By ABIGAIL LEE MILLER DISSERTATION Submitted In

A NOVEL ROLE FOR A COMPLEX OF PDZ PROTEINS IN PI3K SIGNALING

by ABIGAIL LEE MILLER

DISSERTATION

Submitted in partial satisfaction of the requirements for the degree of

DOCTOR OF PHILOSOPHY

BIOMEDICAL SCIENCES

in the

GRADUATE DIVISION

of the

UNIVERSITY OF CALIFORNIA, SAN FRANCISCO

Abigail Lee Miller

Acknowledgements

There are many people who have impacted both my personal and professional life during

my studies at UCSF. I would like to thank first and foremost my family. My parents,

John and Connie Miller, have given me unlimited support and a home on the east coast

for when I needed to get away, recharge my batteries, and celebrate the holidays. My

siblings, JD Miller and Hannah Peterson, have given me the best 5 nephews and nieces,

whom I affectionately call the germ incubators. Finally, my youngest brother Andy

Miller, who has grown up a lot during my time in SF, is a model for kindness and

consideration of others, qualities for which everyone should strive.

In a similar vein, the people with whom I have had the pleasure of sharing a home must

be acknowledged. Being so far from the east coast, these people have served as my

surrogate family and have provided me with safe, comfortable, and friendly living

environments. Steve Chmura and Chris Campbell introduced me to the great city of San

Francisco. Conrado Soria, who was a roommate and a labmate, taught me the meaning of the work hard, play hard motto, and Charel Margison-Evans was the best traveling buddy, up for exploring any city, any country, and any continent. I wish them all the best of luck.

When I was choosing graduate schools, I was recommended to apply to the BMS program at UCSF, and I am grateful for that recommendation. The BMS administrative staff is superb. Lisa Magargal and Monique Piazza have answered every question,

explained every form, and helped with any problem I have ever brought to them. My

BMS advisor Martin McMahon was conveniently located down the hall and always had

iii

his door open for scientific questions, reagent requests, and interesting conversation. My

BMS class was small, but there were four of us that became good friends. Cynthia Lyle was both a classmate and a labmate. Not only was she outgoing and fun, but she was also very supportive during both a family tragedy and a work crisis. Elizabeth Sharp, otherwise known as the lizard, was a great tennis and dinner buddy. Together with fellow classmate Dustin Khiem, we spent many days playing tennis and video games and eating dinners/bbqs at Dustin’s place. I can’t imagine my graduate career without these guys.

I was fortunate to be one of the first graduate students to join Frank McCormick’s laboratory. Before I get to the lab researchers, I would first like to recognize the unsung heroes of the lab. Joanne Deming, Jessie Castillo, Louisa Johannessen, and Jordan Byrne were the administrative assistants who handled meeting schedules, retreat organization, and submission of all paperwork, things that we in the lab never thought about. Madhu

Macrae, Jacqueline Galeas, and Ophelia Torres managed the lab as well as stocked and cleaned the lab supplies. Now looking back, I realize what a fantastic job they did, and how much I miss both their organizational skills and their great personalities.

I joined the lab with two research technicians, Serah Choi and Conrado Soria, and all three of us worked in the virus bay. Serah and Conrado were brand new to laboratory research, but they were so interested and enthusiastic about everything. They made work seem like play, and we enjoyed many late nights both in and out of the lab together.

Also in the virus bay was Frank’s first graduate student Demetris Iacovides, who was our resident Greek and showed us the best time when we visited Spetses, Greece for an

EMBO signaling course. Jamie Smith, a post-doc fellow, was a later addition to the bay.

He was our microscope expert and was always up for karaoke, sushi, and beer. Our last

virus bay member was Mike Nehil, a friendly and good natured graduate student. He was

always doing science even if it was baking bread or brewing beer. I enjoyed working

side by side with him every day. All the virus bay members truly made my time in the

McCormick lab special.

Of course, there are other graduate students and post-docs that I would like to acknowledge for interactions both in and out of the lab. Cynthia Lyle and Jesse Lyons

were students, whose presentation skills I have always admired. We shared many outings

together within the city and in Tahoe and Disneyland. Amy Young and Irma Rangel-

Alarcon Stowe were students which similar research interests to mine. I had the pleasure of traveling to Croatia for a conference with them, and we often shared our lunches

together. Jennifer Okada-Khiem was a talented technician, who also worked in the PI3K field. Jenn was always up for drinks and dancing. The post-docs Tanja Meyer and David

Dankort could always be counted on for honest and critical feedback but they were also

fun and social. To this day, our times at the Cold Spring Harbor meetings have been some of my funniest. The final two post-docs, Clodagh O’Shea and Pablo Rodriguez-

Viciana, were key figures not only in my research but they were also pillars of the entire lab community. Clodagh was queen of the virus bay, and my research was an extension of her findings. I have such deep gratitude for all the time and encouragement she generously gave me. Our times outside the lab are legendary. From costume parties to spicy pasta dinners to foot racing down Haight St., we never had a dull moment. Pablo was the king of the lab. He generated 99% of all plasmids which he freely gave, and the majority of the lab was trained under Pablo’s methods and protocols. Outside the lab, we

had Pablo singing Ricky Martin for karaoke and dressing like a chicken for Halloween. I

wish success and happiness for each one of these unique and fantastic individuals.

No graduate career is without a thesis committee or mentors. David Stokoe and Kevin

Shannon were kind enough to join my committee. Over the years, both have leant me

their respective expertise and have encouraged me despite the complexity of my research

project. I would also like to thank them for their critical reading of my dissertation.

Another person I would like to thank is Mike Fried, an honorary McCormick lab member

despite having his own lab. Mike has always given me advice and criticisms during lab

meetings and RIPs to improve the level of my science and make me a better researcher.

Last but not least I would like to acknowledge my laboratory advisor Frank McCormick.

Frank is an extremely generous person. Not just because he has provided us with lab

retreats abroad, treated us to dinners and holiday lunches, or provided lab meeting meals,

but also because he is generous scientifically. He has been very open to the direction

projects have turned (mouse work, virus, cell cycle). He has purchased high tech

methods and technologies that many other labs would not (Licor and PALM), and he has encouraged the attendance of meetings regardless if there is data to present, as long as it

will further the knowledge of the attendee. In many ways I think Frank is a great role

model. He’s organized, concise in his writings and presentations, and is a morning

person, which I am most certainly not. More importantly, he truly loves science. He is committed to finding a therapeutic cure to cancers that have an activated Ras/MAPK

pathway. His other loves include formula 1 racing, fine dining, poker, and the Xbox. It’s

these qualities which make Frank a well rounded and an excellent person, and I am very

grateful to have been a part of his lab.

Declaration

The studies presented in this dissertation were performed under the guidance of Dr. Frank

McCormick. The following co-authors contributed to this work: Clodagh O’Shea (Salk

Institute), Conrado Soria (Salk Institute), Mike Trnka (University of California, San

Francisco), Al Burlingame (University of California, San Francisco), and Frank

McCormick (University of California, San Francisco).

vii

A Novel Role for a Complex of PDZ Proteins in PI3K signaling

Abigail Lee Miller

Abstract

Early adenoviral proteins perturb the same pathways that are deregulated in cancer cells

in order to drive viral replication. For example, E1A binds and inactivates the tumor

suppressor pRb, while E1B-55K in conjunction with E4-ORF6 results in the degradation of p53. As a result, the studies of E1A and E1B have contributed greatly to our

understanding of the Rb and p53 pathways, respectively. Other cellular pathways are also targeted by adenoviral proteins. Our lab has demonstrated that the early adenoviral protein E4-ORF1 potently activates PI3Kα signaling. This activation is not through protein-protein interactions with PI3K enzymes, impinging on insulin signaling, disruption of Pten function, or activation of Ras family proteins. To determine how E4-

ORF1 was activating the PI3K pathway, we used an unbiased proteomics approach to identify novel binding partners that played a role in PI3K signaling. We found the E4-

ORF1 bound to a PDZ complex consisting of Cask, Mint1 and Veli-3 through another

PDZ protein called Dlg1. Our results suggest that the Cask, Mint1, and Veli-3 complex acts as a repressor for PI3K signaling by both E4-ORF1 and growth factors, whereas

Dlg1 is required for activation. E4-ORF1 and growth factors, through an unknown cellular factor, may be mislocalizing the repressor complex using Dlg1, which allows

PI3K signaling to occur. Thus, the role of Dlg1, Cask, Mint1, and Veli-3 represents a novel regulatory step in this critical signaling pathway.

viii

Table of Contents

Acknowledgements………………………………………….…….…………………….iii

Declaration………………………………………...…………….……………...………vii

Abstract………………………………………………………..…….…………………viii

Table of Contents…………………….……………….………….….…………...... ……ix

List of Tables…………………………………...……………….…………….……….…x

List of Figures………………………………………………...……….....……..…….….xi

Chapter 1: Introduction…………………………………………………………………1

Chapter 2: Materials and Methods……………………………………………………17

Chapter 3: E4-ORF1 is a potent activator of p110α………………….………………26

Chapter 4: E4-ORF1 activates PI3K through an unknown mechanism……………33

Chapter 5: Identifying E4-ORF1 binding partners: The Dlg1-Cask-Mint1-Veli-3

complex…………………..……………...……...……………………….…45

Chapter 6: The effects of Dlg1, Cask, Mint1, and Veli-3 on PI3K signaling….……59

Chapter 7: Conclusions and Remarks………………………………………………...70

References………………………………………………………………………………73

List of Tables

Table 1.1: Somatic mutations activating the PI3K pathway…………………………7

Table 1.2: Classification of PDZ domains based on the PBMs of their associated

proteins……………………………………………………………………...12

Table 5.1: Differential cellular proteins bound to NTAP E4-ORF1 and ΔPBM…..49

Table 5.2: Adenoviral proteins binding E4-ORF1 and ΔPBM in the TAP assay….56

Table 5.3: Cellular proteins bound to NTAP E4-ORF1 with/without adenovirus…56

List of Figures

Figure 1.1: The PI3K family of enzymes…………………………………………….…3

Figure 1.2: The PI3K/growth factor pathway……………………………………….…5

Figure 1.3: Map of the adenovirus genome and the cellular proteins their gene

products target…………………………………………………………….10

Figure 1.4: The E4-ORF1 domains required for transformation and PI3K

activation…………………………………………………………………...11

Figure 1.5: Modular domains of PDZ containing proteins…………………………..14

Figure 2: Tandem affinity purification (TAP) strategy……………………………....22

Figure 3.1: E4-ORF1 activates the PI3K pathway and is sensitive to inhibitors…...27

Figure 3.2: Timecourse comparing transfected E4-ORF1 and oncogenic Ras……..29

Figure 3.3: The effects of isoform selective PI3K inhibitors on E4-ORF1’s activity.30

Figure 3.4: p110 siRNA anaylsis in E4-ORF1 expressing cells……………………....31

Figure 4.1: Pull down assays of E4-ORF1 and PI3K…………………………………37

Figure 4.2: The effects of E4-ORF1 on insulin signaling…………………………….38

Figure 4.3: E4-ORF1 expression in PTEN mutant cell lines………………………...39

xii

Figure 4.4: The association of Pten with Magi-1 and Dlg1………………………..…40

Figure 4.5: The effects of E4-ORF1 expression on the Ras/MAPK pathway……….41

Figure 4.6: The effects of E4-ORF1 on the Ras/MAPK pathway in the presence or

absence of LY294002 ……………………………………………………..42

Figure 4.7: The effects of E4-ORF1 on R-Ras activation……………………………43

Figure 5.1: NTAP E4-ORF1 and ΔPBM stably expressed in U2OS cells…………...47

Figure 5.2: NTAP pull down of E4-ORF1 and ΔPBM……………………………….48

Figure 5.3: GST E4-ORF1 pulls down endogenous PDZ containing proteins…...…51

Figure 5.4: Dlg1 recruits Cask, Mint1, and Veli-3 to Kir2 potassium channels……52

Figure 5.5: Loss of Dlg1 decreases association of Cask, Mint1, and Veli-3 with

E4-ORF1……………………………………………………..…………….53

Figure 5.6: Loss of Dlg1 does not affect the association of Magi-1 with E4-ORF1…54

Figure 5.7: NTAP pull down of E4-ORF1 and ΔPBM in a wild type adenoviral

infection…………………………………………………………………….55

Figure 6.1: Localization of the Let-23 receptor in C. elegans by the Lin-2/

Lin-10/Lin-7 complex……………………………………………………..60

Figure 6.2: The effects of knocking down Dlg1, Cask, Mint1, and Veli-3 in the

xiii

presence of E4-ORF1………………………………………….…………..63

Figure 6.3: Lack of association of Veli-3 with the ErbB-2 receptor…………………64

Figure 6.4: Lack of association of PI3K with Dlg1…………………………………...65

Figure 6.5: The effects of Dlg1, Cask, Mint1, and Veli-3 in the presence of growth

factors………………………………………………………………………66

Figure 6.6: The effects of knocking down Dlg1, Cask, Mint1, and Veli-3 in HBL100

cells treated with insulin…………………………………….……………67

Figure 6.7: The effects of knocking down Dlg1, Cask, Mint1, and Veli-3 in U251

cells…………………………………………………………………………68

Figure 6.8: The model of PI3K activation by E4-ORF1 and growth factors……….69

xiv

Chapter 1: Introduction

1.1 PI3K and Cancer

Phosphatidylinositol 3-kinases (PI3Ks) are a family of enzymes that phosphorylate lipids called phosphoinositides (PIs) at the 3-hydroxyl of the inositol ring. Divided into three

classes, PI3Ks differ in their structure, regulation, and substrate specificity. Class I

PI3Ks are heterodimers, consisting of a regulatory and catalytic subunit. Their primary

substrate in vivo is PI(4,5)P2, which is converted into PI(3,4,5)P3. Class I PI3Ks are

further subdivided in 1A and 1B. 1A PI3Ks are encoded by three regulatory genes

(p85α, p85β, and p55γ) and three catalytic genes (p110α, p110β, and p110δ). These

enzymes are stimulated when inactive PI3K complexes in the cytoplasm are recruited by

the p85 SH2 domains to the phosphotyrosine residues of receptors or other

phosphoproteins in the membrane. Binding both activates and localizes the PI3Ks in

close proximity to their lipid substrates. Class IB PI3Ks, on the other hand, consist of

two regulatory subunits (p101 and p84) and one catalytic subunit (p110γ), and they

transmit signals by associating with free Gβγ released from activated G-protein coupled

receptors (Vanhaesebroeck, Guillermet-Guibert et al. 2010). Additionally, p110α and

p110γ can be stimulated by the small GTPase Ras and other Ras family GTPases through

direct interaction (Kodaki, Woscholski et al. 1994; Rubio, Rodriguez-Viciana et al.

1997). p110δ has been shown to be stimulated by the Ras GTPases R-Ras and TC21

(Rodriguez-Viciana, Sabatier et al. 2004). Class II PI3Ks have three isoforms

(PI3K2α,β, and γ) and α and β are reported to use clathrin as an adaptor molecule (Prior

and Clague 1999; Wheeler and Domin 2006). Stimulated by tyrosine kinase, chemokine,

and integrin receptors, these lipid kinases in vitro can act on all three lipid substrates

(Domin, Pages et al. 1997), however in vivo it has been show that class II PI3Ks produce

PI(3)P (Domin, Harper et al. 2005; Falasca, Hughes et al. 2007). The single mammalian class III PI3K phosphorylates PI exclusively and functions in membrane trafficking and vacuole sorting (Herman and Emr 1990).

Figure 1.1: The PI3K family of enzymes. PI3Ks are a family of enzymes that are divided into three classes based on their structure, regulation, and substrates. All catalytic subunits consist of a C2, helical phosphatidyl inositol kinase (PIK), and catalytic domain. The class Ia PI3Ks (p110α, β, and γ) have an additional Ras binding domain and another domain which binds to the regulatory subunit (p85α/β, p55α/γ, and p50α). The regulatory proteins contain two Src homology 2 (SH2), one Src homology 3 (SH3), and a Bcr homology (BH) domain that is flanked by two proline (P) rich regions. Also containg a Ras binding domain, the class Ib PI3K, p110γ, binds to its regulatory protein p101. The class II enzymes contain an extra C2, as well as a Phox (PX) and Ras binding domain. These enzymes lack regulatory subunits but PI3KC2α and β do utilize clathrin as an adaptor. Class III has just one PI3K, Vps34p, which binds to the regulatory protein p150. P150 consists of a protein kinase (pk) domain, heat repeats, and WD-40 repeats. This figure is adapted from a previous publication (Anderson and Jackson 2003).

The lipid products produced by PI3Ks serve as second messengers that trigger a cascade of cellular responses. In particular, PI(3,4,5)P3 recruits a variety of pleckstrin homology

(PH) domain containing proteins to the plasma membrane. One of the best characterized proteins and primary effectors of PI3K is Akt, otherwise known as protein kinase B

(PKB). Akt is a serine/threonine kinase that is activated when localized to the membrane where phosphoinositide dependent kinase (PDK1) and mammalian target of rapamycin complex 2 (mTORC2) phosphorylate Akt on its Thr308 and Ser473 residues respectively

(Stephens, Anderson et al. 1998; Sarbassov, Guertin et al. 2005). Following its activation, Akt phosphorylates a host of signaling molecules involved in cell cycle, survival, glucose transport, migration, and protein synthesis. These processes can be negatively regulated by lipid phosphatases, such as phosphatase and tensin homolog

(PTEN), Src homology-2 domain-containing inositol 5-phosphatase 1 (SHIP1), and

SHIP2, which reduce PI(3,4,5)P3 levels and activity of downstream effectors such as

Akt.

Figure 1.2: The PI3K/growth factor pathway. Growth factors bind to their receptor tyrosine kinases (RTK) recruiting and activating the PI3K enzymes. This can occur directly with the p85 subunit binding to a phosphorylated tyrosine on the receptor or indirectly through adaptor proteins such IRS-1 or IRS-2 or through activation by Ras. Activated PI3K enzymes phosphorylate their lipid substrates converting PI(4,5)P2 into PI(3,4,5)P3, which will recruit and activate downstream effectors such as Akt. These effectors function in cellular processes including proliferation and survival, which are tightly controlled by phosphatases such as Pten, which converts PI(3,4,5)P3 back into PI(4,5)P2.

Given its diverse biological roles in the cell, it is not surprising that disruption of

PI3K/AKT signaling pathway is found in a variety of cancers. The PI3K pathway is

often deregulated by somatic mutations in the α catalytic subunit of PI3K, PTEN, or RAS

as well as the upregulation of growth factor receptors or Akt, which enables proliferation,

resistance to apoptosis, and metastasis. While these are the most notable, other

components of this signaling pathway have also been found to be altered in cancers,

including the α regulatory subunit of PI3K and the lipid phosphatases, INPP4B and

PTPN11 (Tartaglia, Mehler et al. 2001; Gewinner, Wang et al. 2009; Jaiswal,

Janakiraman et al. 2009). Uncovering other molecules that impinge on the pathway as well as their regulation will give us a better understanding of PI3K signaling and the

design of cancer therapies targeting it.

Table 1.1: Somatic mutations activating the PI3K pathway.

Genetic alteration Most common tumor References types PIK3CA (p110α) mutation breast, colon, endometrial, http://www.sanger.ac.uk/genetics/CGP/cosmic/ glioblastoma, ovarian PIK3CA amplification cervical, squamous cell (Ma, Wei et al. 2000; Massion, Kuo et al. lung carcinoma, gastric, 2002; Byun, Cho et al. 2003; Pedrero, head and neck Carracedo et al. 2005) PTEN mutation/loss of endometrial, glioblastoma, http://www.sanger.ac.uk/genetics/CGP/cosmic/ heterozygosity melanoma, prostate, breast, ovarian AKT1 (E17K) mutation breast, colorectal, (Carpten, Faber et al. 2007; Kim, Jeong et al. squamous cell lung 2008; Malanga, Scrima et al. 2008) carcinoma AKT1 amplification gastric (Staal 1987) AKT2 mutation colorectal (Parsons, Wang et al. 2005) AKT2 amplification head and neck, pancreatic, (Bellacosa, de Feo et al. 1995; Cheng, Ruggeri ovary, breast et al. 1996; Ruggeri, Huang et al. 1998; Pedrero, Carracedo et al. 2005) AKT3 (E17K) mutation melanoma (Davies, Stemke-Hale et al. 2008) KRAS mutation pancreatic, colorectal, lung (Li, Firozi et al. 2002; Bazan, Agnese et al. adenocarcinoma 2005; Eberhard, Johnson et al. 2005) NRAS mutation melanoma, myeloid (Albino, Nanus et al. 1989; Bowen, Frew et al. leukemia, thyroid 2005; Volante, Rapa et al. 2009) carcinoma HRAS mutation bladder (Pollard, Smith et al. 2010) EGFR mutation lung adenocarcinoma, http://www.sanger.ac.uk/genetics/CGP/cosmic/ glioblastoma, head and (Dong, Luo et al. 2010) neck, (Sok, Coppelli et al. 2006) EGFR amplification glioblastoma, lung (Bhargava, Gerald et al. 2005) adenocarcinoma, breast Her2/Neu amplification breast, ovarian (Mayr, Kanitz et al. 2006) PIK3R1 (p85α) mutation glioblastoma, ovarian (Philp, Campbell et al. 2001; 2008) PIK3CB (p110β) ovarian, breast (Brugge, Hung et al. 2007) amplification PDK1 amplification breast (Brugge, Hung et al. 2007) INPP4B loss of breast, ovarian (Gewinner, Wang et al. 2009) heterozygosity PTPN11 mutation leukemias, (Tartaglia, Niemeyer et al. 2003; Loh, myelodysplastic syndrome Reynolds et al. 2004; Silva, Almeida et al. 2009)

This table was adapted from a previous publication (Engelman 2009).

1.2 Adenovirus and the study of cancer

Adenoviruses are small, non-enveloped, DNA tumor viruses. There are 52 human

adenoviral serotypes or classes based on their surface antigens and these are further

categorized into 6 subgroups, A-F. Most adenovirus infections are associated with

respiratory infections, but other serotypes can cause conjunctivitis and gastroenteritis.

Adenoviruses, particularly the subgroup C viruses Ad 2 and Ad 5, are well characterized.

The adenovirus genome is linear, non-segmented, and double stranded between 26 and 45 kilobase pairs and encodes 22-40 genes. Although it is the largest of the non-enveloped viruses, adenovirus is still relatively basic and heavily relies upon cellular components for its replication and survival (Fields, Knipe et al. 2007).

Adenovirus targets the quiescent epithelial cells in the upper respiratory tract, eye, and

gastrointestinal tract. Therefore, the first functions of the early viral proteins are to 1)

drive the cells into S phase entry to allow the viral genome to replicated with the host’s

and 2) inhibit apoptosis to ensure the host cell survives the infection. These properties

deregulating the cell’s growth regulatory machinery and evading apoptosis are the same

hallmarks observed in cancer cells. Thus, historically adenoviral proteins have been

useful tools in the study of cancer. With just a limited number of viral proteins,

adenovirus is a concise genetic system in which to study these pathways that are

uncoupled in both viral infection and tumorigenesis.

The transformation properties of adenovirus are attributed primarily to the E1A and E1B

proteins, which disrupt the Rb and P53 tumor suppressor pathways, respectively.

However it is becoming evident that the other early viral proteins contribute to viral

oncogenesis. P53, a master regulator of cell cycle and cell death, is targeted by multiple viral proteins. In conjunction with E1B-55K, E4-ORF6 redirects cellular proteins to ubiquitinate and degrade p53 (Querido, Marcellus et al. 1997; Querido, Morrison et al.

2001). E4-ORF3 rearranges heterochromatin to prevent p53 from binding to its target promoters (Soria, Estermann et al. 2010). Another deregulator of cell cycle is E4-

ORF6/7, which promotes the heterodimerization and activation of the cell cycle driving

E2F transcription factors (Neill and Nevins 1991). Other viral proteins drive protein synthesis. E4-ORF1 and E4-ORF4 override the nutrient and growth factor checkpoints regulating protein translation by stimulating the PI3K and mTOR pathways (O'Shea,

Klupsch et al. 2005). Inhibiting cell death is another key function of these early gene products. P53 inactivation and PI3K activation promote cell survival along with the abrogation of the pro-apoptotic proteins Bax and Bak. E1B-19K is a functional homolog of Bcl2, a pro-survival protein which binds and antagonizes Bax and Bak (Farrow, White et al. 1995; Han, Sabbatini et al. 1996). Furthermore, the E3 proteins, E3-gp19k and

E3RIDα and β, inhibit apoptosis induced by immune cells. E3-gp19k sequesters MHC

Class I receptors from the membrane to prevent cytotoxic T cells from killing adenovirus infected cells (Andersson, Paabo et al. 1985), while E3RIDα and β form a complex degrading the death receptors Fas and TRAIL expressed in lymphocytes and monocytes

(Tollefson, Toth et al. 2001; McNees, Garnett et al. 2002). These findings show that the other early viral proteins also function in disrupting the same pathways that are targeted in tumorigenesis.

Figure 1.3: Map of the adenovirus genome and the cellular proteins their gene products target. Early viral proteins are marked in green and late proteins in blue. p53 is inactivated by E1B-55K, E4-ORF6, and E4-ORF3. The cell cycle proteins Rb and E2F are targeted by E1A and E4-ORF6/7, respectively. Protein translation is stimulated by E4-ORF1 and E4-ORF4 which activate the PI3K/mTOR pathway. Apoptosis is inhibited by E1B-19K which binds the Bcl-2 family members Bax and Bak. E3-gp19k and E3-RIDα/β prevent an immune response by impeding MHC Class I receptors and the TNFR family death receptors. This figure was adapted from a previous a publication (Wood and Fry 1999).

1.3 E4-ORF1

E4-ORF1 is a small gene product encoded in the early region 4 (E4) of five (subgroups

A-E) of the six human adenovirus serotypes (Tauber and Dobner 2001). Structurally E4-

ORF1 resembles dUTPase enzymes (Weiss, Lee et al. 1997), however it’s only known functional domain is a C-terminal region that binds PDZ (postsynaptic density-95, discs large, zona occludens-1) domains (Lee, Weiss et al. 1997). This class I PDZ binding motif (PBM) enables E4-ORF1 to associate with the cellular PDZ containing proteins

Dlg1, Zo-2, Mupp1, and Magi-1 (Lee, Weiss et al. 1997; Glaunsinger, Lee et al. 2000;

Lee, Glaunsinger et al. 2000; Glaunsinger, Weiss et al. 2001) Both monomeric and homo-trimeric E4-ORF1 complexes are present in E4-ORF1 expressing cells. Zo-2,

Mupp1, and Magi-1 bind to E4-ORF1 monomers forming insoluble complexes, while

Dlg1 binds to E4-ORF1 homo-trimers forming soluble complexes reported to localize to the plasma membrane (Chung, Weiss et al. 2008).

Similar to the E1 region which contains the oncoproteins E1A and E1B 55K, E4-ORF1 has transforming activity. Exogenous expression of E4-ORF1 induces in vitro transformation of mammalian cells (Weiss, McArthur et al. 1996). Furthermore, the E4-

ORF1 from subgroup D Ad 9 is the principal transforming agent, resulting in estrogen dependent mammary tumor formation in rats (Javier 1994). This transforming activity correlates with E4-ORF1’s ability to upregulate the PI3K pathway and requires its PBM along with two other conserved regions with unknown functions (Frese, Lee et al. 2003).

Figure 1.4: The E4-ORF1 domains required for transformation and PI3K activation. E4- ORF1 contains three domains necessary for transformation and PI3K activation. Shown here are the corresponding amino acids for Ad 5. Domains one and two have unknown functions, while the third domain is a class I PDZ binding motif.

1.4 PDZ proteins and signaling

PDZ domains are 80-90 amino acid structural modules that are found in bacteria, yeast, plants, viruses, and animals. Roughly 260 human proteins contain these protein-protein

interaction domains, which bind to short 3-7 amino acid motifs located on the carboxy

terminus of their partner proteins called PBMs. These interaction motifs found on their

partner proteins determine the class of the PDZ domain.

Table 1.2: Classification of PDZ domains based on the PBMs of their associated proteins

Class C-terminus of Interacting PDZ domain example partner protein partner Class I -ETDV -Shaker K+ channel -PSD-95 (PDZ2) -X-[S/T]-X-Φ -ESDV -NMDA receptor subunits -PSD-95 (PDZ2) -TTRV NR2A/B -PSD-95 (PDZ3) -TSVF -neuroligin -syntenin (PDZ1,PDZ2) -ESLV -ILR-5α -PSD-95 (PDZ1,2,3) -QSAV -PMCA-4b -syntrophin -DSSL -voltage gated Na+ channel -PICK1 -DTRL -protein kinase C-α -NHERF (PDZ1) -QTRL -β-adrenergic receptor -NHERF (PDZ1) -SSTL -CFTR -Shank/Pro-SAP -PTRL -GKAP -Shank/Pro-SAP -metabotrophic glutamate receptor subunit mGluR5 -GRK6A Class II -SVKI -AMPA receptor subunit GluR2 -PICK2, GRIP (PDZ5) -X-Φ-X-Φ -EYFI -glycophorin C -erythrocyte p55 -EYYV -neurexin -CASK -EFYA -syndecan-2 -CASK, syntenin (PDZ2) -YYKV -ephrinB1 -PICK1, GRIP (PDZ6) -DVPV -receptor tyrosine kinase ErbB2 -erbin Class III -VDSV -melatonin receptor -nNOS -X-[D/E/K/R]-X-Φ -GEPL -KIF17 -mLIN10/Mint1/X11 -FEEL -merlin -syntenin (PDZ1) -K/RYV -synthesized peptide -engineered from AF6 Other -DHWC -N-type Ca2+ channel -Mint1 -X-X-C-X -YXC -L6 antigen -SITAC -Ψ-[D/E]

(Φ-hydrophobic, Ψ-aliphatic side chain (nonpolar), X-unspecified)

This table is from a previous publication (Jelen, Oleksy et al. 2003).

PDZ containing proteins are also divided into PDZ domain only proteins and proteins

containing PDZ domains in combination with other structural domains. PDZ only proteins may contain a single or multiple PDZ domains usually of different PDZ domain classes. Proteins containing multiple PDZ domains often link many PDZ containing proteins to receptors, channels, adhesion molecules, and signaling complexes. However, even single PDZ only proteins can multimerize, such as PICK1 which homo- oligomerizes through coil-coil domains enabling the clustering of synaptic glutmate receptors (Staudinger, Zhou et al. 1995).

PDZ domains in combination with other structural domains proteins are sorted into families. The membrane-associated guanylate kinases (MAGUK) family is a large family that contains in addition to one or more PDZ domains, an SH3 domain, and a guanylate kinase homology region. MAGUK proteins are known to function in sequestering complexes at the plasma membrane and cellular junctions. The PDZ-LIM family proteins contain a PDZ domain followed by one or more Lin-11, Isl-1, Mec-3

(LIM) domains. These PDZ proteins tether their binding partners to the cytoskeleton.

Leucine-rich repeats and PDZ (LAP) proteins contain sixteen leucine-rich repeats and one or more PDZ domains and act to establish cell polarity. The SH3 and multiple ankyrin domains (SHANK) proteins are enormous proteins containing multiple ankyrin repeats, an SH3 domain, a PDZ domain, a long proline-rich region, and a sterile alpha motif (SAM). Shank proteins serve to bridge signaling complexes from the membrane to the cytoplasm (Jelen, Oleksy et al. 2003).

Figure 1.5: Modular domains of PDZ containing proteins. This figure is from a previous publication (Jelen, Oleksy et al. 2003).

PDZ containing proteins are integral components of cell signaling pathways. They cluster and properly localize ion channels and cell receptors directly impacting signaling.

Examples include Dlg1 and Erbin proteins which bind to the Kir2 potassium channel and

the ErbB-2 receptor respectively through their PDZ domains (Kaech, Whitfield et al.

1998; Borg, Marchetto et al. 2000; Leonoudakis, Conti et al. 2004). They also organize cell junctions and establish and maintain cell polarity, which allows for the proper

assembly of specific signaling complexes and efficient cell-cell communication. In the brain, cell communication is dependent on the maintenance of the presynaptic and postsynaptic neurons. The PDZ protein post-synaptic density 95 (PSD-95) is a major protein of the PSD, binding to neurotransmitter receptors such as NMDA and signaling

molecules such as nNOS through is PDZ domain (Kornau, Schenker et al. 1995;

Brenman, Chao et al. 1996). PSD-95 is also implicated to have a developmental role in

synapse formation, promoting the development of presynaptic terminals innervating

PSD-95 expressing cells and inducing a retrograde signal (El-Husseini, Schnell et al.

2000). Another way PDZ proteins impact cell signaling is by trafficking signaling molecules. The Cask, Mint1, and Veli PDZ complex functions in NMDA receptor

trafficking. Lin7 binds the NMDA subunit NR2B, while Mint1 interacts with the kinesin superfamily motor protein KIF17. Cask holds Lin7 and Mint1 together. Together these

proteins transport NMDA receptor containing vesicles along microtubules to the dendrite

(Setou, Nakagawa et al. 2000). It has more recently been shown that PDZ domains can

associate with phosphoinositides. Syntenin-1 and syntenin-2 bind PI(4,5)P2 through their

PDZ domains. The association of syntenin-1 and PI(4,5)P2 is required for receptor cargo

recycling (Zimmermann, Zhang et al. 2005), while syntenin-2 is necessary for nuclear

PI(4,5)P2 organization, which plays a role in cell proliferation and survival (Mortier,

Wuytens et al. 2005). Together, these reports show that PDZ containing proteins are

important molecules impinging on cell signaling in a variety of ways through their PDZ domains.

1.5 Summary

The mechanism by which E4-ORF1 activates the PI3K pathway remains uncertain. E4-

ORF1 from Ad 9, a related virus but from a different subgroup than Ad 2/5 which is used in these studies, induces Ras mediated PI3K activation through its interaction with Dlg1 and an unidentified phosphoprotein pp70 (Frese, Latorre et al. 2006). In contrast, we find that E4-ORF1 does not stimulate Ras-GTP levels nor does it activate its downstream effector Erk1/2. Ruling out known mechanisms utilized by other viruses and those found altered in cancer cells, we hypothesized that E4-ORF1 activates PI3K through a novel mechanism. Therefore, we have undertaken an unbiased biochemical approach to identify novel E4-ORF1 binding partners and determine their role in PI3K activation.

Using tandem affinity purification (TAP), we have identified a known PDZ protein complex with a novel role in PI3K signaling.

Chapter 2: Materials and Methods

2.1 Cell lines and culturing conditions

U2OS and HBL100 cell lines were cultured in DMEM with 10% fetal bovine serum

(FBS). U87, U251, and HEC-151 cell lines were cultured in Eagle’s MEM with 10%

FBS, 1mM sodium pyruvate (UCSF Cell Culture Facility), and 100μM non-essential amino acids (Gibco). Stable cell lines were made by transfecting U2OS cell using lipofectamine 2000 (invitrogen) with GST GFP, GST E4-ORF1, and GST E4-ORF1

PBM. N-TAP E4-ORF1 and E4-OR1 PBM cell lines were made by transfecting phoenix packaging cells to make retroviruses which were then used to infect U2OS cells. Stable lines were selected with 500μg/ml Geneticin (Gibco).

2.2 Plasmids

GST GFP, GST HRasV12, GST p110α, GST p110β, GST p110δ, GST p110γ, MYC

RRas, Myc RRasV38, and Flag GFP were previously described (Rodriguez-Viciana,

Sabatier et al. 2004). Flag p110α H1047K was a kind gift from Pablo Rodriguez.

PENTR3C Ad 2/5 E4-ORF1 and E4-ORF1 PBM (called ΔPDZ-E4-ORF1) (O'Shea,

Klupsch et al. 2005) were cloned into the DEST 27 GST (Invitrogen), PCAN Flag DEST

(Invitrogen), PCAN Myc DEST (Invitrogen), and FB neo N-TAP DEST (Rodriguez-

Viciana, Oses-Prieto et al. 2006) vectors using Gateway technology (Invitrogen).

2.3 Reagents

The following antibodies were used. GST (Z-5), GST (B-14), X11α/Mint1 (H-265), and

Dlg-1 (2D11) were from Santa Cruz Biotechnology. Phospho-Akt (Ser473) (193H12),

Phospho-p44/42 MAPK (E10)/P-Erk, p44/43 MAPK/Erk, PI3 Kinase P110α, IRS-1, and

Pten were from Cell Signaling. Cask MAb and Pan-Ras MAb were from BD

Transduction Laboratories. Velis-3 (Mals-3) and rabbit Cask/Lin-2 were from Zymed

Laboratories. Sap97/Dlg1 (ab3437) was from Abcam. Akt/PKB (SKB1) was from

Upstate. Flag (M2) was from Sigma. P85α was a kind gift from Pablo Rodriguez-

Viciana. Secondary antibodies used were Alexa Fluor 680 goat anti-rabbit IgG (H+L)

(Molecular Probes) and anti-mouse IgG (H+L) antibody IRDye 800CW (Rockland).

The following siRNA sequences were used. Non silencing control: Qiagen AllStars negative control. P110α: AAGGAGCCCAAGAATGCACAA,

AAGGCCGAAAGGGTGCTAAAG, AATAGGCAAGTCGAGGCAATG. P110β:

AAAGGGAGCGAGTGCCTTTTA, AACTGAATGCCGTGAAGTTAA,

AACACGAAGACTCTGTGATGT. P110δ: CCGGTCACGCATGAAGGCAAA.

P110γ: CACCTTTACTCTATAACTCAA. DLG1:

CCCAAGATGGAAGATTGCGGGTCAA, GGTCAAGAAGAATACGTCTTATCTT,

GACCAGTGATCATATTGGGACCTAT. MINT1:

CCCTGTGGAAGCGTCCACTAATAAA, GCGGAGAAATCTGGGAAGCTGAATA,

TAAGCAGGATCAAGATGGCCCAGAA. CASK:

GAGGACGTGTTGGAACACCTCATTT, CCTTCAGTGTTGTACGACGATGTAT,

GGCACCTGTTAAACTTGGAGGCTTT. VELI-3:

AGAAGAAATGGAGTCGCGCTTTGAA, GGAGAGAGATATTTGTAGAGCAATT,

GCCGCACAAGGAAAGGTTAAATTAG. The following RT-qPCR primers and probes were used. PIK3CA (P110α): forward- GCAATGTATGTCTATCCTCCAAATGTAG, reverse-CACAGTCATGGTTGATTTTCAGAG, probe-

TCTTCACCAGAATTGCCAAAC(G)CAC. PIK3CB (P110β): forward-

TGGCATTAAAAGGGAGCGAG, reverse-CCATGCCGTCGTAAAATCAGA, probe-

AGTTTGGCCGGTTCCGCCAGTG.

2.4 Transient transfections, cell lysis, and immunoblot anaylysis

Cells were seeded the day before and transfected with 1μg (12 well plate) or 6μg (10cm plate) of plasmid using 2.5μl or 15μl of lipofectamine 2000 (invitrogen) respectively. 1 day after transfection cells were serum starved and lysed in 1% NP40 buffer (1% NP40,

10mM Tris pH 7.5, 150mM NaCl, 25mM NaF, 1mM EDTA, 1mM EGTA, 1mM DTT,

1mM NaVO4, and complete mini protease inhibitor tablet-Roche) the following day.

Protein concentrations were determined using the Biorad DC protein assay and 10-40ug of protein was loaded onto 4-12% NuPage gels or 4-20% Tris Glycine Novex gels

(Invitrogen). Gels were transferred onto nitrocellulose membranes (Biorad) and then blocked in 5% milk in TNT buffer (50mM Tris pH 8.0, 150mM NaCl, and 0.1% tween

20). Primary antibodies in 5% BSA in TNT buffer were incubated overnight at 4 degrees

Celsius. Membranes were washed 3 times with TNT buffer. Secondary antibodies were incubated 1 hour in 5% milk in TNT. Membranes were washed three times with TNT buffer. Western blots were visualized and quantified using the Odyssey Infrared Imaging system (Li-Cor).

2.5 PI3K inhibitor assay

U2OS cells were tranfected with GST E4-ORF1, GST p110α, GST p110β, GST p110δ,

GST p110γ, and myc P110α H1047K. One day later cells were serum starved overnight and lysed the following day. One hour before lysis cells were treated with 20μM

LY294002, 0.5μM PIK-23, 2μM TGX-286, 2μM PIK-75, 0.5μM PIK-90, 1μM PIK-108,

3μM PI-103. The inhibitors were kind gifts from Kevan Shokat and previously described

(Knight, Gonzalez et al. 2006) .

2.6 GST pull downs and immunoprecipitations

Cells were lysed and protein concentrations were calculated as mentioned above. For

GST pull downs, samples of 400μg-1mg of protein were incubated with 10μl of packed glutathione sepharose 4B (Amersham) for 2 hours at 4 degrees Celsius. For immunoprecipitations, lysates were pre-cleared using 10μl of packed rec-Protein G-

Sepharose 4B (Invitrogen) for 20 minutes at 4 degrees Celsius. Samples of 400μg-1mg were incubated with 1-2μg of antibody and 10μl of packed rec-Protein G beads for 2 hours. Isotype controls were used. Samples were washed 3 times with lysis buffer before adding loading buffer and running on 4-12% Nupage gels for western analysis.

2.7 Raf and Ral GDS RBD pulldowns

For the Raf RBD, U2OS cells were transfected with either Flag GFP or Flag E4-ORF1. 1 day after transfection cells were serum starved overnight. One Flag GFP sample was treated with 100ng EGF for 5 minutes. Cells were lysed in TNM buffer (1% triton X-

100, 20mM Tris pH 7.5, 150mM NaCl, 5mM MgCl2, 1mM DTT, and complete mini protease inhibitor tablet-Roche) and GTP bound Ras was pulled down with the GST tagged RBD of Raf bound to glutathione sepharose beads as described previously (van

Triest, de Rooij et al. 2001).

2.8 Tandem affinity purification and mass spectrometry analysis

Figure 2: Tandem affinity purification (TAP) strategy.

An N-terminal TAP tag was used consisting of a calmodulin binding protein tag and a protein A tag. 20 x15cm dishes of both N-TAP E4-ORF1 and N-TAP E4-OR1 PBM stable U2OS cells were grown to confluency and then serum starved. Cells were lysed in

1% triton buffer (1% Triton X-100, 25mM Tris pH 7.5, 150mM NaCl, 1mM EDTA,

1mM EGTA, 20mM NaF, 1mM NaVO4, 1mM DTT, and complete mini protease inhibitor tablet-Roche). Pooled lysates were purified as in (Gavin, Bosche et al. 2002), concentrated by TCA precipitation, separated on a 4-12% NuPage gel, and stained with

SimplyBlue SafeStain (Invitrogen). Excised gel bands were digested with trypsin and analyzed by tandem mass spectrometry on a QSTAR XL instrument (ABI Sciex) as in:

Iacovidas et al, J. Virology, v81, n23, pp13209-13217. The mass spectrometry data files

were converted to peak lists by using the Mascot.dll script 1.6b16 (Matrix Science)

within the Analyst QS software (ABI Sciex). The peak lists were searched against the

SwissProt database (database version: 02/21/2006) using Protein Prospector 4.21.1.

Carbamidomethylation of cysteine was searched as a constant modification.

Additionally, up to two variable modifications per peptide were considered: acetylation

of the N-terminus of the protein, oxidation of methionine, and formation of pyroglutamate from glutamate at the peptide N-terminus. Peptide tolerance in MS and

MS/MS modes was 250 ppm and 300 ppm, respectively. Three missed cleavages were

allowed. Hits were considered significant when three or more peptide sequences with

Prospector scores above 20 matched a protein entry.

In the Tap experiment in the presence of a viral infection, excised gel bands were reduced with dithiothreitol, alkylated with iodoacetamide, and digested with sequencing grade modified trypsin (Promega) overnight at 37° C. Peptides were extracted from the gel bands with two aliquots of 5% formic acid, 50% acetonitrile solution. Extracts were evaporated to dryness and resuspended in 10 μl of 0.1% formic acid for mass spectrometry.

Digests were separated by nano-flow liquid chromatography using a 75-μm x 150-mm reverse phase C18 PepMap column (Dionex-LC-Packings) on an Agilent 1100 series

HPLC system. Mobile phase A was 0.1% formic acid in water, and mobile phase B was

0.1% formic acid in acetonitrile. A flow rate of 350 nl/min was used throughout the elution. After equilibration of the column in 5% solvent B, approximately half of each digest (5 µl) was injected; the organic content of the mobile phase was increased linearly

to 30% over 30 min and then to 50% in 1 min. The column eluate was coupled to a

micro-ionspray source attached to an LTQ-FT hybrid mass spectrometer (Thermo

Scientific). Peptides were analyzed in positive ion mode. MS spectra were acquired over

the mass range 300-2000 m/z in the ICR cell, with the resolving power set to 25,000. MS

acquisitions were followed by collision-induced dissociation (CID) experiments performed in the linear ion trap. For each MS spectrum, the most intense multiply- charged peak over a threshold of 400 counts was selected for generation of CID mass spectra. A dynamic exclusion window was applied that prevented the same m/z from being selected more than twice within 90 seconds after its first acquisition.

Peak lists were generated by using Mascot Distiller, version 2.0.0 (Matrix Science). The peak lists were searched against the SwissProt database (database version: 02/21/2006) using Protein Prospector 4.21.1. Carbamidomethylation of cysteine was searched as a constant modification. Additionally up to two variable modifications per peptide were considered: acetylation of the N-terminus of the protein, oxidation of methionine, and formation of pyroglutamate from glutamate at the peptide N-terminus. Peptide tolerance in MS and MS/MS modes was 20 ppm and 0.6 Da, respectively. Three missed cleavages were allowed. Protein hits were considered significant when two or more peptide sequences with Prospector scores above 20 matched a protein entry.

2.9 siRNA

Cells were transfected with 40nM of siRNA both 1 and 2 days after plating using

RNAiMax (Invitrogen). 3 days after plating, cells were serum starved overnight and lysed in 1% NP40 as mentioned above.

2.10 Real-time Q-PCR analysis

RNA was extracted using RNase Easy kit (Qiagen) and DNAse treated. RNA was reverse transcribe and quantitative PCR analysis was performed as previously described

(O'Shea, Johnson et al. 2004). Probes and primers are listed in reagents above.

2.11 Growth factor experiments

Cells were transfected with siRNAs and serum starved as described above. Cells were treated with 250nM insulin (UCSF Cell Culture Facility) or 50ng/ml of PDGFβ (Gibco) for 15 minutes or 50-100ng/ml EGF (Invitrogen) for 5 minutes. Cells were lysed and protein concentrations were measured as above before running on 4-12% NuPage gels for western analysis.

Chapter 3: E4-ORF1 is a potent activator of P110α

3.1 Objective

Like many viruses, adenovirus has developed the ability to deregulate the PI3K pathway.

E4-ORF1 is an activator of the pathway, as shown by both the production of PI(3,4,5)P3 and the activation of its downstream effector Akt (O'Shea, Klupsch et al. 2005). We tested the potency of this activation, reasoning that if E4-ORF1 was a strong activator of the PI3K pathway, then this mechanism could also be exploited in other biomedical settings such as cancer, inflammation, and diabetes.

The main goal of this project was to investigate how E4-ORF1 was activating the PI3K pathway. Previous studies show that E4-ORF1’s activity is dependent on the C-terminal

PBM (Frese, Lee et al. 2003; O'Shea, Klupsch et al. 2005). In addition, we show E4-

ORF1 is sensitive the general PI3K inhibitors wortmannin and LY294002.

Figure 3.1: E4-ORF1 activates the PI3K pathway and is sensitive to inhibitors. (A) HCT- 116 cells were transfected with the indicated plasmids. 24 hr post-transfection, the cells were labeled with 32P-orthophosphate and PtdIns levels were measured or Akt activity was measured in a kinase assay. E4-ORF1 stimulates PIP3 production and Akt activation. This figure is from a previous publication (O'Shea, Klupsch et al. 2005). (B) U2OS cells were transfected with E4- ORF1 and serum starved 1 day later. 2 days post-transfection, the cells were treated with 20μM LY294002 or wortmannin for 1 hr. Both PI3K inhibitors impede PI3K activation by E4-ORF1.

We first tested whether E4-ORF1 modulates particular PI3K isoforms. Because E4-

ORF1 produces PI(3,4,5)P3 and is sensitive to LY294002 and wortmannin, we focused

our attention on the class I isoforms, p110α, p110β, and p110δ and p110γ. We hypothesized this discovery might direct us towards a mechanism of PI3K activation.

For instance, activation through p110β only could indicate PTEN (Jia, Liu et al. 2008),

p110β and p110γ might suggest G protein coupled receptors (Maier, Babich et al. 1999),

and p110α and p110γ might direct us towards Ras (Rodriguez-Viciana, Sabatier et al.

2004).

3.2 Results

E4-ORF1 is a potent PI3K activator

To determine how strong of a PI3K activator E4-ORF1 is, we compared E4-ORF1 with

oncogenic HRas-V12 by measuring Akt activity. GST tagged GFP, Ad 2/5 E4-ORF1,

and HRas-V12 were transfected into U2OS cells, and p-Akt was measured at different

time points post transfection. E4-ORF1 clearly activates the pathway at a greater level

than oncogenic Ras, despite its expression being significantly less. This suggests that E4-

ORF1 is a highly potent activator of the PI3K pathway.

Figure 3.2: Timecourse comparing transfected E4-ORF1 and oncogenic Ras. U2OS cells were transfected with the indicated GST tagged plasmids under serum starved conditions. Cells were harvested at indicated times and measured for Akt and Erk activation by western blot. Although expressed at lower levels, E4-ORF1 stimulates higher P-Akt levels than HRas-V12.

E4-ORF1 activates p110α signaling

We first used isoform selective inhibitors to test whether E4-ORF1 activates specific

PI3Ks. U2OS cells were transfected with WT PI3K isoforms, p110α H1047K (an activating mutant), and E4-ORF1 and then treated with chemical PI3K inhibitors that have been previously described (Knight, Gonzalez et al. 2006). In addition to being

sensitive to LY294002, E4-ORF1’s activation of the PI3K pathway is suppressed by the

inhibitors PIK-75 and PIK-90. PIK-75 and PIK-90 also inhibit p110α, p110α H1047K, and p110γ. p110β and p110δ are sensitive to PIK-75 and PIK-90 but are also extremely sensitive to PIK-108 and PIK-23 respectively, which E4-ORF1 is not. Thus, E4-ORF1 appears to activate both PI3Kα and PI3Kγ signaling pathways, but mRNA analysis shows that U2OS cells lack p110γ suggesting E4-ORF1 is only activating p110α (data not shown).

Figure 3.3: The effects of isoform selective PI3K inhibitors on E4-ORF1’s activity. U2OS cells were transfected with E4-ORF1 and starved one day later. Two days post-transfection, the cells were treated with inhibitors for one hour. This was compared to U2OS cells transfected with WT p110α, p110β, p110δ, p110γ, and mutant p110α H1047K. Akt activity was measured by western blot and quantified. E4-ORF1 is sensitive to the same inhibitors as WT p110α and mutant p110α H1047K.

To confirm this, we conducted siRNA analysis. U2OS cells stably expressing GST E4-

ORF1 were transfected with WT PI3K siRNAs. All three p110α siRNAs suppress PI3K signaling by E4-ORF1. Signaling is also inhibited by one p110β siRNA but not the other

two despite having similar knockdown levels. This further supports E4-ORF1 activating

the PI3Kα pathway.

Figure 3.4: p110 siRNA anaylsis in E4-ORF1 expressing cells. Stable U2OS cells expressing E4-ORF1 were transfected with one or more of the indicated siRNAs and serum starved two days later. Three days post-transfection, cells were harvested for (A) p-Akt by western blot anaylsis or (B) RT-qPCR for measurement of mRNA levels. All three siRNAs against p110α abrogate PI3K activation by E4-ORF1.

3.3 Discussion

Our results show that E4-ORF1 is just as potent an activator of the PI3K pathway as

oncogenic Ras. Thus, the mechanism that E4-ORF1 utilizes would be an effective

method to deregulate the pathway in other disease states such as cancer, inflammation,

and diabetes. This makes E4-ORF1 a useful and important tool for uncovering this mechanism of PI3K activation.

We also found that E4-ORF1 modulates a particular class I PI3K enzyme. While we cannot rule out E4-ORF1’s activity on p110δ and p110γ due to the lack of expression in

our system, we did observe that E4-ORF1 preferentially activates p110α over p110β. Our inhibitor and siRNA studies showed that E4-ORF1 activation of the PI3K pathway is significantly less sensitive to the loss of p110β function despite having similar

expression levels. This specificity for p110α by E4-ORF1 indicates that p110α

inhibitors may be effective agents in down regulating signaling in cells which the PI3K

pathway is abrogated by the mechanism utilized by E4-ORF1.

We hypothesized that determining which PI3K enzymes E4-ORF1 activates might direct us toward a particular mechanism. The lack of p110γ expression and p110β activation

suggest that E4-ORF1 is probably not working through G protein coupled receptors

(GPCRs), as their Gβγ subunits directly activate p110β and p110γ (Maier, Babich et al.

1999; Guillermet-Guibert, Bjorklof et al. 2008). However, activation of p110α signaling

suggested several possible mechanisms. These include direct binding to PI3K, impinging

on insulin signaling, abrogating Pten function, and activating Ras. Thus we next tested

whether E4-ORF1 activity was through known mechanisms of PI3K activation.

Chapter 4: E4-ORF1 activates PI3K through an unknown mechanism

4.1 Objective

Activation of the PI3Kα pathway by E4-ORF1 did not pinpoint a particular mechanism

of activation, but it did narrow our search to several known mechanisms. One possibility

is the direct interaction with the enzyme itself. This is a common strategy used by

viruses to upregulate PI3K signaling. In fact, PI3K was first discovered as an activity associated with the polyoma middle T protein (Courtneidge and Heber 1987; Kaplan,

Whitman et al. 1987). Other examples include the influenza NS1 protein and the hepatitis C NS5A protein, which bind directly to the p85 subunit of PI3K (He, Nakao et al. 2002; Hale, Batty et al. 2008). These associations repress the negatively regulated

PI3K conformation allowing for membrane localization and activation. Viruses can also interact with the catalytic subunit of PI3K. The hepatitis B X protein (Hbx) binds to p110, which increases phosphorylation of p85 and PI3K activity (Lee, Kang-Park et al.

2001). Thus, we investigated whether adenovirus is another virus that associates with

PI3K.

We also tested insulin signaling. Insulin binds to its receptor tyrosine kinase (RTK) and causes the phosphorylation of the adapter protein IRS-1. This in turn recruits and activates the PI3K enzyme at the membrane. Like E4-ORF1, the Simian Virus 40 (SV40) large T antigen is an oncogene which transforms a variety of human and rodent cell lines.

This transforming ability is attributed to the inhibition of p53 and Rb family members, but it has also been reported that large T requires IRS-1 (D'Ambrosio, Keller et al. 1995).

Mutating IRS-1 residues required for PI3K binding ablates transformation, which can be restored with an activating PI3K mutant (DeAngelis, Chen et al. 2006). In addition, it has been shown in vivo that p110α rather than p110β is selectively recruited and

activated by IRS complexes, and in a number of tumor cell lines, p110α was the principal

IRS associated enzyme (Foukas, Claret et al. 2006). This preference for p110α signaling over p110β correlates with our data. Therefore we tested the effects of E4-ORF1 on insulin signaling.

Another mechanism of PI3K activation is the functional disruption of Pten, a lipid

phosphatase that negatively regulates the PI3K pathway by converting PI(3,4,5)P3 into

PI(4,5)P2. Disruption of PTEN by mutation or deletion is a common mechanism of upregulating PI3K signaling observed in a variety of cancers (Table 1). E4-ORF1 associates with the PDZ proteins Dlg1 and Magi-1, known Pten binding partners

(Kotelevets, van Hengel et al. 2005; Cotter, Ozcelik et al. 2010). Thus E4-ORF1 could

potentially sequester Dlg1 and Magi-1 away from Pten and abrogate its function. In

addition, expression of E4-ORF1 induces the production of both PI(3,4)P2 and

PI(3,4,5)P3 (Figure 3.1). A loss of Pten would result in the inability to reduce

PI(3,4,5)P3 to PI(4,5)P2, generating the increased levels of PI(3,4,5)P3. The elevation of

PI(3,4)P2 levels could be a consequence of the lipid phosphatases, SHIP-1 and SHIP-2, converting the elevated levels of PI(3,4,5)P3 to PI(3,4)P2. Thus, the increased level of both lipid products by E4-ORF1 expression could be the result of disrupting Pten function.

We also investigated whether E4-ORF1 activated the small GTPase Ras. Ras switches between a GTP and GDP bound state. Guanine nucleotide exchange factors (GEFs) induce the release of GDP from Ras allowing for GTP to bind, while GTPase-activating proteins (GAPs) accelerate the hydrolysis of GTP to GDP. Bound to GTP, Ras is active and binds to its effector proteins. The most notable effectors are Raf which activates the

MAPK pathway, p110α and p110γ which stimulate the PI3K pathway, and Ral-GDS

which activates the Ral-GEF pathway. Under normal conditions, growth factors such as

EGF, PDGF, and insulin activate Ras signaling, but in tumor cells, mutating Ras is a

common strategy used to upregulate both the PI3K and MAPK pathways. Ras can also

be activated during infection by certain viruses. The herpes simplex virus-2 protein

ICP10PK phosphorylates and inhibits Ras-GAP. It also binds the Grb/Sos complex facilitating the interaction of Ras and the GEF Sos (Smith, Nelson et al. 2000). The

Epstein-Barr virus protein LMP2A uses an alternative mechanism. It mimics an activated B cell receptor, resulting in the activation of Ras (Portis and Longnecker 2004).

Thus, it is possible that adenovirus could be another virus that activates Ras and in turn the PI3K pathway. Our results also indicate that E4-ORF1 activates p110α which is consistent with Ras activation, and as mentioned earlier, it has been reported that Ad 9

E4-ORF1 induces Ras mediated PI3K activation. Based upon these supporting data, we also investigated whether E4-ORF1 activates Ras.

4.2 Results

E4-ORF1 does not associate with PI3K

To determine whether E4-ORF1 interacts with the PI3K enzyme, U2OS cells were transfected with GST tagged GFP, p110α, p110β, and E4-ORF1. GST p110α, p110β, and endogenous p110α but not E4-ORF1 are present in endogenous p85 immune complexes, despite the high levels of PI3K activation by E4-ORF1. Similarly, GST pull downs show only transfected p110α and p110β associate with p85. GST E4-ORF1 also

fails to pull down endogenous p110α giving further evidence that E4-ORF1 does not bind the PI3K enzyme.

Figure 4.1: Pull down assays of E4-ORF1 and PI3K. U2OS cells were transfected with the indicated plasmids. (A) Lysates were blotted for PI3K activation. (B) On the left, expression of the GST tagged proteins (p110α and p110β are not visible) and endogenous p110α and p85 are shown. In the middle panel, all proteins except GFP and E4-ORF1 pulled down with endogenous p85. The right panel is a GST pull down. Only the transfected p110α and p110β associate with endogenous p85. *A residual band in the E4-ORF1 lane is from the GST P110 blot above and not from endogenous p110.

E4-ORF1 does not impinge on insulin signaling

To test whether E4-ORF1 was affecting insulin signaling, we investigated E4-ORF1’s ability to induce the recruitment of PI3K to IRS-1 complexes. In U2OS cells, we compared insulin treatment with E4-ORF1 expression. Both insulin and E4-ORF1 activated Akt compared to the untreated GFP control. However, when we

immunoprecipitate PI3K complexes through the p85 subunit, only insulin stimulated cells contain IRS-1/PI3K complexes, indicating E4-ORF1 is not perturbing insulin signaling.

Figure 4.2: The effects of E4-ORF1 on insulin signaling. U2OS cells were transfected with either GFP or E4-ORF1 and serum starved one day after transfection. Two days post transfection, one dish of GFP transfected cells was treated with 250nM insulin for 20 minutes before harvesting. The left panel shows the expression of the transfected plasmids and activation of the PI3K pathway as measured by Akt phosphorylation. The right panel is a p85 immunoprecipiation, which is blotted for Irs-1. Only insulin stimulated cells induce the association of Irs-1 to PI3K despite both insulin and E4-ORF1 activating the pathway.

E4-ORF1 does not disrupt Pten function

We hypothesized that if E4-ORF1 inactivates PTEN, then E4-ORF1 would not be able to further stimulate the PI3K pathway in PTEN mutant cells. To test this, we transfected into three PTEN null cell lines (HEC151, U87, and U251) Flag tagged GFP, E4-ORF1, and ΔPBM, the mutant E4-ORF1 highly defective for PI3K pathway activation (Figure

3.1). Despite having a higher basal level of PI3K activity than U2OS cells, WT E4-

ORF1 is able to further increase PI3K signaling in all three PTEN mutant cell lines.

Figure 4.3: E4-ORF1 expression in PTEN mutant cell lines. U2OS (WT PTEN) and three PTEN mutant cell lines were transfected with GFP, E4-ORF1, or the mutant E4-ORF1 ΔPBM. One day post-transfection, the cells were serum starved overnight before harvesting. In all cell lines, E4-ORF1 increased PI3K signaling as measured by p-Akt. Transfection efficiency is less in mutant cells, thus expression of E4-ORF1 and ΔPBM are difficult to observe.

We also investigated the association of Pten with the known E4-ORF1 binding partners

Magi-1 and Dlg1 in our experimental conditions. U2OS cells were transfected with

either GST GFP or E4-ORF1 and then Dlg1, Magi-1, and Pten immunoprecipitations

were performed. In each experiment, we fail to detect association of Pten with either

Magi-1 or Dlg1. This data in conjunction with the fact E4-ORF1 can stimulate the PI3K

pathway in absence of Pten function suggest that E4-ORF1’s activation of PI3K signaling

is Pten independent.

Figure 4.4: The association of Pten with Magi-1 and Dlg1. U2OS cells were transfected with either GFP or E4-ORF1 and serum starved one day later. Two days post transfection, cells were harvested. (A) Dlg1 was immunoprecipitated and blotted for Pten. (B) The left panel shows expression of the transfected plasmids. On the right, a Magi-1 immunoprecipitation was performed and blotted for Pten. (C) Pten was immunoprecipitated and blotted for Magi-1 and Dlg1. This experiment was also performed with a GFP sample treated with insulin to test for association in a growth factor stimulated condition. Pten does not bind to Magi-1 or Dlg1 in these experiments.

E4-ORF1 does not activate Ras

To test whether E4-ORF1 is able to activate Ras, we analyzed Ras-GTP levels and the activity of the downstream effector Erk1/2 in U2OS cells stimulated with EGF or transfected with E4-ORF1. Both EGF stimulation and E4-ORF1 expression upregulated the PI3K pathway, as shown by increased levels of p-Akt. However, Erk1/2 was only activated when stimulated by EGF. See also Figure 3.2. To assess Ras-GTP levels, we used the Ras binding domain (RBD) of C-Raf to pull down Ras-GTP. Again, only EGF

increased Ras-GTP levels. We conclude that E4-ORF1 induction of the PI3K pathway is

not due to Ras activation.

Figure 4.5: The effects of E4-ORF1 expression on the Ras/MAPK pathway. U2OS cells were transfected with GFP or E4-ORF1. One day post-transfection, the cells were serum starved overnight. Five minutes before harvest, cells were stimulated or not with EGF. In the left panel, the cells were harvested and measured for activation of the PI3K and MAPK pathway by p-Akt and p-Erk. E4-ORF1 only stimulates the PI3K pathway. In the right panel, Ras-GTP was pulled down using the Raf RBD bound to GST beads. E4-ORF1 did not increase Ras-GTP levels.

This contrasts with the previous report that Ad 9 E4-ORF1 activates PI3K via Ras. In

that study, E4-ORF1 did not activate Erk, which is consistent with our data. However,

upon treatment with the PI3K inhibitor LY294002, they observed phosphorylation of Erk

by E4-ORF1. They suggest a complex of E4-ORF1, Dlg1 and a protein known as

phosphoprotein pp70, activate Ras by an unknown mechanism (Frese, Latorre et al.

2006). Our results show Ad 2/5 E4-ORF1 does not increase Ras GTP levels, and thus

Ras is not activated by the presence of E4-ORF1 in our experiments.

Nevertheless, we conducted the experiment in the presence of LY294002 to test whether

we would observe the same increase in the RAS/MAPK pathway or whether the

difference was due to the cell lines or adenoviral E4-ORF1 proteins used. The

experiment was performed side by side with the experiment shown above but included

the addition of 20μM LY294002 one hour before harvesting. LY294002 completely

blocks PI3K signaling in EGF treated cells and mostly blocked in the presence of E4-

ORF1. Similar to the previous report, we detect activation of Erk with LY294002 and

E4-ORF1 expression. It is possible that Ras may also be activated in the presence of

LY294002 and E4-ORF1, as that lane is clearly under loaded. Because we know that E4-

ORF1 does not activate Ras in our experiments, we suspect treatment with LY294002 is activating a feedback loop, possibly at or above the level of Ras.

Figure 4.6: The effects of E4-ORF1 on the Ras/MAPK pathway in the presence or absence of LY294002. U2OS cells were transiently transfected with either GFP or E4-ORF1 and serum starved one day later. One hour before harvest, the cells were treated with or without 20μM LY294002. Five minutes before, the cells are stimulated or not with EGF. The left panel shows phosphorylation of Akt and Erk in harvested lysates. LY294002 inhibits activation of the PI3K pathway completely in EGF stimulated cells and greatly impedes activation in E4-ORF1 stimulated cells. The right panel shows the Ras-GTP levels in response to the various stimuli and inhibitor.

Other Ras family GTPases activate the PI3K pathway. In particular, the RRas family are potent activators of p110α and weak activators of Erk1/2 (Rodriguez-Viciana, Sabatier et al.

2004). We tested whether E4-ORF1 activated RRas. U2OS were transfected with Myc tagged E4-ORF1, WT RRas, RRas-V38 (an activating mutant), a CMV control, and one sample with a combination of E4-ORF1 and WT RRas. As expected, E4-ORF1 and

RRas-V38 activate the PI3K pathway but weakly activate the MAPK pathway. To determine the activation of RRas, we performed a Ral GDS RBD pull down and blotted for the transfected RRas to measure the RRas-GTP levels. A portion of the transfected

WT RRas is GTP bound, but a much greater level of the mutant is in the GTP bound form. The presence of E4-ORF1 does not increase WT RRas GTP levels, suggesting E4-

ORF1 is not activating the PI3K through RRas. We also tested the other two RRas family members, TC21 and MRas, which are also PI3K activators (data not shown).

Thus, it appears that E4-ORF1 is not activating Ras family members to induce PI3K signaling.

Figure 4.7: The effects of E4-ORF1 on R-Ras activation. U2OS cells were transfected with CMV, E4-ORF1, WT RRAS, E4-ORF1 + WT RRAS, or mutant RRAS-V38 and serum starved one day later. Two days post transfection, cells were lysed. The left panel shows the effects on the activation of the PI3K and MAPK pathway. On the left, a Ral GDS RBD was performed, showing the E4-ORF1 does not increase WT RRas-GTP.

4.3 Discussion

We tested whether E4-ORF1 activated the PI3K pathway by mechanisms that are used by

other viruses or are found in cancer cells and correlated with our previous data. We show

that E4-ORF1 does not activate the pathway via direct protein-protein interactions with the PI3K enzymes, impinging on insulin signaling, disruption of Pten function, or activation of the Ras family proteins. Our data challenges the previous report of E4-

ORF1 activating PI3K through Ras. We believe the use of LY294002 to uncover E4-

ORF1’s role in Ras activation results in a feedback loop that stimulates the Ras/MAPK pathway. These results suggest that E4-ORF1 may be utilizing a novel mechanism of activating the pathway, and determining this mechanism could give us new insight into the regulation of the PI3K pathway.

Chapter 5: Identifying E4-ORF1 binding partners:

The Dlg1-Cask-Mint1-Veli-3 complex

5.1 Objective

Having ruled out the best characterized and known mechanisms of PI3K activation, we

hypothesized that E4-ORF1 utilizes a novel mechanism. Other than activating PI3K

signaling, little is known about the function of E4-ORF1. In fact, an adenoviral mutant

unable to activate PI3K signaling is only marginally deficient in S-phase entry, late viral

protein production, and virus replication in cell culture (O'Shea, Klupsch et al. 2005), although its importance cannot be ruled out in an in vivo infection. Thus E4-ORF1’s role in adenoviral replication is also not understood. Our next research aim was to identify novel E4-ORF1 interacting proteins to generate candidate mechanisms of PI3K activation and perhaps viral functions.

5.2 Results

Generation of the NTAP tagged cell lines

To identify novel E4-ORF1 binding partners, we performed an unbiased biochemical analysis called tandem affinity purification (TAP). The TAP system we used was an N- terminal tag consisting of the calmodulin binding protein (CBP) and protein A. U2OS cells stably expressing NTAP E4-ORF1 and NTAP ΔPBM were generated by retroviral infection. We first verified the NTAP proteins were well expressed and functioned properly. As expected, stably expressed NTAP E4-ORF1 activated the PI3K pathway whereas NTAP ΔPBM did not.

Figure 5.1: NTAP E4-ORF1 and ΔPBM stably expressed in U2OS cells. Lysates from U2OS cells were compared to U2OS expressing NTAP E4-ORF1 or NTAP ΔPBM. The NTAP tag was visualized by IgG of both the p-Akt and Akt antibodies. Only NTAP E4-ORF1 stimulates phosphorylation of Akt.

We also constructed E4-ORF1 mutants lacking the other two protein domains that fail to

transform or have PI3K activity (Figure 1.4). However, these proteins were poorly expressed due to protein instability and could not be assessed for their PI3K activity (data

not shown).

Identifying cellular E4-ORF1binding partners in the absence of the virus

To identify E4-ORF1 binding partners, we used the NTAP E4-ORF1 and ΔPBM cell

lines. TAP pull downs were performed as described in the Materials and Methods

section, and run on a 4-20% SDS gradient gel. Comparable levels of E4-ORF1 and

ΔPBM were purified, suggesting the differentially bound proteins observed between the

WT and mutant E4-ORF1 are due to ability to bind the candidate proteins rather than the amount of sample loaded. The gel was then cut according to the visible bands and then analyzed by LC-MS/MS mass spectrometry.

NTAP E4-ORF1 ΔPBM

Figure 5.2: NTAP pull down of E4-ORF1 and ΔPBM. NTAP E4-ORF1 and ΔPBM complexes were purified in U2OS cells. NTAP P53 was used as a control (lane not shown). Samples were run on a 4-20% gradient gel, stained with Coomassie blue, and visualized using the Li-Cor imaging system.

Table 5.1: Differential cellular proteins bound to NTAP E4-ORF1 and ΔPBM

Avg. Band MW Protein (kd) 1-3 196 InaD-like protein (Inadl protein) (hINADL) (Pals1-associated tight junction protein) (Protein associated to tight junctions)(PATJ) 2 277 Tyrosine-protein phosphatase non-receptor type 13 (EC 3.1.3.48) (Protein-tyrosine phosphatase 1E) (PTP-E1) (hPTPE1) (PTP-BAS) (Protein-tyrosine phosphatase PTPL1) (Fas-associated protein-tyrosine phosphatase 1) (FAP-1) PTPN13 2-6, 8-9 165 Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1 (BAI1-associated protein 1) (BAP-1) (Membrane-associated guanylate kinase inverted 1) (MAGI-1) (Atrophin-1-interacting protein 3) (AIP3) 2-11, 13 105 Peripheral plasma membrane protein CASK (EC 2.7.1.-) (hCASK) (Calcium/calmodulin-dependent serine protein kinase) (Lin-2 homolog) 2-13 100 Disks large homolog 1 (Synapse-associated protein 97) (SAP-97) (hDlg) 3 142 Pleckstrin homology-like domain family B member 2 (Protein LL5-beta) (LL5B) 4 140 ATP-dependent RNA helicase A (EC 3.6.1.-) (Nuclear DNA helicase II) (NDH II) (DEAH box protein 9)(DDX9) 4 118 angiomotin 4 93 Amyloid beta A4 precursor protein-binding family A member 1 (APBA1) (Neuron- specific X11 protein) (Neuronal Munc18-1-interacting protein 1) (MINT1) (Adapter protein X11alpha)(X11α) 10 58 Beta-2-syntrophin (SNTB2) (59 kDa dystrophin-associated protein A1, basic component 2) (Syntrophin 3) (SNT3) (Syntrophin-like) (SNTL) 16 22 LIN-7 homolog C (LIN-7C) (Mammalian LIN-seven protein 3) (MALS-3) (Vertebrate LIN 7 homolog 3) (VELI-3 protein) 17 14 E4-ORF1 20 14 E4-ORF1 20 15 Galectin-1 (GAL-1)(Beta-galactoside-binding lectin L-14-I) (Lactose-binding lectin 1) (S-Lac lectin 1) (Galaptin) (14 kDa lectin) (HPL) (HBL) (Putative MAPK- activating protein MP12) 21 45 Squamous cell carcinoma antigen 1 (SCCA-1) (Protein T4-A) 21 28 14-3-3 protein sigma (Stratifin) (Epithelial cell marker protein 1) 21 15 Galectin-7 (GAL-7) (HKL-14) (PI7) (p53-induced protein 1) 21 13 Calgranulin B (Migration inhibitory factor-related protein 14) (MRP-14) (P14) (Leukocyte L1 complex heavy chain) (S100 calcium-binding protein A9) (Calprotectin L1H subunit) 21 11 S100 calcium-binding protein A7 (Psoriasin) 21 11 Calgranulin A (Migration inhibitory factor-related protein 8) (MRP-8) (Cystic fibrosis antigen) (CFAG) (P8) (Leukocyte L1 complex light chain) (S100 calcium- binding protein A8) (Calprotectin L1L subunit) (Urinary stone protein band A 24 95 Matrin-3 25 89 RelA-associated inhibitor (Inhibitor of ASPP protein) (Protein iASPP) (PPP1R13B- like protein) (NFkB-interacting protein 1) 26 65 Galectin-3 binding protein precursor (Lectin galactoside-binding soluble 3 binding protein) (Mac-2 binding protein) (Mac-2 BP) (MAC2BP) (Tumor-associated antigen 90K) 28 55 Ribosomal L1 domain-containing protein 1 (Cellular senescence-inhibited gene protein) (PBK1 protein) (CATX-11) 35 28 Hornerin 35 14 ΔPBM 38 14 ΔPBM Blue indicates proteins bound to E4-ORF1, and red indicates proteins bound to ΔPBM.

Cask, Mint1, and Veli-3 are novel E4-ORF1 binding partners

Our mass spectrometry analysis identified a number of proteins which were purified in the TAP experiment. E4-ORF1 did not pull down the PI3K enzymes, Ras, PTEN, or

IRS-1 which further supports our earlier experiments testing known mechanisms of PI3K

activation. We also did not observe other obvious components of the PI3K pathway

associating with E4-ORF1. However, we did find that a number of PDZ containing

proteins bound to the WT E4-ORF1 but not the mutant ΔPBM. To confirm these binding

partners, we generated U2OS cells lines stably expressing GST tagged GFP, E4-ORF1,

and ΔPBM. GST pull downs show that in addition to Magi-1 and Dlg1, reported E4-

ORF1 binding partners, only wild type E4-ORF1 associates with endogenous Cask,

Mint1, and Veli-3.

Figure 5.3: GST E4-ORF1 pulls down endogenous PDZ containing proteins. Stable GST GFP, E4-ORF1, and ΔPDZ U2OS cell lines were generated. The cells were plated. One day before harvest, they were serum starved. (A) Lysates were analyzed for PI3K pathway activation. (B) GST pull downs were performed and run on a gel to be immunoblotted for the endogenous PDZ containing proteins. Wild type E4-ORF1 binds Cask, Mint1, and Veli-3, novel partners, as well as the previously reported Magi-1 and Dlg1.

We also tested the PDZ proteins, syntrophin β2 and the protein tyrosine phosphatase

PTPN13, as well as 14-3-3σ, but could not confirm binding (data not shown).

E4-ORF1 binds to a complex of Cask, Mint1, and Veli-3 using Dlg1 as a bridge

PDZ containing proteins often form macromolecular complexes with other PDZ containing proteins. Cask, Mint1, and Veli-3 form evolutionary conserved tripartite complexes which bind to receptors and ion channels (Kaech, Whitfield et al. 1998;

Leonoudakis, Conti et al. 2004). Interestingly, the Cask-Mint1-Veli-3 complex

associates with Kir2 potassium channels using Dlg1 as a bridge. These potassium channels, like E4-ORF1, contain a C-terminal PBM which binds to the second PDZ domain of Dlg1 (Frese, Lee et al. 2003; Leonoudakis, Conti et al. 2004).

Figure 5.4: Dlg1 recruits Cask, Mint1, and Veli-3 to Kir2 potassium channels. The Kir2 channel subunit is bound by Dlg1 through Kir2’s C-terminal PDZ binding motif. This results in the recruitment of Cask, Mint1, and Veli-3 to the channel. PDZ, Postsynaptic-95/Dlg1/Zo-1 domain; SH3, Src homology 3 domain; GK, guanylate kinase-like domain; CaMK, calmodulin kinase II-like domain; L27, L27 domain. This figure was adapted from a previous publication (Leonoudakis, Conti et al. 2004).

Given these findings, we hypothesized that E4-ORF1 binds to the Cask-Mint1-Veli3 complex using Dlg1 as a bridge. To test this hypothesis, we compared the association of

E4-ORF1 with Cask, Mint1, and Veli-3 in the presence or absence of Dlg1. Knocking

down Dlg1 resulted in the loss of interaction with all three PDZ proteins. Likewise, pulling down the complex through Veli-3, results in the loss of Dlg1 and disassociation of Veli-3 with E4-ORF1. These results are consistent using different DLG1 siRNAs

(data not shown). Thus, E4-ORF1 forms complexes consisting of the four PDZ proteins, with Dlg1 serving as a bridge between E4-ORF1 and Cask, Mint1, and Veli-3.

Figure 5.5: Loss of Dlg1 decreases association of Cask, Mint1, and Veli-3 with E4-ORF1. GST E4-ORF1 cells were transfected with the DLG1 or control siRNA and serum starved two days later. Three days post-transfection, the cells were harvested. (A) The left panel shows the efficiency of the DLG1 knock down in the lysates. The right panel is a GST pull down showing the effects of DLG1 knock down on Cask, Mint1, and Veli-3 binding to E4-ORF1. Loss of Dlg1 clearly impedes the interaction. (B) The left panel shows efficiency of the DLG1 knock down. The right panel is a Veli-3 immunoprecipitation showing loss of Dlg1 results in Veli-3 no longer associating with E4-ORF1.

However, not all PDZ proteins associate with E4-ORF1 through Dlg1. Magi-1, which is not known to associate with the Cask-Mint1-Veli3 complex, is not affected by Dlg1 siRNA. This data is consistent with the report that E4-ORF1 homo-trimers bind to Dlg1 in soluble complexes, whereas E4-ORF1 monomers sequester Magi-1 within insoluble complexes (Chung, Weiss et al. 2008).

Figure 5.6: Loss of Dlg1 does not affect the association of Magi-1 with E4-ORF1. GST E4- ORF1 cells were transfected with MINT1, DLG1, or control siRNA and serum starved two days later. Three days post transfection, the cells were harvested. The left panel shows the efficiency of DLG1 knock down in the lysates. The right panel is a GST pull down showing the effects of DLG1 knock down on Magi-1 and Veli-3 binding to E4-ORF1. Unlike Veli-3, loss of Dlg1 does not disrupt the interaction of Magi-1 and E4-ORF1.

Identifying candidate E4-ORF1 binding partners in an adenoviral infection

To identify E4-ORF1 binding partners during an infection, we again used the NTAP E4-

ORF1 and ΔPBM cell lines and NTAP P53 as a control. Cells were infected with wild type adenovirus 36 hours before harvest and then subjected to TAP purification.

Figure 5.7: NTAP pull down of E4-ORF1 and ΔPBM in a wild type adenoviral infection. NTAP E4-ORF1 and ΔPBM complexes were purified in U2OS cells infected with wild type adenovirus for 36 hours. Samples were run on a 4-20% gradient gel, stained with Coomassie blue, and visualized with Li-Cor.

Table 5.2: Adenoviral proteins binding E4-ORF1 and ΔPBM in the TAP assay

Candidates adenoviral proteins associating with E4-ORF1 Late100k Late hexon (late protein 2) Peripentonal hexon-associated protein (Protein IIIA) Minor core protein (Protein V) (pV) Peripentonal hexon-associated protein (Protein IIIA) 33 kDa protein Hexon-associated protein precursor (Protein VIII) (pVIII) 22 kDa protein Minor capsid protein 6 precursor (Minor capsid protein VI) Protein VIII 33 kDa phosphoprotein Major core protein precursor (Protein VII) (pVII) DNA-binding protein Hexon-associated protein (Protein IX) (pIX) Early E2A DNA-binding protein* Fiber protein (pIV) Penton protein (Virion component III) (Penton base protein) (pIII)*

*All viral proteins associated with both E4-ORF1 and ΔPBM except early E2A DNA binding protein which bound to E4-ORF1 and penton which bound to ΔPBM.

Table 5.3: Cellular proteins bound to NTAP E4-ORF1 with/without adenovirus

E4-ORF1 partners in both Partners in uninfected Partners in infected PATJ/hINADL PTPN13 Utrophin MAGI-1 APBA1/MINT1 Plectin 1 DLG1/SAP97 LL5β MPP5 CASK GAL-1 E1B-AP5* GAL-7 SNTB2 Desmoplakin LIN7C/VELI-3 psoriasin Tropomysin (α-1,-3,-4, β) * MRP-14 CapZβ∗ MRP-8 ANT2, ANT3* SCCA-1 Emerin 14-3-3σ Mito phosph carrier protein (PTP)* angiomotin C1orf77* DDX LIN7A/VELI-1 HEP27* PP-1B* Prohibitin

*These binding partners were pulled down by both E4-ORF1 and ΔPBM.

None of the proteins that bound only to ΔPBM in the uninfected experiment were repeated in the viral infection experiment.

E4-ORF1binding partners in an adenoviral infection

Again, mass spectrometry analysis identified a number of cellular and viral proteins bound to E4-ORF1 during an adenoviral infection. We attempted to verify E4-ORF1’s interaction with several viral proteins using our GST tagged cell lines but were unable to confirm them. Transiently expressed late 100K did not bind to either GST E4-ORF1 or

ΔPBM (data not shown). We also tested whether hexon, penton, and fiber were pulled down with E4-ORF1 in our GST E4-ORF1 cell line infected with wild type adenovirus.

However, all three bound to the GFP control in addition to E4-ORF1 making the results inconclusive (data not shown). Further studies will need to be performed to identify viral proteins interacting with E4-ORF1. Additionally, the majority of the proteins were late viral proteins, a consequence of the 36 hour time point. To assess E4-ORF1’s role early in infection, an earlier time point needs to be used.

Several of the cellular proteins that were pulled down in this experiment are repeated from the previous TAP experiment, further confirming them as E4-ORF1 binding partners. Because more E4-ORF1 was purified in the infected cells, we cannot conclude that the cellular proteins identified only in the infected cells are infection specific.

However, it is likely E1B-AP5 (E1B associated protein 5) and C1orf77, which binds to

PRMT1 (a late 100K binding partner), are infected only associated E4-ORF1 proteins

(Iacovides, O'Shea et al. 2007; van Dijk, Gillemans et al. 2010). Again, future studies confirming these binding partners and assessing what E4-ORF1’s role in adenovirus infection will need to be performed.

Discussion

We used an unbiased biochemical approach to identify E4-ORF1 interacting proteins.

We suspected the purification of many PDZ containing proteins, binding indiscriminately

to the PBM of E4-ORF1, but our results were much more limited to particular proteins.

We confirmed the interaction of Dlg1 and Magi-1 with E4-ORF1 and did not observe

binding to Mupp1, a PDZ protein that interacts with Ad 9 but not Ad 2 or Ad 5 E4-ORF1

(Lee, Glaunsinger et al. 2000). More importantly, we show that Cask, Mint1, and Veli-3

are novel binding partners of E4-ORF1. Known to form a tripartite complex, these three proteins associate with E4-ORF1 using Dlg1 as a bridge, in a fashion similar to the complex’s association with Kir2 potassium channels.

More studies will need to be performed to verify the other E4-ORF1 interacting proteins in both uninfected and infected conditions. In addition, many ribosomal proteins are pulled down in TAP experiments, possibly masking important binding partners in the 40-

20 kD range. Thus further investigation will need to be done to address other novel E4-

ORF1 binding partners and functions.

Chapter 6: The effects of Dlg1, Cask, Mint1, and Veli-3 on PI3K

signaling

6.1 Objective

Munc-18-1-interacting protein (Mint1), calcium/calmodulin dependent serine kinase

(Cask), and vertebrate lin7-3 (Veli-3), are the vertebrate homologs of the C. elegans

proteins Lin-10, Lin-2, and Lin-7. Together these PDZ containing proteins form an

evolutionarily conserved tripartite complex that functions in receptor and ion channel

localization and vesicle trafficking (Butz, Okamoto et al. 1998; Kaech, Whitfield et al.

1998). In C. elegans, the Lin-10/Lin-2/Lin-7 complex localizes the Let-23 protein

(EGFR) to the basolateral membrane. This interaction occurs through the PDZ domain of

Lin-7/Veli binding to the C-terminal PBM of Let-23.

Figure 6.1: Localization of the Let-23 receptor in C. elegans by the Lin-2/Lin-10/Lin-7 complex. The PBM of Let-23 binds the PDZ domain of Lin-7. Lin-7 binds to the L27 domain of Lin-2 and the CAMK domain of Lin-2 interacts with Lin-10. Basolateral localization of the Let- 23 receptors allows for the interaction with the Lin-3 growth factor produced by the neighboring

anchor cell. This figure is taken from a previous publication (Caruana 2002).

Loss of any component of the complex results in apical localization and impaired signaling, resulting in a vulvaless phenotype, which is also observed when the Ras homolog Let-60 is deleted (Simske, Kaech et al. 1996).

In mammalian cells, there are four EGF receptors, with only Erb-B2 and Erb-B4 containing PBMs. One group reports that ectopically expressed Lin-7 binds all four ectopically expressed mammalian EGF receptors. Interaction occurs through a kinase interaction domain and the EGF receptors are basolaterally localized even when the PBM is absent or when Cask is deleted (Shelly, Mosesson et al. 2003; Lozovatsky,

Abayasekara et al. 2009). These reports suggest the Lin-10/Lin-2/Lin-7 complex’s role in EGF receptor signaling is not conserved. Nevertheless, localization and clustering of

EGF receptors is a possible mechanism of upregulating PI3K signaling. Thus, we were interested in determining whether Cask, Mint1, and Veli-3 had a role in PI3K signaling by E4-ORF1 and if it was through interaction with the EGF receptor.

Dlg1, also known as synapse associated protein 97 (Sap97), is a highly conserved

MAGUK PDZ family member that functions in epithelial cell polarity and adherens junction formation, membrane receptor trafficking from the ER in the brain, assembly of the actin cytoskeleton, and T cell activation (Woods and Bryant 1991; Wu, Reuver et al.

1998; Xavier, Brennan et al. 1998; Firestein and Rongo 2001). Recessive lethal mutations in drosophila cause neoplastic overgrowth in the imaginal discs, indicating

Dlg1’s role as a tumor suppressor (Woods and Bryant 1991). Dlg1 has also been reported to interact with components of the PI3K pathway. In epithelial cells, Laprese et al. show Dlg1 associates with the p85 subunit of PI3K at sites of cell contact in confluent cells (Laprise, Viel et al. 2004). More recently, it has been shown that in schwann cells

Dlg1 interacts with Pten, which leads to the down regulation of Akt activity. Our

previous results show that Dlg1 does not interact with Pten in our experiments, but E4-

ORF1 could be relocalizing or causing a conformational change in PI3K through Dlg1 to activate the pathway. Thus we tested whether Dlg1 was necessary for E4-ORF1 activation of the PI3K pathway and whether it was through Dlg1’s association with PI3K.

In addition to investigating the role of Dlg1, Cask, Mint1, and Veli-3 in PI3K signaling

by E4-ORF1, we tested their effects on signaling in the absence of E4-ORF1. Although

viral proteins have given great insight into the regulation of many cellular pathways, they

have also been known to redirect a cellular protein towards a function it does not usually

perform. An example is the HPV protein E6, which causes the cellular ubiquitin ligase

E6-AP to degrade p53. P53 is not a normal target of E6-AP (Scheffner, Huibregtse et al.

1993). Thus, if Dlg1, Cask, Mint1, and Veli-3 have a role in PI3K signaling even in the absence of E4-ORF1, then they would be novel components of this cellular pathway and

would further expand our knowledge of PI3K signaling.

6.2 Results

The effects of Dlg1, Cask, Mint1, and Veli-3 on PI3K activation by E4-ORF1

We assessed the role of the Dlg1-Cask-Mint1-Veli-3 complex in PI3K signaling by E4-

ORF1. These PDZ proteins are abundantly expressed and all but Mint1 have alternative

splice variants (McLaughlin, Hale et al. 2002) (www.uniprot.org/uniprot/O14936,

www.ebi.ac.uk/astd/geneview.html?acc=ENSG00000148943). Therefore, we determined

their role in PI3K signaling by conducting loss of function studies. Stable E4-ORF1

expressing cells were transfected with siRNAs to the PDZ proteins. Loss of Dlg1

expression clearly inhibits E4-ORF1’s activation of PI3K signaling. This finding is confirmed in Dlg1gt/gt (Dlg/β-geo fusion) MEFs, in which Ad 9 E4-ORF1 is expressed

(Frese, Latorre et al. 2006). Conversely, Mint1 siRNA significantly increases E4-ORF1 activity. Knockdowns of Cask and Veli-3 also stimulate PI3K activation by E4-ORF1 albeit to a lesser degree. This suggests that Dlg1 is necessary for E4-ORF1 ability to stimulate the pathway, while Cask, Mint1, and Veli-3 serve as inhibitors.

Figure 6.2: The effects of knocking down Dlg1, Cask, Mint1, and Veli-3 in the presence of E4-ORF1. GST E4-ORF1 expressing U2OS cells were transfected with siRNAs against the PDZ containing proteins and serum starved two days later. Three days post transfection, cells were harvested. The right panel shows the efficiency of the knock down. The left panel shows the effect on PI3K signaling as measured by Akt phosphorylation. Loss of Mint1, Cask, and Veli-3 further stimulate PI3K activity whereas Dlg1knock down decreases signaling.

Cask, Mint1, and Veli-3 do not impinge on PI3K signaling by E4-ORF1 through the EGF

receptor

We tested whether the Cask-Mint1-Veli-3 complex was interacting with the EGF

receptor in a similar fashion to the Lin-2/Lin-10/Lin-7 complex in C. elegans. Both

ErbB-2 and ErbB-4 have PBMs, however, in U2OS cells ErbB-4 is hypermethylated

(Sadikovic, Yoshimoto et al. 2008). Therefore, we investigated whether Lin-7c/Veli-3

associated with the ErbB-2 receptor in presence or absence of E4-ORF1 in U2OS cells.

Pulling down either ErbB-2 or Veli-3 failed to show the two interacting. This suggests

that the Cask-Mint1-Veli-3 complex is not impacting PI3K signaling through localization

of the EGFR.

Figure 6.3: Lack of association of Veli-3 with the ErbB-2 receptor. U2OS cells stably expressing GST GFP or E4-ORF1 were lysed and immunoprecipitated with either ErbB-2 or Veli-3. ErbB-2 does not bind Veli-3 nor does Veli-3 pull down ErbB-2. Veli-3 does immunoprecipitate more Dlg1 in the presence of E4-ORF1, which has been repeated in other experiments. However, Dlg1 does not pull down more Veli-3 in E4-ORF1 expressing cells. Therefore, E4-ORF1 causing formation or increased formation of the Dlg1-Cask-Mint1-Veli-3 complex cannot be concluded.

Dlg1 does not impinge on PI3K signaling by E4-ORF1 through interaction with PI3K

We next tested whether Dlg1 was associating with PI3K, as relocalization or allosteric

regulation of PI3K by Dlg1 is a possible mechanism by which E4-ORF1 may activate the

pathway. To address this question, GFP or E4-ORF1 was transfected into confluent

U2OS cells. Two GFP samples were treated with either EGF or insulin. When the p85

subunit was immunoprecipitated, association of IRS-1 occurs in the insulin stimulated

sample, but Dlg1 does not associate with p85 in any of the samples. This suggests that

the effect of Dlg1 on PI3K signaling is not through interaction with the PI3K enzyme

through p85. Our results are supported by the failure to detect PI3K associating with

either Dlg1 or E4-ORF1 in cells expressing Ad 9 E4-ORF1 (Frese, Latorre et al. 2006).

Figure 6.4: Lack of association of PI3K with Dlg1. U2OS cells were transfected with GST GFP or E4-ORF1 and serum starved one day later. Two days post transfection the confluent cells were treated with EGF, insulin, or untreated. The left panel shows activation of the PI3K pathway and expression of the GFP and E4-ORF1. The right panel is a p85 immunoprecipitation. In insulin treated cells, p85 interacts with IRS-1. However, p85 does not associate with Dlg1 under any conditions.

The effects of Dlg1, Cask, Mint1, and Veli-3 on PI3K activation by growth factors and

Pten

Our siRNA experiments show that all four PDZ proteins affect PI3K signaling by E4-

ORF1. This raises the question of whether they have a role in PI3K signaling in normal,

uninfected cells. To determine whether Cask, Mint1, Veli-3, and Dlg1 are involved in

PI3K signaling in the absence of E4-ORF1, we transfected siRNAs against the PDZ proteins into U2OS cells stimulated by growth factors. Similar to cells expressing E4-

ORF1, Dlg1 knockdown inhibits PI3K activation by EGF, insulin, and PDGF while

Mint1 siRNA results in further stimulation. Consistent with our E4-ORF1 experiments,

Cask and Veli-3 siRNA weakly stimulate activation in the presence of growth factors, with the exception of Cask in response to PDGF.

Figure 6.5: The effects of Dlg1, Cask, Mint1, and Veli-3 in the presence of growth factors. U2OS cells were serum starved one day after plating. Two days after plating, cells were treated with growth factors, harvested, and analyzed for Akt activation. EGF treatment was for 5 minutes, insulin for 15 minutes, and PDGF for 15 minutes. Loss of Mint1, Cask, and Veli-3 result in further growth signaling, with the exception of Cask in the presence of PDGF. On the other hand, Dlg1 siRNA decreases growth factor stimulation of PI3K.

The effects of Cask, Mint1, and Dlg1 siRNA are also observed in insulin treated HBL100

cells, which have no known PI3K pathway mutations.

Figure 6.6: The effects of knocking down Dlg1, Cask, Mint1, and Veli-3 in HBL100 cells treated with insulin. HBL100 cells were serum starved one day after plating. Two days after plating cells were treated with insulin for 15 minutes before harvesting. Similar to U2OS cells, Cask and Mint1 siRNA result is higher p-Akt levels, while Dlg1 siRNA decreases them.

However, when we tested the effects of knocking down PDZ proteins in U251 cells

(PTEN null), a slight inhibition of basal PI3K signaling by all the siRNAs is observed.

Thus, the effect on PI3K signaling observed by the loss of the PDZ proteins in E4-ORF1

expressing cells and growth factors is not observed when PTEN function is lost.

This suggests that the loss of PDZ proteins does not have the same consequence in all

situations of PI3K activation, and that the PDZ proteins may be acting above the level of

phospholipids.

Figure 6.7: The effects of knocking down Dlg1, Cask, Mint1, and Veli-3 in U251 cells. U251 cells were serum starved one day after plating. Two days after plating, cells were harvested. All the siRNAs inhibited PI3K signaling compared to the NS control.

6.3 Discussion

This data suggests Mint1, Cask, Veli-3, and Dlg1 have a novel role in PI3K signaling by

both E4-ORF1 and growth factors. Mint1, Cask, and Veli-3 serve as repressors whereas

Dlg1 is necessary for activation. Because these PDZ proteins interact with E4-ORF1 as a

complex, it raises the question of why the loss of Dlg1 differs from the other three PDZ proteins. We propose a model in which the Mint1-Cask-Veli-3 complex is a repressor inhibiting PI3K signaling above the level of phospholipids. The presence of E4-ORF1 results in E4-ORF1 binding and inhibiting the repressor complex through Dlg1, possibly by mis-localizing the Mint1-Cask-Veli-3 complex. Thus loss of any one of the repressor complex components results in further stimulation of PI3K signaling, whereas loss of

Dlg1 prevents E4-ORF1 from sequestering away the repressor complex and inhibiting

E4-ORF1 induction of PI3K signaling. In the presence of growth factors, we predict an

unknown cellular factor must be serving the role of E4-ORF1, inhibiting Mint1-Cask-

Veli-3 through Dlg1.

Figure 6.8: The model of PI3K activation by E4-ORF1 and growth factors. A repressor complex composed of Mint1, Cask, and Veli-3 prevents PI3K signaling. In the presence of E4- ORF1, binding of Dlg1 sequesters the repressor complex allowing for activation of the PI3K pathway above the level of phospholipids. In the presence of growth factors, a unknown cellular factor X also relieves the inhibitory effects of the repressor complex enabling activation of PI3K.

Chapter 7: Conclusions and Remarks

In this study, we used the early adenoviral protein E4-ORF1, an activator of the PI3K

pathway, to study this important signaling pathway. We found that E4-ORF1 activates

p110α and is more potent than oncogenic Ras. It has previously been reported that the

activation of PI3K by Ad 9 E4-ORF1 occurs through its interaction with Dlg1 and the

unidentified protein pp70 in a Ras dependent manner (Frese, Lee et al. 2003). However,

our studies indicate that E4-ORF1 does not activate Ras family proteins. We also found

that E4-ORF1 does not associate with the PI3K enzymes, impinge on insulin signaling, or

disrupt PTEN function. This led us to believe that E4-ORF1 was utilizing a novel

mechanism to upregulate the pathway.

We used tandem affinity purification (TAP) to identify novel E4-ORF1 binding partners

and tested whether they had a role in PI3K signaling. Mass spectrometry results showed

that E4-ORF1 did not pull down the PI3K enzymes, PTEN, Ras, or growth factor

receptors further confirming our earlier experiments testing known mechanisms of PI3K

activation. We also did not identify any proteins at the proper size that could be the

unknown protein pp70. E4-ORF1 did pull down a number of PDZ containing proteins,

and we identified a complex of PDZ proteins that associated with E4-ORF1. Through

Dlg1, E4-ORF1 associates with the novel binding partners Cask, Mint1, and Veli-3, thus

giving another example of the Dlg1-Cask-Mint1-Veli-3 complex in a biological setting.

siRNA studies revealed that Mint1, Cask, and Veli-3 are repressors of E4-ORF1 and growth factor PI3K signaling, while Dlg1 is an activator. The PDZ proteins appear to acting above the level of phospholipids, as these effects are not seen in PTEN null cells.

Cask, Mint1, and Veli-3 were originally identified as a complex that functions in properly localizing the C. elegans’ EGFR to the basolateral membrane (Kaech, Whitfield et al.

1998). Although the Cask-Mint1-Veli complex is not associating with the EGFR in our experimental conditions, we do find it interesting that with Dlg1, the complex affects growth factor signaling. Certainly further studies will need to be performed to tease out the precise mechanism and what cellular factor X might be, which could be a possible therapeutic target in cancers with aberrant PI3K signaling. Our findings indicate that targeting this hypothetical protein would hit p110α, the PI3K isoform which is most targeted in cancers, and would not affect normal signaling occurring through p110β.

Our studies emphasize the use of early adenoviral proteins as tools to study cellular pathways deregulated in cancer cells. Not only is E4-ORF1 a potent activator of the

PI3K pathway, but it also utilizes a novel mechanism. The E4-ORF1 interacting proteins not investigated in these studies, indicate that E4-ORF1, like many viral proteins, has other functions. Future investigation of these proteins could provide valuable information about other cellular pathways that may be deregulated in tumorigenesis as well as the function of E4-ORF1 in viral infection.

In conclusion, our studies show that Cask, Mint1, Veli-3, and Dlg1 form a novel complex involved in PI3K signaling in normal cells and in cells expressing the adenoviral protein

E4-ORF1. These effects are not mediated through the Cask-Mint1-Veli-3 complex’s association with EGFRs nor are they through Dlg1’s interaction with PI3K or Pten.

Thus, the role of Dlg1, Cask, Mint1, and Veli-3 represents a novel regulatory step in this critical signaling pathway.

References

(2008). "Comprehensive genomic characterization defines human glioblastoma genes and

core pathways." Nature 455(7216): 1061-1068.

Albino, A. P., D. M. Nanus, et al. (1989). "Analysis of ras oncogenes in malignant

melanoma and precursor lesions: correlation of point mutations with

differentiation phenotype." Oncogene 4(11): 1363-1374.

Anderson, K. E. and S. P. Jackson (2003). "Class I phosphoinositide 3-kinases." Int J

Biochem Cell Biol 35(7): 1028-1033.

Andersson, M., S. Paabo, et al. (1985). "Impaired intracellular transport of class I MHC

antigens as a possible means for adenoviruses to evade immune surveillance."

Cell 43(1): 215-222.

Bazan, V., V. Agnese, et al. (2005). "Specific TP53 and/or Ki-ras mutations as

independent predictors of clinical outcome in sporadic colorectal

adenocarcinomas: results of a 5-year Gruppo Oncologico dell'Italia Meridionale

(GOIM) prospective study." Ann Oncol 16 Suppl 4: iv50-55.

Bellacosa, A., D. de Feo, et al. (1995). "Molecular alterations of the AKT2 oncogene in

ovarian and breast carcinomas." Int J Cancer 64(4): 280-285.

Bhargava, R., W. L. Gerald, et al. (2005). "EGFR gene amplification in breast cancer:

correlation with epidermal growth factor receptor mRNA and protein expression

and HER-2 status and absence of EGFR-activating mutations." Mod Pathol 18(8):

1027-1033.

Borg, J. P., S. Marchetto, et al. (2000). "ERBIN: a basolateral PDZ protein that interacts

with the mammalian ERBB2/HER2 receptor." Nat Cell Biol 2(7): 407-414.

Bowen, D. T., M. E. Frew, et al. (2005). "RAS mutation in acute myeloid leukemia is

associated with distinct cytogenetic subgroups but does not influence outcome in

patients younger than 60 years." Blood 106(6): 2113-2119.

Brenman, J. E., D. S. Chao, et al. (1996). "Interaction of nitric oxide synthase with the

postsynaptic density protein PSD-95 and alpha1-syntrophin mediated by PDZ

domains." Cell 84(5): 757-767.

Brugge, J., M. C. Hung, et al. (2007). "A new mutational AKTivation in the PI3K

pathway." Cancer Cell 12(2): 104-107.

Butz, S., M. Okamoto, et al. (1998). "A tripartite protein complex with the potential to

couple synaptic vesicle exocytosis to cell adhesion in brain." Cell 94(6): 773-782.

Byun, D. S., K. Cho, et al. (2003). "Frequent monoallelic deletion of PTEN and its

reciprocal associatioin with PIK3CA amplification in gastric carcinoma." Int J

Cancer 104(3): 318-327.

Carpten, J. D., A. L. Faber, et al. (2007). "A transforming mutation in the pleckstrin

homology domain of AKT1 in cancer." Nature 448(7152): 439-444.

Caruana, G. (2002). "Genetic studies define MAGUK proteins as regulators of epithelial

cell polarity." The International journal of developmental biology 46(4): 511-518.

Cheng, J. Q., B. Ruggeri, et al. (1996). "Amplification of AKT2 in human pancreatic

cells and inhibition of AKT2 expression and tumorigenicity by antisense RNA."

Proc Natl Acad Sci U S A 93(8): 3636-3641.

Chung, S. H., R. S. Weiss, et al. (2008). "Functionally distinct monomers and trimers

produced by a viral oncoprotein." Oncogene 27(10): 1412-1420.

Cotter, L., M. Ozcelik, et al. (2010). "Dlg1-PTEN interaction regulates myelin thickness

to prevent damaging peripheral nerve overmyelination." Science 328(5984):

1415-1418.

Courtneidge, S. A. and A. Heber (1987). "An 81 kd protein complexed with middle T

antigen and pp60c-src: a possible phosphatidylinositol kinase." Cell 50(7): 1031-

1037.

D'Ambrosio, C., S. R. Keller, et al. (1995). "Transforming potential of the insulin

receptor substrate 1." Cell Growth Differ 6(5): 557-562.

Davies, M. A., K. Stemke-Hale, et al. (2008). "A novel AKT3 mutation in melanoma

tumours and cell lines." Br J Cancer 99(8): 1265-1268.

DeAngelis, T., J. Chen, et al. (2006). "Transformation by the simian virus 40 T antigen is

regulated by IGF-I receptor and IRS-1 signaling." Oncogene 25(1): 32-42.

Domin, J., L. Harper, et al. (2005). "The class II phosphoinositide 3-kinase PI3K-C2beta

regulates cell migration by a PtdIns3P dependent mechanism." J Cell Physiol

205(3): 452-462.

Domin, J., F. Pages, et al. (1997). "Cloning of a human phosphoinositide 3-kinase with a

C2 domain that displays reduced sensitivity to the inhibitor wortmannin."

Biochem J 326 ( Pt 1): 139-147.

Dong, H., L. Luo, et al. (2010). "Integrated analysis of mutations, miRNA and mRNA

expression in glioblastoma." BMC Syst Biol 4(1): 163.

Eberhard, D. A., B. E. Johnson, et al. (2005). "Mutations in the epidermal growth factor

receptor and in KRAS are predictive and prognostic indicators in patients with

non-small-cell lung cancer treated with chemotherapy alone and in combination

with erlotinib." J Clin Oncol 23(25): 5900-5909.

El-Husseini, A. E., E. Schnell, et al. (2000). "PSD-95 involvement in maturation of

excitatory synapses." Science 290(5495): 1364-1368.

Engelman, J. A. (2009). "Targeting PI3K signalling in cancer: opportunities, challenges

and limitations." Nat Rev Cancer 9(8): 550-562.

Falasca, M., W. E. Hughes, et al. (2007). "The role of phosphoinositide 3-kinase C2alpha

in insulin signaling." J Biol Chem 282(38): 28226-28236.

Farrow, S. N., J. H. White, et al. (1995). "Cloning of a bcl-2 homologue by interaction

with adenovirus E1B 19K." Nature 374(6524): 731-733.

Fields, B. N., D. M. Knipe, et al. (2007). Fields virology. Philadelphia, Wolters Kluwer

Health/Lippincott Williams & Wilkins.

Firestein, B. L. and C. Rongo (2001). "DLG-1 is a MAGUK similar to SAP97 and is

required for adherens junction formation." Mol Biol Cell 12(11): 3465-3475.

Foukas, L. C., M. Claret, et al. (2006). "Critical role for the p110alpha phosphoinositide-

3-OH kinase in growth and metabolic regulation." Nature 441(7091): 366-370.

Frese, K. K., I. J. Latorre, et al. (2006). "Oncogenic function for the Dlg1 mammalian

homolog of the Drosophila discs-large tumor suppressor." EMBO J 25(6): 1406-

1417.

Frese, K. K., S. S. Lee, et al. (2003). "Selective PDZ protein-dependent stimulation of

phosphatidylinositol 3-kinase by the adenovirus E4-ORF1 oncoprotein."

Oncogene 22(5): 710-721.

Gavin, A. C., M. Bosche, et al. (2002). "Functional organization of the yeast proteome by

systematic analysis of protein complexes." Nature 415(6868): 141-147.

Gewinner, C., Z. C. Wang, et al. (2009). "Evidence that inositol polyphosphate 4-

phosphatase type II is a tumor suppressor that inhibits PI3K signaling." Cancer

Cell 16(2): 115-125.

Glaunsinger, B. A., S. S. Lee, et al. (2000). "Interactions of the PDZ-protein MAGI-1

with adenovirus E4-ORF1 and high-risk papillomavirus E6 oncoproteins."

Oncogene 19(46): 5270-5280.

Glaunsinger, B. A., R. S. Weiss, et al. (2001). "Link of the unique oncogenic properties

of adenovirus type 9 E4-ORF1 to a select interaction with the candidate tumor

suppressor protein ZO-2." EMBO J 20(20): 5578-5586.

Guillermet-Guibert, J., K. Bjorklof, et al. (2008). "The p110beta isoform of

phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and

is functionally redundant with p110gamma." Proc Natl Acad Sci U S A 105(24):

8292-8297.

Hale, B. G., I. H. Batty, et al. (2008). "Binding of influenza A virus NS1 protein to the

inter-SH2 domain of p85 suggests a novel mechanism for phosphoinositide 3-

kinase activation." J Biol Chem 283(3): 1372-1380.

Han, J., P. Sabbatini, et al. (1996). "The E1B 19K protein blocks apoptosis by interacting

with and inhibiting the p53-inducible and death-promoting Bax protein." Genes

Dev 10(4): 461-477.

He, Y., H. Nakao, et al. (2002). "Subversion of cell signaling pathways by hepatitis C

virus nonstructural 5A protein via interaction with Grb2 and P85

phosphatidylinositol 3-kinase." J Virol 76(18): 9207-9217.

Herman, P. K. and S. D. Emr (1990). "Characterization of VPS34, a gene required for

vacuolar protein sorting and vacuole segregation in Saccharomyces cerevisiae."

Mol Cell Biol 10(12): 6742-6754.

Iacovides, D. C., C. C. O'Shea, et al. (2007). "Critical role for arginine methylation in

adenovirus-infected cells." J Virol 81(23): 13209-13217.

Jaiswal, B. S., V. Janakiraman, et al. (2009). "Somatic mutations in p85alpha promote

tumorigenesis through class IA PI3K activation." Cancer Cell 16(6): 463-474.

Javier, R. T. (1994). "Adenovirus type 9 E4 open reading frame 1 encodes a transforming

protein required for the production of mammary tumors in rats." J Virol 68(6):

3917-3924.

Jelen, F., A. Oleksy, et al. (2003). "PDZ domains - common players in the cell signaling."

Acta Biochim Pol 50(4): 985-1017.

Jia, S., Z. Liu, et al. (2008). "Essential roles of PI(3)K-p110beta in cell growth,

metabolism and tumorigenesis." Nature 454(7205): 776-779.

Kaech, S. M., C. W. Whitfield, et al. (1998). "The LIN-2/LIN-7/LIN-10 complex

mediates basolateral membrane localization of the C. elegans EGF receptor LET-

23 in vulval epithelial cells." Cell 94(6): 761-771.

Kaplan, D. R., M. Whitman, et al. (1987). "Common elements in growth factor

stimulation and oncogenic transformation: 85 kd phosphoprotein and

phosphatidylinositol kinase activity." Cell 50(7): 1021-1029.

Kim, M. S., E. G. Jeong, et al. (2008). "Mutational analysis of oncogenic AKT E17K

mutation in common solid cancers and acute leukaemias." Br J Cancer 98(9):

1533-1535.

Knight, Z. A., B. Gonzalez, et al. (2006). "A pharmacological map of the PI3-K family

defines a role for p110alpha in insulin signaling." Cell 125(4): 733-747.

Kodaki, T., R. Woscholski, et al. (1994). "The activation of phosphatidylinositol 3-kinase

by Ras." Curr Biol 4(9): 798-806.

Kornau, H. C., L. T. Schenker, et al. (1995). "Domain interaction between NMDA

receptor subunits and the postsynaptic density protein PSD-95." Science

269(5231): 1737-1740.

Kotelevets, L., J. van Hengel, et al. (2005). "Implication of the MAGI-1b/PTEN

signalosome in stabilization of adherens junctions and suppression of

invasiveness." FASEB J 19(1): 115-117.

Laprise, P., A. Viel, et al. (2004). "Human homolog of disc-large is required for adherens

junction assembly and differentiation of human intestinal epithelial cells." The

Journal of biological chemistry 279(11): 10157-10166.

Lee, S. S., B. Glaunsinger, et al. (2000). "Multi-PDZ domain protein MUPP1 is a cellular

target for both adenovirus E4-ORF1 and high-risk papillomavirus type 18 E6

oncoproteins." Journal of virology 74(20): 9680-9693.

Lee, S. S., B. Glaunsinger, et al. (2000). "Multi-PDZ domain protein MUPP1 is a cellular

target for both adenovirus E4-ORF1 and high-risk papillomavirus type 18 E6

oncoproteins." J Virol 74(20): 9680-9693.

Lee, S. S., R. S. Weiss, et al. (1997). "Binding of human virus oncoproteins to

hDlg/SAP97, a mammalian homolog of the Drosophila discs large tumor

suppressor protein." Proc Natl Acad Sci U S A 94(13): 6670-6675.

Lee, Y. I., S. Kang-Park, et al. (2001). "The hepatitis B virus-X protein activates a

phosphatidylinositol 3-kinase-dependent survival signaling cascade." J Biol Chem

276(20): 16969-16977.

Leonoudakis, D., L. R. Conti, et al. (2004). "A multiprotein trafficking complex

composed of SAP97, CASK, Veli, and Mint1 is associated with inward rectifier

Kir2 potassium channels." J Biol Chem 279(18): 19051-19063.

Li, D., P. F. Firozi, et al. (2002). "DNA adducts, genetic polymorphisms, and K-ras

mutation in human pancreatic cancer." Mutat Res 513(1-2): 37-48.

Loh, M. L., M. G. Reynolds, et al. (2004). "PTPN11 mutations in pediatric patients with

acute myeloid leukemia: results from the Children's Cancer Group." Leukemia

18(11): 1831-1834.

Lozovatsky, L., N. Abayasekara, et al. (2009). "CASK deletion in intestinal epithelia

causes mislocalization of LIN7C and the DLG1/Scrib polarity complex without

affecting cell polarity." Molecular biology of the cell 20(21): 4489-4499.

Ma, Y. Y., S. J. Wei, et al. (2000). "PIK3CA as an oncogene in cervical cancer."

Oncogene 19(23): 2739-2744.

Maier, U., A. Babich, et al. (1999). "Roles of non-catalytic subunits in gbetagamma-

induced activation of class I phosphoinositide 3-kinase isoforms beta and

gamma." J Biol Chem 274(41): 29311-29317.

Malanga, D., M. Scrima, et al. (2008). "Activating E17K mutation in the gene encoding

the protein kinase AKT1 in a subset of squamous cell carcinoma of the lung." Cell

Cycle 7(5): 665-669.

Massion, P. P., W. L. Kuo, et al. (2002). "Genomic copy number analysis of non-small

cell lung cancer using array comparative genomic hybridization: implications of

the phosphatidylinositol 3-kinase pathway." Cancer Res 62(13): 3636-3640.

Mayr, D., V. Kanitz, et al. (2006). "HER-2/neu gene amplification in ovarian tumours: a

comprehensive immunohistochemical and FISH analysis on tissue microarrays."

Histopathology 48(2): 149-156.

McLaughlin, M., R. Hale, et al. (2002). "The distribution and function of alternatively

spliced insertions in hDlg." J Biol Chem 277(8): 6406-6412.

McNees, A. L., C. T. Garnett, et al. (2002). "The adenovirus E3 RID complex protects

some cultured human T and B lymphocytes from Fas-induced apoptosis." J Virol

76(19): 9716-9723.

Mortier, E., G. Wuytens, et al. (2005). "Nuclear speckles and nucleoli targeting by PIP2-

PDZ domain interactions." EMBO J 24(14): 2556-2565.

Neill, S. D. and J. R. Nevins (1991). "Genetic analysis of the adenovirus E4 6/7 trans

activator: interaction with E2F and induction of a stable DNA-protein complex

are critical for activity." J Virol 65(10): 5364-5373.

O'Shea, C., K. Klupsch, et al. (2005). "Adenoviral proteins mimic nutrient/growth signals

to activate the mTOR pathway for viral replication." EMBO J 24(6): 1211-1221.

O'Shea, C. C., L. Johnson, et al. (2004). "Late viral RNA export, rather than p53

inactivation, determines ONYX-015 tumor selectivity." Cancer Cell 6(6): 611-

623.

Parsons, D. W., T. L. Wang, et al. (2005). "Colorectal cancer: mutations in a signalling

pathway." Nature 436(7052): 792.

Pedrero, J. M., D. G. Carracedo, et al. (2005). "Frequent genetic and biochemical

alterations of the PI 3-K/AKT/PTEN pathway in head and neck squamous cell

carcinoma." Int J Cancer 114(2): 242-248.

Philp, A. J., I. G. Campbell, et al. (2001). "The phosphatidylinositol 3'-kinase p85alpha

gene is an oncogene in human ovarian and colon tumors." Cancer Res 61(20):

7426-7429.

Pollard, C., S. C. Smith, et al. (2010). "Molecular genesis of non-muscle-invasive

urothelial carcinoma (NMIUC)." Expert Rev Mol Med 12: e10.

Portis, T. and R. Longnecker (2004). "Epstein-Barr virus (EBV) LMP2A mediates B-

lymphocyte survival through constitutive activation of the Ras/PI3K/Akt

pathway." Oncogene 23(53): 8619-8628.

Prior, I. A. and M. J. Clague (1999). "Localization of a class II phosphatidylinositol 3-

kinase, PI3KC2alpha, to clathrin-coated vesicles." Mol Cell Biol Res Commun

1(2): 162-166.

Querido, E., R. C. Marcellus, et al. (1997). "Regulation of p53 levels by the E1B 55-

kilodalton protein and E4orf6 in adenovirus-infected cells." J Virol 71(5): 3788-

3798.

Querido, E., M. R. Morrison, et al. (2001). "Identification of three functions of the

adenovirus e4orf6 protein that mediate p53 degradation by the E4orf6-E1B55K

complex." J Virol 75(2): 699-709.

Rodriguez-Viciana, P., J. Oses-Prieto, et al. (2006). "A phosphatase holoenzyme

comprised of Shoc2/Sur8 and the catalytic subunit of PP1 functions as an M-Ras

effector to modulate Raf activity." Mol Cell 22(2): 217-230.

Rodriguez-Viciana, P., C. Sabatier, et al. (2004). "Signaling specificity by Ras family

GTPases is determined by the full spectrum of effectors they regulate." Mol Cell

Biol 24(11): 4943-4954.

Rubio, I., P. Rodriguez-Viciana, et al. (1997). "Interaction of Ras with phosphoinositide

3-kinase gamma." Biochem J 326 ( Pt 3): 891-895.

Ruggeri, B. A., L. Huang, et al. (1998). "Amplification and overexpression of the AKT2

oncogene in a subset of human pancreatic ductal adenocarcinomas." Mol

Carcinog 21(2): 81-86.

Sadikovic, B., M. Yoshimoto, et al. (2008). "In vitro analysis of integrated global high-

resolution DNA methylation profiling with genomic imbalance and gene

expression in osteosarcoma." PloS one 3(7): e2834.

Sarbassov, D. D., D. A. Guertin, et al. (2005). "Phosphorylation and regulation of

Akt/PKB by the rictor-mTOR complex." Science 307(5712): 1098-1101.

Scheffner, M., J. M. Huibregtse, et al. (1993). "The HPV-16 E6 and E6-AP complex

functions as a ubiquitin-protein ligase in the ubiquitination of p53." Cell 75(3):

495-505.

Setou, M., T. Nakagawa, et al. (2000). "Kinesin superfamily motor protein KIF17 and

mLin-10 in NMDA receptor-containing vesicle transport." Science 288(5472):

1796-1802.

Shelly, M., Y. Mosesson, et al. (2003). "Polar expression of ErbB-2/HER2 in epithelia.

Bimodal regulation by Lin-7." Developmental cell 5(3): 475-486.

Silva, F. P., I. Almeida, et al. (2009). "Genome wide molecular analysis of minimally

differentiated acute myeloid leukemia." Haematologica 94(11): 1546-1554.

Simske, J. S., S. M. Kaech, et al. (1996). "LET-23 receptor localization by the cell

junction protein LIN-7 during C. elegans vulval induction." Cell 85(2): 195-204.

Smith, C. C., J. Nelson, et al. (2000). "Ras-GAP binding and phosphorylation by herpes

simplex virus type 2 RR1 PK (ICP10) and activation of the Ras/MEK/MAPK

mitogenic pathway are required for timely onset of virus growth." J Virol 74(22):

10417-10429.

Sok, J. C., F. M. Coppelli, et al. (2006). "Mutant epidermal growth factor receptor

(EGFRvIII) contributes to head and neck cancer growth and resistance to EGFR

targeting." Clin Cancer Res 12(17): 5064-5073.

Soria, C., F. E. Estermann, et al. (2010). "Heterochromatin silencing of p53 target genes

by a small viral protein." Nature 466(7310): 1076-1081.

Staal, S. P. (1987). "Molecular cloning of the akt oncogene and its human homologues

AKT1 and AKT2: amplification of AKT1 in a primary human gastric

adenocarcinoma." Proc Natl Acad Sci U S A 84(14): 5034-5037.

Staudinger, J., J. Zhou, et al. (1995). "PICK1: a perinuclear binding protein and substrate

for protein kinase C isolated by the yeast two-hybrid system." J Cell Biol 128(3):

263-271.

Stephens, L., K. Anderson, et al. (1998). "Protein kinase B kinases that mediate

phosphatidylinositol 3,4,5-trisphosphate-dependent activation of protein kinase

B." Science 279(5351): 710-714.

Tartaglia, M., E. L. Mehler, et al. (2001). "Mutations in PTPN11, encoding the protein

tyrosine phosphatase SHP-2, cause Noonan syndrome." Nat Genet 29(4): 465-

468.

Tartaglia, M., C. M. Niemeyer, et al. (2003). "Somatic mutations in PTPN11 in juvenile

myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid

leukemia." Nat Genet 34(2): 148-150.

Tauber, B. and T. Dobner (2001). "Adenovirus early E4 genes in viral oncogenesis."

Oncogene 20(54): 7847-7854.

Tollefson, A. E., K. Toth, et al. (2001). "Inhibition of TRAIL-induced apoptosis and

forced internalization of TRAIL receptor 1 by adenovirus proteins." J Virol

75(19): 8875-8887. van Dijk, T. B., N. Gillemans, et al. (2010). "Friend of Prmt1, a novel chromatin target of

protein arginine methyltransferases." Mol Cell Biol 30(1): 260-272.

van Triest, M., J. de Rooij, et al. (2001). "Measurement of GTP-bound Ras-like GTPases

by activation-specific probes." Methods Enzymol 333: 343-348.

Vanhaesebroeck, B., J. Guillermet-Guibert, et al. (2010). "The emerging mechanisms of

isoform-specific PI3K signalling." Nat Rev Mol Cell Biol 11(5): 329-341.

Volante, M., I. Rapa, et al. (2009). "RAS mutations are the predominant molecular

alteration in poorly differentiated thyroid carcinomas and bear prognostic

impact." J Clin Endocrinol Metab 94(12): 4735-4741.

Weiss, R. S., S. S. Lee, et al. (1997). "Human adenovirus early region 4 open reading

frame 1 genes encode growth-transforming proteins that may be distantly related

to dUTP pyrophosphatase enzymes." J Virol 71(3): 1857-1870.

Weiss, R. S., M. J. McArthur, et al. (1996). "Human adenovirus type 9 E4 open reading

frame 1 encodes a cytoplasmic transforming protein capable of increasing the

oncogenicity of CREF cells." J Virol 70(2): 862-872.

Wheeler, M. and J. Domin (2006). "The N-terminus of phosphoinositide 3-kinase-C2beta

regulates lipid kinase activity and binding to clathrin." J Cell Physiol 206(3): 586-

593.

Wood, K. J. and J. Fry (1999). "Gene therapy: potential applications in clinical

transplantation." Expert Rev Mol Med 1999: 1-20.

Woods, D. F. and P. J. Bryant (1991). "The discs-large tumor suppressor gene of

Drosophila encodes a guanylate kinase homolog localized at septate junctions."

Cell 66(3): 451-464.

Wu, H., S. M. Reuver, et al. (1998). "Subcellular targeting and cytoskeletal attachment of

SAP97 to the epithelial lateral membrane." J Cell Sci 111 ( Pt 16): 2365-2376.

Xavier, R., T. Brennan, et al. (1998). "Membrane compartmentation is required for

efficient T cell activation." Immunity 8(6): 723-732.

Zimmermann, P., Z. Zhang, et al. (2005). "Syndecan recycling [corrected] is controlled

by syntenin-PIP2 interaction and Arf6." Dev Cell 9(3): 377-388.