DOCSLIB.ORG

WO 2017/187426 Al 02 November 2017 (02.11.2017) W !P O PCT

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
WO 2017/187426 Al 02 November 2017 (02.11.2017) W !P O PCT (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/187426 Al 02 November 2017 (02.11.2017) W !P O PCT (51) International Patent Classification: SD, SE, SG, SK, SL, SM, ST, SV, SY,TH, TJ, TM, TN, TR, C12N 15/113 (2010.01) TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (21) International Application Number: (84) Designated States (unless otherwise indicated, for every PCT/IB20 17/052505 kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (22) International Filing Date: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 28 April 2017 (28.04.2017) TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (25) Filing Language: English EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, (26) Publication Langi English TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, (30) Priority Data: KM, ML, MR, NE, SN, TD, TG). 62/329,537 29 April 2016 (29.04.2016) US Declarations under Rule 4.17: (71) Applicant: APTAMIR THERAPEUTICS, INC. — as to applicant's entitlement to apply for and be granted a [US/US]; 3925 W. Braker Lane, Austin, Texas 78759 (US). patent (Rule 4.1 7(H)) (72) Inventor: THIBONNIER, Marc; AptamiR Therapeutics, Published: Inc., 484 Terracina Way, Naples, Florida 341 19 (US). — with international search report (Art. 21(3)) (74) Agent: BARRETT, Tamsen L.; NORTON ROSE FUL- — before the expiration of the time limit for amending the BRIGHT US LLP, 98 San Jacinto Blvd., Suite 1100, Austin, claims and to be republished in the event of receipt of Texas 78701 (US). amendments (Rule 48.2(h)) — with sequence listing part of description (Rule 5.2(a)) (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (54) Title: INHIBITION OF MIR-22 MIRNA BY APT-1 10 m NA inhibitor with P 6 Medium human Day 14 p r -a ip c t s transrectal Gene Expression C n t g, SS) Protein Expression Hig h Content imaging, C- $/ S| FIG. 3A 0 0 f— (57) Abstract: Increase of energy expenditure as an effective treatment of obesity and related disorders is a target for drug research and development. A 15% increase of energy expenditure is believed to be sufficient to achieve significant weight and fat mass reduction ® while providing meaningful improvement of metabolic parameters. Disclosed herein is a method for pharmacological inhibition of miR-22-3p, which represents a new therapeutic approach for treating human obesity, diabetes, and hypercholesterolemia. INHIBITION OF MIR-22 MIRNA BY APT-110 CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 62/329,537 filed April 29, 2016, which is hereby incorporated by reference in its entirety. FIELD OF THE INVENTION [0002] This invention relates to the fields of molecular biology, microbiology, pharmacology, and synthetic organic chemistry. BACKGROUND [0003] Human obesity has become a worldwide pandemic due to sedentary lifestyle and excessive consumption of energy-dense foods rich in saturated fats and sugars. It currently affects one third of the world population, including adolescents and children (Ng, M., et al., 2014). Obesity and excessive weight are major risk factors for many chronic diseases, including diabetes mellitus, hyperlipidemia, cardiovascular diseases, visceral inflammation, and several cancers (Wilborn, C , et al., 2005). Furthermore, obesity and excessive weight are the cause of lost earnings, restricted activity days, absenteeism, lower productivity at work (presenteeism), reduced quality of life, permanent disability, significant morbidity and mortality, and shortened lifespan. About 400,000 deaths per year in the US are related to obesity. Obesity is responsible for more than 10% of US total healthcare costs (Wang, Y., et al., 2008). Furthermore, voluntary spending on weight loss, mostly on unproven means, exceeds $75 billion annually. [0004] Current medical treatments of human obesity have poor benefit-to-risk profiles, fail to attain long-term therapeutic goals, do not meet patients' expectations and are often not covered by health insurance plans (Haslam, D.W., et al., 2005). Therefore, there is a pressing need to develop an effective and safe medical treatment of human obesity and related disorders that should significantly reduce health care expenses, improve and save human lives. [0005] Obesity is the result of a chronic imbalance between energy intake and expenditure. This imbalance leads to storage of excess energy as fat (triglycerides) into adipocytes, which typically exhibit both hypertrophy (increase in cell size) and hyperplasia (increase in cell number or adipogenesis). Therefore, treatements that target this imbalance are needed. SUMMARY [0006] The inventor has identified methods for treating human obesity and related disorders through the administration of a novel inhibitor of mir-22 microRNA (miRNA). Specifically, it has been found that administration of a mir-22 inhibitor brings about a series of positive metabolic effects, including weight loss, fat mass reduction, increased energy expenditure, and improvement of glucose control, insulin sensitivity and cholesterol levels. The disclosure provides a miRNA inhibitor that provides upstream control of a variety of proteins involved in metabolism and thermogenesis. In some embodiments, the miRNA inhibitor inhibits mir-22 miRNA. In further embodiments, the miRNA inhibitor inhibits the mature 3p nucleotide of mir-22 miRNA. mir-22 has the stem-loop structure shown in FIG. 16. The mature sequence, hsa-mir-22-3p is aagcugccaguugaagaacugu, and the mature sequence, hsa-mir-22-5p, is aguucuucaguggcaagcuuua. In some aspects, administration of a mir-22 inhibitor to a subject increases thermogenesis in the subject. [0007] In some embodiments, the mi-RNA inhibitor is a compound of the formula: wherein X is OH or a sodium or protonated phorphorothioate 5'-hydroxy nucleotide; Rl is cytosine, 5-methyl cytosine, guanine, or thymine; R2, R3, R4, R7, and R13 are each independently cytosine, 5-methyl cytosine, or thymine; R5, R6, and RIO are each independently adenine, 5-methyl cytosine, or cytosine; R8 is guanine or thymine; R9 and R12 are each independently cytosine, 5-methyl cytosine, or guanine; R l 1 is adenine or guanine; R12 is cytosine, 5-methyl cytosine, or thymine; and Y1-Y10 are H and Z1-Z10 each independently H or OMe, or the respective Y and Z groups on a sugar moiety join to form an internal ether where Y is methylene and Z is an oxygen atom. In some embodiments, the miRNA inhibitor comprises counter-ions other than sodium, or is a protonated version thereof. [0008] Methods of inhibiting mir-22 in a cell are disclosed herein. In some embodiments, a method of inhibiting mir-22 in a cell comprises administering to the cell a mir-22 antagonist, a molecule comprising a therapeutic agent conjugated to a fatty acid, a liposome comprising phospholipids, cholesterol, and a therapeutic agent, or a nanoparticle containing a therapeutic agent. The cell may be an adipocyte, pre-adipocyte, fibroblast, or vascular endothelial cell. In some embodiments, the cell is an adipose tissue cell. In further embodiments, the adipose tissue cell is subcutaneous white adipose cell or brown adipose tissue cell. [0009] Some aspects of the present disclosure are directed towards a molecule comprising a therapeutic agent conjugated to a fatty acid. In some embodiments, the fatty acid may be a CIO to C35 chain fatty acid. In some embodiments, the fatty acid selected from decanoic acid, dodecanoic acid, oleic acid, stearic acid, docosanoic acid, and dotriacontahexaenoic acid. In some embodiments, the therapeutic agent is a nucleic acid (Oligonucleotide Therapeutic, ONT), a gene editing agent, a polypeptide, or a small molecule. In some embodiments, the nucleic acid is a miRNA. [0010] Some aspects of the present disclosure are directed towards a liposome comprising phospholipids and cholesterol. The liposome diameter may range from 100 to 200 nm. In some embodiments, the liposome comprises a targeting element such as a peptide or an antibody. In some embodiments, the targeting element is a TSP-1 polypeptide. In some embodiments, the TSP-1 polypeptide comprises the sequence GVITRIR (SEQ ID NO:l). In some embodiments, the targeting element is a Hexarelin polypeptide. In some embodiments, the Hexarelin polypeptide comprises the sequence HWAWFL (SEQ ID NO:2). In some embodiments, the targeting element is a Prohibitin polypeptide. In some embodiments, the Prohibitin polypeptice comprises the sequence CKGGRAKDC (SEQ ID NO:3). The liposomal phospholipids and cholesterol may be present in a weight ratio of 80:20. In some embodiments, the phospholipids are selected from sphingomyelin, 1,2- dimyristoyl-sn-glycero-3-phosphocholine (DMPC), or both. In some embodiments, the liposome comprises both sphingomyelin and DMPC. Sphingomyelin, DMPC, and cholesterol may be present in a weight ratio of 40:40:20. In some embodiments, the liposome further comprises a therapeutic agent. In some embodiments, the therapeutic agent may be a polypeptide, a nucleic acid, or a small molecule. In some embodiments, the therapeutic agent is conjugated to a fatty acid.
Load more

Recommended publications
  • Mice Subjected to Ap2-Cre Mediated Ablation of Microsomal Triglyceride Transfer Protein Are Resistant to High Fat Diet Induced Obesity Ahmed Bakillah1,2* and M
    Bakillah and Hussain Nutrition & Metabolism (2016) 13:1 DOI 10.1186/s12986-016-0061-6 RESEARCH Open Access Mice subjected to aP2-Cre mediated ablation of microsomal triglyceride transfer protein are resistant to high fat diet induced obesity Ahmed Bakillah1,2* and M. Mahmood Hussain1,2,3 Abstract Background: Microsomal triglyceride transfer protein (MTP) is essential for the assembly of lipoproteins. MTP has been shown on the surface of lipid droplets of adipocytes; however its function in adipose tissue is not well defined. We hypothesized that MTP may play critical role in adipose lipid droplet formation and expansion. Methods: Plasmids mediated overexpression and siRNA mediated knockdown of Mttp gene were performed in 3T3-L1 pre-adipocytes to evaluate the effects of MTP on cell differentiation and triglyceride accumulation. Adipose- specific knockdown of MTP was achieved in mice bybreeding MTP floxed (Mttpfl/fl) mice with aP2-Cre recombinase transgenic mice. Adipose-specific MTP deficient (A-Mttp-/-) mice were fed 60 % high-fat diet (HFD), and the effects of MTP knockdown on body weight, body fat composition, plasma and tissues lipid composition, glucose metabolism, lipogenesis and intestinal absorption was studied. Lipids were measured in total fasting plasma and size fractionated plasma using colorimetric assays. Gene expression was investigated by Real-Time quantitative PCR. All data was assessed using t-test, ANOVA. Results: MTP expression increased during early differentiation in 3T3-L1 cells, and declined later. The increases in MTP expression preceded PPARγ expression. MTP overexpression enhanced lipid droplets formation, and knockdown attenuated cellular lipid accumulation. These studies indicated that MTP positively affects adipogenesis.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals
    animals Review Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals Mohammadreza Mohammadabadi 1 , Farhad Bordbar 1,* , Just Jensen 2 , Min Du 3 and Wei Guo 4 1 Department of Animal Science, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman 77951, Iran; [email protected] 2 Center for Quantitative Genetics and Genomics, Aarhus University, 8210 Aarhus, Denmark; [email protected] 3 Washington Center for Muscle Biology, Department of Animal Sciences, Washington State University, Pullman, WA 99163, USA; [email protected] 4 Muscle Biology and Animal Biologics, Animal and Dairy Science, University of Wisconsin-Madison, Madison, WI 53558, USA; [email protected] * Correspondence: [email protected] Simple Summary: Skeletal muscle mass is an important economic trait, and muscle development and growth is a crucial factor to supply enough meat for human consumption. Thus, understanding (candidate) genes regulating skeletal muscle development is crucial for understanding molecular genetic regulation of muscle growth and can be benefit the meat industry toward the goal of in- creasing meat yields. During the past years, significant progress has been made for understanding these mechanisms, and thus, we decided to write a comprehensive review covering regulators and (candidate) genes crucial for muscle development and growth in farm animals. Detection of these genes and factors increases our understanding of muscle growth and development and is a great help for breeders to satisfy demands for meat production on a global scale. Citation: Mohammadabadi, M.; Abstract: Farm-animal species play crucial roles in satisfying demands for meat on a global scale, Bordbar, F.; Jensen, J.; Du, M.; Guo, W.
    [Show full text]
  • Original Article
    Original Article Deletion of Rictor in Brain and Fat Alters Peripheral Clock Gene Expression and Increases Blood Pressure Katja Drägert, Indranil Bhattacharya, Giovanni Pellegrini, Petra Seebeck, Abdelhalim Azzi, Steven A. Brown, Stavroula Georgiopoulou, Ulrike Held, Przemyslaw Blyszczuk, Margarete Arras, Rok Humar, Michael N. Hall, Edouard Battegay, Elvira Haas Abstract—The mammalian target of rapamycin complex 2 (mTORC2) contains the essential protein RICTOR and is activated by growth factors. mTORC2 in adipose tissue contributes to the regulation of glucose and lipid metabolism. In the perivascular adipose tissue, mTORC2 ensures normal vascular reactivity by controlling expression of inflammatory molecules. To assess whether RICTOR/mTORC2 contributes to blood pressure regulation, we applied a radiotelemetry approach in control and Rictor knockout (RictoraP2KO) mice generated using adipocyte protein-2 gene promoter–driven CRE recombinase expression to delete Rictor. The 24-hour mean arterial pressure was increased in RictoraP2KO mice, and the physiological decline in mean arterial pressure during the dark period was impaired. In parallel, heart rate and locomotor activity were elevated during the dark period with a pattern similar to blood pressure changes. This phenotype was associated with mild cardiomyocyte hypertrophy, decreased cardiac natriuretic peptides, and their receptor expression in adipocytes. Moreover, clock gene expression was reduced or phase-shifted in perivascular adipose tissue. No differences in clock gene expression were observed in the master clock suprachiasmatic nucleus, although Rictor gene expression was also lower in brain of RictoraP2KO mice. Thus, this study highlights the importance of RICTOR/mTORC2 for interactions between vasculature, adipocytes, and brain to tune physiological outcomes, such as blood pressure and locomotor activity.
    [Show full text]
  • Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
    Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation.
    [Show full text]
  • STX Stainless Steel Boxes Characteristics Enclosure and Door Manufactured from AISI 304 Stainless Steel (AISI 316 on Request)
    STX stainless steel boxes characteristics Enclosure and door manufactured from AISI 304 stainless steel (AISI 316 on request). Mounting plate manufactured from 2.5mm sendzimir sheet steel. Hinge in stainless steel. composition Box complete with: • mounting plate • locking system body in zinc alloy and lever in stainless steel with Ø 3mm double bar key • package with hardware for earth connection and screws to mounting plate. conformity and approval protection degree • IP 65 complying with EN50298; EN60529 for box with single blank door • IP 55 complying with EN50298; EN60529 for box with double blank door • type 12, 4, 4X complying with UL508A; UL50 • impact resistance IK10 complying with EN50298; EN50102. box with single blank door code B A P C D E F weight kg mod. art. STX2 315 200 300 150 150 250 * 219 6 STX3 415 300 400 150 250 350 215 319 9,5 STX3 420 300 400 200 250 350 215 319 11 STX4 315 400 300 150 350 250 315 219 9,5 STX4 420 400 400 200 350 350 315 319 13,5 STX4 520 400 500 200 350 450 315 419 15,5 STX4 620 400 600 200 350 550 315 519 18 STX5 520 500 500 200 450 450 415 419 18 STX5 725 500 700 250 450 650 415 619 27 STX6 420 600 400 200 550 350 315 519 17,3 STX6 620 600 600 200 550 550 515 519 24,5 STX6 625 600 600 250 550 550 515 519 27 STX6 630 600 600 300 550 550 515 519 30 STX6 820 600 800 200 550 750 515 719 31 STX6 825 600 800 250 550 750 515 719 34 STX6 830 600 800 300 550 750 515 719 37 STX6 1230 600 1200 300 550 1150 515 1119 54 STX8 830 800 800 300 750 750 715 719 48 STX8 1030 800 1000 300 750 950 715 919 58 STX8 1230 800 1200 300 750 1150 715 1119 67 * B=200 M6 studs welded only on the hinge side.
    [Show full text]
  • Acid Sphingomyelinase Regulates the Localization and Trafficking of Palmitoylated Proteins
    Chemistry and Biochemistry Faculty Publications Chemistry and Biochemistry 5-29-2019 Acid Sphingomyelinase Regulates the Localization and Trafficking of Palmitoylated Proteins Xiahui Xiong University of Nevada, Las Vegas, [email protected] Chia-Fang Lee Protea Biosciences Wenjing Li University of Nevada, Las Vegas, [email protected] Jiekai Yu University of Nevada, Las Vegas, [email protected] Linyu Zhu University of Nevada, Las Vegas SeeFollow next this page and for additional additional works authors at: https:/ /digitalscholarship.unlv.edu/chem_fac_articles Part of the Biochemistry, Biophysics, and Structural Biology Commons Repository Citation Xiong, X., Lee, C., Li, W., Yu, J., Zhu, L., Kim, Y., Zhang, H., Sun, H. (2019). Acid Sphingomyelinase Regulates the Localization and Trafficking of Palmitoylated Proteins. Biology Open 1-56. Company of Biologists. http://dx.doi.org/10.1242/bio.040311 This Article is protected by copyright and/or related rights. It has been brought to you by Digital Scholarship@UNLV with permission from the rights-holder(s). You are free to use this Article in any way that is permitted by the copyright and related rights legislation that applies to your use. For other uses you need to obtain permission from the rights-holder(s) directly, unless additional rights are indicated by a Creative Commons license in the record and/ or on the work itself. This Article has been accepted for inclusion in Chemistry and Biochemistry Faculty Publications by an authorized administrator of Digital Scholarship@UNLV. For
    [Show full text]
  • Integrative Clinical Sequencing in the Management of Refractory Or
    Supplementary Online Content Mody RJ, Wu Y-M, Lonigro RJ, et al. Integrative Clinical Sequencing in the Management of Children and Young Adults With Refractory or Relapsed CancerJAMA. doi:10.1001/jama.2015.10080. eAppendix. Supplementary appendix This supplementary material has been provided by the authors to give readers additional information about their work. © 2015 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/29/2021 SUPPLEMENTARY APPENDIX Use of Integrative Clinical Sequencing in the Management of Pediatric Cancer Patients *#Rajen J. Mody, M.B.B.S, M.S., *Yi-Mi Wu, Ph.D., Robert J. Lonigro, M.S., Xuhong Cao, M.S., Sameek Roychowdhury, M.D., Ph.D., Pankaj Vats, M.S., Kevin M. Frank, M.S., John R. Prensner, M.D., Ph.D., Irfan Asangani, Ph.D., Nallasivam Palanisamy Ph.D. , Raja M. Rabah, M.D., Jonathan R. Dillman, M.D., Laxmi Priya Kunju, M.D., Jessica Everett, M.S., Victoria M. Raymond, M.S., Yu Ning, M.S., Fengyun Su, Ph.D., Rui Wang, M.S., Elena M. Stoffel, M.D., Jeffrey W. Innis, M.D., Ph.D., J. Scott Roberts, Ph.D., Patricia L. Robertson, M.D., Gregory Yanik, M.D., Aghiad Chamdin, M.D., James A. Connelly, M.D., Sung Choi, M.D., Andrew C. Harris, M.D., Carrie Kitko, M.D., Rama Jasty Rao, M.D., John E. Levine, M.D., Valerie P. Castle, M.D., Raymond J. Hutchinson, M.D., Moshe Talpaz, M.D., ^Dan R. Robinson, Ph.D., and ^#Arul M. Chinnaiyan, M.D., Ph.D. CORRESPONDING AUTHOR (S): # Arul M.
    [Show full text]
  • Adenovirus-Mediated Interference of FABP4 Regulates Mrna Expression of ADIPOQ, LEP and LEPR in Bovine Adipocytes
    Adenovirus-mediated interference of FABP4 regulates mRNA expression of ADIPOQ, LEP and LEPR in bovine adipocytes S. Wei1,3, L.S. Zan1,2, H.B. Wang1, G. Cheng1, M. Du3, Z. Jiang3, G.J. Hausman4, D.C. McFarland5 and M.V. Dodson3 1College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, P.R. China 2National Beef Cattle Improvement Center, Yangling, Shaanxi, P.R. China 3Department of Animal Sciences, Washington State University, Pullman, WA, USA 4United States Department of Agriculture, Agriculture Research Services, Athens, GA, USA 5Department of Animal Science, South Dakota State University, Brookings, SD, USA Corresponding authors: L.S. Zan / M.V. Dodson E-mail: [email protected] / [email protected] Genet. Mol. Res. 12 (1): 494-505 (2013) Received May 9, 2012 Accepted September 13, 2012 Published January 4, 2013 DOI http://dx.doi.org/10.4238/2013.January.4.21 ABSTRACT. Fatty acid binding protein 4 (FABP4) is an important adipocyte gene, with roles in fatty acid transport and fat deposition in animals as well as human metabolic syndrome. However, little is known about the functional regulation of FABP4 at the cellular level in bovine. We designed and selected an effective shRNA (small hairpin RNA) against bovine FABP4, constructed a corresponding adenovirus (AD-FABP4), and then detected its influence on mRNA expression of four differentiation-related genes (PPARᵧ, CEBPA, CEBPB, and SREBF1) and three lipid metabolism-related genes (ADIPOQ, LEP and LEPR) of adipocytes. The FABP4 mRNA content, derived from bovine adipocytes, decreased by 41% (P < 0.01) after 24 h and 66% (P < 0.01) Genetics and Molecular Research 12 (1): 494-505 (2013) ©FUNPEC-RP www.funpecrp.com.br shRNA interference of FABP4 in bovine adipocytes 495 after 72 h of AD-FABP4 infection.
    [Show full text]