Long Non-Coding RNA NEAT1 Promotes Proliferation, Migration
Total Page:16
File Type:pdf, Size:1020Kb
Int. J. Med. Sci. 2018, Vol. 15 1227 Ivyspring International Publisher International Journal of Medical Sciences 2018; 15(11): 1227-1234. doi: 10.7150/ijms.25662 Research Paper Long non-coding RNA NEAT1 promotes proliferation, migration and invasion of human osteosarcoma cells Pengcheng Li1, Rui Huang2, Tao Huang1, Shuo Cheng1, Yao Chen1, Zhihang Wang1 1. Department of Orthopedics, The First Affiliated Hospital of China Medical University. Shenyang 110001, Liaoning, P.R. China 2. Department of Clinical Medicine, Da Lian Medical University. Dalian 116000, Liaoning, P.R. China. Corresponding author: Tao Huang, Department of Orthopedics, The First Affiliated Hospital of China Medical University. Shenyang 110001, Liaoning, P.R. China. Email: [email protected] © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2018.02.22; Accepted: 2018.05.27; Published: 2018.07.30 Abstract Aim: Long non-coding RNAs (LncRNAs) have been identified to play a crucial role in tumorigenesis and the progression of many types of tumors. However, the clinical significance and biological function of lncRNA nuclear-enriched abundant transcript 1(NEAT1) in human osteosarcoma remains unknown. Here, we investigated the role of NEAT1 in human osteosarcoma cell lines and clinical tumor samples. Methods: In this study, expression of NEAT1 was analyzed in 19 osteosarcoma tissues and paired adjacent non-tumor tissues by using quantitative real-time PCR. Additionally, knockdown of NEAT1 expression using Lentivirus-mediated siRNA was performed in order to explore the biological function of NEAT1 on osteosarcoma cell proliferation and metastasis through MTT, colony formation assay and transwell assay. Results: NEAT1 was over-expressed in osteosarcoma tissues compared with adjacent non-tumor tissues. In addition, knockdown of NEAT1 expression could suppress cell proliferation, migration and invasion in vitro. Conclusion: LncRNA NEAT1 was up-regulated in osteosarcoma tissue, promoting proliferation and metastasis of osteosarcoma cells. These findings indicate the role of this substance, as a growth regulator in osteosarcoma, and thus it may serve as a novel biomarker, and drug target for developing osteosarcoma therapies. Key words: NEAT1, Long non-coding RNA, Osteosarcoma Introduction Osteosarcoma is the most common malignant transcripts. Recent studies have demonstrated that bone tumor of mesenchymal origin, usually occurring lncRNAs are emerging as new regulators within in children and adolescents with early occurrence cellular processes such as cell proliferation, commonly leading to pulmonary metastasis and a differentiation, apoptosis, and disease pathogenesis. poor prognosis overall [1]. Combination of limb Further evidence has shown that aberrantly expressed salvage and neoadjuvant chemotherapy as a lncRNAs are associated with tumorigenesis in treatment strategy for this condition has increased numerous types of cancers such as gastric cancer, five-year disease-free survival rates to 70% [2-4]. cervical cancer [5], lung cancer and hepatocellular Unfortunately, the toxic effects of chemotherapy, carcinoma [6], suggesting that they may perform an resistance to treatment, and the spread of metastasis important regulatory function in tumorigenesis and remain some of the main obstacles to treatment of the cancer progression. disease. Therefore, it is necessary to explore the LncRNA nuclear-enriched abundant transcript 1 potential molecular mechanisms of this condition to (NEAT1), which has two isoforms, 3.7 kb NEAT1_1 discover novel biomarkers which may lead to the and 23 kb NEAT1_2, identified from the multiple development of diagnosis and treatment of endocrine neoplasia located at chromosome 11q13.1 osteosarcoma. [7], is an crucial element of nuclear paraspeckles [8]. LncRNAs are more than 200 nucleotides in Some studies have showed that aberrant expression of length, containing non-protein-coding capacity NEAT1 is correlated to a range of cancers diagnoses. http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1228 For example, Fu et al. found that lncRNA NEAT1 was “TGGCTAGCTCAGGGCTTCAG”. Osteosarcoma overexpressed in gastric cancer tissues and cell lines cells U-2 OS were transfected at a multiplicity of as well as clinical stage and distant metastases [9]. Li infection of 20, and then the transfected U-2 OS cells et al. also showed that NEAT1 was overexpressed in, were normal cultured 72 h to perform the following and correlated with poor prognosis in, endometrial assays. cancer. Further studies suggested that NEAT1 promoted cell proliferation, invasion, migration and Cell proliferation analysis inhibited cell apoptosis in endometrial cancer [10]. Cell viability was measured using an “MTT kit” Additionally, Guo found lncRNA NEAT1 expression (Keygen Biotech, Jiangsu China) according to the was increased in hepatocellular carcinoma tissues and manufacturer’s instruction. A total of 3,000 related to tumor size and TNM stage [11]. These transfected cells/well were seeded in 96‑well plates findings suggest that NEAT1 may participate in the and incubated at 37˚C in 5% CO2 for 1 day. Then, 50 progression of various human cancers. To date ml MTT solution was added into the medium for 4 h however, the emerging potential role and mechanism incubation at 37˚C in 5% CO2, and then each well was of NEAT1 in osteosarcoma is yet unclear. replaced with 150 ml dimethylsulfoxide. Cell In this study, the biological functions of lncRNA proliferation was then monitored at 24, 48, 72 and 96 NEAT1 in osteosarcoma development have been h. The absorbance value (OD) of each well was then explored, by examining the expression pattern of measured at 490 nm. NEAT1 in osteosarcoma tissues, followed by Cell formation assay correlation analysis with respect to clinicopatho- 3 logical features of the disease. Moreover, in vitro Transfected cells (0.5x10 ) were placed into each assays were performed to demonstrate the biological well of 6-well plates and cultured for two weeks, with functions of NEAT1 in osteosarcoma cell lines. nutrient media being replaced every 4 days. Colonies were then fixed with 10% formaldehyde for 20mins, Materials and methods followed by staining with 0.1% crystal violet in phosphate buffered saline (PBS) for 5 minutes. The Patients and samples total number of stained colonies was then counted. Osteosarcoma tissues and their adjacent non-tumor tissues were obtained from 19 Cell migration and invasion assays pathologically diagnosed osteosarcoma patients who Osteosarcoma cell lines were harvested and underwent resection of osteosarcoma within the First collected 48 h after transfection with si-NEAT1 or Hospital of China Medical University, (Shenyang, si-NC. In the migration assay, 1x105 cells were seeded China) between July 2010 and July 2014. None of these on a fibronectin-coated polycarbonate membrane patients had received preoperative therapy before insert within a transwell apparatus (Corning). In the surgery. Patients at stage IIB/III were included, and invasion assay, the upper chamber of the apparatus patients with any other primary disease were was pre-coated with 24mg/ml Matrigel (Corning), excluded. All tissues were immediately stored at followed by 1x105 transfected cells being placed into -80°C. Related clinical data was also retrieved from the upper chamber. Inserts were then placed into the each patient’s medical records. This study was bottom chamber wells of the apparatus containing approved by the ethics committee of First Hospital of 1640-medium with 10% FBS. After the cells were China Medical University, and informed consent was incubated for 24 h, the cells remaining on the upper obtained from all of the patients. membrane were removed by scrubbing with a cotton swab. Giemsa-stained cells adhering to the lower Cell culture surface were counted under a microscope in five The human osteosarcoma cell line U-2 OS was predetermined fields. purchased from Shanghai Gefan Biotechnology. All cell lines were cultured in RPMI-1640 (GIBCO) Quantitative real-time PCR analyses medium supplemented with 10% fetal bovine serum (qRT-PCR) (VAN Biotech) at 37°C in CO2 (5%). Total RNA was extracted from tissues or cells using TRIzol reagent (Invitrogen). cDNA synthesis Cell transfection was performed using a PrimeScript RT Reagent Kit Osteosarcoma cells U-2 OS were transfected with with gDNA Eraser (Takara). Real-time PCR analyses shRNAs which were synthesized and inserted into the were performed with SYBR Premix Ex Taq (Takara). lentivirus core vector (hU6-MCS-CMV-RFP), Relative expression was calculated via the purchased from GeneChem (Shanghai, China). The comparative cycle threshold method, and results were sequence of shRNA for NEAT1 was normalized to the expression of GAPDH. The http://www.medsci.org Int. J. Med. Sci. 2018, Vol. 15 1229 sequences of specific RNA primers for NEAT1 or proliferation in U-2 OS compared with the negative GAPDH were as follows: NEAT1 sense, control group (p<0.05) (Figure 3). Further, colony 5′-TGGCTAGCTCAGGGCTTCAG-3′ and reverse, formation assays suggested that silencing of NEAT1 5′-TCTCCTTGCCAAGCTTCCTTC-3′; GAPDH sense, significantly decreased the number of colonies formed 5′-GAAGGTGAAGGTCGGAGTC-3′ and reverse, by U-2 OS (p<0.05) (Figure 4A, Figure 4B, Figure 4C). 5′-GAAGATGGTGATGGGATTTC-3′. The qRT-PCR and