) 424 to serine (S) confers resistance to neutralization by plasma. (A) Bole1a_R424 and Bole1a_S424 HCVpp were tested for neutralization by an additional panel of 19 HCV-infected plasma samples in duplicate. Each point represents the mean of two replicate values.

Each line indicates neutralization by a unique plasma sample. P values were calculated using a paired two-tailed Student’s t-Test. (B) Bole1a_R424 and

Bole1a_S424 E1E2 sequences were cloned into full-length replication competent

HCV (HCVcc) and used to produce infectious supernatants Viral supernatants were incubated with a 1:100 dilution of HCV-infected plasma for 1h and then used to infect Huh7.5.1 cells in triplicate. Values shown are means of replicate wells. Each line indicates neutralization by a unique plasma sample. P values were calculated using a paired two-tailed Student’s t-Test. (C) E1E2 variants

1a53, 1a79, and H77 were mutated via site directed mutagenesis to produce

1a53_S424, 1a79_S424, and H77_R424. Wild type and mutant E1E2 HCVpp were made from these constructs which were then tested in duplicate for neutralization sensitivity to the panel of 19 HCV-patient plasma samples. Each point represents the mean of two replicate values and each line indicates neutralization by a unique plasma sample. P values were calculated using a paired two-tailed Student’s t-Test. Percentage neutralization values <0 are not shown. (D) Bole1a_R424 and Bole1a_S424 HCVpp were purified by ultracentrifugation through a sucrose cushion then analyzed by Western blot.

Blots were probed with human anti-E2 (HC33.1.53) (140) and a mouse anti-HIV1 p24.

Figure 2.3

Figure 2.4

Mutation of arginine (R) 424 to serine (S) confers resistance to binding of plasma antibodies. (A) Lysates of cells transfected with Bole1a_R424 and

Bole1_S424 E1E2 expression constructs were used in enzyme-linked immunosorbent assays (ELISAs) to assess E1E2 binding by IgG in the same panel of 19 HCV-infected plasma samples. Each of the 19 plasma samples was assayed in duplicate and antibody binding detected using HRP-conjugated anti- human IgG secondary antibody. Each point represents the mean of two replicate values and each line indicates binding by IgG from a unique plasma sample. P values were calculated using a paired two-tailed Student’s t-Test. (B) Lysates of

E1E2 transfected cells used for ELISA measurements were analyzed by Western blot in three dilutions to confirm that equal quantities of E1E2 were present. Blots were probed using anti-E2 antibody HC33.1.53 (140).

Figure 2.4

Figure 2.5

Mutation of arginine 424 to serine confers resistance to neutralization by a diverse array of broadly neutralizing monoclonal antibodies. (A) A panel of six broadly neutralizing monoclonal human antibodies: CBH-5, HC84.22,

HC84.26, AR3A, AR4A, and HC33.4 were selected to assess relative neutralization sensitivity of Bole1a_R424 and Bole1a_S424 variants. The E2 core structure published by Kong and colleagues (137), Protein Data Bank accession 4MWF, is shown with colors modified. The front layer is cyan; CD81- binding loop is blue; central β-sandwich is red. The 424 position is indicated with an arrow. Known critical binding residues of AR3A and HC84.22 are indicated with purple and yellow spheres, respectively. Critical binding residues of HC33.4 and AR4A are not present in this structure, but approximate binding positions are indicated along with their known critical binding residues. CBH-5 and HC84.26

(not shown) share multiple binding residues with AR3A and HC84.22, respectively. (B) Bole1a_R424 and Bole1a_S424 E1E2 sequences were cloned into full-length replication competent HCV (HCVcc) and used to produce infectious virus. Viral supernatants were titered and used to infect target cells in duplicate in neutralization assays with serial dilutions of six different broadly neutralizing mAbs or control IgG. Values shown are means and error bars indicate standard deviations between replicates. (C) IC50 values calculated from the curves in (5B). For curves with only the highest antibody concentration producing more than 50% neutralization, IC50 is reported as ~50µg/ml and for curves with maximum neutralization less than 50%, IC50 is reported as >50µg/ml.

(D) Bole1a_R424 and Bole1a_S424 HCVpp were tested for sensitivity to neutralization by a panel of six broadly neutralizing mAbs. Each HCVpp was incubated with 10ug/mL mAb for 1h prior to incubation with Hep3B target cells.

Percent neutralization was calculated by comparing infection of HVCpp incubated with mAb to HCVpp incubated with nonspecific IgG. Each construct was tested in duplicate. Values shown are means and error bars indicate standard deviations. P-values were calculated using a paired two-tailed Student’s

T-Test. Percentage neutralization <0 are not shown. (E) HCVpp 1a53,

1a53_S424, 1a79, 1a79_S424, H77, and H77_R424 were tested for neutralization sensitivity as described for Bole1a HCVpp in (5D).

Figure 2.5

Figure 2.6

Mutation of arginine 424 to serine confers resistance to binding of broadly neutralizing monoclonal antibodies. (A) Binding of mAbs AR3A, CBH-5,

HC84.22, and AR4A to Bole1a_R424 and Bole1a_S424 E1E2 lysates was measured by ELISA. MAbs were assayed in duplicate with 2.5-fold serial dilutions, starting at 10µg/ml and binding detected using HRP-conjugated anti- human IgG secondary antibody. Values shown are the mean of two replicates and error bars indicate standard deviations. P-values were determined by two- way ANOVA (*, <0.05, ****, <0.0001). (B) To compare binding under native and denatured E1E2 conditions, Bole1a_R424 and Bole1a_S424 E1E2 lysates were diluted either in a denaturing buffer containing sodium dodecyl sulfate (SDS) or phosphate buffered saline (PBS). The denatured lysates were also boiled for 5 minutes and then cooled on ice. Both native and denatured lysates were then added to GNA-lectin-coated plates and binding of serial dilutions of mAb HC33.4 quantitated in duplicate. Data shown is the mean of two independent experiments and error bars indicate standard deviations. (C) Binding of mAbs

HC84.22, HC33.4, CBH-5, and AR4A to 1a53, 1a53_S424, 1a79, 1a79_S424,

H77, and H77_R424 E1E2 lysates were measured by ELISA as described in

(6A). P-values were determined by two-way ANOVA (*, <0.05 and ****, <0.0001).

Figure 2.6

Figure 2.7

Bole1a_S424 carries a fitness cost. Bole1a_R424 and Bole1a_S424 E1E2 sequences were cloned into full-length replication competent HCV (HCVcc). RNA was in-vitro synthesized and transfected into Huh7.5.1 cells and culture supernatants collected. Transfection supernatants were subsequently used to infect Huh7.5.1 cells to expand viral stocks. Huh7.5.1 cells were infected in duplicate with serial dilutions of Bole1a_R424 HCVcc and Bole1a_S424 HCVcc supernatants. After 48 hours, infection was quantified in spot forming units/mL of supernatant. Viral RNA was extracted from the same infection supernatants and

RNA viral load was quantitated using real time PCR and an International Unit (IU) viral load standard. Specific infectivity is expressed as spot forming units/IU.

Values shown represent the mean of two independent experiments, and error bars indicate range.

Figure 2.7

CHAPTER III:

Agreement between hepatitis C virus neutralization measured using

replication competent virus and pseudoparticles

This chapter is in submission for publication as: Wasilewski LN, Ray SC, & Bailey JR. 2016. “Agreement between hepatitis C virus neutralization measured using replication competent virus and pseudoparticles.”

Abstract

A better understanding of HCV neutralization by antibodies and the resulting effects of neutralization escape mutations on HCV viral fitness will be critical to guide rational development of an HCV vaccine. This work has been hindered by a lack of standardization of HCV entry and neutralization assays. Much of our knowledge of HCV entry was acquired using lentiviral pseudoparticles expressing

HCV envelope proteins (HCVpp), but, more recently, chimeric full-length viruses that are replication competent in cell culture (HCVcc) have been produced expressing diverse envelope (E1E2) variants. There have been few systematic comparisons of fitness and antibody neutralization resistance of E1E2-matched

HCVcc and HCVpp, in part due to a more limited repertoire of available HCVcc variants. Here, we describe development of an efficient method to clone naturally-occurring E1E2 genes into a full-length HCV genome, producing replication-competent chimeric HCVcc. We generated a panel of HCVcc and

HCVpp expressing genetically identical E1E2 variants and measured the relative fitness of E1E2 variants to mediate entry using the two systems, as well as neutralization resistance of E1E2-matched HCVcc and HCVpp. We found a surprising lack of correlation of relative E1E2 fitness measured by infectivity of

E1E2-matched HCVcc versus HCVpp, but found a very strong positive correlation between relative neutralization resistance of these same E1E2- matched HCVcc and HCVpp variants. These results suggest that E1E2 fitness measured using HCVcc or HCVpp should be interpreted with caution, but that

50 quantitative comparisons of relative neutralization resistance of E1E2 variants can be made with confidence using either HCVcc or HCVpp.

Importance

More than 170 million people worldwide are infected with hepatitis C virus (HCV), which can result in chronic infection, cirrhosis, and hepatocellular carcinoma.

While effective antiviral treatments have yielded significant advances in patient care, there remains an urgent need for preventative vaccines. A better understanding of HCV neutralization by antibodies, the resulting effects of neutralization escape mutations on HCV viral fitness, and high throughput assays to measure neutralizing breadth will be critical to guide rational vaccine development. As viral entry, neutralization, and vaccine development studies proceed using HCV pseudoparticles (HCVpp), replication competent cell culture virus (HCVcc), or both, it is critical to understand whether envelope fitness and neutralization results measured in one assay system are reproducible in the other. In this study, we show differences in HCV envelope fitness measured using the two systems, but strong agreement between antibody neutralization measured using HCVpp or HCVcc.

Introduction

HCV infects over 170 million people worldwide (157) and kills more people in the

United States annually than HIV (158). While direct-acting antiviral (DAA) therapy has revolutionized care for some patients with HCV, control of the HCV pandemic remains challenging due to poor access to care, frequent nosocomial transmission in developing countries (159), reinfection in high-risk individuals, and the high proportion of infected individuals who are unaware asymptomatic carriers (160). Since DAA therapy is very unlikely to control the HCV pandemic, development of a vaccine against HCV remains essential.

Understanding of virus neutralization by antibodies is important for vaccine development, since prior studies have shown that antibodies that neutralize HCV play an important role in immune-mediated control of the virus, and that neutralizing antibody resistance mutations may reduce viral replicative fitness

(31, 57, 84, 161, 162). However, study of HCV neutralizing antibodies has been hindered by a lack of standardized methods to measure virus entry and neutralization. Entry and neutralization assays generally rely on either lentiviral particles with HCV envelope proteins (E1and E2) on their surface (HCV pseudoparticles, HCVpp), or full-length hepatitis viruses that are replication competent in cell culture (HCVcc).

HCVpp have greatly advanced understanding of HCV entry and neutralization by antibodies (31, 84, 109, 110, 112). This model system has been used extensively

53 in identifying HCV cell surface receptors required for viral entry (163-166), and studies using HCVpp have established that neutralizing antibodies can drive evolution in vivo of HCV E1E2, leading to neutralization escape (84, 129).

HCVpp panels expressing diverse E1E2 variants have also been used to define neutralizing breadth of antibodies and to show that development of broadly neutralizing antibodies is associated with spontaneous clearance of HCV infection (31, 84), and reduced liver fibrosis in chronic infection (167).

More recently, chimeric full-length viruses that are replication competent in cell culture (HCVcc) have been produced which express diverse E1E2 variants and reproduce the full replication cycle of HCV in vitro and in animal models (161,

162, 168). These HCVcc have been used to further define viral entry pathways

(79, 169-171) and to show that broadly neutralizing antibodies can prevent HCV infection in animal models (40, 41, 112). Panels of HCVcc expressing E1E2 from multiple genotypes have also been used to measure neutralizing breadth of broadly neutralizing monoclonal antibodies (bNAbs) (109, 139, 140, 145).

Overall, HCVpp and HCVcc both have advantages for investigation of HCV entry and antibody neutralization. HCVpp can be used to quantitate single round entry and neutralization in a high-throughput format. Very large panels of HCVpp have been produced that encompass much of the diversity of circulating HCV variants, which is critical for accurate measurement of antibody neutralizing breadth (30,

31). Production of HCVpp is also generally less technically difficult than HCVcc

54 production. While significantly fewer replication competent HCVcc variants are available, progress has been made in expanding the number of variants (30,

172). Also, E1E2 on surface of HCVcc may resemble more closely the envelopes of viruses circulating in vivo, given incorporation of human apolipoproteins into HCVcc virions (59, 173, 174).

As viral entry, neutralization, and vaccine development studies proceed using

HCVpp, HCVcc, or both, it is critical to understand whether envelope fitness and neutralization results measured in one assay system are reproducible in the other. Neutralization results obtained using HCVcc and HCVpp have generally been similar, but comparisons of fitness and neutralization of HCVpp and HCVcc expressing genetically identical E1E2 variants have previously been performed only on a fairly limited basis (30, 146, 153, 167, 175).

Here, we describe the development of a new method to efficiently clone naturally occurring E1E2 genes into a full-length HCV genome, producing a panel of 11 replication competent HCVcc chimeras expressing naturally occurring E1E2 proteins. Identical E1E2 genes were also used to produce HCVpp, allowing a systematic comparison of fitness of matched E1E2 proteins to mediate entry of

HCVcc and HCVpp, as well as comparison of neutralization of E1E2-matched

HCVcc and HCVpp by a panel of 8 well-characterized bNAbs targeting distinct epitopes.

Materials and Methods

Source of HCVcc

H77/JFH-1 (45) and S52/JFH-1 (8) were a gift of Jens Bukh, (Copenhagen

University Hospital, Copenhagen, Denmark).

Source of E1E2

Plasma samples were obtained from HCV-infected subjects as previously described (31). E1E2 clones used are found in GenBank (accession numbers

FJ828970.1, KF589884.1, KJ187972.1, KJ187973.1, KJ187974.1, KJ187975.1,

KJ187977.1, KJ187983.1, KJ187984.1, KJ187986.1, KJ187989.1, KJ187990.1).

Source of monoclonal antibodies.

CBH-5 (138), HC84.22, HC84.26 (118), and HC33.4 (140) were a gift of Steven

Foung (Stanford University School of Medicine, Stanford, California). AR3A,

AR3C (109), AR4A, and AR5A (110) were a gift from Mansun Law (The Scripps

Research Institute, La Jolla, California, USA).

HCVcc neutralization assays

HCVcc neutralization assays were performed as described elsewhere (176).

Briefly, human hepatoma Huh7.5.1 cells (a gift of Jake Liang, NIH, Bethesda,

Maryland, USA) were maintained in DMEM supplemented with 10% fetal bovine serum, 1% sodium pyruvate, and 1% l-glutamate. 10,000 Huh7.5.1 cells per well were plated in flat bottom 96 well tissue culture plates and incubated overnight at

37oC. The following day, HCVcc were mixed with mAb (2.5-fold dilutions started at 50μg/mL) then incubated at 37oC for 1 hour. Media was removed from the cells and replaced with 50 µL of HCVcc/antibody mixture. The plates were placed

o in a CO2 incubator at 37 C overnight, after which the HCVcc were removed and replaced with 100µL of Huh7.5.1 media and incubated for 48 hours at 37oC. After

48 hours, medium was removed and cells were fixed and stained. Images were acquired and spot forming units were counted in the presence of mAb

(HCVccSFUtest) or nonspecific IgG (HCVccSFUcontrol) using an AID iSpot Reader

Spectrum operating AID ELISpot Reader version 7.0. Percent neutralization was calculated as 100% x [1-(HCVccSFUtest /HCVccSFUcontrol)].

HCV NS5A immunostaining

HCV NS5A immunostaining was conducted as described elsewhere (176).

Briefly, Cells were fixed with 4% formaldehyde then stained for HCV NS5A using primary anti-NS5A antibody 9E10 (a gift of Charles Rice, The Rockefeller

University, New York City, New York, USA) at 1:10,000 dilution for 1 hour at room temperature. Cells were washed twice with PBS and stained using secondary antibody Alexa Daylight 488–conjugated goat anti-mouse IgG (Life

Technologies) at 1:500 dilution for 1 hour at room temperature. Cells were washed twice in PBS and then stored covered in 100μl PBS at 4°C.

HCVpp neutralization assays

HCVpp were generated by cotransfection of pNL4-3.Luc.R-E- plasmid and an expression plasmid containing HCV E1E2 as described elsewhere (26, 108,

152). Virus-containing medium was collected at 48 and 72 hours, pooled, and stored at -4oC. For infectivity and neutralization testing of HCVpp 8,000 Hep3B cells (American Type Culture Collection) or 10,000 Huh7.5.1 cells per well were plated in flat bottom 96 well tissue culture plates and incubated overnight at

37oC. The following day, HCVpp were mixed with mAb (2.5-fold dilutions started at 50μg/mL or a single concentration of 10μg/mL) then incubated at 37oC for 1 hour. Media was removed from the cells and replaced with 50 µL of

o HCVpp/antibody mixture. The plates were placed in a CO2 incubator at 37 C for

5 hours, after which the HCVpp were removed and replaced with 100µL of fresh media and incubated for 72 hours at 37oC. Media was removed from the cells and 50µL of 1x Cell Culture Lysis Reagent (Promega) added and left to incubate for >5 minutes then 45µL from each well were then transferred to a white, low- luminescence 96-well plate (Berthold) and luciferase activity measured in relative light units (RLUs) in a Berthold Luminometer (Berthold Technologies Centro

LB960). Pseudoparticle infection was measured in the presence of mAb

(HCVppRLUtest) or nonspecific IgG/HCV-negative normal human plasma

(HCVppRLUcontrol) at the same dilution. The percentage of neutralization was calculated as 100% x [1-(HCVppRLUtest /HCVppRLUcontrol)]. Fraction unaffected

(Fu) was measured as described above using mAb and IgG at a concentration of

10μg/mL. This was then calculated as (HCVppRLUtest /HCVppRLUcontrol). Each

58 sample was tested in duplicate. A mock pseudoparticle (no envelope) was used as a negative control. Neutralization was tested only for HCVpp with infectivity at least 10X greater than typical mock pseudoparticle values.

HCVcc fitness quantitation

HCVcc RNA levels in infection supernatants (International Unit (IU)/mL) were quantified using a process of RNA extraction and utilization of commercial real time reagents (Abbot HCV Real Time Assay) migrated onto a research based real time PCR platform (Roche 480 Lightcycler). HCVcc were titered and spot forming units (SFU)/mL were calculated in the linear range. Fitness was calculated as [spot forming units (SFU/mL)/(HCV IU/mL)].

HCVpp fitness quantitation

HCVpp RNA viral load (International Unit (IU)/mL) was quantitated using real time PCR and an IU viral load standard (177). The amount of infection produced in Huh7.5.1 cells by a measured volume of HCVpp supernatant was measured in relative light units (HCVppRLU) as described in HCVpp neutralization assays. To determine specific infectivity, the amount of infection/mL was divided by viral load/mL, calculated as [(HCVppRLU/mL)/(HIV IU/mL)].

Generation of HCVcc chimeras

HCVcc chimeras were generated as previously described (176). Briefly, HCVcc chimera H77/JFH1 (153) was amplified in three sections, omitting nucleotides

916 to 2579 (E1E2). Amplified sections were re-assembled using In-Fusion cloning (Clontech) and this reassembly generated an AfeI restriction site at the location of the omitted nucleotides. After digestion of this HCVcc backbone with enzyme AfeI (New England Biolabs), E1E2 inserts amplified from library plasmids were inserted in frame using In-Fusion cloning.

To make HCVcc RNA, 2μg plasmid DNA was linearized using XbaI (New

England Biolabs) then used for in vitro RNA transcription using the T7

MEGAscript kit (Ambion). RNA clean-up was performed using RNeasy mini kit

(Qiagen), quantified using a NanoDrop 1000 spectrophotometer (Thermo

Scientific), and stored at –80°C. 5µg of RNA was transfected into 1.8e6

Huh7.5.1 cells using Nucleofector Kit T (Amaxa) and plated in a 6-cm plate.

Transfection supernatants were collected 4-6 days later and stored at -80oC for titering by HCV NS5A immunostaining. High-titer transfection supernatants were used to infect Huh7.5.1 cells and infection supernatants collected, titered, and stored at -80oC for use in infectivity and neutralization experiments.

Determination of IC50 values

Neutralization data was plotted and analyzed in GraphPad Prism version 6.00 for

Windows. Curves generating ambiguous IC50 values were discarded.

Generation of phylogenetic tree

A maximum likelihood tree was generated from nucleotide sequences using the

Tamura-Nei model, uniform rates, deletion of columns with gaps, with maximum likelihood tree inferred by the Nearest-Neighbor-Interchange method, with analyses carried out in Mega v6 (178, 179).

Western Blotting

HCVpp and HCVcc supernatants were concentrated and purified by ultracentrifugation through a 20% sucrose cushion (123 000g, 2h, 4ºC) with pellets resuspended in PBS. Viral RNA was extracted from purified supernatants and RNA viral concentration quantitated using real time PCR. Equal copy numbers of each viral supernatant were denatured and run on a 4-12% Bis-Tris gel. After transfer, blots were probed with human anti-E2 HC33.1.53 (140) (a gift of Dr. Steven Foung, Stanford University School of Medicine, Stanford,

California), and goat anti-Apo E (50A-G1b, Academy Bio-medical, Houston, TX).

Binding was detected with HRP-conjugated anti-human IgG secondary antibody

(no. 555788, BD Pharmingen) and HRP-conjugated anti-goat IgG (sc-2020,

Santa Cruz Biotechnology, Dallas, TX).

Results

Efficient cloning of naturally occurring E1E2 genes to generate E1E2-matched

HCVcc and HCVpp.

We developed a new method to efficiently clone naturally occurring E1E2 genes into a full-length chimeric H77/JFH-1 HCV genome, producing a panel of replication competent HCVcc chimeras expressing different E1E2 protein variants (Figure 3.1). These identical E1E2 genes were also cloned into a mammalian expression vector and co-transfected with a lentiviral luciferase reporter construct to produce HCVpp, allowing comparison of relative fitness of

HCVpp and HCVcc with matched E1E2 proteins, and also allowing a systematic comparison of neutralization of E1E2-matched HCVpp and HCVcc by a panel of well-characterized bNAbs targeting distinct epitopes. In total, 11 novel, replication competent HCVcc chimeric viruses expressing diverse genotype 1a and 1b primary-isolate E1E2s were produced by this method (Figure 3.2).

These HCVcc, along with two previously described HCVcc chimeras, H77/JFH-1

(genotype 1a E1E2) (45) and S52/JFH-1 (genotype 3a E1E2) (8), were used in subsequent neutralization and fitness experiments.

There is no clear relationship between E1E2 fitness quantified using HCVcc versus HCVpp.

To determine whether fitness of E1E2 to mediate entry quantified using HCVcc or HCVpp are related, specific infectivities (spot forming units (SFU)/HCV

International Unit (IU) for HCVcc and relative light units (RLU)/HIV IU for HCVpp)

62 of 12 E1E2-matched HCVcc and HCVpp were compared. To limit HCVcc as much as possible to single round infection, virus was removed from cell supernatant after 12 hours, and infected cells were fixed and stained after a 72 hour incubation. For both HCVpp and HCVcc, dilution of supernatant and level of infection showed a linear relationship (data not shown). Specific infectivities of

HCVcc (range: 0.03 to 0.67 SFU/HCV IU) and HCVpp (range: 0.002 to 0.079

RLU/HIV IU) expressing different E1E2 variants varied considerably (Figure

3.3A and Supplemental Table 3.1). Interestingly, no correlation in relative specific infectivities of E1E2-matched HCVcc and HCVpp was observed. These results suggest that relative fitness of different E1E2 variants measured with either HCVpp or HCVcc may not predict results that would be obtained using the other model system.

Given these differences in specific infectivity between E1E2-matched HCVcc and

HCVpp, we investigated biochemical differences between HCVcc and HCVpp.

To determine whether the amount of E2 incorporated per virion differs between

E1E2-matched HCVcc and HCVpp, we performed a Western Blot on HCVcc and

HCVpp which had been purified by ultracentrifugation through a 20% sucrose cushion (Figure 3.3B). HCVcc incorporated significantly more E2 per virion, with

HCVcc E2 becoming undetectable by Western Blot below a dilution of 3E7 virions (virions quantitated by HCV IU), whereas HCVpp E2 became undetectable below 1E9 virions (virions quantitated by HIV IU). The complex E2 banding pattern observed has been reported elsewhere and has been attributed

63 to the presence of FBS protein (180) or the high mannose content of E2 glycans

(181). Together, these results suggest that HCVcc incorporate a larger number of E2 molecules per virion than HCVpp.

Multiple prior studies have demonstrated that human apolipoproteins are present on the surface of HCVcc virions. To investigate the presence of apolipoproteins in our model systems, we performed a Western Blot on purified E1E2-matched

HCVcc and HCVpp. We found that we can detect ApoE protein in purified HCVcc preparations and in uninfected Huh7.5.1 supernatants (Figure 3.3C). It has been previously demonstrated that some of this ApoE is associated with HCVcc virions

(182-184). Despite testing a much higher number of purified HCVpp virions as well as mock-transfected 293T supernatants, we could not detect any ApoE protein. These data show that ApoE protein is present in HCVcc supernatants, but is not present in HCVpp supernatants or the 293T cells used to produce them.

E1E2-matched HCVcc and HCVpp show the same hierarchy of resistance to a diverse panel of broadly neutralizing antibodies.

To compare antibody neutralization measured using HCVcc and HCVpp model systems, 7 HCVcc were tested for neutralization by serial dilutions of up to 7 bNAbs each to quantitate neutralization sensitivity, with a total of 35 bNAb/HCVcc combinations tested. E1E2 variants tested included 4 different genotype 1a isolates (H77, 1a09, 1a38, 1a53), 2 different genotype 1b isolates

(1b09, 1b52) and one genotype 3a isolate (S52). HCVpp expressing a subset of

64 these E1E2 variants (H77, 1b09, 1b52, and 1a53) were tested similarly with full dilution series of up to 4 bNAbs each (12 HCVpp/bNAb combinations). Despite the differences in HCVcc and HCVpp infectivity, E2 incorporation, and ApoE incorporation, relative neutralization of E1E2-matched HCVcc and HCVpp by bNAbs was strikingly similar. Representative neutralization curves are shown in

Figure 3.4, with all other curves in Supplemental Figure 3.1. IC50 values for all

E1E2-matched HCVcc and HCVpp tested with full bNAb dilution curves are summarized in Table 3.1.

Using Spearman correlation, rank order of fifty percent inhibitory concentrations

(IC50s) of 12 different bNAb/HCVpp combinations were compared to the rank order of IC50s of the same bNAbs tested against E1E2-matched HCVcc (Figure

3.5). A highly significant positive correlation between IC50s determined using

HCVpp or HCVcc was observed (r=0.8, p=0.002), suggesting that comparison of relative neutralization resistance of different E1E2 variants expressed on either

HCVcc or HCVpp reliably yields the same result. Interestingly, while relative neutralization of E1E2-matched HCVpp and HCVcc was very tightly correlated, the absolute IC50 values for each bNAb/HCVpp were generally lower than the

IC50s measured for the same bNAbs with E1E2-matched HCVcc (Figure 3.5 and

Table 3.1), suggesting that HCVpp may be generally more neutralization sensitive than HCVcc. Notable exceptions are combinations like monoclonal antibody (mAb) CBH-5/E1E2 variant H77 and mAb AR5A/E1E2 variant 1b52, where both HCVcc and HCVpp were fully or almost fully resistant. Also, bNAb

HC84.26 had a lower IC50 measured against 1b09 HCVcc than against 1b09

HCVpp (IC50 5.4E-3 vs. 0.03 µg/mL).

To improve throughput of HCVpp neutralization assays, neutralization of HCVpp is sometimes measured at a single concentration of mAb or a single dilution of serum rather than with full antibody dilution series. This quantitative neutralization value can be expressed as a Fraction Unaffected (Fu), which is infection in the presence of a given concentration of mAb relative to infection in the presence of an equivalent concentration of nonspecific IgG. Using a single concentration of mAb (10 µg/mL), 34 HCVpp/bNAb combinations were tested and Fu was calculated. All 10 µg/mL Fu values and corresponding IC50 values measured with the same bNAbs and E1E2-matched HCVcc are summarized in

Table 3.2.

To determine whether HCVpp Fu also has a positive correlation with E1E2- matched HCVcc IC50, we compared the rank order of 10 µg/mL Fu of 34 different bNAb/HCVpp combinations to the IC50s of the same bNAbs measured using

E1E2-matched HCVcc (Figure 3.6). These values also showed a highly significant positive correlation (r=0.7, p<0.0001), suggesting that even if neutralization of HCVpp is tested at a single mAb concentration, Fu values varying more than 3000-fold can be quantitated, and comparison of relative neutralization resistance of different E1E2 variants expressed on either HCVcc or

HCVpp reliably yields the same result.

Discussion

For this study, we developed an efficient method for producing infectious HCVcc chimeras expressing naturally occurring E1E2 genes. In doing so, we created a panel of paired HCVcc and HCVpp with genetically identical E1E2 that were used to compare the two model systems with respect to E1E2 fitness and bNAb neutralization resistance. We found that relative specific infectivities of E1E2- matched HCVcc and HCVpp variants showed no correlation, perhaps due to a higher density of E2 on HCVcc virions relative to HCVpp, and presence of ApoE on HCVcc virions and not HCVpp. Despite these differences, there was a very strong correlation between relative bNAb neutralization resistance of E1E2- matched HCVcc and HCVpp variants.

This work increases the impact of prior studies investigating HCV neutralization resistance. It has previously been shown in both HCVcc and HCVpp model systems that different E1E2 variants show differing sensitivities to antibody neutralization (30, 118, 176). Our work also supports prior studies showing that

HCVcc and HCVpp with identical E1E2 have similar relative neutralization resistance (30, 146, 147, 167). Importantly, this study utilized many distinct natural E1E2 variants and a diverse assortment of bNAbs targeting distinct epitopes across E2, suggesting that these results are broadly applicable to other

E1E2 variants and other antibodies.

These results have several important implications for HCV fitness and antibody neutralization studies. First, this study suggests that relative fitness of different

E1E2 variants measured with either HCVpp or HCVcc may not predict results that would be obtained using the other model system. Further studies are indicated to determine whether one model system more accurately reflects E1E2 fitness in vivo. Measurement of HCVpp entry may be more quantitative, since only a single-round of infection can occur, but the incorporation of E2 and apolipoproteins into HCVcc virions may be more similar to natural HCV virions. It is important to note, however, that some studies have shown that HCVcc particles produced in Huh-7 cells also differ from HCV particles produced in vivo or in primary human hepatocytes in their biophysical properties (185, 186), and that mutations that enhance HCVcc replication in vitro can reduce efficient replication in animal models (187). Ultimately, understanding of E1E2 fitness may require correlation of in vitro testing with persistence of particular variants in vivo.

These studies also confirm that natural E1E2 isolates show a wide range of neutralization resistance whether they are expressed on HCVpp or HCVcc, suggesting that large, representative panels of HCV variants are needed to accurately define neutralizing antibody breadth. Additionally, relative neutralization resistance of different E1E2 variants by the same antibody is highly correlated between HCVcc and HCVpp, as is relative neutralization of the same

E1E2 variant by different monoclonal antibodies. This confirms that assays designed to compare neutralizing breadth of different antibodies, or assays to

68 measure changes in resistance mediated by resistance polymorphisms, could be performed in either HCVpp or HCVcc systems. This study also confirms prior work showing that IC50 values measured using HCVpp are generally lower than

IC50 values of the same mAb measured using HCVcc, which could lead to higher estimates of neutralizing antibody breadth using panels of HCVpp and lower estimates using HCVcc expressing the same E1E2 variants (167). This quantitative difference in HCVpp and HCVcc neutralization may be explained by the recent demonstration of Fauvelle et al that ApoE increases HCVcc neutralization resistance (188).

Importantly, neutralization of HCVpp can also be measured as a Fraction

Unaffected (Fu) at a single antibody concentration, with results that correlate with those that would be obtained using HCVcc and full antibody dilution curves.

Testing of single antibody concentrations for neutralization of HCVpp could allow extremely high throughput neutralizing breadth measurements against large numbers of diverse variants.

In conclusion, we have developed a unique and efficient method to produce

HCVcc bearing natural E1E2 protein variants. With this new tool, we produced

HCVcc and HCVpp bearing matched E1E2 proteins and conducted a systematic comparison of E1E2 fitness and neutralizing antibody resistance between the two model systems. We found no correlation between relative fitness of E1E2 variants quantitated using HCVcc or HCVpp, whereas we found a very strong

69 positive correlation between relative neutralization resistance of these same

E1E2-matched HCVcc and HCVpp variants. These results suggest that E1E2 fitness measured using HCVcc or HCVpp should be interpreted with caution, but that quantitative comparisons of relative neutralization resistance of E1E2 variants can be made with confidence using either HCVcc or HCVpp.

Table 3.1 E1E2-matched HCVpp and HCVcc IC50 values

Table 3.2 HCVpp Fraction Unaffected and HCVcc IC50 values

Figure 3.1

Cloning strategy to generate HCVcc and HCVpp with matched E1E2 proteins. Using PCR and In-Fusion cloning, the H77 E1E2 gene sequence was deleted from the H77/JFH-1 chimeric full-length replication competent HCV

(HCVcc) genome, and an AfeI restriction site was introduced between the Core and P7 genes. This plasmid was then linearized by AfeI digestion and various

E1E2 genes from naturally circulating HCV viruses inserted, generating chimeric

H77/natural isolate E1E2/JFH-1 HCVcc genomes. RNA was produced via in-vitro transcription and transfected into Huh7.5.1 cells to generate replication competent virus. Matching natural isolate E1E2 gene sequences were also cloned into the expression vector pcDNA3.2, and this plasmid was co-transfected with the lentiviral luciferase reporter plasmid pNL4-3.Luc.R-E- to produce HCV pseudoparticles (HCVpp). Colors in the HCVcc genome indicate the HCV variant from which each segment is derived (red=JFH-1, blue=H77, orange=naturally circulating HCV sequence).

Figure 3.1

Figure 3.2

E1E2 genes used to generate E1E2-matched HCVcc and HCVpp are genetically diverse. Maximum likelihood tree of E12 nucleotide sequences of

E1E2-matched HCVcc and HCVpp. 11 primary isolate E1E2 genes (7 genotype

1a, 4 genotype 1b) were used to generate novel replication competent HCVcc chimeras and E1E2-matched HCVpp. E1E2-matched HCVpp were also generated for two previously described HCVcc chimeras (H77/JFH-1 (genotype

1a E1E2) and S52/JFH-1 (genotype 3a E1E2).

Figure 3.2

Figure 3.3

No correlation between relative specific infectivities of E1E2-matched

HCVcc and HCVpp. (A) Serial dilutions of twelve different E1E2-matched

HCVcc and HCVpp were used to infect Huh7.5.1 cells. Using a data point in the linear range of each infectivity assay, entry was quantified for HCVpp (RLU/mL of supernatant) and HCVcc (spot forming units/mL of supernatant). Viral RNA was extracted from these supernatants and RNA viral load (International Unit (IU)/mL) quantitated using real time PCR and an IU viral load standard. Specific infectivity for HCVpp was calculated as RLU/HIV IU and for HCVcc as Spot Forming

Unit/HCV IU. Each point represents specific infectivity of HCVcc on the x-axis and HCVpp on the y-axis of E1E2-matched HCVpp and HCVcc. Values represent the average of two independent experiments performed in duplicate or triplicate. (B) E1E2-matched HCVcc and HCVpp (1a38 variant) were purified by ultracentrifugation through a 20% sucrose cushion. Viral RNA was extracted from the purified supernatants and viral copy number (IU) measured. A dilution series of the purified virus was analyzed by Western blot. Mock-transfected 293T supernatants (“293T”) and uninfected Huh7.5.1 cell supernatants (“Huh7.5.1”) were also tested. Blots were probed with human anti-E2 (HC33.1.53). (C)

Purified E1E2-matched HCVcc and HCVpp (1a38 variant), mock-transfected

293T supernatants (“293T”), and uninfected Huh7.5.1 supernatants (“Huh7.5.1”) were analyzed by Western Blot probed with anti-ApoE.

Figure 3.3

Figure 3.4

E1E2-matched HCVcc and HCVpp show the same hierarchy of neutralization resistance to a panel of broadly neutralizing antibodies targeting distinct epitopes. Representative neutralization curves for H77 and

1b09 (natural isolate) HCVcc and HCVpp. E1E2-matched HCVcc and HCVpp were tested for sensitivity to neutralization by serial dilutions of anti-HCV bNAbs or nonspecific IgG. Colors indicate bNAb tested (dark blue=CBH5, red=HC84.26, green=HC84.22, purple=HC33.4, orange=AR3A). Error bars indicate standard deviations between duplicate wells. IC50 results for all E1E2/bNAb combinations tested with full mAb dilution curves for both HCVcc and HCVpp are summarized in Table 3.1, and all neutralization curves are shown in Supplemental Figure

3.1.

Figure 3.4

Figure 3.5

Positive correlation between the rank orders of IC50 values measured using

E1E2-matched HCVpp and HCVcc. E1E2 matched HCVcc and HCVpp with five different E1E2 proteins (H77, 1a38, 1a53, 1b09, 1b52) were tested in duplicate in neutralization assays with serial dilutions of up to 4 different bNAbs targeting distinct epitopes or control nonspecific IgG (12 total bNAb/E1E2 combinations).

HCVpp and HCVcc IC50 values were calculated from these curves. Each point indicates the HCVcc IC50 on the x-axis and HCVpp IC50 on the y-axis of E1E2- matched HCVcc and HCVpp. For neutralization curves with only the highest antibody concentration (50 µg/mL) producing more than 50% neutralization, IC50 is graphed as 50 µg/mL, and for curves with maximum neutralization less than

50%, IC50 is graphed as 100 µg/mL. Colors indicate mAb tested (cyan=AR3C, pink=AR5A, light blue=AR4A, dark blue=CBH5, purple=HC33.4, green=HC84.22, red=HC84.26, orange=AR3A) and shapes indicate E1E2 sequence (=1a38, 

=1a53, =H77, =1b52, =1b09). Correlation (r) and p value were computed using the Spearman method.

Figure 3.5

Figure 3.6

Positive correlation between the rank orders of Fraction Unaffected values measured using HCVpp and IC50 values measured using E1E2-matched

HCVcc. E1E2 matched HCVcc and HCVpp with six different E1E2 proteins (H77,

1a38, 1a53, 1b09, 1b52, S52) were tested in duplicate in neutralization assays with up to 7 different bNabs or control nonspecific IgG (34 total bNAb/E1E2 combinations). For HCVpp, neutralization was tested at a single concentration of mAb (10 µg/mL), and Fraction Unaffected (Fu) was calculated (Infection in the presence of 10 µg/mL of mAb/infection in the presence of nonspecific IgG).

HCVcc were tested with serial dilutions of these bNabs and IC50 values were calculated from these curves. Values are summarized in Table 3.2. Relative

HCVpp Fu values were compared to IC50 values of E1E2-matched HCVcc neutralized by the same bNAbs. Each point indicates the HCVcc IC50 on the x- axis and HCVpp Fu on the y-axis of E1E2-matched HCVcc and HCVpp. Colors indicate mAb tested (cyan=AR3C, pink=AR5A, light blue=AR4A, dark blue=CBH5, purple=HC33.4, green=HC84.22, red=HC84.26, orange=AR3A) and shapes indicate E1E2 (=1a09, =1a38,  =1a53, =H77, =1b52, =1b09,

X=S52). Correlation (r) and p value were computed using the Spearman method.

Figure 3.6

Supplemental Figure 3.1

All HCVcc and HCVpp neutralization curves used to calculate IC50 values.

(A) Neutralization curves not shown in Figure 3.4. Patient-derived E1E2 sequences were cloned into full-length replication competent HCV (HCVcc).

HCVcc viral supernatants were tested in duplicate for neutralization sensitivity to serial dilutions of up to 7 mAbs or IgG. Colors indicate mAb tested (dark blue=CBH5, red=HC84.26, green=HC84.22, purple=HC33.4, orange=AR3A, light blue=AR4A, cyan=AR3C, pink=AR5A). (B) Patient-derived E1E2 sequences were used to generate HCVpp. HCVpp were tested in duplicate for neutralization sensitivity to serial dilutions of 1-2 mAbs or IgG. Colors indicate mAb tested (light blue=AR4A, cyan=AR3C, pink=AR5A).

Supplemental Figure 3.1

Supplemental Table 3.1 HCVcc and HCVpp specific infectivity measurements

HCVcc specific infectivity

IU/mL SFU/mL SFU/mL SFU/IU SFU/IU Average (rep1) (rep2) (rep1) (rep2) SFU/IU 1a01 1.32E+05 1.33E+04 8.88E+03 1.01E-01 6.73E-02 8.42E-02 1a09 1.38E+05 1.40E+04 5.64E+03 1.02E-01 4.09E-02 7.13E-02 1a22 1.87E+05 1.04E+04 8.96E+03 5.53E-02 4.78E-02 5.15E-02 1a38 9.86E+04 9.76E+03 5.06E+03 9.90E-02 5.13E-02 7.52E-02 1a53 8.13E+04 1.02E+04 1.41E+04 1.25E-01 1.74E-01 1.49E-01 1a72 1.01E+05 1.08E+04 7.92E+03 1.07E-01 7.85E-02 9.28E-02 H77 2.27E+05 2.04E+03 1.24E+04 8.99E-03 5.46E-02 3.18E-02 1a157 5.50E+05 3.72E+04 2.81E+04 6.76E-02 5.11E-02 5.93E-02 1b09 2.32E+04 3.30E+03 4.84E+03 1.42E-01 2.08E-01 1.75E-01 1b20 3.96E+04 1.24E+04 4.03E+04 3.13E-01 1.02E+00 6.66E-01 1b52 2.39E+05 2.29E+04 9.66E+03 9.58E-02 4.04E-02 6.81E-02 1b58 2.86E+04 7.28E+03 2.06E+04 2.55E-01 7.19E-01 4.87E-01

HCVpp specific infectivity

IU/mL IU/mL RLU/mL RLU/mL RLU/IU RLU/IU Average (rep1) (rep2) (rep1) (rep2) (rep1) (rep2) RLU/IU 1a01 9.32E+09 9.74E+09 9.62E+07 1.39E+08 1.03E-02 1.42E-02 1.23E-02 1a09 9.30E+09 1.67E+10 1.63E+08 2.52E+08 1.76E-02 1.51E-02 1.63E-02 1a22 8.13E+09 1.18E+10 2.16E+07 2.65E+07 2.66E-03 2.26E-03 2.46E-03 1a38 6.75E+09 8.97E+09 4.95E+08 7.60E+08 7.33E-02 8.47E-02 7.90E-02 1a53 1.01E+10 1.58E+10 1.61E+07 3.45E+07 1.60E-03 2.18E-03 1.89E-03 1a72 1.14E+10 1.46E+10 1.00E+08 1.74E+08 8.82E-03 1.19E-02 1.04E-02 H77 7.60E+09 5.83E+09 7.10E+07 7.49E+07 9.34E-03 1.29E-02 1.11E-02 1a157 1.63E+10 2.55E+09 3.53E+07 4.16E+07 2.17E-03 1.63E-02 9.26E-03 1b09 5.53E+09 3.12E+09 1.50E+08 2.70E+08 2.72E-02 8.68E-02 5.70E-02 1b20 1.47E+10 4.30E+09 5.76E+07 1.20E+08 3.92E-03 2.79E-02 1.59E-02 1b52 6.08E+09 5.39E+09 3.01E+08 3.12E+08 4.95E-02 5.79E-02 5.37E-02 1b58 6.71E+09 1.16E+10 4.79E+07 4.84E+07 7.15E-03 4.17E-03 5.66E-03

CHAPTER IV: DISCUSSION

This thesis presents a study of the determinants of antibody neutralization resistance in HCV and describes the development of an efficient method to clone

E1E2 genes into a full length replication competent HCV genome, which facilitated a careful comparison of relative fitness and neutralization resistance between E1E2-matched HCVpp and HCVcc.

In chapter two, we use the computationally derived, representative, ancestral genotype 1a HCV strain, Bole1a, to identify a polymorphism that confers significant neutralization resistance to both polyclonal plasma and broadly neutralizing monoclonal antibodies. This polymorphism was found using a unique strategy which identifies amino acid changes deep in a phylogenetic tree of diverse HCV sequences. We found that mutation of arginine to serine at polyprotein position 424, located in E2, conferred broad resistance to antibody neutralization in Bole1a. This neutralization resistance was confirmed using both polyclonal HCV-infected sera and a diverse array of broadly neutralizing mAbs with distinct binding epitopes. We show that this neutralization resistance is due to a reduction in binding of neutralizing antibodies. Finally, we demonstrate that the neutralization resistant Bole1a_S424 variant has reduced replicative fitness compared to the R424 variant which may account for the persistence of both polymorphisms in circulating viral populations. A better understanding of the determinants of bNab resistance in candidate vaccine antigens like Bole1a may help to guide future rational HCV vaccine development.

In chapter three, we describe the development of an efficient method for producing HCVcc chimeras expressing naturally occurring E1E2 genes. With this

89 technique, we create a panel of paired HCVcc and HCVpp constructs, each containing identical HCV E1E2. Using this panel, we determine that the specific infectivities of E1E2-matched HCVcc and HCVpp variants are not correlated, possibly due to the demonstrated presence of ApoE on HCVcc and not HCVpp.

However, when comparing bNab neutralization resistance between the two model systems, we find a very strong positive correlation. Also notable is the wide range of neutralization resistance of natural E1E2 variants expressed on either HCVpp or HCVcc. This suggests that the genetic diversity of HCV influences neutralization, so large, representative panels of HCV variants are needed to accurately define neutralizing antibody breadth. We also demonstrate that neutralization of HCVpp can also be measured as Fraction Unaffected at a single antibody concentration, as results correlate with those obtained using full antibody dilution curves with HCVcc. By validating testing with single antibody concentrations for neutralization of HCVpp, we open the door to high throughput assays measuring neutralizing breadth against large panels of diverse variants.

Overall, our results suggest that using HCVcc or HCVpp to measure E1E2 fitness requires further investigation and should be interpreted with caution but that quantitative comparisons of relative neutralization resistance of E1E2 variants can be made confidently using either HCVcc or HCVpp.

Future directions for this work include a thorough study of HCVcc and HCVpp specific infectivity. The discordant results found in this work reveal a need to determine whether one model system more accurately reflects E1E2 fitness in vivo. The development of a panel of genetically diverse HCVcc enables further

90 study of later stages of viral replication and more in-depth exploration of viral evolution, including viral response to immune pressure.

In total, this work identifies a polymorphism which renders Bole1a resistant to neutralization by both polyclonal plasma and multiple broadly neutralizing antibodies and describes the development of an efficient means for expanding the diversity of HCVcc constructs available for study. Using these constructs, strong agreement between HCVcc and HCVpp antibody neutralization was shown.

APPENDIX

REFERENCES

1. Thomas, D.,L. Global control of hepatitis C: where challenge meets opportunity. .

2. Wong, J. B., G. M. McQuillan, J. G. McHutchison, and T. Poynard. 2000. Estimating future hepatitis C morbidity, mortality, and costs in the United States. Am. J. Public Health. 90:1562-1569.

3. Gower, E., C. Estes, S. Blach, K. Razavi-Shearer, and H. Razavi. 2014. Global epidemiology and genotype distribution of the hepatitis C virus infection. J. Hepatol. 61:S45-57. doi: 10.1016/j.jhep.2014.07.027 [doi].

4. Rauch, A., Z. Kutalik, P. Descombes, T. Cai, J. Di Iulio, T. Mueller, M. Bochud, M. Battegay, E. Bernasconi, J. Borovicka, S. Colombo, A. Cerny, J. F. Dufour, H. Furrer, H. F. Gunthard, M. Heim, B. Hirschel, R. Malinverni, D. Moradpour, B. Mullhaupt, A. Witteck, J. S. Beckmann, T. Berg, S. Bergmann, F. Negro, A. Telenti, P. Y. Bochud, Swiss Hepatitis C Cohort Study, and Swiss HIV Cohort Study. 2010. Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology. 138:1338-45, 1345.e1-7. doi: 10.1053/j.gastro.2009.12.056 [doi].

5. Tanaka, Y., N. Nishida, M. Sugiyama, M. Kurosaki, K. Matsuura, N. Sakamoto, M. Nakagawa, M. Korenaga, K. Hino, S. Hige, Y. Ito, E. Mita, E. Tanaka, S. Mochida, Y. Murawaki, M. Honda, A. Sakai, Y. Hiasa, S. Nishiguchi, A. Koike, I. Sakaida, M. Imamura, K. Ito, K. Yano, N. Masaki, F. Sugauchi, N. Izumi, K. Tokunaga, and M. Mizokami. 2009. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat. Genet. 41:1105-1109. doi: 10.1038/ng.449 [doi].

6. Suppiah, V., M. Moldovan, G. Ahlenstiel, T. Berg, M. Weltman, M. L. Abate, M. Bassendine, U. Spengler, G. J. Dore, E. Powell, S. Riordan, D. Sheridan, A. Smedile, V. Fragomeli, T. Muller, M. Bahlo, G. J. Stewart, D. R. Booth, and J. George. 2009. IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat. Genet. 41:1100-1104. doi: 10.1038/ng.447 [doi].

7. Ge, D., J. Fellay, A. J. Thompson, J. S. Simon, K. V. Shianna, T. J. Urban, E. L. Heinzen, P. Qiu, A. H. Bertelsen, A. J. Muir, M. Sulkowski, J. G. McHutchison, and D. B. Goldstein. 2009. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 461:399-401. doi: 10.1038/nature08309 [doi].

8. Thomas, D. L., C. L. Thio, M. P. Martin, Y. Qi, D. Ge, C. O'Huigin, J. Kidd, K. Kidd, S. I. Khakoo, G. Alexander, J. J. Goedert, G. D. Kirk, S. M. Donfield, H. R. Rosen, L. H. Tobler, M. P. Busch, J. G. McHutchison, D. B. Goldstein, and M. Carrington. 2009. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature. 461:798-801. doi: 10.1038/nature08463 [doi].

9. Prokunina-Olsson, L., B. Muchmore, W. Tang, R. M. Pfeiffer, H. Park, H. Dickensheets, D. Hergott, P. Porter-Gill, A. Mumy, I. Kohaar, S. Chen, N. Brand, M. Tarway, L. Liu, F. Sheikh, J. Astemborski, H. L. Bonkovsky, B. R. Edlin, C. D. Howell, T. R. Morgan, D. L. Thomas, B. Rehermann, R. P. Donnelly, and T. R. O'Brien. 2013. A variant upstream of IFNL3 (IL28B) creating a new interferon gene IFNL4 is associated with impaired clearance of hepatitis C virus. Nat. Genet. 45:164-171. doi: 10.1038/ng.2521 [doi].

10. Schmidt, J., R. Thimme, and C. Neumann-Haefelin. 2011. Host genetics in immune-mediated hepatitis C virus clearance. Biomark Med. 5:155-169. doi: 10.2217/bmm.11.19 [doi].

11. Hoofnagle, J. H. 2002. Course and outcome of hepatitis C. Hepatology. 36:S21-9. doi: S0270913902001684 [pii].

12. Cortez, K. J., and S. Kottilil. 2015. Beyond interferon: rationale and prospects for newer treatment paradigms for chronic hepatitis C. Ther. Adv. Chronic Dis. 6:4-14. doi: 10.1177/2040622314551934 [doi].

13. Pawlotsky, J. M., J. J. Feld, S. Zeuzem, and J. H. Hoofnagle. 2015. From non-A, non-B hepatitis to hepatitis C virus cure. J. Hepatol. 62:S87-99. doi: 10.1016/j.jhep.2015.02.006 [doi].

14. Afdhal, N. H., S. Zeuzem, R. T. Schooley, D. L. Thomas, J. W. Ward, A. H. Litwin, H. Razavi, L. Castera, T. Poynard, A. Muir, S. H. Mehta, L. Dee, C. Graham, D. R. Church, A. H. Talal, M. S. Sulkowski, and I. M. N. P. H. C. V. T. M. P. Jacobson. 2013. The new paradigm of hepatitis C therapy: integration of oral therapies into best practices. J. Viral Hepat. 20:745-760. doi: 10.1111/jvh.12173 [doi].

15. Bartenschlager,Ralf, Lohmann Volker, and Penin Francois. The molecular and structural basis of advanced antiviral therapy for hepatitis C virus infection. .

16. Schmidt, W. N., D. R. Nelson, J. M. Pawlotsky, K. E. Sherman, D. L. Thomas, and R. T. Chung. 2014. Direct-acting antiviral agents and the path to interferon independence. Clin. Gastroenterol. Hepatol. 12:728-737. doi: 10.1016/j.cgh.2013.06.024 [doi].

17. Sarrazin, C. 2016. The importance of resistance to direct antiviral drugs in HCV infection in clinical practice. J. Hepatol. 64:486-504. doi: 10.1016/j.jhep.2015.09.011 [doi].

18. Callendret,Benoit, H. Eccleston B., Hall Shelby, Satterfield William, Capone Stefania, Folgori Antonella, Cortese Riccardo, Nicosia Alfredo, and C. Walker M. T-cell immunity and hepatitis C virus reinfection after cure of chronic hepatitis C with an interferon-free antiviral regimen in a chimpanzee. .

19. van der Meer, A. J., B. J. Veldt, J. J. Feld, H. Wedemeyer, J. F. Dufour, F. Lammert, A. Duarte-Rojo, E. J. Heathcote, M. P. Manns, L. Kuske, S. Zeuzem, W. P. Hofmann, R. J. de Knegt, B. E. Hansen, and H. L. Janssen. 2012. Association between sustained virological response and all-cause mortality among patients with chronic hepatitis C and advanced hepatic fibrosis. JAMA. 308:2584-2593. doi: 10.1001/jama.2012.144878 [doi].

20. Ferenci, P., K. Kozbial, M. Mandorfer, and H. Hofer. 2015. HCV targeting of patients with cirrhosis. J. Hepatol. 63:1015-1022. doi: 10.1016/j.jhep.2015.06.003 [doi].

21. Chung, R. T., and T. F. Baumert. 2014. Curing chronic hepatitis C--the arc of a medical triumph. N. Engl. J. Med. 370:1576-1578. doi: 10.1056/NEJMp1400986 [doi].

22. Kolykhalov, A. A., E. V. Agapov, K. J. Blight, K. Mihalik, S. M. Feinstone, and C. M. Rice. 1997. Transmission of hepatitis C by intrahepatic inoculation with transcribed RNA. Science. 277:570-574.

23. Xie, Z. C., J. I. Riezu-Boj, J. J. Lasarte, J. Guillen, J. H. Su, M. P. Civeira, and J. Prieto. 1998. Transmission of hepatitis C virus infection to tree shrews. Virology. 244:513-520. doi: S0042-6822(98)99127-9 [pii].

24. Weiner, A. J., G. Kuo, D. W. Bradley, F. Bonino, G. Saracco, C. Lee, J. Rosenblatt, Q. L. Choo, and M. Houghton. 1990. Detection of hepatitis C viral sequences in non-A, non-B hepatitis. Lancet. 335:1-3.

25. Amako, Y., K. Tsukiyama-Kohara, A. Katsume, Y. Hirata, S. Sekiguchi, Y. Tobita, Y. Hayashi, T. Hishima, N. Funata, H. Yonekawa, and M. Kohara. 2010. Pathogenesis of hepatitis C virus infection in Tupaia belangeri. J. Virol. 84:303-311. doi: 10.1128/JVI.01448-09 [doi].

26. Hsu, M., J. Zhang, M. Flint, C. Logvinoff, C. Cheng-Mayer, C. M. Rice, and J. A. McKeating. 2003. Hepatitis C virus glycoproteins mediate pH- dependent cell entry of pseudotyped retroviral particles. Proc. Natl. Acad. Sci. U. S. A. 100:7271-7276. doi: 10.1073/pnas.0832180100 [doi].

27. Bartosch, B., J. Dubuisson, and F. L. Cosset. 2003. Infectious hepatitis C virus pseudo-particles containing functional E1-E2 envelope protein complexes. J. Exp. Med. 197:633-642.

28. Lagging, L. M., K. Meyer, R. J. Owens, and R. Ray. 1998. Functional role of hepatitis C virus chimeric glycoproteins in the infectivity of pseudotyped virus. J. Virol. 72:3539-3546.

29. Tarr, A. W., A. M. Owsianka, J. M. Timms, C. P. McClure, R. J. Brown, T. P. Hickling, T. Pietschmann, R. Bartenschlager, A. H. Patel, and J. K. Ball. 2006. Characterization of the hepatitis C virus E2 epitope defined by the broadly neutralizing monoclonal antibody AP33. Hepatology. 43:592-601. doi: 10.1002/hep.21088 [doi].

30. Urbanowicz, R. A., C. P. McClure, R. J. Brown, T. Tsoleridis, M. A. Persson, T. Krey, W. L. Irving, J. K. Ball, and A. W. Tarr. 2015. A Diverse Panel of Hepatitis C Virus Glycoproteins for Use in Vaccine Research Reveals Extremes of Monoclonal Antibody Neutralization Resistance. J. Virol. 90:3288- 3301. doi: 10.1128/JVI.02700-15 [doi].

31. Osburn, W. O., A. E. Snider, B. L. Wells, R. Latanich, J. R. Bailey, D. L. Thomas, A. L. Cox, and S. C. Ray. 2014. Clearance of hepatitis C infection is associated with the early appearance of broad neutralizing antibody responses. Hepatology. 59:2140-2151. doi: 10.1002/hep.27013 [doi].

32. Ortega-Prieto, A. M., J. Sheldon, A. Grande-Perez, H. Tejero, J. Gregori, J. Quer, J. I. Esteban, E. Domingo, and C. Perales. 2013. Extinction of hepatitis C virus by ribavirin in hepatoma cells involves lethal mutagenesis. PLoS One. 8:e71039. doi: 10.1371/journal.pone.0071039 [doi].

33. Lindenbach, B. D., M. J. Evans, A. J. Syder, B. Wolk, T. L. Tellinghuisen, C. C. Liu, T. Maruyama, R. O. Hynes, D. R. Burton, J. A. McKeating, and C. M. Rice. 2005. Complete replication of hepatitis C virus in cell culture. Science. 309:623-626. doi: 1114016 [pii].

34. Wakita, T., T. Pietschmann, T. Kato, T. Date, M. Miyamoto, Z. Zhao, K. Murthy, A. Habermann, H. G. Krausslich, M. Mizokami, R. Bartenschlager, and T. J. Liang. 2005. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat. Med. 11:791-796. doi: nm1268 [pii].

35. Zhong, J., P. Gastaminza, G. Cheng, S. Kapadia, T. Kato, D. R. Burton, S. F. Wieland, S. L. Uprichard, T. Wakita, and F. V. Chisari. 2005. Robust hepatitis C virus infection in vitro. Proc. Natl. Acad. Sci. U. S. A. 102:9294-9299. doi: 0503596102 [pii].

36. Li, Y. P., S. Ramirez, L. Mikkelsen, and J. Bukh. 2015. Efficient infectious cell culture systems of the hepatitis C virus (HCV) prototype strains HCV-1 and H77. J. Virol. 89:811-823. doi: 10.1128/JVI.02877-14 [doi].

37. Ramirez, S., Y. P. Li, S. B. Jensen, J. Pedersen, J. M. Gottwein, and J. Bukh. 2014. Highly efficient infectious cell culture of three hepatitis C virus genotype 2b strains and sensitivity to lead protease, nonstructural protein 5A, and polymerase inhibitors. Hepatology. 59:395-407. doi: 10.1002/hep.26660 [doi].

38. Kim, S., T. Date, H. Yokokawa, T. Kono, H. Aizaki, P. Maurel, C. Gondeau, and T. Wakita. 2014. Development of hepatitis C virus genotype 3a cell culture system. Hepatology. 60:1838-1850. doi: 10.1002/hep.27197 [doi].

39. Morin, T. J., T. J. Broering, B. A. Leav, B. M. Blair, K. J. Rowley, E. N. Boucher, Y. Wang, P. S. Cheslock, M. Knauber, D. B. Olsen, S. W. Ludmerer, G. Szabo, R. W. Finberg, R. H. Purcell, R. E. Lanford, D. M. Ambrosino, D. C. Molrine, and G. J. Babcock. 2012. Human monoclonal antibody HCV1 effectively prevents and treats HCV infection in chimpanzees. PLoS Pathog. 8:e1002895. doi: 10.1371/journal.ppat.1002895 [doi].

40. Youn, J. W., S. H. Park, D. Lavillette, F. L. Cosset, S. H. Yang, C. G. Lee, H. T. Jin, C. M. Kim, M. T. Shata, D. H. Lee, W. Pfahler, A. M. Prince, and Y. C. Sung. 2005. Sustained E2 antibody response correlates with reduced peak viremia after hepatitis C virus infection in the chimpanzee. Hepatology. 42:1429- 1436. doi: 10.1002/hep.20934 [doi].

41. Forns, X., P. J. Payette, X. Ma, W. Satterfield, G. Eder, I. K. Mushahwar, S. Govindarajan, H. L. Davis, S. U. Emerson, R. H. Purcell, and J. Bukh. 2000. Vaccination of chimpanzees with plasmid DNA encoding the hepatitis C virus (HCV) envelope E2 protein modified the infection after challenge with homologous monoclonal HCV. Hepatology. 32:618-625. doi: S0270913900192869 [pii].

42. Smith, D. B., J. Bukh, C. Kuiken, A. S. Muerhoff, C. M. Rice, J. T. Stapleton, and P. Simmonds. 2014. Expanded classification of hepatitis C virus into 7 genotypes and 67 subtypes: updated criteria and genotype assignment web resource. Hepatology. 59:318-327. doi: 10.1002/hep.26744 [doi].

43. Chang, K. S., J. Jiang, Z. Cai, and G. Luo. 2007. Human apolipoprotein e is required for infectivity and production of hepatitis C virus in cell culture. J. Virol. 81:13783-13793. doi: JVI.01091-07 [pii].

44. Lavillette, D., A. W. Tarr, C. Voisset, P. Donot, B. Bartosch, C. Bain, A. H. Patel, J. Dubuisson, J. K. Ball, and F. L. Cosset. 2005. Characterization of

96 host-range and cell entry properties of the major genotypes and subtypes of hepatitis C virus. Hepatology. 41:265-274. doi: 10.1002/hep.20542 [doi].

45. Lindenbach, B. D., and C. M. Rice. 2013. The ins and outs of hepatitis C virus entry and assembly. Nat. Rev. Microbiol. 11:688-700. doi: 10.1038/nrmicro3098 [doi].

46. Mazumdar, B., A. Banerjee, K. Meyer, and R. Ray. 2011. Hepatitis C virus E1 envelope glycoprotein interacts with apolipoproteins in facilitating entry into hepatocytes. Hepatology. 54:1149-1156. doi: 10.1002/hep.24523 [doi].

47. Domingo, E., D. Sabo, T. Taniguchi, and C. Weissmann. 1978. Nucleotide sequence heterogeneity of an RNA phage population. Cell. 13:735-744. doi: 0092-8674(78)90223-4 [pii].

48. Domingo, E., E. Martinez-Salas, F. Sobrino, J. C. de la Torre, A. Portela, J. Ortin, C. Lopez-Galindez, P. Perez-Brena, N. Villanueva, and R. Najera. 1985. The quasispecies (extremely heterogeneous) nature of viral RNA genome populations: biological relevance--a review. Gene. 40:1-8.

49. Kato, N., Y. Ootsuyama, T. Tanaka, M. Nakagawa, T. Nakazawa, K. Muraiso, S. Ohkoshi, M. Hijikata, and K. Shimotohno. 1992. Marked sequence diversity in the putative envelope proteins of hepatitis C viruses. Virus Res. 22:107-123. doi: 0168-1702(92)90038-B [pii].

50. Martell, M., J. I. Esteban, J. Quer, J. Genesca, A. Weiner, R. Esteban, J. Guardia, and J. Gomez. 1992. Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution. J. Virol. 66:3225-3229.

51. Ray, S. C., Q. Mao, R. E. Lanford, S. Bassett, O. Laeyendecker, Y. M. Wang, and D. L. Thomas. 2000. Hypervariable region 1 sequence stability during hepatitis C virus replication in chimpanzees. J. Virol. 74:3058-3066.

52. Mao, Q., S. C. Ray, O. Laeyendecker, J. R. Ticehurst, S. A. Strathdee, D. Vlahov, and D. L. Thomas. 2001. Human immunodeficiency virus seroconversion and evolution of the hepatitis C virus quasispecies. J. Virol. 75:3259-3267. doi: 10.1128/JVI.75.7.3259-3267.2001 [doi].

53. Ray, S. C., Y. M. Wang, O. Laeyendecker, J. R. Ticehurst, S. A. Villano, and D. L. Thomas. 1999. Acute hepatitis C virus structural gene sequences as predictors of persistent viremia: hypervariable region 1 as a decoy. J. Virol. 73:2938-2946.

54. Cox, A. L., T. Mosbruger, Q. Mao, Z. Liu, X. H. Wang, H. C. Yang, J. Sidney, A. Sette, D. Pardoll, D. L. Thomas, and S. C. Ray. 2005. Cellular

97 immune selection with hepatitis C virus persistence in humans. J. Exp. Med. 201:1741-1752. doi: jem.20050121 [pii].

55. Owsianka, A. M., J. M. Timms, A. W. Tarr, R. J. Brown, T. P. Hickling, A. Szwejk, K. Bienkowska-Szewczyk, B. J. Thomson, A. H. Patel, and J. K. Ball. 2006. Identification of conserved residues in the E2 envelope glycoprotein of the hepatitis C virus that are critical for CD81 binding. J. Virol. 80:8695-8704. doi: 80/17/8695 [pii].

56. Rothwangl, K. B., B. Manicassamy, S. L. Uprichard, and L. Rong. 2008. Dissecting the role of putative CD81 binding regions of E2 in mediating HCV entry: putative CD81 binding region 1 is not involved in CD81 binding. Virol. J. 5:46-422X-5-46. doi: 10.1186/1743-422X-5-46 [doi].

57. Lavie, M., S. Sarrazin, R. Montserret, V. Descamps, T. F. Baumert, G. Duverlie, K. Seron, F. Penin, and J. Dubuisson. 2014. Identification of conserved residues in hepatitis C virus envelope glycoprotein E2 that modulate virus dependence on CD81 and SRB1 entry factors. J. Virol. 88:10584-10597. doi: 10.1128/JVI.01402-14 [doi].

58. Xu, Y., P. Martinez, K. Seron, G. Luo, F. Allain, J. Dubuisson, and S. Belouzard. 2015. Characterization of hepatitis C virus interaction with heparan sulfate proteoglycans. J. Virol. 89:3846-3858. doi: 10.1128/JVI.03647-14 [doi].

59. Jiang, J., W. Cun, X. Wu, Q. Shi, H. Tang, and G. Luo. 2012. Hepatitis C virus attachment mediated by apolipoprotein E binding to cell surface heparan sulfate. J. Virol. 86:7256-7267. doi: 10.1128/JVI.07222-11 [doi].

60. Lefevre, M., D. J. Felmlee, M. Parnot, T. F. Baumert, and C. Schuster. 2014. Syndecan 4 is involved in mediating HCV entry through interaction with lipoviral particle-associated apolipoprotein E. PLoS One. 9:e95550. doi: 10.1371/journal.pone.0095550 [doi].

61. Molina, S., V. Castet, C. Fournier-Wirth, L. Pichard-Garcia, R. Avner, D. Harats, J. Roitelman, R. Barbaras, P. Graber, P. Ghersa, M. Smolarsky, A. Funaro, F. Malavasi, D. Larrey, J. Coste, J. M. Fabre, A. Sa-Cunha, and P. Maurel. 2007. The low-density lipoprotein receptor plays a role in the infection of primary human hepatocytes by hepatitis C virus. J. Hepatol. 46:411-419. doi: S0168-8278(06)00580-0 [pii].

62. Agnello, V., G. Abel, M. Elfahal, G. B. Knight, and Q. X. Zhang. 1999. Hepatitis C virus and other flaviviridae viruses enter cells via low density lipoprotein receptor. Proc. Natl. Acad. Sci. U. S. A. 96:12766-12771.

63. Monazahian, M., I. Bohme, S. Bonk, A. Koch, C. Scholz, S. Grethe, and R. Thomssen. 1999. Low density lipoprotein receptor as a candidate receptor for

98 hepatitis C virus. J. Med. Virol. 57:223-229. doi: 10.1002/(SICI)1096- 9071(199903)57:3<223::AID-JMV2>3.0.CO;2-4 [pii].

64. Owen, D. M., H. Huang, J. Ye, and M. Gale Jr. 2009. Apolipoprotein E on hepatitis C virion facilitates infection through interaction with low-density lipoprotein receptor. Virology. 394:99-108. doi: 10.1016/j.virol.2009.08.037 [doi].

65. Barth, H., C. Schafer, M. I. Adah, F. Zhang, R. J. Linhardt, H. Toyoda, A. Kinoshita-Toyoda, T. Toida, T. H. Van Kuppevelt, E. Depla, F. Von Weizsacker, H. E. Blum, and T. F. Baumert. 2003. Cellular binding of hepatitis C virus envelope glycoprotein E2 requires cell surface heparan sulfate. J. Biol. Chem. 278:41003-41012. doi: 10.1074/jbc.M302267200 [doi].

66. Barth, H., E. K. Schnober, F. Zhang, R. J. Linhardt, E. Depla, B. Boson, F. L. Cosset, A. H. Patel, H. E. Blum, and T. F. Baumert. 2006. Viral and cellular determinants of the hepatitis C virus envelope-heparan sulfate interaction. J. Virol. 80:10579-10590. doi: JVI.00941-06 [pii].

67. Morikawa, K., Z. Zhao, T. Date, M. Miyamoto, A. Murayama, D. Akazawa, J. Tanabe, S. Sone, and T. Wakita. 2007. The roles of CD81 and glycosaminoglycans in the adsorption and uptake of infectious HCV particles. J. Med. Virol. 79:714-723. doi: 10.1002/jmv.20842 [doi].

68. Popescu, C. I., L. Riva, O. Vlaicu, R. Farhat, Y. Rouille, and J. Dubuisson. 2014. Hepatitis C virus life cycle and lipid metabolism. Biology (Basel). 3:892-921. doi: 10.3390/biology3040892 [doi].

69. Dao Thi, V. L., M. Dreux, and F. L. Cosset. 2011. Scavenger receptor class B type I and the hypervariable region-1 of hepatitis C virus in cell entry and neutralisation. Expert Rev. Mol. Med. 13:e13. doi: 10.1017/S1462399411001785 [doi].

70. Zeisel, M. B., G. Koutsoudakis, E. K. Schnober, A. Haberstroh, H. E. Blum, F. L. Cosset, T. Wakita, D. Jaeck, M. Doffoel, C. Royer, E. Soulier, E. Schvoerer, C. Schuster, F. Stoll-Keller, R. Bartenschlager, T. Pietschmann, H. Barth, and T. F. Baumert. 2007. Scavenger receptor class B type I is a key host factor for hepatitis C virus infection required for an entry step closely linked to CD81. Hepatology. 46:1722-1731. doi: 10.1002/hep.21994 [doi].

71. Catanese, M. T., H. Ansuini, R. Graziani, T. Huby, M. Moreau, J. K. Ball, G. Paonessa, C. M. Rice, R. Cortese, A. Vitelli, and A. Nicosia. 2010. Role of scavenger receptor class B type I in hepatitis C virus entry: kinetics and molecular determinants. J. Virol. 84:34-43. doi: 10.1128/JVI.02199-08 [doi].

72. Bertaux, C., and T. Dragic. 2006. Different domains of CD81 mediate distinct stages of hepatitis C virus pseudoparticle entry. J. Virol. 80:4940-4948. doi: 80/10/4940 [pii].

73. Farquhar, M. J., K. Hu, H. J. Harris, C. Davis, C. L. Brimacombe, S. J. Fletcher, T. F. Baumert, J. Z. Rappoport, P. Balfe, and J. A. McKeating. 2012. Hepatitis C virus induces CD81 and claudin-1 endocytosis. J. Virol. 86:4305-4316. doi: 10.1128/JVI.06996-11 [doi].

74. Evans, M. J., T. von Hahn, D. M. Tscherne, A. J. Syder, M. Panis, B. Wolk, T. Hatziioannou, J. A. McKeating, P. D. Bieniasz, and C. M. Rice. 2007. Claudin-1 is a hepatitis C virus co-receptor required for a late step in entry. Nature. 446:801-805. doi: nature05654 [pii].

75. Ploss, A., M. J. Evans, V. A. Gaysinskaya, M. Panis, H. You, Y. P. de Jong, and C. M. Rice. 2009. Human occludin is a hepatitis C virus entry factor required for infection of mouse cells. Nature. 457:882-886. doi: 10.1038/nature07684 [doi].

76. Harris, H. J., C. Davis, J. G. Mullins, K. Hu, M. Goodall, M. J. Farquhar, C. J. Mee, K. McCaffrey, S. Young, H. Drummer, P. Balfe, and J. A. McKeating. 2010. Claudin association with CD81 defines hepatitis C virus entry. J. Biol. Chem. 285:21092-21102. doi: 10.1074/jbc.M110.104836 [doi].

77. Benedicto, I., F. Molina-Jimenez, B. Bartosch, F. L. Cosset, D. Lavillette, J. Prieto, R. Moreno-Otero, A. Valenzuela-Fernandez, R. Aldabe, M. Lopez- Cabrera, and P. L. Majano. 2009. The tight junction-associated protein occludin is required for a postbinding step in hepatitis C virus entry and infection. J. Virol. 83:8012-8020. doi: 10.1128/JVI.00038-09 [doi].

78. Lavillette, D., B. Bartosch, D. Nourrisson, G. Verney, F. L. Cosset, F. Penin, and E. I. Pecheur. 2006. Hepatitis C virus glycoproteins mediate low pH- dependent membrane fusion with liposomes. J. Biol. Chem. 281:3909-3917. doi: M509747200 [pii].

79. Timpe, J. M., Z. Stamataki, A. Jennings, K. Hu, M. J. Farquhar, H. J. Harris, A. Schwarz, I. Desombere, G. L. Roels, P. Balfe, and J. A. McKeating. 2008. Hepatitis C virus cell-cell transmission in hepatoma cells in the presence of neutralizing antibodies. Hepatology. 47:17-24. doi: 10.1002/hep.21959 [doi].

80. Cooper, S., A. L. Erickson, E. J. Adams, J. Kansopon, A. J. Weiner, D. Y. Chien, M. Houghton, P. Parham, and C. M. Walker. 1999. Analysis of a successful immune response against hepatitis C virus. Immunity. 10:439-449. doi: S1074-7613(00)80044-8 [pii].

100

81. Gruner, N. H., T. J. Gerlach, M. C. Jung, H. M. Diepolder, C. A. Schirren, W. W. Schraut, R. Hoffmann, R. Zachoval, T. Santantonio, M. Cucchiarini, A. Cerny, and G. R. Pape. 2000. Association of hepatitis C virus-specific CD8+ T cells with viral clearance in acute hepatitis C. J. Infect. Dis. 181:1528-1536. doi: JID991221 [pii].

82. Lechner, F., D. K. Wong, P. R. Dunbar, R. Chapman, R. T. Chung, P. Dohrenwend, G. Robbins, R. Phillips, P. Klenerman, and B. D. Walker. 2000. Analysis of successful immune responses in persons infected with hepatitis C virus. J. Exp. Med. 191:1499-1512.

83. Takaki, A., M. Wiese, G. Maertens, E. Depla, U. Seifert, A. Liebetrau, J. L. Miller, M. P. Manns, and B. Rehermann. 2000. Cellular immune responses persist and humoral responses decrease two decades after recovery from a single-source outbreak of hepatitis C. Nat. Med. 6:578-582. doi: 10.1038/75063 [doi].

84. Pestka, J. M., M. B. Zeisel, E. Blaser, P. Schurmann, B. Bartosch, F. L. Cosset, A. H. Patel, H. Meisel, J. Baumert, S. Viazov, K. Rispeter, H. E. Blum, M. Roggendorf, and T. F. Baumert. 2007. Rapid induction of virus- neutralizing antibodies and viral clearance in a single-source outbreak of hepatitis C. Proc. Natl. Acad. Sci. U. S. A. 104:6025-6030. doi: 0607026104 [pii].

85. Hiroishi, K., H. Kita, M. Kojima, H. Okamoto, T. Moriyama, T. Kaneko, T. Ishikawa, S. Ohnishi, T. Aikawa, N. Tanaka, Y. Yazaki, K. Mitamura, and M. Imawari. 1997. Cytotoxic T lymphocyte response and viral load in hepatitis C virus infection. Hepatology. 25:705-712. doi: S0270913997001420 [pii].

86. Rehermann, B., K. M. Chang, J. G. McHutchison, R. Kokka, M. Houghton, and F. V. Chisari. 1996. Quantitative analysis of the peripheral blood cytotoxic T lymphocyte response in patients with chronic hepatitis C virus infection. J. Clin. Invest. 98:1432-1440. doi: 10.1172/JCI118931 [doi].

87. Cerny, A., J. G. McHutchison, C. Pasquinelli, M. E. Brown, M. A. Brothers, B. Grabscheid, P. Fowler, M. Houghton, and F. V. Chisari. 1995. Cytotoxic T lymphocyte response to hepatitis C virus-derived peptides containing the HLA A2.1 binding motif. J. Clin. Invest. 95:521-530. doi: 10.1172/JCI117694 [doi].

88. He, X. S., B. Rehermann, F. X. Lopez-Labrador, J. Boisvert, R. Cheung, J. Mumm, H. Wedemeyer, M. Berenguer, T. L. Wright, M. M. Davis, and H. B. Greenberg. 1999. Quantitative analysis of hepatitis C virus-specific CD8(+) T cells in peripheral blood and liver using peptide-MHC tetramers. Proc. Natl. Acad. Sci. U. S. A. 96:5692-5697.

101

89. Shirai, M., H. Okada, M. Nishioka, T. Akatsuka, C. Wychowski, R. Houghten, C. D. Pendleton, S. M. Feinstone, and J. A. Berzofsky. 1994. An epitope in hepatitis C virus core region recognized by cytotoxic T cells in mice and humans. J. Virol. 68:3334-3342.

90. Battegay, M., J. Fikes, A. M. Di Bisceglie, P. A. Wentworth, A. Sette, E. Celis, W. M. Ching, A. Grakoui, C. M. Rice, and K. Kurokohchi. 1995. Patients with chronic hepatitis C have circulating cytotoxic T cells which recognize hepatitis C virus-encoded peptides binding to HLA-A2.1 molecules. J. Virol. 69:2462-2470.

91. Li, K., N. L. Li, D. Wei, S. R. Pfeffer, M. Fan, and L. M. Pfeffer. 2012. Activation of chemokine and inflammatory cytokine response in hepatitis C virus- infected hepatocytes depends on Toll-like receptor 3 sensing of hepatitis C virus double-stranded RNA intermediates. Hepatology. 55:666-675. doi: 10.1002/hep.24763 [doi].

92. Saito, T., D. M. Owen, F. Jiang, J. Marcotrigiano, and M. Gale Jr. 2008. Innate immunity induced by composition-dependent RIG-I recognition of hepatitis C virus RNA. Nature. 454:523-527. doi: 10.1038/nature07106 [doi].

93. Li, X. D., L. Sun, R. B. Seth, G. Pineda, and Z. J. Chen. 2005. Hepatitis C virus protease NS3/4A cleaves mitochondrial antiviral signaling protein off the mitochondria to evade innate immunity. Proc. Natl. Acad. Sci. U. S. A. 102:17717-17722. doi: 0508531102 [pii].

94. Ding, Q., B. Huang, J. Lu, Y. J. Liu, and J. Zhong. 2012. Hepatitis C virus NS3/4A protease blocks IL-28 production. Eur. J. Immunol. 42:2374-2382. doi: 10.1002/eji.201242388 [doi].

95. Li, K., E. Foy, J. C. Ferreon, M. Nakamura, A. C. Ferreon, M. Ikeda, S. C. Ray, M. Gale Jr, and S. M. Lemon. 2005. Immune evasion by hepatitis C virus NS3/4A protease-mediated cleavage of the Toll-like receptor 3 adaptor protein TRIF. Proc. Natl. Acad. Sci. U. S. A. 102:2992-2997. doi: 0408824102 [pii].

96. Ding, Q., X. Cao, J. Lu, B. Huang, Y. J. Liu, N. Kato, H. B. Shu, and J. Zhong. 2013. Hepatitis C virus NS4B blocks the interaction of STING and TBK1 to evade host innate immunity. J. Hepatol. 59:52-58. doi: 10.1016/j.jhep.2013.03.019 [doi].

97. Nitta, S., N. Sakamoto, M. Nakagawa, S. Kakinuma, K. Mishima, A. Kusano-Kitazume, K. Kiyohashi, M. Murakawa, Y. Nishimura-Sakurai, S. Azuma, M. Tasaka-Fujita, Y. Asahina, M. Yoneyama, T. Fujita, and M. Watanabe. 2013. Hepatitis C virus NS4B protein targets STING and abrogates RIG-I-mediated type I interferon-dependent innate immunity. Hepatology. 57:46- 58. doi: 10.1002/hep.26017 [doi].

102

98. Larrubia, J. R., E. Moreno-Cubero, M. U. Lokhande, S. Garcia-Garzon, A. Lazaro, J. Miquel, C. Perna, and E. Sanz-de-Villalobos. 2014. Adaptive immune response during hepatitis C virus infection. World J. Gastroenterol. 20:3418-3430. doi: 10.3748/wjg.v20.i13.3418 [doi].

99. Thimme, R., J. Bukh, H. C. Spangenberg, S. Wieland, J. Pemberton, C. Steiger, S. Govindarajan, R. H. Purcell, and F. V. Chisari. 2002. Viral and immunological determinants of hepatitis C virus clearance, persistence, and disease. Proc. Natl. Acad. Sci. U. S. A. 99:15661-15668. doi: 10.1073/pnas.202608299 [doi].

100. Shin, E. C., S. H. Park, M. Demino, M. Nascimbeni, K. Mihalik, M. Major, N. S. Veerapu, T. Heller, S. M. Feinstone, C. M. Rice, and B. Rehermann. 2011. Delayed induction, not impaired recruitment, of specific CD8(+) T cells causes the late onset of acute hepatitis C. Gastroenterology. 141:686-95, 695.e1. doi: 10.1053/j.gastro.2011.05.006 [doi].

101. Lauer, G. M., E. Barnes, M. Lucas, J. Timm, K. Ouchi, A. Y. Kim, C. L. Day, G. K. Robbins, D. R. Casson, M. Reiser, G. Dusheiko, T. M. Allen, R. T. Chung, B. D. Walker, and P. Klenerman. 2004. High resolution analysis of cellular immune responses in resolved and persistent hepatitis C virus infection. Gastroenterology. 127:924-936. doi: S0016508504010364 [pii].

102. Abdel-Hakeem, M. S., N. Bedard, D. Murphy, J. Bruneau, and N. H. Shoukry. 2014. Signatures of protective memory immune responses during hepatitis C virus reinfection. Gastroenterology. 147:870-881.e8. doi: 10.1053/j.gastro.2014.07.005 [doi].

103. Osburn, W. O., B. E. Fisher, K. A. Dowd, G. Urban, L. Liu, S. C. Ray, D. L. Thomas, and A. L. Cox. 2010. Spontaneous control of primary hepatitis C virus infection and immunity against persistent reinfection. Gastroenterology. 138:315-324. doi: 10.1053/j.gastro.2009.09.017 [doi].

104. Ciuffreda, D., D. Comte, M. Cavassini, E. Giostra, L. Buhler, M. Perruchoud, M. H. Heim, M. Battegay, D. Genne, B. Mulhaupt, R. Malinverni, C. Oneta, E. Bernasconi, M. Monnat, A. Cerny, C. Chuard, J. Borovicka, G. Mentha, M. Pascual, J. J. Gonvers, G. Pantaleo, and V. Dutoit. 2008. Polyfunctional HCV-specific T-cell responses are associated with effective control of HCV replication. Eur. J. Immunol. 38:2665-2677. doi: 10.1002/eji.200838336 [doi].

105. Semmo, N., and P. Klenerman. 2007. CD4+ T cell responses in hepatitis C virus infection. World J. Gastroenterol. 13:4831-4838.

106. Sarobe, P., J. J. Lasarte, N. Casares, A. Lopez-Diaz de Cerio, E. Baixeras, P. Labarga, N. Garcia, F. Borras-Cuesta, and J. Prieto. 2002.

103

Abnormal priming of CD4(+) T cells by dendritic cells expressing hepatitis C virus core and E1 proteins. J. Virol. 76:5062-5070.

107. Netski, D. M., T. Mosbruger, E. Depla, G. Maertens, S. C. Ray, R. G. Hamilton, S. Roundtree, D. L. Thomas, J. McKeating, and A. Cox. 2005. Humoral immune response in acute hepatitis C virus infection. Clin. Infect. Dis. 41:667-675. doi: CID36430 [pii].

108. Logvinoff, C., M. E. Major, D. Oldach, S. Heyward, A. Talal, P. Balfe, S. M. Feinstone, H. Alter, C. M. Rice, and J. A. McKeating. 2004. Neutralizing antibody response during acute and chronic hepatitis C virus infection. Proc. Natl. Acad. Sci. U. S. A. 101:10149-10154. doi: 10.1073/pnas.0403519101 [doi].

109. Law, M., T. Maruyama, J. Lewis, E. Giang, A. W. Tarr, Z. Stamataki, P. Gastaminza, F. V. Chisari, I. M. Jones, R. I. Fox, J. K. Ball, J. A. McKeating, N. M. Kneteman, and D. R. Burton. 2008. Broadly neutralizing antibodies protect against hepatitis C virus quasispecies challenge. Nat. Med. 14:25-27. doi: nm1698 [pii].

110. Giang, E., M. Dorner, J. C. Prentoe, M. Dreux, M. J. Evans, J. Bukh, C. M. Rice, A. Ploss, D. R. Burton, and M. Law. 2012. Human broadly neutralizing antibodies to the envelope glycoprotein complex of hepatitis C virus. Proc. Natl. Acad. Sci. U. S. A. 109:6205-6210. doi: 10.1073/pnas.1114927109 [doi].

111. de Jong, Y. P., M. Dorner, M. C. Mommersteeg, J. W. Xiao, A. B. Balazs, J. B. Robbins, B. Y. Winer, S. Gerges, K. Vega, R. N. Labitt, B. M. Donovan, E. Giang, A. Krishnan, L. Chiriboga, M. R. Charlton, D. R. Burton, D. Baltimore, M. Law, C. M. Rice, and A. Ploss. 2014. Broadly neutralizing antibodies abrogate established hepatitis C virus infection. Sci. Transl. Med. 6:254ra129. doi: 10.1126/scitranslmed.3009512 [doi].

112. Morin, T. J., T. J. Broering, B. A. Leav, B. M. Blair, K. J. Rowley, E. N. Boucher, Y. Wang, P. S. Cheslock, M. Knauber, D. B. Olsen, S. W. Ludmerer, G. Szabo, R. W. Finberg, R. H. Purcell, R. E. Lanford, D. M. Ambrosino, D. C. Molrine, and G. J. Babcock. 2012. Human monoclonal antibody HCV1 effectively prevents and treats HCV infection in chimpanzees. PLoS Pathog. 8:e1002895. doi: 10.1371/journal.ppat.1002895 [doi].

113. Vanwolleghem,Thomas, Bukh Jens, Meuleman Philip, Desombere Isabelle, Meunier Jean-Christophe, Alter Harvey, R. Purcell H., and Leroux- Roels Geert. Polyclonal immunoglobulins from a chronic hepatitis C virus patient protect human liverâ€“chimeric mice from infection with a homologous hepatitis C virus strain. .

114. Broering, T. J., K. A. Garrity, N. K. Boatright, S. E. Sloan, F. Sandor, W. D. Thomas Jr, G. Szabo, R. W. Finberg, D. M. Ambrosino, and G. J.

104

Babcock. 2009. Identification and characterization of broadly neutralizing human monoclonal antibodies directed against the E2 envelope glycoprotein of hepatitis C virus. J. Virol. 83:12473-12482. doi: 10.1128/JVI.01138-09 [doi].

115. Owsianka, A., A. W. Tarr, V. S. Juttla, D. Lavillette, B. Bartosch, F. L. Cosset, J. K. Ball, and A. H. Patel. 2005. Monoclonal antibody AP33 defines a broadly neutralizing epitope on the hepatitis C virus E2 envelope glycoprotein. J. Virol. 79:11095-11104. doi: 79/17/11095 [pii].

116. Johansson, D. X., C. Voisset, A. W. Tarr, M. Aung, J. K. Ball, J. Dubuisson, and M. A. Persson. 2007. Human combinatorial libraries yield rare antibodies that broadly neutralize hepatitis C virus. Proc. Natl. Acad. Sci. U. S. A. 104:16269-16274. doi: 0705522104 [pii].

117. Schofield, D. J., B. Bartosch, Y. K. Shimizu, T. Allander, H. J. Alter, S. U. Emerson, F. L. Cosset, and R. H. Purcell. 2005. Human monoclonal antibodies that react with the E2 glycoprotein of hepatitis C virus and possess neutralizing activity. Hepatology. 42:1055-1062. doi: 10.1002/hep.20906 [doi].

118. Keck, Z. Y., J. Xia, Y. Wang, W. Wang, T. Krey, J. Prentoe, T. Carlsen, A. Y. Li, A. H. Patel, S. M. Lemon, J. Bukh, F. A. Rey, and S. K. Foung. 2012. Human monoclonal antibodies to a novel cluster of conformational epitopes on HCV E2 with resistance to neutralization escape in a genotype 2a isolate. PLoS Pathog. 8:e1002653. doi: 10.1371/journal.ppat.1002653 [doi].

119. Pietschmann, T., A. Kaul, G. Koutsoudakis, A. Shavinskaya, S. Kallis, E. Steinmann, K. Abid, F. Negro, M. Dreux, F. L. Cosset, and R. Bartenschlager. 2006. Construction and characterization of infectious intragenotypic and intergenotypic hepatitis C virus chimeras. Proc. Natl. Acad. Sci. U. S. A. 103:7408-7413. doi: 0504877103 [pii].

120. Meunier, J. C., R. S. Russell, V. Goossens, S. Priem, H. Walter, E. Depla, A. Union, K. N. Faulk, J. Bukh, S. U. Emerson, and R. H. Purcell. 2008. Isolation and characterization of broadly neutralizing human monoclonal antibodies to the e1 glycoprotein of hepatitis C virus. J. Virol. 82:966-973. doi: JVI.01872-07 [pii].

121. Dienstag, J. L. 1997. The natural history of chronic hepatitis C and what we should do about it. Gastroenterology. 112:651-655.

122. Liu, L., B. E. Fisher, K. A. Dowd, J. Astemborski, A. L. Cox, and S. C. Ray. 2010. Acceleration of hepatitis C virus envelope evolution in humans is consistent with progressive humoral immune selection during the transition from acute to chronic infection. J. Virol. 84:5067-5077. doi: 10.1128/JVI.02265-09 [doi].

105

123. Liu, L., B. E. Fisher, D. L. Thomas, A. L. Cox, and S. C. Ray. 2012. Spontaneous clearance of primary acute hepatitis C virus infection correlated with high initial viral RNA level and rapid HVR1 evolution. Hepatology. 55:1684- 1691. doi: 10.1002/hep.25575 [doi].

124. Simmonds, P. 2004. Genetic diversity and evolution of hepatitis C virus--15 years on. J. Gen. Virol. 85:3173-3188. doi: 85/11/3173 [pii].

125. Villano, S. A., D. Vlahov, K. E. Nelson, S. Cohn, and D. L. Thomas. 1999. Persistence of viremia and the importance of long-term follow-up after acute hepatitis C infection. Hepatology. 29:908-914. doi: S0270913999001378 [pii].

126. Farci, P., J. Bukh, and R. H. Purcell. 1997. The quasispecies of hepatitis C virus and the host immune response. Springer Semin. Immunopathol. 19:5-26.

127. Bukh, J., R. H. Miller, and R. H. Purcell. 1995. Genetic heterogeneity of hepatitis C virus: quasispecies and genotypes. Semin. Liver Dis. 15:41-63. doi: 10.1055/s-2007-1007262 [doi].

128. Neumann, A. U., N. P. Lam, H. Dahari, D. R. Gretch, T. E. Wiley, T. J. Layden, and A. S. Perelson. 1998. Hepatitis C viral dynamics in vivo and the antiviral efficacy of interferon-alpha therapy. Science. 282:103-107.

129. Dowd, K. A., D. M. Netski, X. H. Wang, A. L. Cox, and S. C. Ray. 2009. Selection pressure from neutralizing antibodies drives sequence evolution during acute infection with hepatitis C virus. Gastroenterology. 136:2377-2386. doi: 10.1053/j.gastro.2009.02.080 [doi].

130. Keck, Z. Y., S. H. Li, J. Xia, T. von Hahn, P. Balfe, J. A. McKeating, J. Witteveldt, A. H. Patel, H. Alter, C. M. Rice, and S. K. Foung. 2009. Mutations in hepatitis C virus E2 located outside the CD81 binding sites lead to escape from broadly neutralizing antibodies but compromise virus infectivity. J. Virol. 83:6149-6160. doi: 10.1128/JVI.00248-09 [doi].

131. Timm, J., G. M. Lauer, D. G. Kavanagh, I. Sheridan, A. Y. Kim, M. Lucas, T. Pillay, K. Ouchi, L. L. Reyor, J. Schulze zur Wiesch, R. T. Gandhi, R. T. Chung, N. Bhardwaj, P. Klenerman, B. D. Walker, and T. M. Allen. 2004. CD8 epitope escape and reversion in acute HCV infection. J. Exp. Med. 200:1593- 1604. doi: jem.20041006 [pii].

132. Wang, X. H., D. M. Netski, J. Astemborski, S. H. Mehta, M. S. Torbenson, D. L. Thomas, and S. C. Ray. 2007. Progression of fibrosis during chronic hepatitis C is associated with rapid virus evolution. J. Virol. 81:6513- 6522. doi: JVI.02276-06 [pii].

106

133. Shimizu, Y. K., M. Hijikata, A. Iwamoto, H. J. Alter, R. H. Purcell, and H. Yoshikura. 1994. Neutralizing antibodies against hepatitis C virus and the emergence of neutralization escape mutant viruses. J. Virol. 68:1494-1500.

134. Kuntzen, T., J. Timm, A. Berical, L. L. Lewis-Ximenez, A. Jones, B. Nolan, J. Schulze zur Wiesch, B. Li, A. Schneidewind, A. Y. Kim, R. T. Chung, G. M. Lauer, and T. M. Allen. 2007. Viral sequence evolution in acute hepatitis C virus infection. J. Virol. 81:11658-11668. doi: JVI.00995-07 [pii].

135. Ray, S. C., L. Fanning, X. H. Wang, D. M. Netski, E. Kenny-Walsh, and D. L. Thomas. 2005. Divergent and convergent evolution after a common-source outbreak of hepatitis C virus. J. Exp. Med. 201:1753-1759. doi: jem.20050122 [pii].

136. Keck, Z. Y., A. Saha, J. Xia, Y. Wang, P. Lau, T. Krey, F. A. Rey, and S. K. Foung. 2011. Mapping a region of hepatitis C virus E2 that is responsible for escape from neutralizing antibodies and a core CD81-binding region that does not tolerate neutralization escape mutations. J. Virol. 85:10451-10463. doi: 10.1128/JVI.05259-11 [doi].

137. Kong, L., E. Giang, J. B. Robbins, R. L. Stanfield, D. R. Burton, I. A. Wilson, and M. Law. 2012. Structural basis of hepatitis C virus neutralization by broadly neutralizing antibody HCV1. Proc. Natl. Acad. Sci. U. S. A. 109:9499- 9504. doi: 10.1073/pnas.1202924109 [doi].

138. Hadlock, K. G., R. E. Lanford, S. Perkins, J. Rowe, Q. Yang, S. Levy, P. Pileri, S. Abrignani, and S. K. Foung. 2000. Human monoclonal antibodies that inhibit binding of hepatitis C virus E2 protein to CD81 and recognize conserved conformational epitopes. J. Virol. 74:10407-10416.

139. Keck, Z. Y., O. Olson, M. Gal-Tanamy, J. Xia, A. H. Patel, M. Dreux, F. L. Cosset, S. M. Lemon, and S. K. Foung. 2008. A point mutation leading to hepatitis C virus escape from neutralization by a monoclonal antibody to a conserved conformational epitope. J. Virol. 82:6067-6072. doi: 10.1128/JVI.00252-08 [doi].

140. Keck, Z., W. Wang, Y. Wang, P. Lau, T. H. Carlsen, J. Prentoe, J. Xia, A. H. Patel, J. Bukh, and S. K. Foung. 2013. Cooperativity in virus neutralization by human monoclonal antibodies to two adjacent regions located at the amino terminus of hepatitis C virus E2 glycoprotein. J. Virol. 87:37-51. doi: 10.1128/JVI.01941-12 [doi].

141. Krey, T., A. Meola, Z. Y. Keck, L. Damier-Piolle, S. K. Foung, and F. A. Rey. 2013. Structural basis of HCV neutralization by human monoclonal antibodies resistant to viral neutralization escape. PLoS Pathog. 9:e1003364. doi: 10.1371/journal.ppat.1003364 [doi].

107

142. Bartosch, B., J. Bukh, J. C. Meunier, C. Granier, R. E. Engle, W. C. Blackwelder, S. U. Emerson, F. L. Cosset, and R. H. Purcell. 2003. In vitro assay for neutralizing antibody to hepatitis C virus: evidence for broadly conserved neutralization epitopes. Proc. Natl. Acad. Sci. U. S. A. 100:14199- 14204. doi: 10.1073/pnas.2335981100 [doi].

143. Perotti, M., N. Mancini, R. A. Diotti, A. W. Tarr, J. K. Ball, A. Owsianka, R. Adair, A. H. Patel, M. Clementi, and R. Burioni. 2008. Identification of a broadly cross-reacting and neutralizing human monoclonal antibody directed against the hepatitis C virus E2 protein. J. Virol. 82:1047-1052. doi: JVI.01986-07 [pii].

144. von Hahn, T., J. C. Yoon, H. Alter, C. M. Rice, B. Rehermann, P. Balfe, and J. A. McKeating. 2007. Hepatitis C virus continuously escapes from neutralizing antibody and T-cell responses during chronic infection in vivo. Gastroenterology. 132:667-678. doi: S0016-5085(06)02566-2 [pii].

145. Carlsen, T. H., J. Pedersen, J. C. Prentoe, E. Giang, Z. Y. Keck, L. S. Mikkelsen, M. Law, S. K. Foung, and J. Bukh. 2014. Breadth of neutralization and synergy of clinically relevant human monoclonal antibodies against HCV genotypes 1a, 1b, 2a, 2b, 2c, and 3a. Hepatology. 60:1551-1562. doi: 10.1002/hep.27298 [doi].

146. Fofana, I., S. Fafi-Kremer, P. Carolla, C. Fauvelle, M. N. Zahid, M. Turek, L. Heydmann, K. Cury, J. Hayer, C. Combet, F. L. Cosset, T. Pietschmann, M. S. Hiet, R. Bartenschlager, F. Habersetzer, M. Doffoel, Z. Y. Keck, S. K. Foung, M. B. Zeisel, F. Stoll-Keller, and T. F. Baumert. 2012. Mutations that alter use of hepatitis C virus cell entry factors mediate escape from neutralizing antibodies. Gastroenterology. 143:223-233.e9. doi: 10.1053/j.gastro.2012.04.006 [doi].

147. Bailey, J. R., L. N. Wasilewski, A. E. Snider, R. El-Diwany, W. O. Osburn, Z. Keck, S. K. Foung, and S. C. Ray. 2015. Naturally selected hepatitis C virus polymorphisms confer broad neutralizing antibody resistance. J. Clin. Invest. 125:437-447. doi: 10.1172/JCI78794 [doi].

148. Munshaw, S., J. R. Bailey, L. Liu, W. O. Osburn, K. P. Burke, A. L. Cox, and S. C. Ray. 2012. Computational reconstruction of Bole1a, a representative synthetic hepatitis C virus subtype 1a genome. J. Virol. 86:5915-5921. doi: 10.1128/JVI.05959-11 [doi].

149. Burke, K. P., S. Munshaw, W. O. Osburn, J. Levine, L. Liu, J. Sidney, A. Sette, S. C. Ray, and A. L. Cox. 2012. Immunogenicity and cross-reactivity of a representative ancestral sequence in hepatitis C virus infection. J. Immunol. 188:5177-5188. doi: 10.4049/jimmunol.1103008 [doi].

108

150. Zibbell, J. E., K. Iqbal, R. C. Patel, A. Suryaprasad, K. J. Sanders, L. Moore-Moravian, J. Serrecchia, S. Blankenship, J. W. Ward, D. Holtzman, and Centers for Disease Control and Prevention (CDC). 2015. Increases in hepatitis C virus infection related to injection drug use among persons aged

151. Cox, A. L., D. M. Netski, T. Mosbruger, S. G. Sherman, S. Strathdee, D. Ompad, D. Vlahov, D. Chien, V. Shyamala, S. C. Ray, and D. L. Thomas. 2005. Prospective evaluation of community-acquired acute-phase hepatitis C virus infection. Clin. Infect. Dis. 40:951-958. doi: CID34887 [pii].

152. Bailey, J. R., K. A. Dowd, A. E. Snider, W. O. Osburn, S. H. Mehta, G. D. Kirk, D. L. Thomas, and S. C. Ray. 2015. CD4+ T-Cell-Dependent Reduction in Hepatitis C Virus-Specific Neutralizing Antibody Responses After Coinfection With Human Immunodeficiency Virus. J. Infect. Dis. 212:914-923. doi: 10.1093/infdis/jiv139 [doi].

153. Scheel, T. K., J. M. Gottwein, T. B. Jensen, J. C. Prentoe, A. M. Hoegh, H. J. Alter, J. Eugen-Olsen, and J. Bukh. 2008. Development of JFH1-based cell culture systems for hepatitis C virus genotype 4a and evidence for cross- genotype neutralization. Proc. Natl. Acad. Sci. U. S. A. 105:997-1002. doi: 10.1073/pnas.0711044105 [doi].

154. McCaffrey, K., I. Boo, P. Poumbourios, and H. E. Drummer. 2007. Expression and characterization of a minimal hepatitis C virus glycoprotein E2 core domain that retains CD81 binding. J. Virol. 81:9584-9590. doi: JVI.02782-06 [pii].

155. Deng, L., L. Ma, M. L. Virata-Theimer, L. Zhong, H. Yan, Z. Zhao, E. Struble, S. Feinstone, H. Alter, and P. Zhang. 2014. Discrete conformations of epitope II on the hepatitis C virus E2 protein for antibody-mediated neutralization and nonneutralization. Proc. Natl. Acad. Sci. U. S. A. 111:10690-10695. doi: 10.1073/pnas.1411317111 [doi].

156. Meola, A., A. W. Tarr, P. England, L. W. Meredith, C. P. McClure, S. K. Foung, J. A. McKeating, J. K. Ball, F. A. Rey, and T. Krey. 2015. Structural flexibility of a conserved antigenic region in hepatitis C virus glycoprotein E2 recognized by broadly neutralizing antibodies. J. Virol. 89:2170-2181. doi: 10.1128/JVI.02190-14 [doi].

157. Thomas, D. L., J. Astemborski, R. M. Rai, F. A. Anania, M. Schaeffer, N. Galai, K. Nolt, K. E. Nelson, S. A. Strathdee, L. Johnson, O. Laeyendecker, J. Boitnott, L. E. Wilson, and D. Vlahov. 2000. The natural history of hepatitis C virus infection: host, viral, and environmental factors. JAMA. 284:450-456. doi: joc00288 [pii].

109

158. Holmberg, S. D., P. R. Spradling, A. C. Moorman, and M. M. Denniston. 2013. Hepatitis C in the United States. N. Engl. J. Med. 368:1859-1861. doi: 10.1056/NEJMp1302973 [doi].

159. Averhoff, F. M., N. Glass, and D. Holtzman. 2012. Global burden of hepatitis C: considerations for healthcare providers in the United States. Clin. Infect. Dis. 55 Suppl 1:S10-5. doi: 10.1093/cid/cis361 [doi].

160. Armstrong, G. L., A. Wasley, E. P. Simard, G. M. McQuillan, W. L. Kuhnert, and M. J. Alter. 2006. The prevalence of hepatitis C virus infection in the United States, 1999 through 2002. Ann. Intern. Med. 144:705-714. doi: 144/10/705 [pii].

161. Gottwein, J. M., T. K. Scheel, T. B. Jensen, J. B. Lademann, J. C. Prentoe, M. L. Knudsen, A. M. Hoegh, and J. Bukh. 2009. Development and characterization of hepatitis C virus genotype 1-7 cell culture systems: role of CD81 and scavenger receptor class B type I and effect of antiviral drugs. Hepatology. 49:364-377. doi: 10.1002/hep.22673 [doi].

162. Gottwein, J. M., T. K. Scheel, A. M. Hoegh, J. B. Lademann, J. Eugen- Olsen, G. Lisby, and J. Bukh. 2007. Robust hepatitis C genotype 3a cell culture releasing adapted intergenotypic 3a/2a (S52/JFH1) viruses. Gastroenterology. 133:1614-1626. doi: S0016-5085(07)01451-5 [pii].

163. Zhang, J., G. Randall, A. Higginbottom, P. Monk, C. M. Rice, and J. A. McKeating. 2004. CD81 is required for hepatitis C virus glycoprotein-mediated viral infection. J. Virol. 78:1448-1455.

164. Bartosch, B., A. Vitelli, C. Granier, C. Goujon, J. Dubuisson, S. Pascale, E. Scarselli, R. Cortese, A. Nicosia, and F. L. Cosset. 2003. Cell entry of hepatitis C virus requires a set of co-receptors that include the CD81 tetraspanin and the SR-B1 scavenger receptor. J. Biol. Chem. 278:41624-41630. doi: 10.1074/jbc.M305289200 [doi].

165. Cormier, E. G., F. Tsamis, F. Kajumo, R. J. Durso, J. P. Gardner, and T. Dragic. 2004. CD81 is an entry coreceptor for hepatitis C virus. Proc. Natl. Acad. Sci. U. S. A. 101:7270-7274. doi: 10.1073/pnas.0402253101 [doi].

166. McKeating, J. A., L. Q. Zhang, C. Logvinoff, M. Flint, J. Zhang, J. Yu, D. Butera, D. D. Ho, L. B. Dustin, C. M. Rice, and P. Balfe. 2004. Diverse hepatitis C virus glycoproteins mediate viral infection in a CD81-dependent manner. J. Virol. 78:8496-8505. doi: 10.1128/JVI.78.16.8496-8505.2004 [doi].

167. Swann, R. E., V. M. Cowton, M. W. Robinson, S. J. Cole, S. T. Barclay, P. R. Mills, E. C. Thomson, J. McLauchlan, and A. H. Patel. 2016. Broad anti-

110

HCV antibody responses are associated with improved clinical disease parameters in chronic HCV infection. J. Virol. . doi: JVI.02669-15 [pii].

168. Scheel, T. K., J. M. Gottwein, T. H. Carlsen, Y. P. Li, T. B. Jensen, U. Spengler, N. Weis, and J. Bukh. 2011. Efficient culture adaptation of hepatitis C virus recombinants with genotype-specific core-NS2 by using previously identified mutations. J. Virol. 85:2891-2906. doi: 10.1128/JVI.01605-10 [doi].

169. Carlsen, T. H., T. K. Scheel, S. Ramirez, S. K. Foung, and J. Bukh. 2013. Characterization of hepatitis C virus recombinants with chimeric E1/E2 envelope proteins and identification of single amino acids in the E2 stem region important for entry. J. Virol. 87:1385-1399. doi: 10.1128/JVI.00684-12 [doi].

170. Mathiesen, C. K., J. Prentoe, L. W. Meredith, T. B. Jensen, H. Krarup, J. A. McKeating, J. M. Gottwein, and J. Bukh. 2015. Adaptive Mutations Enhance Assembly and Cell-to-Cell Transmission of a High-Titer Hepatitis C Virus Genotype 5a Core-NS2 JFH1-Based Recombinant. J. Virol. 89:7758-7775. doi: 10.1128/JVI.00039-15 [doi].

171. Brimacombe, C. L., J. Grove, L. W. Meredith, K. Hu, A. J. Syder, M. V. Flores, J. M. Timpe, S. E. Krieger, T. F. Baumert, T. L. Tellinghuisen, F. Wong-Staal, P. Balfe, and J. A. McKeating. 2011. Neutralizing antibody- resistant hepatitis C virus cell-to-cell transmission. J. Virol. 85:596-605. doi: 10.1128/JVI.01592-10 [doi].

172. Mathiesen, C. K., T. B. Jensen, J. Prentoe, H. Krarup, A. Nicosia, M. Law, J. Bukh, and J. M. Gottwein. 2014. Production and characterization of high-titer serum-free cell culture grown hepatitis C virus particles of genotype 1-6. Virology. 458-459:190-208. doi: 10.1016/j.virol.2014.03.021 [doi].

173. Meunier, J. C., R. S. Russell, R. E. Engle, K. N. Faulk, R. H. Purcell, and S. U. Emerson. 2008. Apolipoprotein c1 association with hepatitis C virus. J. Virol. 82:9647-9656. doi: 10.1128/JVI.00914-08 [doi].

174. Hishiki, T., Y. Shimizu, R. Tobita, K. Sugiyama, K. Ogawa, K. Funami, Y. Ohsaki, T. Fujimoto, H. Takaku, T. Wakita, T. F. Baumert, Y. Miyanari, and K. Shimotohno. 2010. Infectivity of hepatitis C virus is influenced by association with apolipoprotein E isoforms. J. Virol. 84:12048-12057. doi: 10.1128/JVI.01063-10 [doi].

175. Meunier, J. C., R. E. Engle, K. Faulk, M. Zhao, B. Bartosch, H. Alter, S. U. Emerson, F. L. Cosset, R. H. Purcell, and J. Bukh. 2005. Evidence for cross-genotype neutralization of hepatitis C virus pseudo-particles and enhancement of infectivity by apolipoprotein C1. Proc. Natl. Acad. Sci. U. S. A. 102:4560-4565. doi: 0501275102 [pii].

111

176. Wasilewski, L. N., R. El-Diwany, S. Munshaw, A. E. Snider, J. K. Brady, W. O. Osburn, S. C. Ray, and J. R. Bailey. 2016. A hepatitis C virus envelope polymorphism confers resistance to neutralization by polyclonal sera and broadly neutralizing monoclonal antibodies. J. Virol. . doi: JVI.02837-15 [pii].

177. Shan, L., S. A. Rabi, G. M. Laird, E. E. Eisele, H. Zhang, J. B. Margolick, and R. F. Siliciano. 2013. A novel PCR assay for quantification of HIV-1 RNA. J. Virol. 87:6521-6525. doi: 10.1128/JVI.00006-13 [doi].

178. Tamura, K., and M. Nei. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10:512-526.

179. Tamura, K., G. Stecher, D. Peterson, A. Filipski, and S. Kumar. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30:2725-2729. doi: 10.1093/molbev/mst197 [doi].

180. Vieyres, G., X. Thomas, V. Descamps, G. Duverlie, A. H. Patel, and J. Dubuisson. 2010. Characterization of the envelope glycoproteins associated with infectious hepatitis C virus. J. Virol. 84:10159-10168. doi: 10.1128/JVI.01180-10 [doi].

181. Falkowska, E., F. Kajumo, E. Garcia, J. Reinus, and T. Dragic. 2007. Hepatitis C virus envelope glycoprotein E2 glycans modulate entry, CD81 binding, and neutralization. J. Virol. 81:8072-8079. doi: JVI.00459-07 [pii].

182. Catanese, M. T., K. Uryu, M. Kopp, T. J. Edwards, L. Andrus, W. J. Rice, M. Silvestry, R. J. Kuhn, and C. M. Rice. 2013. Ultrastructural analysis of hepatitis C virus particles. Proc. Natl. Acad. Sci. U. S. A. 110:9505-9510. doi: 10.1073/pnas.1307527110 [doi].

183. Jiang, J., and G. Luo. 2009. Apolipoprotein E but not B is required for the formation of infectious hepatitis C virus particles. J. Virol. 83:12680-12691. doi: 10.1128/JVI.01476-09 [doi].

184. Boyer, A., A. Dumans, E. Beaumont, L. Etienne, P. Roingeard, and J. C. Meunier. 2014. The association of hepatitis C virus glycoproteins with apolipoproteins E and B early in assembly is conserved in lipoviral particles. J. Biol. Chem. 289:18904-18913. doi: 10.1074/jbc.M113.538256 [doi].

185. Lindenbach, B. D., P. Meuleman, A. Ploss, T. Vanwolleghem, A. J. Syder, J. A. McKeating, R. E. Lanford, S. M. Feinstone, M. E. Major, G. Leroux-Roels, and C. M. Rice. 2006. Cell culture-grown hepatitis C virus is infectious in vivo and can be recultured in vitro. Proc. Natl. Acad. Sci. U. S. A. 103:3805-3809. doi: 0511218103 [pii].

112

186. Podevin, P., A. Carpentier, V. Pene, L. Aoudjehane, M. Carriere, S. Zaidi, C. Hernandez, V. Calle, J. F. Meritet, O. Scatton, M. Dreux, F. L. Cosset, T. Wakita, R. Bartenschlager, S. Demignot, F. Conti, A. R. Rosenberg, and Y. Calmus. 2010. Production of infectious hepatitis C virus in primary cultures of human adult hepatocytes. Gastroenterology. 139:1355-1364. doi: 10.1053/j.gastro.2010.06.058 [doi].

187. Bukh, J., T. Pietschmann, V. Lohmann, N. Krieger, K. Faulk, R. E. Engle, S. Govindarajan, M. Shapiro, M. St Claire, and R. Bartenschlager. 2002. Mutations that permit efficient replication of hepatitis C virus RNA in Huh-7 cells prevent productive replication in chimpanzees. Proc. Natl. Acad. Sci. U. S. A. 99:14416-14421. doi: 10.1073/pnas.212532699 [doi].

188. Fauvelle, C., D. J. Felmlee, E. Crouchet, J. Lee, L. Heydmann, M. Lefevre, A. Magri, M. S. Hiet, I. Fofana, F. Habersetzer, S. K. Foung, R. Milne, A. H. Patel, K. Vercauteren, P. Meuleman, M. B. Zeisel, R. Bartenschlager, C. Schuster, and T. F. Baumert. 2016. Apolipoprotein E Mediates Evasion From Hepatitis C Virus Neutralizing Antibodies. Gastroenterology. 150:206-217.e4. doi: 10.1053/j.gastro.2015.09.014 [doi].

113

CURRICULUM VITAE Lisa Wasilewski

EDUCATION May 2016 Doctor of Philosophy (Ph.D.) in Immunology, Immunology Training Program, Johns Hopkins University School of Medicine, Baltimore, MD

May 2005 Bachelor of Science (BS), Biology and Chemistry, Simmons College, Boston,MA Magna cum Laude, Simmons Honors Academy

RESEARCH EXPERIENCE Aug. 2010 - Present Johns Hopkins School of Medicine, Baltimore, MD Immunology Training Program Infectious Disease Center for Viral Hepatitis, Laboratory of Dr. Stuart Ray Graduate Researcher  My thesis work involves identifying determinants of antibody neutralization in hepatitis C virus (HCV). The first arm of my research pertains to the computational identification and testing of neutralizing antibody resistance polymorphisms in HCV. The second portion of my research focuses on the development of a high-throughput system for generation and culture of full-length HCV (HCVcc) and validation of this model system.

Sep. 2004 - May 2005 Simmons College, Boston, MA Laboratory of Dr. Connie Chow Undergraduate Researcher Undergraduate Thesis: Dihydroorotate dehydrogenase in Plasmodium falciparum  This project, in collaboration with the Harvard School of Public Health, identified SNPs in the gene encoding dihydroorotate dehydrogenase and used this data on genetic diversity in confirming a recent origin of the parasite.

June 2004 - Aug. 2004 Mayo Clinic, Rochester, MN Laboratory of Dr. Jan van Deursen Summer Research Fellow  During this 10-week undergraduate fellowship, I participated in a study of the role of checkpoint proteins in aneuploidy, cloning mutant BubR1 expression constructs that would be used to examine functional domains of the protein.

TEACHING EXPERIENCE Jan. 2004 - May 2005 Simmons College, Boston, MA Teaching Assistant  Assisted students in understanding and bridging classroom and laboratory concepts  Guided students in the organic chemistry and analytical chemistry laboratory; advised on techniques and on troubleshooting problems Jan. 2002 - May 2004 Academic Support Tutor  Tutored students in psychology, biology, organic chemistry, and calculus  Note-taker in psychology and analytical chemistry for student with a learning disability

OTHER PROFESSIONAL EXPERIENCE Nov. 2006 - Dec. 2009 U.S. Peace Corps, Namibia Peace Corps Education Volunteer  Taught physical sciences to 8th and 9th grade and developed and taught a computer skills curriculum to 11th and 12th grade

114

 Applied for and received grant funding through the Peace Corps Partnership Program to significantly expand the school’s computer program  Aug. 2005 - July 2006 AmeriCorps*National Civilian Community Corps Field Team Leader  Supervised, motivated, directed, and coordinated a team of ten young adults aged 18-24 in multiple projects including Hurricane Katrina disaster relief, tutoring and mentoring rural youth, and Southern California fire risk mitigation  Coordinated project logistics with program staff and project sponsors  Jan. 2005 - May 2005 Barbara Lee Family Foundation / Simmons College Barbara Lee Fellowship Intern  Served in the office of representative Cory Atkins at the Massachusetts state house  Communicated directly with constituents regarding community concerns  Conducted research on state and community issues, composed memos, and made legislative recommendations

PUBLICATIONS Wasilewski LN, Ray SC, Bailey JR. 2016. Manuscript in submission.

El-Diwany R, Wasilewski LN, Mankowski MM, Brady JK, Snider AE, Osburn WO, Murrell B, Ray SC, Bailey JR. 2016. Manuscript in submission.

Wasilewski LN, El-Diwany R, Munshaw S, Snider AE, Brady JK, Osburn WO, Ray SC, Bailey JR. 2016. “A hepatitis C virus envelope polymorphism confers resistance to neutralization by polyclonal sera and broadly neutralizing monoclonal antibodies.” J Virol. 90(7):3773-82.

El-Diwany R, Wasilewski LN, Witwer KW, Bailey JR, Page K, Ray SC, Cox AL, Thomas DL, Balagopal A. 2015. “Acute hepatitis C virus induces consistent changes in circulating microRNAs that are associated with nonlytic hepatocyte release.” J Virol. 89(18):9454-64.

Bailey JR, Wasilewski LN, Snider AE, El-Diwany R, Osburn WO, Keck Z, Foung SK, Ray SC. 2015. “Naturally selected hepatitis C virus polymorphisms confer broad neutralizing antibody resistance.” J Clin Invest. 125(1):437-47.

Bailey JR, Laskey S, Wasilewski LN, Munshaw S, Fanning LJ, Kenny-Walsh E, Ray SC. 2012. “Constraints on viral evolution during chronic hepatitis C virus infection arising from a common- source exposure.” J Virol. 86(23): 12582-90.

Malureanu LA, Jeganathan KB, Hamada M, Wasilewski L, Davenport J, van Deursen JM. 2009. “BubR1 N terminus acts as a soluble inhibitor of cyclin B degradation by APC/C(Cdc20) in interphase.” Dev Cell. 16(1):118-31

POSTERS Lisa N. Wasilewski, Ramy El-Diwany, Madeleine Mankowski, Justin R. Bailey, and Stuart C. Ray. “Computational identification of broadly neutralizing antibody resistance polymorphisms using a panel of naturally occurring HCV envelopes.” Selected for a poster at the 21st International Symposium on Hepatitis C Virus and Related Viruses

Lisa N. Wasilewski, Ramy El-Diwany, Justin R. Bailey, and Stuart C. Ray. “Assessment of monoclonal antibodies using model systems: agreement of HCVpp and HCVcc.”

115

Selected for a poster at the 21st International Symposium on Hepatitis C Virus and Related Viruses

TECHNICAL SKILLS  Cell line culture  Western blots  ELISA  Sequencing/sequence analysis  DNA cloning  PCR  In-vitro RNA transcription and purification  Immunohistochemistry

AWARDS AND HONORS 2005 Catherine Jones Witton Award 2005 Allen Douglass Bliss Award (Chemistry departmental recognition) 2005 Biology Departmental Recognition Award 2004 Alumnae Association Award for Academic Excellence 2004 - 2005 Simmons Honors Academy 2001 - 2005 Simmons College Dean’s List (all semesters) 2001 - 2005 Simmons College Centennial Scholar (full tuition and book scholarship)

TEAMWORK/LEADERSHIP EXPERIENCE 2004 - 2005 Captain of Simmons College varsity crew team 2003 - 2005 Resident Advisor, Simmons College 2002 - 2004 Copy editor for Simmons College Microcosm yearbook 2002 - 2003 President of hall council

116