Int. J. Med. Sci. 2018, Vol. 15 1227

Ivyspring International Publisher International Journal of Medical Sciences 2018; 15(11): 1227-1234. doi: 10.7150/ijms.25662 Research Paper Long non-coding RNA NEAT1 promotes proliferation, migration and invasion of human osteosarcoma cells Pengcheng Li1, Rui Huang2, Tao Huang1, Shuo Cheng1, Yao Chen1, Zhihang Wang1

1. Department of Orthopedics, The First Affiliated Hospital of China Medical University. Shenyang 110001, Liaoning, P.R. China 2. Department of Clinical Medicine, Da Lian Medical University. Dalian 116000, Liaoning, P.R. China.

 Corresponding author: Tao Huang, Department of Orthopedics, The First Affiliated Hospital of China Medical University. Shenyang 110001, Liaoning, P.R. China. Email: [email protected]

© Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions.

Received: 2018.02.22; Accepted: 2018.05.27; Published: 2018.07.30

Abstract Aim: Long non-coding (LncRNAs) have been identified to play a crucial role in tumorigenesis and the progression of many types of tumors. However, the clinical significance and biological function of lncRNA nuclear-enriched abundant transcript 1(NEAT1) in human osteosarcoma remains unknown. Here, we investigated the role of NEAT1 in human osteosarcoma cell lines and clinical tumor samples. Methods: In this study, expression of NEAT1 was analyzed in 19 osteosarcoma tissues and paired adjacent non-tumor tissues by using quantitative real-time PCR. Additionally, knockdown of NEAT1 expression using Lentivirus-mediated siRNA was performed in order to explore the biological function of NEAT1 on osteosarcoma cell proliferation and metastasis through MTT, colony formation assay and transwell assay. Results: NEAT1 was over-expressed in osteosarcoma tissues compared with adjacent non-tumor tissues. In addition, knockdown of NEAT1 expression could suppress cell proliferation, migration and invasion in vitro. Conclusion: LncRNA NEAT1 was up-regulated in osteosarcoma tissue, promoting proliferation and metastasis of osteosarcoma cells. These findings indicate the role of this substance, as a growth regulator in osteosarcoma, and thus it may serve as a novel biomarker, and drug target for developing osteosarcoma therapies.

Key words: NEAT1, Long non-coding RNA, Osteosarcoma

Introduction Osteosarcoma is the most common malignant transcripts. Recent studies have demonstrated that bone tumor of mesenchymal origin, usually occurring lncRNAs are emerging as new regulators within in children and adolescents with early occurrence cellular processes such as cell proliferation, commonly leading to pulmonary metastasis and a differentiation, apoptosis, and disease pathogenesis. poor prognosis overall [1]. Combination of limb Further evidence has shown that aberrantly expressed salvage and neoadjuvant chemotherapy as a lncRNAs are associated with tumorigenesis in treatment strategy for this condition has increased numerous types of cancers such as gastric cancer, five-year disease-free survival rates to 70% [2-4]. cervical cancer [5], lung cancer and hepatocellular Unfortunately, the toxic effects of chemotherapy, carcinoma [6], suggesting that they may perform an resistance to treatment, and the spread of metastasis important regulatory function in tumorigenesis and remain some of the main obstacles to treatment of the cancer progression. disease. Therefore, it is necessary to explore the LncRNA nuclear-enriched abundant transcript 1 potential molecular mechanisms of this condition to (NEAT1), which has two isoforms, 3.7 kb NEAT1_1 discover novel biomarkers which may lead to the and 23 kb NEAT1_2, identified from the multiple development of diagnosis and treatment of endocrine neoplasia located at 11q13.1 osteosarcoma. [7], is an crucial element of nuclear [8]. LncRNAs are more than 200 nucleotides in Some studies have showed that aberrant expression of length, containing non--coding capacity NEAT1 is correlated to a range of cancers diagnoses.

http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1228

For example, Fu et al. found that lncRNA NEAT1 was “TGGCTAGCTCAGGGCTTCAG”. Osteosarcoma overexpressed in gastric cancer tissues and cell lines cells U-2 OS were transfected at a multiplicity of as well as clinical stage and distant metastases [9]. Li infection of 20, and then the transfected U-2 OS cells et al. also showed that NEAT1 was overexpressed in, were normal cultured 72 h to perform the following and correlated with poor prognosis in, endometrial assays. cancer. Further studies suggested that NEAT1 promoted cell proliferation, invasion, migration and Cell proliferation analysis inhibited cell apoptosis in endometrial cancer [10]. Cell viability was measured using an “MTT kit” Additionally, Guo found lncRNA NEAT1 expression (Keygen Biotech, Jiangsu China) according to the was increased in hepatocellular carcinoma tissues and manufacturer’s instruction. A total of 3,000 related to tumor size and TNM stage [11]. These transfected cells/well were seeded in 96‑well plates findings suggest that NEAT1 may participate in the and incubated at 37˚C in 5% CO2 for 1 day. Then, 50 progression of various human cancers. To date ml MTT solution was added into the medium for 4 h however, the emerging potential role and mechanism incubation at 37˚C in 5% CO2, and then each well was of NEAT1 in osteosarcoma is yet unclear. replaced with 150 ml dimethylsulfoxide. Cell In this study, the biological functions of lncRNA proliferation was then monitored at 24, 48, 72 and 96 NEAT1 in osteosarcoma development have been h. The absorbance value (OD) of each well was then explored, by examining the expression pattern of measured at 490 nm. NEAT1 in osteosarcoma tissues, followed by Cell formation assay correlation analysis with respect to clinicopatho- 3 logical features of the disease. Moreover, in vitro Transfected cells (0.5x10 ) were placed into each assays were performed to demonstrate the biological well of 6-well plates and cultured for two weeks, with functions of NEAT1 in osteosarcoma cell lines. nutrient media being replaced every 4 days. Colonies were then fixed with 10% formaldehyde for 20mins, Materials and methods followed by staining with 0.1% crystal violet in phosphate buffered saline (PBS) for 5 minutes. The Patients and samples total number of stained colonies was then counted. Osteosarcoma tissues and their adjacent non-tumor tissues were obtained from 19 Cell migration and invasion assays pathologically diagnosed osteosarcoma patients who Osteosarcoma cell lines were harvested and underwent resection of osteosarcoma within the First collected 48 h after transfection with si-NEAT1 or Hospital of China Medical University, (Shenyang, si-NC. In the migration assay, 1x105 cells were seeded China) between July 2010 and July 2014. None of these on a fibronectin-coated polycarbonate membrane patients had received preoperative therapy before insert within a transwell apparatus (Corning). In the surgery. Patients at stage IIB/III were included, and invasion assay, the upper chamber of the apparatus patients with any other primary disease were was pre-coated with 24mg/ml Matrigel (Corning), excluded. All tissues were immediately stored at followed by 1x105 transfected cells being placed into -80°C. Related clinical data was also retrieved from the upper chamber. Inserts were then placed into the each patient’s medical records. This study was bottom chamber wells of the apparatus containing approved by the ethics committee of First Hospital of 1640-medium with 10% FBS. After the cells were China Medical University, and informed consent was incubated for 24 h, the cells remaining on the upper obtained from all of the patients. membrane were removed by scrubbing with a cotton swab. Giemsa-stained cells adhering to the lower Cell culture surface were counted under a microscope in five The human osteosarcoma cell line U-2 OS was predetermined fields. purchased from Shanghai Gefan Biotechnology. All cell lines were cultured in RPMI-1640 (GIBCO) Quantitative real-time PCR analyses medium supplemented with 10% fetal bovine serum (qRT-PCR) (VAN Biotech) at 37°C in CO2 (5%). Total RNA was extracted from tissues or cells using TRIzol reagent (Invitrogen). cDNA synthesis Cell transfection was performed using a PrimeScript RT Reagent Kit Osteosarcoma cells U-2 OS were transfected with with gDNA Eraser (Takara). Real-time PCR analyses shRNAs which were synthesized and inserted into the were performed with SYBR Premix Ex Taq (Takara). lentivirus core vector (hU6-MCS-CMV-RFP), Relative expression was calculated via the purchased from GeneChem (Shanghai, China). The comparative cycle threshold method, and results were sequence of shRNA for NEAT1 was normalized to the expression of GAPDH. The

http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1229 sequences of specific RNA primers for NEAT1 or proliferation in U-2 OS compared with the negative GAPDH were as follows: NEAT1 sense, control group (p<0.05) (Figure 3). Further, colony 5′-TGGCTAGCTCAGGGCTTCAG-3′ and reverse, formation assays suggested that silencing of NEAT1 5′-TCTCCTTGCCAAGCTTCCTTC-3′; GAPDH sense, significantly decreased the number of colonies formed 5′-GAAGGTGAAGGTCGGAGTC-3′ and reverse, by U-2 OS (p<0.05) (Figure 4A, Figure 4B, Figure 4C). 5′-GAAGATGGTGATGGGATTTC-3′. The qRT-PCR and data collection were performed on Applied Reduced lncRNA NEAT1 expression and Biosystems 7900 Fast Real-Time PCR System (Applied inhibition of invasion and migration of Biosystems). Relative expression was calculated by osteosarcoma cells using the 2-ΔΔCt method. To investigate the effect of NEAT1 silencing on osteosarcoma cell invasion and migration, transwell Statistical analysis invasion and migration assays were performed. All experiments were performed in triplicate. Results indicated that the migration ability of SPSS 19.0 software and GraphPad Prism 6 were used osteosarcoma cell U-2 OS transfected with si-NEAT1 to analyze data for statistical significance. The (Figure 5B) was significantly reduced compared with two-tailed Student’s t test was used for comparisons si-NC group (Figure 5A). Similar results were also of two independent groups. A p value of less than 0.05 seen in invasion assays, with U-2OS cells transfected denoted significance. with si-NEAT1 (Figure 5D) exhibiting a lower ability than that those in the si-NC group (Figure 5C). These Results results suggest that NEAT1 has a role in the LncRNA NEAT1 overexpression in promotion of metastasis of osteosarcoma. osteosarcoma tissues Discussion Real-Time PCR was performed to detect the LncRNAs are more than 200 nucleotides in expression level of NEAT1 in 19 osteosarcoma tissues length, possessing a non-protein-coding capacity, and and their adjacent non-tumor tissues (ANCT). Results lacking an open reading frame [12]. In recent years, indicated that the lncRNA NEAT1 expression level more and more evidence has suggested that long was significantly increased compared to that in ANCT non-coding RNAs play important roles in gene (p<0.05) (Figure 1). imprinting, cell differentiation, immune response, the occurrence of human disease, tumors, and other biological functions [13-14]. Further work has also indicated that an absence of regulation of lncRNAs is involved in tumorigenesis and cancer progression [15]. For example, Qiu G et al showed that the lncRNA MATAL1 was overexpressed in colorectal carcinoma, with high levels of MATAL1 expression being associated with the TNM stage of the disease [16]. Moreover, research conducted by J Qiu et al suggested that the levels of expression of the lncRNA HOTRIL were significantly high within epithelial Figure 1. Relative expression of lncRNA NEAT1 in osteosarcoma tissues in ovarian cancer tissues in comparison to normal comparison with ANCT. LncRNA NEAT1 expression was examined by qRT-PCR and normalized to GAPDH expression. * p<0.05. ovarian tissues, with high expression of HOTAIR being closely associated with the occurrence, development, invasion, metastasis, and prognosis in Silencing of lncRNA NEAT1 and inhibition of epithelial ovarian cancer [17]. In addition, Matouk IJ proliferation of osteosarcoma cells et al suggested that the lncRNA HULC was upregulated in hepatocellular carcinoma and hepatic Lentivirus-mediated silencing of NEAT1 colorectal metastasis, indicating that HULC could expression in osteosarcoma cell lines (U-2 OS) was likely to become a new marker of hepatic colorectal used to investigate the function of NEAT1 on metastasis [18]. Several studies have also indicated osteosarcoma cell proliferation. Real-Time PCR that some transcription factors could be involved in results indicated that expression level of NEAT1 in the regulation of expression of lncRNAs, such as U-2 OS transfected with si-NEAT1 was significantly c-myc, which has been suggested to play a role in the reduced (p<0.05) (Figure 2A, Figure 2B, Figure 2C). transcription of HOTAIR, and further, that p53 could MTT assay results also indicated that silencing of have a function in the regulation of PVT-1 expression NEAT1 expression significantly suppressed cell

http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1230

[19-20]. All of the studies identified here suggest that prognostic indicators. However, the function of aberrant expression of lncRNA is correlated with NEAT1 in osteosarcoma has, to this point, remained tumors progression, and thus, they can be used as unknown.

Figure 2. A, B: Lentivirus-mediated siRNA decreased the expression of NEAT1 in U-2 OS and relative NEAT1 expression of U-2 OS cell after transfection. The transfection efficiency was determined 72 h after incubation with lentivirus at an MOI of 20. C: Total RNA was extracted 72 h after transfection, the relative NEAT1 expression was determined using quantitative real-time PCR, and NEAT1 expression levels were normalized against GAPDH. * p<0.05.

http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1231

Figure 3. Downregulation of NEAT1 inhibited osteosarcoma cell U-2 OS proliferation. MTT assay was performed to determine the proliferation of transfected U-2OS cells. * p<0.05, ** p<0.01.

Figure 4. A, B, C: Downregulation of NEAT1 inhibited osteosarcoma cell U-2 OS proliferation. Colony formation assay was performed to detect the proliferation of transfected U-2OS cells. * p<0.05.

http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1232

http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1233

Figure 5. Downregulation of NEAT1 inhibited osteosarcoma cell U-2 OS migration and invasion. A, B: Transwell migration assays were used to investigate the migration of transfected U-2 OS cells, C, D: Transwell invasion assays were used to investigate the invasion of transfected U-2 OS cells. E: The number of cells passed through Transwell chamber * p<0.05.

LncRNA NEAT1, locus on , is high risk of NSCLC patients [27]. Unfortunately, the transcribed from the familial tumor syndrome. As a effects of NEAT1 in osteosarcoma were not tracked in new class of sub-nuclear bodies, paraspeckles contain the same study. RNA-binding in mammalian cells. NEAT1 has two isoforms, 3.7 kb NEAT1_1 and Paraspeckles can regulate gene expression via 23 kb NEAT1_2. These two isoforms of NEAT1 share maintaining mRNAs for rewriting in the nucleus. the same transcriptional start site and the same RNA NEAT1 serves as a crucial component of paraspeckles polymerase II promoter. They just differ in the [21-23]. Indeed, aberrant expression of NEAT1 has location of their 3’ ends. The NEAT1_2 has a been reported play an important function within tRNA-like structure at its 3’ end that is processed by various human cancers [24]. With regards to existing RNaseP cleavage rather than a poly-A tail [28]. The literature, Chakravarty D et al found that NEAT1 was primers for NEAT1 and shRNA we designed had upregulated in prostate cancer; and further studies included these two isoforms and mRNA have shown that NEAT1 has induced oncogenic measurements had covered both isoforms as well. growth by altering the epigenetic landscape of target In this work, we have identified that the gene promoters to favour transcription [25]. An expression level of NEAT1 was frequently additional study postulated that the expression of overexpressed within osteosarcoma tissues, compared NEAT1 is cooperatively controlled by HuR and with adjacent non-tumor tissues, suggesting that miR-124-3p, and has responsibilities within the NEAT1 may also play a significant role in regulation of ovarian carcinogenesis [26]. In lung osteosarcoma development and progression. To fur- cancer, a strong correlation of high NEAT1 expression ther explore the underlying mechanism of lncRNA in tumors with poor survival was confirmed in NEAT1 in osteosarcoma progression, we silenced NSCLC tissues, indicating that NEAT1 expression NEAT1 expression in the osteosarcoma cell U-2 OS by levels could be a helpful prognostic biomarker for way of Lentivirus-mediated RNA interference,

http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1234 followed by real-time PCR in order to detect the 9. Fu JW, Kong Y, Sun X. Long noncoding RNA NEAT1 is an unfavorable prognostic factor and regulates migration and invasion in gastric cancer. J expression of NEAT1. We observed the fluorescence Cancer Res Clin Oncol. 2016; 142: 1571-9. 10. Li Z, Wei D, Yang C, Sun H, Lu T, Kuang D. Overexpression of long carefully under the inverted microscope and using noncoding RNA, NEAT1 promotes cell proliferation, invasion and migration RT-PCR to ensure the infection efficiency. MTT in endometrial endometrioid adenocarcinoma. Biomed Pharmacother. 2016; 84: 244-51. assays, colony formation assays and transwell assays 11. Guo S, Chen W, Luo Y, Ren F, Zhong T, Rong M, et al. Clinical implication of were all employed to detect proliferation, migration long non-coding RNA NEAT1 expression in hepatocellular carcinoma patients. Int J Clin Exp Pathol. 2015; 8: 5395-402. and invasion capacity of osteosarcoma U-2 OS cells, 12. Zaratiegui M, Irvine DV, Martienssen RA. Noncoding RNAs and gene with these assays indicating that silencing of NEAT1 silencing. Cell. 2007; 128: 763-76. 13. Guttman M, Rinn JL. Modular regulatory principles of large non-coding significantly suppressed the proliferation, migration RNAs. Nature. 2012; 482: 339-46. and invasion of osteosarcoma cells in vitro. These data 14. Esteller M. Non-coding RNAs in human disease. Nat Rev Genet. 2011; 12: 861-74. further support the importance of NEAT1 in cellular 15. Wilusz JE, Sunwoo H, Spector DL. Long noncoding RNAs: functional biology and oncogenesis of osteosarcoma cells. surprises from the RNA world. Genes Dev. 2009; 23: 1494-504. 16. Qiu G, Zhang XB, Zhang SQ, Liu PL, Wu W, Zhang JY, et al. Dysregulation of However, further study is required in order to MALAT1 and miR-619-5p as a prognostic indicator in advanced colorectal identify the exact pathway through which NEAT1 carcinoma. Oncol Lett. 2016; 12: 5036-42. 17. Qiu JJ, Wang Y, Ding JX, Jin HY, Yang G, Hua KQ. The long non-coding RNA influences osteosarcoma and how this pathway HOTAIR promotes the proliferation of serous ovarian cancer cells through the regulation of cell cycle arrest and apoptosis. Exp Cell Res. 2015; 333: 238-48. works. 18. Matouk IJ, Abbasi I, Hochberg A, Galun E, Dweik H, Akkawi M. Highly In summary, we have demonstrated that NEAT1 upregulated in liver cancer noncoding RNA is overexpressed in hepatic colorectal metastasis. Eur J Gastroenterol Hepatol. 2009; 21: 688-92. is commonly upregulated in human osteosarcoma, 19. Ma MZ, Li CX, Zhang Y, Weng MZ, Zhang MD, Qin YY, et al. Long allowing this to be potentially harnessed as a non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer. Mol Cancer. 2014; 13: 156. prognostic factor for this condition and further, the 20. Barsotti AM, Beckerman R, Laptenko O, Huppi K, Caplen NJ, Prives C. silencing of NEAT1 may act as a potentially p53-Dependent induction of PVT1 and miR-1204. J Biol Chem. 2012; 287: 2509-19. significant target for the inhibition of osteosarcoma 21. Choudhry H, Albukhari A, Morotti M, Haider S, Moralli D, Smythies J, et al. cell proliferation and metastasis in vivo. These results Tumor hypoxia induces nuclear formation through HIF-2alpha dependent transcriptional activation of NEAT1 leading to cancer cell survival. underscore the importance of NEAT1 in osteosarcoma Oncogene. 2015; 34: 4546. development. 22. Chen LL, Carmichael GG. Altered nuclear retention of mRNAs containing inverted repeats in human embryonic stem cells: functional role of a nuclear noncoding RNA. Mol Cell. 2009; 35: 467-78. Acknowledgments 23. Hutchinson JN, Ensminger AW, Clemson CM, Lynch CR, Lawrence JB, Chess A. A screen for nuclear transcripts identifies two linked noncoding RNAs This paper was supported by the natural science associated with SC35 splicing domains. BMC Genomics. 2007; 8: 39. 24. Zeng C, Xu Y, Xu L, Yu X, Cheng J, Yang L, et al. Inhibition of long non-coding foundation of science and technology department of RNA NEAT1 impairs myeloid differentiation in acute promyelocytic leukemia Liaoning province. cells. BMC Cancer. 2014; 14: 693. 25. Chakravarty D, Sboner A, Nair SS, Giannopoulou E, Li R, Hennig S, et al. The oestrogen receptor alpha-regulated lncRNA NEAT1 is a critical modulator of Competing Interests prostate cancer. Nat Commun. 2014; 5: 5383. 26. Chai Y, Liu J, Zhang Z, Liu L. HuR-regulated lncRNA NEAT1 stability in The authors have declared that no competing tumorigenesis and progression of ovarian cancer. Cancer Med. 2016; 5: 1588-98. interest exists. 27. Sun C, Li S, Zhang F, Xi Y, Wang L, Bi Y, et al. Long non-coding RNA NEAT1 promotes non-small cell lung cancer progression through regulation of References miR-377-3p-E2F3 pathway. Oncotarget. 2016; 7: 51784-814. 28. Sunwoo H, Dinger ME, Wilusz JE, Amaral PP, Mattick JS, Spector DL. MEN 1. Rasalkar DD, Chu WC, Lee V, Paunipagar BK, Cheng FW, Li CK. Pulmonary epsilon/beta nuclear-retained non-coding RNAs are up-regulated upon metastases in children with osteosarcoma: characteristics and impact on muscle differentiation and are essential components of paraspeckles. Genome patient survival. Pediatr Radiol. 2011; 41: 227-36. Res. 2009; 19: 347-59. 2. Choeyprasert W, Natesirinilkul R, Charoenkwan P, Sittipreechacharn S. Carboplatin and doxorubicin in treatment of pediatric osteosarcoma: a 9-year single institute experience in the Northern Region of Thailand. Asian Pac J Cancer Prev. 2013; 14: 1101-6. 3. Bacci G, Balladelli A, Palmerini E, Alberghini M, Pollastri P, Galletti S, et al. Neoadjuvant chemotherapy for osteosarcoma of the extremities in preadolescent patients: the Rizzoli Institute experience. J Pediatr Hematol Oncol. 2008; 30: 908-12. 4. Bacci G, Ferrari S, Mercuri M, Longhi A, Fabbri N, Galletti S, et al. Neoadjuvant chemotherapy for osteosarcoma of the extremities in patients aged 41-60 years: outcome in 34 cases treated with adriamycin, cisplatinum and ifosfamide between 1984 and 1999. Acta Orthop. 2007; 78: 377-84. 5. Lee M, Kim HJ, Kim SW, Park SA, Chun KH, Cho NH, et al. The long non-coding RNA HOTAIR increases tumour growth and invasion in cervical cancer by targeting the Notch pathway. Oncotarget. 2016; 7: 44558-71. 6. Zhang M, Wang W, Li T, Yu X, Zhu Y, Ding F, et al. Long noncoding RNA SNHG1 predicts a poor prognosis and promotes hepatocellular carcinoma tumorigenesis. Biomed Pharmacother. 2016; 80: 73-9. 7. Clemson CM, Hutchinson JN, Sara SA, Ensminger AW, Fox AH, Chess A, et al. An architectural role for a nuclear noncoding RNA: NEAT1 RNA is essential for the structure of paraspeckles. Mol Cell. 2009; 33: 717-26. 8. Sasaki YT, Ideue T, Sano M, Mituyama T, Hirose T. MENepsilon/beta noncoding RNAs are essential for structural integrity of nuclear paraspeckles. Proc Natl Acad Sci U S A. 2009; 106: 2525-30.

http://www.medsci.org