UNIVERSITY OF CALGARY
Neuropathogenic effects of Syncytin-1 in Multiple Sclerosis
by
Joseph Mathew Antony
A THESIS
SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL
FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF
PHILOSOPHY
DEPARTMENT OF MEDICAL SCIENCE
CALGARY, ALBERTA JUNE, 2006
© Joseph Mathew Antony 2006
iii
ABSTRACT
Human endogenous retroviruses (HERVs) constitute 8% of the human genome and have been implicated in both health and disease. Increased HERV gene activity occurs in activated glia although the consequences of HERV expression in the nervous system remain uncertain. Relative quantification and quantitative PCR analysis of HERV envelopes (env) revealed selectively increased abundance of HERV-W-7q encoded glycoprotein, Syncytin-1 in brains but not in blood-derived leukocytes from patients with
Multiple Sclerosis (MS) relative to non-MS patients. Syncytin-1 expression in astrocytes induced the release of redox reactants, which were cytotoxic to oligodendrocytes.
Increase in Syncytin-1 expression in astrocytes in the brain white matter of MS patients was accompanied by induction of the ER stress genes, OASIS, BiP, PERK, and
GADD153. Expression of OASIS in astrocytes induced iNOS and thus, nitric oxide.
ASCT-1, a neutral amino acid transporter and Syncytin-1 receptor, was suppressed in brain white matter astrocytes of MS patients and also in astrocytes expressing Syncytin-1 or OASIS. Nitric oxide enhanced the expression of the repressor transcription factor,
Egr1, which concurrently suppressed ASCT1. Syncytin-1 mediated neuroinflammation and death of oligodendrocytes with ensuing neurobehavioral deficits were prevented by the antioxidant ferulic acid in a mouse model of MS. TNF-α implantation into a novel
Syncytin-1 transgenic mice induced ER stress, loss of ASCT1 complemented by glial activation and T cell infiltration, indicating that astrocytes actively participate in MS pathogenesis. Thus, Syncytin-1’s proinflammatory properties in the nervous system demonstrate a novel pathogenic role for an endogenous retrovirus-encoded protein, which may serve as a target for future therapeutic intervention.
iv
PREFACE
Some of the work presented in this thesis has been published previously. As
required by thesis guidelines, full citations of these articles and an account of division of
labor with all co-authors are listed below. Articles are listed in the order that they are
published. As a general note, all work presented in this thesis was performed by Joseph
Mathew Antony unless explicitly stated.
1. Antony JM, van Marle G, Opii W, Butterfield DA, Mallet F, Yong VW, Wallace
JL, Deacon RM, Warren K, Power C. Human endogenous retrovirus
glycoprotein-mediated induction of redox reactants causes oligodendrocyte death
and demyelination. Nat Neurosci. 2004; 7 (10): 1088-95. Copyright permission
has been obtained from Nature Publishing Group (Appendix F)
This publication comprises all of Chapter 3. I performed the majority of the work
associated with this study. Dr. Guido van Marle originally designed the SINrep5-
EGFP and SINrep5-JRFL vectors that were used as controls in this study. Wycliffe
Opii and Dr. Allan Butterfield measured protein carbonyls and 4-HNE. Dr. Francois
Mallet provided the Syncytin-1 expressing vectors and monoclonal antibody against
Syncytin-1. Dr. Wee Yong guided and provided materials for the oligodendrocyte
assays. Dr. John Wallace guided and provided materials for anti-oxidant assays. Dr.
Robert Deacon’s protocols were used for designing animal behavior protocols. Dr.
Kenneth Warren supplied clinical samples from MS patients. All experiments were
performed in the laboratory of Dr. C. Power under his supervision.
v
2. Antony JM, Izad M, Bar-Or A, Warren A, Vodjgani M, Mallet F and Power C.
Quantitative analysis of Human Endogenous Retrovirus-W env in
neuroinflammatory diseases (AIDS Research and Human Retroviruses, in Press).
This publication comprises all of Chapter 4. I did the majority of the work
associated with this study. Dr. Maryam Izad assisted in the PCR assays. DNA was
obtained from an Iranian cohort of MS patients provided by Dr. Mohammed
Vodjgani. Dr. Amit Bar-Or (cDNA from a cohort of MS patients and controls) and
Dr. Kenneth Warren (CSF and plasma) provided additional clinical samples. Dr.
Francois Mallet provided the Syncytin-1 expressing vectors and monoclonal antibody
against Syncytin-1. All experiments were performed in the laboratory of Dr. C. Power
under his supervision.
vi
3. Antony JM, Ellestad K, Shariat N, Hammond R, Imaizumi K, Mallet F and Power
C. Syncytin-1 mediates Endoplasmic Reticulum Stress in a transgenic mouse
model of Multiple Sclerosis (Manuscript submitted to Journal of Clinical
Investigation).
This publication comprises all of Chapter 5. I performed the majority of the work
associated with this study. Mr. Kristofor Ellestad designed and optimized siRNA
molecules against Syncytin-1. Ms. Neda Shariat performed immunohistochemistry
for ER stress proteins from MS patients’ brain tissue provided by Dr. Robert
Hammond. Dr. Kazunori Imaizumi provided the OASIS construct and antibody. Dr.
Kenneth Warren provided clinical samples (CSF and plasma). Dr. Francois Mallet
provided the Syncytin-1 expressing vectors and monoclonal antibody against
Syncytin-1. All experiments were performed in the laboratory of Dr. C. Power under
his supervision.
vii
ACKNOWLEDGEMENTS
I would like to extend my deepest appreciation and gratitude to my supervisor,
Dr. Christopher Power for his support and encouragement throughout the course of my graduate study at the University of Calgary and later, at the University of Alberta. His confidence and trust enabled me to transcend from one country and area of expertise to another. Also I would like to thank members of my supervisory committee, Dr. Wee
Yong, Dr. Daniel Muruve and Dr. Robert Bell, who are a part of my career process and will continue to be. In addition, a number of faculty members from various Departments made my study exciting, for which I am very appreciative. In particular, I would like to thank Dr. Fabrizio Guilliani, Dr. Peter Dickie, Dr. Suzanne Grant (University of Alberta),
Dr. Guido van Marle, Dr. John Wallace, Dr. Joseph Goren and Dr. Kamala Patel
(University of Calgary). Also, I would like to thank my course coordinators, Dr. Julie
Deans and Dr. David Severson for explaining to me the vagaries of grant and assignment writing.
Laboratory life in Calgary was the most happiest one in my life and I owe this mainly to Claudia Silva, Shigeki Tsutsui, Shuhong Liu, Gareth Jones, Andrea Sullivan,
Robyn Flynn, Qing Tang, Yu Zhu, Guido van Marle, Julie Ethier, Scot Henry, Farshid
Noorbakhsh, Neda Shariat, David Vergote, Aundria Hood (the Calgary gang); Amir
Afkhami, Ramin Sarrami, Kris Ellestad, Nicola Barsby and Martine Ooms (the
BrainPowerLab at Edmonton), members of the Wee Lab (Tiffany, Tammy, Jennifer
Wells, Viktor, Rowena, Lorraine, Angelika, Yan Fan), Zochodne Lab (Cory Toth &
James Kennedy), Patel Lab (Subhadeep, Manprit, Cory, Evelyn, Vicky, Keith & Kamala) and numerous other friends at the Health Sciences Center whose names are not
viii
mentioned here. Graduate life would not have been a smooth without the excellent help
and advise from Belinda Ibrahim, Sherry Sweeney, Rosalie Kolstad, Dr Francine Smith,
Dr. Stephen Robbins and Christine Szefer for which I am forever grateful.
My stay in Calgary and Edmonton was indeed a joyous one-my thanks to the
family of friends- Jasprit, Jose Martinez, Elena Silva, Valentine, George and Annie, Dr.
Rajan George and Deepa.
Lastly, I would like to thank all the funding agencies for the financial support and
encouragement received-Alberta Heritage Foundation for Medical Research, Multiple
Sclerosis Society of Canada and Canadian Institutes for Health Research (CIHR)-
Integrated Health Research Team (IHRT).
ix
DEDICATION
To my wife, Smitha, for what she is to me,
AND
To my parents, for their unfailing commitment to my education
x
Table of Contents
Approval Page ii
Abstract iii
Preface v
Acknowledgements viii
Dedication x
Table of Contents xi
List of Tables xvi
List of Figures xvii
Appendices xx
List of Abbreviations xxi
Epigraph xxii
CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW 1
I.1. Multiple Sclerosis (MS) Pathogenesis 2
I.1.1. Clinical and demographic features of MS 2
I.1.2. Pathophysiology of MS 5
I.1.3. Neuroinflammation 8
I.1.3.1. Cellular components of neuroinflammation 9
I.1.3.1.1.Leukocytes 13
I.1.3.1.1.1. CD4+ T cells 13 I.1.3.1.1.2. CD8+ T cells 14 I.1.3.1.1.3. B cells 14 I.1.3.1.1.4. Mast cells 14 I.1.3.1.1.5. Neutrophils 15 I.1.3.1.1.6. Dendritic cells 16
xi
I.1.3.1.2. Immunoregulatory cells in MS 17 I.1.3.1.3. Resident neural cells 18 I.1.3.1.3.1. Astrocytes 18 I.1.3.1.3.2. Oligodendrocytes 20 I.1.3.1.3.3. Neurons 20 I.1.3.1.3.4. Microglia 21 I.1.3.1.4. T cell-glia interaction 22
I.1.3.2. Molecular components of neuroinflammation 24 I.1.3.2.1. Cytokines 25 I.1.3.2.2. Chemokines 27 I.1.3.2.3. Neurotrophic factors and brain repair 28 I.1.3.2.4. Proteases 31 I.1.3.2.5. Oxidative stress 33 I.1.3.2.5. Nitric oxide (NO) 34 I.1.3.2.7. ER stress 37
I.1.4. Drawbacks of EAE as a model of MS 41 I.1.5. Genetics of MS 42 I.1.6. Environmental Factors in MS 45 I.1.6.1. Infectious agents in MS pathogenesis 45 I.1.6.2. Demyelinating viruses 46 I.1.6.3. Retroviruses and MS pathogenesis 47
I.2. Retroviruses: Introduction 51 I.2.1. Genomic and structural organization 52 I.2.2. Classification 53 I.2.3. Retroviral Biology 57 I.2.4. Retroviral pathogenesis in the nervous system 61 I.2.4.1. Retrovirus and nitric oxide 63 I.2.4.2. Retrovirus-mediated ER stress 64 I.2.5. Exogenous retroviral pathogenesis 67 I.2.5.1. Type C retrovirus 67 I.2.5.1.1. Murine leukemia virus (MuLV) 68 I.2.5.1.2. HTLV 69 I.2.5.2. Lentiviruses 72 I.2.6. Endogenous retroviral pathogenesis 79 I.2.6.1. Characteristics of endogenous retroviruses 79 I.2.6.2. HERVs and evolutionary advantages 83 I.2.6.3. Murine endogenous retroviruses 84 I.2.6.4. Syncytin-1: Characteristics of protein 88 I.2.6.5. Syncytin-1: Interaction with receptors 91
xii
CONCLUSION, STATEMENT OF HYPOTHESIS AND OBJECTIVES 91
CHAPTER II: MATERIALS AND METHODS 93
II.1. Cell culture 94
II.1.1. Primary cells 94 II.1.2. Cell lines 97 II.2. Syncytin-1 constructs 97
II.2.1. Construction of SINrep5-Syncytin-1 plasmid 97 II.2.2. Preparation and titration of viral stocks 98 II.2.3. Construction of pFGH- Syncytin-1-envelope plasmid 99 II.2.4. Construction of pseudotyped virus 101 II.2.5. Soluble Syncytin-1 protein expression 101 II.3. Transfections 101
II.4. Extraction of protein from CSF and plasma 102
II.5. Antioxidant activity 102
II.6. Infection and treatment of cells 103
II.6.1. Infection of cells 103 II.6.2. Treatment with cytokines 103 II.6.3. Treatment with drugs 103 II.7. Animals and in vivo procedures 104
II.7.1. Stereotaxic implantation with SINrep5-Syncytin-1 virus 104 II.7.2. Syncytin-1 transgenic mouse 104 II.7.3. Behavior studies 108 II.7.4. Oral drug treatment 109 II.8. PCR 109
II.8.1. Isolation of DNA and RNA and cDNA preparation 109 II.8.2. Relative quantification real time RT-PCR 110 II.8.3. Quantitative real time PCR 111 II.8.4. Sequencing of virus-cell junctions 112 II.9. In vitro assays 114
II.9.1. Toxicity of astrocyte conditioned medium 114 II.9.2. Analysis of supernatant for protein carbonyls and 4-HNE 114 II.10. Microarray Analysis 116
II.11. Quantitative Immunofluorescence 117
xiii
II.12. Detection of proteins in brain homogenate and cell cultures by western blot 117
II.13. Human tissue samples 118
II.14. Immunohistochemistry and immunocytochemistry 119
II.14.1. Detection of proteins in culture, human and mouse brain tissue sections 119 II.14.2. Double label staining immunohistochemistry and microscopy 120 II.14.3. Luxol fast blue staining for myelin 121 II.14.4. Syncytia formation in astrocytes 121 II.15. Quantification of cell numbers in vivo and in vitro 121
II.16. Statistical analyses 122
CHAPTER III. SYNCYTIN-1 INDUCES NEUROINFLAMMATION 123
III.1. Introduction 124
III.2. Results 124
III.2.1. Syncytin-1 is inducible and up-regulated in MS lesions 124 III.2.2. Syncytin-1 activates pro-inflammatory molecules in glial cells 132 III.2.3. Syncytin-1 causes oligodendrocyte damage and death 135 III.2.4. Anti-oxidants prevent Syncytin-1-induced oligodendrocyte injury 138 III.2.5. Syncytin-1-induced neuroinflammation and neurobehavioral abnormalities are inhibited by ferulic acid 142
III.3. Discussion 150
CHAPTER IV. QUANTIFICATION OF SYNCYTIN-1 153
IV.1. Introduction 154
IV.2. Results 155
IV.2.1. Syncytin-1 expression is cell-and tissue type specific 155 IV.2.2. Minocycline inhibits Syncytin-1 expression 158 IV.2.3. Syncytin-1-RNA and DNA copy numbers are significantly enhanced in brain of MS patients relative to controls 158 IV.2.4. Increased Syncytin-1 DNA copies reflect un-integrated cDNA 161 IV.3. Discussion 164
xiv
CHAPTER V. SYNCYTIN-1 INDUCES ER STRESS 167
V.1. Introduction 168 V.2. Results 171 V.2.1. Syncytin-1 induces ER stress in astrocytes 171 V.2.2. OASIS down-regulates ASCT1 expression in astrocytes 174 V.2.3. Syncytin-1 diminishes oligodendrocyte viability 179 V.2.4. iNOS and Egr1 suppress ASCT1 in astrocytes 181 V.2.5. Soluble Syncytin-1 down-regulates ASCT1 in astrocytes 183 V.2.6. Syncytin-1 transgenic mice exhibit neuroinflammation 188 V.2.7. Syncytin-1 Tg animals show ER stress 193
V.3. Discussion 199
CHAPTER VI. GENERAL DISCUSSION AND CONCLUSIONS 205
VI.1. Overview 206 VI.2. Syncytin vs MSRV 206 VI.3. Syncytin-1-associated neuroinflammation 207 VI.3.1. Syncytin-1 mediates inflammation through nitric oxide intermediates 208 VI.4. Quantification of Syncytin-1 copy numbers in tissues 209 VI.4.1. Syncytin-1 RNA copy numbers in the brain 209 VI.4.2. Syncytin-1 RNA copy numbers in CSF and plasma 211 VI.4.3. Syncytin-1 DNA copy numbers and integration events 212
VI.5. Syncytin-1 induces ER stress in astrocytes 215 VI.6. Syncytin-1 causes astrocyte dysfunction 216 VI.7. Syncytin-1 indirectly regulates its receptor expression 217 VI.8. Conclusions and Future Perspectives 219
REFERENCES 227
xv
LIST OF TABLES
Table 1. Therapeutics employed in EAE 43
Table 2. Classification of HERVs in the genome 58
Table 3. List of oligonucleotide primers used in this study 106
Table 4. Syncytin-1 immunoreactivity in MS patients 130
Table 5. Stereological count in mice brains 146
Table 6. Microarray analysis of astrocytes expressing Syncytin-1- (MS related) 177
Table 7. Microarray analysis of astrocytes expressing Syncytin-1 178
xvi
LIST OF FIGURES
Figure 1. Clinical progression of Multiple Sclerosis 4
Figure 2. Multi-step leukocyte recruitment cascade 11
Figure 3. The endoplasmic reticulum stress response 39
Figure 4. Schematic of a retrovirus 54
Figure 5. Schematic of a provirus 55
Figure 6. Schematic of retroviral classification 56
Figure 7. Life cycle of exogenous and endogenous retrovirus 59
Figure 8. Various forms of HERVs 81
Figure 9. Pathogenic potential of HERVs 82
Figure 10. Phylogenetic tree of endogenous retroviruses 87
Figure 11. Northern blot analysis of Syncytin-1 expression 90
Figure 12. Sindbis virus vector expressing Syncytin-1 100
Figure 13. Stereotaxic implantation of Sindbis virus vector 105
Figure 14. Schematic of retroviral LTR circles and formation of provirus 113
Figure 15. PCR amplification of virus-host cell junctions 115
Figure 16. Increase in Syncytin-1 mRNA in brain of MS patients 126
Figure 17. Western blot analysis of Syncytin-1 expression in MS brains 127
Figure 18. Immunohistochemical analysis of Syncytin-1 expression in brain 128
Figure 19. Mitogen-induced expression of HERV env mRNA 131
Figure 20. Overexpression of Syncytin-1 133
Figure 21. Inflammatory components of Syncytin-1 expression 134
Figure 22. Syncytin-1-mediated damage and death of human oligodendrocytes 136
xvii
Figure 23. Syncytin-1-mediated damage and death of rat oligodendrocytes 137
Figure 24. Syncytin-1 does not affect neuronal viability 139
Figure 25. Anti-oxidant activities of various drugs 140
Figure 26. Abrogation of oligodendrocyte death by anti-oxidants 141
Figure 27. Effect of various drugs on oligodendrocyte protection 143
Figure 28. Syncytin-1 induces neuroinflammation in mice 144
Figure 29. Syncytin-1 induces neurobehavioral deficits in mice 147
Figure 30. Syncytin-1 does not affect neurons 149
Figure 31. Syncytin-1 mRNA is increased in a cell-type specific manner 156
Figure 32. Transcript abundance and effect of mitogen on Syncytin-1 mRNA 157
Figure 33. Minocycline-mediated suppression of Syncytin-1 expression 159
Figure 34. Syncytin-1 RNA copy numbers in brain, CSF and plasma 160
Figure 35. Syncytin-1 DNA copy numbers in brain 162
Figure 36. Detection of circular DNA and provirus integration in brain DNA 163
Figure 37. Syncytin-1 induces ER stress in astrocytes 172
Figure 38. ER stress proteins are induced in MS 173
Figure 39. ASCT1 expression is suppressed in MS 175
Figure 40. Syncytin-1-induced ASCT1 suppression affects oligodendrocyte 180
Figure 41. Syncytin-1 and NO induce Egr1 182
Figure 42. NO regulates ASCT1 expression 184
Figure 43. Expression of functional Syncytin-1 185
Figure 44. Soluble Syncytin-1 affects ASCT1 187
Figure 45. Inhibition of iNOS and minocycline up-regulates ASCT1 expression 189
xviii
Figure 46. Development of Syncytin-1 transgenic mouse 190
Figure 47. TNF-α induces Syncytin-1 in astrocytes 191
Figure 48. TNF-α induces Syncytin-1 in transgenic mouse 192
Figure 49. TNF-α induces neuroinflammation in Syncytin-1 transgenic mouse 194
Figure 50. TNF-α induces ER stress in Syncytin-1 transgenic mouse 195
Figure 51. Syncytin-1 transgenic mouse exhibits loss of ASCT1 197
Figure 52. Model of Syncytin-1-mediated neuropathogenesis 204
xix
APPENDICES 220
APPENDIX A: SINrep5-Syncytin-1 vector 221
APPENDIX B: Quality of DNA extracted from brain tissue 222
APPENDIX C: Affymetrix GeneChip Expression Analysis 223
APPENDIX D: Autopsied samples from patients 224
APPENDIX E: Calculation of Syncytin-1 DNA copy number in the genome 225
APPENDIX F: Copyrights obtained from Publishing Houses for use of materials 226
xx
LIST OF ABBREVIATIONS
APC: Antigen presenting cells BBB: Blood brain barrier BDNF: Brain-derived neurotrophic factor BiP: immunoglobulin heavy chain-binding protein Ca2+: Calcium CD: Cluster of differentiation CNS: Central nervous system CO2: carbon dioxide CSF: cerebrospinal fluid DNA: Deoxyribonucleic acid EAAT: Excitatory amino acid transporter EDSS: Expanded Disability Status Scale ER: endoplasmic reticulum GADD153/CHOP: growth arrest- and DNA damage-inducible gene/C/EBP homologous protein gp: glycoprotein GPCR: G-protein coupled receptor Grp: glucose regulated protein HAD: HIV-associated dementia HERV: Human endogenous retrovirus HLA: human leukocyte antigen 4-HNE: 4-hydroxy-2,3-nonenal IGF-1: Insulin-like growth factor-1 IL: Interleukin kbp: kilo basepair kDa: kilo Dalton LTR: Long terminal repeats MAG: myelin-associated glycoprotein Mg2+: Magnesium MHV: Mouse hepatitis virus MIAME: Minimal Information About a Microarray Experiment MMP: Matrix metalloproteinases MOG: myelin oligodendrocyte glycoprotein MSRV Multiple sclerosis retrovirus NF-κB: nuclear factor kappa B NOS: nitric oxide synthase ONOO−: peroxynitrite PERK: PKR (pancreatic eIF2α [eukaryotic translation initiation factor2, α subunit] kinase-like ER protein kinase PLP: Proteolipid protein PP-MS: Primary Progressive Multiple Sclerosis Rag: Recombinase activating gene RANTES: Regulated upon activation, normal T cell expressed and secreted RBC: Red blood cells
xxi
RNA: Ribonucleic acid ROS: Reactive oxygen species RR-MS: Relapsing remitting Multiple Sclerosis RT-PCR: reverse transcription-polymerase chain reaction TMEV: Theiler’s Murine Encephalitis Virus TNFα: Tumor necrosis factor-alpha
xxii
Nothing in biology makes sense except in the light of evolution
Theodosius Dobzhansky, 1973 (in The American Biology Teacher)
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 1
CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 2
I.1. Multiple Sclerosis (MS) pathogenesis
I.1.1. Clinical and demographic features of MS
MS is a medically important disorder in Canada that afflicts the central
nervous system (CNS) of predominantly young people beyond the age of puberty.
The overall estimate of Canadian MS prevalence is 240 per 100,000, ranging from
180 in Quebec to 350 per 100,000 in Atlantic Canada 1. The overall regional
prevalence rate in the province of Alberta, Canada stands at 340 per 100,000 1. It is a
heterogeneous disorder characterized by repeated unpredictable bouts of motor
disturbances, partial paralysis, sensory abnormalities and/or visual impairment. These
variable signs and symptoms result from inflammatory processes that selectively
attacks and destroys oligodendrocytes, the cells that form the myelin sheaths around
axons in the brain and spinal cord 2. The diversity of the disease pathology and
unknown etiology have made MS among the most damaging of neurological
disorders and the least understood in terms of mechanisms of disease progression.
Indeed, some investigations have speculated that MS is not a single disease entity but
actually represents a spectrum of neuroinflammatory disorders 3. Nevertheless,
significant strides in the recent past have made a dent into unraveling the pathogenic
features of the disease. Notable among these are the use of magnetic resonance
imaging (MRI), immunotherapy using monoclonal antibodies to integrins, drugs such
as glatiramer acetate that shifts the immune response from TH (helper)-1 to TH2,
interferon (IFN)-β and minocycline 4. Exposure to viral, bacterial or other pathogens
may trigger the disease process, perhaps through a molecular mimicry mechanism
where a protein in the pathogen is similar to the host protein, myelin, eliciting an
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 3
autoimmune response 5. Several years of research in MS have implicated activated T
lymphocytes and microglia/macrophages, which can produce cytotoxic cytokines and
reactive oxygen molecules, in the destruction of oligodendrocytes 6.
MS is common among Caucasians, with 0.05-0.15% affected by this chronic
and disabling disorder of the CNS, and is less frequently observed in Asians or
Africans 7. Family members of MS patients inherit a higher risk of developing MS,
arguing for a strong genetic predisposition to this disease. MS usually begins in early
adulthood and affects women more frequently than men. MS usually starts with a
relapsing-remitting course (RR-MS) but some 20% of the cases are defined by a
primary progressive course (PP-MS) without acute relapses. Clinical and
neuropathological features are variable depending on population ethnicity. Among the
aboriginal Manitoba Cree Indians in Canada, a distinct form called neuromyelitis
optica predominates and is common among Asian populations 8. Lesions in RR-MS
patients are usually found in white matter and are characterized by disruption of the
blood-brain barrier (BBB), local edema and demyelination, typical of inflammatory
processes (Fig. 1). In PP-MS, inflammatory processes are less dominant but
progression to disability and brain atrophy evolves faster 9. Understanding the
sequence of events underlying the development of the inflammatory plaque is a
central mission in MS research. There is abundant evidence to support the hypothesis
that genetics has an important role in an individual’s vulnerability to MS, perhaps in
conjunction with trigger factors. Though various infectious agents are linked to MS,
their presence may simply provide an appropriate environment for development of
autoreactive immune response 10 directed against CNS antigens 11. Several viral
Chapter 1: Introduction and Literature Review
Preclinical Relapsing-Remitting MS Secondary Progressive MS
Brain volume
EDSS
Lesion load MRI-T1
Inflammation Demyelination/Axonal loss D Pathology
Fig. 1. Schematic representation of clinical progression of MS by clinical scale (EDSS), frequency of inflammatory events (MRI, A), lesion load (tissue damage) and brain atrophy (brain volume). Inflammation is characterized by perivascular inflammation with mononuclear cells (B), demyelinated regions (C) and axonal injury (D) (Adapted from Sospedra et al., 2005; obtained permission from NEJM and Annual Review of Immunology, See Appendix E)
4 Chapter 1: INTRODUCTION AND LITERATURE REVIEW 5
agents including measles virus, Para influenza virus, canine distemper virus, Epstein-
Barr virus (EBV), human herpes virus (HHV)-6 and retroviruses (eg. MS retrovirus
[MSRV]) have been implicated in demyelination processes 12. I will focus this thesis
on the contribution of a human endogenous retrovirus (HERV)-encoded
envelope protein, Syncytin-1, in the pathogenesis of MS.
I.1.2. Pathophysiology of MS
The disease process in MS is predominantly located in the myelinated
regions of the brain and spinal cord. In MS-affected tissue, inflammation-induced loss
of oligodendrocytes and axonal injury are key features of the pathology 13. MS
pathogenesis involves demyelination and inflammation comprising B cells, T cells,
macrophage/microglia and astrocytes, 9 signified by plaque formation. Loss of
oligodendrocytes and neurons, astrogliosis and remyelination, leading to tissue
damage accompanies inflammatory changes. About 26% of all lesions in the cerebral
hemispheres lie outside the white matter, 5% in the cortex and 17% in the cortical
boundary 14. In this respect, a novel experimental autoimmune encephalomyelitis
(EAE) rat model of MS demonstrating cortical demyelination has been recently
established 15. Though active plaques from the same patient may be similar, histology
reveals evidence for significant heterogeneity in demyelination patterns 16. Lesions
are thus classified into 4 categories of myelin destruction 17.
Type I pattern: Toxic products of activated macrophages (eg. TNF-α, reactive
oxygen species [ROS]) destroy myelin sheath. (Also observed in EAE).
Type II pattern: Antibody-mediated demyelination induced by cooperation between
encephalitogenic T cells that induce inflammation and demyelinating anti-myelin
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 6
oligodendrocyte glycoprotein (MOG) antibodies and also complement proteins. (Also
observed in EAE).
Type III pattern: Oligodendrogliopathy-associated demyelination, commonly found
in virus-induced white matter disease in humans. Antibodies and complement
proteins are absent without any remyelination. (Not observed in EAE).
Type IV pattern: Primary oligodendrocyte degeneration and apoptosis observed.
Restricted to infrequent cases in primary-progressive disease patients. (Not observed
in EAE).
Axonal injury in MS is correlated with the extent of inflammation within
the CNS. Nevertheless, axonal damage is variable and depends on the severity of
inflammation, induction of pathogenetic mechanisms as well as diversity in host
susceptibility. Demyelination is often accompanied by significant neuronal death in
cortical and thalamic MS lesions and also death of retinal ganglion neurons 18. MRI
studies have revealed that progressive and functional deficits can be associated with
axonal loss within lesions and brain atrophy 5 (Fig. 1). Axonal injury due to toxic
products, including nitric oxide (NO) and proteases, released from macrophages,
astrocytes and major histocompatibility complex (MHC) class I-restricted T cells, is
found in active lesions during early phases of the disease 5. CD4+- and γ/δ- T cells are
pathogenic in MS lesions, but whether sufficient T cells are present in MS lesions to
induce axonal damage and neuronal death is not known. Anti-CD3 activated allogenic
and syngenic CD4+ and CD8+ T lymphocytes were found to be toxic to neurons
through a contact-dependent pathway, perhaps mediated by FasL, CD40 and LFA-1
19. Axonal loss is also observed in chronic inactive demyelinated plaques but not in
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 7
remyelinated lesions, suggesting that compromised trophic support by damaged
oligodendrocytes and astrocytes can make axons prone to destruction.
Permanent physical and cognitive disability results from cumulative axon
loss 20. Defects in axonal transport can lead to accumulation of axonal amyloid
precursor protein (APP). Using APP as a marker of early axonal damage in MS
lesions, Ferguson et al., (1997) revealed that APP is expressed in areas of acute
demyelination and inflammation, but not in chronic areas of the lesions 21. Earlier
studies indicated that in acute MS lesions, APP was detected in T cells, foamy
macrophages, activated astrocytes and microglia; also, chronic lesions displayed
APP-positive astrocytes and demyelinated axons 22. Another marker, non-
phosphorylated neurofilament (SMI-32) is abundant in neuronal cell bodies and
dendrites but is heavily phosphorylated in healthy myelinated axons. An extensive
analysis of axonal damage in 47 demyelinated lesions revealed ovoids exhibiting
intense SMI-32 immunostaining 23. Axonal ovoids are transient structures containing
axonal debris and surrounding myelin and are characteristic of degenerating axons.
Proteolytic enzymes, cytokines, oxidative products and free radicals released by
activated immune and glial cells, cause axonal transection. Axonal injury is also
correlated with reduced N-acetyl aspartate levels in MRI studies 23. Thus, axonal
injury in MS is a well-established clinical feature. Having described the disease in the
preceding sections, I will now attempt to elaborate on the CNS disease mechanism
(neuropathogenesis) and the neuroinflammatory components in the context of MS.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 8
I.1.3. Neuroinflammation
The CNS consists of the brain and spinal cord and is the main centre of
correlation and integration of nervous information. The brain lies in the cranial cavity
and is continuous with the spinal cord through the foramen magnum while the spinal
cord is situated within the vertebral canal of the vertebral column. Three layers of
meninges-the dura mater, the arachnoid mater and the pia mater surround both the
brain and spinal cord. The cerebrospinal fluid (CSF), synthesized in the ventricular
choroid plexus, surrounds the spinal cord and brain in the subarachnoid space 24. The
CNS is composed of large numbers of neurons and their processes (axons or nerve
fibers), which are supported by glia. The grey matter in the CNS consists of mainly
neuronal soma while the white matter consists of axons embedded in neuroglia. The
average adult human brain weighs 1300-1400 grams and consists of 100 billion
neurons. The average number of glial cells is 10-50 times the number of neurons 25.
The CNS consists of several groups of highly differentiated and complex
cells that are functionally integrated by cell-to-cell linkages and synapses. A healthy
brain enjoys an immune privileged status in that it lacks resident Natural Killer (NK)
cells, T and B-lymphocytes, lymphatic system and limited ability for capillary
endothelium to bind leukocytes. Expression of MHC class I and II is low on
neuroectodermal cells but microglia 26 (originating from mesenchymal macrophages
and monocytes during development) express MHC class I and II 27. Neurons express
high levels of MHC class I after axotomy 28 and cytokine treatment 29. The BBB is a
tight anatomic barrier that excludes proteins and cells of the blood from entering the
CNS under normal conditions 30. It consists of tight junctions between mitochondria-
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 9
rich endothelial cells in CNS vessels, basal lamina and a continuous covering
provided by extended foot processes derived from astrocytes and microglia. The BBB
has evolved to maintain homeostatic differences in the constituents of the blood and
CSF, and acts as a selective barrier to keep the ionic concentrations of the internal
environment within a narrow physiological range 31. Though the BBB separates the
CNS from circulating lymphocytes and antibodies, the circumventricular organs
allow free interaction of peripheral blood with components of the CNS 32. The
choroid plexus is a highly vascularized area containing fenestrated endothelial cells
unlike the parenchymal endothelial cells associated with a tight BBB 33.
I.1.3.1. Cellular components of neuroinflammation
The generation and selection of a diverse population of immunocompetent
but naive lymphocytes from a large number of precursor cells in the primary
lymphoid organs (PLO) and the efficient initiation of an immune response by
immunocompetent cells on antigen capture in the secondary lymphoid organs (SLO)
lead to antigen recognition and response while maintaining tolerance to self-antigens.
Lymphocyte homing and trafficking link the PLO and SLO with each other and with
the extralymphoid sites of the body 34. It is now increasingly appreciated that the CNS
is not immunologically isolated from the rest of the body, though there are
fundamental differences in the nature of the induced innate and adaptive responses.
In the event of an immune response to an antigen in the CNS,
immunological cues are sent from the CNS to the periphery for recruitment of
leukocytes to eliminate the antigen, remove debris and promote repair. However,
eradication of the antigen from the CNS leads to immunological damage, which may
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 10
be beyond repair and often fatal. Infiltration of effector lymphocytes through the BBB
and their interaction with the CNS components contribute to pathology associated
with CNS diseases. The entry of leukocytes into the CNS is generally restricted by
the tight junctions and by the lack of adhesion molecules on cerebral capillary
endothelial cells 35. However, studies have also shown that activated T cells regularly
transmigrate across the BBB as part of the normal immunological surveillance of all
tissues. Transendothelial migration of activated CD4+ T cells takes place due to
interaction of P-selectin glycoprotein ligands expressed by activated T cells with P-
selectin, which is expressed at low levels by normal cerebrovascular endothelial cells,
but levels of both these molecules increase during an inflammatory response,
increasing surveillance and migration of activated T cells 35,36.
Activated T cells can cross antigen- or cytokine-stimulated endothelial
cells of the BBB, independent of antigen specificity. The general mechanism (Fig. 2)
consists of 1. Tethering and rolling- Circulating leukocytes first tether to and then
roll on endothelial cells expressing adhesion molecules. The tethering and rolling
steps are mediated by the selectins, as well as α4 integrins. Selectins on endothelium
interact with carbohydrate-counter receptors on leukocyte surface, tethering
leukocytes that slow down and roll along the endothelium even in the presence of
shear forces that guide movement of leukocytes through the bloodstream. 2. Integrin
activation: Signaling through Gαi proteins activates integrins expressed on
leukocytes. 3. Leukocyte arrest: Firm adhesion occurs when integrins bind to their
endothelial ligands with high affinity. 4. Diapedesis: Chemokines, acting through G-
protein coupled receptors (GPCRs), mediate leukocyte transmigration into tissue 37.
Chapter 1: Introduction and Literature Review
Selectin Chemokines Integrins Chemokines Carbohydrate ligands GPCRs Adhesion molecules GPCRs of immunoglobulin superfamily
Tethering/Rolling Activation Adhesion Diapedesis
Fig. 2: Multi-step paradigm of leukocyte trafficking. Each step in recruitment can be mediated by different adhesion molecules. By combining these elements in unique ways, specific traffic of leukocytes into sites of inflammation can be achieved. Use of multiple chemoattractants increase the degree of specificity (Adapted from Ransohoff et al., 2003)
11 Chapter 1: INTRODUCTION AND LITERATURE REVIEW 12
The importance of selectins and integrins in leukocyte trafficking through
the CNS vasculature is best elucidated in EAE mice. Though MOG-induced mice
express limited levels of P-selectin in the CNS vasculature, leukocyte rolling is
inhibited by blocking this selectin, suggesting its requirement for initial recruitment
of encephalotigenic T cells. Therapeutically, dual inhibition of α4-integrin and P-
selectin may have a synergistic effect and provide optimal benefit in human disease
38 . Blocking α4β1 integrin leads to reduced infiltration of leukocytes into the CNS
perhaps by affecting fibronectin-mediated leukocyte migration 39. Commercially
available and therapeutically viable antagonists have been derived against α4β1
integrin for treatment of MS with high therapeutic efficiency 40. However, a potential
setback to this treatment protocol was the unexpected development of progressive
multifocal leucoencephalopathy (PML). PML is a demyelinating disease caused by
the human polyomavirus JC virus, a common and widespread infection in humans
and was diagnosed in at least 3 patients who were treated with Natalizumab, a
41 recombinant humanized antibody directed to the α4 integrins (α4β1 and α4β7) . An
extensive study revealed risk of PML in approximately 1 in 1000 patients treated with
Natalizumab for 18 months, though longer treatments and the risks thereof are
unknown 42.
During an inflammatory response, leukocyte recruitment to the site of
inflammation is mediated by chemokines and is also affected by complement,
leukotrienes, prostaglandin, neuropeptides and cytokines 43. Unlike cytokines that
have pleiotropic effects, chemokines target specific leukocyte subsets. Expression of
adhesion molecules on leukocytes and endothelial cells, and chemotaxis lead to
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 13
infiltration by neutrophils and macrophages followed by chemokine-receptor
expressing lymphocytes.
I.1.3.1.1. Leukocytes
In MS, infiltrating activated T and B-lymphocytes, macrophages and
microglia induce proinflammatory cytokines and a host of other soluble factors
leading to inflammation-induced axonal and myelin damage. Oligodendrocytes
undergo damage and perhaps death through the action of several components of the
innate and adaptive immune systems in the CNS 44.
I.1.3.1.1.1. CD4+ T cells
Current experimental evidence in MS research favours the CD4+
autoreactive T cell as a crucial factor for MS pathogenesis for several reasons. These
cells are among the majority infiltrating the CNS and CSF; genetic risk to MS is
contributed by human leukocyte antigen (HLA)-DR and -DQ molecules, which when
transgenically expressed confer susceptibility to EAE; altered peptide ligands of
+ myelin basic protein (MBP)83-99 induce cross-reactive CD4 T cells exacerbating
disease in clinical trials and lastly, CD4+ T cells induce antibody production and
CD8+ maturation 5. Tissue damage caused by the initial infiltration of autoreactive T
cells release myelin antigens that promote immune responses to additional myelin
epitopes, initiating a cascade of events that culminates in chronic disease. Myelin-
reactive T cells from MS patients produce TH1-cytokines (IL-12, IL-23, IL-17, IFN-
β) whereas the same cells from healthy individuals are likely to produce TH2
cytokines (IL-4, IL-10) 11.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 14
I.1.3.1.1.2. CD8+ T cells
In the CNS, only microglia are known to express MHC class II 6. Though
astrocytes express MHC class II after IFN-γ treatment, the constitutive levels of MHC
class II are either absent or at low levels on oligodendrocytes, neurons and astrocytes.
MHC class I expression on the resident neural cells make them vulnerable to
recognition by CD8+ cells. While it has been generally accepted that CD4+ T are the
dominant encephalotigenic cells in the brain 45, there are also experimental and
clinical data showing that CD8+ T cells outnumber CD4+ T cells in MS lesions 45.
CD8+ cells are also closely apposed to oligodendrocytes and axons suggesting that
they may initiate inflammation and tissue injury in MS plaques 45.
I.1.3.1.1.3. B cells
Circulating activated memory B cells can serve as antigen presenting cells
(APCs) and skew T cell responses towards a pro-inflammatory nature. Certain B cell
clones from the CSF of MS patients have revealed receptor editing by which these
cells abrogate the ability of the host to induce autoantibodies during B cell
development. However, reactivity may be introduced to additional CNS autoantigens
46. MS patients demonstrate increased immunoglobulins in the CSF, but not in the
serum, suggesting that these myelin-specific antibodies which may contribute to
destruction of myelin 5 are produced locally in the CNS.
I.1.3.1.1.4. Mast cells
Mast cells arise from CD34+/c-kit+/CD13+/FcεRI- hematopoietic
progenitor cells that differentiate in the presence of stem cell factor, a c-kit ligand,
which in the CNS is synthesized by glial cells. These effector cells of the innate
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 15
immune system are not abundant in the brain, but an increase in their numbers is
associated with a variety of neurological disorders including MS 47. Degranulated
mast cells in the brains of EAE animals release histamines, which alter BBB
permeability 48. Moreover, mast cell-deficient mice (W/Wv) exhibited significantly
reduced disease onset and clinical scores in a MOG-induced model of EAE 49. In
addition to increased numbers of mast cells in plaques, elevated levels of tryptase 50
and histamine 51 in the CSF of MS patients suggest that mast cells may play an
important role in the pathogenesis. This is also important because tryptase activates
proteinase-activated receptor [PAR-2], which is involved in MS pathogenesis
(discussed later). The increase in mast cell numbers is thought to be due to
chemoattractants such as RANTES (regulated upon activation, normal T cell
expressed and secreted) released by inflammatory cells, and hence could be a
secondary event 52.
I.1.3.1.1.5. Neutrophils
Recruitment of neutrophils from the blood into the injured tissue is a
typical inflammatory response and is mostly mediated by CXCL8 (IL-8), which, in
addition to neutrophils, is also produced by a wide variety of other cells 53. The
chemotactic effects of CXCL8 are mediated by binding to its receptors CXCR1 and
CXCR2, both of which are highly expressed on glial cells in acute and chronic brain
lesions of MS patients. However, both neutrophils and eosinophils are rarely
observed in MS lesions, except in cases of fulminant variations of MS such as
Devic’s or Marburg’s syndromes 54. The high levels of CXCL8 in the peripheral
blood of MS patients therefore suggests that high serum CXCL8 levels may be
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 16
preventing the neutrophils from transmigrating into the brain. Nevertheless,
neutrophils may have increased activity prior to the clinical phase of MS, where it
may promote the production and synthesis of matrix metalloproteinases (MMPs),
which play a role in tissue inflammation in MS 55.
I.1.3.1.1.6. Dendritic cells (DCs)
Dendritic cells (DCs) are highly specialized APCs and act as sentinels of
the innate immune system and, due to their intrinsic ability to produce cytokines and
stimulate NK and naïve T cells, DCs link the innate and adaptive arms of the immune
system 56. Under non-inflammatory conditions, the brain parenchyma lacks DCs but
high numbers in the brain and CSF are seen following inflammatory conditions. They
originate from the choroid plexus and meninges or arise from a subpopulation of
activated microglia 35 after antigen uptake. DCs secrete antiviral IFN-γ and also
stimulate the adaptive immune system 57. CD4+ CD11c- type 2 DC precursor cells are
similar to systemic type 1 IFN producing cells. These precursors generate large
quantities of IFN-α/β and TNF-α, which, through an autocrine fashion, stimulate
these cells to mature into DCs that can stimulate adaptive immunity 58. DCs
accumulate in the CNS and CSF in MS and EAE and are detected using the marker
DC-SIGN/CD209, a C-type lectin receptor expressed by immature DCs in non-
lymphoid tissue, but also expressed by mature DCs in secondary lymphoid tissue 59.
DCs have been shown to engulf myelin components and interact predominantly with
CD8+ T lymphocytes in MS lesions. By virtue of chemokines and cytokines released,
DCs mature and activate T lymphocytes in the CNS and also migrate to draining
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 17
lymph nodes where they initiate a new wave of autoreactive T cells to infiltrate the
CNS 59.
I.1.3.1.2. Immunoregulatory cells in MS
CD4+ immunoregulatory T cells (Tregs) express high levels of CD25 and
the transcription factor, Forkhead Box-P3 (FOXP3) 60. These cells suppress T cell
proliferation by both cell-cell contact and cytokine-mediated mechanisms,
particularly producing anti-inflammatory cytokines IL-10, transforming growth factor
(TGF)-β and IL-4 60. Since MS patients show reduced numbers of Tregs, the
subsequent lack of IL-10, TGF-β and IL-4 may further contribute to the pathogenesis.
In an interesting study, Tregs were isolated from MS patients who were vaccinated
with irradiated MBP-reactive T cells. Isolated Tregs were found to reduce the
proliferative response of autologous MBP-reactive T cells 61. These data emphasize
the relevance of Tregs in MS and efforts should be made to harness the major benefit
of Tregs, namely to suppress encephalitogenic T effector cells.
NK cells may also exert an immunoregulatory role in MS by targeted lysis
of encephalotigenic cells through perforin and/or TNF-related apoptosis-inducing
ligand (TRAIL)-dependent mechanisms. Natural Killer (NK)-T cells are another
group of immunoregulatory cells that act through induction of IL-4 and IFN-γ, the
former cytokine being selectively up-regulated by binding the CD1d protein on NKT
cells 5. In humans, NKT cells express a conserved T cell receptor (TCR)α chain,
Vα24JαQ, paired with a selected Vβ11 segment and, in MS, there is a considerable
decrease in the number of these immunoregulatory cells 62.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 18
I.1.3.1.3. Resident neural cells
I.1.3.1.3.1. Astrocytes
There are 3 types of glial cells in the mature CNS-astrocytes,
oligodendrocytes and microglia. Astrocytes are the most abundant cells in the CNS
and are restricted to the brain and spinal cord and have elaborate star-like processes.
There are 2 types of astrocytes in the CNS. The fibrous type with many thin processes
forms a scaffold throughout the grey matter, while the protoplasmic type is short,
with thicker processes and form a continuous covering around blood vessels and both
respond to injury 63. Camillio Golgi’s observations at the end of the 19th century that
astrocytes connect blood vessels and neurons set the precedence for investigations
into the complex roles played by astrocytes 64. Astrocytes maintain the appropriate
chemical environment for neuronal signaling. There are several conditions involving
defective astrocytes, chief among which is the white matter disorder, Alexander’s
disease, characterized by the accumulation of Rosenthal fibers, which are protein
aggregates in astrocytes due to mutations in the glial fibrillary acidic protein (GFAP)
gene. The astrocytes also contain αB-crystallin and heat shock protein (Hsp)-27 65.
Mice that lack GFAP are viable but exhibit morphological and functional alterations
and decreased myelination, suggesting a link between astrocyte function and
maintenance of myelination 66. Astrocytes produce soluble factors, particularly
growth factors, that promote functioning of otherwise defective oligodendrocytes 67,
suggesting extensive cross-talk between astrocytes and oligodendrocytes. Evidence
for a pathogenic role of astrocytes in MS is gaining attention, which is the theme
of my thesis. Activated astrocytes exhibited complement activation in pre-
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 19
demyelinating lesions from MS brains 68, release glutamate leading to neuronal and
oligodendrocyte death 69, express chemokines that lure dendritic cells to sample the
antigens in the CNS 70 and a host of other functions that enhance neuropathogenesis
of demyelination. Astrocyte can also secrete serine and glutamate 71. Glutamate
produced by active neurons is removed by astrocytes through glia-specific
transporters-excitatory amino acid transporter 1 (EAAT1, [rodent, GLAST]) and
EAAT2 [rodent, GLT1]. Astrocyte gap junctions are formed by connexins 43 and 30,
through which these glial cells dissipate glutamate, in addition to propagation of the
intercellular Ca2+ waves. In response to CNS injury, astrocytes become activated,
involving cellular hypertrophy, changes in gene expression and cellular proliferation
forming the classical ‘scar tissue’. However the scar-forming reactive astrocytes are
essential for spatial and temporal regulation of inflammation post CNS injury. Loss of
astrocytes leads to accumulation of extracellular glutamate with subsequent
excitotoxicity of neurons and oligodendrocytes 72. Reactive astrocytes produce
cytotoxins such as NO radicals and ROS that can damage neural cells and contribute
to secondary degeneration after CNS insults 73 and can also inhibit axonal
regeneration 74. Thus astrocytes are able to exert harmful and beneficial effects. It
seems that evolutionary adaptations favoured mechanisms to contain local injuries
rather than those to deal with large injuries. Restricting the injury within insulated
local regions allows robust leukocyte- and microglia-mediated inflammatory
reactions to occur. This allows the damaged tissue to recover and also prevent these
inflammatory cells from invading adjacent healthy tissue. However, during this
process axonal guidance pathways are perturbed and can slow down remyelination74.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 20
I.1.3.1.3.2. Oligodendrocytes
Oligodendrocytes and astrocytes are both cells of neuroectodermal origin
75 like neurons. Oligodendrocytes are restricted to the CNS and form a layer of lipid-
rich and laminated layer called myelin around most axons. Myelin plays an important
role in the conduction of action potentials. In MS, myelin degenerates and
oligodendrocyte die causing a functional short-circuiting of exposed axonal
processes, leading to demyelination 76. Mice deficient in 2’3’ cyclic nucleotide
phosphodiesterase (CNPase), a gene expressed in oligodendrocytes, exhibit motor
deficits due to axonal damage even though normal-looking myelin is formed 77,
suggesting that it could be altered trophic support from oligodendrocytes that
contribute to axonal damage rather than demyelination that leads to axonal damage 14.
The NG2 glycoprotein is a membrane protein expressed in the developing and adult
CNS by subpopulations of glia including oligodendroglial precursor cells (OPCs).
NG2-positive cells are observed in MS lesions and, since they are precursors to
oligodendrocytes during development, the presence of NG2-positive cells in MS
lesions may suggest the possibility of on-going remyelination 78.
I.1.3.1.3.3. Neurons
The neuronal population is established shortly after birth and mature
neurons do not divide. They can be excitatory, inhibitory or modulatory in their effect
and motor, secretory or sensory in their function 79. Neurons range from the small,
globular granule cells with a diameter of 6-8 μm to the pear-shaped Purkinje cells and
star-shaped anterior horn cells which range from 60-80 μm in humans. Neuronal
nuclei are large and spherical with a large nucleolus. The perikaryon or the neuronal
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 21
body comprises the Nissl substance (an intracytoplasmic basophilic mass and extends
along the dendrites), neurotubules (aligned longitudinally along axons and dendrites
and involved in axoplasmic transport) and neurofilaments (found mostly in axons,
maintain neuronal form and axoplasmic transport), in addition to other common
organelles. Importantly, axons emerge from the neuron as a slender thread and are
frequently myelinated. The dendrites are afferent components of neurons and are
arranged in a stellate fashion and lack neurofilaments. The synapse is a specialized
junction where axons and dendrites emerging from different neurons
intercommunicate 80. Neurons also play a modulatory role in inflammation, wherein
healthy neurons actively suppress immune function of microglia by interaction
between CD200 receptor on neurons and its ligand on microglia. CD200-/- (deficient)
mice showed activated microglia with increased expression of CD45, CD11b and
inducible nitric oxide synthase (iNOS) during EAE 81. The pathological features of
axonal demyelination are described in section I.1.2.
I.1.3.1.3.4. Microglia
Mononuclear phagocytes comprise an essential component of the
innate immune system, playing important roles in the defense against infectious
agents. Microglia, forming 12% of the CNS cells, demonstrate low turn over rate and
can be induced to express the surface molecules, CD80, CD86 and MHC class II,
necessary for antigen presentation. The perivascular and meningeal macrophages that
line the endothelia of the cerebral blood vessels are bone-marrow-derived cells. In the
resting state, microglia have a ‘ramified’ morphology, with flattened or angular
nuclei, scanty cytoplasm that accumulates at both poles of the cells and are terminally
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 22
non-dividing cells. Activated microglia assume different shapes and could become
bushy with abundant cytoplasm and ramified thick processes lying adjacent to
neurons, and are thus called perineuronal microglia. They also appear as rod-shaped
microglia with a fusiform, elongated body with small, thin processes. Resting
microglia are postulated to have several roles including sensing and reacting to injury,
regulating blood flow and vasculogenesis, phagocytosis, regulating astrogliosis,
neurodevelopment by secreting trophic factors and neuroendocrine functions 82. The
activated microglia express complement type 3 receptor (CR3), MAC-1, MHC class I
and II antigens and lectin-binding protein 82. In MS, microglia may present antigens,
including myelin-derived peptides through MHC class II molecules to cytotoxic T
cells, leading to disease exacerbation and also recruit further monocytes from the
blood stream, enhancing the cytopathic response. However, due to their phagocytic
nature, microglia may also rid the brain of damaged cells and thus contribute to
resolution of inflammation 82.
I.1.3.1.4. T cell-glia interaction
T cell-secreted IFN-γ activates MHC class II-expressing
microglia/macrophages and perhaps astrocytes, which in turn phagocytose other cells
and lytic debris 83. Microglia also modulate the immune response by cytokine-
mediated polarization of T cells and further enhancement of MHC class II expression.
Microglia phagocytose specific antigens in the CNS and present them on MHC class I
and/or II while also producing cytokines and toxic molecules that compromise neural
cell function and survival. These actions induce further recruitment of inflammatory
and immunologically active cells. In MS lesions, reactive astrogliosis and abundant
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 23
macrophages induce peroxynitrite (OONO-) (indicated by nitrotyrosine
immunoreactivity), up-regulation of adhesion molecules, FasL, TNF-α, IL-1β,
complement and ROS, all of which mediate oligodendrocyte cytotoxicity leading to
CNS damage 84. When peripheral macrophages are selectively depleted by
intravenous injection of mannosylated liposomes containing dichloromethylene
diphosphonate (clodronate), EAE-induced demyelination is reduced in rodents
passively transferred with MBP-reactive T cells 85. Autoreactive and proinflammatory
cytokine-producing CD4+ T cells that activate microglia are also associated with
production of neurotrophic factors suggesting that the same cells play different roles
at various stages of the lesion.
Oligodendrocytes are vulnerable to perforin 86 through MHC class I
effector pathway 87 and CD4+ T cell-mediated lytic damage 88 through Fas/FasL or
TNF-receptor (TNF-R) via the MHC class II elimination pathway 87. Importantly, T
lymphocytes induce considerable damage to oligodendrocytes through a host of
soluble secreted factors. Oligodendrocytes may be injured by several means.
Recently, N-methyl-D-aspartate (NMDA) receptors on oligodendrocytes and
glutamate-mediated killing of these cells were discovered 89, suggesting the use of
NMDA receptor antagonists for preventing myelin damage. It has been established
that chemokines direct TH1 polarized cells into the CNS; however, recently it has
been shown that TH2 polarized cells (producing IL-4, IL-5, IL-13, and high levels of
IL-10) induce EAE in B and T cell deficient (Rag1-/- and TCRα-/-) mice. Normal (i.e.,
+/+ Rag1 ) mice were resistant to EAE induction by TH2 cells but not to induction by
TH1 cells. Moreover, an unusually high percentage of neutrophils and mast cells were
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 24
-/- present in the CNS of Rag1 mice into which TH2 cells had been transferred but this
-/- 90,91 was not the case in Rag1 mice that had received TH1 cells . This suggests that T
cell dynamics in the CNS are far more complex than thought with regard to initiating
demyelination as well as resolution of inflammation. This calls for reassessment of
facts regarding the role of T cells in autoimmunity.
I.1.3.2. Molecular components of MS
A persistent question within the MS research community is whether MS
pathogenesis is initiated when autoreactive T cells are generated in the systemic
compartment (immune-initiated hypothesis) or whether events within the CNS initiate
the disease process (neural initiated hypothesis) 9. Accumulation of activated T cells
in early MS lesions and surrounding normal appearing white matter indicate the
importance of cell-mediated immunity in the pathogenesis of MS. Autoimmune
activated T cells in the CNS of MS patients recognize myelin sheath. This has been
demonstrated in the EAE model, where the disease process is initiated by systemic
immunization with neural autoantigens (eg. myelin) or by passively transferring
activated myelin-specific T cells to induce an active disease, reinforcing the concept
that T-cell autoimmune reactions of myelin may be involved in the inflammatory
response in the CNS 92. Adoptive transfer of neural antigen sensitized CD4+ T cells is
performed as described below. After harvesting spleen and lymph nodes from myelin
(related protein)-injected mice and controls, single cell suspensions are prepared. The
purified lymphocytes are counted, and immediately thereafter, 10, 20 or 50 millions
of either spleen or lymph node cells are injected into age-matched mice through the
tail-vein. One week after the cell transfer, an EAE immunization is carried out. T
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 25
cells that secrete TH1 cytokines (IFN-γ, TNF-α, IL-2) are more likely to transfer the
disease than other myelin-specific T cells. T cells secreting IL-4, -5, -10 and -13
protect animals from EAE. Thus EAE is a prototypic autoimmune disorder caused by
a TH1 cell response to myelin antigens. However, heterogeneity within various EAE
models with regard to lesion topography and extent of demyelination/axonal
disruption, indicate the need to define mechanisms linking neuroinflammation and
actual tissue injury 9. The concerns with EAE as a model for MS will be discussed
later. The molecular components of inflammation are extensive to dissect.
Nevertheless, some of these and their contribution to pathogenesis in MS will be
discussed below.
I.1.3.2.1. Cytokines
Cytokines are small, secreted proteins which mediate and regulate
immunity, inflammation and hematopoiesis. Of these cytotoxic cytokines, TNF-α and
IL-1β are harmful to oligodendrocytes. IL-1β is a potent regulator of MMPs
implicated in demyelination and axonal loss in CNS diseases. IL-1β reduces
expression of glutamate receptors in astrocytes and impairs glutamate uptake. This
results in glutamate dysregulation through α-amino-3-hydroxy-5-methyl-4-
isoxazolepropionic acid (AMPA)/kainate receptors and subsequent glutamate toxicity
in oligodendrocytes, when co-cultured with astrocytes and microglia 93. Though
oligodendrocytes express receptors for IL-2, IL-1α/β, TNF-α, IL-6 and
neurotrophins, contradictory findings exist with regard to their trophic or lethal
functions upon ligand binding. During neuroinflammation, TNF-receptors (-RI and -
RII) are up-regulated on oligodendrocytes and microglia while Fas is increased on
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 26
oligodendrocytes. Ligand binding to TNF-RI and IL-1β receptor and nerve growth
factor (NGF) binding in the absence of its high affinity receptor, TrkA (in mature
oligodendrocytes) can induce synthesis of intracellular ceramide, a sphingolipid
generated by sphingomyelinase. This pathway activates c-Jun-NH2-terminal kinase
(JNK) leading to apoptotic cell death 94.
Recently, the contribution of TRAIL to oligodendrocyte death was
investigated in primary cultures of adult human oligodendrocytes. By activating JNK
pathway 95, TRAIL selectively targeted and killed oligodendrocytes, but not
microglia, through interaction with the receptors, TRAIL-R1 and -R2. However, this
process occurred in the absence of non-signaling decoy receptors, -R3 and -R4, since
most cell types express -R1 and -R2, but microglia express -R3 96. Inconsistencies
with regard to TNF-α-mediated oligodendrocyte killing suggest that this cytokine
may have both lethal as well as neuroprotective effects through induction of trophic
factors, insulin-like growth factor (IGF)-1 and ciliary neurotrophic factor (CNTF) 97.
Though IFN-γ amplifies the inflammatory response, it does not alter oligodendrocyte
survival, which nevertheless is more vulnerable to Fas-mediated apoptosis
precipitated by TNF-α 98. Furthermore, TNF-α blockade in EAE reduces pathology
and TNF-α overexpression increases severity of demyelination 99. However, TNF-α
neutralization worsened MS signs 100 contradicting findings in EAE mice. Since TNF-
α induces protective autoimmunity (discussed later), an innate immune response-
mediated induction of TNF-α may be protective whereas TH1-induced release of IFN-
γ may be detrimental to myelin 101.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 27
I.1.3.2.2. Chemokines
Chemokines are a superfamily of low molecular weight (8-15 kDa),
secreted, heparan-binding molecules that serve as potent chemoattractants for
immune cells. Chemokines bind to GPCRs expressed on most immune cells.
Conserved serine and threonine residues in the short cytoplasmic tail of the
chemokine receptor are important for signaling through phosphorylation by various
kinases. Leukocyte migration and their interaction with neural cells require
chemokine-mediated signaling. Signaling from chemokine receptors is mediated by
Gαi, Gαq and G16 proteins that associate with chemokine receptors. Upon receptor
activation, phosphatidylinositol [PI]-3-kinase-γ is activated and the protein kinase C
(PKC) pathway is triggered by Gβγ subunit by generation of inositol-1,4,5
2+ triphosphate (IP3) and diacylglycerol (DAG). IP3 mobilizes release of [Ca ]i from
intracellular stores activating conventional PKC isoforms that regulate downstream
signaling. Ca2+ flux, generation of lipid mediators and ROS mediate changes in cell
shape, membrane ruffling, actin polymerization as well as extension and retraction of
lamellipodia that propel leukocytes towards the site of inflammation. Receptor
dimerization associated with chemokine binding also activates the JAK/STAT (Janus
kinase/signal transducer and activator of transcription) pathway mediated by a
conserved DRY motif in the intracytoplasmic tails. JAK phosphorylation leads to
STAT recruitment to the receptor followed by its activation and translocation to the
nucleus to activate or repress gene expression 102. Chemokines play an important role
in leukocyte recruitment to inflammatory lesions. They also regulate proliferation and
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 28
migration of neural progenitor cells to sites of CNS trauma and confer trophic activity
on neurons that survive initial insult.
Microglia, astrocytes and endothelial cells express CCR7 receptor that
leads CCL21/SLC and CCL19/ECL-expressing B lymphocytes to migrate to the CNS
where they may destroy myelin. Active MS lesions have increased amounts of
CCL2/MCP-1, CCL8/MCP-2 and CCL7/MCP-3; CCR2, CCR3 and CCR5 on
macrophages, microglia and T cells; CCR3 and CCR5 on reactive astrocytes and
CXCR3 receptor for CXCL10/IP10 is present on all perivascular T cells and
astrocytes in active lesions. The chemokines CCL3/MIP1α, CCL5/RANTES,
CXCL9/MIG and CXCL10/IP-10 are found in the CSF of MS patients. This
chemokine profile suggests that the expression of these chemokines by lesion-
associated cells may be involved in the recruitment of specific T cells expressing
CXCR3 or CCR5 103.
I.1.3.2.3. Neurotrophic factors and brain repair
It has been observed that neurotrophic factors are induced by the
inflammatory cytokines, TNF-α and IL-1β within parenchymal microglia. Microglia-
derived IL-1β induces NGF, CNTF and IGF-1, which repair the injured CNS. TNF-α
plays a dual role in demyelination (TNF-R-I) and remyelination (TNF-R-II), by
interacting with the receptor available 101. TGFβ also plays a dual role by down-
regulating proinflammatory cytokines but unfortunately induces astrocytic activation
and glial scar formation that inhibits oligodendrocyte differentiation and
remyelination 104. IL-6, IL-1β and chemokines (CCL2, CCL3 and CCL5) are essential
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 29
for axonal growth and oligodendrocyte differentiation but also promote inflammatory
cell recruitment and survival 104. IL-1β binds to its receptor on astrocytes leading to
the production of growth factors (Neurotrophin [NT], NGF, CNTF) that act on neural
progenitors and favour repair of oligodendrocytes and induce remyelination 104.
Interestingly, TNF-α binds to TNF-RII (p75) on oligodendrocyte progenitors and
promote their differentiation into mature and functional oligodendrocytes 101. Similar
to IL-6-, CNTF-, oncostatin-M- and IL-11-mediated survival of neurons, leukemia
inhibitory factor (LIF)-mediated signaling through its receptor in mice infected with
Theiler’s murine encephalomyelitis virus (TMEV) 105, can also potentiate
oligodendrocyte survival 106. Thus, an innate immune response is also needed for
repair of the CNS following injury.
Brain repair takes place following injury by neurotrophins (NGF, Brain-
derived neurotrophic factor [BDNF], NT-3, 4/5) and their receptors (Trk A, B & C
and the low affinity p75NTR) as well as growth factors (platelet-derived growth factor
[PDGF], fibroblast growth factor [FGF]-2, IGF-1). These are re-expressed by T and B
cells, macrophages, astrocytes and mast cells in the brain lesions. Growth factors
binding to their receptors lead to receptor clustering and autophosphorylation of
tyrosine residues in the cytoplasmic tail of the receptors. This opens up docking sites
for SH2 domain-containing adaptor proteins such as Shc and/or Grb2 and to
activation of the Ras/Raf/MEK/ERKs cascade 107. Expression of extracellular matrix
or cell surface proteins, (chondroitin sulphate proteoglycan (CSP), integrin, ephrin,
tenascins and semaphorins) and oligodendrocyte proteins (Nogo (Neurite outgrowth
inhibitor), myelin-associated glycoprotein [MAG], MOG, Notch-1) may contribute to
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 30
neurogenesis, gliogenesis, synaptogenesis, migration etc. Re-expression of Jagged
and Notch-1 is important for axonal growth and remyelination. Neurocan, a
chondroitin sulphate proteoglycan, can bind to FGF-2 and promote neural-cell-
precursor differentiation and bind neural cell adhesion molecule on inflammatory
cells, allowing their entry into the brain 104. Astrocytic IGF-1 and FGF-2 are essential
growth factors for oligodendrocyte precursor proliferation and for maturation into
myelin producing oligodendrocytes. High affinity FGF receptors present on
oligodendrocytes in demyelinated lesions are stimulated upon ligand binding, leading
to colonization of oligodendrocytes in lesions. Most importantly, upon activation,
astrocyte-derived growth factors and neurotrophic factors promote neuronal survival
and regeneration 108. Astrocytes mediate synaptogenesis wherein high affinity
receptors on astrocytes bind to vasoactive intestinal peptides (VIPs) 109. Also VIP-
stimulated astrocytes produce activity-dependent neurotrophic factor that promotes
survival of spinal cord and cortical neurons 110. Thus, astrocytes are thought to be just
more than ‘brain glue’ 64 and contribute to several dynamic processes in the CNS.
Undifferentiated adult neural stem cells (NSC) can alter developmental
and differentiation programs in response to injury. Subependymal-zone-restricted
adult neural stem cells (NSC) can selectively migrate into areas of demyelination and
differentiate into myelin-producing cells. These cells constitutively express adhesion
molecules, cytokines and their receptors to guide their migration. Adult NSC
transplanted into brain lesions can differentiate into myelin producing
oligodendrocytes and promote functional recovery 104. Since astrocyte-derived FGF-2
can stimulate NSC proliferation, adult NSC enhance neurogenesis when co-cultured
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 31
with hippocampal astrocytes 111. Failure of brain repair could be due to the ageing of
the brain repair mechanism, as young animals have better capabilities of regenerating
axons and remyelination when compared to older ones. Also, extensive degeneration
may damage the rostral migratory stream used by adult NSC to migrate and colonize
damaged areas 104,112.
I.1.3.2.4. Proteases
Proteases are involved in several aspects of the nervous system including
cell growth, neurite outgrowth, cell survival and pathogenicity. The major classes of
peptide-cleaving enzymes include the cysteine proteases, aspartyl proteases and the
metalloproteases. The major cysteine proteases, calpain and cathepsin, degrade
myelin proteins 113 114. An essential enzyme that cleaves the retroviral gag-pol
polyprotein essential for formation of infectious particles is an aspartyl protease and
is thus, a target of several protease inhibitors 115. The metalloproteases catalyze
reactions involving tissue remodeling and degradation. Of these, MMPs influence
growth and survival of neurons and oligodendrocytes. MMPs can disrupt myelin and
cause demyelination 116. Cellular sources of MMP in the diseased brain include
infiltrating leukocytes (lymphocytes and macrophages) and intrinsic cells (microglia,
astrocytes and neurons). MMPs have both beneficial as well as detrimental qualities
in the context of CNS diseases. Thus, caution must be exercised when using MMP
inhibitors without understanding their specificity with regard to the type of MMP
targeted as well as the phase of CNS disease when treatment is given. Nevertheless,
the damage caused by MMPs is immense and leads to a variety of inflammatory and
neoplasic disorders where MMP production is significantly increased at various
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 32
stages of the disease 116. Presumably by different mechanisms, MMP-9 and -12
mediate oligodendrocyte process extension, remyelination and maturation of
precursor cells into myelinating oligodendrocytes. MMP-9 does so by removing the
injury-induced deposition of inhibitory NG2 proteoglycan 117, that inhibits axon
regeneration 104. MMP-12, which is expressed on phagocytic macrophages, active MS
lesions, oligodendrocytes and to a lesser extent in astrocytes, is essential for process
extension as well as maturation of oligodendrocytes and it may possibly do so by
processing neuregulin, IGF-1 or IGF binding proteins and thyroid hormones 118.
MMP-7 and membrane type (MT)-4-MMP can also perform the role of TNF-α-
converting enzyme (TACE), converting the TNF-α precursor to its active form, thus
perpetuating inflammation. MMP-1 119 and MMP-2 120 are neurotoxic, directly or
indirectly by MMP-2 cleavage of CXCL12/SDF-1α releasing a neurotoxic form of
the chemokine 121. Also MMPs degrade laminin, the extracellular matrix substrate
leading to loss of integrin signaling and death due to cell detachment (anoikis) 122.
Another protease, myelencephalon-specific protease, abundant in neurons and
oligodendrocytes can affect neurite growth and affect oligodendrocyte survival 123.
In the nervous system, proteinase-activated receptors (PARs), which are a
family of GPCRs, are widely expressed on glial cells and neurons. PARs are activated
by proteolytic cleavage of their extracellular amino terminus unmasking a tethered
ligand that binds intramolecularly to the receptor, initiating a signal transduction
event. When expressed on CNS-derived cells, PAR2 contributes to the pathogenesis
of ischemia and neurodegeneration 124. However, enhanced PAR2 expression is
observed in MS and EAE, chiefly on perivascular macrophages and astrocytes. Mice
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 33
lacking PAR2 showed diminished disease severity, associated with lower T cell
reactivity and neuroinflammation 125. Thus PARs have diverse roles in various
diseases and specific antagonists to PAR2 may be beneficial in MS.
I.1.3.2.5. Oxidative stress
Several common pathways leading to oligodendrocyte damage can be
elucidated. Of these, oxidative stress plays an important role in death of
oligodendrocytes and neurons. Unregulated production of free radicals such as
hydrogen peroxide, NO, superoxide and highly reactive hydroxyl ions lead to cellular
oxidative stress 126. ROS in cells and tissue causes lipid peroxidation when free
radicals attack double bonds of unsaturated fatty acids such as linoleic acid and
arachidonic acid generating highly reactive lipid peroxy radicals that initiate a chain
of events leading to the formation of breakdown products including 4-hydroxy-2,3-
nonenal (4-HNE), acrolein, malonaldehyde and F2 isoprostanes which are increased
in neurodegenerative disorders. Acrolein, a lipid peroxidation product, down
regulates glutamate and glucose uptake, and 4-HNE inhibits the glutamate
transporter, EAAT1/GLT-1 127. DNA bases are also susceptible to oxidative damage
leading to mutations and forming 8-hydroxyguanine and 8-hydroxy-2-
deoxyguanosine suggesting selective attack on guanine bases by hydroxy radicals 128.
Protein oxidation impairs glutamine synthetase, superoxide dismutase and leads to
protein carbonyl formation that is toxic to cells 129. Oxidative stress products impair
cellular functions due to the formation of toxic species such as peroxides, alcohols,
aldehydes and ketones that are toxic to lymphocytes and blood vessel macrophages
130.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 34
Oligodendrocytes are vulnerable to a variety of mediators of cell death
including oxidative stress and glutamate excitotoxicity. When exposed to ROS,
oligodendrocytes are more vulnerable to injury than microglia or astrocytes.
Interestingly, lower endogenous antioxidant levels in oligodendrocytes may make
these cell types more vulnerable to oxidative stress than neurons 131. Free radicals
from virus-infected or Fc-receptor or intercellular cell adhesion molecule (ICAM)-1-
crosslinked macrophage/microglia are also cytotoxic to oligodendrocytes 132,133.
Moreover, mature oligodendrocytes are less sensitive to effects of NO than immature
oligodendrocytes 134. Thus, several mechanisms of oligodendrocyte death in MS have
been reported but the outcome of cell death in MS-necrosis or apoptosis remains
undefined.
I.1.3.2.6. Nitric oxide (NO)
NO is an essential intracellular and intercellular signaling molecule
participating in regulation of diverse pathophysiological mechanisms in
cardiovascular, nervous and immunological systems. NO acts as a neurotransmitter, a
host defense effector molecule and also as a cytotoxic free radical. It is
biosynthesized from L-arginine and molecular oxygen utilizing nicotinamide adenine
dinucleotide phosphate (NADPH) as a terminal electron donor and heme, flavin
mononucleotide (FMN), flavin-adenine dinucleotide (FAD) and tetrahydrobiopterin
as cofactors 135. NO production is catalyzed by nitric oxide synthases (NOSs) (130-
160 kDa) whose isoforms include, neuronal nitric oxide synthase (nNOS; NOS I),
inducible nitric oxide synthase (iNOS or NOS II) and endothelial nitric oxide
synthase (eNOS; NOS III). A mitochondrial or mtNOS has also been reported 136.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 35
The iNOS promoter has the binding sites for transcription factors, NF-κB,
and STAT 136. Activation of NF-κB regulates inflammatory gene expression,
including iNOS transcription. Physiologically relevant concentrations of NO
contribute to the balance between pro- and anti- apoptotic activity. High
concentrations of NO produced by iNOS can overwhelm cellular protection systems
and shift towards apoptosis whereas low concentrations (generated by eNOS and
nNOS) may be anti-inflammatory and anti-apoptotic. When biological systems have
an unequal balance between endogenous antioxidants and ROS, the resulting
oxidative stress can cause molecular damage and apoptosis, through p38 mitogen-
activated protein kinase (MAPK) activation and induction of p53 137.
Different isoenzymes of NOS are specific to certain cell-types of the body
and they each produce different redox states of NO. In the brain, glial iNOS
expression has been described after injury and pathology with both deleterious and
protective effects, and particularly in MS, iNOS immunoreactivity has been observed
in plaques 138. eNOS and nNOS are constitutively produced in resting cells and are
activated by Ca2+ and calmodulin while iNOS is induced by immunostimulation and
is Ca2+-independent. NO involved in pathogenicity is produced by all isoforms of
NOS 139. Macrophages isolated from active MS lesions display immunoreactivity for
all three NOS isoforms, eNOS, nNOS and iNOS, supporting NO production. NO
contributes to the cytotoxicity of oligodendrocytes and the destruction of myelin in
MS brain and spinal cord 140. iNOS is implicated in the pathogenesis of EAE, TMEV-
induced demyelination and MS. In chronic MS, astrocytes adjacent to inflammatory
lesions occasionally express iNOS. Other cells expressing iNOS include CD64+ and
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 36
CD14+ microglia/macrophages. Expression of iNOS contributes to tissue injury, BBB
breakdown, plaque formation and contribute to glutamate-induced neuronal
excitotoxicity. Endothelial cells are damaged by peroxynitrite as indicated by
nitrotyrosine formation. iNOS could thus be a part of a complex interaction between
components of the innate and inflammatory responses which contribute to
demyelination 84. nNOS is also produced by astrocytes 141,142 in the spinal cord and is
involved in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) toxicity in a
mouse model of Parkinson’s Disease 143. Thus, the contribution of NO by eNOS as
well as nNOS must be considered when studying the pathogenicity of NO using iNOS
deficient mice models.
The electrons in the outer molecular orbital of NO exist in 2 excitation
states: a low energy state called the triplet state and the high-energy state or the
singlet state. Singlet NO tends to react with thiol groups to form disulfide and
hydroxylamine, whereas triplet NO favours reaction with superoxide radicals,
producing peroxynitrite (ONOO−) 144. When nitrosative and/or oxidative stress is
coupled with decreased antioxidant levels, normal cellular metabolites can cause
deleterious effects that signal apoptotic cell death 144,145. High concentrations of NO
during inflammation can react with oxygen generating reactive nitrogen oxide
- intermediates (RNOIs) such as nitrogen dioxide (NO2), NO and ONOO , which react
with cellular proteins, lipids and carbohydrates resulting in oxidative damage
characterized by reduced levels of antioxidants such as glutathione, ascorbic acid and
uric acid 136.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 37
NO mediates pathophysiology primarily by altering the function of
biological macromolecules through covalent modifications. One of these metabolites,
protein-linked 3-nitrotyrosine (3-NT), is markedly elevated in various diseases
including MS 146. 3-NT, formed by nitration of tyrosine by reactive nitrogen species
derived from NO and nitrite are indicators of NO formation. Nitrogen dioxide can
convert hypochlorous acid (HOCl) to nitryl chloride that can form 3-NT, which is a
footprint of peroxynitrite-induced nitration. Free 3-NT is taken up by mammalian
cells and irreversibly incorporated only into α-tubulin, through a post-translational
mechanism catalyzed by tubulin-tyrosine ligase, a process that alters microtubule
function 147. Tyrosine nitration can induce structural (in neurons, it may disrupt
neurofilaments) and enzymatic alterations as it interferes with tyrosine
phosphorylation and hence, signaling. Close proximity of 3-NT as well as iNOS
immunoreactivity to the vessels may contribute to BBB damage, a cardinal feature of
active MS lesions, HIV-associated dementia (HAD) patients and disorders of striatal
neurodegeneration 148.
I.1.3.2.7. ER stress
Most secretory proteins and extracellular domains of transmembrane
proteins are cotranslationally transported in an unfolded state into the lumen of the
endoplasmic reticulum (ER), where resident enzymatic activities prevent these
nascent proteins from aggregating as they fold into their native conformations 149. If
demand exceeds the protein folding capacity, unfolded proteins accumulate in the ER
(called ER stress), which activates an ER-to-nucleus signaling pathway called the
unfolded protein response (UPR). This leads to transcriptional induction of
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 38
chaperones, oxido-reductases, phospholipid biosynthetic enzymes, ER-associated
degradation (ERAD) components and secretory proteins (Fig. 3). The aggregate
effect of UPR activation is containment and reversal of ER stress. UPR is associated
with global repression of translation through phosphorylation of eukaryotic initiation
factor (eIF) 2α, mediated by PERK (double-stranded RNA-activated protein kinase-
like ER kinase), while mRNA vital for adaptation to ER stress becomes
translationally privileged. The end effect of these responses is to afford proteins
passing through the ER a chance to fold to their native state, reduce the load on the
ER, disposal of unretrievable unfolded polypeptides through ERAD and increase
capacity for ER export and transport. If the ER stress is not contained, the UPR
directs the cell to an apoptotic pathway 149.
IFN-γ, produced by T lymphocytes and NK cells, is detectable during the
symptomatic phase of MS. Recently, it has come to light that the deleterious effects
of IFN-γ on developmental myelination are partly mediated by ER stress in
oligodendrocytes. Remyelination failure was modulated by PERK, an upstream
transducer of ER stress 150. Activation of PERK leads to phosphorylation of eIF2α at
serine 51 resulting in inhibition of general protein synthesis in order to reduce the
protein load in the ER. However, eIF2α phosphorylation also leads to activation of
activating transcription factor (ATF)-4, which induces the expression of growth
arrest- and DNA damage-inducible gene/C/EBP homologous protein
(GADD153/CHOP). The latter is a dominant-negative inhibitor of the
CCAAT/enhancer-binding proteins (C/EBP) and is a negative regulator of the anti-
apoptotic protein, Bcl-2 and its expression facilitates apoptosis 151. Another ER stress
Chapter 1: Introduction and Literature Review
UPR target genes Transcription factor
Nucleus P P PERK P P Transcription factor
IRE1
BiP Correctly Folded proteins Misfolded proteins
ER lumen ERAD ATF6 Proteasome
Fig. 3: The proximal ER stress transducers ATF6, IRE1 and PERK associate with BiP in the active state. Upon accumulation of unfolded/misfolded proteins in the ER lumen, these sensors are activated leading to expression of genes that encode proteins that enhance ER protein folding capacity, while ERAD is accelerated to remove terminally misfolded proteins (Adapted from Wu, J and Kaufman RJ, 2006)
39 Chapter 1: INTRODUCTION AND LITERATURE REVIEW 40
sensor, ATF6, resides in the ER membrane with a cytosolic amino-terminal domain
and an ER luminal carboxy terminal domain. Upon activation, the amino-terminal is
proteolytically cleaved and the cleaved portion translocates to the nucleus,
cooperating with other proteins to form complexes that induce the expression of
chaperones. One of the up-regulated genes is X-box-binding protein (XBP1), a
substrate of high inositol-requiring enzyme 1 (IRE1). IRE1 is a protein with an ER
luminal amino-terminal domain, a transmembrane domain, a serine/threonine kinase
domain and a carboxyl-terminal endonuclease domain in the cytoplasm. Under ER
stress, IRE1 oligomerises, autophosphorylates, and removes an intron from the XBP1
mRNA, resulting in a transcription factor that activates target genes 151. IRE1
transmits a signal via apoptosis signaling kinase, JNK and also recruits TNF-
receptor-associated factor (TRAF)-2. This cascade triggers caspase-12 activation and
subsequent apoptosis 152.
In mammalian cells, phosphorylation of eIF2α leads to up-regulation of
the master chaperone, glucose regulated protein/immunoglobulin heavy chain-binding
protein (Grp78/BiP), which binds to properly folded and misfolded proteins. In
normal cells, Grp78/BiP associates with luminal domains of its mediators, PERK,
ATF6 and IRE1 but under stress conditions, Grp78/BiP is sequestered to proteins in
the ER where its mediators are released. These components serve to reduce the levels
of newly synthesized proteins translocated to the lumen of the ER, enhances protein-
folding capacity and secretion potential of the ER to facilitate transport and
degradation of ER-localized proteins 151. Grp78/BiP release from ATF6 leads to the
translocation of the latter from the ER to the Golgi apparatus, where it is cleaved and
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 41
activated. This stimulates transcription of genes encoding chaperones that refold
misfolded proteins 153. This also leads to decreased protein synthesis and increased
production of ER chaperones and activation of ERAD, which shunts misfolded
proteins to the proteasome. Grp78/BiP thus monitors the folding status of proteins in
the ER and regulates the UPR response to stress 154,155.
I.1.4. Drawbacks of EAE as a model of MS
Since the first experiments by Rivers 156, in which autoimmune
neuroinflammation and demyelination were observed, many animal models have been
used to study MS. MBP, proteolipid protein (PLP), MAG, MOG and S100 proteins
are the major known CNS antigens that elicit an immune response and behavioural
phenotype resembling MS in mice. EAE is said to be a good model for acute
disseminated encephalomyelitis (ADEM), where there is acute monophasic illness
compared to chronic relapsing disease course in MS 157. Among other features, the
disease pathology in EAE is aggravated when MOG is injected along with anti-MOG
antibodies, suggesting a role for the humoral response 158. CD8+ T cells rather than
CD4+ T cells characterize the immune response to MOG in certain mice strains; CD4+
T cells that dominate the perivascular regions, however, characterize EAE induced by
MBP and PLP. It has also been contended that in MS, CD8+ T cells and macrophages
are the predominant cells, while CD4+ T cells are infrequent. Thus, a collective
agreement regarding the predominant T cells in MS pathogenesis seems to be lacking.
CD8+ T cells are found in close association with myelin membranes suggesting a
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 42
possible role in tissue damage, but though these MOG-reactive CD8+ T cells can
induce EAE, their role is only now being investigated intensively in MS 99.
The traditional ‘outside to inside’ hypothesis of myelin-specific T cell
trafficking to the CNS to induce pathology as seen in EAE was challenged by studies
demonstrating death of oligodendrocytes before inflammation in the brain of MS
patients, suggesting that inflammatory responses in MS brain may be an
epiphenomenon or a response to factors in the brain that initiate oligodendrocyte
death 159. Though a decrease in cell numbers was demonstrated, immunotherapy
+ directed against CD4 T cells has also failed. Therapeutic modulation of TH1 cells to
TH2 cell phenotype must be cautioned as TH2 cells are found in aggressive lesions.
Multiple therapeutic drugs have successfully been implemented in
ameliorating EAE in mice (Table 1), with no subsequent therapeutic benefits for MS
patients. Further, several approaches have also been established for promoting
remyelination, ranging from stem cells 160 to immunoglobulins 161. The dynamics of
disease progression in MS, the ability of the CNS to remyelinate itself and the failure
of several established therapeutics suggest that we should examine the disease
without the constraints of EAE, particularly focusing on genetics, epidemiological
and imaging studies in humans and examine issues outside the autoimmune
hypothesis 157.
I.1.5. Genetics of MS
Epidemiological studies have provided evidence for environmental factors
in the disease process. MS relapses are frequently associated with common viral
43
Table 1: Therapeutics employed in EAE (From Sriram and Steiner, 2006)
Compound Target Antibodies to T-cell surface antigens CD3, CD4, T-cell receptor, CD2, IL-2R, CD24, CD40L, CD28 Antibodies to APCs MHC class II, CD40, B7-1, B7-2, Fc receptor blockage Antibodies to NK cells Anti-NK cell antibody, α-Gal ceramide Antibodies to adhesion molecules VLA-4, ICAM-1, LFA-1 Antibodies to cytokines IL-2, IL-6, IL-12, IL-15, TNF-α, IL-1, IL-23 Antibodies to chemokines Anti-MIP-1-α, RANTES Anti-inflammatory cytokines IL-4, IL-10, TGF-β, IFN-β, IFN-α, IFN-γ Antagonists of signaling molecules Tyrphostins (JAK-STAT inhibitors), lysofyline, MAPkinase inhibitors, inhibitors of NF-κB and iNOS activation, amsamysin, cholera toxin, AMPA antagonists, glutamate antagonists, IL-1 receptor antagonists Activation of nuclear receptors PPAR-γ, retinoic acid Hormones Estrogen, progesterone, Vitamin D, DHEA, leptin antagonists Antibiotics Minocycline, rapamycin Anti-metabolites and immunosuppressants FK-506, cyclosporine, dyspergualin, corticosteroids, azathioprine, cyclophosphamide, mycophenolate, bone- marrow transplantation Gene therapies Targeted delivery of IL-4 and IL-10 Enzyme inhibitors HOMG co-reductase inhibitors (statins), COX-2 inhibitors Peptides/proteins Oral myelin proteins, omega-3 fatty acid, curcumin, padma-28, fish oil Small organic molecules Linomide, silica, sodium phenyl acetate, copper chelators (N- acetylcysteine amide), laaquinamod, piperazylbutroxide, uric acid, dermatan sulphate, aminoguanidine, cuprizone, roliprim, H-2 receptor antagonists, indoleamine 2-3 deoxygenase, FTY- 270, pentoxyfyline Miscellaneous Incomplete Freund’s adjuvant, BCG vaccination, Helminthic infections , Glatiramer acetate Chapter 1: INTRODUCTION AND LITERATURE REVIEW 44
infections and migration from low-to-high risk areas exacerbates the risk of
developing MS. A viral infection may initiate MS, presumably an autoimmune
disease 162. Thus, both genetic and environmental factors seem to contribute to
development and progression of the disease 163. MS exhibits several characteristics
that are common to autoimmune diseases including polygenic inheritance, evidence
of environmental exposure, increased frequency in women, and partial susceptibility
conferred by a HLA-associated gene 164. Despite substantial evidence for polygenic
inheritance, the MHC-containing HLA is the only region that has clearly and
consistently demonstrated linkage and association in MS genetic studies.
Susceptibility to MS involves a significant number of different genes, each with a
relatively small contribution. Particularly, MHC genes, namely HLA-DRB1 and
HLA-DQB1 showed strong associations with MS in Canadian and Finnish cohorts
165. The strongest linkage result is on chromosome 1q44 with an increase in the
multipoint Logarithm of the Odds (LOD) score and also to other autoimmune
diseases such as systemic lupus erythematosus and rheumatoid arthritis 166. In
addition, there is a potential presence of an MS susceptibility locus on chromosome
7q21-22, delineated by the markers D7S3126 and D7S554. Interestingly, within this
region, there are 2 putative genes, protachykinin-1 precursor gene (TAC1, pos.
37,224–41,031 in Genbank entry AC004140) and Thymosin-β4, which constitutes a
multigene family of IFN-inducible proteins (Genbank entry M17733). TAC1 encodes
four products of the tachykinin peptide hormone family, Substance P and neurokinin
A, as well as the related peptides, neuropeptide -K and -γ 167. An etiological role for
Substance P in CNS inflammation, such as seen in MS, is likely since Substance P is
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 45
an inflammatory mediator. Astrocytes express the high-affinity NK-1 Substance P
receptor 168. In astrocytes, Substance P induces secretion of IL-8 through the NF-κB
activation pathway 169, and of IL-6 through the p38 MAPK pathway 170. In the
context of my thesis, however, the importance of chromosome 7q21-22 lies in the
fact that it also contains the ancestral proviral copy of HERV-W7q, which
encodes Syncytin-1 7.
I.1.6. Environmental factors in MS
I.1.6.1. Infectious agents in MS pathogenesis
Application of sophisticated molecular tools has led to identification of
several viruses that show association with MS. No pathogen has nonetheless been
accepted as the causal agent of MS. Studies related to virus infection in MS are
serological and are demonstrated by antibody titers against a particular virus, though
it has not been elucidated whether these antibodies are elevated in response to the
etiological agent or if it’s an epiphenomenon. It can be said that inflammatory
mediators and/or demyelination of axons block impulse conduction leading to clinical
manifestations of exacerbations. These inflammatory mediators may include IFN-γ
and IL-12, cytokines that are induced in response to active infection 171. A
prospective study identified that there was worsened neurological damage during
exacerbations with onset around the time of clinical infection than that of non-
infection. Infections contributing to increased clinical activity were supposedly of
viral origin in the upper-respiratory tract, self-limiting and mild, but may also include
pathogens such as Chlamydia pneumoniae and Mycoplasma pneumoniae, that mimic
viral pathogens 172 173.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 46
I.1.6.2. Demyelinating viruses
Following infection and a long period of latency, a virus can be
reactivated and affect oligodendrocytes as in PML caused by JC virus infection. A
virus can also initiate an acute or sub-acute demyelinating immunopathology, as in
the case of Theiler’s murine encephalitis virus (TMEV) model of demyelination. The
mechanisms by which viruses induce autoimmunity include molecular mimicry,
epitope spreading and bystander activation. Molecular mimicry involves the de novo
activation of autoreactive T cells due to cross reactivity between self and viral
epitopes during a virus infection. The recognition of self-antigens at moderate affinity
levels can lead to positive selection and export to the periphery. However, when these
potentially self-reactive T cells cross-react with foreign antigens, they can be
activated and recruited into the nervous system. Based on structural studies, for
molecular mimicry to take place, minimum contact motifs between MHC and TCR is
sufficient.5 This was further clarified by studies in which viral and bacterial peptides
sharing contact motifs led to activation of MBP-specific T-cell clones in MS patients
174. Examples of such mimicking antigens include TMEV and the myelin component,
galactocerebroside 175. Also, a non-pathogenic strain of TMEV mimics the
immunodominant epitope of the myelin protein, PLP139-151, with subsequent
demyelination in the absence of adjuvants such as complete Freud’s adjuvant (CFA),
which imposes an artificial inflammatory environment 176.
Epitope spreading occurs when the immune response from an initiating
antigenic epitope widens to different epitopes on the same molecule (intramolecular
spreading) or to epitopes on a different antigenic molecule (intermolecular
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 47
spreading). For example, cells responding to PLP139-152 isolated from lymph nodes of
TMEV-infected mice have the ability to demyelinate organotypic spinal cord cultures
177. The third mechanism, bystander activation, is the non-specific activation of T
cells resulting from direct inflammatory and/or necrotic effects of virus infection of
tissue in the target organ. Destruction of affected tissues would release sequestered
antigens with increased local inflammation followed by recruitment of activated
lymphocytes, which are not responsible for the initial insult or reactive to the viral
antigens 178.
Myelin-specific CD4+ T cells can potentially cross-react with foreign
antigens such as viral peptides, a process called molecular mimicry, in which self-
reactive T cells become activated by infectious agents to mediate an autoimmune
process. Chronic inflammatory demyelinating disease induced by TMEV is an
example of an acquired acute or persistent infection of neural cells that could result in
release of tissue antigens, provoking a disease relevant autoimmune response. Mouse
hepatitis virus (MHV)-infected mice exhibit chronic demyelinating encephalomyelitis
characterized by mononuclear cell infiltrates. CD8+ and CD4+ T cells are crucial for
controlling the virus while B cells and antibodies are involved to a lesser extent 179.
I.1.6.3. Retroviruses and MS pathogenesis
A retroviral cause for MS was postulated when 70% of MS patients had
cross-reactive antibodies to Human T lymphotropic virus (HTLV-1/2) and Human
Immunodeficiency virus (HIV) antigens 180, although subsequently disproven 181.
Furthermore, there are unconfirmed reports of isolation of HTLV-1-related nucleotide
sequences in cells from the CSF of some MS patients 182. Among retroviruses to be
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 48
associated with MS, probably MSRV is the most intensely studied. MSRV was
initially called LM7 virus, an oncovirus, isolated from the leptomeningeal LM7 cells
obtained from the CSF of a patient with MS 183. However, there is substantial
controversy as to whether MSRV is an endogenous or exogenous virus 184. MSRV
belongs to the ERV9 family of endogenous retroviruses (ERVs), and partial
molecular characterization revealed that MSRV has 75% homology to ERV9 185. In
fact, the MSRV envelope shares about 87% amino acid identity with the human
endogenous retrovirus (HERV)-W7q envelope protein, Syncytin-1
(www.ncbi.nlm.nih.gov). Using MSRV probes obtained from virion-associated RNA,
a novel HERV family was identified that is different from ERV9 and genetically
related to MSRV sequences and was named HERV-W 186,187. The pathogenicity of
MSRV retroviral particles has been evaluated in severe combined immunodeficiency
(SCID) mice grafted with human lymphocytes and injected intraperitoneally with
MSRV virion. MSRV-injected mice suffered acute neurological symptoms and died
within 5 to 10 days post injection. In ill animals, reverse transcription-polymerase
chain reaction (RT-PCR) analyses showed circulating MSRV RNA in serum, with
overexpression of TNF-α and IFN-γ in spleen 188. This in vivo study suggests that
MSRV retroviral particles from MS cultures have potent immunopathogenic
properties mediated by T cells corroborating previously reported superantigen activity
of HERVs in vitro, which appear to be mediated by overexpression of
proinflammatory cytokines 189.
The in vitro production of retrovirus particles (RVP) in cell cultures from
MS patients but not healthy controls may be enhanced or activated by infectious
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 49
triggers such as Herpesviruses (e.g. herpes simplex virus (HSV), EBV). Independent
molecular analysis of retroviral RNA associated with RVP revealed two different
genetic families of endogenous retroviral elements: MSRV/HERV-W and
RGH/HERV-H. Retroviral particles of the latter were found to be transmitted to
mitogen-stimulated lymphocytes from healthy donors 190,191. Though this study was
not confirmed, it suggests that one or more retroviruses may be associated with MS.
Production of pathogenic molecules has been associated with retroviral
expression 192, especially the envelope protein 193. It has been postulated that there
may exist a pathogenic 'chain-reaction' in MS involving several step-specific
pathogens interacting with particular genetic elements leading to enhanced retroviral
expression 194. However, there is no conclusive proof that any human endogenous
retroviruses (HERVs) play a role in human disease, although investigators have
postulated several possible pathogenetic mechanisms. HERVs, for example, could
enhance the transcription of cellular genes downstream of HERV-long terminal
repeats (LTR) that contains the promoter elements. HERVs have been postulated to
encode superantigens that result in enhanced inflammatory responses, or mimic self-
antigens leading to autoimmune pathologies such as lupus or MS 195. Increased
expression of the HERV-W env-encoded glycoprotein, Syncytin-1, in astrocytes was
found to induce ROS that mediated oligodendrocyte toxicity 196. Moreover, Syncytin-
1 expression was enhanced by HSV-1 infection 197. Yet expression of these
endogenous retroviruses are seen in several neuroinflammatory diseases including
MS, with no specific disease pathology 198, suggesting that HERVs found in MS are a
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 50
by-product of the inflammatory component of MS, diluting the contention of some
researchers that HERVs are a causative pathogen of MS 195.
Due to its partial immune-restricted environment, the CNS is particularly
vulnerable to immune mediated damage. In this context, leukocyte infiltration into the
CNS is a double-edged sword with excessive responses leading to irreparable
secondary damage while a hypoimmune response fails to eliminate the pathogen.
Demyelination and neurodegeneration are some of the immune-mediated outcomes
that occur while inflammation-induced apoptosis and activation of neural cells to
stimulate neurotrophic factor production enhances brain repair. The latter
phenomenon is collectively called protective autoimmunity and can be defined as a
physiological response elicited by a threatening situation in the CNS, which is
beneficial but, if impaired, can lead to autoimmune disease. Tolerance to self is not a
state of non-responsiveness but, rather, is an ability to tolerate an autoimmune
response to self-antigens without developing an autoimmune disease 199. Thus,
inflammation can lead to acceleration of brain repair process that ensures longevity of
intrinsic cells in the CNS cells. In the light of several recent studies 45,99,179, more
important than ever, there is a need for better mouse models of MS that actually
reflects the pathogenesis, so that rational therapies can be designed. I have tried to
address this issue by developing another mouse model for studying MS, wherein a
HERV protein is transgenically expressed in the brain. The rationale being that
though HERVs do not cause MS, they participate in the pathogenesis and blocking
HERV function through specific therapies may aid in slowing down the progression
of MS. Having reviewed various components of the neuroinflammatory pathway, I
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 51
will now discuss the relevance of these cascades in the context of MS and how
retroviral pathogenesis has modified our understanding of neuroinflammation.
1.2. Retroviruses: Introduction
Global health is threatened by the emergence of new infectious agents that
have the potential to cause neurological infections 200. Microbial evolution due to
adaptive changes in host or ecological niches further contributes to disease, which
becomes unmanageable by drugs. Among these infectious agents, the Human
Immunodeficiency virus (HIV) retrovirus that causes acquired immunodeficiency
syndrome (AIDS) has devastated economies and threatened livelihoods globally.
Several strategies to eradicate HIV have proven to be futile due to inherent properties
of the virus. Indeed, retroviruses have attracted considerable attention over the past
century with the recognition of their contribution to cancer, infectious diseases and
other facets of virology. Thus far, 3 Nobel Prizes have been awarded for studies of
retroviruses including Peyton Rous (1966), David Baltimore, Rennato Dulbecco and
Howard Martin Temin (1975) and Michael Bishop and Harold Varmus (1989). The
immense impact of retroviruses on our understanding of health and disease makes
these the most pathogenic infectious agents known.
Retroviruses possess a unique replication cycle, which directly or
indirectly leads to formation of diverse strains with different pathogenic effects. Host-
virus interactions result in benign infections to fatal consequences. Retroviruses are
unique in that they acquire and alter the structure of host-encoded sequences leading
to oncogenesis in some cases. Upon insertion into the host genome, retroviruses
behave as transposable elements, thus affecting evolutionary processes. In addition to
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 52
being investigated for diseases, scientists have harnessed the ability of retroviruses to
serve as vectors of foreign genes for therapeutic purposes 201. There is an increasing
trend in using viral vectors for gene therapy in the brain. Retrovirus vectors make a
good choice for gene transfer since they integrate into the target cell genome to
promote stable gene transfer and integration is precise, resulting in unrearranged
transfer of the target genes. A key element in retroviral vector design is the viral
envelope protein, as it is this protein that binds to specific cell-surface proteins and is
the primary determinant of the range of cells that can be transduced by the vector.
The virus from which the envelope protein is derived is known as the pseudotype of
the vector 202. Lentiviral vectors can transduce (gene transfer and expression mediated
by replication-incompetent vectors) both dividing and non-dividing cells. Further,
retrovirus vectors can be designed to eliminate specific viral protein coding regions
without affecting gene transfer rates and can be made in the absence of replication-
competent virus by using retrovirus packaging cell lines which supply all of the viral
proteins required for vector transmission 202.
I.2.1. Genomic and structural organization
Retroviruses are single-stranded RNA viruses that replicate through a
double-stranded DNA intermediate 203. Retrovirus particles consist of the viral protein
core consisting of the reverse transcriptase and integrase enzymes necessary for
replication. Surrounding the core is the viral envelope, made up of a cellular
membrane-derived lipid bilayer and viral-encoded envelope glycoproteins. The
retrovirus genome is approximately 10 kb and is contained within the structural core,
in association with the nucleocapsid protein, surrounded by the capsid protein outside
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 53
of which is the matrix protein. The genome consists of two positive sense identical
RNA molecules that are contained within the viral particle (Fig. 4). The 5’ end of the
genomic RNA begins with the “r” (for repeat) and “u5” (for unique 5’ region)
segment followed by the viral genes gag, pol, and env. The 3’ end of the genomic
RNA terminates with the u3 (for unique 3’ region) and r (identical to the 5’ R region)
regions and a polyA tail. Each end of the proviral genome consists of regions called
LTRs, which contain the U3, R and U5 regions. This rearrangement at the termini
enables appropriate expression of viral genes. The U3 region of the 5’-LTR contains
the viral promoter and enhancer at the 5’-U3/R from where the transcription of the
viral genome is initiated. In a simple retrovirus, the gag and pol genes are expressed
from an unspliced transcript while the env gene is expressed from a spliced transcript.
The splice donor (SD) is situated between the 3’ end of the 5’-LTR and the 5’ end of
the gag gene, while the splice acceptor (SA) is located at the 5’ end of the env gene.
The transcription terminal polyadenylation signal is situated in the 3’-LTR. The gag
gene encodes viral core structural proteins: matrix, capsid and nucleocapsid. The pol
gene encodes the viral replication enzymes: protease, reverse transcriptase and
integrase. The env gene encodes the envelope glycoprotein, which is processed into
the transmembrane (TM) and surface (SU) subunits 201 (Fig. 5).
I.2.2. Classification
Classification of retroviruses is based on sequence identity and functional
properties or genomic organization in simple and complex structure. There are 7
genera (Fig. 6) 204. The exogenous horizontally or vertically transmitted viruses
including feline (FeLV) and murine leukemia viruses (MuLV), HTLV-1/2, HIV-1/2
Chapter 1: Introduction and Literature Review
Nucleocapsid Surface unit (SU)
Capsid
Transmembrane Protein (TM)
Reverse transcriptase Matrix
Envelope
Diploid ss (+) RNA genome Integrase
Fig. 4: Schematic of a retrovirus
54 Chapter 1: Introduction and Literature Review
gag env
pol SU TM 5’ LTR 3’ LTR PR RT IN U3 R U5 U3 R U5
Fig. 5: Typical proviral structure with identical 5’ and 3’ LTRs. Genes illustrated are shared by all replication-competent retroviruses. The horizontal arrow marks the start site of transcription. The arrowhead denotes the site of 3’-end processing and polyadenylation in the RNA transcript. All viruses synthesize full- length genomic RNA. In simple retroviruses, only a single splice donor or, occasionally, two splice acceptors are used. In complex viruses, multiple spliced products are found.
55 Chapter 1: Introduction and Literature Review
Epsilonvirus:WDSV CAEV Spumavirus: (HSRV) VMV Gammaretrovirus: MuLV EIAV FIV lentiviruses HIV -1 SIVagm HIV-2 primate non- primate SIVmac Betaretrovirus: MMTV, HERV
Class I: HERV-W
Alpharetrovirus: RSV Class II: HERV-K Deltaretrovirus:HTLV Class III: HERV-L
• 1. Alpharetrovirus-eg. Avian leucosis virus • 2. Betaretrovirus- eg. Mouse Mammary Tumor virus • 3. Gammaretrovirus-eg. Murine and Feline Leukemia virus, • 4. Deltaretrovirus-eg. Bovine Leukemia virus, Human lymphotropic virus • 5. Epsilonretrovirus-eg. Walleye dermal sarcoma virus • 6. Lentivirus -eg. HIV, SIV, FIV • 7. Spumavirus- eg. Chimpanzee foamy virus
Fig. 6: Schematic of Retroviral Classification (Adapted from Power C; 2001) 56 Chapter 1: INTRODUCTION AND LITERATURE REVIEW 57
etc. are pathogenic while most endogenous retroviruses are not 201. Early
classification of HERVs was based on the tRNA specificity of the primer binding site
by adding the one-letter code for the specific amino acid to HERV 205 but due to
redundancy in usage of tRNA, this system has been abandoned. Current classification
is based on sequence identity to known exogenous retroviruses and also to copy
numbers (Table 2) 206,207.
I.2.3. Retroviral Biology
Retrovirus infection is initiated by the binding of the viral envelope
glycoprotein to host cell surface molecules, which act as viral receptors. Binding of
envelope protein to a cell surface receptor is the first obstacle for the establishment of
an infection. Thus, envelope/receptor binding in part determines viral tropism.
However, various postbinding events and cell factors, independent of cell surface
receptors, influence the outcome of completion of the retroviral replication cycle and
thus impact on tropism. The envelope glycoprotein exists as an oligomeric complex,
usually a trimer. Binding of the SU protein to specific cell surface receptors initiates
conformational changes in the SU protein that result in the exposure of a fusogenic
domain in the TM protein. The fusion domain is responsible for the fusion of the
virus and host cell membranes, followed by release of viral genetic material into the
host cell (Fig. 7).
After the viral genome is uncoated, the viral reverse transcriptase initiates
minus strand synthesis using the RNA genome as the template. During reverse
transcription, the u3 and u5 regions are duplicated such that the 5’ and 3’ ends of the
proviral genome differ in structure from the ends of the RNA genome. A cellular
58
Table 2: Classification of HERVs in the genome (From Gifford and Tristem, 2003)
HERV Family Primer Copy number Class I HERV.Z69907 ND 30 HERV.ADP tRNA Thr 60 HERV.E tRNA Glu 85 HERV-F tRNA Phe 15 HERV-F (Type B) tRNA Phe 30 HERV-FRD tRNA His 15 HERV-H TRNAHis 660 HERV-H49C23 NO LTRs 70 HERV-I tRNA Ile 85 RRHERV-I TRNAIle 15 ERV-9 tRNA Arg 70 HERV-F (Type C) tRNA Phe ND HERV-P tRNA Pro 70 HERV-R tRNA Arg 15 HERV-R (Type B) tRNA Arg 15 HERV-T tRNA Thr 15 HERV-W tRNA Thr 115 HERV-XA tRNA Trp 15 Class II HERV-K.HML1-4 tRNA Lys 170 HERV-K.HML5 tRNA Ile 45 HERV-K.HML6 tRNA Lys 70 HERV-K.HML9 ND ND Class III HERV-L tRNA Leu 575 HERV-S tRNA Ser 70 HERV-U2 ND ND HERV-U3 ND ND Chapter 1: Introduction and Literature Review
Exogenous retrovirus
INFECTIOUS VIRUS
BUDDING INFECTION TRANSCRIPTION TRANSLATION AA mRNA GAG, POL PROVIRUS
cDNA REVERSE INTEGRATION TRANSCRIPTION
TRANSCRIPTION AA REVERSE mRNA TRANSCRIPTION TRANSLATION cDNA RE-INTEGRATION GAG, POL BUDDING
Endogenous retrovirus ?
59 INFECTIOUS VIRUS
Fig. 7: Life cycle of endogenous and exogenous retroviruses (Adapted from Lower, Lower and Kurth, 1996) Chapter 1: INTRODUCTION AND LITERATURE REVIEW 60
tRNA is used as a primer, which is bound to the primer binding site located
downstream of the 5’-LTR. Upon strand transfer of the reverse transcriptase, a
nascent DNA strand is formed for synthesis to continue. DNA synthesis is initiated by
utilization of the polypurine tract (ppt) at the 3’ end of the genome. The reverse
transcriptase transfers to the second identical RNA genome, but not in all cases and
completes the reverse transcription step with LTRs at either end of the full-length
double stranded DNA proviral copy.
Following reverse transcription of the RNA genome into a double-
stranded cDNA molecule, the cDNA form of the viral genome is integrated into the
host cell chromosomal DNA as the provirus. The provirus is integrated into host
genome by a processes known as 3’-processing and strand transfer 208 and is mediated
by the viral integrase enzyme, which is encoded by the pol gene. During 3’-
processing, which takes place in the cytoplasm within the pre-integration complex
(PIC), integrase removes a pGT dinucleotide at the 3’ end of each LTR that is
adjacent to a highly conserved CA dinucleotide. PIC contains linear viral DNA and
several viral proteins including matrix, reverse transcriptase, integrase and
nucleocapsid 208. Strand transfer occurs in the nucleus following the nuclear import of
the PIC. Integrase mediates a nucleophilic attack by the 3’-OH residues of the viral
DNA on phosphodiester bridges located on either side of the major groove in the host
DNA. In a single transesterification reaction, the processed CA-3’-OH viral DNA
ends are ligated to the 5’-O-phosphate ends of the target DNA, forming a gapped
intermediate product in which the 5’-phosphate ends of the viral DNA are not
attached to the 3’-OH ends of the host DNA, as the 3’ ends of the target DNA are not
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 61
joined after strand transfer. The integration process is completed by cleavage of the
unpaired dinucleotides from the 5’ ends of the viral DNA and repair of the single-
stranded gaps created between the viral and target DNA by host-cell DNA-repair
enzymes (Fig. 7). Transcription during the late phase produces the full-length viral
RNA, which is capped at the 5’ end and polyadenylated at the 3’ end by the cellular
machinery and transported to the ribosome. Translation of the unspliced RNA
produces the viral gag and occasional read-through, gag-pol proteins, which assemble
and bud to form immature particles. The actual site of initial genome recognition and
binding is unknown. Proteolytic cleavage of gag by the viral protease produces the
matrix, capsid and nucleocapsid proteins, which rearrange to form the mature particle
209. Retroviruses thus exist as RNA-containing infectious virions and as DNA
proviruses, which may be active or silent 201.
I.2.4. Retroviral Pathogenesis in the Nervous System
Retroviruses represent a group of highly pathogenic infectious agents that
are associated with the development of neurological disease depending on the
individual virus and its host 193. Indeed, human exogenous retroviruses, including
HIV-1/-2 and HTLV-1/-2 viruses, cause neurological disorders involving both the
CNS and peripheral nervous system (PNS) 210-214. Retroviral infections frequently
lead to nervous system disease but HIV-1 infection exhibits the broadest range of
associated neurological phenotypes, which are associated with immunosuppression
and increased HIV-1 molecular diversity within the host. The underlying mechanisms
by which infection and disease occur during exogenous retrovirus infections of the
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 62
nervous system have consistently implicated the amino acid sequence and level of
expression of retrovirus-encoded envelope proteins 215.
Along with host neurosusceptibility, neuropathogenic mechanisms
underlying retroviral infections of the nervous system can be defined by
neuroinvasion, neurotropism and neurovirulence of virus 216. Age, species, immune
status and genetic background determine the host’s vulnerability to HIV-induced
neurological disease. Genetic variation in CCR5, TNF-α and APOE genes, extremes
of age and immunodeficiency characterized by progressive loss of CD4+ cells are
factors that lead to neurosusceptibility to HAD 217,218. The ability of retroviruses to
infect neural cells is neurotropism, which is in part cell-type specific and is dependent
on expression of receptors that mediate viral entry and the viral strain. In the CNS,
HIV infection predominantly occurs within macrophages and microglia. HIV-1
macrophage tropism is correlated with CCR5 while the chemokine receptor CXCR4
suggests T-lymphocyte tropism, though dual-tropic HIV-1 capable of using both
these chemokine receptors have also been identified. Neurovirulence is the capacity
of the virus to cause disease within the nervous system and this involves both host-
and virus-specific factors. Among properties of viruses, variation at the nucleotide
and protein sequences in certain viral genes determines lentivirus-induced disease.
Mediators of host immune response such as cytokines, chemokines, cellular and
humoral immunity that comprise the innate and adaptive immune systems as well as
soluble factors contribute significantly to neuropathogenesis 216.
Retroviral infections might lead to cell death through several ways:
immune system-mediated killing of infected cells, direct toxicity of a virus gene
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 63
product, extensive replication of the virus causing break-down in cell survival and
indirect effects of virus gene products on cell-cell communication 201. Retroviral env
genes encoding structural proteins necessary for cell-surface binding and cell-entry
are also implicated in direct neuronal killing or indirectly through activation of glial
cells that release neurotoxins. Both the adaptive and innate arms of the immune
system can be activated by neurotropic retroviruses; the former consisting of T and B-
lymphocytes and the latter, macrophage/microglia and astrocytes. In the next section,
I will discuss how retroviruses are specifically involved in 2 pathways of
neurodegeneration that are of relevance to my thesis.
I.2.4.1. Retrovirus and Nitric oxide
NO has a dichotomous role in HIV infection; low levels of NO can inhibit
HIV-1 while high levels can induce viral replication and also induce neuronal injury
through apoptosis of neuronal cells, oxidative damage and immune depletion of
lymphocytes and dendritic cells (DCs) leading to immunosuppression 219. Studies
have implicated NO as a key mediator in numerous pathophysiological and
neurodegenerative diseases including HIV-associated dementia (HAD) 220. NO is
vital in inducing innate immunity against virus directly or indirectly (through IFN-γ)
and can inhibit replication of the retroviruses, Friend murine leukemia virus (F-
MuLV) and HIV-1 221. It does so by deamination of viral DNA 221, nitrosylation of
viral cysteine proteases, essential for viral virulence and replication and also by
inhibiting reverse transcriptase by modulating catalytic activity of cysteine residues.
Also, NO reacts with iron-containing proteins and interferes with the function of
several ribonucleotide reductases that induce cytostatic properties 221. HIV replication
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 64
in astrocytes is not productive because NO binds to NFκB, preventing its binding to
HIV-LTR 222.
Another retrovirus, PVC-211, a variant of leukemia-inducing F-MuLV,
primarily targets brain capillary endothelial cells (BCEC), which are resistant to F-
MuLV infection, but not reactive astrocytes and degenerating neurons. Toll-like
receptor (TLR)-4 expressed on microglia and BCECs could interact with viral
envelope to activate NFκB and induce NO. At the early stages, NO may be protective
by inhibiting viral replication 223. NO generated by iNOS has been shown to inhibit
leukocyte adhesion and also proliferation of T cells in the CNS, and, as a result,
MuLV-induced degeneration is not associated with inflammation or infiltration of
leukocytes 223.
I.2.4.2. Retrovirus-mediated ER stress
Viral infection of mammalian cells elicits cellular responses, such as ER
stress and IFN responses 224. Viruses have evolved mechanisms to challenge these
responses that limit/inhibit viral replication. The ER is an essential organelle for viral
replication and maturation and in the course of a productive infection, many viral
proteins are synthesized in infected cells, where unfolded or misfolded proteins
activate the ER stress response 224. Several viral proteins trigger Grp78/BiP
expression during infection, which in turn associates transiently with folding
intermediates of viral glycoproteins. This binding facilitates folding or assembly of
viral proteins along the maturation process 224. Hepatitis C replication stimulates the
ATF6 pathway, but suppresses the IRE1-XBP1 pathway 225. This favours translation
of viral proteins. There is an increased level of Grp78/BiP, which may be stimulated
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 65
by viral replication. Infection by cytomegalovirus transiently induces Grp78/BiP at
early stages but returns to basal levels at the later stage. This coincides with
expression of other markers of UPR. Increased Grp78/BiP at the early stages inhibits
the stress response by interacting with PERK, ATF6 and IRE1. Thus the virus seems
to be inducing Grp78/BiP in order to control ER stress 224.
Caspase-12 is an initiator caspase required for transduction of the death
signal from the ER in infected cells and is activated by several viruses and the onset
occurs before activation of caspase-8 and -3 152. Several viruses induce apoptosis
mediated by ER stress through the activation of GADD153/CHOP. Virus infection
activates the p38 MAPK pathway, which then acts on GADD153/CHOP to initiate
apoptosis in infected cells. Through the mediation of as-yet unidentified proteins,
several viruses including African swine fever virus, block the expression of
GADD153/CHOP 224. It is unclear however, why some viruses promote ER-mediated
apoptosis. Among retroviruses, a temperature sensitive mutant of Moloney murine
leukemia virus (MoMuLV-ts1) has a single point mutation in the env gene that
confers the ability to destroy T cells and motor neurons, causing a progressive
spongiform encephalopathy 226. Neurodegeneration is probably due to loss of glial
support and release of TNF-α, IL-1 and NO from adjacent ts1-infected glial cells 226.
Neurons display apoptosis, vacuolization and inclusion bodies. Elucidation of the
pathogenic mechanisms has revealed a role for ER-stress in neuronal death. TNF-α or
NO induces the ER to release Ca2+ leading to activation of ER-stress signaling
pathways and cell death through apoptosis.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 66
MoMuLV infection is correlated with phosphorylation of PERK and
eIF2α. During late stages, levels of Grp78/Bip may be insufficient to protect neurons
against ER-stress associated with the retroviruses, FrCasBrE and ts1 infection.
Neurons, but not astrocytes, show increased levels of ER-stress associated genes in
infected mice, which result in activation of ER-associated caspase-12 and subsequent
2+ cleavage of caspase-3. Stressed neurons also showed increase in [Ca ]i-mediated
phosphorylation of calmodulin (CaM) kinase IIα. Since ts1 infects glial cells, but not
neurons, an indirect mechanism of neuronal death, perhaps glutamate excitotoxicity
associated with NMDA receptor activation due to neurotoxins from infected glia, may
lead to neurodegeneration 226. The envelope protein of an avirulent strain, F43, binds
to Grp78/BiP and is processed through the normal secretory pathway. In contrast, the
envelope protein of FrCasBrE bound to Grp78/BiP for a prolonged period is retained
in the ER and diverted to the proteasome for degradation 154. ts1-infected astrocytes
demonstrate expression of GADD153/CHOP in neurons but not astrocytes 226,227.
GADD153/CHOP and Grp78/BiP as well as iNOS and apoptosis are induced in p53-/-
microglial cells when treated with lipopolysaccharide (LPS) or IFN-γ, suggesting
p53-independent NO-induced apoptotic mechanism in microglia 228. Both FrCasBrE
and ts1 strains induce a protein misfolding disease since Grp78/BiP binds to
hydrophobic residues and attempts to prevent protein aggregation of misfolded
proteins and activate an UPR. Recently, the Power lab has shown that replication-
competent feline immunodeficiency virus (FIV) is essential for inducing an ER stress
response and a vigorous neurotoxic and immune response in feline macrophages and
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 67
in vivo. However, mere exposure and/or expression of the envelope protein of FIV
was insufficient to induce an ER stress response 229.
Recent studies indicate that ER stress can be linked to inflammation,
specifically the systemic inflammatory component of innate immunity, called acute
phase response (APR) 230. Members of the membrane-bound transcription factor
family with homology to ATF6 include CREBH, Luman and OASIS (old astrocyte
specifically induced substance)231. CREBH is a hepatocyte-specific bZip transcription
factor belonging to the cyclic AMP response element binding protein transcription
factor (CREB/ATF) family, which requires proteolytic cleavage for its activation.
Interestingly, proinflammatory cytokines induce and cleave CREBH, which regulates
C-reactive protein (CRP) and serum amyloid P-component (SAP), which are
implicated in several pathologies 230 including MS, where levels of these proteins are
augmented in the serum 232. CRP can bind to and activate monocyte-macrophages 233,
whereas SAP plays important roles in leukocyte adhesion 234. These results are highly
significant as their relevance to pathologies in the CNS is immense. In the next
section, I will discuss retroviral infections of the nervous system, focusing on the
common pathogenic mechanisms of both the exogenous and endogenous retroviruses.
1.2.5. Exogenous retroviral pathogenesis
1.2.5.1. Type C Retroviruses
Type C or oncogenic retroviruses are associated with neurovirulence in a
range of host species, including cats, rodents, birds and humans with or without
concurrent immunological disease. Genomes consist of three structural genes and 2
LTRs and perhaps an accessory gene. Neurotropic type C retroviruses include MuLV,
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 68
and HTLV-1/-2. Herein, I will discuss only MuLV and HTLV-1 because they are best
understood in terms of neuropathogenesis.
1.2.5.1.1. Murine leukemia virus (MuLV)
Infection with MuLV, a type C neurotropic retrovirus, is associated with
tremor, hindlimb paralysis, and lack of coordination. Several different strains of
MuLV exist, each with varying cell-tropism, usually infecting astrocytes,
oligodendrocytes and microglia. MuLV enters the CNS via leukocyte trafficking in
the nervous system or by infection of the brain endothelial cells, and are known to use
the cationic amino acid transporter (mCAT-1) 193. Spongiform changes or loss of
CNS parenchyma in brain stem and spinal cord or hemorrhagic stroke-like pathology
are the pathological changes associated with different strains of MuLV 235.
Inflammation-induced breach in the BBB leading to its increased permeability and
glutamate excitotoxicity resulting in neuronal death, are associated with the
pathology. TNF-α production in the vicinity of the neurons increases glutamate
concentration, in turn activating the NMDA receptor and causing Ca2+ influx.
Glutamate concentrations in the extracellular fluid of the striatum of MuLV infected
mice are increased, leading to neurodegenerative changes and contributing to
cognitive deficits 236. Altered intracellular processing and expression of MuLV env-
encoded proteins and levels of viral replication in the brain contribute to
neurovirulence. Though proinflammatory cytokines have been identified, pathogenic
host response to MuLV infections of the nervous system remains undefined. A
variant of the oncogenic retrovirus, MuLV, called WB91-GV induces lymphomas in
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 69
a high percentage of adult mice. WB91-GV was highly selective for white matter
infection, especially replicating in oligodendrocytes 237.
Resistance to MoMuLV-induced neurological disease has been localized
to several host genes including Fv1, Fv4 (gag) and Akvr-1 (Env) 238. Akvr-1 prevents
neurovirulence by blocking the putative viral receptor, mCAT-1, while Fv4 gag
inhibits a post-entry step 193. The env gene that contains the principal determinants of
neurovirulence, encodes the SU and the TM involved in receptor binding and fusion.
In CNS tissues of MoMuLVts1-infected mice, astrocytes, microglia,
oligodendrocytes and endothelial cells are infected but neurons are not. Astrocyte
death observed in infected mice occurs through apoptosis, mediated by ER and
mitochondrial stress 239. In addition, infected astrocytes also undergo oxidative stress
wherein cellular glutathione and cysteine are depleted, ROS are increased and
importantly, the basic leucine zipper transcription factor, Nrf-2 is induced which
translocates to the nucleus to drive expression of genes associated with oxidative
stress 240.
1.2.5.1.2. HTLV
HTLV-1 infection currently persists in 10-20 million people worldwide
but is a particular problem in the Caribbean, Japan, South America, Africa and
amongst high-risk groups in the United States. A subset of HTLV-1/-2-infected
patients develop a progressive myelopathy, HTLV-1/-2-associated
myelopathy/Tropical spastic paraparesis (HAM/TSP), characterized by inflammation,
particularly in the thoracic region of the spinal cord 193. In addition, HTLV-1-infected
patients may also develop adult T cell leukemia (ATL). Prednisolone, IFN-α,
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 70
immunoglobulin, and plasma exchange are reported to improve disability, but most
studies were performed on small numbers of patients with a short-term follow-up 241.
HTLV-1 belongs to the Deltaretrovirus genus of Orthoretrovirinae family
and a member of the Oncovirinae type C subfamily whose diploid plus strand RNA is
9032 nucleotides long. HTLV-1 envelope uses the glucose transporter GLUT1 242 as a
receptor. This receptor also mediates infection by HTLV-1 envelope pseudotyped
virus and abrogates HTLV-1 envelope viral interference to superinfection 243. GLUT1
appears to be concentrated in viral synapses 243 and in this context, HTLV-1 subverts
the immunological synapse to transfer viral genomes directly from cell to cell 244.
Although the CD4+ T cells comprise a dominant viral reservoir,
maintaining HTLV-1 infection during the lifespan of an infected individual, other
hematopoietic cells (non-CD4+ T cell subsets, B lymphocytes, monocytes and
macrophages, DCs and megakaryocytes) as well as glial cells (astrocytes and
microglial cells) with limited infection, are also part of HTLV-1 in vivo tropism. Viral
proteins and genomes have been detected in astrocytes and lymphocytes within spinal
cord lesions 193. This is of particular importance in HTLV infections, due to the stable
integration of the viral genome in infected T cells and astrocytes 245, whose in vivo
lifespan may exceed a decade.
In addition to gag, pol and env genes, HTLV-1 also encodes regulatory
proteins, Tax and Rex, derived from the pX open reading frame (ORF) in the 3’
portion of the viral genome. Rex regulates viral gene expression post-transcriptionally
by allowing cytoplasmic and intracellular transport of incompletely spliced viral
mRNA 246. Tax acts in trans to activate transcription initiating from the viral
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 71
promoter in the U3-LTR and also regulates transcription of the host gene, CD25, by
binding to the promoter region. The consequence of CD25 activation by Tax, is
induction of IL-2 in CD4+ T cells where the virus is chiefly found, though CD8+ T
cells also carry the virus. Further, Tax stimulates NF-κB activity via activation of the
signaling cascade controlling IκB phosphorylation specifically through interaction
with IKKγ subunit of the IκB kinase complex 247. Since NF-κB regulates immune and
growth regulatory gene transcription, these events culminate in dysregulation of T
cell function leading to CD4+ T cell proliferation that precedes ATL. Additionally,
cytokines and MMPs induced by the Tax protein may alter BBB permeability,
allowing infiltration of inflammatory cells into the CNS 193. Activated T lymphocytes
directly kill infected cells expressing Tax protein and indirectly injure neurons
through a bystander effect and lead to astrocyte proliferation 248, causing the release
of inflammatory cytokines, or killing CNS cells that express a cross-reactive cellular
determinant 249.
The pathology of HAM/TSP autopsied tissue indicates that affected areas
in the CNS include the myelinated regions of the lateral funiculi of the spinal cord
where inflammatory cell infiltrates are seen. This eventually leads to loss of myelin
and axons; the tissue is replaced by glial proliferation and fibrillary astrocytosis. Loss
of myelin and axons is associated with perivascular and parenchymal lymphocytic
proliferation, foamy macrophages, proliferation of astrocytes and fibrillary gliosis.
Demyelination and axonal loss observed in spinal cord lesions may be due to
bystander activation from activation of T cells and expression of cytokines 250. In
another study, since HTLV-1 provirus DNA was amplified only in infiltrating
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 72
lymphocytes, but not detected in neurons and oligodendrocytes, the demyelination
observed in the spinal cord is unlikely to be due to viral infection of the astrocytes,
oligodendrocytes and/or neurons 251.
Tax expression is generally low in HTLV-1 infected individuals.
Interestingly, HTLV-1 gene expression is regulated by a protein tyrosine phosphatase,
probably SHP-1 252. Infection of CD4+ T lymphocytes results in their activation and
ability to cross the BBB. Interaction of these activated lymphocytes with the CNS
results in cytokine expression, adhesion molecule and receptor expression and
secretion of MMPs leading to disruption of the BBB, allowing cytotoxic T cells and
antibodies against Tax to enter the CNS. HAM/TSP patients exhibit an autoimmune
response to the heterogeneous nuclear ribonuclear protein-A1 (hnRNP-A1), which is
critical for the transport of nuclear mRNA to the cytoplasm. Autoantibodies to
hnRNP-A1 enter cells, bind the protein and decrease neuronal firing, enhancing
myelopathy 253.
1.2.5.2. Lentiviruses
Lentiviral infections of the nervous system have attracted increasing
attention due to the growing HIV/AIDS pandemic and the concomitant high rates of
neurological disease among HIV-infected individuals 254. Despite extensive genetic
diversity among lentiviruses, they share several biological properties, including
structural and genomic organizations, Mg2+-dependent reverse transcriptase activity
and broad cellular tropisms involving both proliferating and non-proliferating cells,
within and outside the nervous system. On the basis of pathogenicity, lentiviruses are
subdivided into immunodeficiency viruses including human (HIV), simian (SIV),
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 73
feline (FIV) and bovine (BIV) immunodeficiency virus. Further, lentiviruses that
activate the immune system include caprine arthritis encephalitis virus (CAEV),
maedi-visna virus (MVV) and equine infectious anemia virus (EIAV). Of interest,
MVV served as a model of MS in the past 255. Visna is a slow infection of sheep
caused by MVV, which infects the oligodendrocytes 256 and demyelination might be
due to host immune response 257. Though astrocytes are not considered to be major
targets of visna virus, infection of astrocytes leads to sustained activation of MAPK,
triggering reactive astrogliosis 258.
Lentiviruses exhibit a disease pattern in which a primary infection
induces an acute disease and an intense immune response, followed by a lengthy
period of subclinical infection and a terminal phase resulting in death. The intense
host immune response is diminished over time, increasing the individual’s
susceptibility to opportunistic infections. Lentiviruses are distinguished by their
ability to replicate in non-dividing cells such as macrophages. Viral tropism involves
cells of bone-marrow lineage, such as microglia and macrophages. Lentiviruses are
assumed to enter the CNS through infected macrophages crossing the BBB and
subsequent microglial infection. The primary receptors utilized by HIV (CD4)259, FIV
(CD134)260 and SIV (CD4)261, and chemokine co-receptors, CXCR4 and CCR5 are
expressed in the nervous system. The viruses of topical interest in our research are
HIV, MVV and FIV, which will be described below.
The high error rate of HIV-1/-2 reverse transcriptase, high replication
rates, frequent recombination and increased selection make HIV-1 the fastest
evolving organism. Point mutations, deletions, insertions and recombination events
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 74
within a viral population or quasi-species leading to synonymous and non-
synonymous changes and immunosuppression contribute to viral molecular diversity.
The benefit of increased molecular diversity is that HIV-1 has an enhanced ability to
evade the immune system with concurrent depletion of immunological defenses and
gain or loss of (co) receptor binding or replication competence as well as gain drug
resistance. Increased viral diversity at onset of infection may predict a higher viral
load and accelerated disease progression. The interaction of a genetically large and
outbred human population with a highly diverse and dynamic viral population has the
potential for emergence of novel and potentially virulent strains of HIV-1 262.
Lentivirus-associated neurovirulence has been demonstrated by
neurotoxicity caused by viral proteins from HIV, SIV, MVV and FIV, directly or
indirectly. SIV gp41, FIV gp95 and hypervariable regions within HIV gp120
comprise the viral determinants associated with envelope-mediated neurovirulence.
HIV enters the CNS early in the course of infection, and the virus resides primarily in
microglia and macrophages, contributing to productive infection and subsequent
neurodegeneration by forming viral reservoirs. Although HIV-1 infection of
astrocytes has been reported, this appears to be largely restricted to the expression of
mRNA transcripts and protein of the HIV-1 early expressed genes tat, nef and rev.
Brain-derived progenitor cells are permissive to infection but thus far, no convincing
evidence of neuronal infection by HIV-1 has been demonstrated, but are highly
susceptible to injury by direct or indirect/bystander effects 214,263.
Neuropathological features of HIV-1 infection of the brain include HIV-
encephalitis, characterized by multinucleated giant cells, astrogliosis, microglial
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 75
nodules, macrophage infiltration, white matter pallor, reduced synaptic density and
neuronal loss in the cortex and basal ganglia. At the time of seroconversion, about
50% of patients infected with HIV experience acute demyelinating neuropathy 264 and
these characteristics are associated with a subcortical clinical disorder (HAD),
defined by cognitive, behavioural and motor dysfunction 265. HIV infection within the
CNS can be detected by measurements of viral RNA in CSF. There may exist a
positive correlation between CSF viral load and viral load in the brain and the degree
of cognitive dysfunction in patients with HAD. Vacuolar myelopathy is caused due to
HIV infection in the spinal cord and is predominantly found in patients with low
CD4+ T cell count. The pathogenesis remains unclear 266 but intralamellar vacuolation
is observed in the spinal white matter with extensive macrophage activation and
production of cytokines, particularly TNF-α 254.
γ-aminobutyric acid (GABA)-ergic and pyramidal neurons within the
cortex are prone to death in HIV-1-infected brain. Though neurons are not infected by
HIV-1, the primary cause of neuronal injury remains unknown but both apoptotic and
necrotic death are observed. Two theories prevail and are described as ‘direct injury’
and ‘indirect or bystander effect’. HIV proteins can injure neurons directly without
intermediate cells such as microglia and astrocytes. HIV-gp120 interacts with
chemokine and NMDA receptors (by engaging the glycine-binding site) to induce
neuronal apoptosis 267. Neuronal injury can also occur when HIV-Tat is internalized
by receptor-mediated mechanisms into neuronal cells and HIV-Vpr allows formation
of cation-selective ion channels in lipid bilayers 268. Apoptotic neurons do not co-
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 76
localize with infected microglia suggesting that neurons die when HIV-infected
microglia-macrophages release soluble factors 214.
Activated circulating monocytes expressing CD16 and CD69 adhere to
normal endothelium of the brain microvasculature, transmigrate and trigger
deleterious processes during HIV-1 infection. HIV Tat expression can induce
astrocytes to produce CCL2/MCP-1 which is chemotactic for monocytes/microglia
and whose recruitment into the CNS microenvironment leads to potentiation of
toxicity. Chemokines (CCL2/MCP-1) and cytokines (TNF-α) produced by microglia
and astrocytes regulate migration (involving adhesion molecules, vascular cell
adhesion molecule [VCAM-1]) of peripheral blood mononuclear cells (PBMCs)
through the BBB. Neurotoxic factors secreted by brain resident macrophages or
microglia in response to HIV-1 infection and stimulation by viral proteins or immune
activation can induce neuronal death. Among the potential neurotoxins, eicosanoids,
pro-inflammatory cytokines, free radicals and neurotoxic amines are elevated in brain
mononuclear phagocytes infected with HIV-1. TNF-α acts in an autocrine and
paracrine role through its TNF-RI (p55) receptor to activate microglia. HIV-
associated neuronal injury is induced by HIV (gp120 or Tat) through the action of IL-
1α/β, IL-6, TNF-α, chemokines 121 and glutamate excitotoxicity 269. Other microglial
factors released are quinolinic acid (which induces neurotoxicity through NMDA
receptors), cysteine and low molecular weight amine, Ntox 270. These factors induce a
vicious cycle of immune dysregulation and BBB dysfunction leading to neuronal
injury 263.
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 77
Detection of apoptotic astrocytes is more common in HIV-associated
dementia (HAD) patients compared to non-demented HIV/AIDS patients and in the
gp120 transgenic mouse, implying a role for astrocyte cell loss in the
neuropathogenesis of HAD 271. Astrocytes positive for activated caspase-3 in
autopsied subcortical brain tissue from HAD brain suggest ongoing injury to
astrocytes. During HIV infection in the brain, the normal functions of astrocytes are
impaired and they are unable to re-uptake glutamate 272. Astrocytes perform trophic
roles in the CNS and their death could impact on glutamate levels, production of
neurotrophic factors and maintenance of the BBB 214. Cell-specific
compartmentalization of viral strains exists within the CNS as evidenced by
astrocyte-specific env sequences of HIV 265. The mechanism of viral entry into
astrocytes is unclear, because they do not express detectable levels of CD4+ or the
HIV co-receptors 265. Apart from mediating neuronal death in HIV (gp120)-CXCR4
interaction 273, TNF-α produced by macrophages during HIV infection in the brain
blocks glutamate uptake by astrocytes contributing to neuronal injury 274. Stimulation
2+ of metabotropic glutamate receptors (mGluRs) on astrocytes leads to increased [Ca ]i
and further release of glutamate. Cytokines and viral proteins also promote iNOS
induction within astrocytes. NO, thus released reacts with superoxide anions to form
neurotoxic peroxynitrite 263. Thus, astrocytosis induced by viral proteins and
macrophage products might play a role in loss of astrocyte function and brain
homeostasis, leading to neuropathogenesis 214.
Although there is no evidence of oligodendrocyte infection in vivo, the
binding of gp120 to galactosylceramide or other proteoglycans can reduce myelin
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 78
2+ 275 synthesis and increase [Ca ]i levels and apoptotic cell numbers . Further, NMDA
receptors present on myelin can lead to oligodendrocyte damage through bystander
effect 89.
Unlike primate and human immunodeficiency viruses, Maedi visna virus
(MVV) does not cause immunodeficiency in its infected host, primarily due to its
inability to productively infect CD4+ T lymphocytes 276. MVV infects mainly
monocyte/macrophages, dendritic cells and does not require CD4+ nor CXCR4 for
infection, but are required for syncytium formation 277. In the CNS, MVV causes
meningitis, periventricular inflammation and infiltration of the choroid plexus and is
known to induce apoptosis in sheep brain cells 278.
FIV-induced brain disease occurs in 20-50% of infected animals, usually
concurrent with diminished CD4+ T-lymphocyte levels 279. Sharing structural and
biochemical properties with HIV-1, FIV-infected cats have been used as an animal
model that recapitulates many salient aspects of HIV infection including
immunosuppression with depletion of CD4+ and CD8+ T lymphocytes in blood and
high viral burdens 280. Neonatal infection by HIV, SIV and FIV causes neuro-
developmental delay and frank encephalopathy in 50% of those infected, signifying a
worsened overall survival prognosis. Studies have shown that lentivirus envelope
proteins derived from HIV-1 and FIV are highly cytotoxic to neural cells 281. Growth
hormone was shown to improve both neurological and immunological outcomes in a
FIV-infected model by up-regulating IGF-1 in cortical neurons 282. Analogous to the
cell tropisms of HIV and SIV, FIV infects feline macrophages, CD4+ T lymphocytes,
neural cells including microglia and astrocytes, but not neurons 283, by means of the
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 79
chemokine receptors CXCR4 or CCR5 120. However, FIV’s cell tropism has a broader
range infecting both CD8+ T and B lymphocytes 284. Both in vivo and in vitro studies
indicate that FIV is a neurovirulent virus causing neurological complications
manifested as FIV encephalopathy and peripheral neuropathy, similar to the clinical
findings observed during HIV-1 infection 285.
1.2.6. Endogenous retroviral pathogenesis
I.2.6.1. Characteristics of endogenous retroviruses
Human DNA contains ~3,100,000,000 bp comprising ~20,000-25,000
genes, with many transcripts that are non-protein encoding and of no known function
286. All humans carry HERV sequences as an integral part of their genomes,
comprising almost 8% of the human genome and are likely vestiges of retroviral
infections during primate evolution. At some point during evolution, exogenous
progenitors of HERVs inserted themselves into the cells of the germ line, where they
have been replicated along with the host’s cellular genes following a Mendelian
pattern 287,288. Integration of endogenous retroviruses into the germ line is thought to
have occurred 2 to about 70 million years ago and were introduced by mechanisms
involving reverse transcription. HERVs were discovered as a result of approaches
such as low-stringency screening of human genomic libraries 289, PCR by
oligonucleotide homology to viral primer binding sites 290 and during analyses of
human gene loci 291. They are identified as retroviruses because of their provirus-like
structure containing LTRs flanked by short direct repeats and primer binding site
flanking internal coding regions. Other retroelements that make up the genome
include LINES (Long Interspersed Repeat Sequences) that move due to inherent
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 80
reverse transcription activity and processed pseudogenes whose motion is dictated by
reverse transcription not encoded by the pseudogenes 292. Of the retroelements present
in the human genome, HERVs are significant in terms of both physiology and
pathogenesis. HERVs are divided into two groups based upon the presence or absence
of LTRs. Those HERVs with LTRs can be further divided based on infectivity.
Infectious elements with LTRs are retroviruses, while noninfectious elements with
LTRs are retrotransposons while those lacking LTRs are termed retroposons 293.
HERVs represent approximately integrated 1500–2000 proviruses,
together with at least 20000–40000 copies of solitary HERV LTRs per genome (Fig.
8). They have been amplified during evolution by repeated reintegration of reverse-
transcribed mRNA into the DNA of germ line cells 293-296. By virtue of their ability to
integrate randomly into the host genome, HERVs are considered to be an important
class of insertional mutagens 297,298 and exert pathogenic effects through several
possible mechanisms (Fig. 9). Endogenous retroviruses have a life cycle that is quite
different in many aspects. Following reverse transcription, they may re-integrate as
demonstrated for HERV-K 299 or the gene product (envelope) can combine with other
available retroviral proteins such as gag or pol and form a recombinant virus which
may or may not bud out to form an infectious particle (Fig. 7). Exogenous
retroviruses occasionally infect germline cells and become fixed in the host germline.
Intracellular retrotransposition and new integrations in germ cells lead to
amplification of proviral copies. The amplification will decline over time due to
mutations, deletions or recombination between viral LTRs. It is probable that
retrotranposons may give rise to infectious retroviruses by recombination events 300.
Chapter 1: Introduction and Literature Review
Provirus
AAA Genomic RNA
AAA Full length retrosequence
AAA Truncated retrosequence
AAA
Solitary LTR
Fig.8: Various forms of HERVs in the genome (Adapted from Costas J, 2002).
81 Chapter 1: Introduction and Literature Review
Activation of HERVs
Transactivation of cellular genes
LTR (gag) (pol) (env) LTR DNA
cellular gene cytoplasm nucleus mRNA (A)6 enhancer/ insertional promoter mutagenesis insertion
Retroviral proteins Integration events Molecular mimicry Superantigens
Figure 9: Pathogenic potential of HERVs (Adapted from http://www3.gsf.de/imv/gif/lmhome1.gif
82 Chapter 1: INTRODUCTION AND LITERATURE REVIEW 83
The consequences of reverse transcription and integration are insertional mutagenesis,
presence of multiple homologous genomic regions, insertion of heterologous reverse
transcripts and non-transposed reverse transcripts 301.
To date, 31 HERV families have been identified and are named according
to the transfer RNA used to prime reverse transcription 302 303 (Table 2). However,
based on sequence homology, HERVs can be grouped into 80 distinct families 300.
Several members of the HERV-W and -H families have been shown to encode intact
envelope proteins and currently 18 full-length HERV env sequences have been
defined 186,303-305. HERV gene expression is principally regulated by their individual
LTRs. Varied levels of expression and cell-type specificity of isolated HERV LTRs in
human cell lines suggest that HERV LTRs may be a valuable source of
transcriptional regulatory elements for the construction of targeted retroviral
expression vectors 306.
1.2.6.2. HERVs and evolutionary advantages
There is evidence for the ability of HERVs to mediate genomic
rearrangements during primate evolution 307. Examples of the nonfunctional viral
sequences that may have arisen through several duplications, recombination events,
and mutations acquired during primate evolution are HERV-H, HERV-F and HERV-
K. Comparison of sequences, particularly in the LTRs of certain HERV families
provide insight into the length of time a particular genetic sequence may have been
present in the genome. In addition to its evolutionary advantages in mediating
necessary recombination events in the human genome, expressed ERV envelope
genes may have beneficial functions to the host. A possible advantage of expressing
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 84
an ERV envelope protein is to resist exogenous retroviral infections 308. ERVs found
in the genomes of birds, mice and cats protect these animals from certain exogenous
retroviral infections. For example, ERV envelope (ev3 and ev6) in chickens protect
against infection by Avian leucosis virus (ALV) 309; an endogenous feline leukemia
virus protects cats against feline leukemia virus-B infection and the Fv-4 locus in
mice confers resistance to infection by Friend leukemia virus 310. In this context, it is
also worth considering if HIV is on its way to becoming endogenized into the human
genome as it may have occurred in the past for HERVs. However, for this to happen,
HIV must infect germline cells.
The most abundant expression of different HERVs is observed in placenta
and embryonic tissues, and also in reproductive tissues or cells such as testis and
oocytes. The broad expression of HERVs in embryonic tissues may be sufficient for
induction of immunological tolerance towards HERV-encoded proteins. HERV
proteins could influence foeto-maternal immunosuppression 311 during pregnancy
when expressed in the placenta 312, fuse trophoblast cells in the placenta 313 and also
provide protection against exogenous retroviruses through receptor interference 308.
Interestingly, no other human gene has been discovered that encodes these functions.
Lower Syncytin-1 expression in human placentas has been correlated with placental
dysfunction, including pre-eclampsia and hemolysis, elevated liver enzymes and low
platelets syndrome 311.
1.2.6.3. Murine endogenous retroviruses
Mice have two types of retroviral elements, the intracisternal particles
(IAPs) and early transposon element (Etn) families which are responsible for dozens
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 85
of documented germ line and somatic mutations, present in both wild-type and inbred
mice 314. Mouse IAPs are endogenous retroviruses showing sequence homologies to
B/D- and avian type C retroviruses and a gene expression strategy similar to that of
type D retroviruses. These particles are competent for allowing retrotransposition
within the virus-producing cell. IAPs are abundant in many murine tumours and cell
lines. F-MuLV is another endogenous, defective leukemia virus. Cells expressing the
envelope protein of the defective F-MuLV virus are resistant to infection by ecotropic
MuLVs 315. F-MuLV infection during EAE showed many inflammatory cells in the
gray matter including the frontal lobe, whereas almost no inflammatory cells were
found in rats with EAE alone, with pathological features resembling HAM/TSP,
suggesting that retroviral infections can modify the pattern of EAE to a certain extent
316. Two previously uncharacterized retroviral envelope proteins have been identified
in the mouse, namely Syncytin-A and -B. They are present at a single copy and are
phylogenetically unrelated to Syncytin-1 and -2. Northern blot analysis revealed
expression of Syncytin-A and -B in the placenta and mediates syncytia formation 317.
Retrovirus replication cycle does not require the infected cell to be
harmed. HERVs potentially influence progression of human diseases through
insertional mutagenesis, molecular mimicry or induction of aberrant cellular
responses, mediated through viral receptors 193. The increased expression of HERV
genes may be important in modulating host innate and adaptive immune responses
with ensuing disease effects although definitive proof of specific HERV-related
pathogenic effects is lacking. Several human and animal exogenous retrovirus
proteins, particularly the env-encoded proteins, demonstrate a tendency for causing
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 86
neuropathogenic effects 193. However, the precise functions of endogenous retrovirus
proteins in the nervous system are uncertain despite being abundantly expressed in
many species including rodents, cats and non-human primates 193,318,319 (Fig. 10).
HERVs are expressed in healthy tissues such as placenta and interestingly they are
also up-regulated in neoplasic, autoimmune and inflammatory conditions 320. Apart
from controversies regarding the involvement of HERVs in insulin-dependent
diabetes mellitus 321, most reports of involvement of HERVs in disease have been
speculative. Anti-HERV antibodies and retroviral nucleic acid are detected frequently
in several autoimmune diseases such as systemic lupus, MS and schizophrenia. This
however, does not prove cause or consequence of HERV expression but the probable
mechanisms may include break-down of tolerance to HERV proteins, transactivation
of cellular genes by HERV proteins, expression of superantigens, molecular mimicry
etc (Fig. 9). Retroviral involvement in tumorigenesis is well established through
several mechanisms: acute transformation of cells by insertional mutagenesis and
transactivation involving cellular proteins but there is no evidence that human cancer
is caused by a HERV. Development of cancer could be a multi-step process wherein
HERV contribution may be restricted to perhaps insertional mutagenesis 322. In this
regard, there are implications for retrotransposition involving HERV-K which may be
active in the human population 299. Other modes include retroviral superantigen
activation that reacts with the immune system in an unusual way. Normal antigens
stimulate an immune response through presentation by MHC molecules on B cells to
the T cells whose TCRs are arranged in a specific fashion. The stimulated T cells
divide and release cytokines. Superantigens, in contrast, bind simultaneously to MHC
Chapter 1: Introduction and Literature Review
HERV-W HERV-E ERV-FRD (Primate) HIV HERV-H MuLV (Mouse) FeLV (Cat) ZFERV (Fish) HTLV-1 HERV-K Human Foamy Virus 0.5
Fig. 10: A phylogenetic tree describing the evolutionary relationships between different endogenous (ERV-FRD, MuLV, ZFERV, HERV-W, -E, -H, -K) and exogenous (HIV, HTLV-1) retrovirus envelope genes found in mice, fish, cats, non-human primates and humans. Amino acid sequences were obtained from GenBank. The DNA analysis software, MEGA3 (Available from the Lab of Masatoshi Nei, Penn State University) was used to draw the phylogenetic tree.
87 Chapter 1: INTRODUCTION AND LITERATURE REVIEW 88
class II molecules and to all TCR molecules expressing a particular class of Vβ
chains. This accounts for about 5% of the T cells to be stimulated at one time, leading
to a very large immune response following infection of newborn mouse with mouse
mammary tumor virus (MMTV) 323.
Induction of several HERVs is reported in different cell types derived
from patients with various diseases. The HERV-K gag protein and RNA transcript
have been reported to be highly expressed in teratocarcinoma and breast cancer cell
lines 324,325, HERV-E in prostate carcinoma 326, HERV-H in leukemia cell lines 327
and HERV-W in brain tissue and CSF from MS 186 and schizophrenic patients 328.
Induction of HERV-H/RGH, HERV-W and ERV-9 expression was reported after
specific cell types (mainly B cells) from MS patients were cultivated in vitro 329. Viral
RNA from these HERVs has been detected by RT-PCR in blood and brain tissues
from MS patients, although not exclusively from this patient group 329. HERVs could
play several roles in MS pathogenesis, acting predominantly as a component of the
inflammatory cytokine-mediated cascade of events. Thus HERVs may act as auto-,
super- or neoantigens (upon expression of oncogenic viruses) with the potential to
enhance inflammatory responses or induce autoimmune reactions 329.
I.2.6.4. Syncytin-1: Characteristics of protein
The multi-copy (30 known copies of full length env gene) HERV-W
family contains a unique proviral locus, located on chromosome 7q21-q22. The
HERV-W7q envelope gene encodes a 538-amino acid envelope (Syncytin-1) but with
presence of inactivating mutations in the HERV-W7q gag and pol genes 186,330. The
deduced 538-amino acid envelope protein contains an N-terminal leader peptide and a
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 89
putative C-terminal hydrophobic membrane anchoring sequence. Northern blot
analysis detects 8.0, 3.1 and 1.3 kb Syncytin-1 transcripts in the placenta 186 (Fig. 11).
The Syncytin-1 envelope glycoprotein is synthesized as a gPr73 precursor, which is
specifically cleaved at a consensus furin cleavage site to give rise to two mature
subunits, gp50 SU and gp24 TM unit. The non-glycosylated Syncytin-1 molecule is
53 kDa, corresponding to gPr73 lacking seven N-glycans. Presence of the leucine
zipper-like motif and the CX6CC motif suggests that the envelope protein can
oligomerize and the SU and TM subunits are covalently linked. The retroviral
protease cleavage site and the C-terminal 16 residue (R peptide) region are missing
from the 69-amino acid intracytoplasmic tail of Syncytin-1. Fusion competence does
not depend on the R-like peptide cleavage but on the first 16 residues of the
intracytoplasmic tail. The Syncytin-1 sequence shows a 4 amino acid deletion in the
intracytoplasmic tail, located after the conserved 16 residues. This deletion modifies
the potential retroviral protease cleavage site allowing fusogenic activity. This finding
suggests that Syncytin-1 evolved from an infectious ancestor with an original R
peptide fusion inhibition function 331.
Computer analysis (ExPASy Proteomics Tool, available free online,
(http://ca.expasy.org/tools/) of the Syncytin-1 protein revealed a glycosylphosphatidyl
inositol (GPI) linkage on serine 524, through which Syncytin-1 is tethered to the
membrane. There were, in addition, 13 serine, 8 threonine and 9 tyrosine predicted
phosphorylation sites and 189 proteasomal potential cleavage sites identified in the
Syncytin-1 protein.
Chapter 1: Introduction and Literature Review
Fig.11: Northern Blot analysis of Syncytin-1 expression. Poly (A)+ RNAs from placental tissues with the U5(g) (nt 115 to 717 of cl.6A2) and U5(e) (nt 1 to 491 of cl.24.4) probe, gag (Pgag-LB19), pro (Ppro-E), pol (Ppol- MSRV), and env (Penv-C15) probes and the U3(e) (nt 732 to 1116 of cl.C4C5) probe (From Blond et al., 1999). For permission to use this figure, please see Appendix F.
90 Chapter 1: INTRODUCTION AND LITERATURE REVIEW 91
I.2.6.5. Syncytin-1: Interaction with receptors
Syncytin-1 303,332 is functional in that it can induce cell-cell fusion when
expressed in cells expressing the feline endogenous virus (RD114)/simian type D
retrovirus (RDR) receptor 333,334 and as infectious pseudotypes generated with HIV-1
virions 332,333. A widely dispersed group of interfering retroviruses, which includes
the feline endogenous virus (RD114), baboon endogenous virus (BaEV), HERV-W,
and type D primate retrovirus, uses the human sodium-dependent neutral amino acid
transporters type 1 and 2 (hASCT1; gene name, SLC1A4 and hASCT2; gene name,
SLC1A5) as common cell surface receptors 335. Syncytin-1 engages these two highly
divergent (54% amino acid identity) ASCT members, as receptors, which also
transports polar neutral amino acids including, Ala, Ser, Cys and Thr 333. It also uses
the mouse ASCT transporter orthologues of these receptors if the N-linked
oligosaccharides in their extracellular loop 2 regions are eliminated 333. ASCT1 and -
2 transport an overlapping but non-identical set of neutral amino acids, with an
important difference being the transport of glutamine only by ASCT2. The carboxyl
terminal regions of extracellular loop 2 in both ASCT1 and -2 play critical roles in
controlling retroviral reception. ASCT1 and -2 are localized on both neurons and glia
in the brain 336,337 and are essential for maintaining cellular integrity through the
transport of amino acids with potentially neurotrophic 338 or neurotoxic 339 effects.
Conclusion, Statement of Hypothesis and Objectives
Understanding the roles of HERVs in health and disease is of immense
importance considering the diversity and abundance of these retroelements in the
human genome. The lack of reagents and appropriate animal models has restricted
Chapter 1: INTRODUCTION AND LITERATURE REVIEW 92
studies on HERVs. Availability of the human genome sequence and establishment of
several antibodies and vectors has revitalized research on HERVs. We have taken a
step further by establishing a transgenic animal model for MS as well as elucidating a
potentially pathogenic role for Syncytin-1.
Based on previous work by others and our own preliminary studies, I developed the
working hypothesis:
Inflammation in the brain enhances expression of Syncytin-1 in astrocytes,
leading to cellular dysfunction. Through Syncytin-1-mediated induction of ER
stress, free radicals and receptor modulation, astrocytes can affect
oligodendrocyte viability and myelination.
To systematically address this hypothesis, we developed the following objectives:
Objective 1: Determine which HERV envelope gene exhibits up-regulation in
neuroinflammation and the mechanism of oligodendrocyte injury.
Hypothesis 1: Syncytin-1 (HERV-W env) is up-regulated in astrocytes and
microglia in MS.
Objective 2: Define the precise Syncytin-1 abundance in clinical samples and
correlation with disease pathogenesis.
Hypothesis 2: Syncytin-1-mRNA and DNA copy numbers are increased in
tissues from MS patients.
Objective 3: Investigate the mechanisms leading to Syncytin-1-induced ER stress
and the consequences of ER stress on oligodendrocyte viability.
Hypothesis 3: Syncytin-1 induces ER stress in astrocytes resulting in cellular
dysfunction subsequently affecting oligodendrocyte survival.
Chapter 2: MATERIALS AND METHODS 93
CHAPTER 2
MATERIALS AND METHODS
Chapter 2: MATERIALS AND METHODS 94
II.1. Cell culture
II.1.1. Primary cells
Oligodendrocytes were derived from adult Sprague-Dawley rat brains. After
isolating brains from rats in sterile conditions, they were rinsed in PBS and minced with
sterile scalpels in a plastic dish. The contents were pipetted into a 100 ml flask. Two ml
of DNase I (1 mg/ml stock solution; Sigma) and 10 ml of 2.5% trypsin (final concentration 0.25%; Invitrogen) were added to the contents and stirred at 37oC for 45 min. Later, 3 ml of heat-inactivated FBS (Invitrogen) was added to the contents to inhibit trypsin activity. The cell suspension was then forced through a 132 μm mesh into a sterile glass bottle using a plunger. The contents were washed liberally with PBS and centrifuged at 1200 rpm for 10 min at room temperature and low brakes. The supernatant was discarded and the pellets were pooled in PBS up to 21 ml and then 9 ml of Percoll
(Sigma) was added to the contents. The mix was then added to sterile polycarbonate tubes and centrifuged at 15000 rpm for 30 min at 4oC without brakes. The myelin layer
was aspirated off and the cell layer was removed and pooled in 50 ml tubes and topped
up with PBS. The contents were washed by centrifugation at 2000 rpm for 10 min at
room temperature and low brakes. The resulting cells were incubated in RBC lysis buffer
(ammonium chloride, 0.15 M; potassium carbonate, 10 mM; EDTA, 0.1 mM in distilled
water) for 5 min followed by a final wash in PBS at 1200 rpm under similar conditions
and resuspended in feeding medium (500 ml MEM (Invitrogen), 0.2 mM glutamine
(Invitrogen), 0.1 % Dextrose (BDH, Canada), 2.5 ml penicillin-streptomycin (Invitrogen)
and 10% FBS). The cells were counted, and after adjusting the cell density to 3 x 106/ml, flasks were seeded and incubated overnight at 37oC. Floating cells were harvested by
Chapter 2: MATERIALS AND METHODS 95
centrifugation. Oligodendrocytes thus obtained were seeded onto poly-ornithine coated
chamber slides at a density of 50,000/well.
Human fetal astrocytes (HFA) cultures were a gift from Dr. VW Yong
(University of Calgary). 12-14 week old fetal brain tissue was minced and 3 ml of 2.5%
trypsin and 6-8 ml of DNase-I was added to the tissue. Cells were passed through a 125
μm mesh and washed with PBS. Cells were centrifuged at 1200 rpm for 10 min and resuspended in culture medium comprising MEM supplemented with 10% FBS, 1%
glutamine and antibiotics (penicillin-streptomycin). Cells were counted and seeded on
poly-ornithine coated plates at a density of 3-5 x106 cells/ml. Human fetal neurons (HFN)
culture were a gift from Dr. VW Yong (University of Calgary). Neurons were purified
from the mixed cultures obtained above by treating cells with 25 μM cytosine B-D-
arabinofuranoside (Ara-C; Sigma), which selectively blocks DNA synthesis. Adult human oligodendrocytes (HOLs), also a gift from Dr. VW Yong (University of Calgary), were derived from brain biopsy specimens from patients who underwent surgical
resection to ameliorate drug-intractable epilepsy. Preparation procedures followed are as
described above for adult rat oligodendrocytes.
Bone-marrow-derived macrophages (BMDM) were obtained from 8-10 week old
mice. Mononuclear phagocyte progenitor cells derived from femoral and tibial bone
marrow were propagated in the presence of M-CSF. This macrophage growth factor is
secreted by L929 cells and is used in the form of L929 cell conditioned medium. The
progenitor cells proliferate and differentiate through monoblast, promonocyte and
monocyte stages before maturing to macrophages. At this time, the cells adhere firmly to the culture vessel. After sacrificing animals by carbon dioxide CO2 overdose and a
Chapter 2: MATERIALS AND METHODS 96
thorough wash with 70% alcohol, the skin is removed from the lower part of the body.
The tissue from legs is removed and the limb is dissected out. In order to prevent
contamination of the marrow preparation with extraneous cells that could potentially
overgrow the macrophages, the remaining tissue from the pelvic and femoral bones are
removed and then separated at the knee joint. Each end of bone is cut with a scalpel and
using a 25-gauge needle and a 12 cc syringe filled with bone marrow medium (DMEM
supplemented with antibiotics (penicillin-streptomycin) and glutamine [29.2 mg/1000
ml]), the bone marrow is expelled from both ends of the bone with a jet of medium
directed into a 50 ml screw top Falcon tube. The cells are washed by centrifugation at
1000 rpm for 10 minutes and resuspended in 10 ml bone marrow medium. The cell
aggregates are broken up by gentle aspiration using an 18-gauge needle attached to a 12
cc syringe. After bringing the sample volume to 40 ml with bone marrow medium, the
cells are counted and suspended to a concentration of 11.0 × 106 cells/12 ml and
dispensed into culture dishes and incubated for 5 to 7 days at 37° under 10% (v/v) CO2.
On day 5, half of the media is replaced followed by a complete change on day 6.
To obtain and culture human monocytes-derived macrophages (MDMs) and peripheral blood lymphocytes (PBLs), blood from healthy donors was diluted at 50% in
RPMI (Invitrogen) medium. 25 ml of diluted blood was overlaid on 15 ml Histopaque
(Sigma) and centrifuged for 20 min at 1800 rpm with low brakes. The buffy coat was removed and washed with RPMI by centrifugation at 1200 rpm for 10 min followed by a second wash at 800 rpm for 10 min. Cells were resuspended in 12% RPMI supplemented with antibiotics (penicillin-streptomycin). Cells were counted and seeded onto poly- ornithine-coated tissue culture plates at a density 10 times more than the final number of
Chapter 2: MATERIALS AND METHODS 97
MDM required per well. After allowing cells to adhere for 3h, the medium was changed and 20% (10% FBS and 10% human serum or L-929 (macrophage-colony stimulating factor rich) medium) RPMI was added. MDMs were used for experiments after 7 days in culture. Human PBLs were obtained from the cultures described above for MDM. Cells that did not attach to the poly-ornithine coated plates were identified as peripheral blood leukocytes (PBLs). All primary cultures were grown and maintained in MEM with 10% glucose.
II.1.2. Cell lines
BHK-21 cells (ATCC, Manassas, VA) were cultured in MEM with 1% sodium pyruvate. U373 astrocytoma, HeLa 340 and HEK293T cells (ATCC, Manassas, VA), were cultured in DMEM. U937 monocytoid cells (ATCC, Manassas, VA) and MYA-1 feline cells 341 were grown in RPMI. Cells were cultured in media with 10% FBS unless otherwise mentioned. Human LAN-2 neuronal cells were proliferated in 10% MEM with
1% N2 supplement (Invitrogen) and differentiated in L-15 medium (Invitrogen) with 50
μg/ml gentamicin (Invitrogen) and cyclic adenine monophosphate (AMP) (1 mM;
Sigma). Cell lines were used when they were between passage numbers 10-25.
II.2. Syncytin-1 constructs
II.2.1. Construction of SINrep5-Syncytin-1 plasmid
The Sindbis virus-based (SIN) vector system used in this study has been described previously 342. The constructs pSINrep5-EGFP and pSINrep5-Syncytin-1 were obtained by cloning the EGFP and HERV-W env (Syncytin-1) genes, respectively, into the multiple cloning site present in the pSINrep5 expression vector as described 342. Briefly, to construct pSINrep5-EGFP, pEGFP-N1 (Clontech, Palo Alto, CA) was digested with
Chapter 2: MATERIALS AND METHODS 98
SmaI and HpaI, and the resulting 862 bp DNA fragment, containing the EGFP ORF, was
isolated from an agarose gel using the Concert Rapid Gel extraction kit (Life
Technologies Inc., Burlington, ON) and inserted into the StuI restriction site of the
pSINrep5 multiple cloning site. The Syncytin-1 envelope insert was obtained by
digesting the expression vector phCMVenvpH74 334 with EcoR1 and Xba1 and subsequent isolation from an agarose gel. The 1.832 kbp fragment was inserted into the
EcoR1 and Xba1 restriction sites of pBluescript SK+. The resulting construct, pBS-
Syncytin-1, was digested with EcoRV and Xba1 to generate a fragment containing the
Syncytin-1 ORF, which was subsequently cloned into the StuI site of the multiple cloning site of pSINrep5 (Appendix A). For all constructs, correct insertion of the inserts was determined by restriction enzyme digest analysis and sequencing. All restriction and other enzymes were obtained from New England Biolabs (Mississauga, ON) or Life
Technologies (Burlington, ON) and used according to their specifications.
II.2.2. Preparation and titration of viral stocks
Constructs pSINrep5-EGFP and pSINrep5-Syncytin-1 and helper virus construct
pDH-BB 343,344 were linearized with XhoI. The linearized plasmids were used as
templates for the generation of capped RNA transcripts by in vitro run-off transcription
using the SP6 mMESSAGE mMACHINE kit (Ambion Inc, Austin, TX). 10 μg of DH-
BB RNA transcript and 10 μg SINrep5-EGFP or SINrep5-Syncytin-1 RNA transcript
were transfected into 3-5 x 106 BHK-21 cells/ml in diethyl pyrocarbonate (DEPC)-treated
PBS by electroporation according to a previously published protocol 343. Briefly, the cells
were subjected to two pulses at 850V, 50 μF and infinity (∞) resistance (Ω), using a Gene
Chapter 2: MATERIALS AND METHODS 99
Pulser II (BioRad Laboratories Canada Ltd., Missisauga, ON). Cells were plated in
culture media and incubated at 37°C/5% CO2. The media containing recombinant
SINrep5 was harvested 20-24 hr after transfection. When high titers were needed, the
SINrep5-Syncytin-1 viral stock was concentrated by centrifugation at 120,000 g at 4°C for 4 hr, and the virus pellet dissolved in culture media. The recombinant SINrep5 stocks
(Fig. 12) were titered on BHK cells. For SINrep5-EGFP, the titer was determined by counting the number of EGFP-positive cells using fluorescent microscopy 24 hr post infection. To determine the titer of SINrep5-Syncytin-1, cells were immunostained using monoclonal antibody 6A2B2 334 directed against the Syncytin-1 envelope protein and the
number of Syncytin-1-positive cells were counted. The average of the numbers of
Syncytin-1 immunopositive BHK cells in each well in chamber slide at dilutions of 1:100
and 1:1000 were counted. Viral titer = Average x dilution (100 or 1000) x 1000/100 per
mL. On average, 5 x 106 to 3 x 107 infectious virus particles per ml were obtained for
SINrep5-EGFP and 5 x 106 particles per ml for SINrep5-Syncytin-1.
II.2.3. Construction of pFGH-Syncytin-1 envelope plasmid
(5’-AAGGAATAAAGCGGCCGCATGGCCCTCCCTTATCATATCTTTC-3’) and (5’-
AAAAGGAAAAGCGGCCGCCTAACTGCTTCCTGCTG-3’) oligonucleotides with
Not1 tags (underlined) in both sequences and a silent mismatch (C, italicized) in the sense
sequence were designed. The Not1 restriction sites allowed PCR amplification and
cloning into suitable vectors, whereas the silent mismatch prevented five ‘T’s in the
sequence. PCR was performed with phCMVph74 334 as the template, resulting in a 1.8 kb
product. The pFGH vector containing the GFAP promoter (kindly provided by Iain
Chapter 2: Materials and Methods
DHBB SINrep5- Syncytin-1 Syncytin-1
REPLICASE EGFP
REPLICASE REPLICASE
Syncytin-1 Structural proteins (Capsid/envelope proteins)
Translation of Syncytin-1 Specific assembly of SINrep5 genome in virus particle
SINrep5-Syncytin-1 virus
Fig. 12: Sindbis virus vector expressing Syncytin-1 (Adapted from Schlesinger, S (2000)
100 Chapter 2: MATERIALS AND METHODS 101
Campbell, University of Sydney) and the PCR product were digested with Not1
restriction enzyme. The PCR product was cloned into pFGH to obtain the construct,
pFGH-Syncytin-1.
II.2.4. Construction of pseudotyped virus
Pseudotyped virions expressing Syncytin-1 were generated by co-transfecting
293T cells with plasmids expressing firefly luciferase within an envelope-inactivated
HIV-1 clone (pNL-Luc-E-R-) 340 and the expression vector pCMV containing the full-
length Syncytin-1 sequence (pCMV-Syncytin-1) 334 or pCDNA 3.1 (+) (Clontech, CA,
USA). Transduction of target cells by pseudotyped virus led to expression of luciferase,
which was quantified in cells, lysed 48 h following infection, using the Luciferase Assay
Kit (Pharmingen, Canada). For experimental purposes, equal numbers of target cells were treated with 100 μl per well (96 well plate) of supernatant containing pseudotyped virus.
II.2.5. Soluble Syncytin-1 protein expression
Five μg of pVGW427 vector (a gift from Dr. Francoiş Mallet) expressing soluble
Syncytin-1 was transfected into HEK 293T cells using Lipofectamine-2000 (4 μl;
Invitrogen) and 100 μg of soluble Syncytin-1 protein was used for various experiments or
stored at –80oC.
II.3. Transfections
Constructs (5 μg) expressing various ER stress proteins were transfected into
astrocytes using Transfectin Lipid reagent (5 μl; Biorad) following the manufacturer’s
protocol. CHOP was obtained from David Ron (NYU School of Medicine); OASIS was a
kind gift from Kazunori Imaizumi (University of Miyazaki).
Chapter 2: MATERIALS AND METHODS 102
II.4. Extraction of protein from CSF and plasma
Protein from CSF, plasma and cell culture supernatants was precipitated by
adding 9 volumes of sample to 4 volumes of buffer (10% trichloroacetic acid, 0.07% β- mercaptoethanol in acetone) as described previously 345. Following centrifugation at
15000 g for 30 min at 4oC, 4 volumes of acetone containing 0.07% β-mercaptoethanol
were added to the pellet and incubated for 1 h at -20oC followed by centrifugation as
above. The pellet was air-dried and incubated for 90 min at room temperature in 2x
Laemmli buffer that was pre-heated to 95-100oC.
II.5. Antioxidant activity
The antioxidant activity of the test drugs was measured using a
spectrophotometric DPPH assay as described previously 346. NCX-2216 and ferulic acid
were dissolved in 95% ethanol after which serial dilutions of each drug were made in
95% ethanol. An aliquot (20 µl) of each drug, at various dilutions, was added to the wells
of a 96-well plate. A stable free radical [1,1-diphenyl-2-picrylhydrazyl (DPPH)], also
dissolved in 95% ethanol (180 µl), was then added to each well, and absorbance at 540
nM was monitored over a 15-min period. DPPH is a purple-colored substance, which is
converted to a colourless substance in the presence of antioxidants. The concentration of
each test compound that reduced absorbance to 50% was then calculated (EC50). Ascorbic
acid was included in this analysis as a positive control. All test compounds were assessed
at concentrations ranging from 1 to 300 µM.
Chapter 2: MATERIALS AND METHODS 103
II.6. Infection and treatment of cells
II.6.1. Infection of cells
All SINrep5 infections were performed with the same number of virus particles
(multiplicity of infection (MOI) of 1.0). HFA and MDM (5×104/well) were seeded in 16-
well chamber slides and infected with SINrep5-Syncytin-1 or SINrep5-EGFP (MOI 1.0
each) or mock conditioned medium (CM).
II.6.2. Treatment with cytokines
Cells were treated with human recombinant TNF-α, IL-1β, IL-10 (10 ng/ml, R &
D Systems, MN, USA) and IFN-β (100 U/ml, Serrono, USA).
II.6.3. Treatment with drugs
To assess the effect of astrocyte and monocyte stimulation on HERV expression,
U373, PBL and U937 cells were treated with 50 ng/ml of PMA (phorbol-12-myristate-
13-acetate) (Sigma, Canada) for 4-72 hours prior to harvest and RNA isolation as
described previously 198. Cells were treated with minocycline (10 μM, Sigma), sodium nitroprusside, an NO donor (100 nM, Axxora Life Science Inc., San Diego, CA, USA),
NBQX (30 µM; Sigma), MK-801 (30 µM; Sigma), glatiramer acetate (25 μg/ml; Teva,
Israel), IFN-β (100 U/ml; Serrono, Oakville, ON, Canada), ferulic acid (0.005, 0.5, 5, 50 and 250 μM; Sigma), NCX-2216 (60 nM, 600 nM and 6 μM; generously provided by
NicOx S.A., Nice, France), L-NIL (N6- (1-iminoethyl)-lysine, hydrochloride) (0.5 μM,
Sigma), L-NAME (NG-nitro-L-arginine methyl ester, a non-specific NOS inhibitor) (5.0
μM, Sigma), IGF-1 (3 ng/mL, R&D Systems, MN, USA) and Growth Hormone (100
μg/mL; GH, Serrono, USA); Thapsigargin and Tunicamycin (5 ng/ml; Sigma) were gifts from Dr. M. Marek (University of Alberta, Canada).
Chapter 2: MATERIALS AND METHODS 104
II.7. Animals and in vivo procedures
II.7.1. Stereotaxic implantation with SINrep5-Syncytin-1 virus
SINrep5-EGFP or SINrep5-Syncytin-1 virus (0.5 x 106 particles/ml in 3 μl) was stereotaxically implanted bilaterally into the corpus callosum of 10-week old CD1 mice
(n=6 for each treatment). The corpus callosum was chosen since this region of the brain is predominantly white matter with myelin-producing oligodendrocytes. Control mice (n=6) were implanted with conditioned medium from mock-infected cultures (1 mm anterior,
2.0 mm lateral and 1.5 mm deep relative to bregma). In addition, the right striatum of 10- week old CD1 male mice (n = 4 for each treatment) was stereotaxically implanted with
SINrep5-EGFP and SINrep5-Syncytin-1 (0.5 x 106 particles/ml). The striatum was chosen since this region of the brain is predominantly rich in neurons. The coordinates for the striatal implant were 3 mm posterior, 2.5 mm lateral, and 3 mm deep relative to the bregma (Fig. 13).
II.7.2. Syncytin-1 transgenic mouse
The construct pFGH-Syncytin-1 was digested with EcoR1 to produce a fragment of 5 kb that was used for pronuclear microinjection. We produced three independently- derived transgenic (Tg) lines on a CD1 background, bearing the Syncytin-1 transgene.
For genotyping, we isolated genomic DNA from tail biopsies by lysis in 0.25 mg/ml proteinase K (Sigma) in 1% SDS, 100 mM NaCl, 100 mM EDTA, 50 mM Tris, pH 8 at
55°C overnight followed by salt extraction and ethanol precipitation. We determined the presence of the transgene using PCR and the Syncytin-1 primers described in Table 3.
Genotyping was further confirmed by a second set of Syncytin-1 primers (5'-
ACCCATACCTCAAACCTCACCTG-3' and 5'-CTTTTGTTGCGGGGCTTAGATA-3').
Chapter 2: Materials and Methods
Fig. 13: Stereotaxic implantation of SINrep-Syncytin-1/EGFP/mock into corpus callosum (arrows) and striatum (arrowheads).
105 106
Table 3: List of Primers used in the study
Primer Sequence Genbank ID Primer Location HERV-W env 5’-TGCCCCATCGTATAGGAGTCT-3’ and NM_014590.3 1187-1207 Syncytin-1 5’-CATGTACCCGGGTGAGTTGG-3’ 1464-1445 HERV-W env 5'-ACCCATACCTCAAACCTCACCTG-3' and NG_004112 8870-8893 Syncytin-1* 5'-CTTTTGTTGCGGGGCTTAGATA-3' 9240-9219 HERV-H env 5’-TTACCCCATCATCAGTCCCCATTAC-3’ and AJ289709 870-895 5’-GAGCTCTTCGGTCCCATTTG-3’ 1125-1105 HERV-E env 5’- TCCCCTGTCCTCCTGCTCTTT -3’ and HEU34991 25-46 5’- AGGGTTGTCTGGGCTTGGTCT -3’ 491-511 HERV-K 5’- CCTGCAGTCCAAAATTGGTT -3’ and X82272 955-975 (HML2) env 5’- GGGGCAAGTTTTCCCTTTAG -3’ 1120-1100 HERV-R env 5’-CCATGGGAAGCAAGGGAACT-3’ and NM_001007253.1 793-812 5’-CTTTCCCCAGCGAGCAATAC-3’ 933-914 HERV-FRD 5’-GCCTGCAAATAGTCTTCTTT-3’ and BC068585.1 631-650 env 5’-ATAGGGGCTATTCCCATTAG-3’ 744-725 (Syncytin-2) HERV-T env 5’-CCAGGATTTGATGTTGGG-3’ and AJ862655.1 640-657 5’-GGGGTGAGGTTAAGGAGATGG-3’ 884-865 IL-10 5’-CCTCTCACCGTCTTGCTTTC-3’ and DQ217938.1 4457-4476 5’-GCAGAGGTTGCTTGTTCTCC-3’ 4710-4691 IL-1β 5’-CCAAAGAAGAAGATGGAAAAGCG-3’and NM_000576.2 706-728 5’-GGTGCTGATGTACCAGTTGGG-3’ 807-787 iNOS 5’- CAAAGGCTGTGAGTCCTGCAC -3’ and NM_000625.3 2418-2398 5’- ACTTTGATCAGAAGCTGTCCC -3’ 2203-2186 nNOS 5’- TCAGTCTCCCAGGCTAATGG-3’ and NM_008712.1 609-628 5’- CTGTCCACCTGGATTCCTGT-3’ 808-789 Alu 5’-GTGGATCACCTGAGGTCAGGAGTTTC-3’ Universal Alu NCBI Primer Handbook Syncytin-1- 5’-GGCAAAGACAGGAGGTAAAGAAAT-3’ and AF520550.1 2103-2126 LTR 5’-TGAAAACAGCTCCCATACAAAG-3’ 293-272 PLP 5′-CTTCCCTGGTGGCCACTGGATTGT-3′ and NM_011123.2 128-151 5′-CCGCAGATGGTGGTCTTGTAGTCG-3 407-384 MOG 5′-CCTCTCCCTTCTCCTCCTTC-3′ and NM_010814.1 39-58 5′-AGAGTCAGCACACCGGGGTT-3′ 470-451 CNPase 5′-CTACCCTCCACGAGTGCAAGACGCT-3′ and BC021904.1 147-171 5′-AGTCTAGTCGCCACGCTGTCTTGGG-3’ 485-461 OASIS 5’-CAACGCACCCCACTCACAGACACC-3’ and AB063321.1 1975-1998 5’-GGAGCAGCAAAGCCCGCACTAACT-3’ 2171-2148 GADD153 5’-AACCAGCAGAGGTCACAAGC-3’ and S40706.1 377-396 5’-AGCCGTTCATTCTCTTCAGC-3’ 593-574 CGT 5’-TTATCGGAAATTCACAAGGAT-3’ and X92122.1 1710-1730 5’-TGGCGAAGAATGTAGTCTATC-3’ 1786-1766 IFN-α 5’-GTGATCTCCCTGAGACCCAC-3’ and NM_006900.2 101-120 5’- GGTAGAGTTCGGTGCAGAAT-3’ 409-390 TNF-α 5’-ATTCAGGAATGTGTGGCCTGC-3’ and NM_000594.2 1041-1061 5’-GTTTGAATTCTTAGTGGTTGCCAG-3’ 1096-1073 107
PERK 5’-AAGTAGATGACTGCAATTACGCTATCAA-3’ NM_004836.3 2005-2032 and 2090-2070 5’-TTTAACTTCCCGCATTACCTTCTC-3’
ERp57 5’-TCAAGGGTTTTCCTACCATCTACTTC-3’ and NM_005313.4 1493-1513 5’-TTAATTCACGGCCACCTTCAT-3’ 1568-1548 BiP 5’-TCATCGGACGCACTTGGAA-3’ and NM_022310.2 523-541 5’-CAACCACCTTGAATGGCAAGA-3’ 591-571 ASCT1 (H) 5’-TCCCCATAGGCACTGAGATAGAAG-3’ and BC026216.1 819-842 5’-CAAGGAACATGATGCCCACAGGTA-3’ 1013-990 ASCT2 (H) 5’-CCTGCTGGGGGTGCTCTTTGGACA-3’ and NM_005628.1 2240-2263 5’-TTGAGTTGGGGACATGAGTGAGAA-3’ 2448-2425 ASCT-1 (M) 5’-CCTGGCTTGATGATGAACGC-3’ and BC043483.1 624-605 5’-CTGGTGCTGCTCACCGTGTC-3’ 348-329 ASCT-2 (M) 5’-CCATCGGCGCCACGGTCAACAT-3’ and NM_009201.1 1669-1690 5’-GTGGCGAGGGGCAGTGGATTCAGA-3’ 2071-2048 Egr1 5’-AGCAGCACCTTCAACCCTCA-3’ and BC073983.1 509-528 5’-CAGCACCTTCTCGTTGTTCAGA-3’ 610-589 Egr3 5'-TTGGGAAAGTTCGCCTTCG-3 and NM_004430.2 614-632 5’-ATGATGTTGTCCTGGCACCA-3’ 666-647 Egr4 5'-CCCCGCTGGATGCCCCTTTTC-3' and NM_001965.1 537-557 5'-ACTCTCCGCCGTCGCCGCTACTCC-3' 1073-1050 EAAT1 5’- GCGGGCCTGGTCACTATGGT -3’ and NM_004172.3 1991-1968 5’- AGAAGGGAGGAAAGGGAAGATGAC -3’ 1580-1599 GAPDH** 5’-AGCCTTCTCCATGGTGGTGAAGAC-3’ AND AY841947.1 214-191 (R) 5’-CGGAGTCAACGGATTTGGTCG-3’ BC002547.1 70-90 (H)
* Oligonucleotide primers used for genotyping Syncytin-1 transgenic mice ** Oligonucleotide primers designed to amplify GAPDH from a variety of species H: Human R: Rat M: Mouse Chapter 2: MATERIALS AND METHODS 108
The PCR mix contained approximately 100 ng genomic DNA, 200 μM dNTPs, 100 nM
each primer, 2 units Taq DNA polymerase I (5 units/μl; Invitrogen) in 1x reaction buffer
supplemented with 1.5 mM MgCl2 (Invitrogen). A 267 bp fragment was amplified under
the following PCR conditions: 94°C for 1 min, 56°C for 2 min, 72°C for 1 min for 40
cycles, then 72°C for 10 min. For stereotaxic implantations, 10-week transgenic and wild
type (WT) littermate controls were stereotaxically implanted with TNF-α or PBS
bilaterally into the corpus callosum (n=6 for each treatment) (1 mm anterior, 2.0 mm
lateral and 1.5 mm deep relative to bregma). All studies and procedures were carried out following University of Calgary Animal Care Committee guidelines.
II.7.3. Behaviour studies
Behavioural tests were conducted in mice that were injected with the SINrep5-
Syncytin-1, SINrep5-EGFP virus and the mock-infected conditioned medium on days 3,
7, 10 and 14 days post implantation. The horizontal bar test involved a test of co-
ordination and forelimb strength using a horizontal bar that was 0.2 cm thick, 38 cm long,
held 49 cm above a bench 347. The mouse was positioned to hold the bar using its
forelimbs and the time taken to either fall off the bar or reach the ends of the bar was
noted. The static rod test involved a test of co-ordination using five rods each 60 cm long
and of varying thickness (diameter) (Rod 1: 35 mm; Rod 2: 28 mm; Rod 3: 22 mm; Rod
4: 15 mm and Rod 5: 9 mm). These rods were bolted to the edge of a bench such that the
rods horizontally protruded their full 60 cm length into space. A mouse was placed at the
exposed end of the widest rod and the time taken to orient 180 degrees from the starting
position and the time taken to travel to the other end were noted 347. A test of strength and
seeking behavior was performed using the inverted screen test. The invertible screen was
Chapter 2: MATERIALS AND METHODS 109
a 43 cm2 area of wire mesh consisting of 12 mm squares of 1 mm diameter wire and
surrounded by a 4 cm deep wooden beading 347. We modified the inverted screen test by
placing the mouse at a point that was equidistant from the edges of the screen and the
stopclock was started once the screen was inverted and the time taken to reach the edge
of the inverted screen was determined, as a measure of curiosity and seeking behaviour.
Rotary behaviour of the animals implanted in the striatum was analyzed at 3, 7, 10 and 14
days after implantation, as described previously 342. Briefly, total and ipsiversive percent
rotation was assessed over 10 minutes after intraperitoneal injection of amphetamine (1 mg/kg, Sigma) at days 3, 7, 10 and 14 following intrastriatal injection.
II.7.4. Oral drug treatment
For treatment with ferulic acid, mice (n=6) were implanted with SINrep5-
Syncytin-1 followed by daily oral gavage with ferulic acid (20 mg/kg on a daily basis) for
14 days. Animals were sacrificed at day 14 and intracardially perfused with saline followed by 4% paraformaldehyde (PFA).
II.8. PCR
II.8.1. Isolation of DNA and RNA and cDNA preparation
Approximately 100 mg brain tissue or 1 x 106 cells were homogenized in Trizol
reagent (Invitrogen) followed by phase separation in Trizol-chloroform. The resulting
aqueous phase was used for RNA extraction while the inter- and -phenol phases were
used for DNA extraction. DNA was precipitated from the inter- and phenol phases by
ethanol, washed in a solution containing 0.1 M sodium citrate in 10% ethanol and the
DNA pellet was finally dissolved in 8 mM NaOH. Quality and quantity of DNA thus
obtained was measured spectrophotometrically (Appendix B). PBMC-derived DNA from
Chapter 2: MATERIALS AND METHODS 110
a cohort of Canadian MS patients and non-MS controls was obtained from Dr. George
Ebers (University of Oxford). Ten ng per reaction of DNA was used for PCR. Total RNA
and cDNA were prepared from brain tissue or cells. RNA was isolated using Trizol
reagent (Invitrogen) following the manufacturer’s protocol. Total RNA (encapsidated and non-encapsidated) was extracted from CSF and plasma of control and MS patients by
Trizol LS reagent (Invitrogen) following the manufacturer’s instructions. Briefly, after chloroform extraction, the resulting aqueous phase was treated with isopropanol and the
RNA was precipitated. The RNA pellet thus obtained was washed with 75% ethanol in
DEPC-treated water and finally suspended in DEPC water for cDNA preparation with the following conditions. Approximately 3 μg of RNA was dissolved in 8 μl of DEPC water and was subjected to RNase-free DNase-1 (Promega, Madison, WI) treatment for 45 min
o o at 37 C and heat inactivated at 65 C for 10 min. After addition of dNTP and random N6
oligomers to prime cDNA synthesis (Invitrogen, Burlington, ON), the reaction was
performed at 70oC for 5 min and reverse-transcribed at 37oC for 1 hour using
SuperscriptII (Invitrogen) to a final volume of 50 μl. Enzymes were heat-inactivated at
90oC for 5 min and the cDNA thus obtained was diluted 3-4 times in water before PCR
amplification.
II.8.2. Relative quantification real time RT-PCR
Relative quantification real time PCR analysis of cDNA or genomic DNA levels
in brain was performed. This was achieved by monitoring in real-time, the increase of
fluorescence of SYBR-green dye on a Biorad iCycler. A threshold cycle (Ct) value for
each gene of interest was calculated by determining the point at which the fluorescence
exceeded a threshold limit (12-fold increase above the standard deviation of the initial
Chapter 2: MATERIALS AND METHODS 111
baseline). To confirm single-band production, a melt-curve analysis was performed and
subsequently confirmed by electrophoresis and ethidium bromide staining. The 2-∇∇Ct method was used to quantify relative gene expression 348. The calculation assumes that
the amplification efficiencies of target and reference genes are equal. The change in
expression of the target gene was normalized to that of housekeeping genes such as β-
actin or GAPDH and expressed as mRNA relative fold change (RFC). Triplicate samples
were collected from the real-time RT-PCR experiment. The data were analyzed using the
-∇∇Ct equation 2 , where -∇∇Ct = (Ct (target)-Ct (housekeeping gene) CONTROL- Average (Ct (target)-Ct
(housekeeping gene) TREATMENT). Total RNA from CSF and plasma samples was subjected to
DNase treatment and a combined RT-PCR was done with Syncytin-1 specific primers
(Table 3) generating a 278 bp PCR product. PCR analysis of brain tissue was performed
using the primer pair 5'-TGCCCCATCGTATAGAGTCT-3' and 5'
CATGTACCCGGGTGAGTTGG-3'. The product was sequenced and confirmed to be
that of Syncytin-1.
II.8.3. Quantitative real time PCR
The construct, pBS-Syncytin-1, contained the 1.832 kbp Syncytin-1 env gene cloned into the EcoR1 and Xba1 sites downstream of the T3 promoter in pBluescript SK
II (+) (See section II.2.2.). Ten-fold serial dilutions of this clone were used to obtain the
DNA standard used for real time PCR to determine DNA copy numbers. Serial dilutions
of U937 cells were performed prior to extraction of genomic DNA for developing a
GAPDH standard. To obtain in vitro RNA transcripts to develop the RNA standard curve,
pBS-Syncytin-1 plasmid was linearized with XhoI, treated with proteinase-K (0.2 mg/ml,
0.5% SDS, 50°C for 30 minutes) and purified by phenol-chloroform extraction and
Chapter 2: MATERIALS AND METHODS 112
ethanol precipitation. About 2-3 μg of linearized DNA was used as template to generate in vitro run-off RNA transcripts using a T3 in vitro RNA transcription Kit (Ambion,
Austin, TX). RNA transcripts were purified by phenol-chloroform extraction and
isopropanol precipitation. Genomic DNA and/or total RNA were measured by
spectrophotometry (Appendix B). For quantitation of Syncytin-1 DNA or RNA levels, a
standard curve was generated with serial 10-fold dilutions (1011 copy/8μg to 1 copy/8μg)
of the DNA plasmid (pBS-Syncytin-1) or cDNA derived from the in vitro transcribed
RNA, respectively. Subsequently, the in vitro RNA transcripts were treated with RNase-
free DNase (Promega, Madison, WI) and reverse-transcribed using SuperscriptII
(Invitrogen) and random N6 oligomers to prime cDNA synthesis (Invitrogen, Burlington,
ON). The cDNA was diluted 1:1 with sterile water and 5 μl were used per PCR reaction.
Cycle threshold values from relative quantification RT-PCR experiments were analyzed
for levels of expression of several genes using equal concentrations of cDNA as templates
for the PCR. A real-time PCR protocol, using primers that amplified Syncytin-1 gene,
described in Table 3, was developed to determine the number of copies of Syncytin-1
encoding DNA and RNA sequences/μg of brain or RNA/μL of plasma or CSF.
II.8.4. Sequencing of virus-cell junctions
Primers were designed to PCR amplify circular, single and/or double LTR
sequences. Virus-host cell sequence junctions that included HERV-W7q LTR (U5) and
the universal Alu primer sequence were also designed (Table 3). PCR amplification of
either 780 or ~1500 bp fragments indicating single or double LTRs (Fig. 14) respectively
was performed and shown as Circ (+) if a PCR product was amplified and Circ (-), if not
amplified. First round PCR assay was performed using Syncytin-1-sense and Alu primers
Chapter 2: Materials and Methods
Preintegration complex 2-LTR circle
1-LTR circle
Target DNA Terminal cleavage, strand transfer
Integration intermediate
Repair Provirus
Fig. 14: Schematic of retroviral LTR circles and formation of provirus
113 Chapter 2: MATERIALS AND METHODS 114
(Table 3). A second round PCR was performed using 5 μl of the first round reaction with
HERV-W7q LTR (U5)-sense and Alu primers (Fig. 15). Results were expressed as percent detection of PCR amplified products.
II.9. In vitro assays
II.9.1. Toxicity of astrocyte conditioned medium
Adult rat oligodendrocytes and LAN-2 neurons were treated with conditioned
medium (diluted 1:1 with AIM-V medium). Conditioned media for toxicity assays were
obtained from HFA and MDM infected with SINrep5-Syncytin-1 or SINrep5-EGFP.
Cells were examined for cytotoxicity by trypan-blue dye exclusion for up to 5 days.
Culture medium in 96 well plates or chamber slide (Nunc) was carefully removed by
pipetting, followed by addition of trypan-blue dye (50 μl per well). After incubating cells
for 5 min, the trypan-blue dye was carefully removed and cells were washed twice with
PBS. Cells were counted on a Zeiss inverted microscope using the 10X objective. All
experiments were repeated at least three times. For measurements of cellular injury,
oligodendrocytes were immunostained with antibody to Gal-C, CNPase and MBP, and
cells with and without processes were counted. In addition, oligodendrocyte injury was
also measured by in-cell western analysis using quantitative immunofluorescence
(section II.11).
II.9.2. Analysis of supernatant for protein carbonyls and 4-HNE
The level of protein oxidation was determined by an oxidized protein detection kit
(OxyblotTM, ONCOR) 349. Samples were incubated for 20 min with 12% SDS and 2,4- dinitrophenylhydrazine (DNPH) in 10% trifluoroacetic acid, vortexing every 5 min, and
then neutralized with OxyblotTM Neutralization solution. 600 ng of protein was blotted
LTR-F ltr gag pol env LTR-F
Alu LTR-R LTR-R
Fig. 15: Location of oligonucleotide primers for PCR amplification of virus-host cell junctions and quantification of Syncytin-1 DNA copy numbers
115 Chapter 2: MATERIALS AND METHODS 116
onto nitrocellulose paper by the slot blotting technique. Membranes were incubated with
blocking buffer for 30 min at room temperature, exposed to rabbit anti-DNPH protein
antibody (1:150) for 90 min, followed by anti-rabbit IgG coupled to alkaline phosphatase
(1:15,000) for 2 h at room temperature. Following washing and development with
SigmaFastTM chromogen, blots were analyzed by computer-assisted imaging software,
Scion Imaging. Samples for HNE detection were similarly analyzed by slot blotting
technique except that rabbit-anti-HNE antibody (1:4,000; Calbiochem) was used as a
primary antibody as described 349. Results were expressed as relative fold change (RFC)
over levels in AIM-V medium.
II.10. Microarray Analysis
U373 astrocytes were infected with Sindbis virus-derived clones (0.5 x 106) or mock-infected for 24 h in AIM-V medium. Total cellular RNA from infected astrocytes
was purified and subjected to hybridisation using Affymetrix Human Genome U133 Plus
2 arrays. Following purification of RNA, discrete 28S rRNA and 18S rRNA peaks were
observed. RNA concentrations were determined spectrophotometrically and all samples
had an OD260/OD280 ratio of 1.7-1.9. RNA amplification was followed by hybridization,
washing, staining and scanning as described in the Affymetrix GeneChip Expression
Analysis Technical Manual. Relevant sections are provided in Appendix C.
Hybridizations were carried out at 45°C for 16 h. Following hybridization, the arrays
were washed and stained with streptavidin–phycoerythrin in the Affymetrix Fluidics
Station 400, using the standard antibody amplification protocol. Arrays were scanned
with the Affymetrix GeneArray Scanner at 488 nm and 3 μm per pixel. Relative expression values were calculated using GeneChip Operating Software (Affymetrix). The
Chapter 2: MATERIALS AND METHODS 117
experimental approach and data acquisition were performed in accordance with MIAME
requirements.
II.11. Quantitative Immunofluorescence
Astrocytes were plated in a 96-well plate and grown to confluence overnight
before being treated with soluble Syncytin-1 protein or supernatant from empty vector
transfected HEK293T cells. Treatment period ranged from 24-96 hours after which cells
were processed for analysis. Cells were permeabilized by five washes of 5 minutes each
in PBS containing 0.1% Triton X-100. Cells were blocked by a 90-minute incubation in
Li-Cor Odyssey blocking buffer at room temperature with gentle shaking. The primary
antibodies (anti-ASCT1, anti-CNPase, anti-MBP, anti-Egr1) were added at a
concentration of 1:500 and incubated overnight at 4°C with gentle shaking. Cells were washed 5 × 5 minutes each in PBS containing 0.1% Tween-20. The secondary antibodies
(1:800, room temperature, IRDye800-conjugated or Alexafluor-conjugated, Rockland,
Gilbertsville, PA, USA) were added at a concentration of 1:500 and incubated 1 hour at room temperature with gentle shaking, after which cells were washed 5 × 5 min in PBS containing 0.1% Tween. The plate was then scanned using the Odyssey Infrared Imaging
System (700 nm and 800 nm wavelength; 169 μm resolution, 2 mm offset, intensity setting of 5 for both channels). Label intensity was measured by densitometric analysis of the wells.
II.12. Detection of proteins in brain homogenate and cell cultures by western blot
Protein extracts were prepared from various brain tissue and cell samples with
lysis buffer (10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.5 % NP-40) and
concentrations were determined by Bradford assay (Biorad, Mississauga, ON, Canada).
Chapter 2: MATERIALS AND METHODS 118
Equal amounts of protein from each sample (100-200 μg) were separated by 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE, under reducing conditions), transferred to nitrocellulose membranes and blocked with 10% skimmed milk in TBST (25 mM Tris-buffered saline and 0.05% Tween-20). Primary antibodies were diluted in TBST containing 5% skimmed milk and incubated with membranes for at least 2 h at room temperature. Membranes were washed and incubated for at least 2 h at room temperature with horseradish peroxidase (HRP)-conjugated goat-anti-mouse (or rabbit anti-goat) IgG (Jackson ImmunoResearch Lab Inc. Westgrove, PA, USA) diluted in 5% milk-TBST. Immunoreactive proteins were detected by chemiluminescence
(Roche) and protein abundance measured by densitometry using Scion Image (Scion
Corp. MD, USA). Blots were stripped in stripping buffer (100 mM β-mercaptoethanol in
2% SDS-containing TBS) for 2 h at 55oC and probed with either other primary antibodies or against β-actin. When needed, densitometric analysis was performed and the average of the results was expressed as the RFC in the density of the band in treatment versus controls.
II.13. Human tissue samples
Brain tissue (frontal white matter) was collected at autopsy. Age-matched control subjects included 18 patients (mean age 56 ± 16.4 years) who were diagnosed with
Alzheimer’s Disease (AD) (n=6), HIV-infection (encephalitis (n=4); gliosis (n=4)), cerebral arteriosclerosis (n=2), anoxic encephalopathy (n=1) or normal brain pathology
(n=1). MS patients included 20 patients (age 63.3 ± 13.4 years) who had been classified as primary progressive (n=6), secondary progressive (n=10), and relapsing-remitting
(n=4) who had Expanded Disability Status Scale score (EDSS) ranging from 7 to 9 prior
Chapter 2: MATERIALS AND METHODS 119
to death. Frozen brain tissue from MS patients was obtained from the Multiple Sclerosis
Patient Care and Research Clinic, Edmonton, AB, Canada. (See Appendix D for list of
patients and their disease conditions). In addition, one case of an acute MS lesion was obtained from Dr. Arthur Clarke (University of Calgary, Canada) and tissue sections of acute lesions from MS patients was also obtained from Dr. Robert Hammond (University of Western Ontario, Canada). Matched plasma and CSF samples from controls (n=40) and MS (n=38) patients with relapsing-remitting disease were also obtained with consent through the MS clinic at the University of Alberta, through Dr. K.G. Warren and centrifuged to remove cellular debris. In addition, resting PBMC subsets (B and T cells, monocytes) from a previously reported cohort of acute RR-MS patients and healthy age- and sex-matched controls at the Montreal Neurological Institute, McGill University,
Montreal QC, were used 350.
II.14. Immunohistochemistry and immunocytochemistry
II.14.1. Detection of proteins in culture, human and mouse brain tissue sections
Paraffin-embedded sections were immunostained with antibodies to ionized
calcium binding adaptor protein (Iba-1) 351 (macrophages and microglia), GFAP
(astrocytes) (DAKO), iNOS (Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit
anti-mouse GSTYp (oligodendrocytes) (Biotrin), APC (Ab-7) (oligodendrocytes)
(Oncogene Research Products, CA, USA), Syncytin-1 (6A2B2) 334, SLC1A4 (ASCT1),
SLC1A5 (ASCT2) (US Biologicals), CD45 (macrophage/microglial cells) (Zymed
Laboratories, San Francisco, CA), mouse anti-myelin basic protein (MBP Sternberger
Monoclonals Inc.), CNPase (Chemicon, USA), (Iba-1 1.0 μg/ml, GFAP 1:2000, iNOS
1:500, GSTYp 1:600, APC 1:500, Syncytin-1 1:1000, ASCT1 1:40, ASCT2 1:40, CD45
Chapter 2: MATERIALS AND METHODS 120
1:1000, MBP 1:1000, GSTYp 1:600, CNPase 1:100). ER stress proteins
GADD153/CHOP, Grp78/BiP, Grp58/ERp57 and PERK were detected using antibodies sc-575, sc-1050, sc-18619 and sc-13073 respectively (1:100, Santa Cruz Biotechnology,
CA, USA). Cultured oligodendrocytes derived from adult human and rat brains were stained with a mAb (O1, 1:1, a kind gift from Dr. V.W. Yong, University of Calgary) that recognizes galactocerebroside (Gal-C), a marker for mature oligodendrocytes 352, CNPase
or MBP.
II.14.2. Double label immunohistochemistry and microscopy
To double label both microglia and astrocytes with cell type-specific markers and
Syncytin-1, sections were initially probed with antibodies to Iba-1 and GFAP
respectively. This was followed by incubation with biotinylated goat anti-rabbit Ig (H+L)
(1:500, Vector Laboratories Inc. Burlingame, CA, USA) and subsequently with Elite
ABC reagent (Vector Laboratories Inc. Burlingame, CA, USA) or peroxidase-conjugated
affinipure goat anti-rabbit IgG (H+L) (1:500, Jackson Immunoresearch Laboratories, PA,
USA) and later developed by DAB treatment for peroxidase or BCIP/NBT for alkaline
phosphatase activity. Slides were examined on a Zeiss Axioskop2 microscope.
Immunofluorescence studies on brain sections from mouse models were performed when
required using secondary antibodies conjugated to Alexa488 (Molecular Probes) or Cy3
(1:200, Jackson Immunoresearch Laboratories, PA, USA). Images were captured on an
Olympus FV300 confocal laser-scanning microscope at the University of Calgary or at
the University of Alberta using a LSM510 META (Carl Zeiss MicroImaging, Inc.) laser-
scanning microscope. Images were analyzed by Scion Image software (Spot Diagnostic
Instruments, MD, USA).
Chapter 2: MATERIALS AND METHODS 121
II.14.3. Luxol fast blue staining for myelin
Sections were stained for myelin using Luxol fast blue (Solvent blue 38; Sigma).
Briefly, sections were deparaffinized, incubated in the solvent blue solution for 3 hr at
60°C, destained with 0.05% lithium carbonate, and counterstained with
hematoxylin/eosin 353.
II.14.4. Syncytia formation in astrocytes
HFA infected with SINrep5-Syncytin-1 or SINrep5-EGFP or mock-infected
astrocytes were immunostained for expression of Syncytin-1 using the monoclonal
antibody 6A2B2 334. Cells were double labeled with anti-GFAP antibody to determine
GFAP-positive astrocytes overexpressing Syncytin-1.
II.15. Quantification of cell numbers in vivo and in vitro
Fluorescently (Alexa488, Molecular Probes)-labeled cells were counted (10
fields) from a total area of 23760 μm2 using a 10X objective on a Zeiss Axioskop
microscope and expressed as a percentage. In addition, cells were also counted by a
stereological method 354. APC (Ab-7)-positive oligodendrocytes as well as GFAP-
positive astrocytes in the vicinity of the implantation site were counted per well (5 fields
at 400 x; expressed as total number of GSTYp-positive cells in an area of 2376 μm2).
Three serial sections (5 μm) from 6 animals per treatment group were used for
quantitative analysis of numbers of GFAP-positive astrocytes and GSTYp-positive
oligodendrocytes. Briefly, a systematic random sample of 3 sections that span the corpus
callosum was selected for analysis. Sections were selected at equal intervals in the series
comprising a known fraction of the section series (ssf). The labeled astrocytes and
oligodendrocytes were counted (ΣQ) under a known fraction of the section area (asf). The
Chapter 2: MATERIALS AND METHODS 122 height of the optical dissectors (h) positioned in the central part of the section thickness
(t) was used to determine the ratio h/t (tsf). The total number (N) of astrocytes or oligodendrocytes were estimated as N= ΣQ. 1/ssf. 1/asf. 1/tsf. The coefficient of error was determined by the formula CE (ΣQ)= SEM/Mean.
II.16. Statistical analyses
Statistical tests were performed using GraphPad InStat version 3.01 software
(GraphPad Software, San Diego California USA). Syncytin-1 RNA and DNA copy numbers were shown as the median viral copy numbers with 95% confidence intervals.
Contingency tables were analyzed using Chi-square and Fisher’s Exact Tests. The Mann-
Whitney U or unpaired t tests were used to analyze data and when multiple treatments were used, a one-way Analysis of variance (ANOVA) with Tukey-Kramer Multiple
Comparisons Test was also performed. When data from treatments were normalized to the control values, Dunnet’s post-hoc test was applied. When distribution of our data was unknown and non-parametric tests were used, data were analyzed with the Kruskal-
Wallis test.
Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 123
CHAPTER 3
SYNCYTIN-1 INDUCES NEUROINFLAMMATION
Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 124
III.1. Introduction
As much as 8% of the human genome is derived from retrovirus-like elements,
presumably remnants of retroviral infections during primate evolution 287,307,355. Many
HERVs have retained functional promoter, enhancer, and polyadenylation signals, and
these regulatory sequences have the potential to modify the expression of adjacent genes
318,319 . Despite most HERVs being replication defective because of mutations within
structural retrovirus genes, specific ORFs corresponding to HERV genes encode
detectable proteins 356. The increased expression of HERV genes may be important in
modulating host innate and adaptive immune responses with ensuing disease effects
although definitive proof of specific HERV-related pathogenic effects is lacking.
Earlier studies suggested that HERV expression in human brain was augmented in
circumstances of neuroinflammation 198. MS is a prototypic neuroinflammatory disease,
characterized by infiltration of inflammatory cells, damage and death of oligodendrocytes
with demyelination, resulting in physical and cognitive disabilities. Indeed, cytokines,
arachidonic acid metabolites and redox reactants including NO are major determinants of
pathogenicity in MS 138,357,358, which is also influenced by an individual’s genetic susceptibility. The role of both exogenous and endogenous infectious pathogens in MS pathogenesis is uncertain but several viruses and bacteria have been implicated through specific mechanisms including transactivation of aberrant immune responses and molecular mimicry. Herein, we examined the effects of Syncytin-1 expression on neural
cell function and survival, focusing in particular on the pathogenic effects.
III.2. RESULTS
III.2.1. Syncytin-1 is inducible and up-regulated in MS lesions.
Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 125
To investigate gene expression of phylogenetically related HERVs (Fig. 10) in
neuroinflammatory diseases, we examined the abundance of different HERV env mRNAs
in brains from patients with MS and other neurological diseases as controls. We analyzed
a broad range of endogenous retroviral envelope genes, whose sequences have since
become available (www.ncbi.nlm.nih.gov). The recently described Syncytin-2 (HERV-
FRD)303, HERV-R and -T env expression was analyzed by real-time RT-PCR, in addition
to HERV-H, -K (HML-2), -E and Syncytin-1. Syncytin-1 mRNA expression was
selectively up-regulated in brain tissue from MS patients relative to control patients,
while other HERV env mRNAs were not elevated in MS patients (Fig. 16). Sequencing
of the resulting PCR products confirmed that Syncytin-1 was overexpressed in the brain
samples, based on comparisons with HERV-W and other HERV env sequences located in
Genbank (www.ncbi.nlm.nih.gov/Genbank). Western blotting showed that HERV-W
env-encoded Syncytin-1 (75 kDa) immunoreactivity was detected in brain tissue from
MS patients but exhibited limited detection in control patients (Fig. 17A). Comparison of
Syncytin-1 immunoreactivity in brain, showed a ~3.0-fold increase among MS patients
relative to controls (Fig. 17B). Lesions from MS patients containing active demyelination
[D] in acute (Fig. 18A) tissue sections with numerous lipid/myelin filled macrophages and hypertrophied astrocytes demonstrated Syncytin-1 immunoreactivity. Syncytin-1 expression was observed in acute (Fig. 18C) lesions in cells resembling activated glia, which also exhibited iNOS immunoreactivity (Fig. 18C, inset), but not in controls (Fig.
18 D) that showed normal myelination (Fig. 18 B). Lipid vacuole filled Syncytin-1- immunopositive cells resembling phagocytic macrophages, were evident at the margin of the lesion (Fig. 18 G) as well as within the core of the lesion (Fig. 18H) in both acute and
Chapter 3: Syncytin-1 induces neuroinflammation
7 Brain Control ** 6 MS 5
4
mRNA RFC mRNA 3
2
1
0 -R -FRD -E - W -H -T -K
HERV
Fig. 16: A significant increase (3-fold) in the mRNA of HERV-W env (Syncytin-1) in MS patients relative to other HERVs and disease control patients was observed by real-time RT-PCR analysis. Statistical comparisons were made between controls and MS and also among different HERVs (Tukey’s Multiple Comparison Test was used to compare all columns; ** p<0.01).
126 Chapter 3: Syncytin-1 induces neuroinflammation
A MS Controls KDa
Syncytin-1 75 β-actin 42
B 4 MS (n=16) * 3 Controls (n=18) 2 1 Protein RFC 0 MS Controls
Fig. 17: Representative western blot of brain tissue lysate from MS patients (MS) that exhibited increased Syncytin-1 immunoreactivity compared to controls (A). Quantitation of western blots showed increased Syncytin-1 immunoreactivity in MS brains compared to controls (B) (Dunnet’s test was used to compare patient groups; * p<0.05).
127 Chapter 3: Syncytin-1 induces neuroinflammation
D AB
CD
EF
D *
G H
Fig. 18: (A) An active demyelinating (D) lesion from frontal lobe sections of a MS patient brain shows myelin debris in macrophages, minimal Luxol fast blue (LFB), hematoxylin and eosin staining, compared to normal myelin (B). (C) Serial sections from the same active lesion show increased Syncytin-1 expression in an area of active demyelination (D) that was absent in control sections (D). iNOS immunoreactivity (dark blue) was co-localized with Syncytin-1 (brown) in glia (C, inset). Double-label immunohistochemistry of acute lesions in MS brain shows Syncytin-1 expression in activated astrocytes colocalized with GFAP immunoreactivity (E), (Syncytin-1-blue and GFAP-brown, arrows) (E; inset figure shows only GFAP- immunoreactive astrocyte) or microglia and macrophages colocalized with Iba-1 immunoreactivity (Iba-1-blue and Syncytin-brown, arrowheads) (F; inset figure shows only Iba-1 immunoreactive microglia). Syncytin-1 immunoreactivity (G) is detected at the edge (asterix) of an acute demyelinated (D) lesion. (H) Phagocytic macrophages containing lipid vacuoles, representing myelin debris (arrow), are evident at the edge of the lesion (G, box) in the vicinity of Syncytin-1-positive hypertrophied astrocytes or macrophages (arrowheads). 128 Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 129
chronic demyelinating lesions (Table 4). As astrocytes 359 and microglia 6 are important
modulators of neuroinflammation, we determined if Syncytin-1 expression was
selectively up-regulated in these immunologically active cells. Double-label
immunohistochemistry revealed enhanced expression of Syncytin-1 in astrocytes (Fig.
18E) and microglia (Fig. 18F) of acute brain lesions (frontal white matter) from MS
patients, but not in other neural cells including neurons and myelin-forming
oligodendrocytes.
To examine the relative expression of different HERV env mRNAs in specific cell
types implicated in neuroinflammation, we studied human cell lines with and without cellular activation. Peak mean HERV transcript abundance was detected at 4 h in PMA- treated monocytoid (U937) cells with a significant increase in Syncytin-1 mRNA level
compared to other HERVs (Fig. 19A). HERV-H env mRNA was the most highly
expressed HERV in PMA-treated astrocytic (U373) cells at 24 h together with a
significant increase in Syncytin-1 (Fig. 19B). In contrast, we were unable to induce
HERV env expression in lymphocytes (PBLs) with PMA stimulation although IL-1β
expression was significantly elevated (Fig. 19C), similar to monocytoid and astrocytic cells. In fact, we observed suppression of HERV env mRNA levels when PBLs were stimulated with PMA (Fig. 19C). Thus, these studies indicated up-regulation of Syncytin-
1 occurred among MS patients in active demyelinating lesions with selective expression in cells mediating neuroinflammation.
130
Table 4: Clinical and neuropathological features of multiple sclerosis patients exhibiting Syncytin-1 immunoreactivity in [Acute (A), sub-acute (SA) and chronic (C)] demyelinating lesions Section ID 1 2 3 Age at Death 65 71 38 Gender F F M MS Type1 SP SP RR Duration of MS >10 years >10 years 8 years Pattern of Syncytin-1 immunoreactivity2 Lesion type SA (n=1), SA (n=2), C (n=3) A (n=3), SA (n=3), C (n=3) C (n=2) Lesion type SA C C SA SA C C C SA SA SA A A A C C C Lesion edge 3+ 1+ 0 2+ 1+ 2+ 1+ 0 3+ 4+ 3+ 4+ 4+ 4+ 3+ 2+ 3+ Lesion core 4+ 2+ 1+ 4+ 3+ 3+ 2+ 1+ 2+ 2+ 2+ 4+ 4+ 0 1+ 1+ 0 Periplaque white matter 1+ 0 0 1+ 1+ 1+ 1+ 0 0 1+ 2+ 0 1+ 0 0 1+ 0 Normal appearing white matter 1+ 0 0 1+ 1+ 1+ 1+ 0 0 0 0 0 0 1+ 0 0 0
1 Clinical course: Secondary Progressive (SP), relapsing-remitting (RR) 2 Scoring pattern: 0, no cells; 1+, 1-10 cells/hpf; 2+, 10-50 cells/hpf; 3+, 50-100 cells/hpf; 4+, 100-500 cells/hpf (hpf = X 200) Chapter 3: Syncytin-1 induces neuroinflammation
ABC 60 25 Control ** Control *** Control PMA PMA 250 20 PMA ** 150 40 15 50 5 ** ** ** 10 4 20 * 3 mRNA RFC mRNA * 5 2 1 0 0 HERVHERV-KHERVHERV-EIL-1 HERV-EHERV-KHERV-HHERV-W HERV HERV HERV-HHERV β -H -W -E -K -W
Monocytoid cells Astrocytes Lymphocytes (U937) (U373) (PBL)
Fig. 19. Monocytoid cells (U937) (A) and astrocytic cells (U373) (B) show an increase in individual HERV mRNA relative fold change (RFC) when stimulated in the presence of 50 ng/ml of PMA as detected by real-time RT-PCR analysis using HERV envelope specific primers. All HERVs’ mRNA levels were suppressed in peripheral blood lymphocytes (PBL) (C) upon PMA stimulation despite marked induction of IL-1β mRNA levels. Statistical comparisons were made between controls and PMA and also among different HERVs (Dunnet’s Test was used to compare all PMA treatments to untreated controls; ***p<0.001, **p<0.01, *p<0.05).
131 Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 132
III.2.2. Syncytin-1 activates pro-inflammatory molecules in glial cells
As Syncytin-1 was abundantly expressed in vivo in MS brain tissue (Fig. 18), we
constructed a SINrep5-based vector (Fig. 12) that efficiently expressed the HERV-W-env
ORF encoding Syncytin-1 (Fig. 20A) and also mediated syncytia formation in BHK cells
(Fig. 20B). The SINrep5-Syncytin-1 virus infected HFA (Fig. 20C) that expressed GFAP
(Fig. 20E) compared to controls (Fig. 20 D&F). Comparison of cellular localization of
Syncytin-1 in BHK and HFA revealed distinct patterns of localization, with localized
staining in BHK (Fig. 20G) compared to a more dispersed pattern in HFA (Fig. 20H)
relative to SINrep5-EGFP expressing controls that did not display any Syncytin-1
immunoreactivity (Fig. 20 I&J). Further, RT-PCR analysis revealed comparable levels
of Syncytin-1 expression in fetal astrocytes and brain tissue from MS patients (Fig. 20K).
Syncytin-1-mediated induction of genes related to neuroinflammation was
examined 24 h post infection (p.i), revealing that the pro-inflammatory cytokine, IL-1β,
was significantly increased in both HFA (Fig. 21A) and MDMs (Fig. 21B) infected with
SINrep-5-Syncytin-1 compared to the controls including SINrep5-EGFP and mock-
infected cells. Moreover, mean iNOS expression was also enhanced in astrocytes upon infection with SINrep5-Syncytin-1 (Fig. 21A) but not in MDMs (Fig. 21B). However,
the anti-inflammatory cytokine, IL-10, was not induced in either cell type, suggesting that
Syncytin-1 expression selectively induced pro-inflammatory responses. A marked increase in mean protein carbonyl levels was also observed in the conditioned medium from SINrep5-Syncytin-1-infected HFA compared to controls (Fig. 21A), but not in
MDM-derived conditioned medium (Fig. 21B). Conversely, there was no significant difference in the mean levels of malondialdehyde (a product of lipid peroxidation) 349 in
Chapter 3: Syncytin-1 induces neuroinflammation
A B BHK EGFP Syncytin-1Mock 75 KDa C DC GFAP
EF Syncytin-1 GHH Syncytin-1 I J EGFP
K BHK HFA 7 ** 6 * 5 4 3
mRNA RFC mRNA 2 1 0 -1 MS Non-MS FP n G E ncyti y (n=13) (n=11) (n=5) S (n=6) Fig. 20: Western blot analysis of BHK cells transfected with SINrep5-Syncytin-1 RNA transcript. Syncytin-1 immunoreactivity on western blot (A) and syncytia formation (B) could be detected in transfected cells but not in mock-transfected or cells transfected with SINrep5-EGFP. Confocal microscopy of uninfected human fetal astrocytes (HFA) immunostained for GFAP (C) and Syncytin-1 (D) and astrocytes infected with SINrep5-Syncytin-1 (multiplicity of infection (MOI) of 1.0) immunostained for GFAP (E) and Syncytin-1 (F). Localization pattern of Syncytin-1 in BHK cells (G) and HFA (H) expressing Syncytin-1 reveal distinct patterns of immunoreactivity. Syncytin-1 expression is not observed in BHK (I) and HFA (J) infected with SINrep5-EGFP. Comparable levels of expression of 133 Syncytin-1 was observed in Syncytin-1 expressing brain tissue from MS patients and astrocytes (K). Levels of Syncytin-1 was compared between brain tissue of MS patients and SINrep5-Syncytin-1 infected astrocytes (Tukey’s Multiple Comparison Test was used to compare all columns**p<0.01, *p<0.05). Chapter 3: Syncytin-1 induces neuroinflammation
A
20 Carbonyls (%) ** Mock HFA EGFP * 250 Protein 15 Syncytin 200 10 150
mRNA RFC mRNA 100 *** 5 50 0 0 IL-1β IL-10 iNOS Protein B carbonyl Mock 100 *** MDM Carbonyls (%) EGFP 180 80 Syncytin Protein 140 60 100 40 mRNA RFC mRNA 60 20 20 0 IL-1β IL-10 iNOS Protein carbonyl C 1000 800 600 400 4-HNE (RFC) 200 0 ck -CM -CM o M EGFP DM M HFA SINrep5-Syncytin-1 Fig. 21: SINrep5-Syncytin-1-infected HFA show a significant increase in mRNA expression of IL-1β and iNOS together with increased protein carbonyl levels relative to SINrep5-EGFP and mock controls while IL-10 mRNA expression was similar between treatments (A). IL-1β expression was increased in MDMs relative to controls while IL-10 and iNOS mRNA expression and levels of protein carbonyls did not differ between viruses (B). Levels of 4-HNE, a product of lipid peroxidation was not significantly different in the conditioned medium from astrocytes (HFA) and macrophages (MDM) infected with SINrep5- Syncytin-1 compared to controls. (C) Lipid peroxidation was not significantly different between samples. Samples were analyzed by slot blotting technique 134 that used a rabbit-anti-HNE antibody (1:4,000; Calbiochem) as a primary antibody (Dunnet’s Test was used to compare all PMA treatments to untreated controls; *p<0.05 , **p< 0.01, *** p< 0.001; compared to values obtained in Mock or SINrep5-EGFP infected astrocytes) Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 135
conditioned medium from SINrep5-Syncytin-1 infected HFA or MDMs compared to
controls (Fig. 21C). These observations indicated that Syncytin-1 induced a
proinflammatory molecular profile in astrocytes that included increased oxidation of
cellular proteins.
III.2.3. Syncytin-1 causes oligodendrocyte damage and death
Since oligodendrocytes are the principal cell types susceptible to injury associated
with neuroinflammation and demyelination, their morphology and survival was examined
after treatment with conditioned medium from HFAs and MDMs infected with SINrep5-
Syncytin-1. Conditioned medium from HFA infected with SINrep5-Syncytin-1 was
highly cytotoxic to human oligodendrocytes compared to SINrep5-EGFP- and mock-
infected HFA-derived supernatants (Fig. 22A). Importantly, conditioned medium from
HFA infected with SINrep5-Syncytin-1 also induced higher mean oligodendrocyte death
than that from SINrep5-Syncytin-1-infected MDM (Fig. 22B). Additionally, human
oligodendrocytes treated with media from HFA infected with SINrep5-Syncytin-1 also
displayed significant retraction of cellular processes (p<0.001) (Fig. 22C), compared to
the controls.
These results were confirmed using rat oligodendrocytes in the same cytotoxicity
protocol, which showed that supernatants from SINrep5-Syncytin-1-infected HFA
similarly caused significantly higher mean levels of cell death than that from SINrep5-
Syncytin-1 infected MDMs (Fig. 23A). As a control, the envelope protein from HIV-
JRFL, another neurotropic retrovirus from a patient with HIV-associated dementia, expressed in astrocytes using the same vector (SINrep5) did not cause cytotoxicity of oligodendrocytes (Fig. 23A). Aside from cell loss, there was also marked process
Chapter 3: Syncytin-1 induces neuroinflammation
A
Mock Syncytin-1 EGFP
BC
10 * HFA-CM *** 80 HFA-CM 8 MDM-CM 6 60 4 40 2 20 Cytotoxicity (%) Cytotoxicity 0 0 Oligodendrocytes with Oligodendrocytes Mock Syncytin-1 EGFP retracted processes ( %) Mock Syncytin-1 EGFP
Fig.22: Syncytin-1 causes oligodendrocyte damage and death. (A) Human oligodendrocytes (H-OL) treated with conditioned medium (CM) from SINrep5-Syncytin-1- infected HFA exhibited retracted cellular processes (arrowhead) with cell loss compared to SINrep5-EGFP and mock controls which showed abundant cell numbers and intact processes (arrowhead). (B) H-OLs treated with CM from SINrep5- Syncytin-1- infected HFA for 24 h showed significantly higher cytotoxicity than the controls. CM from SINrep5-Syncytin-1-infected MDMs was not toxic to H-OLs. (C) H-OLs treated with CM from SINrep5-Syncytin-infected HFA for 24 h showed significantly more cells with retracted processes compared to controls. Statistical comparisons 136 were made between Syncytin-1 and EGFP relative to mock controls (Tukey’s Multiple Comparison Test was used to compare all columns *p< 0.05, *** p< 0.001). Chapter 3: Syncytin-1 induces neuroinflammation
A
30 MDM-CM *** ROL 25 HFA-CM 20 15 10
Cytotoxicity (%) Cytotoxicity 5
FL R Mock EGFP HIV-J velope Syncytin-1 n e B C
Syncytin EGFP
Fig. 23: (A) Conditioned medium (CM) from SINrep5-Syncytin-1- infected HFA induced significant cytotoxicity in rat oligodendrocytes but not CM from SINrep5-HIV-envelope. CM from HFA infected with SINrep5-Syncytin-1 caused rat OL cytotoxicity and process retraction (B) compared to conditioned media from SINrep5-EGFP-infected HFAs (C). Cells were stained for Gal-C using the monoclonal antibody O1 (1:50 dilution). OLs were immunostained for p53 to determine if cytotoxicity is mediated through the p53 pathway. Indeed, p53 immunopositive OLs (B, inset) were observed when OLs were treated with conditioned medium from Syncytin-1 expressing astrocytes. Statistical comparisons were made between Syncytin-1 and EGFP and HIV-JRFL relative to mock controls (Dunnet’s Test was used to compare all PMA treatments to untreated controls; *** p< 0.001). 137 Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 138
retraction in rat oligodendrocytes treated with conditioned medium from SINrep5-
Syncytin-1 infected HFA (Fig. 23B) compared to controls (Fig. 23C). Examination of rat
oligodendrocytes for apoptotic markers revealed enhanced immunostaining for p53 (Fig.
23B, inset) in Gal-C-positive cells treated with conditioned medium from Syncytin-1
expressing astrocytes (Fig. 23B).
Conditioned medium from SINrep5-Syncytin-1 infected HFA and MDM was not
cytotoxic to human neurons under similar conditions unlike the envelope protein from
HIV-JRFL, which was highly cytotoxic to neurons (Fig. 24). Thus, soluble factors released from astrocytes selectively induced by Syncytin-1 caused cellular injury and death in oligodendrocytes.
III.2.4. Anti-oxidants prevent Syncytin-1-induced oligodendrocyte injury
Since protein carbonyl formation is mediated by redox reactants such as NO and
its metabolite peroxynitrite 349, we hypothesized that compounds that scavenge redox
reactants might reduce death of oligodendrocytes. We examined the free radical
scavenging properties of a polyphenolic anti-oxidant, ferulic acid and a non-steroidal
anti-inflammatory-based anti-oxidant, NCX-2216 by the DPPH assay. Ferulic acid (Fig.
25B) efficiently scavenged free radicals whereas NCX-2216 was not efficient at doing so
(Fig. 25C) compared to the positive control, ascorbic acid (Fig. 25A). SINrep5-Syncytin-
1 infected HFA were treated with ferulic acid 360, NCX-2216 and the NOS inhibitors, L-
NIL (0.5 μM) and L-NAME (5.0 μM). Oligodendrocytes treated with the conditioned
media from these astrocytes showed a marked reduction in both mean oligodendrocyte cytotoxicity and protein carbonyl levels, compared to oligodendrocytes not treated with
either drug (Fig. 26A). Indeed, protection of oligodendrocytes by ferulic acid (Fig. 26B)
Chapter 3: Syncytin-1 induces neuroinflammation
A 90 *** 80 70 60 50 40 30
Cytotoxicity (%) Cytotoxicity 20 10
HIV Mock EGFP velope n Syncytin e
Fig. 24. SINrep5-Syncytin-1 expression in astrocytes and conditioned medium, therein, is not neurotoxic. Conditioned media from Sinrep5- Syncytin-1 and SINrep5-EGFP infected astrocytes were not toxic to neurons but control conditioned media from HFA infected with SINrep5-HIV-JRFL envelope was highly cytotoxic. Statistical comparisons were made between Syncytin-1 and EGFP and HIV-JRFL relative to mock controls (Dunnet’s Test was used to compare all PMA treatments to untreated controls; *** p< 0.001).
139 Chapter 3: Syncytin-1 induces neuroinflammation
A B
C
Fig. 25: Antioxidant activity of various drugs were examined. Ascorbic acid was used as the positive control, showing a potent antioxidant
activity with an EC50 of 40.06 μM(A). Ferulic acid had an EC50 of 83.18 μM (B) while NCX2216 had an EC50 of >100 μM (C) and was not effective as an antioxidant. 140 Chapter 3: Syncytin-1 induces neuroinflammation
A (%)Protein carbonyl 30 300 *** Cell death 25 * Protein carb. 20 200 15 10 100
Cytotoxicity (%) Cytotoxicity 5 0 0 16 2 Mock S + FA S +L-NIL S + L-NAME Syncytin (S) S+ NCX-2 B C 25 20
20 16 ** 15 * 12
10 8 ***
Cytotoxicity ( %) Cytotoxicity *** ( %) Cytotoxicity 5 4
0 0 M M M M μ μ μ 5 0 μ 0 nM nM Mock .5 5 6 0 0 0 Mock 6 6 Syncytin Syncytin Ferulic acid NCX-2216
Fig. 26: (A) Both Syncytin-1-induced OL cytotoxicity and protein carbonyl abundance in the CM of HFA were reduced when HFA were treated with the antioxidants, ferulic acid (50 μM) and NCX- 2216 (6 μM), L-NIL (N6- (1-iminoethyl)-lysine, hydrochloride) (0.5 μM) and L-NAME (N-nitroωarginine methyl ester) (5.0 μM). Syncytin-mediated rat oligodendrocyte toxicity was prevented by the anti-oxidants, ferulic acid (B) and NCX-2216 (C) in a dose- dependent manner. 50 μM of ferulic acid and 6.0 μM of NCX-2216 were the optimum doses required to block oligodendrocyte cytotoxicity mediated by free radicals. Statistical comparisons (ANOVA) were made between treatments relative to mock controls 141 Values are Mean ± SEM; (Dunnet’s Test was used to compare all PMA treatments to untreated controls *p < 0.05 ***p< 0.001). Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 142
and NCX-2216 (Fig. 26C) against Syncytin-1-mediated toxicity was found to be dose-
dependent. Treatment with ferulic acid did not affect infection or expression by SINrep5-
Syncytin-1. Conversely, treatment with other established neuroprotectants including
MK801 (NMDA-receptor antagonist), NBQX [α-amino-3-hydroxy-5-methyl-4-
isoxazolepropionate- (AMPA) receptor antagonist], IFN-β and glatiramer acetate failed
to reduce Syncytin-1-related oligodendrocyte toxicity. In fact, oligodendrocyte toxicity
increased in the presence of NMDA/AMPA receptor antagonists (Fig. 27A). Moreover, pre-treatment of rat oligodendrocytes with IGF-1 (3 ng/mL) and growth hormone (GH,
100 μg/mL) did not protect cells from cytotoxicity induced by conditioned medium from fetal astrocytes overexpressing Syncytin-1 (Fig. 27B). Hence, Syncytin-1-induced
oligodendrocyte cytotoxicity was likely mediated by the pathogenic effect of redox
reactants in this in vitro system.
III.2.5. Syncytin-1-induced neuroinflammation and neurobehavioral abnormalities are inhibited by ferulic acid
Given that Syncytin-1 caused a significant increase in cytotoxicity of
oligodendrocytes, the in vivo effects of Syncytin-1 were examined following stereotaxic
implantation of the SINrep5-Syncytin-1 virus into the corpus callosum of CD1 mice. This
brain region was selected because it is abundant in myelin, oligodendrocytes and
astrocytes and is specifically injured in demyelinating diseases such as MS, resulting in
motor and cognitive abnormalities. Following implantation with SINrep5-Syncytin-1,
Syncytin-1 was detected near the implantation site (Fig. 28c) and Syncytin-1-expressing
astrocytes were visible in the corpus callosum (Fig. 28c, inset). Serial tissue sections
displayed increased numbers of hypertrophied astrocytes (Fig. 28f) and microglia (Fig.
Chapter 3: Syncytin-1 induces neuroinflammation
AB 10 25 *** CNPase *** *** 8 20 *** ***
15 6 * 4 10 Cytotoxicity (%) (%) Cytotoxicity 5 Fluorescence (AU) 2
0 0 1 1 1 P 1 β trol GH rol GA GH t -801 IGF- IGF- Mock EGF NBQX IFN- Con Con MK Syncytin- Syncytin- Syncytin-1 Syncytin-1
Fig. 27: (A) Treatment of astrocytes with NMDA and AMPA receptor agonists (MK-801 and NBQX respectively; 30 μM each), interferon-β (IFN-β; 100 U/ml) or glatiramer acetate (GA; 25 μg/ml) prior to infection with SINrep5-Syncytin-1 did not block oligodendrocyte cytotoxicity relative to untreated cells and in some instances appeared to exacerbate Syncytin-1induced cytotoxicity. (B) Pre-treatment of oligodendrocytes with IGF-1 (3 ng/mL) and Growth Hormone (GH, 100 μg/mL) did not protect cells from toxicity mediated by conditioned medium from astrocytes overexpressing Syncytin-1 This assay was performed by quantitative immunofluorescence for CNPase immunoreactivity (LI-COR, Odyssey) and values are expressed as arbitrary units of fluorescence. Statistical comparisons (ANOVA) were made between treatments relative to mock controls. Values are Mean ± SEM; (Dunnet’s Test was used to compare all PMA treatments to untreated controls; *p < 0.05, **p < 0.001).
143 Chapter 3: Syncytin-1 induces neuroinflammation
Mock SINrep5-EGFP SINrep5-syncytin-1 abc Syncytin-1
def GFAP
ghi MBP
jkl GSTYp
mon Iba-1
Fig. 28: Syncytin-1 induces neuroinflammation in mice. Syncytin-1 immunoreactivity was detected in the corpus callosum up to 14 days after infection with SINrep5-Syncytin-1 (c) but not in mock-CM- (a) and SINrep5- EGFP- (b) implanted animals. Astrogliosis indicated by intense GFAP immunoreactivity was observed in the corpus callosum of mice injected with SINrep5-Syncytin-1 (f) while normal astrocytes are observed in mock CM- (d) and SINrep5-EGFP- (e) implanted animals. White matter of mice injected with SINrep5-Syncytin-1 showed a vacuolar appearance (i) but in contrast, healthy myelin is seen in mock CM- (g) and SINrep5-EGFP- (h) implanted animals. GSTYp-immunopositive OLs were decreased in the white matter of mice implanted with SINrep5-Syncytin-1 (l) compared to the controls (j and k). Syncytin induces microgliosis in mice brain. Mock (m) and SINrep5-EGFP (n)- implanted mice brains showed fewer activated microglia compared to those implanted with SINrep5-Syncytin-1 (o), 144 suggesting microglial activation by Syncytin-1(White Bar represents 0.05 mm; Original magnification X400 (a-c); inset X1000); X200 (d-f); X200 (g-i); X600 (j-l); X200 (m-o). Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 145
28o) in the corpus callosum of SINrep5-Syncytin-1 implanted mice compared to
SINrep5-EGFP (Fig. 28 e&n) and the mock-implanted control (Fig. 28 d&m). In addition, myelin in the corpus callosum of mice implanted with SINrep5-Syncytin-1 showed a vacuolar appearance after immunostaining for MBP (Fig. 28i), compared to the controls (Fig. 28 g&h). Immunoreactive oligodendrocytes (GSTYp-positive) were substantially fewer in the animals receiving the Syncytin-1-expressing virus (Fig. 28 l), compared to controls (Fig. 28 j&k). To verify the latter observation, stereological cell counts of immunoreactive oligodendrocytes were performed revealing a significant reduction in mean cell numbers in the SINrep5-Syncytin-1 implanted animals compared to controls (Table 5). In contrast, astrocyte counts in the same animals revealed a significant increase in activated astrocytes. However, the decrease in oligodendrocyte numbers and increase in hypertrophied astrocytes caused by Syncytin-1 expression were reversed by daily ferulic acid treatment (Table 5).
The above neuropathological findings were confirmed by neurobehavioural testing of animals receiving SINrep5-EGFP, mock-implanted conditioned medium and
SINrep5-Syncytin-1 with and without concurrent ferulic acid treatments. At days 3 and 7, there were no differences in performance among the different groups (Fig. 29 (A-C)).
However, at days 10 and 14 post-implantation, SINrep5-Syncytin-1 implanted mice grasped the horizontal rod significantly less time compared to the controls (p<0.05) (Fig.
29D). In addition, mice implanted with SINrep5-Syncytin-1 were not sufficiently impaired that they could not hold onto the screen, but were slower to reach the screen edge (Fig. 29E), while mice implanted with SINrep5-EGFP or control conditioned medium were more curious and reached the edges of the inverted screen more quickly
146
Table 5: Cell counts of immunoreactive astrocytes and oligodendrocytes in corpus callosum1
Mock SINrep5- SINrep5- SINrep5- EGFP Syncytin-1 Syncytin-1 +Ferulic acid Oligodendrocytes 653.97 (0.05) 760.53 (0.06) 356.32 (0.07) ‡ 731.99 (0.04)
Astrocytes 130.50 (0.12) 198.98 (0.14) 402.49 (0.09) ‡ 177.08 (0.17)
1 Cell counts were performed using stereological methods and expressed as mean and coefficient of error (CE). GST-Yp (oligodendrocytes) and GFAP (astrocytes) immunopositive cells were counted in the corpus callosum of animals implanted with SINrep5-Syncytin-1, SINrep5-Syncytin-1 and ferulic acid, SINrep5-EGFP or mock- infected. Tukey’s Multiple Comparison Test was used for post-hoc analysis (‡, P<0.0001) Chapter 3: Syncytin-1 induces neuroinflammation
50 Control A B Control C Control EGFP 200 EGFP 300 EGFP 40 Syncytin Syncytin Syncytin 250 160 30 200 120
Seconds 150 Seconds
20 Seconds 80 100 10 40 50 0 0 0 Day 3 Day 7 Day 3 Day 7 Day 3 Day 7
35 Day 10 D Day 10 E Day 10 ** F 60 300 Day 14 Day 14 Day 14 250 *** 50 ** 25 40 200 30 150 15 Seconds Seconds
Seconds 20 100 10 * 50 5
l -1 l -1 -1 FP n -1 + n -1 + l n -1 + n FP n G G n FP E E G Contro ncyti ncyti E ncyti y ncyti FA Contro y ncyti FA Contro y ncyti S y S y S y FA S S S
Horizontal bar test Modified Screen test Beam test
Fig. 29: Syncytin-1 induces neurobehavioral deficits in mice. At days 3 and 7, behavior of mice implanted with SINrep5-Syncytin-1 did not differ significantly among various treatment groups in the Horizontal Rod test (A), Modified screen test (B) and the Beam test (C). (D) SINrep5-Syncytin-1-implanted mice showed significantly reduced ability to grasp a horizontal rod (Horizontal Bar test), compared to SINrep5-EGFP and control CM implanted controls (n=6 per group). (E) SINrep5-Syncytin-1-implanted mice exhibited significantly diminished ability to grasp and escape from an inverted screen (Modified Screen test) compared to controls (n=6 per group). (F) SINrep5-Syncytin-1-implanted mice exhibited delays in time taken to cross a cantilevered beam (Beam test) compared to controls (n=6 per group). Ferulic acid (20 mg/kg administered daily by oral gavage) treatment increased the animal’s ability to grasp the bar (D), improved ability to grasp and escape from the inverted screen (E) and cross the cantilevered beam in less time (F) compared to SINrep5-Syncytin-1, SINrep5- EGFP and mock-CM implanted mice. Syncytin-1 induced neurobehavioral changes in mice. Mice were subjected to the following tests after implantation 147 with SINrep5-Syncytin-1, SINrep5-EGFP or mock conditioned medium. Statistical comparisons (ANOVA) were made between treatments relative to mock controls Values are Mean ± SEM; (Tukey’s Multiple Comparison Test was used to compare all columns; *p < 0.05, **p < 0.005, ***p < 0.0001). Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 148
(p<0.0001). Finally, mice implanted with SINrep5-Syncytin-1 exhibited mean delays in
the time taken to cross a cantilevered beam, compared to mice implanted with SINrep5-
EGFP or control conditioned medium (p<0.005) (Fig. 29F), suggesting that the SINrep5-
Syncytin-1 implanted mice showed diminished motor activity and exploratory behaviour.
When SINrep5-Syncytin-1 implanted mice were treated with ferulic acid for 14 d, the neurobehavioural outcomes in the Horizontal Bar test (Fig. 29D), the Modified Screen test (Fig. 29E) and the Beam test (Fig. 29F) were significantly improved. Further, behavioral studies on mice implanted with SINrep5-Syncytin-1 or EGFP in the striatum were examined up to Day 14 of the experiment. Both total (Fig. 30A) and ipsiversive
(Fig. 30B) rotations did not reveal significant differences between groups. These in vivo
studies indicated that Syncytin-1 induced neuroinflammation, oligodendrocyte and
myelin damage together with neurobehavioural abnormalities, which were abrogated by
the anti-oxidant ferulic acid, similar to our in vitro observations.
Chapter 3: Syncytin-1 induces neuroinflammation
A B 100 120 CM EGFP Syncytin-1 CM EGFPEGFPSyncytin-1 100 Mock 80 Syncytin 80 60 60 40 40 20 20 Total rotations/10 min 0 0 Day 3 Day 7 Day 10 Day 14 Ipsiversive rotations/10 min Day 3 Day 7 Day 10 Day 14
Fig. 30: The striatum of 8-10-week-old CD1 mice were stereotaxically implanted with SINrep5-Syncytin-1, SINrep5-EGFP or BHK conditioned media. To assess neuronal damage as a result of expression of Syncytin-1, the rotational behavior of the mice was analyzed 3, 7, 10 and 14 days after striatal implantation. The total number of rotations (A) and ipsiversive rotations (B) over time of the animals following implantation with SINrep5-Syncytin-1, SINrep5- EGFP or mock-infected-CM animals were not significantly different among groups, suggesting Syncytin-1 expression does not cause striatal injury 149 Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 150
III.3. Discussion
Herein, we report both mRNA and protein (Syncytin-1) encoded by the HERV-W
env gene showed increased expression in the brains of MS patients and in specific cell
types involved in neuroinflammation within demyelinating and demyelinated lesions.
Furthermore, in vitro, Syncytin-1 mediated the production of pro-inflammatory
molecules such as iNOS, IL-1β and redox reactants that at high levels are damaging to
the brain 349,357,361. An explicit function for Syncytin-1 in the brain is unknown in contrast
to the placenta where it seems important for placental development 186,313,334,362.
Nonetheless, our findings are consistent with the neuroinflammatory profile in astrocytes associated with MS including elevated levels of iNOS and redox reactants 363-365. In
addition to the pro-inflammatory effects of Syncytin-1 in glial cells, soluble factors derived from Syncytin-1-expressing astrocytes were toxic to oligodendrocytes but not to neurons implying a select mechanism of killing and/or targeting of individual cell-types, which is congruent with earlier studies showing astrocytes may influence oligodendrocyte survival 93,366,367. Since pre-treatment of oligodendrocytes with IGF-1
and GH did not protect cells from death and injury, withdrawal of these trophic factors
due to astrocyte dysfunction may not be the cause of oligodendrocyte injury.
Interestingly, the increase in oligodendrocyte toxicity associated with NMDA/AMPA-
receptor antagonist treatment might be due to the decrease in neurotrophic factors, BDNF
and NGF as suggested previously 368.
Syncytin-1 was not detected in supernatants from astrocytes infected by SINrep5-
Syncytin-1, precluding a direct interaction between Syncytin-1 and the target cells that
led to cytotoxicity. Nonetheless, Syncytin-1 expression in astrocytes resulted in cellular
Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 151
stress, manifested by induction of IL-1β, iNOS and redox reactants. Importantly,
Syncytin-1 expression was evident in glia at both the margin and core of acute
demyelination, emphasizing its role in cellular stress. Of interest, polymorphisms in
retrovirus-encoded envelope proteins from HIV 342 and MuLV that alter intracellular
envelope expression in glial cells, have been associated previously with pathogenic
effects in the nervous system 369. These effects may occur through misfolding of the envelope protein or protein accumulation in the endoplasmic reticulum, which results in a stress response by the cell and the subsequent release of neurotoxic molecules including redox reactants 226,370. Given that iNOS was induced in astrocytes, likely redox stress
products include NO, reactive nitrogen-oxygen species, peroxynitrite and superoxide
anions, which are capable of damaging target tissues, particularly the brain 349,363 and are also toxic to oligodendrocytes 371. In contrast, in vitro generation of lipid peroxidation
products was not increased in the present study, in agreement with earlier reports of MS
pathogenesis 372. The precise pathway by which oxidation of a protein released by
astrocytes mediates oligodendrocyte toxicity remains to be determined but a potential mechanism might occur through oxidation of a released MMP 373.
We also demonstrated that by inducing pro-inflammatory molecules and redox reactants, ultimately resulting in oligodendrocyte death, Syncytin-1 modulates neurobehavioural changes in a mouse model displaying pathology similar to other MS animal models. The present neurobehavioural changes are also reminiscent of those seen among individuals with MS, including weakness, gait unsteadiness and altered executive functions 374,375. In addition, our studies showed that the plant-derived phenolcarboxylic
acid, ferulic acid, which acts as an anti-oxidant, 360,376 ameliorates death of
Chapter 3: SYNCYTIN-1 INDUCES NEUROINFLAMMATION 152
oligodendrocytes in vitro and in vivo and significantly improves the neurobehavioural
outcomes. Thus, the present study indicates that Syncytin-1 maybe involved in the
pathogenesis of active demyelination, principally by evoking redox reactant-mediated
cellular damage in the brain. Alternatively, given its persistent expression in lesion cores,
the Syncytin-1-mediated glial stress reaction might antagonize remyelination. In this
regard, ferulic acid or equivalent compounds might be considered for trials designed to
evaluate efficacy for reducing demyelination or enhancing remyelination, similar to its
protective effects in neurons 360. Moreover, because HERVs represent a substantial proportion of the human genome and in some cases express proteins, the potential pathogenic (or reparative) effects of other HERV proteins expressed in the nervous system warrant further investigation.
Chapter 4: QUANTIFICATION OF SYNCYTIN-1 153
CHAPTER 4
QUANTIFICATION OF SYNCYTIN-1
Chapter 4: QUANTIFICATION OF SYNCYTIN-1 154
IV.1. Introduction
HERVs are comprised of approximately 1500–2000 integrated proviruses, which
may have been amplified during evolution by repeated reintegration events in germ line cells, although most HERVs are not replication competent per se 296. Although 18
HERVs possess a coding retroviral envelope gene 304, expression of only 5 HERVs has
been detected in healthy human brain tissue to date 303. Importantly, the HERV-W family
has received extensive attention in the literature 196,331, in part because its envelope (env)-
encoded protein has retained the ability to interact with a receptor for the D-type
retroviruses 333,334. The multi-copy HERV-W family contains a unique proviral locus,
located on chromosome 7q, flanked by two intact LTRs and encodes a 538-amino acid
envelope (Syncytin-1) together with presence of inactivating mutations in the gag and pol
genes 186,330.
In addition to expression of HERVs in healthy tissues such as placenta, they are also up-regulated in neoplasic, autoimmune and inflammatory conditions 186,198,377.
Induction of several HERVs is reported in different cell types derived from patients with
MS 329. Relative quantification analyses from Chapter #3 indicated that Syncytin-1 mRNA and protein levels are increased in the brains of MS patients, predominantly in
glial cells 196. In this Chapter, we have quantitatively analyzed Syncytin-1 expression in
brain, CSF and plasma, together with relevant leukocytes. These studies revealed that
Syncytin-1 RNA was selectively up-regulated in the brains of MS patients. Increase in
Syncytin-1-encoding DNA sequences in the brain occurred without evidence of new
integration events.
Chapter 4: QUANTIFICATION OF SYNCYTIN-1 155
IV.2. Results
IV.2.1. Syncytin-1 expression is cell-type and tissue specific
Given that Syncytin-1 RNA levels were increased in brains of MS patients, we
also investigated its expression in blood-derived leukocyte populations because these
cells are pivotal in MS pathogenesis. Analysis of different HERVs in PBMC subsets
showed that env RNA abundance for HERV-H, -K (HML-2), -E, and Syncytin-1 in T
cells (Fig. 31A), monocytes (Fig. 31B) and B cells (Fig. 31C) did not differ between MS and non-MS controls. Using matched cDNA quantities, the average cycle threshold (Ct ±
standard error) values were 26.1 ± 0.16, 27.3 ± 0.3 and 26.6 ± 0.5 for HERV-H env in
monocytes, T and B cells, respectively. Similarly, Ct values for Syncytin-1 and HERV-K
(HML-2) env did not differ between PBMC subsets. However, expression of HERV-E
env was significantly lower in monocytes (32.7 ± 0.8) and T cells (32.5 ± 0.6) compared
to B cells (28 ± 0.3) (Fig. 32A). Thus, there were cell-type-specific differences in
expression of HERVs within PBMC subsets, though differences between clinical groups
were not significant. To determine if Syncytin-1 was in fact inducible in leukocytes, we
stimulated PBLs, monocytoid (MDM) and astrocyte (U373) cells with PMA. PMA
treatment induced Syncytin-1 mRNA expression in monocytoid (46 fold) and astrocytic
(10 fold) cell lines (p<0.001) (Fig. 32B). However, PMA suppressed Syncytin-1 mRNA
expression in PBLs from healthy individuals (p<0.05) although IL-1β was inducible in
these same cells (Fig. 32B).
Chapter 4: Quantification of Syncytin-1
A
6 Control T 5 MS 4 3 2 mRNA RFC mRNA 1
-W -H -E -K HERV BC 2.5 4 B Control M Control MS MS 2 3 1.5 2 1 mRNA RFC mRNA mRNA RFC mRNA 1 0.5
-W -H -E -K -W -H -E -K HERV HERV
Fig. 31: Expression of HERV env mRNA in resting T cells (T) (A), monocytes (M) (B) and B cells (C) did not differ between age- matched non-MS controls (n=9) and RR-MS patients (n=9). Data were not considered significant.
156 Chapter 4: Quantification of Syncytin-1 A 40 Monocytes 35 T-cells 30 B-cells * 25 Ct 20 15 10 5 0 WEKH
B *** 1 50
60 ***
40 mRNA RFC mRNA 20 ** ** * * 0 PMA -+-+-+ -+-+-+ PBL MDM Ast PBL MDM Ast Syn-1 IL-1β
Fig. 32: Detection of HERV env transcript abundance by real time RT- PCR suggests comparable levels of HERV-W (Syncytin-1), -H and -K, but abundance of HERV-E was lower in B cells (A). PMA stimulated Syncytin-1 (Syn-1) expression in monocytoid (MDM) cells and astrocytic (Astro) cells (U373). Syncytin-1 mRNA levels were suppressed in PMA-stimulated peripheral blood lymphocytes (PBL) despite marked induction of IL-1β mRNA levels (B). Statistical comparisons (ANOVA) were made between treatments relative to controls (Dunnet’s Test was used to compare all treatments to untreated controls; *** p<0.001, ** p <0.01, * p<0.05). 157 Chapter 4: QUANTIFICATION OF SYNCYTIN-1 158
IV.2.2. Minocycline inhibits Syncytin-1 expression
Since inflammation drives Syncytin-1 expression, we wished to determine
whether Syncytin-1 expression is regulated by minocycline, an anti-inflammatory drug.
PMA-induced Syncytin-1 transcript abundance was significantly suppressed by
minocycline (10 μM) (Fig. 33).
IV.2.3. Syncytin-1-RNA and DNA copy numbers are significantly enhanced in brain
of MS patients relative to controls
As relative quantification analysis disclosed increased Syncytin-1 expression in
the brains of MS patients, we focused on determining the actual copy numbers of
Syncytin-1-encoding RNA and DNA-encoding sequences in different tissues relevant to
neuroinflammation. Syncytin-1 RNA copy numbers were measured using a quantitative
real time RT-PCR, which were derived as copy numbers from a standard curve plotted
with RNA transcribed from pBS-Syncytin-1 (Fig. 34A). Median Syncytin-1 RNA copy numbers were significantly increased in MS brains (5.04 log 10) compared to non-MS
brains (4.57 log 10) per μg RNA (p<0.05) (Fig. 34B). The mean PCR cycle threshold
differences between GAPDH cDNA from the same MS (20.52) and non-MS (20.24)
brain tissues did not differ significantly. Total RNA extracted from CSF and plasma of
MS and non-MS patients showed that Syncytin-1 RNA was detected in samples from all
patients examined. However, there were no significant differences in Syncytin-1 RNA
copy numbers between groups in both CSF (MS: 3.8 log 10/ml and non-MS: 5.0 log 10/ml)
(Fig. 34C) and plasma (MS: 2.9 log 10/ml and non-MS: 5.033 log 10/ml) (Fig. 34D).
The median Syncytin-1 DNA copy number was increased (79 fold) in the brains
of MS patients (9.8 log 10/μg DNA), compared to that of the non-MS brains (7.9 log 10/μg
Chapter 4: Quantification of Syncytin-1
60 *** Control 50 PMA PMA + Minocycline 40
30
mRNA RFC mRNA 20 ** ** 10 * 0 Syn-1 IL-1β Syn-1 IL-1β
U937 U373
Fig. 33: Minocycline suppresses PMA-induced Syncytin-1 expression Monocytoid cells (U937) and astrocytic cells (U373) show an increase in Syncytin-1 mRNA relative fold change (RFC) when stimulated in the presence of 50 ng/ml of PMA as detected by real-time RT-PCR analysis. Minocycline (10 μM) treatment significantly suppressed expression of the envelope gene. Statistical comparisons (ANOVA) were made between treatments relative to controls (Dunnet’s Test was used to compare all treatments to untreated controls; *** p<0.001, ** p <0.01, * p<0.05).
159 Chapter 4: Quantification of Syncytin-1
AB
30 8 * 25 g μ 6
t 20 C 15 4 copies/ 10 RNA
10 2 5 RNA Brain log 0 024681012 MS Control Log copy number
C D L L ns μ ns μ 6 6 4 4 copies/ copies/ copies/
2 10
10 2 log log 0 CSF 0 Plasma MS Control MS Control
Fig. 34: Syncytin-1 RNA copy numbers are increased in brain of MS patients. A standard curve for Syncytin-1 RNA copy number (correlation coefficient: 0.978; slope: -1.857; intercept: 32.632; Y= -1.857 X + 32.632) was derived (A). Absolute numbers of Syncytin-1 RNA copies were increased in brains of MS patients
(5.04 log10) relative to non-MS controls (4.57 log10) (B). Quantitative analysis of Syncytin-1 RNA abundance in CSF (C) and plasma (D) did not reveal statistically significant differences between clinical groups. Statistical comparisons (Mann-Whitney 2-tailed test) were made between MS and non-MS controls (* p<0.05).
160 Chapter 4: QUANTIFICATION OF SYNCYTIN-1 161
DNA) (p<0.001) (Fig. 35C), based on a standard curve derived for Syncytin-1-encoding
DNA (Fig. 35A). To normalize for the quantity of DNA used as PCR template, a
GAPDH standard curve was developed (Fig. 35B), revealing that the Syncytin-1- encoding DNA copy numbers, when expressed as a ratio of the absolute copy numbers of
Syncytin-1 relative to the copies of GAPDH per μg DNA, displayed an increased median ratio for MS patients (3.1) compared to that of the control patients (1.6) (p<0.001) (Fig.
35D). We also investigated PBMC-derived DNA from non-MS and MS patients from two cohorts of patients. The ratio of Syncytin-1 DNA to GAPDH DNA copy numbers did not differ between MS patients and unaffected family members from an Iranian cohort
(Fig. 35E). Similarly, another cohort of patients from Canada did not reveal any differences in the ratio of Syncytin-1 DNA to GAPDH DNA copies between non-MS controls and MS patients (Fig. 35F).
IV.2.4. Increased Syncytin-1 DNA copies reflect un-integrated cDNA
To determine if the increased brain levels of Syncytin-1 DNA in MS patients reflected unintegrated linear/episomal cDNA or newly integrated proviral DNA, we developed PCR assays to detect HERV-W7q circular, single and/or double LTR sequences and integration events using oligonucleotide primers targeting Syncytin-1,
HERV-W7q LTR U3-U5 regions and Alu sequences (Fig. 15). Comparisons of the relative frequency of detection of circular Syncytin-1-LTR encoding DNA (Fig. 36A) and integrated LTR-U5-Alu sequences (Fig. 36B) did not reveal statistically significant differences between MS and non-MS brain-derived DNA samples.
Chapter 4: Quantification of Syncytin-1 A B DNA STANDARD GAPDH STANDARD 30 30 25 25
20 t 20 C t
C 15 15 10 10 5 5
0 246810 01234567 C Log copy number D Log copy number
12 *** 5 *** 10 4 g DNA μ 8 3 6 DNA 2 4 copies/ 1
10 2 Brain Brain MS Control Syncytin-1/GAPDH MS Control log
EF Iran-PBMC Canada-PBMC 4 7 6 3 5 4 DNA 2 DNA 3 1 2
Syncytin-1/GAPDH Syncytin-1/GAPDH 1 0 Syncytin-1/GAPDH MS CONTROL MS CONTROL (n=28) (n=27) (n=22) (n=24)
Fig. 35: Standard curves for Syncytin-1 DNA copies (A) ( Correlation Coefficient: 0.979; Slope: -1.365; Intercept: 29.435; Y= -1.365 X + 29.435; PCR efficiency: 440.6%) and GAPDH (Correlation Coefficient: 0.965; Slope: -2.276; Intercept: 29.371; Y= -2.276 X + 29.371; PCR efficiency: 175.0%) were obtained (B). Syncytin-1 DNA was quantified by real time PCR in brain tissue (white matter) of MS patients (n=20) and control patients (n=15) that included HIV (n=6), Alzheimer’s (n=6) and neuroinflammatory disease controls (n=3). Absolute number of viral DNA copies indicates a significant increase in viral DNA copy number in brain of MS patients relative to control (C). Ratio of Syncytin-1 copy number to GAPDH copy number also shows a significant increase in Syncytin-1 DNA copy number in brain of MS patients relative to control (D). Ratio of copy numbers of Syncytin-1 to GAPDH did not differ between MS and unaffected family members from PBMC DNA of an Iranian cohort (E). Similarly, PBMC from a 162 Canadian cohort of MS patients and non-MS controls did not reveal differences
between clinical groups (F). Data shown are log 10 (median copy number) (Mann- Whitney 2-tailed test; *** p<0.001; p<0.01). Chapter 4: Quantification of Syncytin-1
A B 100 70 MS ns MS Control ns 80 Control 50 ns 60 30 40 ns Detection (%) Detection
Detection (%) 20 10 0 Circ+ Circ- LTR-Alu+ LTR-Alu-
Fig. 36. Double LTR sequences from brain tissue of non-MS controls and MS patients did not reveal detection differences between clinical groups. Circ (+) refers to the numbers of DNA samples where the PCR product was detected, while Circ (-) refers to the numbers of DNA samples where the PCR product was not detected (A). Detection of PCR products from amplification of HERV-W7q-cell junctions (LTR-Alu) showed no detection differences between clinical groups. Detection of PCR products was denoted as LTR-Alu+ and absence as LTR-Alu - (B). Chi-square and Fisher’s exact tests were used to analyze the contingency tables obtained in this assay.
163 Chapter 4: QUANTIFICATION OF SYNCYTIN-1 164
IV.3. Discussion
The present study represents the first quantitative PCR analysis of a human
endogenous retrovirus expression in a range of tissues. Syncytin-1 mRNA copy number
was consistently higher in brain tissue from MS patients relative to non-MS controls.
Further, DNA copy numbers were also higher, though without evidence of new
integration events or viral replication. Syncytin-1 was inducible by the mitogen, PMA, in
astrocytic and monocytoid cells but not in lymphocytes. Expression level of Syncytin-1
in different leukocyte populations did not differ between clinical groups. These
observations highlight the perturbed expression of Syncytin-1 in neuroinflammation,
providing new insights into the pathogenesis of MS and other neuroinflammatory
disorders.
Though Syncytin-1 expression was increased in brains of MS patients relative to
non-MS controls, it was detected in both MS and non-MS patient brains and in
leukocytes from each group in the current study. Thus, it is improbable that HERV-W is
a conventional infectious agent causing MS, thereby supporting the notion that Syncytin-
1 may act as an immunomodulator in the brain, as proposed for endogenous retroviruses
in other organs 378,379. The specific cellular milieu is an important determinant of HERV transcription since it is regulated by chemokines, inflammatory molecules infectious
agents or cytokines 379. However, it is clear that HERV expression is differentially
regulated depending on the cell types involved in MS pathogenesis, as leukocytes from
MS patients did not differ from non-MS controls (Fig. 32 A-C), whereas differences were observed in brain-derived tissue. Further, mitogen stimulation of healthy PBLs did
Chapter 4: QUANTIFICATION OF SYNCYTIN-1 165
not induce Syncytin-1 expression. Using env-specific PCR primers for a PCR-based quantification assay for Syncytin-1, copy numbers of Syncytin-1 mRNA were
significantly higher in brain tissue of MS patients extending an earlier study 196 by showing selective up-regulation of Syncytin-1 only in brains of patients with MS.
However, levels of Syncytin-1 RNA copies in CSF and plasma did not reflect the enhanced levels in brains of MS patients relative to non-MS controls. These findings are in contrast to low HIV-1 copy numbers in brains of patients with another neurological disorder, HIV-associated dementia, but simultaneously exhibit elevated levels of HIV-1 viral copies in CSF 193. High frequency of detection of another HERV-W family member,
MSRV, in lymphocytes (B cells) and sera of MS patients has led to speculation regarding
its involvement in the etiopathogenesis of MS 380-383. In the present study, we used
Syncytin-1 primers, which did not recognize MSRV env, thus solely focusing on the role
of Syncytin-1 in MS neuropathogenesis. Nevertheless, there are molecular differences
(13.2% at the amino acid level, www.ncbi.nlm.nih.gov) between the two members of the
HERV-W family 319, including the absence of a 4-amino acid gap in MSRV env, a unique signature of Syncytin-1 384 and MSRV is postulated to be an exogenous retrovirus,385 rather than a HERV.
Increased Syncytin-1 DNA copy numbers were present in the brains of MS patients, which did not reflect increased viral re-infection or integration as the number of single/double DNA LTRs and integrated genomes did not differ between groups. Due to the detection of predominantly ~800 bp single LTR PCR fragments suggestive of aborted replication, the present study suggests that Syncytin-1 is reverse transcribed but not integrated. These results underscore the widely-held supposition that HERV-W is a non-
Chapter 4: QUANTIFICATION OF SYNCYTIN-1 166
replicating agent 330. In fact, this may indicate accumulation of un-integrated extra-
chromosomal viral cDNA, similar to reports of HIV-1 infection of the brain 386,387, which
is found to be associated with S35 domains in the interchromosomal space 388. The precise mechanism by which HERVs are induced or suppressed is likely dependent on the individual HERV, cell type and other host determinants but may be an important aspect to investigate further, given the interest in HERVs as biomarkers for disease.
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 167
CHAPTER 5
SYNCYTIN-1 INDUCES ER STRESS
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 168
V.1. Introduction
Multiple Sclerosis is a progressive demyelinating disease of the CNS defined by
inflammatory destruction of the myelin sheath and ensuing axonal damage. The
neuropathological hallmarks of acute MS lesions are demyelination and inflammation, involving T and B cells and activated macrophage/microglia, which result in tissue damage characterized by loss of oligodendrocytes, astrocytes, and axons 389. Although largely assumed to be a T cell-mediated disease, increasing evidence indicates involvement of other immune cells including microglia/macrophages 5 and astrocytes 389 in MS pathogenesis. The latter group of cells can efficiently present MOG peptides and act as a secondary line of APCs in the CNS, simultaneously acting to down-modulate proinflammatory T cell-driven inflammation 390. Up-regulation of ER stress molecules including ATF-4 has been demonstrated in MS lesions 391 and accumulation of proteins
such as MHC class I in the ER 150 or induction of ER stress by IL-1β or nitric oxide 392 can affect reparative abilities of oligodendrocytes 393.
In Chapter #3, we have demonstrated up-regulation of Syncytin-1 in the brains of
MS patients and its overexpression in areas of acute demyelination 196. Syncytin-1
appears to bind to at least two receptors (ASCT1 and 2) including sodium-dependent
transporters of polar neutral amino acids, Ala, Ser, Cys, Thr 333. ASCT1 and 2 are
localized on both neurons and glia in the brain 337 and are essential for maintaining
cellular integrity through the transport of amino acids with potentially neurotrophic 338 or neurotoxic 339 effects.
Astrocytes are more than ‘brain glue’; in addition to their roles in modulating
synaptic plasticity 64, they provide trophic support to oligodendrocytes and neurons 394,
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 169
while also protecting neurons from damage such as excitotoxicity 395. Extrinsic and
intrinsic factors can lead to astrocyte dysfunction, including accumulation of misfolded
proteins contributing to disruption of ER function, resulting in ER stress 396. Specific
signaling pathways including the UPR are triggered during ER stress to enable cells
survive the perturbed condition of the ER 396. During the pre-stress period, nascent
folding-competent polypeptides are maintained in a soluble form in interaction with ER
luminal chaperones, chief among which is BiP. BiP is a cytoprotective protein 397 that associates with 3 proximal sensors of the UPR namely, PERK, ATF6 and the inositol- requiring enzyme 1 (IRE1). Upon ER stress, BiP disassociates from the UPR transducers to permit their signaling 392. Recently, a basic leucine zipper (bZIP) transcription factor,
old astrocyte specifically induced substance (OASIS), which has a structure similar to
that of ATF6, was found to be activated by cleavage in response to ER stress. The
cleaved fragment, p50OASIS, activates the BiP promoter and thus protects astrocytes
from ER stress 398, but its other functions remain unknown.
Several lines of evidence implicate astrocytes in retrovirus-induced ER stress and
neuropathogenesis 370. Indeed, astrocyte activation and death are closely correlated with
the severity of HIV-associated dementia 399. Infection of astrocytes with MoMuLV-ts1 induces an ER stress response, in particular inducing the expression of the redox- sensitive transcription factor NF-E2-related factor 2 (Nrf2) 400, which is also required for
cell survival during ER stress 401. Importantly, xCT, a cystine transporter 402 and also a
viral receptor 403 was induced by Nrf2 370 and reactive oxygen species 404. These findings
prompted us to ask whether Syncytin-1 induced an ER stress response, modulated its
receptor expression and affected oligodendrocyte viability. Although Syncytin-1 blocks
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 170
infection by an exogenous retrovirus 308, how it affects glial physiology or if it mediates
interference with its cognate receptors, ASCT1 or 2 is not known. Since retroviral
envelopes are known to interfere with their respective receptor’s function 405, we hypothesized that enhanced Syncytin-1 might influence expression of its receptor through
ER stress induction, contributing to MS pathogenesis. Earlier studies showed that
Syncytin-1 protein and transcript expression in glial cells including astrocytes and macrophage/microglia were substantially greater in the brains of MS patients compared to non-MS controls 196,406. In addition, iNOS expression is enhanced in demyelinating regions of MS brains relative to controls 138. Moreover, increased expression of iNOS in
Syncytin-1-expressing astrocytes in vitro as well as in acute MS lesions was observed 196.
The present studies revealed that Syncytin-1 induced several ER stress molecules including OASIS. Using a new model of MS, we describe a novel pathway for oligodendrocyte injury in which Syncytin-1 induced OASIS expression in astrocytes accompanied by increased production of nitric oxide and the transcription factor, early growth response (Egr1), leading to diminished ASCT1 expression and oligodendrocyte loss.
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 171
V.2. Results
V.2.1. Syncytin-1 induces ER stress in astrocytes
Since retroviral proteins cause neuropathogenic effects through protein misfolding
235, we investigated whether enhanced levels of Syncytin-1 in the brains of MS patients
196 contributed to ER stress. To examine the effects of Syncytin-1 up-regulation in ER
stress, we overexpressed Syncytin-1 in human astrocytes by transduction of a Syncytin-1 expressing neurotropic Sindbis virus 196, which revealed syncytia formation in astrocytes
(Fig. 37A), confirming its functional role in GFAP-positive (Fig. 37A, inset) astrocytes.
Levels of GADD153, BiP, PERK, ERp57 and OASIS transcripts were significantly
increased (Fig. 37B) in astrocytes overexpressing Syncytin-1 but not in astrocytes
transduced by an EGFP-expressing virus (control) (p<0.05). However, ER stress genes
were not induced in monocyte-derived macrophages (MDMs) overexpressing Syncytin-1
relative to EGFP-expressing MDMs (Fig. 37C). To determine the comparative transcript
levels of ER stress genes in Syncytin-1 expressing astrocytes and brains of MS patients,
we examined ER stress gene induction in brain white matter from MS (n=15) and non-
MS controls (n=12). The expression profile of ER stress genes observed in Syncytin-1
expressing astrocytes closely resembled transcript abundance in brain white matter tissue
of MS patients relative to non-MS controls in areas of acute demyelination (Fig. 38A). In
particular, the induction of OASIS was highly significant (p<0.001) in MS brains
compared to non-MS controls. To determine the cell-types expressing ER stress proteins,
we analyzed tissue sections from MS and non-MS control brain sections. Demyelinated
(D) lesions from MS patient brains (B i) stained less intensely with luxol fast blue (LFB),
hematoxylin and eosin compared to a non-MS control brain section (B ii). Serial sections
Chapter 5: Syncytin-1 induces ER stress
A
SYNCYTIN-1 CONTROL B
30 * Control 25 Syncytin-1 (HFA) 20 15
mRNA RFC mRNA 10 * * * 5 * * 0 7 -1 BiP RK p5 N D153 E R Y D P E OASIS S GA
C Control 7 6 Syncytin-1 5 (MDM) 4 3 mRNA RFC 2 1
7 RK p5 BiP D153 E R D P E GA
Fig.37: Syncytin-1 expressing human fetal astrocytes (HFA) but not controls exhibit syncytia formation (A) (inset: GFAP-positive astrocytes) with concurrent increase in mRNA levels of Syncytin-1 and ER stress genes, BiP, GADD153, PERK, ERp57 and OASIS compared to controls (B). SINrep5-Syncytin-1 infected monocyte- derived macrophages (MDMs) showed no significant differences in the level of induction of ER stress genes, BiP, GADD153, PERK and ERp57 compared to controls (C). Statistical comparisons (t test with Dunnet’s test for post-hoc analysis) were made between Syncytin-1 relative to controls (* p<0.05) 172 Chapter 5: Syncytin-1 induces ER stress
A B MS Non-MS i ii
500 LFB D 400 Non-MS MS *** 300 iiii iv 200 50 * 40 * mRNA RFC mRNA 30 * 20 SYNCYTIN-1 10 * * 0 7 -1 v vi BiP RK p5 N D153 E R Y D P E OASIS S GA GADD153
vii viii BiP
ix x ERp57
Fig. 38: Increased transcript levels of Syncytin-1, BiP, GADD153, PERK, ERp57, and OASIS were evident in the white matter tissue of MS (n=12) brains relative to non-MS controls (n=11) (A). Demyelinated (D) lesions from MS patient brains (B i) stained less intensely with luxol fast blue (LFB), hematoxylin and eosin compared to a non-MS control (B ii). MS brains showed marked increase in Syncytin-1 immunoreactivity (B iii), particularly in GFAP-positive astrocytes (B iv), GADD153 (B v) and BiP (B vii) expression compared to non-MS control brain (B vi & viii). ERp57 immunoreactivity was observed in both MS (B, ix) and non-MS control brain (B, x) in and around blood vessels (Original magnification X400; 173 (inset, X1000). Statistical comparisons (t test with Dunnet’s test for post-hoc analysis) were made between treatments relative to controls (*** p<0.001, * p<0.05). Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 174
of demyelinated regions in the brains of MS patients demonstrated marked increase in
Syncytin-1 immunoreactivity (B iii), particularly in astrocytes expressing GFAP (B iv)
(Syncytin-1-blue and astrocytes-brown) (inset, figure shows GFAP-positive astrocyte).
Sections from the same lesions show increased GADD153 (B v) and BiP (B vii) expression compared to non-MS control brain (B vi & viii; arrow shows blood vessel).
GADD153 expression was increased in several cell-types but most prominently in
astrocytes, co-localized with GFAP immunoreactivity (B v, inset) (GADD153-blue and
GFAP-brown, arrowhead) in brains of MS patients. BiP expression was found in several
cell types including astrocytes (arrow) and macrophages (arrowhead) in the white matter
(B vii) of demyelinating lesions (arrow shows blood vessel). ERp57 was minimally expressed with no differences between clinical groups (B, ix & x). Thus, multiple ER stress genes including OASIS were overexpressed in brain glia of MS patients, suggesting a role for ER stress in the pathogenesis of MS.
V.2.2. OASIS down-regulates ASCT1 expression in astrocytes
As several retroviral proteins including Syncytin-1 mediate receptor interference
308 and induce free radicals in astrocytes 196, we hypothesized that Syncytin-1 might
influence expression and function of its putative receptors, ASCT1 and -2 in the brain 131, perhaps through regulation by free radical production and removal, similar to the related transporter, xCT 402,407. Hence, we examined the expression of ASCT1 and 2 in brain
white matter from MS and non-MS brains. Intense ASCT1 immunoreactivity was
observed in the white matter of non-MS brain sections (Fig. 39A) on glial cells including
both astrocytic (Fig. 39A, inset) and CD45-positive monocytoid cells (Fig. 39B, inset)
but was reduced in MS sections (Fig. 39B). Expression of ASCT2, however, revealed no
Chapter 5: Syncytin-1 induces ER stress
Non-MS MS
A B ASCT1
C D ASCT2
EF Non-MS (n=15) 35 30 * Non-MSMS kDa 25 MS (n-12) 50 * 20 25 42 15 10 15 mRNA RFC mRNA 5 OASIS/ACTIN 0 ND 5 WM CTX WM CTX Non-MS MS G ASCT1 ASCT2 H 2.5 Control 2 SYN-1 Vec OASIS kDa OASIS 1.5 iNOS 130 β-Actin 42 1
mRNA RFC mRNA 0.5 ** 0 ** ASCT1 ASCT2 Fig. 39: ASCT1 expression was detected in non-MS brains (A), particularly in astrocytes (A, inset) and CD45-positive leukocytes (B, inset) compared to minimal immunoreactivity in MS white matter (B). ASCT2 expression did not differ between MS (D) and non-MS controls (C). MS brains showed down-regulation of ASCT1 mRNA in white matter (WM) but not in the frontal cortex (CTX) compared to non-MS controls. ASCT2 mRNA was undetectable in the CTX and did not differ between groups in the WM (E). OASIS immunoreactivity (50 kDa) was increased in MS brains compared to non-MS controls (F, inset). Graphic analysis of the OASIS immunoreactivity in brains relative to actin revealed a significant increase in MS brains (F). OASIS expressing astrocytes revealed increased iNOS expression (G). 175 Astrocytes overexpressing OASIS or Syncytin-1 down-regulated ASCT1, but not ASCT2 compared to empty vector (pCDNA 3.1) and mock controls (H) (Original magnification X400 (C); (inset, X1000) (Dunnet’s test for post-hoc analysis ** p< 0.01, * p<0.05). Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 176
differences in immunoreactivity between non-MS (Fig. 39C) and MS patients’ white
matter (Fig. 39D). Interestingly, ASCT2 expression was predominantly expressed on
activated microglia (Fig. 39D). To examine the effects of Syncytin-1 expression in
astrocytes, we performed microarray analysis of astrocytic cells transduced with the
Sindbis virus-derived vector expressing Syncytin-1. Investigation of gene expression profile (Table 6) revealed several genes, particularly an MS lesion-specific transcript and
a disintegrin and metalloproteinase (ADAM)-10 in addition to multiple genes involved in
ER stress, myelin synthesis and immune response (Table 6), which were also modulated
in acute lesions from brains of MS patients 408 (Table 7). Importantly, ASCT1 and 2 were
down-regulated in astrocytes overexpressing Syncytin-1 (Table 6). Corroborating these
findings was the observation that ASCT1 transcripts were significantly diminished in MS brain white matter relative to non-MS brains. Conversely, ASCT2 transcript levels did
not differ in white matter between clinical groups. ASCT1 transcript levels did not differ
in (frontal) cortex between non-MS and MS patients while ASCT2 was not detected in
cortex (Fig. 39E).
Corresponding to increased transcript levels of OASIS in MS brain lesions (Fig.
38A), western blot analysis (Fig. 39F, inset) of non-MS (n=6) and MS (n=6) patient
brain lysates revealed a significant increase in OASIS protein levels in the brain (Fig.
39F). Since OASIS activates the transcription of target genes via acting on the ER stress
responsive element (ERSE) and cyclic AMP responsive element (CRE) 409, we hypothesized that OASIS might trigger iNOS through CRE on the iNOS promoter 410.
Indeed, increased expression of iNOS in OASIS transfected astrocytes was evident compared to empty vector (Fig. 39G). Based on these results, we transfected astrocytes
177
Table 6: Gene profile in Syncytin-1 expressing astrocytes showing up-regulation and down-regulation of immune response, myelin-related and ER stress genes.
Gene Function Fold GenBank ID Name change STCH stress 70 protein chaperone, microsome-associated, 60kDa 8.3 AI718418 HSPH1 heat shock 105kDa/110kDa protein 1 5.29 NM_006644 LONP peroxisomal lon protease 3.32 AV700132 FLJ23560 hypothetical protein FLJ23560 2.56 NM_024685 ER stress FLJ14281 hypothetical protein FLJ14281 2.38 NM_024920 response HSPD1 heat shock 60kDa protein 1 (chaperonin) 2.24 NM_002156 SERP1 stress-associated endoplasmic reticulum protein 1 2.26 AL136807 homocysteine-inducible, endoplasmic reticulum stress- HERPUD1 inducible, ubiquitin-like domain member 1 0.74 BC015447 heat shock 70kDa protein 5 (glucose-regulated protein, HSPA5BP1 78kDa) binding protein 1 0.71 AB046803 GADD45B growth arrest and DNA-damage-inducible, beta 0.70 AV658684 Syncytin-1 HERV-W envelope glycoprotein 3.11 AC000064 solute carrier family 1 (glutamate/neutral amino acid SLC1A4 transporter), member 4 0.68 W72527 solute carrier family 1 (neutral amino acid transporter), SLC1A5 member 5 0.69 AF105230 ADAM10 a disintegrin and metalloproteinase domain 10 8.25 N51370 MS- MS-lesion MS lesion transcript 6.82 N73682 related Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, CMT4B2 with myelin outfolding) 4.48 AK022478 MBP myelin basic protein 0.73 NM_002385 MAG myelin associated glycoprotein 0.69 X98405 SOCS5 suppressor of cytokine signaling 5 5.38 NM_014011 Immune STAT1 signal transducer and activator of transcription 1, 91kDa 2.12 NM_007315 response TLR4 toll-like receptor 4 2.05 NM_003266 TLR9 toll-like receptor 9 0.73 AB045180 IL23A interleukin 23, alpha subunit p19 0.72 NM_016584 OLIG1 oligodendrocyte transcription factor 1 0.72 AL355743 TLR8 toll-like receptor 8 0.61 NM_016610 OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa 0.41 NM_002534
178
Table 7: Genes exhibiting increased and decreased transcript levels in Syncytin-1 expressing astrocytes, showing a similar profile in lesions from MS patients (Lock et al., 2002) Gene Function Fold GenBank ID Name change CEBPG CCAAT/enhancer binding protein (C/EBP), gamma 2.75 BE622659 TNFRSF6 tumor necrosis factor receptor superfamily, member 6 2.43 NM_000043 RCN1 reticulocalbin 1, EF-hand calcium binding domain 1.61 NM_002901 GAD2 glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) 0.96 BQ128302 SPOCK2 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 0.96 NM_014767 SST somatostatin 0.91 NM_001048 NEUROD2 neurogenic differentiation 2 0.88 AB021742 PVALB parvalbumin 0.87 NM_002854 CCNI cyclin I 0.85 BG530368 SCD stearoyl-CoA desaturase (delta-9- desaturase) 0.84 BC005807 RPS4Y1 ribosomal protein S4, Y-linked 1 0.83 NM_001008 RAB5B RAB5B, member RAS oncogene family 0.82 AF267863 PEG3 paternally expressed 3 0.82 AF208967 HTR7 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) 0.71 NM_019859 ACAT2 acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase) 0.70 BC000408 HSPA6 heat shock 70kDa protein 6 (HSP70B') 0.70 NM_002155 AQP11 aquaporin 11 0.68 AI886656 MAP1D methionine aminopeptidase 1D 0.68 AA779679 KIF5A kinesin family member 5A 0.67 AF063608 CNP 2',3'-cyclic nucleotide 3' phosphodiesterase 0.62 AK098048 EXTL3 Exostoses (multiple)-like3 0.62 BC006363 Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 179
with an OASIS expression vector, which resulted in down-regulation of Syncytin-1 receptor, ASCT1, but not ASCT2 with the latter gene demonstrating an increase in expression (Fig. 39H). These results were supported by the finding of down-regulation of
ASCT1, but not ASCT2, in Syncytin-1 expressing astrocytes (Fig. 39H). Thus, Syncytin-
1-induced OASIS expression and resulting ER stress was associated with down- regulation of ASCT1 expression, but not ASCT2, which recapitulated the present observations in MS brain lesions.
V.2.3. Syncytin-1 diminishes oligodendrocyte viability
Oligodendrocyte death may represent the earliest neuropathological feature of
MS, in advance of infiltrating inflammatory cells 159 but is also a cardinal feature of
established MS lesions 411. Indeed, we have previously demonstrated that free radicals
induced by Syncytin-1 contribute to oligodendrocyte damage 196. To determine whether
Syncytin-1 expression in astrocytes affected oligodendrocyte viability, we treated
oligodendrocytes with supernatants from astrocytes overexpressing Syncytin-1 and
examined oligodendrocyte viability by measuring the levels of two markers of
myelination, CNPase (2′,3′-cyclic nucleotide 3′-phosphodiesterase) and MBP.
Supernatant from Syncytin-1-transfected astrocytes reduced the number of CNPase-
positive oligodendrocytes (Fig. 40Aii) compared to mock-treated cells (Fig. 40Ai).
Counts of CNPase-positive cells revealed that indeed Syncytin-1-transfected astrocytes significantly reduced the number of CNPase-positive oligodendrocytes compared to mock-treated cells (Fig. 40B). Immunofluorescence levels of CNPase-expressing
oligodendrocytes (Fig. 40C) were reduced by Syncytin-1-mediated toxicity but there was
no effect of Syncytin-1 on MBP-immunofluorescence (Fig. 40C). Since our observations
Chapter 5: Syncytin-1 induces ER stress
A B MOCK SYN-1 250 iii 200 150
CNPase 100 *** 50 CNPase (+)OLs 0 -1 N Y C D MOCK S
140 CNPase MBP 120 Control BS 14 100 ** 12 ** + 80 10 MBP 60 + 8 ** ♣ ♣ 40 6
Rat OL 4 20 Fluorescence (%) 2 0 Casp.3 Act. 0 00.11.0 1 N- Benzylserine (mM) Y S MOCK
Benzylserine
Fig. 40: Oligodendrocytes treated with supernatants from mock, Syncytin-1 overexpressing human fetal astrocytes (A) or supernatants from astrocytes treated with 1 mM benzylserine (C) revealed that the supernatant from Syncytin-1 overexpressing astrocytes (A) and supernatants from astrocytes treated with the ASCT inhibitor, benzylserine (C) were cytotoxic to oligodendrocytes compared to mock. (B) Quantitative analysis of immunofluorescence depicted as a percent of CNPase-immunoreactivity was decreased by both treatments (C). Immunoreactivity of MBP was not affected by various treatments (C). Oligodendrocytes were immunostained for MBP (red) and activated caspase-3 (green). Number of activated caspase-3 and MBP-positive oligodendrocytes were counted per field and expressed as a ratio of positive cells in benzylserine containing supernatant to that of DMSO containing supernatant from astrocytes. Results indicate a significant increase in oligodendrocyte damage and injury with benzylserine treatment. Original magnification 400x 180 (A). Statistical comparisons (ANOVA) were made between treatments relative to mock controls (Dunnet’s test for post-hoc analysis; ♣ p<0.001, ** p<0.01). Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 181
indicated a reduction in expression of ASCT1 in MS brain white matter (Fig. 39E) and in astrocytes overexpressing Syncytin-1 (Fig. 39G), we hypothesized that inhibition of
ASCT transporters may adversely affect amino acid flux, thus contributing to astrocyte
dysfunction. Inhibitors of ASCT transporters include benzylserine and benzylcysteine 412.
Supernatants from astrocytes treated with benzylserine were found to reduce immunofluorescence levels of both CNPase and MBP, more so than astrocytes expressing Syncytin-1 (p<0.01) (Fig. 40C). Further, supernatant from astrocytes treated with benzylserine induced caspase-3 in rat oligodendrocytes in a dose-dependent manner
(Fig. 40D). Thus, Syncytin-1 expression and inhibition of ASCT transporter function exerted cytotoxic effects on oligodendrocytes.
V.2.4. iNOS and Egr1 suppress ASCT1 in astrocytes
Increased expression of iNOS 138,196 and Egr1 391, an established transcriptional repressor of TNF-α 413 and ASCT1 414 are consistent observations in the brains of MS
patients. Given that OASIS (Fig. 38 & 39) was induced in brains of MS patients, we
examined the contributions of iNOS, Egr1 and OASIS to the expression of ASCT1.
Transfection of astrocytes with a pCDNA vector expressing Syncytin-1 revealed
significant induction of Egr1 but not Egr3 and Egr4 (Fig. 41A). Treatment of astrocytes
with the NO donor, sodium nitroprusside (SNP) reduced ASCT1 mRNA (p<0.05) (Fig.
41B). Expression of Egr1 was also significantly increased by SNP in keeping with earlier
studies showing that NO enhanced Egr1 expression 415 (Fig. 41B). Our observations were
confirmed by quantitative immunofluorescence analysis of Egr1 expression, which was
increased in astrocytes after SNP or Syncytin-1 treatment (Fig. 42A). SNP treatment
decreased ASCT1 expression in a dose-dependent manner in astrocytes (Fig. 42B),
Chapter 5: Syncytin-1 induces ER stress
A B
30 40 ** * Control ASCT1 25 30 Vector Egr1 20 20 Syncytin-1 10 15 5 10 4 mRNA RFC mRNA
mRNA RFC mRNA 3 5 2 1 * 0 0 Egr1 Egr3 Egr4 -SNP +SNP
Fig. 41: Expression of Syncytin-1 in astrocytes induced the expression of the transcription factor, Egr1 but not Egr3 and Egr4 (A). Treatment of astrocytes with sodium nitroprusside (SNP) significantly decreased ASCT1 expression, concurrently increasing the expression of Egr1 (B). Statistical comparisons (ANOVA) were made between treatments relative to controls (Dunnet’s test for post-hoc analysis ; ** p<0.01, * p<0.05).
182 Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 183
confirming our PCR results (Fig. 41B). Enhanced expression of Egr1 was also observed in MS brain white matter lesions (Fig. 42D) compared to non-MS controls (Fig. 42C).
Egr1 was localized predominantly in the cytoplasm of astrocytes in the white matter
(GFAP-positive astrocytes, blue; Egr1-brown) (Fig. 42D). Thus, these observations
indicated that Syncytin-1 expression in astrocytes diminished ASCT1 expression, which
involved induction of the transcription factors, OASIS and Egr1 by Syncytin-1.
V.2.5. Soluble Syncytin-1 down-regulates ASCT1 in astrocytes
As soluble retroviral envelope proteins are capable of modulating their cognate
receptors’ expression 416, directly inducing immune responses in different cell types 417 and down-regulating amino acid transporters 418, we hypothesized that secreted Syncytin-
1 might also affect astrocyte function. Since Syncytin-1 is highly expressed in brain
tissue 196, its expression was investigated in plasma and CSF of MS patients. Protein was
extracted as described previously 345 followed by SDS-PAGE analysis. Syncytin-1 was
detected in plasma and CSF and to a lesser extent in supernatant from mitogen (PMA)-
stimulated monocytoid cells (Fig. 43A). To determine if secreted Syncytin-1 engaged its
putative receptor on glial cells, we constructed pseudotyped virions expressing Syncytin-
1. HERVs can be assembled into virions through transcomplementation with virion
proteins encoded by different retroviruses 256 and thus, we determined whether Syncytin-
1 could act as a functional envelope glycoprotein permitting neural cell infection. By
pseudotyping an envelope-defective HIV-1 clone containing a luciferase reporter gene
(pNL-Luc-E-R-) 264 with Syncytin-1, I observed that supernatants from cells transfected with pCMVenv-Syncytin-1 alone, or co-transfected with pNL-Luc-E-R-, exhibited
Syncytin-1 immunoreactivity suggesting that Syncytin-1 and pseudotyped virions were
Chapter 5: Syncytin-1 induces ER stress
A B
(%) 140 120
* (%) 120 * 100 100 80 * 80 60 60 ASCT1 * 40
Egr1/Tubulin 40 20 20
P 100 10 1 N-1 N Con Y S Con pcDNA S pcDNA SNP (nM)
Non-MS MS C D Egr1
Fig. 42: Quantitative immunofluorescence of Egr1 showed significant induction in astrocytes treated with soluble Syncytin-1 or SNP relative to supernatant from pCDNA (empty) vector transfected HEK293T cells (A). SNP dose-dependently suppressed ASCT1 in astrocytes as determined by quantitative immunofluorescence analysis (B). MS brains (D) revealed increased expression of Egr1 in astrocytes in the white matter compared to non-MS controls (C). Statistical comparisons (t test) were made between treatments relative to controls (Original magnification 400x) (E & F), (inset F, X1000) (Dunnet’s test for post-hoc analysis; * p<0.05)
184 Chapter 5: Syncytin-1 induces ER stress
B A Syn-1 Syn-1+Luc Cont MA S φ 70 KDa C -ND A-M -CSF M 4 MS PLA HIV P MS ASTRO MDM *** 75 kDa Syn-1 25 Neurons 20 1 N- 15 D Y Vector S 10 *** 75 kDa 5 Relative Light Units x 10– x Units Light Relative Syn-1 Luc Syn-1+Luc
Fig. 43: Soluble Syncytin-1 was detectable in plasma and CSF of MS patients and supernatant of monocytoid (U937) cells (MΦ) stimulated with PMA but not in brain tissue from HIV patients without dementia (HIV-ND) (A). Syncytin-1 was detectable in supernatants from HEK293T transfected with a Syncytin-1 vector, which was enhanced by pseudotyping with the HIV vector, pNL- Luc-E-R-+ (Luc) (B). MDMs and HFAs but not neurons were permissive to pseudotyped virus, based on cellular luciferase activity. Supernatants from cells transfected with pNL-Luc-E-R-+ (Luc) failed to show any luciferase activity (C). Soluble Syncytin-1 protein from the vector pVGW427 exhibited an immunoreactive band at 70 kDa (D). Statistical comparisons (ANOVA) were made between pseudotyped virus relative to Syncytin-1 alone (Dunnet’s test for post-hoc analysis; ***p<0.001).
185 Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 186
released into the culture medium. Importantly, Syncytin-1 immunoreactivity was
increased in supernatant from the co-transfected cells (Fig. 43B). Examination of the cell-
type specificity associated with pseudotyped virus infection revealed that human
macrophages and astrocytes were permissive to infection by pseudotyped viruses while human neurons (LAN-2) were not infected based on luciferase expression (Fig. 43C).
Indeed, HeLa cells and a feline lymphocyte line (MYA-1) were also not permissive to the
pseudotyped virus, underscoring the selective cell tropism mediated by Syncytin-1,
similar to the neural cell tropism of exogenous retroviruses 419. We then produced soluble
Syncytin-1 that was secreted by pVGW427-transfected HEK293T cells (Fig. 43D). A
distinct immunoreactive band at 75 kDa was observed by western blot analysis using a
mAb to Syncytin-1 (Fig. 43D).
Following treatment of astrocytes with soluble Syncytin-1, its temporal effects on receptor expression was examined. Suppression of ASCT1 levels was observed in astrocytes after Syncytin-1 treatment for 96 h (Fig. 44A). Conversely, β-tubulin and
ASCT2 levels in similarly treated cells revealed no differences in protein expression at all time points examined (Fig. 44A). ASCT1 suppression was independent of regulation by
cytokines, as both IL-10 and IL-1β significantly increased the transcription of ASCT1
(Fig. 44B). Interestingly, soluble Syncytin-1 also induced OASIS transcription in
astrocytes, which was inhibited by the mAb to Syncytin-1 (Fig. 44C), corroborating
previous observations (Fig. 37B). The suppression of ASCT1 transcripts observed in
Syncytin-1-overexpressing astrocytes was significantly reversed by treatment of cells
with a NOS inhibitor, L-NAME [5 μM] (Fig. 45A) and minocycline treatment, which
also inhibited PMA-induced iNOS expression (Fig. 45B). Thus, ASCT1 expression in
Chapter 5: Syncytin-1 induces ER stress
A B 180 Tubulin ASCT1 8 U373 7 * 140 ASCT2 U937 6 * * 5 100 4 60 3 2 Fluorescence (%) Fluorescence 20 1 ASCT1 mRNA RFC mRNA ASCT1 0 Cont IL-10 IL-1β TNF-α 24 48 72 96 Control Hours
C 100 U373 80
60
40
20 OASIS mRNA RFC 0 Vector Syn-1 Syn1+mAb
Fig. 44: Chronic treatment of astrocytes with soluble Syncytin-1 resulted in diminished ASCT1 expression immunoreactivity although β-tubulin and ASCT2 were not altered (A). Astrocytes (U373) and monocytoid cells (U937) were treated with IL-10, IL-1β and TNF-α (10 ng/ml) for 24 h and expression of ASCT1 was examined by real time RT-PCR. Expression of ASCT1 was examined following cytokine treatment, which revealed a significant increase with IL-10 and IL-1β, but not with TNF-α treatment, particularly in astrocytes (U373) but not monocytoid cells (U937) (B). Treatment of human fetal astrocytes with soluble Syncytin-1 significantly induced mRNA levels of OASIS, which was inhibited when Syncytin-1 was blocked with the anti- Syncytin-1 mAb (6A2B2) (C). Statistical comparisons (ANOVA) 187 were made between treatments relative to controls (Dunnet’s test for post-hoc analysis; * p<0.05). Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 188
astrocytes could also be diminished by secreted Syncytin-1, suggesting that ASCT1
expression may be regulated by both extracellular and intracellular Syncytin-1 exposure.
V.2.6. Syncytin-1 transgenic mice exhibit neuroinflammation
We have previously reported up-regulation of Syncytin-1 in the brains of MS
patients relative to age-matched controls 196. To elucidate the mechanism by which
Syncytin-1-mediates oligodendrocyte injury and to confirm in vitro data obtained above, we generated three independent lines of transgenic (Tg) mice expressing Syncytin-1, driven by the GFAP promoter 420 (Fig. 46A). Transgene detection was performed by PCR assay using tail-derived genomic DNA (Fig. 46B). Lines of Tg mice were obtained by serial back-crossing onto C57/BL6 mice as the latter are susceptible to EAE (Fig. 46C).
As Syncytin-1 Tg mice displayed no obvious disease phenotype, we utilized a model of
MS in which PBS or murine recombinant TNF-α was stereotaxically implanted into the corpus callosum 196, an anatomical region usually exhibiting demyelination in MS
patients 421. In fact, TNF-α is a highly potent inducer of Syncytin-1 expression in
astrocytes (Fig. 47A). Since Syncytin-1 Tg and wild type (WT) littermates stereotaxically
implanted with PBS did not demonstrate Syncytin-1 expression (Fig. 47B), subsequent comparisons were made between Tg and WT animals implanted with TNF-α, which significantly induced Syncytin-1 mRNA (Fig. 48A) and protein (Fig. 48B) expression in brains of Tg mice. To determine whether Syncytin-1 expression in the brain provoked an inflammatory response in mice, we examined TNF-α-implanted Syncytin-1-Tg and WT littermates, which showed induction of the pro-inflammatory genes, TNF-α and IFN-α
(Fig. 49A). Interestingly, expression of CNPase and ceramide galactosyltransferase
(CGT), indicators of oligodendrocyte viability/myelination, was significantly reduced in
Chapter 5: Syncytin-1 induces ER stress
A B 2.5 ASCT1 * 65 *** iNOS 2 ASCT1 45 *** 1.5 25
1 7.5 mRNA RFC mRNA mRNA RFC mRNA * * 0.5 5.0 2.5 0 Control Syn-1 Syn-1 CPP+MCPP+M + L-NAME Astro MDM
Fig. 45: Suppression of ASCT1 transcripts observed in Syncytin-1- overexpressing astrocytes was significantly reversed by treatment of cells with an iNOS inhibitor, L-NAME (A). Minocycline restored ASCT1 in astrocytes and monocytoid cells and simultaneously suppressed PMA-induced iNOS (B). Statistical comparisons (ANOVA) were made between treatments relative to controls (Dunnet’s test for post-hoc analysis; *** p<0.001, * p<0.05).
189 Chapter 5: Syncytin-1 induces ER stress A B
Syn-1 1 kb GFAP hGH promoter Not1 Syncytin-1 ATG poly A EcoR1 EcoR1
SV40 1.6 Kb 267 bp SD/SA
C
Ear Tag No. 1 2 3 N 5 6 7 N N N N N 13 N 15 Founder Mice
95 5 11 F1 112 149 137
F2 19
122 F3 124
Fig. 46: The Syncytin-1 gene was cloned into pFGH vector containing the GFAP promoter (A). Transgene integration was confirmed by genotyping revealing a 267 bp product (Syn-1) (B). Map showing lineage of transgenic mice
190 Chapter 5: Syncytin-1 induces ER stress
A B
*** 100 Syncytin-1 U373 75 PBS 50 Tg- Tg WT 25 TNF-α 1 2 3 1 2 3 kDa 5 Syncytin-1 75 4 mRNA RFC mRNA 3 β-Actin 42 2 1
l α -β A 5 10 15 20 5 10 15 20 N N M F IF P α ControI β -1 IL TNF-
Fig. 47: Syncytin-1 expression in U373 astrocytes was determined by real time RT-PCR analysis after treatment with IFN-α and IFN-β (100 U/ml), PMA (50 ng/ml) and varying doses of IL-1β and TNF-α. Syncytin-1 expression was significantly induced in astrocytes treated with 15 ng/ml of TNFα compared to untreated control (A). Implantation of PBS into the corpus callosum of Syncytin-1 transgenic mice did not induce Syncytin-1 expression compared to implantation with TNF-α, where Syncytin-1 immunoreactive band is seen in Lane 1. Tg (n=3) and WT (n=3) mice implanted with PBS did not reveal any Syncytin-1 immunoreactive bands when SDS-PAGE followed by Western blot analysis was performed (B). Statistical comparisons (ANOVA) were made between treatments relative to controls (Dunnet’s test for post-hoc analysis; *** p< 0.001).
191 Chapter 5: Syncytin-1 induces ER stress
A B
2.5 Syncytin-1 * TNF-α 2 Tg Wt 1.5 1 2 3 1 2 3 + kDa 1 Syncytin-1
mRNA RFC mRNA 75 0.5 β-Actin 42 Tg-PBS Tg-TNFα
Fig. 48: TNF-α-implantation induced Syncytin-1 in Tg mice but not in Tg mice implanted with PBS (A). TNF-α-implantation induced Syncytin-1 immunoreactivity on western blot in Tg mice brains but not in WT littermates (B). Statistical comparisons (t test) were made between treatments relative to controls (Dunnet’s test for post-hoc analysis; * p<0.05).
192 Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 193
Tg mice (Fig. 49A). The transcript levels of MOG and proteolipid protein (PLP) were not
affected in the Syncytin-Tg mice relative to WT animals (Fig. 49B). The brains of TNF-
α-implanted Syncytin-1 Tg mice revealed astrocytosis, demonstrated by increased GFAP immunoreactivity (Fig. 49C i&ii). Expression of Iba-1-positive microglia/macrophages was enhanced in the brains of Tg mice compared to WT littermates (Fig. 49C iii&iv).
Brains of Tg mice displayed increased numbers of infiltrating CD3-positive T cells relative to controls (Fig. 49C v&vi). Importantly, Syncytin-1-positive astrocytes (Fig.
49C viii, inset) in brains of Tg mice also demonstrated enhanced iNOS immunoreactivity
(Fig. 49C viii) relative to WT littermates (Fig. 49C vii), which supported the notion that iNOS and ER stress induction are closely coupled 228. Analysis of CNPase-
immunoreactivity in the corpus callosum demonstrated a marked reduction in Syncytin-1
Tg mice (Fig. 49C x) compared to WT littermates implanted with TNF-α (Fig. 49C ix),
confirming earlier observations 196. Interestingly, there was no difference in MBP immunoreactivity between Tg (Fig. 49C xii) and WT littermates (Fig. 49C xi) implanted with TNF-α.
V.2.7. Syncytin-1 Tg animals show ER stress
Brain tissue from TNF-α-implanted Tg mice also revealed significant induction
of ER stress gene transcripts, ERp57, OASIS, and GADD153 compared to WT
littermates (Fig. 50A), while both BiP and PERK showed a trend towards increased
transcript levels. Of particular interest, GADD153 was observed in astrocytes in brains of
Syncytin-1 Tg mice (Fig. 50C). BiP was up-regulated in brains of Syncytin-1 Tg mice
(Fig. 50A), but expression was predominantly in cortical neurons (Fig. 50C).
Interestingly, OASIS, which is induced during astrocytic ER stress 398 and in acute
Chapter 5: Syncytin-1 induces ER stress
A B
1500 TNFα *** 3 Wt-TNFα (n=6) 1200 IFNα 900 Tg-TNFα (n=6) CGT 600 2 300 CNPase 3 * mRNA RFC mRNA
2 RFC mRNA 1
1 * * 0 0 Wt-TNFα Tg-TNFα MOG PLP
C GFAP Iba-1 CD3 iNOS CNPase MBP i iii v vii ix xi
cc
ii iv vi viii x xii
cc Tg-TNF Wt-TNF
Fig. 49: TNF-α implantation in corpus callosum of Syncytin-1 Tg mice enhanced levels of pro-inflammatory genes, IFN-α and TNF-α and decreased levels of the oligodendrocyte markers, CGT and CNPase in Syncytin-1 Tg mice relative to WT littermates (A). Transcript levels of MOG and PLP did not differ between groups (B). Syncytin-1 Tg mice implanted with TNF-α revealed astrocytosis (GFAP immunoreactivity) (A ii inset), microgliosis (Iba-1- immunoreactivity) (A iv), infiltrating CD3-positive T cells (A vi) and iNOS immunoreactivity in Syncytin-1-positive cells (A viii, inset) compared to WT littermates (A i, iii, v & vii). CNPase expression was reduced in the corpus callosum of Syncytin-1Tg mice implanted with TNF-α (A x) compared to WT littermates (A ix). Syncytin-1 Tg (A xi) mice did not show any difference in the expression of myelin basic protein (MBP) in the corpus callosum (CC) after TNF-α implantation compared to WT littermates (A xii) (Original 194 magnification 50x A, xi&xii) (400x, inset 1000x). Statistical comparisons (ANOVA) were made between expression levels in Tg mice relative to Wt littermates (Dunnet’s test for post-hoc analysis; *** p<0.001, * p<0.05). Chapter 5: Syncytin-1 induces ER stress AB
1000 Wt-TNFα (n=6) Tg-TNFα (n=6) ** 100 Tg-TNFα Wt-TNFα kDa * GADD153 30 mRNA RFC mRNA 10 * BiP 78 1 β-Actin 42 7 RK BiP D153 p5 E R D P E OASIS GA
Wt-TNFα Tg-TNF α Tg-PBS C i alsmCortex callosum Corpus BiP
ii BiP
iii callosum Corpus GADD153
Fig. 50: TNF-α implantation significantly enhanced levels of ER stress genes, particularly GADD153, ERp57 and OASIS in the brains of TNF-α- implanted Syncytin-1 Tg mice relative to WT controls (A). These results were also confirmed by western blot analysis, which revealed induction of GADD153 and BiP in Syncytin-1 Tg mice brains (C) Immunohistochemical analyses of expression of ER stress proteins, BiP and GADD153 in Syncytin-1 Tg mice revealed BiP immunostaining in glial cells in the corpus callosum (i) and also in neurons in the cortex (ii). Expression of GADD153 was mostly observed in astrocytes in the corpus callosum of Syncytin-1 Tg mice implanted with TNF-α and to a lesser extent in Tg mice implanted with PBS (iii) (Original magnification 630x). Statistical comparisons ( t test) were 195 made between treatments relative to controls (Dunnet’s test for post-hoc analysis; ** p<0.01, * p<0.05). Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 196 lesions of MS patients (Fig. 38) was also increased in the brain of Syncytin-1 Tg mice
(Fig. 50A).
Complementing these findings, Syncytin-1 Tg mice implanted with TNF-α displayed significantly lower ASCT1 transcript levels but ASCT2 did not differ between groups. This finding corresponded to higher iNOS mRNA levels in the Tg mice (Fig.
51A), emphasizing our immunohistochemical analysis. Induction of pro-inflammatory molecules was specific to the brain, since treatment of macrophages from Syncytin-1-Tg mice with TNF-α did not induce iNOS expression differentially compared with WT- derived macrophages (Fig. 51B). Further, comparison of nNOS transcripts did not differ between groups (Fig. 51C). The number of ASCT1-positive cells was reduced in
Syncytin-Tg mice implanted with TNF-α compared to WT littermates (Fig. 51D).
Stereotaxic implantation of TNF-α into the corpus callosum of Syncytin-1 Tg animals resulted in significant neurobehavioral deficits compared to TNF-α implanted WT littermates at days 3 and 6 post-implantation (Fig. 51E). The mean deficit scores were obtained from a combination of three behavioral tests described previously 347. TNF-α- implanted Tg mice grasped a horizontal rod for significantly less time compared to the
WT littermates. In addition, Tg mice were sufficiently impaired that they could not hold on to an inverted screen and reach the screen edge, while WT littermates reached the edges of the inverted screen more quickly. Lastly, Tg mice implanted with TNF-α exhibited mean delays in the time taken to cross a cantilevered beam, compared to WT littermates, suggesting that the Tg mice showed diminished motor activity and exploratory behavior. Thus, in vivo Syncytin-1 overexpression caused oligodendrocyte
Chapter 5: Syncytin-1 induces ER stress
A B C Wt-TNFα (n=6) WT-TNFα Tg-TNFα (n=6) 1.4 Tg-TNFα 250 1.2 BMDM-iNOS *** 150 1.0 50 1 5 0.8 4 0.6 0.6
3 0.4 RFC mRNA mRNA RFC mRNA mRNA RFC mRNA 2 1 0.2 0.2 0 * ASCT1 ASCT2 iNOS Wt-TNFα Tg-TNFα nNOS
D E Wt-TNFα (n=6) 60 3.5 Tg-TNFα (n=6) * 2.5 40 * * cells (%) + MDS 1.5 20 0.5 ASCT1 0 Wt-TNFα Tg-TNFα Day 3 Day 6
Fig. 51: TNF-α-implantation induced iNOS but reduced ASCT1 expression, but not ASCT2, in Syncytin-1 Tg mice relative to WT littermates (A). Bone marrow-derived macrophages (BMDM) from Syncytin-1 Tg mice and WT littermate controls were treated with TNFα. Expression of iNOS did not differ between WT and Tg groups (B). Transcript levels of nNOS in brains of Tg mice did not differ from that of the WT littermates (C) Analysis of ASCT1-immunopositive cells in the corpus callosum (D, inset) revealed significantly lower numbers in TNF- α-implanted brains of Syncytin-1 Tg mice compared to WT littermate controls (D). Mean deficit scores (MDS) revealed significantly high MDS scores for Syncytin-1 Tg mice implanted with TNF-α compared to WT littermates (E) (Original magnification: D, X400). Statistical comparisons (ANOVA) were made between treatments relative to controls (Tukey’s Multiple Comparison Test was performed; *** p<0.001, * p<0.05). 197 Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 198 loss and neurobehavioral abnormalities, which were accompanied by ER stress and down-regulation of Syncytin-1’s receptor, ASCT1.
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 199
V.3. Discussion
In this Chapter, we have demonstrated enhanced expression of ER stress proteins,
GADD153, ERp57, BiP, PERK and OASIS, in demyelinating brain lesions of MS
patients. We have also identified a novel role for Syncytin-1 whereby through the
induction of ER stress molecules, and in particular OASIS, this retroviral protein mediates down-regulation of its receptor, ASCT1 with ensuing adverse effects on oligodendrocyte survival. Using a newly developed mouse model of MS, Syncytin-1 was
found to induce neuroinflammation, myelin injury and neurobehavioral deficits that were
accompanied by ER stress in astrocytes, recapitulating our observations in MS patients.
Retrovirus receptor interference and down-regulation proceeds from direct
interactions between the virus and the receptor or through indirect (intracellular)
mechanisms through redox regulation of the putative receptor 422. Excessive or long-term
ER stresses result in apoptotic cell death, and a balance between apoptotic and ER stress
signals determines cell fate after ER stress 398. Since inflammation can drive an ER stress
response 230, induction of ER stress genes in the brains of Syncytin-1 Tg mice may be the
result of enhanced inflammation in conjunction with Syncytin-1 expression observed in
the brain of these animals. We have previously demonstrated that Syncytin-1 expression
in astrocytes increases pro-inflammatory cytokine expression 196. Herein, we demonstrate
that Syncytin-1-induced inflammation enhances ER stress in astrocytes and in particular,
the expression of OASIS. The regulation of this recently discovered molecule 398 has not
been elucidated in great detail. Nevertheless, for the first time, we have shown that
OASIS is induced in MS brain tissue, astrocytes overexpressing Syncytin-1 and
following chronic exposure to Syncytin-1, and in each case with an ensuing reduction in
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 200
ASCT1. Suppression of ASCT1 might be brought about by OASIS-mediated iNOS
expression through the production of Egr1. Moreover, our present observations imply an
interaction of Syncytin-1 with ASCT1, leading to diminished oligodendrocyte.
The receptors for Syncytin-1, ASCT1 and 2, are widely expressed on most cell
types 333, but their expression in the human brain has not been previously characterized.
Expression of ASCT2 is low in the adult brain 423 and our observations of ASCT2
immunostaining in human brains represent the first report of its expression predominantly
in microglial cells. In the mouse brain, ASCT1 is chiefly expressed in GFAP-positive
astrocytes in the cerebral cortex and corpus callosum, but not in neurons,
oligodendrocytes or activated/resting microglia 424, similar to our observations in the
white matter of human brains. Interestingly, weak ASCT1 labeling was observed around
ER cisterns, revealing its intracellular trafficking pathway or ASCT1 may have a
functional role in exchange of ions between cytoplasm and ER lumen 424. In our study,
we provide evidence for the down-regulation of ASCT1 in MS brain white matter.
ASCT1 was also found to be significantly down-regulated in glial cells treated with 7-
ketocholestrol, a by-product of myelin, damaged by oxidative stress, a key feature of MS
425, which supports the present findings. Reduced expression of ASCT1 in brain
astrocytes of MS patients appears to have adverse consequences for oligodendrocytes and
perhaps other proximate cells’ health and function. ASCT1 is the principal transport
system involved in the secretion of L-serine 426, a potent astrocyte-derived neurotrophic
factor 424, essential for myelination 427 and neuronal survival 338. Conversely, ASCT1 is also responsible for mediating intracellular transport of the excitotoxic amino acid, cysteine 338, preventing its extracellular accumulation. Interestingly, a reciprocal change
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 201
of Syncytin-1 and its putative receptor, along with diminished amino acid influx has been
observed in the placenta 428. Down-regulation of ASCT1 expression in mouse brain
capillaries has been observed during the second postnatal week and is speculated to be due to lowered demand for small neutral amino acids from circulation or their increased
synthesis in local glial cells 424. Our results suggest a highly specific role for ASCT1
down-regulation, since another astrocytic, amino acid transporter, EAAT1 429, was unaffected by Syncytin-1. Indeed, this finding supports our earlier studies showing that
Syncytin-1-mediated effects on oligodendrocytes were not dependent on the glutamate receptors NMDA-R and AMPA-R 172.
To investigate the mechanism of ASCT1 down-regulation in astrocytes, we
hypothesized that NO might play a role as NO donors are known to modulate ASCT2
expression 430. Further, our rationale for using NO donors was that Syncytin-1 mediates
NO production and formation of peroxynitrites 196, both of which are known to induce
ER stress 431. iNOS expression and overproduction of NO in astrocytes of MS
demyelinating lesions also contributes to inflammation and tissue injury 138,196. Indeed,
SNP, an NO donor, diminished ASCT1 expression in astrocytes, but also induced Egr1,
an established repressor protein of ASCT1 in neural cells 414,432. Of note, Egr1 also
suppresses TNF-α 413, which may have pathogenic consequences in MS due to the
protective nature of this pro-inflammatory cytokine 433. Indeed, Bcl-2-induced Egr1 DNA
binding activity has been correlated to oligodendrocyte death 434. Since iNOS and Egr1
are significantly enhanced in brain lesions of MS patients 391 with concurrent down-
regulation of ASCT1, we might have also identified a potential role for Egr1 in MS
neuropathogenesis.
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 202
Syncytin-1 is a complex endogenous retroviral protein that is largely beneficial to
the host in terms of enhancing placental development 334. However, in the brains of MS
patients, it becomes a part of the inflammatory cascade when its expression is increased
by various factors including viruses 197. Syncytin-1 overexpression in astrocytes is detrimental 196 and also results in syncytia formation, which corroborates recent
observations in an MS neuropathology wherein syncytium formation was reported 435.
Cytokines are known to enhance expression of HERV env genes 379 and in the present
study we found that TNF-α increased Syncytin-1 expression in the Tg mice, likely
through activation of the GFAP promoter. Enhanced inflammatory responses in the brain
of Syncytin-1 Tg mice as well as recruitment of CD3-positive T cells are highly
significant in our model of MS since the effect of T cell-mediated pathology as well as
the potential role of Syncytin-1 to chemoattract T cells into the brain can be investigated.
The significance of my study lies in the pathogenic consequences of Syncytin-1, whose
expression in astrocytes has negative consequences for oligodendrocyte viability.
CNPase, an early marker of myelination and oligodendrocyte viability, was suppressed in
our transgenic model compared to MBP, a late marker. Supporting our observation is the finding that CNPase, but not MBP, is regulated by redox reactants 436. A major
implication of our findings, therefore, is that compromised expression of ASCT1 in the
brain, particularly in astrocytes, can contribute to altered concentrations of small neutral
amino acids, which might potentiate neurotoxicity by excessive stimulation of the
NMDA receptor 437. In the light of recent evidence for NMDA receptor expression on
oligodendrocytes 89, the effect of neutral amino acids on viability of oligodendrocytes
warrants further investigation. Availability of specific antagonists/inhibitors for ASCT1
Chapter 5: SYNCYTIN-1 INDUCES ER STRESS 203
will also be useful in dissecting the molecular mechanisms of ASCT1 suppression in
mediating neuropathogenesis. We speculate that the supernatant from astrocytes
expressing Syncytin-1 might be containing lower amounts of neutral amino acids,
particularly, L-serine than the controls. If so, this might contribute to the demyelination
seen in our transgenic mouse model as well as in vitro experiments.
Thus, we have identified a novel pathway in the pathogenesis of MS, wherein
Syncytin-1 induces ER stress in astrocytes. The prototypic ER stress molecule examined in this study, OASIS, and Syncytin-1-mediated NO production suppressed ASCT1 in astrocytes, which compromised oligodendrocyte viability (Fig. 52). These observations highlight the perturbed expression of Syncytin-1 and its receptor, ASCT1, in neuroinflammation providing new insights into the pathogenesis of MS and other neuroinflammatory disorders. Based on our results, this new mouse model of MS expressing a HERV glycoprotein in astrocytes can be used to dissect the pathogenic mechanisms of MS, without the constraints reported for other MS models 157.
Activated astrocyte Syncytin-1 Quiescent astrocytes OASIS Syncytin-1- OASIS Egr1 NO P ASCT1 ASCT1 induced ER stress Syncytin-1 Egr1
Neuroinflammation ASCT1
Healthy Oligodendrocyte toxins oligodendrocyte Demyelination and axonal injury Axon Damaged Myelin ↓ oligodendrocyte
204 Fig. 52: Syncytin-1-mediated neuropathogenesis GENERAL DISCUSSION AND CONCLUSIONS 205
CHAPTER 6
GENERAL DISCUSSION AND CONCLUSIONS
GENERAL DISCUSSION AND CONCLUSIONS 206
VI. General Discussion and Conclusions VI.1. Overview
Since the completion of sequencing of the human genome, scientific focus has
shifted from studying genes, to analyzing the proteins encoded by them. Among these
genes, the endogenous retroviral protein, Syncytin-1, has been characterized as an
essential component for placental development 235. However, as many other proteins do,
expression of Syncytin-1 in cell types other than trophoblasts in the placenta may not
exert beneficial effects. To the best of our knowledge, the present studies represent the
first direct evidence of Syncytin-1 being neuropathogenic, particularly inducing ER stress
and free radicals that are responsible for demyelination, damage and death of oligodendrocytes.
VI.2. Syncytin-1 vs MSRV
It is speculated that Syncytin-1 behaves as a complex host gene that has evolved
from a retrovirus and might not exist as an infectious virus, though evidence supporting
this contention is still lacking. Among infectious agents, several different viruses have been posited to have an association with MS 438. Studies by others in the field of HERV-
induced inflammation have focused primarily on MSRV. MSRV is a component of
previously characterized extracellular virions derived from MS choroid plexus cell
cultures 183 and is a prototype member from which the whole HERV-W family was later
characterized 185. Syncytin-1 is another member of this family and maybe an endogenous counterpart of the exogenous retrovirus, MSRV. Another HERV implicated in MS is
HERV-H, which has also been demonstrated to be transmissible 167 but convincing
evidence is lacking. Nevertheless, the complex reality is that pathogenicity of one
member might be amplified by unavoidable interactions with other family members.
GENERAL DISCUSSION AND CONCLUSIONS 207
Indeed, superinfection with exogenous retroviruses that are closely related appear to
escalate the disease course 439. In fact, other non-RNA viruses have the ability to drive
expression of Syncytin-1 in the brain 197, further corroborating our contention that MS is not caused by Syncytin-1, but rather is an essential component of the inflammatory
cascade that comprises MS demyelinating pathogenesis.
VI.3. Syncytin-1-associated neuroinflammation
In Chapter #3, we have shown that Syncytin-1 expression is increased in the
brain. As mentioned earlier, Syncytin-1 expression is enhanced by other viruses notable
among them being HSV 197. In placental cells, Syncytin-1 expression is decreased under
hypoxic conditions, resulting in decreased cell fusion and placental abnormalities in pre- eclampsia, a common clinical problem in pregnant women 440. The transcription factors
CBF (CCAAT binding factor), Oct-1 (octamer protein-1), AP-1 and Sp1 are known to bind to the Syncytin-1 gene promoter. CBP and Oct-1 sites are critical for transcriptional regulation of the gene in trophoblast cells 441, suggesting that one or more of these transcription factors may be involved in the induction of Syncytin-1 in MS. CBP induces the expression of granulocyte/macrophage colony-stimulating factor (GM-CSF) 442, a hematopoietic growth factor which is increased in association with demyelination in MS and whose deficiency in mice results in resistance to EAE 443. Other transcription factors,
Sp1 and Oct-1 that bind to Syncytin-1 promoter are also known to up-regulate osteopontin in MS 444. Mice lacking osteopontin are resistant to demyelination in the EAE model 445. The pathways upstream of these transcription factors in astrocytes are unknown, but might include cytokines induced in lymphocytes and macrophages early in the MS disease process.
GENERAL DISCUSSION AND CONCLUSIONS 208
VI.3.1. Syncytin-1 mediates inflammation through nitric oxide intermediates
We have shown that Syncytin-1 can cause the production of proinflammatory cytokines and reactive oxygen species in astrocytes. Viral envelope glycoproteins are known to affect immune responses, and Syncytin-1 has amino acid sequences that would be predicted to affect the activation of lymphocytes and macrophages 313. Thus far, a single nucleotide polymorphism (SNP) in Syncytin-1 gene has been reported in the transmembrane domain of Syncytin-1 (www.ncbi.nlm.nih.gov), whose gene is carried by all people in the general population and indeed expresses the protein. However, no studies exist to explain if this polymorphism predisposes certain individuals to MS.
HIV-1 coat protein gp120 can be cytotoxic to neurons and glial cells by a
mechanism involving membrane-associated oxidative stress and up-regulation of IL-1β
and other oxidative stress genes 446, suggesting similarities in the pathogenic actions of
Syncytin-1 and gp120. IL-1β can also increase ROS by enhancing NO production in astrocytes and possibly the activation and cytokine production by MS lesion-associated T cells and macrophages. However, we do know that ROS and intermediate compounds are responsible for damaging oligodendrocytes but additional cytolytic mediators may also be generated by Syncytin-1 expression since neuronal cells were not damaged in our model. It could be because of constitutively low levels of antioxidants in oligodendrocytes that may make them prone to oxidative stress 131. In particular, the
levels of glutathione has been determined to be lower in oligodendrocytes than in neurons
and this might make the former cells vulnerable to oxidative stress. It might perhaps be
interesting to determine whether Syncytin-1 can induce neuropathological changes in
iNOS deficient mice. We have demonstrated a modest but significant increase in protein
GENERAL DISCUSSION AND CONCLUSIONS 209 carbonyls that can kill oligodendrocytes. In fact, a 30% increase in protein carbonyls is also seen in other models of oxidative stress mediated neurodegeneration 447. Moreover, amyloid β protein can induce 60% increase in protein carbonyls, which corresponds to
20-40% neuronal death. Thus there is no direct correlation between amount of protein carbonyls and cell death 447.
Previously it has been demonstrated that T cells reactive to MSRV were specifically and clonally selected for expansion 189. Since the contribution of T cells to
MS pathogenesis is well established and cannot be ignored in the current model, it is important to determine whether T cells derived from MS patients are capable of mounting an immune response to Syncytin-1, which is up-regulated in activated glial cells of MS patients. It may be interesting to demonstrate if EAE is worsened in a
Syncytin-1 transgenic mouse, which is part of an ongoing study in the laboratory. If tissue injury or trauma releases the otherwise sequestered Syncytin-1, a normal immune response comprising autoantibodies and autoreactive T-lymphocytes might be generated which can modulate pathogenesis in MS patients. It is also imperative to understand the immunological tolerance to Syncytin-1 during development.
VI.4. Quantification of Syncytin-1 copy numbers in tissues
VI.4.1. Syncytin-1 RNA copy numbers in the brain
Chapter#4 deals with using HERV copy number as an important variable for understanding retroviral dynamics. Using simple RNA and DNA extraction and performing real time PCR analyses, we have demonstrated that Syncytin-1 RNA and
DNA copy numbers are increased in brain tissue of MS patients, but not from the PBMC.
This study has several implications, notably that it cannot be used as a biomarker, unless
GENERAL DISCUSSION AND CONCLUSIONS 210 of course brain biopsies will be performed regularly to monitor disease status. Indeed,
Syncytin-1 RNA copy numbers were quantified, revealing increased levels in the brains of MS patients. This was not surprising since we have shown this by relative quantification in Chapter#3. However, the copy numbers that we obtained in this study may not reflect actual copy numbers for several reasons. Firstly, the assay may not be the most accurate. We have compared the copy numbers in the brain RNA sample to RNA transcribed in vitro from a Syncytin-1 expressing construct. RNA extracted from tissues exhibit less efficient amplification than from in vitro RNA. It may be necessary to make standard curves including non-human tissue extracts to overcome this problem. Secondly, there is tremendous variability in the stability of RNA in post mortem tissue resulting in
RNA levels that differ extensively between clinical samples as well as stability of
GAPDH mRNA which may be quite different from that of Syncytin-1 mRNA. This may explain why the difference in quantitative analyses (p<0.05) of Syncytin-1 mRNA is less significant than that of the relative quantification analysis (p<0.01). The 2.5 fold change in RNA copy numbers in MS patients over controls seen in this study could be low either due to difference in patterns of death among different patients and removal of necropsy samples or it could be high due to insensitivity of the assay for the above mentioned reasons. However, in our analysis, the mean PCR threshold cycle differences between cDNA from MS (20.52) and control (20.24) brain tissue for the housekeeping gene,
GAPDH, was not significant, suggesting that the differences observed in RNA copy numbers were not due to differences in RNA and cDNA quality between groups.
Moreover, the 0.5log10 difference (2 fold change) seen with RNA copy numbers has translated into a 3-fold change in Syncytin-1 protein expression in the brain by western
GENERAL DISCUSSION AND CONCLUSIONS 211
blot analysis. Relative quantification analysis (2.74 fold) of Syncytin-1 RNA in the brain
of MS patients relative to controls agreed with our quantitative analysis (2.95 fold)
highlighting the utility of our assays, as well as indicating that the variations in RNA
extracted from autopsy specimen and in vitro transcription reactions may be minimal.
VI.4.2. Syncytin-1 RNA copy numbers in CSF and plasma
One concern with quantification of HERV is that cellular RNA may be released
due to cell lysis in samples after blood collection or CSF obtained by lumbar puncture
during sample treatment and storage. Previously, quantification of MSRV virion was
complex since it could not be differentiated from cellular RNA released from dead cells.
This problem was overcome by incorporating centrifugation, filtration, RNase and DNase
digestion steps to ensure that only particle-associated MSRV RNA was extracted and to
remove any non-encapsidated RNA 184,448 and thus prevented contamination of irrelevant
HERV sequences from cellular DNA or RNA in extracellular fluids. However, in our study, we have examined the total RNA extracted from cells and other body fluids in an effort to understand copy numbers of Syncytin-1 as one might see in the clinical setting, comprising both particle-associated and non-encapsidated RNA. The biological relevance of Syncytin-1 in CSF and plasma, amplified in my study is yet to be fully understood,
though extracellular Syncytin-1 protein might be involved in regulation of its cognate
receptor expression (Chapter #5).
Other issues that we pondered over but did not address in my thesis are whether
our PCR primers cross react with other overexpressed loci since competition in a PCR
reaction will favour the higher amount of mRNA. Syncytin-1 mRNA is derived from a single specific locus (7q21q2), whereas there is no specific locus for MSRV and it was
GENERAL DISCUSSION AND CONCLUSIONS 212
also revealed that it was the Syncytin-1 locus that had a role in placental morphogenesis
due to a conserved ORF as opposed to mutated gag, pol pseudogenes of the same locus
334. Indeed, we sequenced the PCR product, which revealed that it is Syncytin-1 locus
(7q) that is overexpressed. Studies suggest that of 30 env sequences, only one on
chromosome 7q is expressed 449. Northern blot analysis revealed the presence of genomic, sub-genomic and large spliced mRNAs 186. Transcripts from defective
Syncytin-1-like sequences or due to alternate splicing might influence the results of
Syncytin-1 quantitative PCR assay developed in this study, although the latter is
improbable because retrovirus envelopes do not usually contain splice variants. cDNA
synthesis performed in this study employed random primers, which can bind to mRNA
transcripts of varied length. The real time RT-PCR experiments could be performed with
oligodT primers that bind only to polyadenylated mature mRNA.
VI.4.3. Syncytin-1 DNA copy numbers and integration events
Analysis of DNA copy numbers by PCR has proven to be an interesting
challenge. Measurement of MSRV pol gene DNA copy numbers by fluorescent in situ
hybridization (FISH) revealed an increased copies of the gene in MS patient samples 450.
Similarly rigorous PCR quantification procedures applied in my thesis for Syncytin-1 revealed massive increases in Syncytin-1-encoding DNA copy numbers in the brains of
MS patients relative to controls (Fig. 35C). Whether the increase in DNA copy numbers implied new viral DNA insertions due to ongoing reinfection by replication competent
HERV was investigated. We looked for evidence of newly acquired proviruses by cloning virus-cell junctions and determining new integration junctions. Since our PCR assays did not detect increased numbers of HERV-W-LTR (U5)-Alu PCR fragments, we
GENERAL DISCUSSION AND CONCLUSIONS 213
speculated that the increase in DNA copy numbers can be attributed to accumulation of
unintegrated linear retroviral cDNA sequences 301, which were assessed by PCR of 1 and
2 LTR circles. Also Southern blotting of supernatant DNA, a technique named Hirt assay could be performed to detect LTR circles or episomal DNA 451, although this was not performed in my studies. We have demonstrated that the env sequences are amplified but not the LTR sequences perhaps by a mechanism similar to that of the dihydrofolate reductase (DHFR) gene under methotrexate selection 452. Accumulation of abundant
unintegrated retroviral DNA post reverse transcription, suggests that integration may be
aborted. This also suggests that superinfection of replication-competent retrovirus may be occurring, overcoming cellular receptor interference, which was also not investigated in our study.
Appendix E shows the calculations performed to study the retroviral copy
numbers. We acknowledge that there may be several issues here. Firstly, the
measurement of DNA may not be accurate since the samples may contain, in addition to
genomic DNA, contaminating RNA and ribonucleotides that could influence the results
despite rigorous attempts to generate pure DNA. To control for this, GAPDH was used to
normalize the data though the PCR efficiency for detection of Syncytin-1 and GAPDH
are not similar. Secondly, the human genome consists of 654 LTRs of HERV-W 292 of
which we examined one in our assay. This may not reflect precisely the Syncytin-1 locus
unless extensive sequencing of various PCR fragments was carried out. Thirdly, use of
appropriate controls and methodology is essential here. As mentioned before, Syncytin-1
is not unique to MS and it is assumed that Syncytin-1 copy number is fairly constant
among a control population. However, we have observed that the non-MS controls from
GENERAL DISCUSSION AND CONCLUSIONS 214
brain and PBMC differ by more than 1000 fold in copy numbers, which we attribute to
different methods of DNA purification from 2 different cohorts of MS patients and from
2 different tissues. Fourthly, our method of normalization may have inherent problems.
The ratio of Syncytin-1 to GAPDH is in the 1-4 range, which means Syncytin-1 copy
number is 2-8 per cell (since the observed 100 fold difference in Syncytin-1 DNA/μg of
total DNA is reduced to 2 fold when normalized to GAPDH) but sometimes this ratio is
less than 1 which suggests that Syncytin-1 copies are less than 2 per cell, a number that is
lower than the existing 30 copies of full-length env in the diploid genome 330. This anomaly can be attributed to normalizing the data to GAPDH and the real time PCR quantification methodology. To normalize the data between 2 genes, it is absolutely critical to have similar PCR efficiencies, which is difficult to achieve with the quality of autopsy material used in this study. Using Taqman probes to perform real time PCR assays might overcome this problem.
The issue of using appropriate clinical samples also needs to be addressed. Our disease controls were obtained from autopsied specimens of other neurological disorders.
Patients suffering from AD, HIV, Cancer etc. may die from a variety of different causes
(Appendix D). Our tissue bank consists of samples that were not standardized in terms of autopsy time. Further, for the purpose of our study, we did not take into consideration differences in copy numbers between patients’ brain tissue by matching for age and sex.
MS is disproportionately distributed with younger females affected whereas AD is more common among older people. Further, comparisons were made between different cohorts of MS patients.
GENERAL DISCUSSION AND CONCLUSIONS 215
Nevertheless, we have made a preliminary attempt to quantify Syncytin-1 DNA
copy numbers in clinical samples, which has not been undertaken before. It must be
acknowledged that syncytia formation in brain of MS patients is relatively unknown
except for a single report 435. So the relevance of Syncytin-1 as a fusion protein in MS
pathogenesis needs further investigation. It could be that Syncytin-1 does not reach the
cellular membrane when overexpressed, but rather is trapped in the ER where it manifests
its pathogenicity and thus no fusion is seen in brain of MS patients or perhaps it may be a temporal effect and there may no way of knowing it since our analyses are performed on autopsy tissue. No systematic studies have ever been carried out to understand if HERVs can be used as a biomarker. We now know that Syncytin-1 expression is increased in MS
brains. However, its expression is also increased relative to healthy control brains in other neuroinflammatory disorders, including HIV-dementia and Alzheimer’s disease, though
its expression was higher in MS.
VI.5. Syncytin-1 induces ER stress in astrocytes
Chapter#5 deals with the mechanism of Syncytin-1-induced neurodegeneration.
An observation that we made was that prolonged overexpression (up to 5 days) of
Syncytin-1 in astrocytes led to cell death. Though apoptosis/necrosis of astrocytes can be
mediated through several pathways, several studies indicate a strong link between
retroviral infections and the induction of ER stress proteins. The UPR is an evolutionarily
conserved response, triggered by accumulation of unfolded proteins in the ER. Viral
infections trigger the UPR and this could represent an ancient evolutionary adaptation
that links ER stress to apoptosis in order to avoid spread of viruses 453. It is possible that
the cell death observed among astrocytes expressing Syncytin-1 over a prolonged period
GENERAL DISCUSSION AND CONCLUSIONS 216 of time is an ER-linked process. Since recent reports suggest oligodendrocyte death in the absence of T cell infiltration and inflammation 159, the culprits may be activated astrocytes in the vicinity of oligodendrocytes 131.
Induction of the UPR permits cells to adapt to the changing microenvironment and establish normal ER function. The adaptive mechanism involves several processes that integrate into restoring cellular normalcy. Translation of new mRNAs is inhibited, thereby reducing the amount and number of proteins destined for the ER for folding and allowing UPR proteins to be synthesized. Transcription of genes that increase the protein folding capacity and ER-associated degradation (ERAD) for removal of misfolded proteins is enhanced. However, due to the nature of the protein that accumulates in the
ER and the overwhelming taxation on the cellular machinery, the adaptive mechanisms may fail, leading cells to initiate an alarm pathway involving NF-κB, a transcription factor involved in host defense response. However, prolonged and excessive ER stress triggers apoptosis, which perhaps is the phenomenon occurring in astrocytes herein.
VI.6. Syncytin-1 causes astrocyte dysfunction
We chose to focus on the dysfunction of astrocytes in our study, rather than apoptosis because frank apoptosis induced by Syncytin-1 was a highly contrived circumstance resulting from very efficient transduction of astrocytes. There are several studies that describe death of astrocytes in MS 389 454 455 456 and this may be reversed by
IFN-β treatment 455. However, this is not a well-established clinical pathology, perhaps because astrocytes are proliferating in MS 457. Astrocyte dysfunction resulting in reduced trophic support to oligodendrocytes may lead to oligodendrogliopathy observed in MS lesions 458. Rat pups injected with astrocytes demonstrated oligodendrocyte remyelination
GENERAL DISCUSSION AND CONCLUSIONS 217 in an ethidium bromide model of demyelination, perhaps by secreting platelet-derived growth factor (PDGF) 459. An astroglial response called isomorphic gliosis is associated with improved recovery from tissue damaging insults. Soluble trophic and growth factors produced by these astrocytes enhance the survival of adjacent neurons and glia as well as contribute to tissue remodeling 111. Oligodendrocyte precursors proliferate in response to
FGF-2 induced by CNTF-secreting astrocytes 108. Thus, astrocytes contribute substantially to oligodendrocyte viability and myelination, which has implication for design of therapeutics in MS.
VI.7. Syncytin-1 indirectly regulates its receptor expression
In Chapter #3, we brought to attention the enhanced expression of Syncytin-1 in
MS brains. During investigation of the consequence of Syncytin-1 overexpression in astrocytes, we discovered that expression of the receptor for Syncytin-1, a transporter molecule named ASCT1, was diminished. Since ASCT1 transports alanine, serine, cysteine and threonine, accumulation or withdrawal of these neutral amino acids in the astrocyte culture supernatant, might harm adjacent oligodendrocytes. The amount of L- serine and other neutral amino acids in the culture media can be determined by high performance liquid chromatography (HPLC) analysis and we intend to complete this experiment in due course. To investigate the mechanism of Syncytin-1-induced neuroinflammation and whether MS pathogenesis is enhanced by an ER stress response that has not subsided, we developed a transgenic mouse model of MS that expresses
Syncytin-1 in astrocytes under the GFAP promoter. Indeed, the Syncytin-1 transgenic mouse exhibited clinical features resembling MS. In fact, we also observed T cell infiltration into the corpus callosum of transgenic mice upon TNF-α implantation,
GENERAL DISCUSSION AND CONCLUSIONS 218
suggesting that the adaptive immune component of neuroinflammation is activated in this
model. The role of T cells in Syncytin-1-mediated neuropathogenesis can be investigated
in our novel Syncytin-1 transgenic mouse model of MS.
Based on the data obtained from analysis of CSF and plasma of MS patients,
wherein we detected Syncytin-1 by Western blotting, we wish to caution from deriving
conclusions from this observation, as this may not necessarily mean presence of soluble
and secreted Syncytin-1. Rather, we may have detected Syncytin-1 from lysed cells that
released host proteins into the CSF and plasma. Soluble and secreted Syncytin-1 may
interact with its putative receptors and may enter astrocytes via pinocytic mechanisms.
The implication of the recent identification of two mouse orthologues of
Syncytin-1 and Syncytin-2, named Syncytin-A and Syncytin-B 317 respectively is important to understand in the context of the Syncytin-1 transgenic mouse model of MS developed in this study. Experiments must be carried out to determine whether the transcript and protein levels of Syncytin-A are modulated in the Syncytin-1 transgenic mouse model in various treatment paradigms.
GENERAL DISCUSSION AND CONCLUSIONS 219
VI. 8. Conclusions and Future Perspectives
The goals of this project were to identify and characterize the function of a HERV glycoprotein encoded by the human genome and its relationship to neuropathogenesis.
The knowledge gained from these studies might be used to identify and evaluate novel targets for intervention of neuroinflammation in MS. Though our studies imply that MS is not caused by Syncytin-1 per se, the results indicate a strong relationship between induction of Syncytin-1 in astrocytes and diminished oligodendrocyte viability mediated by ER stress and free radical production. They also highlight the role of astrocytes in the pathogenesis of MS. Future research in this direction may help identify novel therapeutic compounds that modulate the behaviour of astrocytes during neuroinflammation.
APPENDICES 220
APPENDICES
221
APPENDIX A: SINrep5 VECTOR USED IN THIS THESIS
222
Appendix B: Quality and quantity of DNA extracted from brain tissue Patient ID Concentration (ng/μl) OD (26/280) 1 63.9 1.82 2 652.7 1.74 3 364.4 1.82 4 201.5 1.72 5 312.8 1.66 6 560.3 1.68 7 195.6 1.79 8 109.8 1.71 9 214.3 1.75 10 375.7 1.74 11 862.9 1.68 12 394.6 1.87 13 257.5 1.74 14 131.2 1.61 15 131.2 1.77 16 449.7 1.68 17 176.8 1.71 18 144.9 1.94 19 294.6 1.66 20 719.8 1.61 21 244.5 1.94 22 348.3 1.79 23 1656.2 1.89 24 774.4 1.79 25 625.6 1.76 26 820.8 1.9 27 1757.9 1.9 28 799.5 1.69 29 1016.6 1.7 30 469.7 1.77 31 222.5 1.71 32 312.4 1.59 33 502.8 1.7 34 749.7 1.61 35 278.8 1.76 36 306.9 1.73 37 1537.8 1.81 38 407.2 1.85 39 317.1 1.81 40 329 1.86
223
APPENDIX C: AFFYMETRIX GENECHIP EXPRESSION ARRAY 224
APPENDIX D: AUTOPSIED SAMPLES FROM PATIENTS
Patient ID Disease 1- LA MS 2- MF MS 3- EH MS 4- SH MS 5- MH MS 6- WC MS 7- JZ MS 8- MF MS 9-GD MS 10-RW MS 11-RS MS 12-JMK MS 13-JK MS 14-LG (F) MS 15- LA (F) MS 16-MJH MS 17-LJ MS 18-M230-98 MS 19-RS MS 20-SM MS 21-AD1 AD 22-AD2 AD 23-AD3-cerebellum AD 24-AD4 AD 25-AD5 AD 26-AD6 AD 27-A93-125 Control (cerebral arteriolosclerosis, multiple old cerebral infarcts) 28-A93-111 Control (Normal brain) 29-A93-120 Control (Normal brain, drug overdose) 30-A93-119 Control (cerebral arteriolosclerosis, minute foci of old cerebral infarcts) 31-A94-75 Control (Candida endocarditis with septic emboli) 32-A95-117 Control 33-A96-28 Control (Nocardiosis with meningitis and cerebral abscess) 34-A94-82 HIV (MGN encephalitis consistent with CMV) 35-A95-89 HIV (CMV optic neuritis, CMV encephalitis, HSV encephalitis) 36-A93-121 HIV (HIV encephalitis) 37-A94-66 HIV (acute aroxic/ischemic encephalopathy) 38-A95-91 HIV (florid CNS toxo with multiple necrotizing microabscesses) 39-A93-109 HIV (subacute encephalitis) 40-A95-121 HIV 41-A94-97 HIV (microglial nodules, microinfarcts; MNL) 225
APPENDIX E: Calculation of Syncytin-1 DNA copy number in the genome
Total size of human genome (haploid): 3x 109 bases Diploid genome: 6 x 109 bases
1000 bp = 9.1 x 1011 molecules = 1 μg DNA
Therefore, 1 molecule = 1/9.1 x 1011 = 10-12 μg DNA 1000 bp = 10-12 μg DNA 1 bp = 10-15 μg DNA
Therefore, 6 x 109 bases = 6 x 109 x 10-15 μg DNA = 6 pg DNA/cell
6 pg DNA= 30 copies of Syncytin-1 100 ng DNA = 5 x 105 copies of Syncytin-1 226
APPENDIX F: COPYRIGHTS OBTAINED FROM PUBLISHERS REFERENCES 227
REFERENCES
REFERENCES 228
1. Beck, C.A., Metz, L.M., Svenson, L.W. & Patten, S.B., Regional variation of multiple sclerosis prevalence in Canada, Mult Scler, 11, 516, 2005. 2. Steinman, L., Martin, R., Bernard, C., Conlon, P. & Oksenberg, J.R., Multiple sclerosis: deeper understanding of its pathogenesis reveals new targets for therapy, Annu Rev Neurosci, 25, 491, 2002. 3. Lucchinetti, C.F., Brueck, W., Rodriguez, M. & Lassmann, H., Multiple sclerosis: lessons from neuropathology, Semin Neurol, 18, 337, 1998. 4. Yong, V.W. et al., The promise of minocycline in neurology, Lancet Neurol, 3, 744, 2004. 5. Sospedra, M. & Martin, R., Immunology of multiple sclerosis, Annu Rev Immunol, 23, 683, 2005. 6. Carson, M.J., Microglia as liaisons between the immune and central nervous systems: functional implications for multiple sclerosis, Glia, 40, 218, 2002. 7. Villoslada, P., Barcellos, L.F. & Oksenberg, J.R., Chromosome 7q21-22 and multiple sclerosis, J Neuroimmunol, 150, 1, 2004. 8. Mirsattari, S.M. et al., Aboriginals with multiple sclerosis: HLA types and predominance of neuromyelitis optica, Neurology, 56, 317, 2001. 9. Prat, A. & Antel, J., Pathogenesis of multiple sclerosis, Curr Opin Neurol, 18, 225, 2005. 10. Kanki, P.J. et al., Human immunodeficiency virus type 1 subtypes differ in disease progression, J Infect Dis, 179, 68, 1999. 11. Frohman, E.M., Racke, M.K. & Raine, C.S., Multiple sclerosis--the plaque and its pathogenesis, N Engl J Med, 354, 942, 2006. 12. Grigoriadis, N. & Hadjigeorgiou, G.M., Virus-mediated autoimmunity in Multiple Sclerosis, J Autoimmune Dis, 3, 1, 2006. 13. Trapp, B.D., Bo, L., Mork, S. & Chang, A., Pathogenesis of tissue injury in MS lesions, J Neuroimmunol, 98, 49, 1999. 14. Bruck, W., Inflammatory demyelination is not central to the pathogenesis of multiple sclerosis, J Neurol, 252 Suppl 5, v10, 2005. 15. Merkler, D., Ernsting, T., Kerschensteiner, M., Bruck, W. & Stadelmann, C., A new focal EAE model of cortical demyelination: multiple sclerosis-like lesions with rapid resolution of inflammation and extensive remyelination, Brain, 2006. 16. Lassmann, H., Bruck, W. & Lucchinetti, C., Heterogeneity of multiple sclerosis pathogenesis: implications for diagnosis and therapy, Trends Mol Med, 7, 115, 2001. 17. Lucchinetti, C.F., Bruck, W. & Lassmann, H., Evidence for pathogenic heterogeneity in multiple sclerosis, Ann Neurol, 56, 308, 2004. 18. Cifelli, A. et al., Thalamic neurodegeneration in multiple sclerosis, Ann Neurol, 52, 650, 2002. 19. Giuliani, F., Goodyer, C.G., Antel, J.P. & Yong, V.W., Vulnerability of human neurons to T cell-mediated cytotoxicity, J Immunol, 171, 368, 2003. 20. Rao, S.M., Leo, G.J., Bernardin, L. & Unverzagt, F., Cognitive dysfunction in multiple sclerosis. I. Frequency, patterns, and prediction, Neurology, 41, 685, 1991.
REFERENCES 229
21. Ferguson, B., Matyszak, M.K., Esiri, M.M. & Perry, V.H., Axonal damage in acute multiple sclerosis lesions, Brain, 120 ( Pt 3), 393, 1997. 22. Gehrmann, J., Banati, R.B., Cuzner, M.L., Kreutzberg, G.W. & Newcombe, J., Amyloid precursor protein (APP) expression in multiple sclerosis lesions, Glia, 15, 141, 1995. 23. Trapp, B.D. et al., Axonal transection in the lesions of multiple sclerosis, N Engl J Med, 338, 278, 1998. 24. Snell, R.S. Clinical Neuroanatomy for Medical Students, 653 (Little, Brown and Company, Boston, MA, USA, 1992). 25. Williams, R.W. & Herrup, K., The control of neuron number, Annu Rev Neurosci, 11, 423, 1988. 26. Kaur, C., Hao, A.J., Wu, C.H. & Ling, E.A., Origin of microglia, Microsc Res Tech, 54, 2, 2001. 27. Neumann, H., Control of glial immune function by neurons, Glia, 36, 191, 2001. 28. Maehlen, J., Schroder, H.D., Klareskog, L., Olsson, T. & Kristensson, K., Axotomy induces MHC class I antigen expression on rat nerve cells, Neurosci Lett, 92, 8, 1988. 29. Neumann, H., Schmidt, H., Cavalie, A., Jenne, D. & Wekerle, H., Major histocompatibility complex (MHC) class I gene expression in single neurons of the central nervous system: differential regulation by interferon (IFN)-gamma and tumor necrosis factor (TNF)-alpha, J Exp Med, 185, 305, 1997. 30. Johnson, R.T. Viral infections of the nervous system, 265 (Lippincott-Raven Publishers, Philadelphia, 1998). 31. Lowenstein, P.R., Immunology of viral-vector-mediated gene transfer into the brain: an evolutionary and developmental perspective, Trends Immunol, 23, 23, 2002. 32. Steinman, L., Elaborate interactions between the immune and nervous systems, Nature Immunology, 5, 575, 2004. 33. Kosugi, I., Kawasaki, H., Arai, Y. & Tsutsui, Y., Innate immune responses to cytomegalovirus infection in the developing mouse brain and their evasion by virus-infected neurons, Am J Pathol, 161, 919, 2002. 34. Brocke, S., Piercy, C., Steinman, L., Weissman, I.L. & Veromaa, T., Antibodies to CD44 and integrin alpha4, but not L-selectin, prevent central nervous system inflammation and experimental encephalomyelitis by blocking secondary leukocyte recruitment, Proc Natl Acad Sci U S A, 96, 6896, 1999. 35. Griffin, D.E., Immune responses to RNA-virus infections of the CNS, Nat Rev Immunol, 3, 493, 2003. 36. Callahan, M.K. & Ransohoff, R.M., Analysis of leukocyte extravasation across the blood-brain barrier: conceptual and technical aspects, Curr Allergy Asthma Rep, 4, 65, 2004. 37. Ransohoff, R.M., Kivisakk, P. & Kidd, G., Three or more routes for leukocyte migration into the central nervous system, Nat Rev Immunol, 3, 569, 2003. 38. Kerfoot, S.M. & Kubes, P., Overlapping roles of P-selectin and alpha 4 integrin to recruit leukocytes to the central nervous system in experimental autoimmune encephalomyelitis, J Immunol, 169, 1000, 2002.
REFERENCES 230
39. Yednock, T.A. et al., Prevention of experimental autoimmune encephalomyelitis by antibodies against alpha 4 beta 1 integrin, Nature, 356, 63, 1992. 40. Ropper, A.H., Selective treatment of multiple sclerosis, N Engl J Med, 354, 965, 2006. 41. Langer-Gould, A., Atlas, S.W., Green, A.J., Bollen, A.W. & Pelletier, D., Progressive multifocal leukoencephalopathy in a patient treated with natalizumab, N Engl J Med, 353, 375, 2005. 42. Yousry, T.A. et al., Evaluation of patients treated with natalizumab for progressive multifocal leukoencephalopathy, N Engl J Med, 354, 924, 2006. 43. Chavarria, A. & Alcocer-Varela, J., Is damage in central nervous system due to inflammation?, Autoimmun Rev, 3, 251, 2004. 44. Tran, E.H., Hoekstra, K., van Rooijen, N., Dijkstra, C.D. & Owens, T., Immune invasion of the central nervous system parenchyma and experimental allergic encephalomyelitis, but not leukocyte extravasation from blood, are prevented in macrophage-depleted mice, J Immunol, 161, 3767, 1998. 45. Huseby, E.S. et al., A pathogenic role for myelin-specific CD8(+) T cells in a model for multiple sclerosis, J Exp Med, 194, 669, 2001. 46. Monson, N.L. et al., Receptor revision and atypical mutational characteristics in clonally expanded B cells from the cerebrospinal fluid of recently diagnosed multiple sclerosis patients, J Neuroimmunol, 158, 170, 2005. 47. Dines, K.C. & Powell, H.C., Mast cell interactions with the nervous system: relationship to mechanisms of disease, J Neuropathol Exp Neurol, 56, 627, 1997. 48. Orr, E.L. & Stanley, N.C., Brain and spinal cord levels of histamine in Lewis rats with acute experimental autoimmune encephalomyelitis, J Neurochem, 53, 111, 1989. 49. Secor, V.H., Secor, W.E., Gutekunst, C.A. & Brown, M.A., Mast cells are essential for early onset and severe disease in a murine model of multiple sclerosis, J Exp Med, 191, 813, 2000. 50. Rozniecki, J.J., Dimitriadou, V., Lambracht-Hall, M., Pang, X. & Theoharides, T.C., Morphological and functional demonstration of rat dura mater mast cell- neuron interactions in vitro and in vivo, Brain Res, 849, 1, 1999. 51. Tuomisto, L., Kilpelainen, H. & Riekkinen, P., Histamine and histamine-N- methyltransferase in the CSF of patients with multiple sclerosis, Agents Actions, 13, 255, 1983. 52. Zappulla, J.P., Arock, M., Mars, L.T. & Liblau, R.S., Mast cells: new targets for multiple sclerosis therapy?, J Neuroimmunol, 131, 5, 2002. 53. Mukaida, N., Interleukin-8: an expanding universe beyond neutrophil chemotaxis and activation, Int J Hematol, 72, 391, 2000. 54. Lucchinetti, C.F. et al., A role for humoral mechanisms in the pathogenesis of Devic's neuromyelitis optica, Brain, 125, 1450, 2002. 55. Lund, B.T. et al., Increased CXCL8 (IL-8) expression in Multiple Sclerosis, J Neuroimmunol, 155, 161, 2004. 56. Pashenkov, M., Teleshova, N. & Link, H., Inflammation in the central nervous system: the role for dendritic cells, Brain Pathol, 13, 23, 2003. 57. Tailor, P., Tamura, T. & Ozato, K., IRF family proteins and type I interferon induction in dendritic cells, Cell Res, 16, 134, 2006.
REFERENCES 231
58. Wakimoto, H., Johnson, P.R., Knipe, D.M. & Chiocca, E.A., Effects of innate immunity on herpes simplex virus and its ability to kill tumor cells, Gene Ther, 10, 983, 2003. 59. Serafini, B. et al., Dendritic cells in multiple sclerosis lesions: maturation stage, myelin uptake, and interaction with proliferating T cells, J Neuropathol Exp Neurol, 65, 124, 2006. 60. Dejaco, C., Duftner, C., Grubeck-Loebenstein, B. & Schirmer, M., Imbalance of regulatory T cells in human autoimmune diseases, Immunology, 117, 289, 2006. 61. Hong, J., Zang, Y.C., Nie, H. & Zhang, J.Z., CD4+ regulatory T cell responses induced by T cell vaccination in patients with multiple sclerosis, Proc Natl Acad Sci U S A, 103, 5024, 2006. 62. van der Vliet, H.J. et al., Circulating V(alpha24+) Vbeta11+ NKT cell numbers are decreased in a wide variety of diseases that are characterized by autoreactive tissue damage, Clin Immunol, 100, 144, 2001. 63. Marin-Padilla, M., Prenatal development of fibrous (white matter), protoplasmic (gray matter), and layer I astrocytes in the human cerebral cortex: a Golgi study, J Comp Neurol, 357, 554, 1995. 64. Volterra, A. & Meldolesi, J., Astrocytes, from brain glue to communication elements: the revolution continues, Nat Rev Neurosci, 6, 626, 2005. 65. Li, R. et al., Glial fibrillary acidic protein mutations in infantile, juvenile, and adult forms of Alexander disease, Ann Neurol, 57, 310, 2005. 66. Liedtke, W. et al., GFAP is necessary for the integrity of CNS white matter architecture and long-term maintenance of myelination, Neuron, 17, 607, 1996. 67. Bartlett, W.P., Knapp, P.E. & Skoff, R.P., Glial conditioned medium enables jimpy oligodendrocytes to express properties of normal oligodendrocytes: production of myelin antigens and membranes, Glia, 1, 253, 1988. 68. Gay, F.W., Early cellular events in multiple sclerosis. Intimations of an extrinsic myelinolytic antigen, Clin Neurol Neurosurg, 108, 234, 2006. 69. Matute, C., Domercq, M. & Sanchez-Gomez, M.V., Glutamate-mediated glial injury: mechanisms and clinical importance, Glia, 53, 212, 2006. 70. Ambrosini, E. et al., Astrocytes produce dendritic cell-attracting chemokines in vitro and in multiple sclerosis lesions, J Neuropathol Exp Neurol, 64, 706, 2005. 71. Seifert, G., Schilling, K. & Steinhauser, C., Astrocyte dysfunction in neurological disorders: a molecular perspective, Nat Rev Neurosci, 7, 194, 2006. 72. Bush, T.G. et al., Leukocyte infiltration, neuronal degeneration, and neurite outgrowth after ablation of scar-forming, reactive astrocytes in adult transgenic mice, Neuron, 23, 297, 1999. 73. Neufeld, A.H. & Liu, B., Glaucomatous optic neuropathy: when glia misbehave, Neuroscientist, 9, 485, 2003. 74. Sofroniew, M.V., Reactive astrocytes in neural repair and protection, Neuroscientist, 11, 400, 2005. 75. Miller, R.H., Regulation of oligodendrocyte development in the vertebrate CNS, Prog Neurobiol, 67, 451, 2002. 76. Cohen, R.I., Exploring oligodendrocyte guidance: 'to boldly go where no cell has gone before', Cell Mol Life Sci, 62, 505, 2005.
REFERENCES 232
77. Lappe-Siefke, C. et al., Disruption of Cnp1 uncouples oligodendroglial functions in axonal support and myelination, Nat Genet, 33, 366, 2003. 78. Chang, A., Nishiyama, A., Peterson, J., Prineas, J. & Trapp, B.D., NG2-positive oligodendrocyte progenitor cells in adult human brain and multiple sclerosis lesions, J Neurosci, 20, 6404, 2000. 79. Lledo, P.M., Alonso, M. & Grubb, M.S., Adult neurogenesis and functional plasticity in neuronal circuits, Nat Rev Neurosci, 7, 179, 2006. 80. Peters, A. & Palay, S.L., The morphology of synapses, J Neurocytol, 25, 687, 1996. 81. Hoek, R.M. et al., Down-regulation of the macrophage lineage through interaction with OX2 (CD200), Science, 290, 1768, 2000. 82. Nelson, P.T., Soma, L.A. & Lavi, E., Microglia in diseases of the central nervous system, Ann Med, 34, 491, 2002. 83. Gimsa, U., Peter, S.V., Lehmann, K., Bechmann, I. & Nitsch, R., Axonal damage induced by invading T cells in organotypic central nervous system tissue in vitro: involvement of microglial cells, Brain Pathol, 10, 365, 2000. 84. Hill, K.E., Zollinger, L.V., Watt, H.E., Carlson, N.G. & Rose, J.W., Inducible nitric oxide synthase in chronic active multiple sclerosis plaques: distribution, cellular expression and association with myelin damage, J Neuroimmunol, 151, 171, 2004. 85. Huitinga, I., van Rooijen, N., de Groot, C.J., Uitdehaag, B.M. & Dijkstra, C.D., Suppression of experimental allergic encephalomyelitis in Lewis rats after elimination of macrophages, J Exp Med, 172, 1025, 1990. 86. Scolding, N.J., Jones, J., Compston, D.A. & Morgan, B.P., Oligodendrocyte susceptibility to injury by T-cell perforin, Immunology, 70, 6, 1990. 87. Russell, J.H. & Ley, T.J., Lymphocyte-mediated cytotoxicity, Annu Rev Immunol, 20, 323, 2002. 88. Antel, J.P., Williams, K., Blain, M., McRea, E. & McLaurin, J., Oligodendrocyte lysis by CD4+ T cells independent of tumor necrosis factor, Ann Neurol, 35, 341, 1994. 89. Micu, I. et al., NMDA receptors mediate calcium accumulation in myelin during chemical ischaemia, Nature, 2005. 90. Sun, D. et al., Myelin antigen-specific CD8+ T cells are encephalitogenic and produce severe disease in C57BL/6 mice, J Immunol, 166, 7579, 2001. 91. Lassmann, H. & Ransohoff, R.M., The CD4-Th1 model for multiple sclerosis: a crucial re-appraisal, Trends Immunol, 25, 132, 2004. 92. de Rosbo, N.K. & Ben-Nun, A., T-cell responses to myelin antigens in multiple sclerosis; relevance of the predominant autoimmune reactivity to myelin oligodendrocyte glycoprotein, J Autoimmun, 11, 287, 1998. 93. Takahashi, J.L., Giuliani, F., Power, C., Imai, Y. & Yong, V.W., Interleukin- 1beta promotes oligodendrocyte death through glutamate excitotoxicity, Ann Neurol, 53, 588, 2003. 94. Casaccia-Bonnefil, P., Carter, B.D., Dobrowsky, R.T. & Chao, M.V., Death of oligodendrocytes mediated by the interaction of nerve growth factor with its receptor p75, Nature, 383, 716, 1996.
REFERENCES 233
95. Jurewicz, A., Matysiak, M., Andrzejak, S. & Selmaj, K., TRAIL-induced death of human adult oligodendrocytes is mediated by JNK pathway, Glia, 53, 158, 2006. 96. Matysiak, M., Jurewicz, A., Jaskolski, D. & Selmaj, K., TRAIL induces death of human oligodendrocytes isolated from adult brain, Brain, 125, 2469, 2002. 97. Venters, H.D., Dantzer, R. & Kelley, K.W., Tumor necrosis factor-alpha induces neuronal death by silencing survival signals generated by the type I insulin-like growth factor receptor, Ann N Y Acad Sci, 917, 210, 2000. 98. Pouly, S., Becher, B., Blain, M. & Antel, J.P., Interferon-gamma modulates human oligodendrocyte susceptibility to Fas-mediated apoptosis, J Neuropathol Exp Neurol, 59, 280, 2000. 99. Lassmann, H. & Ransohoff, R.M., The CD4-Th1 model for multiple sclerosis: a critical [correction of crucial] re-appraisal, Trends Immunol, 25, 132, 2004. 100. van Oosten, B.W. et al., Increased MRI activity and immune activation in two multiple sclerosis patients treated with the monoclonal anti-tumor necrosis factor antibody cA2, Neurology, 47, 1531, 1996. 101. Nguyen, M.D., Julien, J.P. & Rivest, S., Innate immunity: the missing link in neuroprotection and neurodegeneration?, Nat Rev Neurosci, 3, 216, 2002. 102. Ono, S.J. et al., Chemokines: roles in leukocyte development, trafficking, and effector function, J Allergy Clin Immunol, 111, 1185, 2003. 103. Gerard, C. & Rollins, B.J., Chemokines and disease, Nat Immunol, 2, 108, 2001. 104. Martino, G., How the brain repairs itself: new therapeutic strategies in inflammatory and degenerative CNS disorders, Lancet Neurol, 3, 372, 2004. 105. Pavelko, K.D. et al., Interleukin-6 protects anterior horn neurons from lethal virus-induced injury, J Neurosci, 23, 481, 2003. 106. Butzkueven, H. et al., LIF receptor signaling limits immune-mediated demyelination by enhancing oligodendrocyte survival, Nat Med, 8, 613, 2002. 107. Lee, J.W. & Juliano, R., Mitogenic signal transduction by integrin- and growth factor receptor-mediated pathways, Mol Cells, 17, 188, 2004. 108. Albrecht, P.J. et al., Astrocytes produce CNTF during the remyelination phase of viral-induced spinal cord demyelination to stimulate FGF-2 production, Neurobiol Dis, 13, 89, 2003. 109. Brenneman, D.E. & Gozes, I., A femtomolar-acting neuroprotective peptide, J Clin Invest, 97, 2299, 1996. 110. Gozes, I. et al., A novel signaling molecule for neuropeptide action: activity- dependent neuroprotective protein, Ann N Y Acad Sci, 897, 125, 1999. 111. Liberto, C.M., Albrecht, P.J., Herx, L.M., Yong, V.W. & Levison, S.W., Pro- regenerative properties of cytokine-activated astrocytes, J Neurochem, 89, 1092, 2004. 112. Picard-Riera, N. et al., Experimental autoimmune encephalomyelitis mobilizes neural progenitors from the subventricular zone to undergo oligodendrogenesis in adult mice, Proc Natl Acad Sci U S A, 99, 13211, 2002. 113. Nakanishi, H., Microglial functions and proteases, Mol Neurobiol, 27, 163, 2003. 114. Burster, T. et al., Cathepsin G, and not the asparagine-specific endoprotease, controls the processing of myelin basic protein in lysosomes from human B lymphocytes, J Immunol, 172, 5495, 2004.
REFERENCES 234
115. Pozio, E. & Morales, M.A., The impact of HIV-protease inhibitors on opportunistic parasites, Trends Parasitol, 21, 58, 2005. 116. Yong, V.W., Metalloproteinases: mediators of pathology and regeneration in the CNS, Nat Rev Neurosci, 6, 931, 2005. 117. Larsen, P.H., Wells, J.E., Stallcup, W.B., Opdenakker, G. & Yong, V.W., Matrix metalloproteinase-9 facilitates remyelination in part by processing the inhibitory NG2 proteoglycan, J Neurosci, 23, 11127, 2003. 118. Larsen, P.H. & Yong, V.W., The expression of matrix metalloproteinase-12 by oligodendrocytes regulates their maturation and morphological differentiation, J Neurosci, 24, 7597, 2004. 119. Vos, C.M. et al., Cytotoxicity by matrix metalloprotease-1 in organotypic spinal cord and dissociated neuronal cultures, Exp Neurol, 163, 324, 2000. 120. Johnston, J.B., Olson, M.E., Rud, E.W. & Power, C., Xenoinfection of nonhuman primates by feline immunodeficiency virus, Curr Biol, 11, 1109, 2001. 121. Zhang, K. et al., HIV-induced metalloproteinase processing of the chemokine stromal cell derived factor-1 causes neurodegeneration, Nat Neurosci, 6, 1064, 2003. 122. Giancotti, F.G. & Ruoslahti, E., Integrin signaling, Science, 285, 1028, 1999. 123. Scarisbrick, I.A. et al., Activity of a newly identified serine protease in CNS demyelination, Brain, 125, 1283, 2002. 124. Noorbakhsh, F. et al., Proteinase-activated receptor-2 induction by neuroinflammation prevents neuronal death during HIV infection, J Immunol, 174, 7320, 2005. 125. Noorbakhsh, F. et al., Proteinase-activated receptor 2 modulates neuroinflammation in experimental autoimmune encephalomyelitis and multiple sclerosis, J Exp Med, 203, 425, 2006. 126. Vollgraf, U., Wegner, M. & Richter-Landsberg, C., Activation of AP-1 and nuclear factor-kappaB transcription factors is involved in hydrogen peroxide- induced apoptotic cell death of oligodendrocytes, J Neurochem, 73, 2501, 1999. 127. Keller, J.N. et al., Impairment of glucose and glutamate transport and induction of mitochondrial oxidative stress and dysfunction in synaptosomes by amyloid beta- peptide: role of the lipid peroxidation product 4-hydroxynonenal, J Neurochem, 69, 273, 1997. 128. Chiou, C.C. et al., Urinary 8-hydroxydeoxyguanosine and its analogs as DNA marker of oxidative stress: development of an ELISA and measurement in both bladder and prostate cancers, Clin Chim Acta, 334, 87, 2003. 129. Drake, J., Sultana, R., Aksenova, M., Calabrese, V. & Butterfield, D.A., Elevation of mitochondrial glutathione by gamma-glutamylcysteine ethyl ester protects mitochondria against peroxynitrite-induced oxidative stress, J Neurosci Res, 74, 917, 2003. 130. Barnham, K.J., Masters, C.L. & Bush, A.I., Neurodegenerative diseases and oxidative stress, Nat Rev Drug Discov, 3, 205, 2004. 131. Mattson, M.P. & Taub, D.D., Ancient viral protein enrages astrocytes in multiple sclerosis, Nat Neurosci, 7, 1021, 2004.
REFERENCES 235
132. Merrill, J.E., Ignarro, L.J., Sherman, M.P., Melinek, J. & Lane, T.E., Microglial cell cytotoxicity of oligodendrocytes is mediated through nitric oxide, J Immunol, 151, 2132, 1993. 133. Ulvestad, E. et al., Fc receptors for IgG on cultured human microglia mediate cytotoxicity and phagocytosis of antibody-coated targets, J Neuropathol Exp Neurol, 53, 27, 1994. 134. Mackenzie-Graham, A.J., Mitrovic, B., Smoll, A. & Merrill, J.E., Differential sensitivity to nitric oxide in immortalized, cloned murine oligodendrocyte cell lines, Dev Neurosci, 16, 162, 1994. 135. Alderton, W.K., Cooper, C.E. & Knowles, R.G., Nitric oxide synthases: structure, function and inhibition, Biochem J, 357, 593, 2001. 136. Aktan, F., iNOS-mediated nitric oxide production and its regulation, Life Sci, 75, 639, 2004. 137. Nelson, E.J., Connolly, J. & McArthur, P., Nitric oxide and S-nitrosylation: excitotoxic and cell signaling mechanism, Biol Cell, 95, 3, 2003. 138. Bo, L. et al., Induction of nitric oxide synthase in demyelinating regions of multiple sclerosis brains, Ann Neurol, 36, 778, 1994. 139. Bredt, D.S., Endogenous nitric oxide synthesis: biological functions and pathophysiology, Free Radic Res, 31, 577, 1999. 140. Broholm, H. et al., Nitric oxide synthase expression and enzymatic activity in multiple sclerosis, Acta Neurol Scand, 109, 261, 2004. 141. Cha, C.I. et al., Reactive astrocytes express nitric oxide synthase in the spinal cord of transgenic mice expressing a human Cu/Zn SOD mutation, Neuroreport, 9, 1503, 1998. 142. Catania, M.V., Aronica, E., Yankaya, B. & Troost, D., Increased expression of neuronal nitric oxide synthase spliced variants in reactive astrocytes of amyotrophic lateral sclerosis human spinal cord, J Neurosci, 21, RC148, 2001. 143. Tieu, K., Ischiropoulos, H. & Przedborski, S., Nitric oxide and reactive oxygen species in Parkinson's disease, IUBMB Life, 55, 329, 2003. 144. Lipton, S.A. et al., Cysteine regulation of protein function--as exemplified by NMDA-receptor modulation, Trends Neurosci, 25, 474, 2002. 145. Gow, A.J., Farkouh, C.R., Munson, D.A., Posencheg, M.A. & Ischiropoulos, H., Biological significance of nitric oxide-mediated protein modifications, Am J Physiol Lung Cell Mol Physiol, 287, L262, 2004. 146. Bizzozero, O.A., DeJesus, G., Bixler, H.A. & Pastuszyn, A., Evidence of nitrosative damage in the brain white matter of patients with multiple sclerosis, Neurochem Res, 30, 139, 2005. 147. Eiserich, J.P. et al., Microtubule dysfunction by posttranslational nitrotyrosination of alpha-tubulin: a nitric oxide-dependent mechanism of cellular injury, Proc Natl Acad Sci U S A, 96, 6365, 1999. 148. Mihm, M.J. et al., Free 3-nitrotyrosine causes striatal neurodegeneration in vivo, J Neurosci, 21, RC149, 2001. 149. Credle, J.J., Finer-Moore, J.S., Papa, F.R., Stroud, R.M. & Walter, P., On the mechanism of sensing unfolded protein in the endoplasmic reticulum, Proc Natl Acad Sci U S A, 102, 18773, 2005.
REFERENCES 236
150. Lin, W. et al., Interferon-{gamma} inhibits central nervous system remyelination through a process modulated by endoplasmic reticulum stress, Brain, 2006. 151. Rao, R.V., Ellerby, H.M. & Bredesen, D.E., Coupling endoplasmic reticulum stress to the cell death program, Cell Death Differ, 11, 372, 2004. 152. Liu, N. et al., ATM deficiency induces oxidative stress and endoplasmic reticulum stress in astrocytes, Lab Invest, 85, 1471, 2005. 153. Oyadomari, S. & Mori, M., Roles of CHOP/GADD153 in endoplasmic reticulum stress, Cell Death Differ, 11, 381, 2004. 154. Dimcheff, D.E., Faasse, M.A., McAtee, F.J. & Portis, J.L., Endoplasmic reticulum (ER) stress induced by a neurovirulent mouse retrovirus is associated with prolonged BiP binding and retention of a viral protein in the ER, J Biol Chem, 279, 33782, 2004. 155. Kaufman, R.J., Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls, Genes Dev, 13, 1211, 1999. 156. Rivers TM, S.F., Encephalomyelitis accompanied by myelin destruction experimentally produced in monkeys, journal of experimental medicine, 61, 689, 1935. 157. Sriram, S. & Steiner, I., Experimental allergic encephalomyelitis: a misleading model of multiple sclerosis, Ann Neurol, 58, 939, 2005. 158. Genain, C.P. et al., Late complications of immune deviation therapy in a nonhuman primate, Science, 274, 2054, 1996. 159. Barnett, M.H. & Prineas, J.W., Relapsing and remitting multiple sclerosis: pathology of the newly forming lesion, Ann Neurol, 55, 458, 2004. 160. Pluchino, S. & Martino, G., The therapeutic use of stem cells for myelin repair in autoimmune demyelinating disorders, J Neurol Sci, 233, 117, 2005. 161. Trebst, C. & Stangel, M., Promotion of remyelination by immunoglobulins: implications for the treatment of multiple sclerosis, Curr Pharm Des, 12, 241, 2006. 162. Olson, J.K. & Miller, S.D., Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs, J Immunol, 173, 3916, 2004. 163. Noseworthy, J.H., Progress in determining the causes and treatment of multiple sclerosis, Nature, 399, A40, 1999. 164. Haines, J.L. et al., Multiple susceptibility loci for multiple sclerosis, Hum Mol Genet, 11, 2251, 2002. 165. Lincoln, M.R. et al., A predominant role for the HLA class II region in the association of the MHC region with multiple sclerosis, Nat Genet, 37, 1108, 2005. 166. Kenealy, S.J. et al., Examination of seven candidate regions for multiple sclerosis: strong evidence of linkage to chromosome 1q44, Genes Immun, 7, 73, 2006. 167. Vandenbroeck, K. et al., Chromosome 7q21-22 and multiple sclerosis: evidence for a genetic susceptibility effect in vicinity to the protachykinin-1 gene, J Neuroimmunol, 125, 141, 2002. 168. Palma, C. et al., Functional characterization of substance P receptors on cultured human spinal cord astrocytes: synergism of substance P with cytokines in inducing interleukin-6 and prostaglandin E2 production, Glia, 21, 183, 1997.
REFERENCES 237
169. Lieb, K., Fiebich, B.L., Berger, M., Bauer, J. & Schulze-Osthoff, K., The neuropeptide substance P activates transcription factor NF-kappa B and kappa B- dependent gene expression in human astrocytoma cells, J Immunol, 159, 4952, 1997. 170. Fiebich, B.L., Schleicher, S., Butcher, R.D., Craig, A. & Lieb, K., The neuropeptide substance P activates p38 mitogen-activated protein kinase resulting in IL-6 expression independently from NF-kappa B, J Immunol, 165, 5606, 2000. 171. van Boxel-Dezaire, A.H. et al., Decreased interleukin-10 and increased interleukin-12p40 mRNA are associated with disease activity and characterize different disease stages in multiple sclerosis, Ann Neurol, 45, 695, 1999. 172. M Mayne, J.J. Latent and activated brain flore: human herpes virus, endogenous retroviruses,coronaviruses and Chlamydia and their role in neurological disease. in Emerging Neurological Infections (ed. Johnson, C.P.a.R.T.) 363 (Taylor and Francis, 2005). 173. Buljevac, D. et al., Prospective study on the relationship between infections and multiple sclerosis exacerbations, Brain, 125, 952, 2002. 174. Wucherpfennig, K.W. & Strominger, J.L., Molecular mimicry in T cell-mediated autoimmunity: viral peptides activate human T cell clones specific for myelin basic protein, Cell, 80, 695, 1995. 175. Tsunoda, I. & Fujinami, R.S., Two models for multiple sclerosis: experimental allergic encephalomyelitis and Theiler's murine encephalomyelitis virus, J Neuropathol Exp Neurol, 55, 673, 1996. 176. Olson, J.K., Croxford, J.L., Calenoff, M.A., Dal Canto, M.C. & Miller, S.D., A virus-induced molecular mimicry model of multiple sclerosis, J Clin Invest, 108, 311, 2001. 177. Dal Canto, M.C., Calenoff, M.A., Miller, S.D. & Vanderlugt, C.L., Lymphocytes from mice chronically infected with Theiler's murine encephalomyelitis virus produce demyelination of organotypic cultures after stimulation with the major encephalitogenic epitope of myelin proteolipid protein. Epitope spreading in TMEV infection has functional activity, J Neuroimmunol, 104, 79, 2000. 178. Horwitz, M.S. & Sarvetnick, N., Viruses, host responses, and autoimmunity, Immunol Rev, 169, 241, 1999. 179. Hemmer, B., Archelos, J.J. & Hartung, H.P., New concepts in the immunopathogenesis of multiple sclerosis, Nat Rev Neurosci, 3, 291, 2002. 180. Azoulay-Cayla, A., [Is multiple sclerosis a disease of viral origin?], Pathol Biol (Paris), 48, 4, 2000. 181. Rice, G.P., Armstrong, H.A., Bulman, D.E., Paty, D.W. & Ebers, G.C., Absence of antibody to HTLV I and III in sera of Canadian patients with multiple sclerosis and chronic myelopathy, Ann Neurol, 20, 533, 1986. 182. Christensen, T., Moller-Larsen, A. & Haahr, S., A retroviral implication in multiple sclerosis?, Trends Microbiol, 2, 332, 1994. 183. Perron, H. et al., Leptomeningeal cell line from multiple sclerosis with reverse transcriptase activity and viral particles, Res Virol, 140, 551, 1989. 184. Garson, J.A., Tuke, P.W., Giraud, P., Paranhos-Baccala, G. & Perron, H., Detection of virion-associated MSRV-RNA in serum of patients with multiple sclerosis, Lancet, 351, 33., 1998.
REFERENCES 238
185. Perron, H. et al., Molecular identification of a novel retrovirus repeatedly isolated from patients with multiple sclerosis. The Collaborative Research Group on Multiple Sclerosis, Proc Natl Acad Sci U S A, 94, 7583, 1997. 186. Blond, J.L. et al., Molecular characterization and placental expression of HERV- W, a new human endogenous retrovirus family, J Virol, 73, 1175, 1999. 187. Komurian-Pradel, F. et al., Molecular cloning and characterization of MSRV- related sequences associated with retrovirus-like particles, Virology, 260, 1, 1999. 188. Firouzi, R. et al., Multiple sclerosis-associated retrovirus particles cause T lymphocyte- dependent death with brain hemorrhage in humanized SCID mice model, J Neurovirol, 9, 79, 2003. 189. Perron, H. et al., Multiple sclerosis retrovirus particles and recombinant envelope trigger an abnormal immune response in vitro, by inducing polyclonal Vbeta16 T- lymphocyte activation, Virology, 287, 321, 2001. 190. Christensen, T., Pedersen, L., Sorensen, P.D. & Moller-Larsen, A., A transmissible human endogenous retrovirus, AIDS Res Hum Retroviruses, 18, 861, 2002. 191. Christensen, T. et al., Molecular characterization of HERV-H variants associated with multiple sclerosis, Acta Neurol Scand, 101, 229, 2000. 192. Menard, A. et al., Detection of a gliotoxic activity in the cerebrospinal fluid from multiple sclerosis patients, Neurosci Lett, 245, 49, 1998. 193. Power, C., Retroviral diseases of the nervous system: pathogenic host response or viral gene-mediated neurovirulence?, Trends Neurosci, 24, 162, 2001. 194. Perron, H., Perin, J.P., Rieger, F. & Alliel, P.M., Particle-associated retroviral RNA and tandem RGH/HERV-W copies on human chromosome 7q: possible components of a 'chain-reaction' triggered by infectious agents in multiple sclerosis?, J Neurovirol, 6 Suppl 2, S67, 2000. 195. Kolson, D.L. & Gonzalez-Scarano, F., Endogenous retroviruses and multiple sclerosis, Ann Neurol, 50, 429, 2001. 196. Antony, J.M. et al., Human endogenous retrovirus glycoprotein-mediated induction of redox reactants causes oligodendrocyte death and demyelination, Nat Neurosci, 7, 1088, 2004. 197. Ruprecht, K. et al., Regulation of human endogenous retrovirus W protein expression by herpes simplex virus type 1: Implications for multiple sclerosis, J Neurovirol, 12, 65, 2006. 198. Johnston, J.B. et al., Monocyte activation and differentiation augment human endogenous retrovirus expression: implications for inflammatory brain diseases, Ann Neurol, 50, 434, 2001. 199. Schwartz, M. & Kipnis, J., Protective autoimmunity: regulation and prospects for vaccination after brain and spinal cord injuries, Trends Mol Med, 7, 252, 2001. 200. Domingo, E. Microbial Evolution and emerging diseases. in Emerging Neurological Infections (ed. RT, C.P.a.J.) (Taylor and Francis, 2005). 201. Coffin, J.M. Retroviridae: The viruses and their replication. in Fields Virology, Vol. 2 (ed. Fields BN, K.D., Howley PM, Chanock RM, Melnick JL, Monath TP, Roizman B and Straus SE) 1767 (Lippincott-Raven, Philadelphia, New York, 1996).
REFERENCES 239
202. Miller, A.D., Cell-surface receptors for retroviruses and implications for gene transfer, Proc Natl Acad Sci U S A, 93, 11407, 1996. 203. Goff, S.P., Integration of retroviral DNA into the genome of the infected cell, Cancer Cells, 2, 172, 1990. 204. van Regenmortel MHV, F., CM, Bishop DHL, Carsten EB, Estes MK, Lemon SM, Maniloff J, Mayo MA, McGeoch DH, Pringle CR and Wickner RB. Virus Taxonomy, (Academic Press, San Diego, 2000). 205. Larsson, E., Kato, N. & Cohen, M., Human endogenous proviruses, Curr Top Microbiol Immunol, 148, 115, 1989. 206. Andersson, M.L. et al., Diversity of human endogenous retrovirus class II-like sequences, J Gen Virol, 80 ( Pt 1), 255, 1999. 207. Medstrand, P. & Blomberg, J., Characterization of novel reverse transcriptase encoding human endogenous retroviral sequences similar to type A and type B retroviruses: differential transcription in normal human tissues, J Virol, 67, 6778, 1993. 208. Van Maele, B., Busschots, K., Vandekerckhove, L., Christ, F. & Debyser, Z., Cellular co-factors of HIV-1 integration, Trends Biochem Sci, 31, 98, 2006. 209. D'Souza, V. & Summers, M.F., How retroviruses select their genomes, Nat Rev Microbiol, 3, 643, 2005. 210. Jacobson, S., Immunopathogenesis of human T cell lymphotropic virus type I- associated neurologic disease, J Infect Dis, 186 Suppl 2, S187, 2002. 211. Jones, G. et al., Peripheral nerve-derived HIV-1 is predominantly CCR5- dependent and causes neuronal degeneration and neuroinflammation, Virology, 334, 178, 2005. 212. Zehender, G. et al., Increased risk of developing peripheral neuropathy in patients coinfected with HIV-1 and HTLV-2, J Acquir Immune Defic Syndr, 31, 440, 2002. 213. Barmak, K., Harhaj, E.W. & Wigdahl, B., Mediators of central nervous system damage during the progression of human T-cell leukemia type I-associated myelopathy/tropical spastic paraparesis, J Neurovirol, 9, 522, 2003. 214. Gonzalez-Scarano, F. & Martin-Garcia, J., The neuropathogenesis of AIDS, Nat Rev Immunol, 5, 69, 2005. 215. Zhou, N. et al., The N-terminal domain of APJ, a CNS-based coreceptor for HIV- 1, is essential for its receptor function and coreceptor activity, Virology, 317, 84, 2003. 216. Patrick, M.K., Johnston, J.B. & Power, C., Lentiviral neuropathogenesis: comparative neuroinvasion, neurotropism, neurovirulence, and host neurosusceptibility, J Virol, 76, 7923, 2002. 217. Wang, C. et al., Cytokine and chemokine gene polymorphisms among ethnically diverse North Americans with HIV-1 infection, J Acquir Immune Defic Syndr, 35, 446, 2004. 218. Knight, J.C., Regulatory polymorphisms underlying complex disease traits, J Mol Med, 83, 97, 2005. 219. Torre, D., Pugliese, A. & Speranza, F., Role of nitric oxide in HIV-1 infection: friend or foe?, Lancet Infect Dis, 2, 273, 2002.
REFERENCES 240
220. Carreras, M.C., Franco, M.C., Peralta, J.G. & Poderoso, J.J., Nitric oxide, complex I, and the modulation of mitochondrial reactive species in biology and disease, Mol Aspects Med, 25, 125, 2004. 221. Akarid, K., Sinet, M., Desforges, B. & Gougerot-Pocidalo, M.A., Inhibitory effect of nitric oxide on the replication of a murine retrovirus in vitro and in vivo, J Virol, 69, 7001, 1995. 222. Colasanti, M. & Persichini, T., Nitric oxide: an inhibitor of NF-kappaB/Rel system in glial cells, Brain Res Bull, 52, 155, 2000. 223. Jinno-Oue, A. et al., Expression of inducible nitric oxide synthase and elevation of tyrosine nitration of a 32-kilodalton cellular protein in brain capillary endothelial cells from rats infected with a neuropathogenic murine leukemia virus, J Virol, 77, 5145, 2003. 224. He, B., Viruses, endoplasmic reticulum stress, and interferon responses, Cell Death Differ, 2006. 225. Tardif, K.D., Mori, K., Kaufman, R.J. & Siddiqui, A., Hepatitis C virus suppresses the IRE1-XBP1 pathway of the unfolded protein response, J Biol Chem, 279, 17158, 2004. 226. Kim, H.T. et al., Activation of endoplasmic reticulum stress signaling pathway is associated with neuronal degeneration in MoMuLV-ts1-induced spongiform encephalomyelopathy, Lab Invest, 84, 816, 2004. 227. Liu, N. et al., Interaction between endoplasmic reticulum stress and caspase 8 activation in retrovirus MoMuLV-ts1-infected astrocytes, Virology, 348, 398, 2006. 228. Kawahara, K. et al., Induction of CHOP and apoptosis by nitric oxide in p53- deficient microglial cells, FEBS Lett, 506, 135, 2001. 229. Noorbakhsh, F. et al., Lentivirus envelope protein exerts differential neuropathogenic effects depending on the site of expression and target cell, Virology, 2006. 230. Zhang, K. et al., Endoplasmic reticulum stress activates cleavage of CREBH to induce a systemic inflammatory response, Cell, 124, 587, 2006. 231. Omori, Y. et al., CREB-H: a novel mammalian transcription factor belonging to the CREB/ATF family and functioning via the box-B element with a liver- specific expression, Nucleic Acids Res, 29, 2154, 2001. 232. Boylan, M.T. et al., Interferon-beta1a administration results in a transient increase of serum amyloid A protein and C-reactive protein: comparison with other markers of inflammation, Immunol Lett, 75, 191, 2001. 233. Crowell, R.E., Du Clos, T.W., Montoya, G., Heaphy, E. & Mold, C., C-reactive protein receptors on the human monocytic cell line U-937. Evidence for additional binding to Fc gamma RI, J Immunol, 147, 3445, 1991. 234. Kim, J.K., Scott, E.A. & Elbert, D.L., Proteomic analysis of protein adsorption: serum amyloid P adsorbs to materials and promotes leukocyte adhesion, J Biomed Mater Res A, 75, 199, 2005. 235. Dimcheff, D.E., Askovic, S., Baker, A.H., Johnson-Fowler, C. & Portis, J.L., Endoplasmic reticulum stress is a determinant of retrovirus-induced spongiform neurodegeneration, J Virol, 77, 12617, 2003.
REFERENCES 241
236. Sei, Y. et al., The encephalopathy associated with murine acquired immunodeficiency syndrome, Ann N Y Acad Sci, 840, 822, 1998. 237. Simonian, N.A. et al., Specific infection of central nervous system white matter by a variant of gross murine leukemia virus, Virology, 177, 384, 1990. 238. Gardner, M., Dandekar, S. & Cardiff, R., Molecular mechanism of an ecotropic MuLV restriction gene Akvr-1/FV-4 in California wild mice, Curr Top Microbiol Immunol, 127, 338, 1986. 239. Liu, N. et al., Possible involvement of both endoplasmic reticulum- and mitochondria-dependent pathways in MoMuLV-ts1-induced apoptosis in astrocytes, J Neurovirol, 10, 189, 2004. 240. Qiang, W. et al., Activation of transcription factor Nrf-2 and its downstream targets in response to moloney murine leukemia virus ts1-induced thiol depletion and oxidative stress in astrocytes, J Virol, 78, 11926, 2004. 241. Khan, R.B., Bertorini, T.E. & Levin, M.C., HTLV-1 and its neurological complications, Neurologist, 7, 271, 2001. 242. Manel, N. et al., The ubiquitous glucose transporter GLUT-1 is a receptor for HTLV, Cell, 115, 449, 2003. 243. Manel, N., Battini, J.L., Taylor, N. & Sitbon, M., HTLV-1 tropism and envelope receptor, Oncogene, 24, 6016, 2005. 244. Dustin, M., Viral spread through protoplasmic kiss, Nat Cell Biol, 5, 271, 2003. 245. Levin, M.C., Rosenblum, M.K., Fox, C.H. & Jacobson, S., Localization of retrovirus in the central nervous system of a patient co-infected with HTLV-1 and HIV with HAM/TSP and HIV-associated dementia, J Neurovirol, 7, 61, 2001. 246. Feuer, G. & Green, P.L., Comparative biology of human T-cell lymphotropic virus type 1 (HTLV-1) and HTLV-2, Oncogene, 24, 5996, 2005. 247. Xiao, G. & Sun, S.C., Activation of IKKalpha and IKKbeta through their fusion with HTLV-I tax protein, Oncogene, 19, 5198, 2000. 248. Benveniste, E.N. & Merrill, J.E., Stimulation of oligodendroglial proliferation and maturation by interleukin-2, Nature, 321, 610, 1986. 249. Araujo, A. & Hall, W.W., Human T-lymphotropic virus type II and neurological disease, Ann Neurol, 56, 10, 2004. 250. Umehara, F. et al., Cytokine expression in the spinal cord lesions in HTLV-I- associated myelopathy, J Neuropathol Exp Neurol, 53, 72, 1994. 251. Casseb, J. & Penalva-de-Oliveira, A.C., The pathogenesis of tropical spastic paraparesis/human T-cell leukemia type I-associated myelopathy, Braz J Med Biol Res, 33, 1395, 2000. 252. Langlois, M. et al., Activation of HTLV-I gene transcription by protein tyrosine phosphatase inhibitors, Virology, 329, 395, 2004. 253. Levin, M.C. et al., Autoimmunity due to molecular mimicry as a cause of neurological disease, Nat Med, 8, 509, 2002. 254. McArthur, J.C., Brew, B.J. & Nath, A., Neurological complications of HIV infection, Lancet Neurol, 4, 543, 2005. 255. Lewin, R., Promising animal model for MS, Science, 221, 1364, 1983. 256. Stowring, L. et al., Detection of visna virus antigens and RNA in glial cells in foci of demyelination, Virology, 141, 311, 1985.
REFERENCES 242
257. Chebloune, Y. et al., Neuroinvasion by ovine lentivirus in infected sheep mediated by inflammatory cells associated with experimental allergic encephalomyelitis, J Neurovirol, 4, 38, 1998. 258. Barber, S.A. et al., Visna virus-induced activation of MAPK is required for virus replication and correlates with virus-induced neuropathology, J Virol, 76, 817, 2002. 259. Zaitseva, M., Peden, K. & Golding, H., HIV coreceptors: role of structure, posttranslational modifications, and internalization in viral-cell fusion and as targets for entry inhibitors, Biochim Biophys Acta, 1614, 51, 2003. 260. Shimojima, M. et al., Use of CD134 as a primary receptor by the feline immunodeficiency virus, Science, 303, 1192, 2004. 261. Marx, P.A. & Chen, Z., The function of simian chemokine receptors in the replication of SIV, Semin Immunol, 10, 215, 1998. 262. van Marle, G. & Power, C., Human immunodeficiency virus type 1 genetic diversity in the nervous system: evolutionary epiphenomenon or disease determinant?, J Neurovirol, 11, 107, 2005. 263. Kaul, M., Garden, G.A. & Lipton, S.A., Pathways to neuronal injury and apoptosis in HIV-associated dementia, Nature, 410, 988, 2001. 264. Hollander, H. & Stringari, S., Human immunodeficiency virus-associated meningitis. Clinical course and correlations, Am J Med, 83, 813, 1987. 265. Jones, G. & Power, C., Regulation of neural cell survival by HIV-1 infection, Neurobiol Dis, 21, 1, 2006. 266. Anneken, K., Fischera, M., Evers, S., Kloska, S. & Husstedt, I.W., Recurrent vacuolar myelopathy in HIV infection, J Infect, 2005. 267. Xin, K.Q. et al., Evidence of HIV type 1 glycoprotein 120 binding to recombinant N-methyl-D-aspartate receptor subunits expressed in a baculovirus system, AIDS Res Hum Retroviruses, 15, 1461, 1999. 268. Piller, S.C., Ewart, G.D., Jans, D.A., Gage, P.W. & Cox, G.B., The amino- terminal region of Vpr from human immunodeficiency virus type 1 forms ion channels and kills neurons, J Virol, 73, 4230, 1999. 269. Tomonaga, K., Virus-induced neurobehavioral disorders: mechanisms and implications, Trends Mol Med, 10, 71, 2004. 270. Giulian, D., Vaca, K. & Noonan, C.A., Secretion of neurotoxins by mononuclear phagocytes infected with HIV-1, Science, 250, 1593, 1990. 271. Petito, C.K. & Roberts, B., Evidence of apoptotic cell death in HIV encephalitis, Am J Pathol, 146, 1121, 1995. 272. Garden, G.A., Microglia in human immunodeficiency virus-associated neurodegeneration, Glia, 40, 240, 2002. 273. Corasaniti, M.T. et al., Exploitation of the HIV-1 coat glycoprotein, gp120, in neurodegenerative studies in vivo, J Neurochem, 79, 1, 2001. 274. Fine, S.M. et al., Tumor necrosis factor alpha inhibits glutamate uptake by primary human astrocytes. Implications for pathogenesis of HIV-1 dementia, J Biol Chem, 271, 15303, 1996. 275. Yoshioka, M. et al., Role of immune activation and cytokine expression in HIV-1- associated neurologic diseases, Adv Neuroimmunol, 5, 335, 1995.
REFERENCES 243
276. Villet, S. et al., Maedi-visna virus and caprine arthritis encephalitis virus genomes encode a Vpr-like but no Tat protein, J Virol, 77, 9632, 2003. 277. Hovden, A.O. & Sommerfelt, M.A., The influence of CD4 and CXCR4 on maedi- visna virus-induced syncytium formation, Apmis, 110, 697, 2002. 278. Duval, R., Bellet, V., Delebassee, S. & Bosgiraud, C., Implication of caspases during maedi-visna virus-induced apoptosis, J Gen Virol, 83, 3153, 2002. 279. Podell, M. et al., AIDS-associated encephalopathy with experimental feline immunodeficiency virus infection, J Acquir Immune Defic Syndr, 6, 758, 1993. 280. Podell, M., Hayes, K., Oglesbee, M. & Mathes, L., Progressive encephalopathy associated with CD4/CD8 inversion in adult FIV-infected cats, J Acquir Immune Defic Syndr Hum Retrovirol, 15, 332, 1997. 281. Power, C. et al., Neurovirulence in feline immunodeficiency virus-infected neonatal cats is viral strain specific and dependent on systemic immune suppression, J Virol, 72, 9109, 1998. 282. van Marle, G., Antony, J.M., Silva, C., Sullivan, A. & Power, C., Aberrant cortical neurogenesis in a pediatric neuroAIDS model: neurotrophic effects of growth hormone, Aids, 19, 1781, 2005. 283. Dow, S.W., Poss, M.L. & Hoover, E.A., Feline immunodeficiency virus: a neurotropic lentivirus, J Acquir Immune Defic Syndr, 3, 658, 1990. 284. Dean, G.A., Reubel, G.H., Moore, P.F. & Pedersen, N.C., Proviral burden and infection kinetics of feline immunodeficiency virus in lymphocyte subsets of blood and lymph node, J Virol, 70, 5165, 1996. 285. Kennedy, J.M. et al., Peripheral neuropathy in lentivirus infection: evidence of inflammation and axonal injury, Aids, 18, 1241, 2004. 286. Little, P.F., Structure and function of the human genome, Genome Res, 15, 1759, 2005. 287. Costas, J., Characterization of the intragenomic spread of the human endogenous retrovirus family HERV-W, Mol Biol Evol, 19, 526, 2002. 288. Urnovitz, H.B. & Murphy, W.H., Human endogenous retroviruses: nature, occurrence, and clinical implications in human disease, Clin Microbiol Rev, 9, 72, 1996. 289. Ono, M., Kawakami, M. & Takezawa, T., A novel human nonviral retroposon derived from an endogenous retrovirus, Nucleic Acids Res, 15, 8725, 1987. 290. Harada, F., Tsukada, N. & Kato, N., Isolation of three kinds of human endogenous retrovirus-like sequences using tRNA(Pro) as a probe, Nucleic Acids Res, 15, 9153, 1987. 291. La Mantia, G. et al., Identification of regulatory elements within the minimal promoter region of the human endogenous ERV9 proviruses: accurate transcription initiation is controlled by an Inr-like element, Nucleic Acids Res, 20, 4129, 1992. 292. Pavlicek, A., Paces, J., Elleder, D. & Hejnar, J., Processed pseudogenes of human endogenous retroviruses generated by LINEs: their integration, stability, and distribution, Genome Res, 12, 391, 2002. 293. Lower, R., Lower, J. & Kurth, R., The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences, Proc Natl Acad Sci U S A, 93, 5177, 1996.
REFERENCES 244
294. Jurka, J., Repeats in genomic DNA: mining and meaning, Curr Opin Struct Biol, 8, 333, 1998. 295. Leib-Mosch, C. & Seifarth, W., Evolution and biological significance of human retroelements, Virus Genes, 11, 133, 1995. 296. Patience, C., Wilkinson, D.A. & Weiss, R.A., Our retroviral heritage, Trends Genet, 13, 116, 1997. 297. Di Cristofano, A., Strazzullo, M., Parisi, T. & La Mantia, G., Mobilization of an ERV9 human endogenous retroviral element during primate evolution, Virology, 213, 271, 1995. 298. Di Cristofano, A., Strazullo, M., Longo, L. & La Mantia, G., Characterization and genomic mapping of the ZNF80 locus: expression of this zinc-finger gene is driven by a solitary LTR of ERV9 endogenous retroviral family, Nucleic Acids Res, 23, 2823, 1995. 299. Belshaw, R. et al., Long-term reinfection of the human genome by endogenous retroviruses, Proc Natl Acad Sci U S A, 101, 4894, 2004. 300. de Parseval, N. & Heidmann, T., Human endogenous retroviruses: from infectious elements to human genes, Cytogenet Genome Res, 110, 318, 2005. 301. Mourier, T., Reverse transcription in genome evolution, Cytogenet Genome Res, 110, 56, 2005. 302. Katzourakis, A., Rambaut, A. & Pybus, O.G., The evolutionary dynamics of endogenous retroviruses, Trends Microbiol, 13, 463, 2005. 303. Blaise, S., de Parseval, N., Benit, L. & Heidmann, T., Genomewide screening for fusogenic human endogenous retrovirus envelopes identifies syncytin 2, a gene conserved on primate evolution, Proc Natl Acad Sci U S A, 100, 13013, 2003. 304. Dewannieux, M., Blaise, S. & Heidmann, T., Identification of a functional envelope protein from the HERV-K family of human endogenous retroviruses, J Virol, 79, 15573, 2005. 305. Lindeskog, M., Mager, D.L. & Blomberg, J., Isolation of a human endogenous retroviral HERV-H element with an open env reading frame, Virology, 258, 441, 1999. 306. Schon, U. et al., Cell type-specific expression and promoter activity of human endogenous retroviral long terminal repeats, Virology, 279, 280, 2001. 307. Hughes, J.F. & Coffin, J.M., Evidence for genomic rearrangements mediated by human endogenous retroviruses during primate evolution, Nat Genet, 29, 487, 2001. 308. Ponferrada, V.G., Mauck, B.S. & Wooley, D.P., The envelope glycoprotein of human endogenous retrovirus HERV-W induces cellular resistance to spleen necrosis virus, Arch Virol, 148, 659, 2003. 309. Robinson, H.L., Astrin, S.M., Senior, A.M. & Salazar, F.H., Host Susceptibility to endogenous viruses: defective, glycoprotein- expressing proviruses interfere with infections, J Virol, 40, 745, 1981. 310. McDougall, A.S. et al., Defective endogenous proviruses are expressed in feline lymphoid cells: evidence for a role in natural resistance to subgroup B feline leukemia viruses, J Virol, 68, 2151, 1994. 311. Harris, J.R., Placental endogenous retrovirus (ERV): structural, functional, and evolutionary significance, Bioessays, 20, 307, 1998.
REFERENCES 245
312. Larsson, E., Andersson, A.C. & Nilsson, B.O., Expression of an endogenous retrovirus (ERV3 HERV-R) in human reproductive and embryonic tissues-- evidence for a function for envelope gene products, Ups J Med Sci, 99, 113, 1994. 313. Mi, S. et al., Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis, Nature, 403, 785, 2000. 314. Maksakova, I.A. et al., Retroviral Elements and Their Hosts: Insertional Mutagenesis in the Mouse Germ Line, PLoS Genet, 2, e2, 2006. 315. Best, S., Le Tissier, P., Towers, G. & Stoye, J.P., Positional cloning of the mouse retrovirus restriction gene Fv1, Nature, 382, 826, 1996. 316. Fukumitsu, H., Takase-Yoden, S. & Watanabe, R., Neuropathology of experimental autoimmune encephalomyelitis modified by retroviral infection, Neuropathology, 22, 280, 2002. 317. Dupressoir, A. et al., Syncytin-A and syncytin-B, two fusogenic placenta-specific murine envelope genes of retroviral origin conserved in Muridae, Proc Natl Acad Sci U S A, 102, 725, 2005. 318. van de Lagemaat, L.N., Landry, J.R., Mager, D.L. & Medstrand, P., Transposable elements in mammals promote regulatory variation and diversification of genes with specialized functions, Trends Genet, 19, 530, 2003. 319. Sverdlov, E.D., Retroviruses and primate evolution, Bioessays, 22, 161, 2000. 320. O'Reilly, R.L. & Singh, S.M., Retroviruses and schizophrenia revisited, Am J Med Genet, 67, 19, 1996. 321. Conrad, B. et al., A human endogenous retroviral superantigen as candidate autoimmune gene in type I diabetes, Cell, 90, 303, 1997. 322. Herbst, H., Sauter, M. & Mueller-Lantzsch, N., Expression of human endogenous retrovirus K elements in germ cell and trophoblastic tumors, Am J Pathol, 149, 1727, 1996. 323. Coffin, J.M., Superantigens and endogenous retroviruses: a confluence of puzzles, Science, 255, 411, 1992. 324. Boller, K. et al., Evidence that HERV-K is the endogenous retrovirus sequence that codes for the human teratocarcinoma-derived retrovirus HTDV, Virology, 196, 349, 1993. 325. Wang-Johanning, F. et al., Expression of human endogenous retrovirus k envelope transcripts in human breast cancer, Clin Cancer Res, 7, 1553, 2001. 326. Wang-Johanning, F. et al., Detecting the expression of human endogenous retrovirus E envelope transcripts in human prostate adenocarcinoma, Cancer, 98, 187, 2003. 327. Lindeskog, M. & Blomberg, J., Spliced human endogenous retroviral HERV-H env transcripts in T-cell leukaemia cell lines and normal leukocytes: alternative splicing pattern of HERV-H transcripts, J Gen Virol, 78, 2575, 1997. 328. Karlsson, H. et al., Retroviral RNA identified in the cerebrospinal fluids and brains of individuals with schizophrenia, Proc Natl Acad Sci U S A, 98, 4634, 2001. 329. Clausen, J., Endogenous retroviruses and MS: using ERVs as disease markers, Int MS J, 10, 22, 2003.
REFERENCES 246
330. Voisset, C. et al., Chromosomal distribution and coding capacity of the human endogenous retrovirus HERV-W family, AIDS Res Hum Retroviruses, 16, 731, 2000. 331. Cheynet, V. et al., Synthesis, assembly, and processing of the Env ERVWE1/syncytin human endogenous retroviral envelope, J Virol, 79, 5585, 2005. 332. An, D.S., Xie, Y. & Chen, I.S., Envelope gene of the human endogenous retrovirus HERV-W encodes a functional retrovirus envelope, J Virol, 75, 3488, 2001. 333. Lavillette, D. et al., The envelope glycoprotein of human endogenous retrovirus type W uses a divergent family of amino acid transporters/cell surface receptors, J Virol, 76, 6442, 2002. 334. Blond, J.L. et al., An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor, J Virol, 74, 3321, 2000. 335. Marin, M., Lavillette, D., Kelly, S.M. & Kabat, D., N-linked glycosylation and sequence changes in a critical negative control region of the ASCT1 and ASCT2 neutral amino acid transporters determine their retroviral receptor functions, J Virol, 77, 2936, 2003. 336. Weiss, M.D., Rossignol, C., Sumners, C. & Anderson, K.J., A pH-dependent increase in neuronal glutamate efflux in vitro: possible involvement of ASCT1, Brain Res, 1056, 105, 2005. 337. Dolinska, M., Zablocka, B., Sonnewald, U. & Albrecht, J., Glutamine uptake and expression of mRNA's of glutamine transporting proteins in mouse cerebellar and cerebral cortical astrocytes and neurons, Neurochem Int, 44, 75, 2004. 338. Furuya, S. & Watanabe, M., Novel neuroglial and glioglial relationships mediated by L-serine metabolism, Arch Histol Cytol, 66, 109, 2003. 339. Weiss, M.D., Derazi, S., Kilberg, M.S. & Anderson, K.J., Ontogeny and localization of the neutral amino acid transporter ASCT1 in rat brain, Brain Res Dev Brain Res, 130, 183, 2001. 340. Zhang, K. et al., Human immunodeficiency virus type 1 envelope-mediated neuronal death: Uncoupling of viral replication and neurotoxicity, J Virol, 77, 6899, 2003. 341. Kawaguchi, Y., Miyazawa, T., Tohya, Y., Takahashi, E. & Mikami, T., Quantification of feline immunodeficiency virus in a newly established feline T- lymphoblastoid cell line (MYA-1 cells), Arch Virol, 111, 269, 1990. 342. van Marle, G., Ethier, J., Silva, C., Mac Vicar, B.A. & Power, C., Human immunodeficiency virus type 1 envelope-mediated neuropathogenesis: targeted gene delivery by a Sindbis virus expression vector, Virology, 309, 61, 2003. 343. Bredenbeek, P.J., Frolov, I., Rice, C.M. & Schlesinger, S., Sindbis virus expression vectors: packaging of RNA replicons by using defective helper RNAs, J Virol, 67, 6439, 1993. 344. Schlesinger, S. & Dubensky, T.W., Alphavirus vectors for gene expression and vaccines, Curr Opin Biotechnol, 10, 434, 1999.
REFERENCES 247
345. Vergote, D. et al., Characterisation of proteins differentially present in the plasma of Biomphalaria glabrata susceptible or resistant to Echinostoma caproni, Int J Parasitol, 35, 215, 2005. 346. Wallace, J.L. et al., Gastric tolerability and prolonged prostaglandin inhibition in the brain with a nitric oxide-releasing flurbiprofen derivative, NCX-2216 [3-[4- (2-fluoro-alpha-methyl-[1,1'-biphenyl]-4-acetyloxy)-3-methoxyphenyl] -2- propenoic acid 4-nitrooxy butyl ester], J Pharmacol Exp Ther, 309, 626, 2004. 347. Guenther, K., Deacon, R.M., Perry, V.H. & Rawlins, J.N., Early behavioural changes in scrapie-affected mice and the influence of dapsone, Eur J Neurosci, 14, 401, 2001. 348. Livak, K.J. & Schmittgen, T.D., Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods, 25, 402, 2001. 349. Butterfield, D.A. & Lauderback, C.M., Lipid peroxidation and protein oxidation in Alzheimer's disease brain: potential causes and consequences involving amyloid beta-peptide-associated free radical oxidative stress, Free Radic Biol Med, 32, 1050, 2002. 350. Bar-Or, A. et al., Analyses of all matrix metalloproteinase members in leukocytes emphasize monocytes as major inflammatory mediators in multiple sclerosis, Brain, 126, 2738, 2003. 351. Imai, Y., Ibata, I., Ito, D., Ohsawa, K. & Kohsaka, S., A novel gene iba1 in the major histocompatibility complex class III region encoding an EF hand protein expressed in a monocytic lineage, Biochem Biophys Res Commun, 224, 855, 1996. 352. Bansal, R., Warrington, A.E., Gard, A.L., Ranscht, B. & Pfeiffer, S.E., Multiple and novel specificities of monoclonal antibodies O1, O4, and R- mAb used in the analysis of oligodendrocyte development, J Neurosci Res, 24, 548, 1989. 353. Power, C. et al., Cerebral white matter changes in acquired immunodeficiency syndrome dementia: alterations of the blood-brain barrier, Ann Neurol, 34, 339, 1993. 354. West, M.J., Ostergaard, K., Andreassen, O.A. & Finsen, B., Estimation of the number of somatostatin neurons in the striatum: an in situ hybridization study using the optical fractionator method, J Comp Neurol, 370, 11, 1996. 355. Lander, E.S. et al., Initial sequencing and analysis of the human genome, Nature, 409, 860, 2001. 356. Bock, M. & Stoye, J.P., Endogenous retroviruses and the human germline, Curr Opin Genet Dev, 10, 651, 2000. 357. Calabrese, V. et al., Nitric oxide synthase is present in the cerebrospinal fluid of patients with active multiple sclerosis and is associated with increases in cerebrospinal fluid protein nitrotyrosine and S-nitrosothiols and with changes in glutathione levels, J Neurosci Res, 70, 580, 2002. 358. Lu, F. et al., Oxidative damage to mitochondrial DNA and activity of mitochondrial enzymes in chronic active lesions of multiple sclerosis, J Neurol Sci, 177, 95, 2000. 359. John, G.R. et al., Multiple sclerosis: re-expression of a developmental pathway that restricts oligodendrocyte maturation, Nat Med, 8, 1115, 2002.
REFERENCES 248
360. Kanski, J., Aksenova, M., Stoyanova, A. & Butterfield, D.A., Ferulic acid antioxidant protection against hydroxyl and peroxyl radical oxidation in synaptosomal and neuronal cell culture systems in vitro: structure-activity studies, J Nutr Biochem, 13, 273, 2002. 361. Hua, L.L., Kim, M.O., Brosnan, C.F. & Lee, S.C., Modulation of astrocyte inducible nitric oxide synthase and cytokine expression by interferon beta is associated with induction and inhibition of interferon gamma-activated sequence binding activity, J Neurochem, 83, 1120, 2002. 362. Frendo, J.L. et al., Direct involvement of HERV-W Env glycoprotein in human trophoblast cell fusion and differentiation, Mol Cell Biol, 23, 3566, 2003. 363. Calabrese, V. et al., Disruption of thiol homeostasis and nitrosative stress in the cerebrospinal fluid of patients with active multiple sclerosis: evidence for a protective role of acetylcarnitine, Neurochem Res, 28, 1321, 2003. 364. Smith, K.J. & Lassmann, H., The role of nitric oxide in multiple sclerosis, Lancet Neurol, 1, 232, 2002. 365. Danilov, A.I. et al., Nitric oxide metabolite determinations reveal continuous inflammation in multiple sclerosis, J Neuroimmunol, 136, 112, 2003. 366. Lieberman, A.P., Pitha, P.M., Shin, H.S. & Shin, M.L., Production of tumor necrosis factor and other cytokines by astrocytes stimulated with lipopolysaccharide or a neurotropic virus, Proc Natl Acad Sci U S A, 86, 6348, 1989. 367. Rosen, C.L., Bunge, R.P., Ard, M.D. & Wood, P.M., Type 1 astrocytes inhibit myelination by adult rat oligodendrocytes in vitro, J Neurosci, 9, 3371, 1989. 368. Zafra, F., Castren, E., Thoenen, H. & Lindholm, D., Interplay between glutamate and gamma-aminobutyric acid transmitter systems in the physiological regulation of brain-derived neurotrophic factor and nerve growth factor synthesis in hippocampal neurons, Proc Natl Acad Sci U S A, 88, 10037, 1991. 369. Lynch, W.P. & Sharpe, A.H., Differential glycosylation of the Cas-Br-E env protein is associated with retrovirus-induced spongiform neurodegeneration, J Virol, 74, 1558, 2000. 370. Qiang, W. et al., Astrocytes survive chronic infection and cytopathic effects of the ts1 mutant of the retrovirus Moloney murine leukemia virus by upregulation of antioxidant defenses, J Virol, 80, 3273, 2006. 371. Scott, G.S., Virag, L., Szabo, C. & Hooper, D.C., Peroxynitrite-induced oligodendrocyte toxicity is not dependent on poly(ADP-ribose) polymerase activation, Glia, 41, 105, 2003. 372. Ravikumar, A., Arun, P., Devi, K.V., Augustine, J. & Kurup, P.A., Isoprenoid pathway and free radical generation and damage in neuropsychiatric disorders, Indian J Exp Biol, 38, 438, 2000. 373. Gu, Z. et al., S-nitrosylation of matrix metalloproteinases: signaling pathway to neuronal cell death, Science, 297, 1186, 2002. 374. Donald W Paty, J.H.N.a.G.C.E. Diagnosis of Multiple Sclerosis. in Multiple Sclerosis (ed. Ebers, D.W.P.a.G.C.) 68 (FA Davis Company, Philadelphia, 1998). 375. Anlar, O., Tombul, T. & Kisli, M., Peripheral sensory and motor abnormalities in patients with multiple sclerosis, Electromyogr Clin Neurophysiol, 43, 349, 2003.
REFERENCES 249
376. Ogiwara, T. et al., Inhibition of NO production by activated macrophages by phenolcarboxylic acid monomers and polymers with radical scavenging activity, Anticancer Res, 23, 1317, 2003. 377. Armbruester, V. et al., A novel gene from the human endogenous retrovirus K expressed in transformed cells, Clin Cancer Res, 8, 1800, 2002. 378. Larsson, E. et al., Tissue and differentiation specific expression on the endogenous retrovirus ERV3 (HERV-R) in normal human tissues and during induced monocytic differentiation in the U-937 cell line, Leukemia, 11 Suppl 3, 142, 1997. 379. Katsumata, K. et al., Cytokine regulation of env gene expression of human endogenous retrovirus-R in human vascular endothelial cells, Clin Immunol, 93, 75, 1999. 380. Garson, J. et al., MSRV, Syncytin and the role of endogenous retroviral proteins in demyelination, Mult Scler, 11, 249, 2005. 381. Dolei, A. et al., Multiple sclerosis-associated retrovirus (MSRV) in Sardinian MS patients, Neurology, 58, 471, 2002. 382. Sotgiu, S. et al., Multiple sclerosis-associated retrovirus and MS prognosis: an observational study, Neurology, 59, 1071, 2002. 383. Nowak, J. et al., Multiple sclerosis-associated virus-related pol sequences found both in multiple sclerosis and healthy donors are more frequently expressed in multiple sclerosis patients, J Neurovirol, 9, 112, 2003. 384. Bonnaud, B. et al., Evidence of selection on the domesticated ERVWE1 env retroviral element involved in placentation, Mol Biol Evol, 21, 1895, 2004. 385. Dolei, A., MSRV/HERV-W/syncytin and its linkage to multiple sclerosis: the usability and the hazard of a human endogenous retrovirus, J Neurovirol, 11, 232, 2005. 386. Li, Y. et al., Molecular characterization of human immunodeficiency virus type 1 cloned directly from uncultured human brain tissue: identification of replication- competent and -defective viral genomes, J Virol, 65, 3973, 1991. 387. Lazarini, F. et al., Human immunodeficiency virus type 1 DNA and RNA load in brains of demented and nondemented patients with acquired immunodeficiency syndrome, J Neurovirol, 3, 299, 1997. 388. Bell, P., Montaner, L.J. & Maul, G.G., Accumulation and intranuclear distribution of unintegrated human immunodeficiency virus type 1 DNA, J Virol, 75, 7683, 2001. 389. Hartung, H.P. & Rieckmann, P., Pathogenesis of immune-mediated demyelination in the CNS, J Neural Transm Suppl, 50, 173, 1997. 390. Kort, J.J., Kawamura, K., Fugger, L., Weissert, R. & Forsthuber, T.G., Efficient presentation of myelin oligodendrocyte glycoprotein peptides but not protein by astrocytes from HLA-DR2 and HLA-DR4 transgenic mice, J Neuroimmunol, 173, 23, 2006. 391. Mycko, M.P., Papoian, R., Boschert, U., Raine, C.S. & Selmaj, K.W., Microarray gene expression profiling of chronic active and inactive lesions in multiple sclerosis, Clin Neurol Neurosurg, 106, 223, 2004. 392. Wu, J. & Kaufman, R.J., From acute ER stress to physiological roles of the Unfolded Protein Response, Cell Death Differ, 13, 374, 2006.
REFERENCES 250
393. Bauer, J. et al., Endoplasmic reticulum stress in PLP-overexpressing transgenic rats: gray matter oligodendrocytes are more vulnerable than white matter oligodendrocytes, J Neuropathol Exp Neurol, 61, 12, 2002. 394. De Keyser, J., Zeinstra, E. & Wilczak, N., Astrocytic beta2-adrenergic receptors and multiple sclerosis, Neurobiol Dis, 15, 331, 2004. 395. Daniels, M. & Brown, D.R., Astrocytes regulate N-methyl-D-aspartate receptor subunit composition increasing neuronal sensitivity to excitotoxicity, J Biol Chem, 276, 22446, 2001. 396. Rao, R.V. & Bredesen, D.E., Misfolded proteins, endoplasmic reticulum stress and neurodegeneration, Curr Opin Cell Biol, 16, 653, 2004. 397. Yu, Z., Luo, H., Fu, W. & Mattson, M.P., The endoplasmic reticulum stress- responsive protein GRP78 protects neurons against excitotoxicity and apoptosis: suppression of oxidative stress and stabilization of calcium homeostasis, Exp Neurol, 155, 302, 1999. 398. Kondo, S. et al., OASIS, a CREB/ATF-family member, modulates UPR signalling in astrocytes, Nat Cell Biol, 7, 186, 2005. 399. Thompson, K.A., McArthur, J.C. & Wesselingh, S.L., Correlation between neurological progression and astrocyte apoptosis in HIV-associated dementia, Ann Neurol, 49, 745, 2001. 400. Jiang, Y. et al., Retrovirus-Induced Oxidative Stress with Neuroimmunodegeneration Is Suppressed by Antioxidant Treatment with a Refined Monosodium {alpha}-Luminol (Galavit), J Virol, 80, 4557, 2006. 401. Cullinan, S.B. et al., Nrf2 is a direct PERK substrate and effector of PERK- dependent cell survival, Mol Cell Biol, 23, 7198, 2003. 402. Sato, H., Tamba, M., Kuriyama-Matsumura, K., Okuno, S. & Bannai, S., Molecular cloning and expression of human xCT, the light chain of amino acid transport system xc, Antioxid Redox Signal, 2, 665, 2000. 403. Kaleeba, J.A. & Berger, E.A., Kaposi's sarcoma-associated herpesvirus fusion- entry receptor: cystine transporter xCT, Science, 311, 1921, 2006. 404. Sasaki, H. et al., Electrophile response element-mediated induction of the cystine/glutamate exchange transporter gene expression, J Biol Chem, 277, 44765, 2002. 405. Fernandis, A.Z., Cherla, R.P., Chernock, R.D. & Ganju, R.K., CXCR4/CCR5 down-modulation and chemotaxis are regulated by the proteasome pathway, J Biol Chem, 277, 18111, 2002. 406. Perron, H. et al., Human endogenous retrovirus (HERV)-W ENV and GAG proteins: physiological expression in human brain and pathophysiological modulation in multiple sclerosis lesions, J Neurovirol, 11, 23, 2005. 407. Kanai, Y. & Endou, H., Heterodimeric amino acid transporters: molecular biology and pathological and pharmacological relevance, Curr Drug Metab, 2, 339, 2001. 408. Lock, C. et al., Gene-microarray analysis of multiple sclerosis lesions yields new targets validated in autoimmune encephalomyelitis, Nat Med, 8, 500, 2002. 409. Murakami, T. et al., Cleavage of the membrane-bound transcription factor OASIS in response to endoplasmic reticulum stress, J Neurochem, 96, 1090, 2006. 410. Bhat, N.R., Feinstein, D.L., Shen, Q. & Bhat, A.N., p38 MAPK-mediated transcriptional activation of inducible nitric-oxide synthase in glial cells. Roles of
REFERENCES 251
nuclear factors, nuclear factor kappa B, cAMP response element-binding protein, CCAAT/enhancer-binding protein-beta, and activating transcription factor-2, J Biol Chem, 277, 29584, 2002. 411. Kuhlmann, T. et al., Bcl-2-expressing oligodendrocytes in multiple sclerosis lesions, Glia, 28, 34, 1999. 412. Grewer, C. & Grabsch, E., New inhibitors for the neutral amino acid transporter ASCT2 reveal its Na+-dependent anion leak, J Physiol, 557, 747, 2004. 413. Di Battista, J.A., Martel-Pelletier, J. & Pelletier, J., Suppression of tumor necrosis factor (TNF-alpha) gene expression by prostaglandin E(2). Role Of early growth response protein-1 (Egr-1), Osteoarthritis Cartilage, 7, 395, 1999. 414. Kanai, Y. & Hediger, M.A., The glutamate/neutral amino acid transporter family SLC1: molecular, physiological and pharmacological aspects, Pflugers Arch, 447, 469, 2004. 415. Rupprecht, H.D., Akagi, Y., Keil, A. & Hofer, G., Nitric oxide inhibits growth of glomerular mesangial cells: role of the transcription factor EGR-1, Kidney Int, 57, 70, 2000. 416. Cicala, C. et al., R5 and X4 HIV envelopes induce distinct gene expression profiles in primary peripheral blood mononuclear cells, Proc Natl Acad Sci U S A, 103, 3746, 2006. 417. Asensio, V.C. et al., Interferon-independent, human immunodeficiency virus type 1 gp120- mediated induction of CXCL10/IP-10 gene expression by astrocytes in vivo and in vitro, J Virol, 75, 7067, 2001. 418. Wang, Z. et al., Reduced expression of glutamate transporter EAAT2 and impaired glutamate transport in human primary astrocytes exposed to HIV-1 or gp120, Virology, 312, 60, 2003. 419. McCarthy, M. et al., Cellular tropisms and co-receptor usage of HIV-1 isolates from vertically infected children with neurological abnormalities and rapid disease progression, J Med Virol, 67, 1, 2002. 420. Stalder, A.K. et al., Late-onset chronic inflammatory encephalopathy in immune- competent and severe combined immune-deficient (SCID) mice with astrocyte- targeted expression of tumor necrosis factor, Am J Pathol, 153, 767, 1998. 421. Coombs, B.D. et al., Multiple sclerosis pathology in the normal and abnormal appearing white matter of the corpus callosum by diffusion tensor imaging, Mult Scler, 10, 392, 2004. 422. Saccani, A. et al., Redox regulation of chemokine receptor expression, Proc Natl Acad Sci U S A, 97, 2761, 2000. 423. Kekuda, R. et al., Cloning of the sodium-dependent, broad-scope, neutral amino acid transporter Bo from a human placental choriocarcinoma cell line, J Biol Chem, 271, 18657, 1996. 424. Sakai, K., Shimizu, H., Koike, T., Furuya, S. & Watanabe, M., Neutral amino acid transporter ASCT1 is preferentially expressed in L-Ser-synthetic/storing glial cells in the mouse brain with transient expression in developing capillaries, J Neurosci, 23, 550, 2003. 425. Hackel, D. PhD thesis, Magdeburg (2005). 426. Yamamoto, T. et al., Characterization of rapid and high-affinity uptake of L- serine in neurons and astrocytes in primary culture, FEBS Lett, 548, 69, 2003.
REFERENCES 252
427. Sundaram, K.S. & Lev, M., Inhibition of sphingolipid synthesis by cycloserine in vitro and in vivo, J Neurochem, 42, 577, 1984. 428. Kudo, Y. & Boyd, C.A., Changes in expression and function of syncytin and its receptor, amino acid transport system B(0) (ASCT2), in human placental choriocarcinoma BeWo cells during syncytialization, Placenta, 23, 536, 2002. 429. Storck, T., Schulte, S., Hofmann, K. & Stoffel, W., Structure, expression, and functional analysis of a Na(+)-dependent glutamate/aspartate transporter from rat brain, Proc Natl Acad Sci U S A, 89, 10955, 1992. 430. Uchiyama, T., Matsuda, Y., Wada, M., Takahashi, S. & Fujita, T., Functional regulation of Na+-dependent neutral amino acid transporter ASCT2 by S- nitrosothiols and nitric oxide in Caco-2 cells, FEBS Lett, 579, 2499, 2005. 431. Dickhout, J.G. et al., Peroxynitrite causes endoplasmic reticulum stress and apoptosis in human vascular endothelium: implications in atherogenesis, Arterioscler Thromb Vasc Biol, 25, 2623, 2005. 432. Tatarowicz, W.A. et al., Repression of the HSV-1 latency-associated transcript (LAT) promoter by the early growth response (EGR) proteins: involvement of a binding site immediately downstream of the TATA box, J Neurovirol, 3, 212, 1997. 433. Korner, H. et al., Critical points of tumor necrosis factor action in central nervous system autoimmune inflammation defined by gene targeting, J Exp Med, 186, 1585, 1997. 434. FitzGerald, U.F., Gilbey, T., Brodie, S. & Barnett, S.C., Transcription factor expression and cellular redox in immature oligodendrocyte cell death: effect of Bcl-2, Mol Cell Neurosci, 22, 516, 2003. 435. Nishie, M. et al., Multinucleated astrocytes in old demyelinated plaques in a patient with multiple sclerosis, Neuropathology, 24, 248, 2004. 436. Jana, M. & Pahan, K., Redox regulation of cytokine-mediated inhibition of myelin gene expression in human primary oligodendrocytes, Free Radic Biol Med, 39, 823, 2005. 437. Yeh, M.W. et al., Cytokine-stimulated, but not HIV-infected, human monocyte- derived macrophages produce neurotoxic levels of l -cysteine, J Immunol, 164, 4265, 2000. 438. Fujinami, R.S., von Herrath, M.G., Christen, U. & Whitton, J.L., Molecular mimicry, bystander activation, or viral persistence: infections and autoimmune disease, Clin Microbiol Rev, 19, 80, 2006. 439. Brudek, T., Christensen, T., Hansen, H.J., Bobecka, J. & Moller-Larsen, A., Simultaneous presence of endogenous retrovirus and herpes virus antigens has profound effect on cell-mediated immune responses: implications for multiple sclerosis, AIDS Res Hum Retroviruses, 20, 415, 2004. 440. Kudo, Y., Boyd, C.A., Sargent, I.L. & Redman, C.W., Hypoxia alters expression and function of syncytin and its receptor during trophoblast cell fusion of human placental BeWo cells: implications for impaired trophoblast syncytialisation in pre-eclampsia, Biochim Biophys Acta, 1638, 63, 2003. 441. Cheng, Y.H., Richardson, B.D., Hubert, M.A. & Handwerger, S., Isolation and characterization of the human syncytin gene promoter, Biol Reprod, 70, 694, 2004.
REFERENCES 253
442. Cockerill, P.N., Osborne, C.S., Bert, A.G. & Grotto, R.J., Regulation of GM-CSF gene transcription by core-binding factor, Cell Growth Differ, 7, 917, 1996. 443. McQualter, J.L. et al., Granulocyte macrophage colony-stimulating factor: a new putative therapeutic target in multiple sclerosis, J Exp Med, 194, 873, 2001. 444. Wang, D., Yamamoto, S., Hijiya, N., Benveniste, E.N. & Gladson, C.L., Transcriptional regulation of the human osteopontin promoter: functional analysis and DNA-protein interactions, Oncogene, 19, 5801, 2000. 445. Chabas, D. et al., The influence of the proinflammatory cytokine, osteopontin, on autoimmune demyelinating disease, Science, 294, 1731, 2001. 446. Galey, D. et al., Differential transcriptional regulation by human immunodeficiency virus type 1 and gp120 in human astrocytes, J Neurovirol, 9, 358, 2003. 447. Koppal, T. et al., Peroxynitrite-induced alterations in synaptosomal membrane proteins: insight into oxidative stress in Alzheimer's disease, J Neurochem, 72, 310, 1999. 448. Gaudin, P. et al., Infrequency of detection of particle-associated MSRV/HERV-W RNA in the synovial fluid of patients with rheumatoid arthritis, Rheumatology (Oxford), 39, 950, 2000. 449. Mallet, F. et al., The endogenous retroviral locus ERVWE1 is a bona fide gene involved in hominoid placental physiology, Proc Natl Acad Sci U S A, 101, 1731, 2004. 450. Zawada, M. et al., MSRV pol sequence copy number as a potential marker of multiple sclerosis, Pol J Pharmacol, 55, 869, 2003. 451. Hirt, B., Selective extraction of polyoma DNA from infected mouse cell cultures, J Mol Biol, 26, 365, 1967. 452. Lucke-Huhle, C., Hinrichs, S. & Speit, G., DHFR gene amplification in cultured skin fibroblasts of ataxia telangiectasia patients after methotrexate selection, Carcinogenesis, 8, 1801, 1987. 453. Xu, C., Bailly-Maitre, B. & Reed, J.C., Endoplasmic reticulum stress: cell life and death decisions, J Clin Invest, 115, 2656, 2005. 454. Pierig, R., Belliveau, J., Amouri, R., Menard, A. & Rieger, F., Association of a gliotoxic activity with active multiple sclerosis in US patients, Cell Mol Biol (Noisy-le-grand), 48, 199, 2002. 455. Barca, O. et al., Interferon beta promotes survival in primary astrocytes through phosphatidylinositol 3-kinase, J Neuroimmunol, 139, 155, 2003. 456. Benjelloun, N. et al., Case report: DNA fragmentation in glial cells in a cerebral biopsy from a multiple sclerosis patient, Cell Mol Biol (Noisy-le-grand), 44, 579, 1998. 457. Gveric, D., Cuzner, M.L. & Newcombe, J., Insulin-like growth factors and binding proteins in multiple sclerosis plaques, Neuropathol Appl Neurobiol, 25, 215, 1999. 458. Lucchinetti, C. et al., Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination, Ann Neurol, 47, 707, 2000. 459. Franklin, R.J., Crang, A.J. & Blakemore, W.F., Transplanted type-1 astrocytes facilitate repair of demyelinating lesions by host oligodendrocytes in adult rat spinal cord, J Neurocytol, 20, 420, 1991.