Defining Critical Windows in Pituitary Development and Elucidating Sex Differences in Response to Bisphenol A

DEFINING CRITICAL WINDOWS IN PITUITARY DEVELOPMENT AND ELUCIDATING SEX DIFFERENCES IN RESPONSE TO BISPHENOL A

KIRSTEN S. ECKSTRUM

DISSERTATION

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Molecular and Integrative Physiology in the Graduate College of the University of Illinois at Urbana-Champaign, 2017

Urbana, Illinois

Doctoral Committee:

Associate Professor Lori Raetzman, Chair Professor Jodi Flaws Professor Milan Bagchi Assistant Professor Erik Nelson

ABSTRACT

Exposure to hormones or endocrine disrupting chemicals (EDCs) can have many adverse effects on the endocrine system and can potentially lead to endocrine related adverse health effects such as reproductive dysfunction, obesity, and thyroid dysfunction. The pituitary gland plays a critical role in regulation of the endocrine axes; therefore, if EDCs affect the pituitary, it could lead to the development of endocrine related health effects. Exposure to EDCs during developmental windows is often more detrimental due to the perceived higher sensitivity and the potential for exposure to have lasting effects. Pituitary development occurs during two critical windows: embryonic and neonatal. During these periods, progenitor cells proliferate and eventually differentiate to one of three lineages. One EDC, bisphenol A (BPA), has been shown to alter embryonic pituitary development in a sex specific manner, however, the effects of exposure in the neonatal period have not been examined. Before examining the potential sex specific effects of BPA exposure, we first analyzed what baseline sex differences exist in the neonatal pituitary. We found that three genes, Lhb, Fshb, and

Icam5, were higher in females than males and that these genes were decreased by exposure to estradiol. All the sexually dichotomous genes were found in the gonadotrope cells of the pituitary, demonstrating that even at an early age, there are sex differences in the neonatal hypothalamic pituitary gonadal axis and estradiol can regulate these differences. Because the neonatal pituitary could be altered by the naturally circulating hormonal milieu, we hypothesized that the neonatal pituitary would be sensitive to exogenous BPA and estradiol (E2) exposure and there would be sex specific effects of this exposure.

We examined the effects of exposure to BPA on the neonatal pituitary.

Interestingly, BPA was able to alter gene expression in the neonatal pituitary, however, not in the same way it was able to affect the embryonic pituitary. Proliferation and the gonadotrope lineage were altered with embryonic exposure, whereas the corticotrope/melanotrope and PIT1 lineages were altered in the neonatal exposure paradigm. This suggests that there are differences between the embryonic and neonatal period, which may contribute to divergent effects of BPA during the two critical windows of development. Additionally, dose and sex specific effects were observed, which shows there may be additional sex differences in the neonatal pituitary. This also shows that

BPA can alter every axis of the pituitary, though the time, dose, and sex are all contributing factors to what is altered.

Due to the ability of E2 and BPA to disrupt estrogen signaling and to regulate gene transcription in the pituitary, we examined further the mechanisms by which this regulation takes place. We hypothesized that E2 and BPA would be able to regulate gene transcription directly at the pituitary and this regulation would be carried out by the most ubiquitously expressed estrogen receptor, ESR1. To test this hypothesis, we treated pituitaries in ex vivo cultures with E2, BPA, or ER-subtype selective agonists and antagonist and analyzed expression of the sexually dichotomous genes.

Interestingly, sex specific effects were seen with direct stimulation of the pituitary, showing that the pituitary itself maintains sex differences. Also, regulation of the sexually dichotomous genes in vivo did not always match what was seen in the cultures demonstrating other factors may be important in gene regulation. Interestingly, all of the sexually dichotomous genes appeared to be regulated via different estrogen receptor-

iii subtypes or combinations of subtypes, demonstrating the diversity of estrogen signaling pathways within a cell. Of particular interest, Icam5 was regulated by a combination of nuclear and membrane signaling demonstrating that this decrease may be through a multi-step process that will be analyzed further in the future. Taken together, these studies demonstrate that the neonatal pituitary is sensitive to estrogen signaling through multiple pathways and therefore, exposure to EDCs that can interfere with this process to disrupt the neonatal pituitary in sex specific ways.

ACKNOWLEDGMENTS

I would like to thank my advisor, Dr. Lori Raetzman whose limitless patience and encouragement has helped me to find a path that fit my abilities and interests. It is safe to say without Lori I would not have succeeded in my goals. Her excitement and passion for science is a model to everyone around her. More than anything her dedication to her graduate students and lab members creates an enjoyable work environment. I was truly fortunate to have the opportunity to learn from such an amazing mentor and scientist.

I am extremely thankful for the amazing people I have had the honor of working with for so many years. These people made lab feel like home. I would like to thank

Karen Weis, without whom I would not have had a working project. Karen’s technical skills and help with dissections and cultures allowed me to ask questions I would never have been able to answer without her. I was very lucky to have joined the lab with Matt

Biehl, whose immense encouragement and friendship has helped me through graduate school since the beginning. His passion for science is truly evident and I appreciate the many useful suggestions and insights over the years. I am grateful to have worked with

Whitney Edwards, whose positive attitude and willingness to help has always been a constant. I enjoyed many scientific and nonscientific conversations with her and am grateful to have been able to work next to such a good friend. I am also grateful to Leah

Nantie and Paven Aujla for training me when I first arrived. I also had to pleasure of working with two undergraduate students, Nick Baur and Annesha Banerjee whose dedication and will to learn helped complete many of the studies.

I appreciate the guidance of the members of my committee: Drs. Jodi Flaws,

Milan Bagchi, and Erik Nelson. In particular, I appreciate the help of Dr. Jodi Flaws, who’s experiments on the effects of embryonic exposure to BPA provided a comparison for my studies and provided tissue to analyze. Due to Dr. Flaws, I was able to design my own dosing study based off of her design.

I am grateful to many who have shared reagents or equipment with me over the years including; Dr. Milan Bagchi, Dr. Ann Narduli, Dr. CheMyong Ko, Dr. John

Katzenellenbogen, Dr. Benita Katzenellenbogen, and Dr. Yoshihiro Yoshihara, which have helped me greatly in advancing the project. I am also thankful for the funding I received through the Toxicology Training Grant and the Midwest Regional Chapter of the Society of Toxicology, which helped very much with my project and my future.

Finally, I am indebted to my family and friends who have stuck with me throughout this experience. I am thankful to my parents who have always supported me no matter what and whose love and encouragement I could not do without. I am grateful for my brother and sister who have always been there for me when I needed them.

Finally, I am grateful to all my friends who made Champaign-Urbana an enjoyable place to live and pursue a Ph.D.

TABLE OF CONTENTS Chapter 1: Introduction ...... 1

Chapter 2: Icam5 expression exhibits sex differences in the neonatal pituitary and is regulated by estradiol and bisphenol A……………………………………………. 22

Abstract ...... 22 Introduction ...... 23 Materials and Methods ...... 27 Results ...... 31 Discussion ...... 37 Acknowledgments ...... 43 Figures and Tables ...... 44

Chapter 3: Effects of exposure to the endocrine disrupting chemical, bisphenol A, during critical windows of murine pituitary development ...... 54

Abstract ...... 54 Introduction ...... 55 Materials and Methods…………………………………...... 57 Results ...... 62 Discussion ...... 66 Acknowledgments ...... 72 Figures and Tables ...... 73

Chapter 4: Estrogen receptor mediated down regulation of gonadotrope specific genes in the neonatal pituitary ...... 83

Abstract ...... 83 Introduction ...... 84 Materials and Methods ...... 88 Results ...... 90 Discussion ...... 93 Figures and Tables...... 100

Chapter 5: Conclusions/Discussion ...... 106 Figures and Tables ...... 117

Abbreviations ...... 120

References ...... 124

vii

Chapter 1: Introduction Exposure to endocrine disrupting chemicals (EDCs) has increased greatly over the past several decades, co-related to an increase in endocrine related health concerns, such as infertility, diabetes, thyroid dysfunction, neurological disorders, and cancer to name a few. Many of these disorders are more likely to occur if exposure to the compound occurs during developmental windows as these periods can be more sensitive and disruptions in development and can lead to permanent effects later in life

(Hanson & Gluckman 2008). Though many outcomes of EDC exposures are known, the precise location of the disruption is not well known. Disruption of the pituitary gland could potentially be responsible or contribute to development of diseases caused by

EDCs due to its ability to control several endocrine systems.

The pituitary is the central gland of the endocrine axes, important in releasing hormones that affect growth, metabolism, stress, lactation, and reproduction. In order for the pituitary to properly regulate these endocrine axes, it must develop the hormone secreting cell types in the right number and proportion. Too many or too few hormone secreting cell types can disrupt the amount of hormone released from those cells, which can subsequently lead to several endocrine disorders such as gigantism, dwarfism, hypothyroidism, hyperthyroidism, Cushing’s syndrome, hyperprolactinemia, and hypogonadotropic hypogonadism. Many of these disorders arise while the pituitary is developing. Therefore, it is important to understand what controls proper development of the pituitary cell types and how exposure to exogenous endocrine disrupting chemicals can influence proper development of the pituitary during critical windows.

The murine pituitary gland consists of three lobes. The posterior lobe (PL) is connected to the hypothalamus via the infundibulum through which the magnocellular neurons of hypothalamus travel and release anti-diuretic hormone (ADH) and oxytocin

(OT) (Markakis 2002). The anterior lobe (AL) consists of the somatotropes, thyrotropes, lactotropes, corticotropes, and gonadotropes, which secrete growth hormone (GH), thyroid stimulating hormone (TSH), prolactin (PRL), adreno-corticotropic hormone

(ACTH), and luteinizing hormone (LH) and follicle stimulating hormone (FSH), respectively. The intermediate lobe (IL) separates the posterior and anterior lobes and, in rodents, it consists of melanotrope cells that secrete melanotropin stimulating hormone (MSH). Development of these lobes and cell types within the lobes is a very well controlled process from the beginning of organogenesis to maintenance of all the cell populations in the adult pituitary. The posterior and anterior lobes of the pituitary are derived from different tissues, the neural ectoderm and oral ectoderm, respectively.

Embryonic pituitary development

The pituitary develops during two critical windows: embryonic and neonatal.

During these two periods, different factors are involved in controlling proliferation and cell fate choices. Organogenesis of the pituitary begins around embryonic (e) day 8.5 in the murine pituitary. At this time the oral ectoderm begins to thicken and invaginate to become the beginnings of Rathke’s pouch (Treier et al. 1998). Eventually, Rathke’s pouch breaks apart from the oral ectoderm and the pouch becomes an isolated anterior pituitary gland containing organ restricted progenitor cells (Bancalari et al. 2012). All the hormone-secreting cells of the pituitary are derived from the common progenitor cell pool. These cells are generally found lining the cleft between the anterior and

2 intermediate lobes as well as scattered throughout the parenchyma of the anterior lobe

(Vankelecom 2010). They also express several stem cell markers such as SRY (sex determining region Y)-box 2 (SOX2), octamer-binding transcription factor 4 (OCT4), and glial cell line-derived neurotrophic factor (GDNF) receptor alpha 2 (GFRa2) (Alatzoglou et al. 2009; Garcia-Lavandeira et al. 2009). These progenitor cells give rise to transit amplifying cells, which are undifferentiated cells that rapidly proliferate and eventually differentiate. Progenitor cells must balance self-renewal, to maintain adequate progenitor number in order to expand the size of the pituitary, and differentiation, to create all the hormone cell populations in the right proportions for proper functioning of the pituitary. Once the transit amplifying cell receives signals to differentiate, it will do so to one of the three lineages that make up the pituitary: the SF1, PIT1, and TPIT lineages. These lineages are named as such because of the transcription factor specifically expressed in these cells that is known to drive the differentiation of the specific cell type. The SF1 lineage is characterized by expression of steroidogenic factor 1 (SF1). SF1 is the transcription factor important in expression of genes in gonadotrope cells. SF1 deficient mice do not produce gonadotropins, suggesting SF1 is important in terminal differentiation of these cells. (Ingraham et al. 1994; Zhao et al.

2001). The PIT1 lineage is characterized by expression of POU domain, class 1, transcription factor 1 (PIT1). PIT1, or POU1F1, is a transcription factor found exclusively in the pituitary gland and is important in the development of lactotropes, somatotropes, and thyrotropes and expression of their respective hormones, as loss of Pit1 results in decreased Prl, Gh, and Tshb mRNA as well as severe reduction of the respective cell types (Li et al. 1990). The TPIT lineage is characterized by expression of T-box

3 transcription factor (TPIT), also known as TBX19. TPIT is a transcription factor present in melanotrope (IL) and corticotrope (AL) cells and is important for terminal differentiation of these cells (Pulichino et al. 2003). Absence of TPIT does not lead to complete absence of corticotropes, but expression of POMC is delayed and reduced if

TPIT is absent (Lamolet et al. 2004; Pulichino et al. 2004). Differentiation of the hormone secreting cells just described begins around embryonic day (e) 11.5 to 13.5

(Davis et al. 2011; Seuntjens & Denef 1999) as progenitor cells stop proliferating and exit the cell cycle before differentiating. Though all the cell types begin developing at the same time, they reach terminal differentiation, marked by expression of hormone, at different times. The corticotrope cells are the first to reach terminal differentiation at e12.5 followed by melanotrope and thyrotrope cells at e14.5, somatotrope and lactotrope cells at e15.5, and finally, the gonadotrope cells at e16.5 in mice (Japon et al.

1994). A major question of importance in understanding pituitary development is: what signals are the pituitary progenitor cells receiving that will cause them to proliferate and become fated to a specific lineage?

Signals: Critical Embryonic Period

Factors controlling cell expansion and fate choices in the pituitary during the embryonic period mainly occur from intrinsic signals. Many studies have been done to explore these intrinsic factors involved in proliferation and differentiation in the developing pituitary. Proper development of Rathke’s pouch is controlled by a number of factors from the surrounding ventral diencephalon. The ventral diencephalon secretes bone morphogenetic proteins (BMPs) and fibroblast growth factors (FGFs) that regulate the size of the developing Rathke’s pouch (Davis et al., 2013). BMP is necessary for

4 initiation of Rathke’s pouch, as loss of BMP4 leads to a loss of Rathke’s pouch (Treier et al. 1998). FGFs are important in cell proliferation, as loss of several FGFs result in a hypoplastic Rathke’s pouch and increased apoptosis (Takuma et al. 1998; De

Moerlooze et al. 2000; Ohuchi et al. 2000). Other signaling pathways can also interact with these pathways to affect development of Rathke’s pouch. The WNT and sonic hedgehog (SHH) signaling pathways are active in the developing diencephalon and pituitary and can influence pituitary growth and differentiation (Cha et al. 2004; Potok et al. 2008; Olson et al. 2006; Treier et al. 2001; Wang et al. 2010; Treier et al. 1998).

Loss of Pitx2, which is induced by WNT signaling, leads to a hypoplastic pituitary

(Kioussi et al. 2002) and similarly loss of Wnt4 also results in hypoplasia, suggesting

WNT signaling has a role in progenitor proliferation (Treier et al. 1998). Conversely, increased WNT signaling by a degradation resistant form of β-catenin leads to pituitary hyperplasia only when targeted to progenitor cells (Gaston-Massuet et al. 2011), demonstrating that WNT signaling specifically in progenitor cells leads to pituitary proliferation.

Notch signaling is important in progenitor proliferation and maintenance as loss of down-stream target Hes1 causes global reduction of proliferation in the embryonic pituitary and loss of RBP-J, the major mediator of Notch signaling, which leads to premature lineage differentiation (Raetzman et al. 2007; Zhu et al. 2006). This hypoplasia caused by loss of Notch signaling is thus caused by accelerated differentiation of progenitor cells (Kita et al. 2007). These signaling pathways also play roles in driving progenitor cells within the developing pituitary to adopt certain lineages.

BMP signaling is important in PIT1 cell specification as reduced BMP signaling causes

5 a loss in the PIT1 lineage (somatrope, lactotropes, and thyrotropes) (Treier et al. 1998).

WNT signaling may also play a role, as loss of β-catenin leads to loss/reduction of all cell types except corticotropes (Olson et al. 2006). SHH signaling can alter cell specification, increasing thyrotropes and gonadotropes (Treier et al. 2001). Finally,

Notch signaling is important in cell specification as loss of Notch-induced transcription factor (Hes1) causes cells to switch from melanotropes to somatotropes (Raetzman et al. 2007) and loss of a Notch mediator (Rbpjκ) promotes differentiation of corticotropes and loss of the PIT1 lineage (Zhu et al. 2006). In sum, the developmental pathways,

BMP, WNT, SHH, and Notch, are all important in proliferation and cell specification.

However, with interacting pathways and redundancy, it is still unclear exactly what factors specify a cell to adopt a certain lineage and future studies are needed to elucidate the roles of each of these pathways.

Signals: Critical Neonatal Period

In rodents, there is a second critical period of development, which occurs right after birth and lasts for a period of 21 days, however much proliferation and differentiation occurs during the first week after birth and tapers off with time (Gremeaux et al. 2012). This rodent neonatal developmental period corresponds to the third trimester in humans (Anderson et al. 2003), meaning that neonatal pituitary development in rodents is still embryonic development in humans. During this neonatal period, there are still a vast amount of proliferating progenitor cells (Gremeaux et al.

2012). There is also a large expansion of the hormone producing cell types (Carbajo-

Perez & Watanabe 1990; Yoshimura et al. 1970; Taniguchi et al. 2002; Taniguchi et al.

2001). The intrinsic pathways controlling development during the embryonic period are

6 still at play during the neonatal period. An important factor for postnatal pituitary proliferation is cyclin-dependent kinase 4 (CDK4). Cdk4 deficient mice have hypoplastic pituitaries, which is only apparent postnatally as pituitaries display normal proliferation embryonically (Garcia-Lavandeira et al. 2009). Notch signaling, such as through

NOTCH2, is important for maintaining progenitor cells and proliferation neonatally

(Nantie et al. 2014). It is also important in postnatal differentiation as loss of Notch2 decreases PIT1 cell number and increases POMC cell number (Nantie et al. 2014).

However, less is known about the intrinsic signals regulating postnatal pituitary proliferation and differentiation so more studies are necessary. To compound this lack of knowledge of factors controlling postnatal development, there is also the increasing evidence for extrinsic factors, such as neuroendocrine or endocrine hormones, to influence pituitary proliferation and hormone producing cell number. These factors are less well studied than the influence of intrinsic signals.

The potential for hormones to have a greater influence on neonatal pituitary development is supported by the development of functional axes, which mainly occurs in the late embryonic to neonatal period. The hypothalamic-pituitary-gonadal (HPG) axis begins developing before birth as kisspeptin neurons start to communicate with gonadotropin releasing hormone (GnRH) neurons. Kisspeptin neurons are present and kisspeptin receptor, GPR54, expression in GnRH neurons begins around e13.5 (Kumar et al. 2014; Kumar et al. 2015). GnRH neurons reach the median eminence by e16, in mice (Schwanzel-Fukuda & Pfaff 1989) and pituitaries can respond to GnRH with increased LH, in vitro, at e18 (Pointis & Mahoudeau 1976). Furthermore, in vivo there are differences in serum LH levels between males and females corresponding with

7 differences in testosterone as early as postnatal day (PND)1, suggesting functional negative feedback of testosterone (Pointis et al. 1980; Poling & Kauffman 2012). More evidence that the HPG axis is established embryonically is that GPR54 KO (Kiss1r KO) mice have lower gonadotropin serum levels at birth, suggesting the importance of kisspeptin signaling. Additionally, hypogonadal (hpg) mice, which lack GnRH, similarly demonstrate reduced serum gonadotropin levels at birth (Poling & Kauffman 2012).

Therefore, it seems evident that the HPG axis is functional in the late embryonic period and proper development is identifiable even early in the neonatal period.

Dopaminergic neurons, important in regulation of prolactin, reach the median eminence around e19-20, in rats (Szabat et al. 1998). In vitro, a dopamine receptor agonist can inhibit PRL secretion as early as e19 and co-culture of hypothalamic extracts of day old rats with pituitaries of the same age stimulated PRL release

(Khorram et al. 1984), showing that the axis is at least partially developed. However, in vivo, PRL secretion is low embryonically and neonatally (Dohler & Wuttke 1975). This could be due to low levels of estrogens (Dohler & Wuttke 1975) and the ability of alpha fetoprotein to bind estrogens (Terentiev & Moldogazieva 2013) thus preventing stimulation of Prl transcription and secretion by estrogens. There are also higher levels of glucocorticoids in the late gestational period, which peaks at e16-17 in the mouse.

Glucocorticoids have been shown to inhibit Prl gene expression (Somasekhar & Gorski

1988) though the mechanism by which this happens is unclear (Ogasawara et al. 2009).

Therefore, the ability for prolactin to be hormonally regulated is also somewhat developed embryonically.

The growth hormone (GH) axis is still developing during the neonatal period as well. In rats, GH secretion, in vitro, cannot be induced until e21 (one day before birth)

(Khorram et al. 1983) and cannot be inhibited by somatostatin until postnatal day (PND)

3-5 in rats, in vivo and in vitro (Rieutort 1981; Khorram et al. 1983) indicating that the growth axis is still very much under development during the late embryonic and neonatal period. Proper functioning of the growth hormone axis may also play a role in pituitary development. Little mice, which lack the growth hormone releasing hormone

(GHRH) receptor (GHRHR) develop normally in the embryonic period, but there is hypoplasia due to failure of somatotrope expansion in the mature pituitary (Lin et al.

1993). This suggests that GHRH is important for maintenance and expansion of somatotrope cells in the neonatal period.

In regards to the hypothalamic-pituitary-thyroid (HPT) axis, thyrotropin releasing hormone (TRH) is detected in the hypothalamus as early as e12 in the rat (Nemeskeri et al. 1985). However, the neonatal rat still has low levels of thyroid hormone (T4) at birth, which increase around PND4 (Dussault & Labrie 1975). The HPT axis does not fully mature until around PND7 in the rat (Taylor et al. 1990). However, exogenous

TRH during the neonatal period still elicits an increase in TSH (Bakke et al. 1974), suggesting that the axis can be activated. Furthermore, it seems that despite the axis not being fully developed, hypothyroidism can cause elevated serum TSH at birth, suggesting feedback of thyroid hormones on the pituitary can occur in the fetus (Oliver et al. 1980).

Finally, with the hypothalamic-pituitary-adrenal (HPA) axis, corticotropin releasing hormone (CRH) is detectible in the hypothalamus around e17 in the rat (Baram &

Lerner 1991). ACTH and corticosterone are detectible in the fetal plasma on e16 in rats

(Boudouresque et al. 1988). In rats, the HPA axis becomes responsive to changes in corticosteroids around e18, as evidenced by changes in adrenal weight of the fetus

(Milkovic et al. 1973). These data point to the possibility of the HPA axis being functional prior to birth. However, during the neonatal period there is a hypo-responsive period in which mild stressors cannot induce enhanced ACTH and corticosterone levels

(Schmidt et al. 2003). However, some studies have suggested that this is not a hypo- responsive period, but rather a delayed responsive period. PND2 neonatal rats exposed to stress still exhibit increased CRH and glucocorticoids, albeit about 40 minutes after these same factors would increase in an adult (Hiroshige et al. 1971). Therefore, all the functional axes involving the pituitary appear to be developing during this late embryonic and neonatal time. Knowledge that the axes are functional or developing during this neonatal period suggests that these endocrine and neuroendocrine hormones can potentially regulate pituitary development. These endocrine signals could influence cell population size and play a vital role in fine tuning or maturation of the cell types.

Role of Estrogens in Pituitary Development

One hormone that has been demonstrated to have a profound developmental role is estradiol (E2). E2 in embryonic and neonatal female rat circulation is estimated to be 2-10 pg/ml, values similar to free estradiol in adult female rats in proestrus, and are not different between males and females (Montano et al. 1995; Konkle & McCarthy

2011). E2 levels are highest at birth (50 pg/ml) in both males and females (Konkle &

McCarthy 2011). However, high levels of alpha-fetoprotein during development bind estrogens, keeping most of them from being active. Importantly, local conversion of

10 estradiol from testosterone via aromatase is the main source of developmental estrogen exposure and this plays a major role in the establishment of sex differences during the late embryonic and neonatal period (McCarthy 2008; Simerly 2002; Simerly et al. 1985;

Simerly 1989; Clarkson et al. 2014). In mice, males have higher levels of testosterone beginning around e13, which is followed by a testosterone surge at birth (Clarkson &

Herbison 2016). Serum testosterone levels are higher in males than females 4 hours after birth, but there is no longer a difference in testosterone levels between males and females after 16 hours in mice (Poling & Kauffman 2012), showing that the testosterone surge only lasts for a brief period of time, despite its extreme importance in establishment of sex differences. Levels of testosterone are similar between males and females until PND10 when testosterone levels are once again higher in males than females (Poling & Kauffman 2012).

There is a potential for aromatase expressed in the pituitary to play an important role as well. Studies have shown that both E2 and testosterone suppress Lhb mRNA and LH serum levels, however, this was not seen with either treatment in Esr1 knockout mice, suggesting androgens must be converted to E2 (Lindzey et al. 1998). Aromatase is higher in males than females in the adult and is expressed in gonadotropes, somatotropes, lactotropes, and thyrotropes (Carretero et al. 1999; Galmiche et al. 2006;

Caglar et al. 2015). It is clear that sex steroids create differences in the male and female brain. However, it has not been shown whether these same perinatal hormones create sex differences at the level of the pituitary.

The effect of estrogens in pituitary development are not yet clear. Estrogens have been demonstrated as potent mitogens in a number of tissues including the

11 uterus, mammary gland, adrenal gland, and pituitary (Cunha & Lung 1979; Anderson et al. 1998; Bayne et al. 2008; Sabatino et al. 2015). In the pituitary, long-term estradiol administration drives the creation of prolactin secreting tumors or prolactinomas

(Takekoshi et al. 2014). Estrogens act by increasing production of growth factors, such as transforming growth factor (TGF)β, that will induce proliferation and differentiation.

Induction of galanin, a lactotrope growth factor, is thought to mediate the stimulatory effects of estradiol on lactotrope proliferation as galanin anti serum prevents the actions of estradiol on lactotrope cells (Wynick et al. 1993; Denef 2003). It is clear that estrogen exposure can promote lactotrope proliferation in the adult, but it is not clear if the same thing happens in the developing pituitary or if estrogen exposure can fate cells to become lactotropes. Few lactotrope cells are identifiable embryonically, however, treatment with estradiol or diethylstilbestrol (DES) can increase the number of PRL positive cells (Ogasawara et al. 2009; Matsubara et al. 2001). However, it has been shown that estradiol induces prolactin production in development similarly to the adult

(Ogasawara et al. 2009; Kiino & Dannies 1981); therefore, it is possible that estradiol is not necessarily increasing lactotrope cell number, but is advancing onset of PRL expression in already present lactotrope cells, thus advancing terminal differentiation.

Furthermore, the role of naturally circulating estradiol during this time may be minimal because the minimum dose needed to induce lactotropes to initiate PRL production is

10 pM in mice at e15 (Ogasawara et al. 2009), which is below the amount of free estradiol in circulation during this time, 0.5-2.2pg/ml (Montano et al. 1995). Furthermore, estrogen receptor alpha knockout (ESR1 KO) mice still have lactotrope cells, suggesting again that estrogen is not required for differentiation of these cells. There

12 are fewer lactotrope cell numbers in the adult ESR1 knockout mice compared to control, however, demonstrating the importance of estrogens in lactotrope cell growth

(Ogasawara et al. 2009; Scully et al. 1997).

In the embryonic pituitary, estradiol exposure increases proliferation and gonadotrope cell number in chick embryos (Wu et al. 2009). During the embryonic period, the main cells that are proliferating are progenitor and transit amplifying cells, which then differentiate to hormone producing cells. It is possible that E2 exposure causes an increase in progenitor proliferation and subsequent differentiation to the gonadotrope lineage. Estrogens may increase progenitor proliferation indirectly as pituitaries treated in vivo with estradiol demonstrate an increase in progenitor proliferation, however, isolated progenitor cells treated with estradiol in vitro do not

(Rizzoti et al. 2013), showing that some kind of indirect cell signaling has to take place to increase progenitor proliferation. Interestingly, exposure to the estrogen receptor modulator, tamoxifen, also causes an increase in cells adopting the gonadotrope lineage during the neonatal period (Rizzoti et al. 2013). However, other studies have demonstrated conflicting results as treatment with DES to neonatal pituitaries in culture did not alter LH cell number, despite being able to alter expression of estrogen regulated genes (Ishikawa et al. 2014). Despite the apparent ability of estrogens to advance gonadotrope cell number, ESR1 KO mice still have gonadotrope cells.

However, there does appear to be a difference in the morphology of these cells, as the adult ESR1 KO mice have less homogenous gonadotropes than control mice. Estradiol increases the percentage of homogenous gonadotropes in both control and ESR1 KO, suggesting a role of ESR2 in this process (Sanchez-Criado et al. 2012). Given these

13 data, it is possible that estrogen signaling can modulate progenitor proliferation and differentiated cell number, but likely is not necessary for initial gonadotrope or lactotrope specification.

Endocrine Disruption by Bisphenol A

The ability of estrogens to alter proliferation and cell fate choices in the developing pituitary as well as generate sex differences opens up the possibility of the pituitary to be similarly affected by exposure to endocrine disrupting chemicals (EDCs).

One such compound is bisphenol A (BPA). BPA is a plasticizer found in polycarbonate plastics, epoxy resins, and thermal paper (Shelby 2008). BPA was developed in the

1890s and was first reported to have estrogenic properties in the 1930s (Dodds &

Lawson 1936). Despite a low binding affinity to the classical estrogen receptors ESR1 and ESR2, which is about 10,000 fold weaker than estradiol (Kuiper et al. 1998), BPA has still been shown to have effects similar to estradiol. BPA can also bind the membrane estrogen receptor, GPER, with an affinity that is 8-50 times higher than the affinity for the ERs (Thomas & Dong 2006). Therefore, many studies have focused on comparing the effects of BPA to that of estradiol.

Very few studies have looked at the effects of BPA on the pituitary and fewer still have looked at the effects on the developing pituitary. A previous study in our lab shows that embryonic exposure to environmentally relevant doses of BPA increases pituitary proliferation and gonadotrope cell number in female offspring, but not male offspring

(Brannick et al. 2012). This increase in proliferation and gonadotrope number is consistent with effects of estrogen as discussed previously. A similar increase in pituitary proliferation is seen with BPA exposure in the adult rat through placement of

14 dental fillings, another common source of BPA exposure. Although a precise dose was not determined in this study, it is assumed to be low as BPA would be eluted during mastication over a long period of time. Along with the increase in proliferation there was also an increase in lactotrope cell number (Velasco-Marinero et al. 2011), again consistent with expected results of estrogenic exposure as discussed previously. BPA is also able to induce proliferation and prolactin protein synthesis in a prolactin secreting pituitary cell line, PR1. The ability of BPA to induce proliferation in these cells is about

10,000 fold less than E2, however, it is blocked by the antiestrogen, ICI 182,780, suggesting that BPA affects proliferation through the ER (Chun & Gorski 2000). These studies suggest the possibility for BPA to alter pituitary proliferation and cell fate choices. However, these few studies did not fully determine the effects on the pituitary during other developmental periods, such as the neonatal period, and therefore more studies are warranted.

Despite the lack of studies specifically examining the effects of BPA on pituitary development there are a number of studies that examine the effects of developmental exposure to BPA on hormonal factors related to the pituitary. One of the best studied axes in relation to the effects of BPA is the hypothalamic-pituitary-adrenal (HPA) axis. In the HPA axis, corticotropin releasing hormone (CRH) from the hypothalamus binds the

CRH-receptor (CRHR1) on the corticotrope cells of the anterior pituitary, which leads to the release of adrenocorticotropic hormone (ACTH). ACTH then causes the release of glucocorticoids from the adrenal gland, which will provide negative feedback on the hypothalamus and pituitary. Sex steroids have a critical role in development of sex differences in this axis basally and after stress. Males have higher CRH and lower

15 glucocorticoid receptor (GR) and neonatal estrogen makes females more male-like

(Patchev et al. 1995).

Exogenous exposure to estrogens can influence proper functioning of the HPA axis. DES exposure in pregnant women increases depression and anxiety in their offspring (Vessey et al. 1983). Estrogen exposure also alters normal anxiety related behavior during neonatal development (Leret et al. 1994). Similarly, exposure to BPA can influence proper development of the HPA axis. Developmental BPA exposure

(40μg/kg/day, which is a dose similar to dose that increased pituitary proliferation and gonadotrope number (Brannick et al. 2012)) increases anxiety-like behavior and hyperactivity of the HPA axis via impaired glucocorticoid negative feedback (Zhou et al.

2015). Embryonic and lactational exposure to 2 μg/kg/day BPA similarly increases anxiety and depression behaviors. This dose also demonstrates HPA axis activation, including increased Crh mRNA and increased serum ACTH and corticosterone levels in males at PND80. BPA also decreases Nr3c1 mRNA, which is the gene for the glucocorticoid receptor, GR, suggesting that hyperactivation of the HPA axis may be due to decreased negative feedback (Chen et al. 2015). In a parallel study, females did not have changes in Crh mRNA or serum ACTH and corticosterone. However, BPA treated females did have reduced response to stress, meaning lower elevation in corticosterone, with BPA treatment. Males had increased response to stress, meaning higher elevation in corticosterone. This difference could be because Nr3c1 mRNA is increased in females, whereas it is decreased in males with BPA exposure (F. Chen et al. 2014). However, in another study using 40 μg/kg/day BPA exposure during pregnancy and lactation, BPA increased serum corticosterone and decreased GR

16 protein levels in females, but not males. Interestingly, stress increased Crhr1 and Pomc mRNA levels in BPA treated males, but not females in PND46 rats (Panagiotidou et al.

2014), which again suggests hyper-activation of the HPA axis in males with stress and basal hyper-activation of the HPA axis in females. The differences between effects of studies could be due to dose used or the age examined. However, many of these studies showed that BPA decreased GR, which would be the expected effect of neonatal estrogenic exposure (Patchev et al. 1995). Overall, these studies indicated that BPA can alter HPA axis function, alter basal sex differences, and have sex specific effects.

Another axis that is profoundly affected by BPA exposure is the hypothalamic- pituitary-gonadal (HPG) axis. In the HPG axis, gonadotropin releasing hormone (GnRH) is released from GnRH neurons. GnRH then binds to GnRH receptors on the gonadotrope cells in the anterior pituitary and stimulates the release of luteinizing hormone (LH) and follicle stimulating hormone (FSH). These hormones travel to the gonads and stimulate the production of sex steroids, estrogen and testosterone, which generally provide negative feedback on the hypothalamus and pituitary. Developmental exposure (embryonic and lactational) to rodents of environmentally relevant (0-50 mg/kg/day) (Vandenberg et al. 2012) doses of BPA lead to altered serum levels of hormones in rodents. Gestational and lactational exposure to approximately 3 μg/kg/day leads to increased LH and estradiol serum levels in females (only females were analyzed), but FSH is unaffected at PND30 (Gamez et al. 2015). Males treated embryonically with 2.5 and 25 μg/kg/day BPA show a similar increase in LH protein at

PND35, but then a decrease in LH and FSH at PND90 (Abdel-Maksoud et al. 2015).

Along with this, embryonic exposure to 0.5 μg/kg/day BPA increases Lhb mRNA, whereas 50 μg/kg/day BPA decreases Lhb mRNA in female offspring at PND0

(Brannick et al. 2012). Slightly higher doses of 12-50 mg/kg/day BPA, but still below the

LOAEL of 50 mg/kg/day, from gestation to five weeks of age does not affect Lhb, Tshb,

Gh, or Prl mRNA levels in males or females, but does increase Fshb in females at 25 and 50 mg/kg/day and males at 25 mg/kg/day (Xi et al. 2011). Neonatal exposure to

2.5-6.2 mg/kg/day BPA or 25-62.5 mg/kg/day BPA decreased the GnRH stimulated release of LH and disrupted GnRH pulsatility at PND13 (Fernandez et al. 2009).

However, another study determined that neonatal exposure to BPA at 50 μg/kg/day and

50 mg/kg/day, which is sufficient to disrupt reproductive development, does not alter the ability of GnRH to respond to steroid feedback (Adewale et al. 2009). From these studies, it seems clear that BPA is able to disrupt development of the HPG axis.

Similar to the HPA axis, the HPG axis exhibits sex differences that are established by the neonatal testosterone surge, and like the HPA axis, BPA is able to alter expression of sex specific genes and characteristics in the HPG axis. Embryonic and lactational dosing of 25 or 250 ng/kg BPA decreases and eliminates the sex difference in tyrosine hydroxylase expression in the anteroventral periventricular nucleus (AVPV) (Rubin et al. 2006). The AVPV houses the kisspeptin neurons important in the generation of the LH surge that occurs in females. Females have a larger population of kisspeptin neurons and therefore have a larger amount of tyrosine hydroxylase (TH) expression than males. The neonatal testosterone surge is responsible for generating this sex difference as higher amounts of testosterone, which is converted to estrogen, decreases kisspeptin neuron numbers in the AVPV.

Interestingly, if females are treated with estradiol during the neonatal period, their AVPV will be smaller and more similar to a male. (Simerly 1989; Kelly et al. 2013). However, another study showed that exposure to 250 μg BPA from PND1-2 actually increased TH cells in the male AVPV to make it more like a female (Patisaul et al. 2006), demonstrating an anti-estrogenic effect. Exposure to 50 μg or 50 mg of BPA from

PND0-2 showed sex specific effects of BPA on Esr1, (gene for ESR1), Esr2 (gene for

ESR2), and Kiss1 mRNA expression, however in this study BPA did not simply mimic actions of estrogen, suggesting the ability to alter hypothalamic organization via other pathways (Cao et al. 2012).

Few studies have examined possible sex difference in the pituitary with regards to the HPG axis. In fact, our lab’s previous study is the only one, which showed that only female offspring were affected by embryonic exposure to BPA (Brannick et al. 2012).

The reasons why BPA would have sex specific effects are unknown, however, it is likely due to its action as a sex steroid mimic or inhibitor. It could also be due to differences in innate expression of genes and receptors that allow BPA to have an effect in one sex, but not the other. More studies are needed in order to determine what sex differences exist so it can be determined how BPA can potentially modulate them.

Exposure to BPA is generally considered to be oral for terrestrial animals as BPA leaches from food and drink containers (Lakind & Naiman 2008). In order to understand how method of exposure to BPA could affect the results, it is important to understand how BPA is processed in the body. Normally when BPA is ingested it will go through first pass metabolism in the liver and gut and become converted to the inactive BPA glucuronide (Matthews et al. 2001) by uridine diphosphate glucuronosyltransferases

(UGTs). It will then be cleared via urine in humans (Volkel et al. 2002) and mainly in feces in rodents (Zalko et al. 2003). Activity of UGTs is lower embryonically and increases with age, not reaching the level of activity seen in the adult until PND21. This potentially prolongs the elimination half time in embryonic and neonatal mice compared to the adult (Doerge et al. 2011). During embryonic development, dams are orally dosed with BPA, this BPA then goes through first pass metabolism in the mom before reaching the fetus. Concentrations of BPA in maternal blood and tissue parallel that of the fetus

(Kim et al. 2001; Moors et al. 2006) suggesting that the placenta is not a barrier for BPA transfer, thus giving the fetus similar exposure to BPA as the dosed mother. However, as the activity of UGTs increases in the fetus with age the amount of active BPA (BPA aglycone) decreases. During neonatal development, UGT activity is not yet sufficient to cause differences in circulating BPA concentrations until after PND3 due to method of exposure. Subcutaneous injections and oral exposure on PND3 cause the same circulating concentrations of BPA. However at PND10, subcutaneous injections lead to higher concentrations of BPA than oral exposure (Doerge et al. 2011). Lactational delivery of BPA is also somewhat controversial as the doses the pups receive are about

300-500 fold lower than the amount given to the mother (Doerge et al. 2010). Despite the limitations of method of exposure, especially during the neonatal period, it is clear that effects are still observable with BPA. It is just important to keep in mind that subcutaneous injections could lead to stronger effects due to higher circulating levels of

BPA, whereas lactational exposure may lead to lesser effects due to inability of BPA to transfer to milk at the same concentration as the mother was dosed with.

Defining critical windows of exposure to endocrine disrupting chemicals is of great concern given the rise of EDCs in the environment. These chemicals can influence all aspects of the endocrine system including the center of the axes, the pituitary. My study examined how BPA will differentially regulate pituitary development in the embryonic vs the neonatal period and discovered sex differences that exist in the pituitary after exposure to the testosterone surge. We hypothesized that due to potential differences in signals modulating pituitary development during the embryonic and neonatal periods and differences in the pituitary between these periods that the pituitary may be differentially sensitive to BPA exposure during these times. The studies outlined here aim to address: 1) determining the gene expression sex differences in the neonatal period and whether these differences can be regulated by exposure to estrogen or BPA,

2) determining the effects of neonatal exposure to estradiol and BPA on pituitary development, 3) uncover the mechanism by which estrogens regulate expression of differentially expressed genes in the pituitary.

Chapter 2: Icam5 expression exhibits sex differences in the neonatal pituitary and is regulated by estradiol and bisphenol A

Published: Eckstrum, K. S., Weis, K. E., Baur, N. G., Yoshihara, Y., Raetzman, L.T. (2016). Icam5 expression exhibits sex differences in the neonatal pituitary and is regulated by estradiol and bisphenol A. Endocrinology, 157(4), 1408-1420.

Abstract

Endocrine disrupting chemicals (EDCs) are prevalent in the environment and can impair reproductive success by affecting the hypothalamic-pituitary-gonadal (HPG) axis.

The developing pituitary gland is sensitive to exposure to EDCs, such as bisphenol A

(BPA), and sex-specific effects can occur. However, effects on the critical window of neonatal pituitary gland development in mice have not been explored. Therefore, this study determined baseline gene expression in male and female pituitaries and consequences of environmental exposure to 17β-estradiol (E2) and BPA on transcription of genes exhibiting sex differences during the neonatal period. Through microarray and qRT-PCR analysis of pituitaries at PND1, three genes were differentially expressed between males and females: Lhb, Fshb, and intracellular adhesion molecule-

5 (Icam5). To see if E2 and BPA exposure regulates these genes, pituitaries were cultured at postnatal day (PND)1 with 10-8M E2 or 4.4x10-6M BPA. E2 decreased expression of Lhb, Fshb, and Icam5 mRNA in females, but only significantly decreased expression of Icam5 in males. BPA decreased expression of Icam5 similarly to E2, but it did not affect Lhb or Fshb. Importantly, in vivo exposure to 50 μg/kg/day E2 from PND0-

7 decreased expression of Lhb, Fshb, and Icam5 mRNA in both males and females while 50 mg/kg/day BPA exposure during the same time frame decreased expression of

Icam5 in females only. Overall, we have uncovered that genes differentially expressed

22 between the sexes can be regulated in part by hormonal and chemical signals in vivo and directly at the pituitary and can be regulated in a sex-specific manner.

Introduction:

Endocrine disrupting chemicals (EDCs) in the environment are correlated in humans with impaired reproductive health including: decreasing age of onset of puberty, infertility, miscarriage, and decreased sperm quality (Maffini et al. 2006; Rochester

2013). These disruptions may originate from alterations in development or function of the pituitary, which is a critical component of the hypothalamic-pituitary-gonadal (HPG) axis. Exposure to EDCs during developmental windows may be more detrimental as these periods can be more sensitive and disruptions in development can lead to permanent effects later in life (Hanson & Gluckman 2008). Expansion of the pituitary gland occurs embryonically through the first two postnatal weeks in the mouse to create the hormone-secreting cell types including somatotropes, lactotropes, gonadotropes, corticotropes, thyrotropes, and melanotropes (JACOBSON et al. 1979; Treier &

Rosenfeld 1996; Carbajo-Perez & Watanabe 1990). The cells subsequently form functional networks through cell-cell contact, which is crucial in generating proper hormone release (Bonnefont et al. 2005). The neonatal period of development is of particular interest because, unlike the embryonic period, the axes connecting the hypothalamus, pituitary, and target organs are established allowing for influence of circulating hormones. In terms of HPG axis; the pituitary becomes responsive to gonadotropin-releasing hormone (GnRH) at e16, when the axons of GnRH neurons reach the median eminence, (Wen et al. 2010; Pointis et al. 1980) and the testes can secrete testosterone in response to luteinizing hormone (LH) (Pointis et al.

1980).Therefore, it is possible that circulating hormones, as well as EDC exposure, during the neonatal period could affect development of the pituitary, potentially having permanent effects. It is unknown if there would be a difference between males and females with respect to pituitary development or response to EDCs during this time.

One prevalent EDC is bisphenol A (BPA), a plasticizer found in polycarbonate plastics, epoxy resins, and thermal paper (Shelby 2008), leading to daily exposure in humans. BPA’s mode of action is considered to be estrogenic, despite its binding affinity to the classical estrogen receptors (ESR1 and ESR2) being about 10,000 fold weaker than that of estradiol (Kuiper et al. 1998). BPA has a better binding affinity to the membrane G protein-coupled estrogen receptor, GPER, (Thomas & Dong 2006). The pituitary expresses estrogen receptor alpha (ESR1) and estrogen receptor beta (ESR2) before birth (Nishihara et al. 2000). GPER is expressed in the adult pituitary as well, however expression in the developing pituitary is unknown (Hazell et al. 2009). Since the pituitary possesses these estrogen receptors, it is possible that estrogens and BPA can affect neonatal pituitary development either directly or indirectly through the hypothalamus, which also expresses GPER, ESR1 and ESR2 (Hazell et al. 2009; Mitra et al. 2003; Merchenthaler et al. 2004).

In rodent models, developmental exposure to BPA adversely affects the HPG axis. For example, developmental BPA exposure can advance the age of vaginal opening and first estrus as well as cause various fertility problems (Maffini et al. 2006;

Wang et al. 2014; Losa-Ward et al. 2012). These effects have been correlated with elevated levels of Kiss1 and Gnrh mRNA in the hypothalamus and Fshb mRNA in the pituitary (Xi et al. 2011). Similarly, neonatal exposure to BPA alters estrous cyclicity and

24 impairs LH release (Monje et al. 2010; Fernandez et al. 2009). Thus, developmental time periods are sensitive to endocrine disruption, which can have lasting effects on function of the HPG axis. Despite the abundance of knowledge regarding the adverse effects of BPA exposure on the HPG axis, very few of these studies closely examined the pituitary or deciphered if effects seen in vivo occurred at the pituitary itself.

BPA not only impacts the proper functioning of the HPG axis, but also has a number of sex-specific effects. The anteroventral periventricular nucleus, AVPV, is a sexually dimorphic nucleus important for generation of the LH surge in females.

Estrogen, converted from testosterone via aromatase, is responsible for generation of the sex differences in the brain (Simerly 2002). Developmental BPA exposure alters the size of the AVPV to make males and females more similar (Patisaul et al. 2006; Rubin et al. 2006) and alters sex differences in gene expression of Esr1, Esr2, Esrrg, and

Kiss1 (Cao et al. 2012; Kundakovic et al. 2013). In the pituitary, embryonic exposure to

BPA leads to an increase in gonadotrope number and altered gonadotrope-specific mRNA in females, but not in males (Brannick et al. 2012). However, it is unknown if

BPA would have a sex-specific effect on the pituitary during the critical neonatal period of development.

To understand why BPA has differing effects in males and females, it is important to characterize baseline differences between the sexes. Focusing on the pituitary, only

43 genes are differentially expressed in adults between males and females (Nishida et al. 2005). No studies have been done to determine the sex differences during the neonatal period of development. However, it is known that serum levels of gonadotrope- derived luteinizing hormone (LH) and follicle stimulating hormone (FSH) are higher in

25 females than males at the day of birth (Poling & Kauffman 2012). It is also apparent that proper functioning of the HPG axis is essential for manifestation of this sex difference because hypogonadal mice (hpg), which lack GnRH signaling, do not exhibit a sexual dimorphism in LH and FSH serum levels (Poling & Kauffman 2012). Despite the differences in LH and FSH serum levels at birth and apparent dependence on GnRH, it is unknown what other differences exist in the pituitary during the neonatal period and if there is any direct contribution of sex steroids to pituitary sexual dichotomy.

We hypothesize that there are sex differences in gene expression at the level of the pituitary during the neonatal period and these genes can be regulated by hormones and EDCs. To test this hypothesis, we analyzed global mRNA expression in male and female CD-1 mouse pituitaries during the neonatal period. We found very few sex differences besides Lhb and Fshb during this neonatal period at the mRNA level. One novel gene uncovered was intracellular adhesion molecule 5, Icam5. ICAM5 characteristically is expressed on dendritic filopodia of telencephalic neurons and is involved in dendritic shape changes during development (Tian et al. 2007; Tian et al.

2000; Nyman-Huttunen et al. 2006). In the pituitary, we demonstrated that ICAM5 is detected predominantly in gonadotropes. We then showed that, 17β-estradiol (E2) and

BPA could disrupt gene expression of differentially expressed genes, including ICAM5, in the pituitary. These findings indicate the neonatal pituitary is sensitive to exogenous

EDC exposure.

Materials and Methods

Mice

CD-1 mice were bred in house. Sex was confirmed by visual inspection and SRY genotyping using the primer sequences SRY forward 5’ to 3’

TGCAGCTCTACTCCAGTCTTG and reverse 5’ to 3’ GATCTTCATTTTTAGTGTTC (Life

Technologies). The University of Illinois Urbana-Champaign Institutional Animal Care and Use Committee approved all procedures.

Microarray:

Control postnatal day (PND) 1 male and female pituitaries were collected and stored in RNAlater (Ambion) at -20°C. Two pituitaries of same sex were then pooled and four independent pools were made for each sex. RNA was isolated using the

RNAqueous-Micro Kit (Ambion). RNA was sent to Roy G. Carver Biotechnology Center

(University of Illinois at Urbana-Champaign). Agilent Mouse 4 × 44K expression microarrays were used to examine pituitary gene expression. Total RNA, (200 ng per sample), was reverse transcribed and linear-amplified according to the manufacturer's instructions using the Agilent Low Input QuickAmp labeling kit (Agilent Technologies,

Santa Clara, CA, USA) and labeled with either Cy3 or Cy5 dyes. One of the male samples failed to label well so the other sample in the same dye was used twice.

Samples (two per array) were hybridized on the microarray slide and washed according to the Agilent protocol. Slides were scanned using an Axon 4000B scanner, and images were analyzed with genepix 6.1 software (Molecular Devices, Sunnyvale, CA, USA).

Quantitative RT-PCR

For sex difference RNA analysis, two litters were combined and analyzed at

PND0 (n=10-15), PND4 (n=7-11), PND9 (n=10-11), and adult (n=7). One litter was analyzed at PND20 (n=6-7). RNA processed as previously described (Nantie et al.

2014). Gapdh, Lhb, and Fshb primers were used previously in our lab (Brannick et al.

2012). For Icam5, the sequences used were forward 5’ to 3’:

CCAAACAGCTGATGTGCGTC and reverse 5’ to 3’: AGAGGAGTCGGGAAGCTGTA.

For Eif2s3x the sequences used were forward 5’ to 3’: GGGACCAAAGGGAACAAG and reverse 5’ to 3’: AGCATCCTAGCCATCAAAATATCA (Life Technologies). Data were analyzed using the standard comparative ΔCT value method as previously described (Goldberg et al. 2011). The error bars in the figures represent the SEM of the relative fold-change for each group.

Immunohistochemistry:

LHβ staining was performed on paraffin sections as previously described

(Brannick et al. 2012) on PND0 (day of birth). Three slides evenly spaced spanning the entire pituitary from four male and female CD1 pups were stained with anti- LHβ antibody. The number of LHβ positive cells were counted and divided by the total number of cells in the anterior lobe. Sections on a slide, as well as slides per animal, were averaged together to obtain the mean % positive LHβ cells.

For ICAM5 staining, pituitaries from three male and female PND7-PND9 mice were fixed in 3.7% paraformaldehyde, cryoprotected in 30% sucrose/PBS solution, then frozen in Optimal Cutting Temperature compound (Electron Microscopy Sciences). The

ICAM5 antibody was applied on 10 μm sections (Yoshihara et al. 1994). For double

28 stains with ICAM5, three female pituitaries were stained at PND9 for LHβ, TSHβ, ACTH, and GH and at PND75 for PRL and LHβ. All antibodies are listed in Table 1. All experiments contained a slide without any primary antibodies to ensure specificity.

Slides were counterstained with 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) and visualized and processed as previously described (Brannick et al. 2012).

In situ Hybridization:

An antisense probe for Icam5 was prepared from mouse cDNA using sequence- specific primers, forward primer 5’-3’ ATGACTTGGATTGTCCCAGAAG and reverse primer 5’-3’ CAGGTTACCAGGGGTCATAGAG. The resulting PCR product was cloned into pGEM-T easy vector following the manufacturer’s guidelines (Promega). The probe was linearized and transcribed with T7 polymerase (Promega) in the presence of digoxigenin-labeled nucleotides (Roche). In situ hybridization was performed on three

PND9-11 male and female pituitaries prepared as for ICAM5 IHC above. For in situ hybridization, pituitaries were thawed and fixed with 3.7% paraformaldehyde, permeabilized with proteinase K (0.1μg/ml) (Life Technologies), and incubated with the

Icam5 probe at 55°C overnight. Probe detection was carried out as previously described

(Nantie et al. 2014). Slides were then counterstained with methyl green (National

Diagnostics) and mounted with Permount Mounting Medium (Fisher).

17β-Estradiol and BPA Culture Experiments

PND1 pituitaries were cultured overnight on Millicell CM membranes (Millipore) in a 24 well plate. The culture media consisted of phenol red-free DMEM/F12 (Fisher), supplemented with 10% charcoal-stripped FBS (Sigma) and 100x Penicillin- streptomycin solution (Fisher). A dose response curve for BPA (Aldrich ≥ 99% purity)

29 was performed including: vehicle control (0.1% ethanol), 4.4x10-8M BPA, 4.4x10-7M

BPA, 4.4x10-6M BPA, and 4.4x10-5M BPA. Male and female pituitaries were pooled with

4-5 pituitaries in each group. Assuming that all BPA in an in vivo treatment paradigm reaches the pituitary, a dose of the lowest observed adverse effect level (LOAEL) (50 mg/kg/day) would equate to 50 μg/ml or 2.106x10-4M (Peretz et al. 2012; Peretz et al.

2011). Therefore, the in vitro dose response corresponds to in vivo doses ranging from

10 μg/kg/day to 10 mg/kg/day, which encompasses the oral reference dose of 50

μg/kg/day. For subsequent cultures comparing the effects of E2 and BPA in combination with ICI 182,780 (Tocris), PND1 pituitaries were cultured as described above. Pituitaries were placed in one of seven treatment groups; control (0.2% ethanol),

E2 (10-8 M), E2+ICI (10-8 M +10-5 M), BPA (4.4x10-6 M), BPA+ICI (4.4x10-6 M + 10-5 M), and ICI (10-5 M). Four individual experiments were conducted consisting of control, E2, and E2+ICI for a total of 6-9 pituitaries for each male and female group. Five individual experiments were conducted consisting of control, BPA, BPA+ICI, and ICI for a total of

6-9 pituitaries for each male and female group. Cultures were harvested 48 hours post- treatment for analysis. This time was chosen to maximize the possibility of seeing changes in genes that were directly or indirectly regulated by E2 or BPA.

17β-Estradiol and BPA Dosing Experiments

Neonatal CD-1 mice were dosed orally with 50 μg/kg/day of 17β-estradiol (E2)

(Tocris) dissolved in tocopherol-stripped corn oil (MP Biomedicals) or 0.1% ethanol in corn oil as a control. Pups were dosed orally once daily from PND0 to PND7 and pituitaries were collected on the morning of PND7, one hour after the last treatment. A total of 6-8 pituitaries spanning three litters for each group were analyzed. For BPA

30 dosing experiments, mice were dosed during the same period with either 50 mg/kg/day

BPA (Aldrich ≥ 99% purity) or 0.5% ethanol in corn oil. Two liters were individually dosed with control and two with BPA, giving 7-14 pituitaries for each group.

Statistical Analysis:

Statistical significance was determined using a two-tailed t-test in Microsoft Excel for qRT-PCR and cell counting. P values less than 0.05 were considered statistically significant. For culture experiments, a one-way ANOVA was performed and groups were compared via Tukey HSD test.

Results:

Lhb and Fshb mRNA levels are higher in neonatal females than males

In this study, we sought to determine the baseline differences between males and females during the critical neonatal period of pituitary development prior to exploring hormonal regulation of pituitary gene expression. To address this question, pituitaries were collected on the day of birth (PND0) for RNA analysis and histology from CD-1 mice. At PND0, mRNA levels for luteinizing hormone beta (Lhb) and follicle stimulating hormone beta (Fshb) were significantly higher in females than in males as assessed by quantitative RT-PCR (qRT-PCR) (Figure 1A). We further characterized the expression of other gonadotrope-specific genes in males and females at this age, such as gonadotropin releasing hormone receptor (Gnrhr) as well as transcription factors necessary for the expression of Lhb and Fshb: forkhead box L2 (Foxl2), early response

1 (Egr1), and steroidogenic factor 1 (Nr5a1). Expression levels of Foxl2, Erg1, and

Nr5a1 were not significantly different between the sexes; however, the level of Gnrhr in females was slightly lower than in males. Thus, mRNA levels of these genes did not

31 explain why Lhb and Fshb mRNA was higher in females. Next, to see if gonadotrope number was different in males and females, as a possible explanation for the difference in Lhb and Fshb mRNA, we performed immunohistochemistry for LHβ in PND0 males

(Figure 1B) and females (Figure 1C) and counted the number of cells, which are represented as the percent positive cells (Figure 1D). There was no sexual dimorphism in the number of gonadotrope cells at PND0.

Transcriptional profiling identifies Icam5 as a differentially expressed gene between males and females in the pituitary

To determine what other differences exist between male and female mouse pituitaries at the mRNA level that may explain variations in levels of Lhb and Fshb, we performed a microarray analysis of male and female PND1 pituitaries. Table 2 shows the differentially expressed genes with a p-value of 0.06 or less. Only eight genes were found to be significantly different by the microarray, most of which are sex-chromosome linked genes. We found only two somatic chromosomal genes that exhibited significant differences between the sexes: Lhb and Icam5. A difference in Fshb expression was near significance. Therefore, we chose Lhb, Fshb, Eif2s3x, and Icam5 for further analysis (underlined genes Table 2). These genes were compared in males and females, by qRT-PCR at PND0, PND4, PND9, PND20, and Adult (6 weeks old, females in diestrus). Lhb (Figure 2A) and Fshb (Figure 2B) followed similar expression patterns over the postnatal period with higher expression in females than males from PND0 to

PND9, but lower expression in females at PND20 and the adult. The differences between male and female Lhb and Fshb mRNA levels in the adult appear to be due to both increasing levels of Lhb and Fshb in males and decreasing Fshb in females. These

32 mRNA expression patterns of Lhb and Fshb correlate to LH and FSH serum levels over the postnatal period (Dohler & Wuttke 1975). Icam5 expression was not different between males and females at PND0, but was higher in females from PND4-PND20 and lower in females at the adult time point (Figure 2C). Expression of Icam5 peaks at

PND9 in both males and females. The X-linked gene Eif2s3x was always more highly expressed in the female and expression of this gene did not change greatly over time

(Figure 2D). Taken together, these data demonstrate that Icam5 mRNA is dynamically regulated over time in a sex-specific manner.

Icam5 is expressed in the anterior pituitary of neonatal mice, mainly in gonadotropes

Icam5 (telencephalin) has been reported as a telecephalon-specific adhesion molecule and its expression in the pituitary has never been documented. Therefore, we performed in situ hybridization (ISH) to elucidate the expression pattern of this gene in the anterior pituitary at PND9-11 when the expression levels of Icam5 were highest and most different between males and females (Figure 2C). We observed that Icam5 localized to isolated cells in the anterior lobe in males (Figure 3A) and more strongly in females (Figure 3B), which correlates well with the qRT-PCR data (Figure 2C).

Similarly, ICAM5 protein was expressed in the anterior lobe of the pituitary and it appeared to be more highly expressed in the female (Figure 3D) than the male (Figure

3C). Next, immunohistochemistry was used to co-localize ICAM5 with pituitary hormones. At PND9, ICAM5 is rarely expressed in TSHβ expressing thyrotropes (Figure

3E) and POMC expressing corticotropes (Figure 3F). Although occasional GH expressing somatotropes were double-labeled (Figure 3G), many, but not all LHβ expressing gonadotrope cells (Figure 3H) contain ICAM5. In the adult, most ICAM5

33 positive cells were gonadotropes (Figure 3J). Prolactin co-localization was also performed in the adult due to low detection levels neonatally and was rarely co-localized with ICAM5 (Figure 3I). Therefore, the main cell type that ICAM5 is expressed in is the gonadotrope population. Importantly, Icam5 mRNA was also expressed in the human brain and pituitary, as assessed by RT-PCR analysis (data not shown), indicating that expression and regulation of this gene could be important in human physiology.

Regulation of Icam5 may occur directly at the level of the pituitary

To see if exposure to exogenous estrogenic compounds could alter expression of sexually dichotomous genes, we isolated pituitaries at PND1, which is a time point at which expression of these genes is sexually dichotomous in vivo, and treated them with

E2 and BPA. First, to determine if the pituitary would be responsive to E2 in culture, we looked at the ability of E2 to regulate expression of Cckar, a known estrogen responsive gene (Kim et al. 2007). E2 increased Cckar mRNA levels (Figure 6A) indicating that the cultured pituitary is able to respond to estrogenic stimuli in vitro. To see if the xenoestrogen, BPA, would similarly increase Cckar mRNA and to determine the dose of

BPA inducing the strongest estrogenic effect, we performed a dose response for BPA and observed that 4.4x10-6M BPA induced Cckar mRNA to the greatest extent (Figure

4A). Therefore, we chose this dose for all further BPA cultures. To determine if BPA is acting through estrogen receptors ESR1 or ESR2, pituitaries were co-treated with the estrogen receptor antagonist ICI 182,780, which blocks signaling through ESR1 and

ESR2 (Wakeling 2000). However, this compound has also been shown to activate the

G-protein coupled estrogen receptor GPER (Filardo et al. 2000). Expression of Cckar mRNA was examined in pituitary explants treated with control, BPA, BPA+ICI, and ICI

34 alone (Figure 4B). BPA increased Cckar mRNA levels, ICI was able to block this increase, and ICI alone had no effect on gene expression. These data show that the in vitro whole organ pituitary explants are a good system to study the regulation of estrogen-responsive gene expression.

Next, to see if estrogen could regulate expression of sexually dichotomous genes directly at the pituitary, we treated pituitaries at PND1 with E2, BPA, ICI, or a combination of these compounds. In the male, E2 was unable to alter levels of Lhb and

Fshb (Figure 5A). In contrast, in the female, E2 significantly decreased expression of

Lhb and Fshb (Figure 5B). This indicates that there is a difference in the way male and female pituitaries respond to E2 in vitro. Interestingly, treatment with BPA was unable to alter expression of Lhb or Fshb in males (Figure 5C) or females (Figure 5D), showing that BPA does not act exactly like E2 in regulation of Lhb or Fshb, despite its ability to alter Cckar expression.

Lastly, we examined the direct effect of E2 and BPA on the expression of Icam5 in the pituitary. E2 decreased expression of Icam5 and co-treatment with ICI blocked this effect in males (Figure 6A) and in females (Figure 6C). BPA treatment also decreased expression of Icam5 in both males (Figure 6C) and females (Figure 6D) similarly to E2 and co-treatment with ICI blocked the decrease in males (Figure 6C) but only partially blocked the decrease in females (Figure 8D). ICI alone had no effect in males or females (Figure 6C, D). Finally, to show that suppression of Icam5 by BPA occurs in a dose-dependent manner, we examined Icam5 mRNA levels in the samples used for the Cckar dose response curve (Figure 4A). BPA decreased expression of

Icam5 at the 4.4x10-6 M and 4.4x10-5 M concentrations, but did not significantly reduce

35 expression at the 4.4x10-7 M or 4.4x10-8 M concentrations, demonstrating a dose- dependent effect of BPA on Icam5 expression (Figure 6E). Taken together, these data demonstrate that E2 and BPA can both decrease expression of Icam5 mRNA directly at the pituitary in males and females, however some of this suppression may come from a pathway other than an ER-mediated pathway. This is in contrast to Lhb and Fshb that were only significantly regulated by E2 at the level of the pituitary in females and were unaffected by BPA. Thus, some gene expression can be regulated directly at the level of the pituitary in a sexually dichotomous manner and BPA does not have identical effects to that of E2.

Neonatal exposure to E2 or BPA can influence the levels of sexually dichotomous genes in vivo

Since E2 and BPA were able to regulate expression of sexually dichotomous genes in vitro, we next determined if these effects were translatable to an in vivo scenario. Neonatal mice were orally dosed for one week (PND0 to PND7) with 50

μg/kg/day of E2, which is a dose sufficient to regulate expression of estrogen responsive genes: progesterone receptor (Pgr) and cholecystokinin A receptor (Cckar)

(data not shown) or 50 mg/kg/day BPA, which is the Lowest Observed Adverse Effect

Level (LOAEL) for BPA and was similar to the effective dose used in vitro. E2 was sufficient to suppress levels of Lhb and Fshb mRNA, which are genes known to be regulated by E2 in the adult (Shupnik et al. 1988) in both males (Figure 7A) and females

(Figure 7B). Interestingly, we found that E2 treatment also reduced levels of Icam5 in both males and females (Figure 7A, B), demonstrating that E2 may play a role in regulation of Icam5 transcription in vivo. Exposure to BPA during the neonatal period

36 had a sex specific effect. BPA significantly decreased the levels of Icam5 in females

(Figure 7D), however, males were unaffected by exposure (Figure 7C). Lhb and Fshb were not significantly affected by BPA during this time period in males (Figure 7C) or females (Figure 7D), which is similar to in vitro data (Figure 5 C-D). Thus, Icam5 can be regulated in part by estrogenic exposure during the critical neonatal period and BPA can alter its expression in a sex specific manner.

Discussion

BPA is thought to cause reproductive health effects due to HPG axis disruption and mediates numerous sex specific outcomes. However, little is known about any potential sexual dichotomy at the level of the pituitary gland. Therefore, we documented sex differences in gene expression during the critical neonatal period of pituitary development and determined if E2 and BPA could alter expression of genes expressed differently between the sexes. In this study, we found a few genes to be differentially expressed between male and female pituitaries at PND1. These genes were Lhb, Fshb, and a novel gene to the pituitary, Icam5. E2 attenuated Lhb and Fshb gene expression in females both in vitro and in vivo, but only suppressed these genes in vivo in males. In contrast, Icam5 was suppressed in males and females both in vitro and in vivo by E2.

BPA was unable to suppress Lhb and Fshb mRNA, but did suppress Icam5 similarly to

E2 in both sexes in vitro. In vivo, BPA only suppressed Icam5 in females. Thus, the neonatal pituitary is sensitive to hormonal and chemical stimuli that can potentially disrupt expression of sexually dichotomous genes within the pituitary, potentially contributing to negative effects on reproduction seen with BPA treatments (Maffini et al.

2006; Wang et al. 2014).

Gonadotrope subunit mRNAs represent the main sex difference in the neonatal pituitary. The higher levels of Lhb and Fshb mRNA observed in females correspond with previous studies showing higher LH and FSH serum levels in females (Poling &

Kauffman 2012). However, the differences in Lhb and Fshb mRNA does not seem to be due to mRNA levels of other transcription factors regulating these genes, indicating the difference likely exists at the level of the hypothalamus or in protein levels not examined in our study. Additionally, at PND1 gonadotrope cell number between males and females was similar, which is in agreement with previous studies (Dihl et al. 1988; Chen

1988). However, another study did indicate that there are more gonadotrope cells in females at PND5 (Ishikawa et al. 2014). This discrepancy may be due to the age of the mice or the method of staining (colormetric vs. fluorescence). If it is the age, it is possible that sex differences in cell number do not develop till a later time point. It is somewhat surprising that we uncovered few other sex differences in the neonatal pituitary via microarray analysis. In the adult pituitary more differences were found via serial analysis gene expression (SAGE) (Nishida et al. 2005). This discrepancy may be due to age of the pituitary or technique used to probe gene expression. Furthermore, the pituitary consists of a very heterogeneous population of cells. It may be difficult to detect changes that occur only in one small population of cells within the pituitary.

Gonadotropin subunit mRNAs can be regulated by E2 throughout the lifespan.

Our data show that, at the level of the pituitary, E2 decreased expression of Lhb and

Fshb in females, however, not in males. This sex-specific effect in vitro may suggest that the neonatal male pituitary is programmed in such a way to make it unable to respond to E2 directly at the level of the pituitary. Males are exposed to greater

38 hormonal stimuli during the perinatal testosterone surge. This surge has been shown to cause epigenetic changes in the brain possibly leading to permanent modifications, such as sexually dichotomous expression of Esr1 mRNA (DonCarlos et al. 1995) and sex differences in the DNA methylation pattern of the Esr1 promoter (Kurian et al. 2010;

Tsai et al. 2009). Our data suggest that the pituitary also experiences gender-specific changes that modify the direct response of the pituitary to E2. These modifications are not necessarily permanent and can be reprogrammed across the lifespan (Schwarz et al. 2010; Nugent et al. 2015), therefore, it is possible that a male pituitary could directly respond to E2 at a different age.

Surprisingly, exposure to BPA did not affect transcription of Lhb or Fshb in neonatal males or females. Embryonic BPA exposure has been shown to alter expression of Lhb and Fshb in vivo (Xi et al. 2011; Brannick et al. 2012), therefore, it could be that the embryonic period is more sensitive to exposure to BPA. However, neonatal BPA exposure has been shown to decrease GnRH induced LH serum levels, indicating that BPA may be affecting LH release during this time period in concert with

GnRH stimulation (Fernandez et al. 2009). Prolactin, another important pituitary derived hormone, exhibits increases in expression and release by exposure to both E2 and BPA in the adult (Steinmetz et al. 1997). In a previous study, embryonic exposure to BPA did not increase expression of prolactin at birth, which is the time point at which we are isolating pituitaries for culture analysis (Brannick et al. 2012). Although we have not analyzed prolactin expression because it was not detected as sexually dichotomous at this time point on our array, we cannot rule out that it would not be regulated by E2 or

BPA neonatally. Taken together, there are age dependent effects of environmental exposures on several pituitary hormones.

One of the most significant findings of our study is the sex-specific expression pattern of Icam5 mRNA and protein in the pituitary. ICAM5 is characterized as a telencephalon-specific cell adhesion molecule (Yoshihara et al. 1994). It is expressed in the soma-dendritic membrane of spiny neurons in the mammalian telencephalon, but not the axonal membrane and is absent from other brain regions and the spinal cord

(Yoshihara et al. 1994; Benson et al. 1998; Mitsui et al. 2005; Kelly et al. 2014). Our data indicate that ICAM5 is also expressed in the anterior pituitary gland, and its expression appears greater in females than males (Figure 3). The cell type where we see the greatest expression of ICAM5 is the gonadotrope cells, possibly indicating that this adhesion molecule could be contributing to differences in LH and FSH serum levels between males and females (Poling & Kauffman 2012). Icam5 mRNA is not readily expressed in the embryo, but begins to be expressed at birth and reaches maximal levels at PND10/PND9 in the brain (Yoshihara et al. 1994) and the pituitary (Figure 2C).

This timing corresponds with the timing of dendritic development and synapse formation in the brain (Mori et al. 1987; Imamura et al. 1990) and active pituitary gland expansion

(Taniguchi et al. 2002; Carbajo-Perez & Watanabe 1990). The dynamic expression of

Icam5 mRNA over time, especially in females, may indicate hormonal regulation similar to Lhb and Fshb. The ability of E2 to decrease Icam5 expression was confirmed in both males and females, and the regulation appears to occur at the level of the pituitary. The mechanism of action likely takes place through an ESR1- or ESR2- mediated pathway as co-treatment with ICI inhibited this decrease in both males and females (Wakeling

2000). This shows that Icam5 expression can be regulated by classical estrogen signaling pathways that are very important for proper transcription and hormone release within the pituitary.

The xenoestrogen BPA is also capable of decreasing Icam5 expression in both males and females at the level of the pituitary. However, ICI did not fully block this effect in females, suggesting that Icam5 can potentially be regulated by BPA via mechanisms other than ESR1 or ESR2. One potential pathway would be through the G-protein coupled receptor, GPER (Thomas & Dong 2006). Additionally, BPA has also been shown to act via androgen receptor, thyroid hormone receptor, estrogen-related receptor gamma, and aryl hydrocarbon receptor (Okada et al. 2008; Sohoni & Sumpter

1998; Kruger et al. 2008; Moriyama et al. 2002). However, we do know that BPA can act at ESR1 in the pituitary because BPA induced expression of Cckar (Figure 4), which is an ESR1 regulated gene (Kim et al. 2007) and this increase was fully blocked by ICI.

Therefore, BPA likely has multiple pathways of action within the pituitary, as well as actions in the HPG axis that will subsequently influence the pituitary. BPA in vivo was only able to decrease Icam5 in females and not males. This is similar to the sex specific effects seen with embryonic BPA treatment (Brannick et al. 2012). Since BPA was able to decrease Icam5 in vitro but not in vivo in males, it is possible that signals from the hypothalamus may either protect the male pituitary or counteract the actions of BPA. It is also possible that since levels of Icam5 are lower in males in vivo than females that

BPA is unable to reduce Icam5 further. Therefore, it is possible that BPA can regulate

LH and FSH levels by changing Icam5 expression and possibly interfering with either response to GnRH or release of LH and FSH.

Although the function of ICAM5 in the pituitary is unknown, its roles in the brain as a cell adhesion molecule have been extensively studied. ICAM5 is abundantly expressed in the dendritic filopodia and plays an important role in synapse formation with presynaptic axons, via the extracellular matrix molecule, vitronectin (Furutani et al.

2012), and/or β1 integrins (Tian et al. 2000; Ning et al. 2013). Once these connections are established, the extracellular domain of ICAM5 is cleaved, disrupting the cytoplasmic actin cytoskeleton through to α-actinin or ERM (ezrin/radixin/moesin) proteins promoting reorganization to induce spine maturation (Tian et al. 2007; Tian et al. 2000; Matsuno et al. 2006; Nyman-Huttunen et al. 2006; Tsukita & Yonemura 1999;

Furutani et al. 2012). Based on the role of ICAM5 in cell adhesion and its ability to alter the actin cytoskeleton, we propose that ICAM5 may play a role in structural organization of functional homotypic cell networks within the pituitary. These cell networks in the pituitary are important because they set up the ability of the pituitary cells to have proper hormone release (Le Tissier et al. 2012; Bonnefont et al. 2005; Budry et al. 2011). Cells and cell networks can also adjust in response to external stimuli. For example, GnRH signaling in gonadotrope cells can cause actin reorganization, resulting in membrane projections and cellular migration towards blood vessels (Navratil et al. 2007).

Interestingly, pituitary cell networks can also exhibit sex differences. For example, a higher proportion of somatotrope cells respond to growth hormone releasing hormone

(GHRH) in males than in females (Sanchez-Cardenas et al. 2010). It is possible that something similar may be happening with the gonadotrope population due to expression of ICAM5. Also, cell networks can be regulated by hormonal mechanisms because gonadectomy alters the responsiveness of cells to GHRH, including hormone release

42 and cell motility (Sanchez-Cardenas et al. 2010; Schaeffer et al. 2011). In gonadotropes, GnRH treatment leads to an increase in process extension, which is enhanced by prior E2 exposure (Alim et al. 2012). Therefore, it is evident that sex differences can exist in pituitary networks and these networks can be regulated by gonadal hormones. However, the mechanism behind these observations has yet to be elucidated. Our data provide one potential adhesion and cytoskeletal modifying molecule that is regulated by E2 and BPA in the pituitary, ICAM5. Neonatal exposure to

BPA caused decreased basal LH secretion as well as decreased amount of LH release in response to GnRH (Fernandez et al. 2009). Thus, if ICAM5 is important in the function of pituitary networks, which are necessary for proper response to signals from the hypothalamus and subsequent hormone release, disruption of ICAM5 via BPA could be responsible for negative impacts on reproductive health directly at the pituitary.

Further investigation into the role of ICAM5 in the pituitary is warranted.

Acknowledgments

We thank Ms. Sachiko Mitsui (Riken Brain Science Institute) for technical assistance. We thank Mary Majewski and Dr. Mark Band of the Functional Genomics

Unit of the Carver Biotechnology Center, University of Illinois, for help with the microarray hybridizations and Dr. Jenny Drnevich of the High Performance Biological

Computing (HPCBio) group of the Carver Biotechnology Center for help with the statistical analysis. We are also grateful to Dr. Jodi Flaws (University of Illinois at

Urbana Champaign) for providing the mice for the pituitaries used in the microarray experiment. Karen Weis (Raetzman Lab) conducted the pituitary organ culture experiments.

Figures and Tables

Manufacture r, catalog #, Species Antigen Name of Peptide/protein and/or name raised in; Dilution sequence (if Antibod target of individual monoclonal used known) y providing or polyclonal the antibody National Hormone and Rat Beta anti- Paraffin Peptide rabbit; Luteinizing N/A rBetaLH- 1:1000 Program polyclonal Hormone IC Frozen 1:50 (NHPP) Dr. A.F. Parlow AEGGAETPG Mouse ICAM5 anti- Dr. Yoshihiro rabbit; TAESPADGE 1:4000 (TLCN) TLCN-C Yoshihara polyclonal VFAIQLTSS National Hormone and Rat Beta Thyroid anti- Peptide rabbit; Stimulating N/A rBetaTS 1:1000 Program polyclonal Hormone H-IC-1 (NHPP) Dr. A.F. Parlow National Hormone and Rat anti- Peptide rabbit; Adrenocorticotro N/A 1:1000 rACTH Program polyclonal pic Hormone (NHPP) Dr. A.F. Parlow National Hormone and Rat Growth Peptide rabbit; N/A anti-rGH 1:1000 Hormone Program polyclonal (NHPP) Dr. A.F. Parlow National Hormone and Anti- Peptide rabbit; Rat Prolactin N/A 1:1000 rPRL Program polyclonal (NHPP) Dr. A.F. Parlow

Table 1. Antibodies used in study.

Figure 1. Lhb and Fshb mRNA levels were higher in females than males at PND0, but gonadotrope cell number was the same. Females showed elevated levels of Lhb and Fshb compared to males, but levels of transcription factors Foxl2, Egr1, and Nr5a1 were the same between sexes and there was a significant but small difference in Gnrhr (n=10-15) (A). Immunohistochemistry at PND0 with LHβ marked gonadotrope cells (Mag 200x) in males (B) and females (C). Cell counts showed that there were no differences in gonadotrope cell number (n=4) (D). Scale bar=50μm. (*)= p-value 0.05.

Table 2. Few sex differences discovered in pituitary at PND1 by microarray Higher in Males Gene Fold Change P Value Ddx3y 11.6176 4.3006E-11 Eif2s3y 10.2549 6.8983E-05 Uty 1.6276 0.0142 Higher in Females Gene Fold Change P Value Xist 5.1038 1.6954E-07 Xist 2.9461 5.5872E-06 Lhb 3.7814 1.5293E-04 Eif2s3x 1.5297 0.0218 Icam5 1.4555 0.0290 Fshb 2.5616 0.0561

Table 2. Few sex differences discovered in the pituitary at PND1 by microarray. Microarray analysis of PND1 control pituitaries showed few genes to be differentially expressed between males and females, of which, only three are not sex chromosome linked: Lhb, Fshb, and Icam5. Bolded genes were further analyzed and confirmed by qRT-PCR analysis.

Figure 2. Lhb, Fshb, and Icam5 demonstrated fluctuations in expression over the postnatal period. Lhb, Fshb, Icam5, and Eif2s3x were examined at PND0 (n=10-15), PND4 (n=7-12), PND9 (n=10-11), PND20 (n=6-7), and 6 week old adults, with females taken in diestrus (n=7). Lhb (A) and Fshb (B) were more highly expressed in females than males from PND0 to PND9 and less expressed in females by PND20 and in adulthood. Icam5 was not different between males and females at PND0, was higher in females from PND4 to PND20, and was lower in females in the adult (C). Eif2s3x was higher in females than males at all timepoints examined (D). (*)= p-value 0.05.

Figure 3. Icam5 was expressed more strongly in the anterior pituitary of females than males at PND9 and mainly expressed in gonadotrope cells. In situ hybridization shows

Figure 3 continued: expression of Icam5 mRNA in isolated cells in the anterior pituitary of males (A) and stronger expression in females (B) at PND9 (n=3). Immunohistochemistry for ICAM5 shows similar expression in the anterior lobe of males (C) and stronger expression in females (D) at PND9 (n=3). Arrows denote positive cells. Double IHC shows ICAM5 is rarely expressed in thyrotropes (E) and corticotropes (F), occasionally expressed in somatotropes (G) and mainly expressed in gonadotrope cells in PND9 females (H). In the adult ICAM5 is rarely expressed in lactotrope cells (I) and continues to be mainly expressed in gonadotrope cells (J) of randomly cycling adult females. Scale bar=50μm

Figure 4. 17β-Estradiol (E2) and Bisphenol A (BPA) increased expression of Cckar, in vitro. Whole organ pituitary cultures treated with 10-8M E2 and doses of BPA from 4.4x10-8M to 4.4x10-5M. Cckar expression was significantly increased with E2, BPA 10- 7M, BPA 10-6M, and BPA 10-5M with the highest induction by BPA at the 10-6M concentration (A). In whole organ pituitary cultures treated with BPA, ICI, or a combination of the two, BPA (10-7M) increased expression of Cckar, co-treatment of BPA+ICI blocked this increase, and ICI alone had no effect (B) (n=4-5) (*)= p-value 0.05.

Figure 5. 17β-Estradiol (E2) and Bisphenol A (BPA) had different effects on Lhb and Fshb mRNA levels in vitro. Pituitaries treated in vitro with E2 (10-8M) showed no significant change in Lhb or Fshb levels compared to controls in males (A), however E2 decreased expression of Lhb and Fshb significantly in females (B) (n=6-9). Pituitaries treated in vitro with BPA (4.4x10-6M) showed no significant change in Lhb or Fshb in males (C) or females (D) (n=6-9) (*)= p-value 0.05.

Figure 6. 17β-Estradiol (E2) and Bisphenol A (BPA) decreased expression of Icam5 in vitro. Pituitaries treated in vitro with E2 (10-8M) showed decreased expression of Icam5, this decrease was inhibited by co-treatment of E2+ICI in males (A) and females (B) (n=6-9). Pituitaries treated with BPA (4.4x10-6M) demonstrated decreased expression of Icam5 which was blocked fully by co-treatment of BPA+ICI in males (C), but only partially blocked the decrease in females (BPA+ICI significantly lower than control in females) (D). ICI alone had no effect in males (C) or females (D) (n=6-9). A dose response curve showed that BPA decreased expression of Icam5 at the 10-6M and 10- 5M concentrations, but had no effect at lower concentrations in vitro (n=4-5) (E) (*)= p- value 0.05

Figure 7. 17β-Estradiol (E2) decreased expression of Lhb, Fshb, and Icam5 in vivo and Bisphenol A (BPA) decreased expression of Icam5 in females only. Mice dosed from PND0-PND7 with 50 μg/kg/day E2 showed lower expression of Lhb, Fshb, and Icam5 in males (A) and females (B) at PND7 compared to control (n=6-8). Mice dosed with 50 mg/kg/day BPA showed no change in Lhb, Fshb, or Icam5 in males (C), but showed a slight repression of Icam5 in females (D). (*)= p-value 0.05.

Chapter 3: Effects of exposure to the endocrine disrupting chemical, bisphenol A, during critical windows of murine pituitary development

Abstract:

Critical windows of development are quite sensitive to endocrine disruption. The murine pituitary gland has two critical windows of development: embryonic gland establishment and neonatal hormone cell expansion. During embryonic development, one environmentally ubiquitous endocrine disrupting chemical (EDC), bisphenol A

(BPA), has been shown to alter pituitary development by increasing proliferation and gonadotrope number only in females. However, the effects of embryonic dosing on neonatal development and the effects of exposure during the neonatal period were not examined. Therefore, in this study, we first examined mice exposed to BPA during the embryonic period and found no change in proliferation and gonadotrope number at

PND4 in females. Next, we dosed pups from postnatal day (PND) 0 to PND7 with 0.05,

0.5, and 50μg/kg/day BPA, environmentally relevant doses, or 50μg/kg/day estradiol

(E2). Mice were collected after dosing at PND7 and at five weeks. Mice dosed neonatally with BPA did not have the same effects as embryonic exposure, but did have new effects, some being sex specific. Pituitary Pit1 mRNA expression was decreased with BPA 0.05 and 0.5μg/kg/day in males only. Expression of Pomc mRNA was decreased at 0.5μg/kg/day BPA and E2 in males and 0.5, 50μg/kg/day BPA, and E2 in females, however, there were no noticeable corresponding changes in protein expression. At 5 weeks, minimal changes confined to females were detected. These

54 data demonstrate that BPA exposure during different critical windows of pituitary development has unique sex specific effects on gene expression.

Introduction:

The pituitary is the master gland of the endocrine system, releasing hormones that control reproduction, lactation, growth, metabolism, and stress. To release these hormones, the anterior pituitary must develop five hormone secreting cell types: gonadotropes, lactotropes, somatotropes, thyrotropes, and corticotropes. Development of the hormone secreting cell types occurs during two key periods in mouse development: embryonic and neonatal. During embryonic development, cell specification is regulated by intrinsic and paracrine signals from the pituitary and surrounding tissue (Davis et al. 2013). However, during the neonatal period, the capability for communication between the hypothalamus, pituitary, and target organs develops (Pointis & Mahoudeau, 1976; Milkovic et al., 1973), suggesting a potential role for axis hormones in this window of development. Additionally, at birth, the testosterone surge establishes sex differences in the hypothalamic-pituitary-gonadal (HPG) and the hypothalamic-pituitary-adrenal (HPA) axes through local aromatization of testosterone to estradiol in the male brain (Homma et al., 2009; McCormick et al., 1998). Thus, the endocrine milieu postnatally may alter pituitary sensitivity to exposure to endocrine disrupting chemicals (EDCs).

Bisphenol A (BPA) is an EDC found in several items such as polycarbonate plastics, epoxy resins, and thermal paper, leading to ubiquitous exposure (Shelby

2008). Importantly, studies suggest that developing organs of fetuses and neonates have heightened sensitivity to EDCs such as diethylstilbestrol and BPA (Herbst 1981;

Markey et al. 2001; Markey et al. 2005). BPA is readily detectible in fetal cord serum, maternal serum, and fetal amniotic fluid in humans (Vandenberg et al. 2007), demonstrating exposure to BPA during critical developmental windows. A possible mechanism by which BPA is considered to act is by disrupting the actions of estrogens.

The classical estrogen receptors ESR1 and ESR2 and the membrane G protein- coupled estrogen receptor (GPER) are found in the hypothalamus and pituitary

(Nishihara et al. 2000; Ogasawara et al. 2009; Hazell et al. 2009; Mitra et al. 2003;

Merchenthaler et al. 2004). However, the roles of estrogen signaling and potential effects of BPA during neonatal pituitary development are unexplored.

Developmental exposure to environmentally relevant doses of BPA can adversely affect every axis of the endocrine system regulated by the pituitary gland, including the reproductive axis (Losa-Ward et al. 2012; Monje et al. 2010; Fernandez et al. 2009; Wang et al. 2014; Howdeshell et al. 1999), prolactin levels (Khurana et al.

2000), the growth axis (Ramirez et al. 2012), the thyroid axis (Zoeller et al. 2005), and the stress axis (F. Chen et al. 2014). BPA also alters sex differences of the HPG and

HPA axis established by sex steroids (Patchev et al., 1995; Chen et al., 2014; Rubin et al., 2006; Cao et al., 2012). Despite the relatively quick metabolism of BPA (Stahlhut et al. 2009), changes can sometimes be seen well after exposure has ended. For example, embryonic exposure to BPA led to reproductive tissue weight changes in adult females and changes in estrogen and progesterone receptor expression (Markey et al.

2005). Also, neonatal exposure to BPA had different outcomes on the hypothalamus two days after exposure than eight days after exposure (Cao et al. 2012), indicating the importance of examining multiple time points after exposure. Therefore, it is clear that

56 developmental exposure to BPA can influence sex differences and the endocrine axes, though regulation may be time and/or context specific. Despite this evidence, few studies have closely examined the effects of neonatal BPA exposure on development and expression of genes in the pituitary itself.

Previously, our laboratory showed that embryonic exposure to BPA increased pituitary proliferation and gonadotrope cell number in female offspring (Brannick et al.

2012), which is a response similar to that of estradiol (E2) (Wu et al. 2009). However, the effect of embryonic or neonatal exposure on the second wave of pituitary development is unknown. We hypothesized that BPA exposure would have different effects on the pituitary depending on gender, the developmental period of exposure, and the time examined after exposure. To test this hypothesis, two experiments were performed: first we examined pituitaries exposed to BPA embryonically at PND4 to determine the effects on neonatal pituitary development. Second, we examined pituitaries at two time points after exposure neonatally to three environmentally relevant doses of BPA and E2 and compared male and female effects.

Materials and methods:

Experiment 1 Design: Effects of embryonic dosing on neonatal pituitary development

This experiment examined whether the increased proliferation and gonadotrope number seen in females as a result of embryonic dosing of BPA would be maintained during the neonatal developmental period in the absence of BPA. Timed pregnancies of mice on a mixed FVB, C57BL/6 background were generated and orally dosed with control, 0.5µg/kg/day BPA, or 50µg/kg/day of BPA dissolved in ethanol and diluted in tocopherol stripped corn oil as previously described (Brannick et al. 2012) from

57 embryonic day 10.5 to 18.5. Pups were collected for immunohistochemistry at PND0.

Another cohort of mice was dosed similarly and one female offspring from each dam was collected on PND4, a time at which the pituitary is rapidly expanding (Wang et al.

2014; Carbajo-Perez & Watanabe 1990). The University of Illinois Urbana-Champaign

Institutional Animal Care and Use Committee approved all procedures.

Experiment 2 Design: Effects of neonatal dosing

This experiment examined the effects of dosing males and females during the critical neonatal period of pituitary development. Here, CD-1 mice, obtained from

Charles Rivers, were bred in house and maintained as described (Weis & Raetzman

2016). Sex was confirmed by visual inspection and gonad removal. Litters were culled to 8-12 pups and neonatal pups were dosed orally through consumption from a pipet tip, once daily, from postnatal day (PND)0 to PND7 with control (0.1% EtOH), 0.05, 0.5, or

50μg/kg/day bisphenol A (BPA) (referred to as BPA0.05, BPA0.5, and BPA50 respectively) (Aldrich ≥ 99% purity), or 50μg/kg/day 17β-estradiol (E2) (Tocris) dissolved in tocopherol-stripped corn oil (MP Biomedicals). The 0.05 and 0.5 μg/kg/day doses of

BPA were chosen because they fall within the range of human exposure levels (Lakind

& Naiman 2008). The 50μg/kg/day dose of bisphenol A was chosen because it is the oral reference dose for BPA. The 50μg/kg/day dose of E2 was chosen because it was a dose that was sufficient to induce expression of estrogen regulated genes in our system. One male and one female were taken from each litter at each time point. Six separate litters were dosed with each compound, each n represents a different litter.

Part A. On neonatal pituitary development

This part of the experiment examined the immediate effects of exposure to BPA and E2 during the neonatal period. Mice were harvested on PND7, one hour after the final dosing. For western blot analysis, an additional dosing of each compound was performed and all pups were collected at PND7 for western blot analysis.

Part B. At five weeks

This experiment examined whether neonatal dosing would influence the pituitary outside the first postnatal rapid growth phase, which ends at 3 weeks of age (Gremeaux et al. 2012). Here, five-week old siblings of the mice examined at PND7 were collected for RNA analysis. One male and female were analyzed from each litter, if possible. Due to sex distribution, it was not always possible to have an n of 6. The estrous cycles were monitored beginning at five weeks by vaginal smears and mice were euthanized when in estrus. Female mice were euthanized in estrus because neonatal E2 treatment caused persistent estrus.

Measurements, Weight, and Puberty Assessment

Weights and measurements were taken of mice at PND7 and five weeks to determine if there were any gross systemic effects of BPA or E2 exposure. Wet weights for testes, ovaries, uteri, and liver were all compared to body weight. Anogenital distance was measured and compared to body weight. Puberty measurements were observed by the day of vaginal opening for females and preputial separation for males.

Immunohistochemistry:

PND0 and PND4 heads were fixed overnight in 3.7% formaldehyde in PBS at

4ºC. Heads were then dehydrated in a series of graded ethanol at room temperature

59 and embedded in paraffin. Paraffin blocks were sectioned 6µm thick. For PND4 pituitaries, LHβ and Ki67 staining was performed as previously described (Brannick et al. 2012). Three slides evenly spaced spanning the entire pituitary from three female pups all from separately dosed litters were stained with anti-LHβ antibody (1:1000,

National Hormone and Pituitary Program) and anti-Ki67 antibody (1:500, BD

Pharmingen). The number of LHβ positive cells were counted and divided by the total number of cells in the anterior lobe. Sections on a slide, as well as slides per animal, were averaged together to obtain the mean % positive LHβ cells. The number of Ki67 positive cells lining both the intermediate lobe cleft and the anterior lobe cleft were counted and divided by the total number of cells lining the intermediate lobe cleft and the anterior lobe cleft, respectively. Average % positive Ki67 cells lining the cleft was determined for each animal. Only cells lining the cleft were counted as this location generally harbors the pituitary progenitor cells, which were the cells determined to be experiencing increased proliferation with BPA treatment at PND0 previously described

(Brannick et al. 2012). All experiments contained a slide without primary antibody to ensure specificity. The TUNEL Kit (Roche) was used to determine cell death. Positive cells from three sections evenly spaced from three female pituitaries were counted to determine cell death at both PND0 and PND4. All experiments were performed with a no enzyme slide as a control. Positive cells were averaged on a slide then averaged for the animal. For all experiments, slides were counterstained with 4’,6-diamidino-2- phenylindole (DAPI; 1:1000; Sigma) or counterstained with DAPI in mounting media

(2μg/ml). All immunostaining slides were visualized and processed as previously described (Brannick et al. 2012).

Quantitative RT-PCR:

For RNA analysis, males and females were analyzed separately (n=3-6). RNA was processed as previously described (Nantie et al. 2014). Expression levels of the genes of interest were normalized to Actb mRNA levels, with the primer sequences of forward 5’ to 3’: GACATGGAGAAGATCTGGCA and reverse 5’ to 3’:

GGTCTCAAACATGATCTGGGT (Life Technologies). Gene expression for Mki67, Lhb,

Nr5a1, Tshb, Gh, Prl was analyzed using primer sequences previously published

(Brannick et al. 2012) and Pit1 and Tpit previously published (Nantie et al. 2014).

Finally, Pomc sequences used were forward 5’ to 3’: GATAGCGGGAGAGAAAGCCG and reverse 5’ to 3’: GGGACCCCGTCCTGTCCTAT. Proliferating progenitor cells are marked by Mki67. Nuclear receptor subfamily 5 group A member 1, Nr5a1, expression is found solely in the gonadotrope lineage. Expression of POU domain class 1, transcription factor 1, Pit1, is found in the lactotropes, somatotropes, and thyrotropes, and T-Box 19, Tbx19, or Tpit is found in the melanotrope cells of the intermediate lobe and corticotrope cells of the anterior lobe (McDermott et al. 1999; Li et al. 1990;

Pulichino et al. 2003). Data were analyzed using the standard comparative ΔCT value method as previously described (Goldberg et al. 2011). Individual points were graphed with the sex indicated. Outliers were determined by the Grubbs test. Averages are shown as a line.

Western Blot:

Pituitaries (n=3) were frozen on dry ice and lysed using radioimmunoprecipitation assay buffer (RIPA) buffer. Protein fractions were obtained by centrifugation for 5 min at

4°C at 20817 rcf. Total protein concentration was measured via a BCA protein assay kit

(Thermo Fisher) according to the manufacturer’s instructions. Protein samples (20μg) were mixed with RIPA buffer and 3x Laemmli loading dye, then heated for 12 minutes at

57°C. Samples were loaded on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane (BioRad). The membrane was blocked for two hours in 5% nonfat dried milk in Tris buffered saline (TBS) then incubated with either PIT1 antibody

(rabbit, 1:1000, gift from Dr. Simon Rhodes), POMC antibody (rabbit, 1:250, DAKO),

βACTIN antibody (rabbit, 1:1000, Cell Signaling), or α-TUBULIN antibody (mouse,

1:5000, Sigma) in 1% milk with 0.2% Tween, overnight at 4°C. Secondary goat anti- rabbit (1:500) or goat anti-mouse (1:5000) IgG conjugated to IRdye 800cw (LiCor) was added at room temperature for one hour. Membrane was then imaged with the Odyssey infrared imaging system (LiCor). The relative protein levels were analyzed by NIH

ImageJ.

Statistical Analysis:

Statistical significance between the controls, three BPA treatment groups, and E2 were determined using a one-way ANOVA. If significance was found, the mean fold change between groups were compared using the Tukey HSD test in Microsoft Excel for both qRT-PCR and cell counting. P values less than 0.05 were considered statistically significant.

Results:

Experiment 1: Effects of embryonic dosing on neonatal pituitary development:

PND4 pituitaries, from female mice dosed embryonically with control or BPA, were stained by immunohistochemistry with Ki67 and Ki67 positive cells in the cleft of the anterior and intermediate lobes were counted. Percent Ki67 positive cells in the

62 control (Figure 8A; 24.6 ± 2.2% positive), BPA0.5 (Figure 8B; 23.9 ± 0.2% positive), and

BPA50 (Figure 8C; 23.1 ± 2.3% positive) groups showed no difference in Ki67 in the cells lining the cleft. Next, the PND4 pituitaries were stained with LHβ to look at gonadotrope number. Percent LHβ positive cells in the control (Figure 8D; 4.5 ± 0.4% positive) BPA0.5 (Figure 8E; 4.0 ± 0.3% positive), and BPA50 (Figure 8F; 4.2 ± 0.5% positive) groups showed that there was no difference in gonadotrope cell number. To determine what other factors were influencing cell number at PND0 or PND4, a TUNEL assay was performed to determine if the cells were dying by apoptosis. There appeared to be more cell death with BPA treatment at PND0 in the BPA0.5 (Figure 8H) and the

BPA50 (Figure 8I) groups than the female control (Figure 8G) and this was found to be significant by cell counts (Figure 8J). At PND4, there was a trend toward more cell death in the BPA treated groups, however, this was not found to be significant (Figure

8K).

Experiment 2: Neonatal dosing caused few changes in gross appearance of mice:

In light of the embryonic period of pituitary development demonstrating sensitivity to BPA, we next examined whether exposure to BPA during the neonatal period would be sensitive. Organ weights and measurements were taken to determine if any gross effects are observed. Testes, ovaries, uteri, and liver weight are shown as percent of body weight (Table 3). At PND7, the lowest dose of BPA decreased ovary weight compared to control and E2 increased uterine weight compared to control. At five weeks, the same weights and measurements were gathered. There were no differences in body weights or measurements between any of the treatments at this time (Table 4).

Experiment 2: Neonatal exposure to bisphenol A did not affect pituitary proliferation:

Exposure to BPA or E2 during the neonatal period had no significant effect on pituitary proliferation at PND7, as measured by Mki67 mRNA levels in males (Figure

9A) and females (Figure 9B). We next examined proliferation at five weeks, to see if there would be an effect of neonatal BPA exposure at a later time point. Mki67 mRNA levels were not significantly altered by BPA or E2 in males (Figure 9C) or females

(Figure 9D) at five weeks.

Experiment 2: Neonatal bisphenol A exposure did not affect gonadotrope lineage gene expression:

To examine if there was any effect of BPA exposure during the neonatal period on the gonadotrope lineage, mRNA expression levels of the gonadotrope lineage transcription factor Nr5a1 were examined. Neither BPA nor E2 had any effect on Nr5a1 mRNA levels in males at PND7 (Figure 10A). In females, there was no change in Nr5a1 mRNA levels with BPA treatment, however there was an increase in Nr5a1 with E2 treatment (Figure 10B). To explore whether a difference in Nr5a1 mRNA levels would exist later, we examined the pituitaries at five weeks. In these mice, males showed no difference in Nr5a1 levels with treatment (Figure 10C), however, in females there were decreases in Nr5a1 with the BPA0.05 and E2 exposures (Figure 10D).

To further explore the gonadotrope lineage during neonatal exposure to E2 or

BPA, Lhb mRNA expression was analyzed. With neonatal dosing, BPA was unable to alter Lhb mRNA levels, however, E2 significantly decreased levels of Lhb mRNA in both males (Figure 10E) and females (Figure 10F) at PND7. We next examined the five- week old mice. For Lhb mRNA levels, there was no effect of BPA or E2 exposure in

64 males (Figure 10G). Females similarly did not demonstrate any difference in Lhb mRNA with BPA exposure, however, there was suppression of Lhb mRNA with E2 exposure

(Figure 10H). Despite seeing effects on the gonadotrope lineage due to E2 treatment, there were no effects on timing of puberty, as assessed by preputial separation, or vaginal opening with E2 or BPA treatment (Table 5).

Experiment 2: Low levels of BPA exposure decreased Pit1 mRNA in males only, without altering hormone transcript levels:

PIT1 is a transcription factor found exclusively in the pituitary gland and is important in the development of lactotropes, somatotropes, and thyrotropes, and expression of their respective hormones. The lowest doses of BPA, BPA0.05 and

BPA0.5, decreased levels of Pit1 mRNA in males, however, the higher dose of BPA,

BPA50, and E2 had no effect on Pit1 mRNA during this time period (Figure 11A).

Females, on the other hand, did not show an effect on Pit1 mRNA with any dose of BPA or E2 (Figure 11B). To determine if the decrease in Pit1 mRNA in males would correspond with a decrease in protein, western blot analysis was done. No significant change in PIT1 protein was seen with any treatment group in males at PND7 (Figure

11C). Finally, to determine if there was any effect of decreased Pit1 mRNA levels, transcription levels of the hormones regulated by PIT1 were analyzed. BPA had no effect on Prl mRNA, however, E2 significantly increased Prl mRNA in males (Figure

11D) and females (Figure 11E). Neither BPA nor E2 had any effect on Gh mRNA levels in males (Figure 11F) or females (Figure 11G). BPA and E2 also had no effect on Tshb mRNA levels in males (Figure 11H) or females (Figure 11I). Finally, to see if the decrease in Pit1 mRNA seen in males at PND7 would be present after removal of BPA,

65 we examined the five-week old mice. There was no effect of exposure to BPA or E2 at five weeks in males (Figure 11J) or females (Figure 11K).

Experiment 2: BPA decreased Pomc mRNA in a dose and sex specific manner:

The last lineage examined was the TPIT lineage, which includes the corticotrope and melanotrope cells. At PND7 there was no effect of BPA or E2 exposure on Tpit mRNA levels in males (Figure 12A) or females (Figure 12B). However, the middle dose of BPA, BPA0.5, and E2 both decreased Pomc mRNA in males, however, the lowest dose of BPA, BPA0.05 and the highest dose, BPA50 showed no change in Pomc mRNA (Figure 12C). In females, Pomc mRNA was reduced with exposure to BPA0.5,

BPA50, and E2 with only BPA0.05 unable to alter Pomc mRNA levels (Figure 12D).

Next, intra-pituitary POMC protein levels were examined by western blot analysis in both males (Figure 12E) and females (Figure 12F) and no change in protein levels were detected in either sex. Next, Pomc mRNA levels were assessed at five weeks. No significant changes in Pomc mRNA were observed in males (Figure 12G). BPA0.5 treated females, however, had lower Pomc mRNA compared to control females (Figure

12H).

Discussion:

We demonstrate that there are critical windows of development in which the pituitary is sensitive to BPA exposure and that there are differential effects based on age and sex. Embryonic exposure to BPA increased pituitary proliferation and gonadotrope number in a sex-specific manner (Brannick et al. 2012). We now demonstrate this effect was not present at PND4, five days after removal of BPA.

Exposure to BPA during the neonatal period did not affect proliferation and also had

66 little effect on gonadotropes. However, we did see a decrease in Pit1 mRNA with lower doses of BPA in males and sex specific decreases in Pomc mRNA with exposure to

BPA and E2. At five weeks, after the first postnatal growth phase of the pituitary has ended, a similar reduction of Pomc mRNA with exposure to BPA0.5 and the appearance of a decrease in Nr5a1 mRNA with exposure to BPA0.05 in females were shown. Therefore, these findings highlight that the pituitary is dynamically affected by

BPA exposure in a sex specific manner and emphasize the need for examining different periods of exposure and times after exposure.

Previously, our lab has shown that embryonic exposure to BPA led to an increase in progenitor proliferation and differentiation to the gonadotrope lineage at

PND0 in females (Brannick et al. 2012). Additionally, we now find increased apoptosis at PND0 with BPA exposure. There is precedence for this developmental effect as BPA has been shown to simultaneously increase proliferation and apoptosis in spermatogenic cells (Xie et al. 2016). Whether both proliferation and apoptosis are directly increased by BPA exposure or if one is a mechanism enacted by the pituitary to counteract the effects of the other is unknown. The pituitary has been shown to be able to minimize the effects of exposure to compounds in other scenarios. In adults chronically exposed to estrogen, senescence mechanisms are activated to decrease the proliferation rate (Sabatino et al. 2015), thus limiting tumor growth. Interestingly, when BPA exposure is stopped before birth, proliferation and gonadotrope number at

PND4 is not altered. This potentially suggests that the pituitary can adjust cell dynamics during the postnatal developmental period if allowed to be removed from BPA.

The impact of neonatal exposure to BPA was not similar to the effects observed with embryonic dosing. Embryonic BPA exposure demonstrated increased proliferation and Lhb mRNA regulation in female offspring (Brannick et al. 2012). However, neonatal exposure demonstrated no change in either parameter in either sex. A higher concentration of 50mg/kg/day BPA and direct stimulation of the neonatal pituitary also did not regulate Lhb and Fshb mRNA (Eckstrum et al. 2016), demonstrating effectively that in the neonatal pituitary, gonadotropes are less affected by BPA exposure than during embryogenesis. There could be many reasons the neonatal period did not respond to BPA in the same way. Pituitary cell composition and receptor levels vary over the developmental period (Yoshimura et al., 1970; Carbajo-Perez and Watanabe,

1990; Pasqualini et al., 1999), which could alter the precise cellular dynamics leading to these changes. Additionally, the functionality of the hypothalamic-pituitary-gonadal

(HPG) axis during these two periods may also play a role. Development of the HPG axis begins prior to birth (Pointis and Mahoudeau, 1976) and is of critical importance to the pituitary as hypogonadal (hpg) mice lacking GnRH and kisspeptin receptor, GPR54, knockout mice have lower serum gonadotropin levels at birth (Poling & Kauffman 2012).

However, after birth the pituitary does not respond to GnRH with increased LH release until two weeks of age, despite a high frequency of GnRH stimulation in the first week of life (Glanowska et al. 2014). This suggests that the pituitary is hypo-responsive to stimuli during the neonatal period, compared to the embryo or the adult. Perhaps, late during the embryonic period, the HPG axis and regulation of proliferation and Lhb mRNA is active, but after birth the responsiveness of the pituitary to GnRH and proliferation signals is decreased, preventing Lhb mRNA and proliferation to be

68 disrupted by BPA during the neonatal period. Another possibility to explain the differences between the embryonic and neonatal exposure results is that CD1 mice, used in the neonatal study, and FVB/BL6 mice, used in the embryonic study, have different sensitivity to BPA exposure. It is possible that FVB/BL6 mice have a more sensitive gonadotrope lineage, whereas the CD1 mice have greater sensitivity in the

PIT1 and TPIT lineages. An example of differential effects due to mouse strain occurs in the uterus where CD1 mice exposed to BPA did not develop pyometra, whereas

C57BL/6 mice exposed to the same concentrations of BPA did (Kendziorski et al. 2012).

However, there is also evidence to support that mouse strain does not affect antral follicles differently with respect to growth and steroidogenesis (Peretz et al. 2013).

Despite an absence of similar changes in the neonatal and embryonic period, effects were observed that were specific to neonatal exposure. The lowest doses of

BPA, within the range of human exposure, decreased Pit1 mRNA, in males. To the best of our knowledge, BPA has not been previously shown to affect Pit1 transcription. This could be a non-estrogenic action because the same effect was not seen with E2.

However, E2 has been shown to increase Pit1 mRNA in cell lines and somatotrope specific ER alpha knockout mice in adults (Avtanski et al. 2014). It is possible regulation of Pit1 mRNA by E2 was not seen here because of the neonatal timing. BPA has been shown to bind different receptors including the androgen receptor, estrogen-related receptor, thyroid hormone receptor, peroxisome proliferator-activated receptor, aryl hydrocarbon receptor, and glucocorticoid receptor (reviewed in Acconcia et al., 2015;

Prasanth et al., 2010). Therefore, it is possible that BPA may be acting through one of these receptors to reduce Pit1 mRNA levels. Despite the decrease in Pit1 mRNA with

69 low doses of BPA in males, we did not see any effect on transcript levels of Prl, Gh, or

Tshb. Furthermore, we did not see any change in protein levels of PIT1, which supports the lack of changes in transcription of genes regulated by PIT1. These data suggest the pituitary may adapt to maintain consistent levels of PIT1 in the presence of BPA exposure.

Neonatal BPA exposure also had striking effects on the TPIT lineage that were not seen following embryonic dosing. We observed a decrease in Pomc mRNA in the

E2, BPA0.5, and BPA50 exposed females and with only BPA0.5 and E2 exposure in males, independent of Tpit mRNA changes. E2 exposure in the adult has been shown to reduce Pomc mRNA in the pituitary, which also leads to decreased plasma ACTH and corticosterone levels when stressed (Redei et al. 1994). Seeing the same suppression of Pomc in the neonate suggests that the mechanism by which this inhibition takes place is established early on. However, the precise mechanism is unclear. Interestingly, BPA50 exposed males did not show a decrease in Pomc mRNA.

This represents a crucial sex difference in Pomc mRNA regulation with varying amount of exposure, and potentially a non-monotonic dose response in males. Despite this, we did not see a decrease in intra-pituitary POMC protein expression. There could be a variety of explanations such as increased translation to compensate for decreased transcription. Alternatively, it could be that hormone release is also affected, and intra- pituitary POMC levels are kept very consistent. Other studies in rats have demonstrated the ability of BPA to regulate Pomc mRNA levels and blood ACTH levels in males compared to females in response to stress (F. Chen et al. 2014; Panagiotidou et al.

2014), emphasizing the importance of sex as a variable in research on the HPA axis.

Of the parameters examined, there were few effects of BPA exposure at five weeks following neonatal dosing. There was a decrease in Nr5a1 in BPA0.05 treated female pituitaries at five weeks, however, there was no corresponding decrease in Lhb.

Additionally, changes in Pit1 at PND7 were not seen at five weeks. However, there was a suppression of Pomc in BPA0.5 treated females at five weeks, suggesting the possibility of lasting effects on the stress axis. Despite the minimal effects of BPA on the five-week old pituitary it is possible that changes may be present at different timepoints.

It is also important to note that exposure to BPA is constant over the life span of a person so one would likely never be removed from BPA. Despite the relative lack of changes due to BPA, E2 exposure affected the reproductive axis of five-week females leading to lower Nr5a1 and Lhb levels as well as persistent estrus. Therefore, neonatal

E2 exposure may have permanently altered the HPG axis, which could impact fertility in females.

Overall, we saw contrary effects of BPA exposure in the embryonic versus the neonatal period. This may be demonstrating that the critical window for proliferation and gonadotrope regulation is embryonic, whereas, the critical window for corticotrope regulation is neonatal. After removal of BPA minimal effects were seen, potentially demonstrating the plasticity of the pituitary in being able to regulate itself to maintain proper cell number and hormonal signaling. A commonality in both the embryonic and neonatal periods is the existence of sex specific effects, which may hint at either baseline differences in male and female pituitaries or differences in hormone signaling that would be worth further exploration.

Funding Information: This work was supported by National Institutes of Health grants

[R01 DK076647 to L.T.R], [P01 ES022848 to J.A.F], and [T32 ES007326 to K.S.E and

W.W.]. This work was also supported by an Environmental Protection Agency grant

[RD-83459301 to J.A.F] and the Midwest Society of Toxicology [Young Investigator

Award to K.S.E].

Acknowledgments:

We would like to thank Annesha Banjeree, Karen Weis, and Liying Gao for technical assistance. Jodi Flaws and Wei Wang provided mice for Figure 1.

Figures and Tables

Figure 8: Female pituitary recovered from embryonic BPA exposure, likely due to increased cell death. Proliferation was assessed by mKi67 immunostaining in female pups exposed to control (A), 0.5 μg/kg/day BPA (B), or 50 μg/kg/day BPA (C), demonstrating no difference in proliferating cells in the cleft at PND4. Gonadotrope cell number was assessed by LHβ cell counts in control (D), 0.5 μg/kg/day BPA (E), and 50 μg/kg/day BPA (F), demonstrating no difference between any treatment group at PND4. Cell death was assessed by TUNEL stain at PND0 in control (G), 0.5 μg/kg/day BPA (H), 50 μg/kg/day BPA (I) arrows denote positive cells. Quantification of positive TUNEL stain at PND0 showed increased cell death with 0.5 μg/kg/day BPA and 50 μg/kg/day BPA (J). Quantification of positive TUNEL stain at PND4 showed no significant differences in TUNEL stain (K). (#) = p value ≤ 0.05. Line=50 μm, n=3

WEIGHT(g) TESTES OVARIES UTERI LIVER MALE FEMALE (%BW) (%BW) (%BW) (%BW) AGD AGD (mm/gBW) (mm/gBW)

CONTROL 4.568 0.175 0.049 0.093 3.118 1.142 0.913

BPA0.05 4.105 0.177 0.038* 0.094 3.012 1.161 0.823

BPA0.5 4.432 0.170 0.043 0.096 3.137 1.095 0.829

BPA50 4.545 0.179 0.044 0.104 3.201 1.203 0.816

E2 4.618 0.183 0.057 0.195* 3.163 1.146 0.825 Table 3: PND7 wet weights and measurements. Body weight, wet weights of testes, ovaries, uteri, and liver were compared as a percentage of body weight, and ano-genital distance (AGD) were compared as mm/gram body weight (gBW). N=6 for males and females. (*) = p value ≤ 0.05.

WEIGHT WEIGHT TESTES OVARIES UTERI LIVER MALE FEMALE MALE FEMALE (%BW) (%BW) (%BW) (%BW) AGD AGD (g) (g) (mm/gBW) (mm/gBW) CONTROL 27.446 23.517 0.499 0.092 0.792 6.470 0.47 0.28 BPA0.05 26.950 22.350 0.506 0.112 0.937 6.570 0.50 0.29 BPA0.5 27.813 23.083 0.509 0.095 0.689 5.373 0.49 0.30 BPA50 29.743 23.136 0.505 0.110 0.760 6.309 0.51 0.31 E2 27.111 24.675 0.573 0.080 0.598 6.842 0.48 0.28 Table 4: Five week wet weights and measurements. Body weight, wet weights of testes, ovaries, uteri, and liver were compared as a percentage of body weight, and ano-genital distance (AGD) were compared as mm/gram body weight (gBW). N=3-6 for males and females.

Figure 9: Proliferation was not changed by neonatal exposure to BPA or E2. Proliferation was measured by Mki67 mRNA levels in males (A) and females (B) at PND7, demonstrating no significant change in proliferation. At five weeks, no significant change in proliferation in males (C) or females (D) was observed as well. N=3-6 for each sex. Circles represent individual animals and average is represented by a line.

Figure 10: Gonadotrope markers were unchanged due to neonatal BPA exposure, despite regulation by E2. Gonadotrope marker Nr5a1 mRNA was measured in males (A) and females at PND7 (B), with no response to BPA. At five weeks, there was no effect of BPA or E2 in males (C), but there was suppression of Nr5a1 mRNA in females with exposure to BPA0.05 and E2 (D). Lhb mRNA was decreased by E2 in males (E) and females (F) at PND7 but was unchanged by BPA (E). At five weeks, Lhb was unaltered by any treatment group in males (G). In females, at five weeks, E2 caused significant repression of Lhb mRNA (H). For PND7 n=5-6. For five weeks n=3-6. Circles represent individual animals and average is represented by a line. (#) = p value ≤ 0.05.

Preputial Separation (day) Vaginal Opening (day) CONTROL 23.695 22.514 BPA0.05 23.700 23.533 BPA0.5 24.222 23.167 BPA50 24.104 23.422 E2 25.780 21.667

Table 5: Puberty measurements. Day of preputial separation and vaginal opening were monitored and averaged for males (n=3-5) and females (n=4-6).

Figure 11: BPA suppressed Pit1 mRNA at low doses in males but did not alter transcription of PIT1 lineage hormones. Pit1 mRNA was decreased at PND7 with 0.05

Figure 11 continued: and 0.5 μg/kg/day BPA in males (A), but not females (B). However, PIT1 protein was not changed by BPA or E2 in males by western blot analysis (C). Prl mRNA was not altered by BPA but was increased with E2 in males (D) and females (E). No difference in Gh mRNA with any treatment in males (F) or females (G), and no difference in Tshb mRNA with BPA or E2 exposure in males (H) or females (I) was detected. Pit1 mRNA at five weeks was not changed in males (J) or females (K). For qPCR, n=3-6 and for PND7 western blot n=3. Circles represent individual animals and average is represented by a line. (#) = p value ≤ 0.05.

Figure 12: Pomc mRNA was suppressed by BPA and E2 neonatal exposure. Tpit mRNA was unchanged by BPA or E2 at PND7 in males (A) and females (B). Pomc mRNA was decreased with 0.5 μg/kg/day BPA and E2 at PND7 in males (C) and decreased with 0.5 μg/kg/day BPA, 50 μg/kg/day BPA and E2 in females (D). POMC protein was unchanged by BPA in males (E) and females (F). Pomc mRNA was not different with treatment at five weeks in males (G), however, there was a persistent

Figure 12 continued: decrease in females treated with 0.5 μg/kg/day BPA (H). For qPCR, n=3-6 and for PND7 western blot n=3. Circles represent individual animals and average of combined sexes is represented by a line. (#) = p value ≤ 0.05.

Chapter 4: Estrogen receptor mediated down-regulation of gonadotrope specific genes in the neonatal pituitary

Abstract:

In the pituitary, estradiol is involved in the down regulation of several genes expressed in gonadotrope cells including Lhb, Fshb, and Icam5. However, very little is known about the mechanism by which this happens including which specific estrogen receptor or receptors are important. Estradiol signals through multiple receptor pathways in order to alter transcription of genes. The three estrogen receptors are estrogen receptor alpha (ESR1), estrogen receptor beta (ESR2), and the G-protein coupled estrogen receptor (GPER). Activation of these receptors can lead to either up regulation or down regulation of specific gene expression. To address the question of how Lhb, Fshb, and Icam5 are regulated, we treated cultured ex vivo pituitaries with

ESR1 selective agonist propyl pyrazole triol (PPT), ESR2 selective agonist diarylpropionitrile (DPN), ESR1 and ESR2 antagonist ICI 182,780 (ICI), and an estrogen dendrimer (ED) conjugate, which selectively activates membrane signaling. We found that all the genes decreased by estradiol seemed to be regulated slightly differently. Lhb was suppressed by combined ESR1 and ESR2 signaling in females, but not regulated in males by E2 or selective agonists. Fshb was decreased by E2 in females and ICI in males, however, specific agonists and combinations of agonists were unable to recapitulate this effect and in fact were able to increase Fshb levels with combined

ESR1 and ESR2 in males and combined ESR1, ESR2, and membrane signaling in males and females. Finally, although Icam5 was slightly decreased by PPT in females, nuclear and membrane signaling components were necessary for full suppression in

83 males. The vast variety of pathways estradiol can use to elicit changes in a cell demonstrates the complexity of estrogen signaling and stresses the importance of analyzing the various mechanisms by which these genes are regulated.

Introduction:

Estrogen is a steroid hormone that is critical in the proper functioning of the hypothalamic pituitary gonadal (HPG) axis. If estrogen signaling is enhanced, diminished or altered in any way, this can lead to the development of several diseases including tumor formation and reproductive dysfunction (Wendell et al. 2006; Mary C.

Gieske et al. 2008; Leret et al. 1994). These endocrine related health concerns can potentially be due to the effects of estrogen on the pituitary gland. In the HPG axis, gonadotropin releasing hormone (GnRH) from the hypothalamus stimulates the release of luteinizing hormone (LH) and follicle stimulating hormone (FSH) from the gonadotrope cells of the anterior pituitary, which then stimulates the testes or ovaries to make sex steroids, such as testosterone or estradiol, which then can feed back on the axis to decrease GnRH, LH, and FSH. In the neonatal period, sex steroids also establish critical sex differences. The neonatal testosterone surge is responsible for masculinization or defeminization of several areas of the brain, however, interestingly it is not testosterone itself that leads to these changes, it is estradiol, through the conversion of testosterone to estradiol via aromatase (McCarthy 2008). One key sex difference during the neonatal period is that serum levels of LH and FSH are lower in males than in females after birth (Poling & Kauffman 2012). Recently, we have discovered that the neonatal pituitary also has sex differences in gene expression of

Lhb, Fshb, and Icam5. Interestingly, these sex differences are exclusively found in the

84 gonadotrope cells, which release LH and FSH (Eckstrum et al. 2016). Additionally, expression of all these genes can be suppressed by E2 in vivo, yet it still is not known which receptor E2 signals through to have these effects, because there are many receptors estrogen can signal through.

In order for estrogen to have these effects on the pituitary, it must express the proper estrogen receptors of which there are three expressed in most tissues: estrogen receptor alpha (ESR1), estrogen receptor beta (ESR2), and the G protein-coupled estrogen receptor (GPER). The pituitary possess all these estrogen receptors

(Nishihara et al. 2000; Ogasawara et al. 2009; Hazell et al. 2009), however, the specific cells in the pituitary that possess ESR1 is a bit unclear. In the chick embryo, the majority of ESR1 cells colocalized with gonadotrope cells. However, some expression was also found in thyrotropes and lactotropes, whereas corticotropes and somatotropes were

ESR1 negative (Liu Sheng Cui 2005). Many cells in the adult pituitary have been shown to express ESR1 and ESR2, but expression of ESR1 is generally thought to be higher than ESR2 (Mitchner et al. 1998). In the pituitary of an ovariectomized rat, mRNA expression of ESR1 and ESR2 is detectible in lactotropes, corticotropes, gonadotropes, melanotropes, and folliculo-stellate cells (Mitchner et al. 1998), however, not every cell expressed ESR1 or ESR2. In another study that examined protein levels during proestrus, ESR1 was found in lactotropes, thyrotropes, gonadotropes, and somatotropes, but not corticotropes (González et al. 2008). Therefore, it seems from the embryonic and adult studies that ERs are expressed in almost every cell type, however, few studies have looked specifically at the neonatal pituitary. In the neonatal rat, nuclear staining of ESR1 is visible in the anterior lobe and cytoplasmic staining is present in the

85 intermediate lobe (Pasqualini et al. 1999). GPER expression in the pituitary is less well established. About half of the GPER positive cells co-localize with LH and about 30% of

LH positive cells express GPER in the adult bovine pituitary (Rudolf & Kadokawa 2013), therefore, GPER must be expressed in other cells in the pituitary in addition to gonadotrope cells. Therefore, studies seem to suggest that all three ERs are expressed in gonadotrope cells.

Each of the estrogen receptors have different ways of causing changes within a cell. Classical estrogen signaling occurs when estrogen binds to ESR1 or ESR2. This activates the receptor and leads to homodimerization of the receptor, which will then bind to estrogen-response-elements (EREs) in the regulatory regions of target genes in the nucleus. Once bound, a variety of cofactor proteins are recruited that help to stabilize the transcription preinitiation complex. Depending on the contexts, the effect of binding can be either to activate or inhibit transcription (Hall et al. 2001). Alternatively, genomic estrogen signaling can occur in the absence of EREs. In this scenario, ESR1 or ESR2 binds to other transcription factors, such as Fos and Jun at AP-1 binding sites for example, and again recruits cofactor proteins that can either activate or inhibit gene transcription (Kushner et al. 2000). Finally, there are also non-genomic membrane- mediated effects of estrogen signaling. First ESR1 and ESR2, which can both be found in membrane fractionations (Razandi et al. 1999), can associate with membrane receptors, such as G proteins, leading to the activation of numerous kinase signaling cascades (Levin 2009). Membrane signaling can also occur through G protein-coupled estrogen receptor (GPER), a 7-transmembrane protein receptor found in the plasma or endoplasmic reticulum membrane. Activation of GPER stimulates many intracellular

86 signaling pathways including adenylate cyclase, ERK/MAPK, and PI3K/AKT pathways

(Filardo & Thomas 2012; Xie et al. 2017). Membrane signaling can have several rapid effects through the actions of the kinase signaling cascades, such as the E2 stimulated release of prolactin (Christian & Morris 2002). Membrane signaling can also eventually lead to transcriptional changes. For example, activation of membrane ERs can lead to phosphorylation of CREB, through MAPK, which can then regulate gene expression through interaction on CREB response elements (CREs) (Micevych & Mermelstein

2008). Therefore, there are several pathways and several factors involved in the ability of estrogen to regulate the cell and importantly, gene transcription. Because there are so many pathways by which estrogen can cause changes in a cell, it can be difficult to determine the precise mechanism by which genes are regulated.

We have previously found that E2 suppresses expression of key genes in the gonadotrope cells including Lhb, Fshb, and Icam5 in the neonatal pituitary (Eckstrum,

Weis, Baur, Yoshihara, & Raetzman, 2016). In the current study, to determine the precise mechanism by which E2 regulates these genes, a variety of compounds were used to selectively activate or inhibit the different estrogen receptors. Propyl pyrazole triol (PPT) is an ESR1 selective agonist and it has a 410-fold preference for ESR1 over

ESR2 (Stauffer et al. 2000). Diarylpropionitrile (DPN) is an ESR2 selective agonist and has a 70-fold higher binding preference for ESR2 than ESR1 (Meyers et al. 2001). To activate membrane estrogen signaling, estrogen dendrimer conjugates were used, which are large poly(amido)amine dendrimer macromolecules that are conjugated to multiple estrogen molecules. Due to the charge and size of the estrogen dendrimers, they cannot pass into the nucleus. Binding affinity assays demonstrate that the

87 dendrimer does not reduce the ability of the estrogen to interact with ER (Harrington et al. 2006). Additionally, ICI 182,780, a pure estrogen receptor antagonist, meaning it blocks the actions of ESR1 and ESR2 and can bind these receptors with the same affinity as estradiol (Wade et al. 1993), will determine if E2 signals through ESR1 or

ESR2 to regulate transcription of our genes. ICI works by disrupting shuttling of ESR1 and ESR2 between the nucleus and cytoplasm and decreasing cellular levels of ESR1 and ESR2 (Dauvois et al. 1993; Howell et al. 2000).

We hypothesized that Lhb, Fshb, and Icam5 would be regulated through one or multiple estrogen receptors in the neonatal pituitary. To test this hypothesis, neonatal pituitaries were treated with selective agonists and antagonists either alone, or in combination with other compounds. We found that each of the genes downregulated by estradiol were regulated slightly differently. Lhb seems to be regulated through ESR1 and ESR2 in females only, Fshb seems to be regulated by multiple receptors in opposing ways. Lastly, Icam5 appears to be regulated by both nuclear and membrane signaling. The fact that none of the genes downregulated by E2 in the neonatal pituitary are regulated in the same way highlights the diversity of possible signaling pathways through which estrogen can alter transcription and shows the importance of finding the specific mechanisms by which these genes are regulated.

Materials and methods

Mice

CD-1 mice were bred in house, kept in plastic cages containing corn cob bedding material, and fed Teklad 8664 rodent chow (Envigo) and water ad libidum. Mice were collected at PND0, PND4, PND9, and six weeks (adult). Females were collected in

88 diestrus for Esr1 and Esr2 analysis (n=6-11). Mice were collected at PND1 for ex vivo pituitary cultures. Sex was confirmed by visual inspection and SRY genotyping as previously described (Eckstrum et al. 2016). The University of Illinois Urbana-

Champaign Institutional Animal Care and Use Committee approved all procedures.

Ex vivo pituitary cultures

PND1 pituitaries were cultured overnight on Millicell CM membranes (Millipore) as previously described (Eckstrum et al. 2016). The next day media were replaced with media containing control (ethanol 0.2%), propyl pyrazole triol (PPT) (10-8M) purity >

99% (Tocris), diarylpropionitrile (DPN) (10-8M) purity > 99% (Tocris), estrogen dendrimer conjugate (10-9M), dendrimer conjugate (dendrimer control) (10-9M) (a generous gift from Dr. John Katzenellenbogen, University of Illinois Champaign-

Urbana), estradiol (E2) (10-8M) purity > 99% (Tocris), or ICI 182,780 (10-5M or 10-6M) purity > 99% (Tocris) or a combination of these compounds for 48 hours before collection (n=6-13).

Quantitative RT-PCR

Cultured pituitaries were rinsed with PBS before being collected and both cultured and in vivo pituitaries were processed as previously described (Nantie et al.

2014). Actb and Cckar primers were previously used in our lab (Weis & Raetzman

2016), as were Lhb, Fshb, Prl (Brannick et al. 2012), and Icam5 (Eckstrum et al. 2016).

Esr1 primers were forward 5’ to 3’: AATTCTGACAATCGACGCCAG and reverse 5’ to

3’: GTGCTTCAACATTCTCCCTCCTC. Esr2 primers were forward 5’ to 3’:

GGATGAGGGGAAGTGCGTGGAAGG and reverse 5’ to 3’:

AGTTTTAACTCACGGAACCGTGCCG. Pmaip1 primers were forward 5’ to 3’:

GCCAATCTGTTTTAGGGTGA and reverse 5’ to 3’: CAGAACAGGCAACATCCGTT.

Data were analyzed using the standard comparative ΔCT value method as previously described (Goldberg et al. 2011). The error bars in the figures represent the SEM of the relative fold-change for each group.

Statistical Analysis

Statistical significant was determined using a one-way ANOVA in excel for ICI experiment followed by a two-tailed Tukey’s HSD test or only the Tukey’s HSD test in

Microsoft Excel. P values less than or equal to 0.05 were considered statistically significant. Outliers were eliminated as determined by the Grubb’s test.

Results:

Esr1 mRNA increases over the postnatal period while Esr2 mRNA decreases

First, to determine dynamics of estrogen receptor expression in the neonatal pituitary compared to an adult, we examined Esr1 and Esr2 mRNA expression from birth to adult. Over the course of the postnatal period, levels of Esr1 increased over time in males and females compared to PND0 (Figure 13A), whereas levels of Esr2 decreased over time in males and females (Figure 13B). Thus, higher expression of

Esr2 during the neonatal period than in the adult may suggest a greater role for ESR2 during the neonatal period. Additionally, at birth, there was no difference in expression of Esr1 or Esr2 between males and females, suggesting that when pituitaries are taken out and treated in culture with selective agonists, receptor levels of Esr1 and Esr2 may be similar between the sexes.

Confirmation of selective activation of estrogen receptors with PPT, DPN and ED

To determine the roles the different estrogen receptors play in the regulation of

Lhb, Fshb, and Icam5, we first confirmed the doses for the selective agonists. A dose response curve was performed for the ESR1 selective agonist propyl pyrazole triol

(PPT) to determine a minimal dose of PPT that was sufficient to induce expression of

ESR1 regulated gene Cckar (Kim et al. 2007). All doses of PPT from 10-8M to 10-5M were sufficient to induce expression Cckar, therefore, PPT 10-8M was used for further studies (Figure 14A). The ESR2 selective agonist, diarylpropionitrile (DPN) increased

Cckar from 10-8M to 10-5M, but not at 10-9M, therefore, DPN 10-9M was used for further studies (Figure 14B). Finally, the estrogen dendrimer (ED (10-9M)) regulated expression of a known membrane estrogen regulated gene phornol-12-myristate-13-acetate- induced protein 1 (Pmaip1) in males only (Figure 14C) (Madak-Erdogan et al. 2008).

Nevertheless, this shows that this dose of ED was sufficient to activate membrane signaling. The estrogen dendrimer only slightly increased expression of nuclear signaling regulated Cckar mRNA compared to that of E2 exposure (Figure 14D).

Therefore, this concentration of ED was chosen to best balance activation of membrane signaling while minimizing nuclear signaling.

Lhb mRNA is decreased by ESR1 and ESR2 combined signaling in females

Whole animal E2 exposure in the neonatal period decreased pituitary Lhb mRNA in both males and females; however, pituitary E2 treatment in vitro decreased Lhb mRNA in females only (Eckstrum et al. 2016). The estrogen receptor that leads to a decrease in Lhb is unknown at this age. Co-treatment of ICI and E2 reversed the decrease in Lhb in female pituitaries and ICI alone had no significant effect in either sex

(Figure 15A), suggesting that ESR1 or ESR2 is important in regulation of Lhb mRNA.

However, PPT (Figure 15B), DPN (Figure 15C), and the ED (Figure 15D) were all insufficient to decrease Lhb on their own, suggesting maybe more than one receptor is necessary for regulation. Combined treatment of PPT and DPN decreased Lhb in females similar to the decrease with E2 (Figure 15E) and there was no increased effect when the ED was also added to PPT and DPN (Figure 15F), suggesting Lhb is regulated by a combination of ESR1 and ESR2 signaling.

Fshb mRNA is regulated by multiple signaling pathways in opposing ways

E2 exposure in the neonatal period in vivo decreased Fshb mRNA in both males and females and in vitro E2 treatment decreased Fshb mRNA in females only

(Eckstrum et al. 2016). Here, we add that co-treatment of ICI and E2 was able to reverse the decrease in Fshb mRNA seen with E2 exposure in females, however, ICI alone was also able to decrease Fshb mRNA in males (Figure 16A). Co-treatment of E2

+ICI suggests either ESR1 or ESR2 is important in down regulation of Fshb in females, however, the effects of ICI in males also suggest other signaling pathways are important. Similarly, to Lhb transcription, PPT (Figure 16B), DPN (Figure 16C), and the

ED (Figure 16D) were all unable to regulate Fshb alone, again suggesting more than one receptor may be required. Surprisingly, co-treatment of PPT+DPN increased Fshb in males and females (Figure 16E). Addition of the ED did not change the direction of

Fshb regulation, and the PPT+DPN+ED treatment increased Fshb mRNA in males and females (Figure 16F). Taken together, these data show that upregulation of Fshb mRNA in vitro is through ESR1 and ESR2, but the mechanism by which E2 decreases Fshb remains elusive.

E2 decreases Icam5 through a combination of membrane and nuclear signaling pathways

Previously, we had demonstrated that E2 decreases Icam5 mRNA in vivo and that this decrease can occur directly at the level of the pituitary in males and females.

This decrease is completely blocked by ICI and ICI alone has no effect (Eckstrum et al.

2016). This suggests either ESR1, ESR2, or both are important in regulation of Icam5.

PPT slightly decreased levels of Icam5 (Figure 17A) in females, but not in males; however, the decrease was not as great as it was with E2 treatment, which was about a

35% decrease (Eckstrum et al. 2016). These data suggest that another receptor may also be important for regulation of gene expression. Neither DPN (Figure 17B) nor the

ED (Figure 17C) could regulate Icam5 alone. Additionally, PPT+DPN had no effect on

Icam5 (Figure 17D). However, co-treatment of PPT, DPN, and the ED, did decrease

Icam5 levels in both males and females (Figure 17E), suggesting both membrane and nuclear signaling components may be necessary for Icam5 regulation.

Discussion

Estrogen can signal through several receptor pathways and intermediate proteins. This diversity allows the main estrogen, E2, to have a wide array of effects in many different tissues. In the neonatal pituitary, we saw that E2 could decrease expression of key genes in the gonadotrope cells, Lhb, Fshb, and Icam5, potentially leading to the establishment of sex differences in expression of these genes. However, the mechanism by which these genes are regulated is not well established, especially in the neonatal pituitary. The first step in determining the mechanism by which these genes are regulated was to determine the precise estrogen receptor important in gene

93 regulation. Therefore, we treated pituitaries with a variety of selective agonists and antagonist in hopes of finding the critical receptor. Table 6 provides a summary of the effects of each of the selective agonists in males and females. Interestingly, we found

Lhb to be regulated by ESR1 and ESR2 in females only. Fshb may be differentially regulated by different estrogen receptors in a complicated system involving levels of activation of each receptor. Finally, Icam5 required components of nuclear and membrane signal to exhibit repression in both males and females. Therefore, the signaling mechanisms by which E2 decreases gene expression in the neonatal pituitary appear to involve multiple receptors and mechanisms.

Direct stimulation of the neonatal pituitary with E2 decreased Lhb mRNA only in females. The combination of PPT and DPN reduced levels of Lhb in females similarly to

E2, suggesting that both ESR1 and ESR2 play a role in this unique suppression during the neonatal period at the level of the pituitary in females. It could be that both ESR1 and ESR2 are important because in the neonatal period levels of Esr1 are lower than they are in the adult, whereas Esr2 levels are higher so both end up being important. It is interesting that when PPT, DPN, and the ED were all combined there was no longer a decrease in Lhb in females. A possible explanation for this is that membrane signaling caused by the ED may interfere with Lhb transcriptional regulation. Other studies have demonstrated a different time course of action for E2 and the ED (Alyea et al. 2008), which may also explain the results.

This study and a previous study examining treatment of a synthetic estrogen, diethylstilbestrol (DES), on neonatal pituitaries in culture show a decrease in Lhb levels,

(Ishikawa et al. 2014). However, in the adult female, Lhb mRNA appears to be primarily

94 regulated by ESR1, but not directly at the pituitary. E2 exposure in adult ESR1 KO mice does not decrease Lhb mRNA in vivo and in cultured pituitary cells and E2 does not decrease Lhb after 48hrs (Lindzey et al. 2006). In fact, in 6 hr cultured hemipituitaries of ovariectomized rats, E2 actually increased Lhb transcription through direct binding to an

ERE located in the Lhb promoter (Margaret A. Shupnik et al. 1989; M A Shupnik et al.

1989). However, conflicting results in pituitary specific ESR1 KO mice make it difficult to determine the role of this receptor in negative feedback of estradiol. In one study, gonadotrope specific ESR1 KO mice have normal levels of LH serum and Lhb mRNA

(M C Gieske et al. 2008), suggesting minimal to no role in negative feedback of estradiol. In another study, gonadotrope specific ESR1 KO mice have high Lhb mRNA, albeit not as high as global ESR1 KO mice and E2 treatment does not repress Lhb mRNA to the degree that occurs in wild type mice, suggesting impaired negative feedback with loss of ESR1 at the level of the pituitary (Singh et al. 2009). However, it is possible that this loss of ESR1 at the pituitary may not directly impact Lhb mRNA transcription, but rather interfere with sensitivity to GnRH (Brown & McNeilly 1999). In all, it is interesting that E2 could decrease Lhb mRNA directly at the pituitary in culture, suggesting that there is something unique about the neonatal pituitary that allows this to happen. Another important observation is that regulation of Lhb mRNA in the neonatal pituitary is confined to females in culture. Perhaps, exposure to sex steroids through the testosterone surge programs the male pituitary to be unable to respond to estradiol directly at the pituitary, making males unable to decrease Lhb with E2 exposure

(Clarkson & Herbison 2016). Females who were not previously exposed to sex steroids may be able to respond until they are also exposed to high sex steroids later in life, so

95 that as an adult, female pituitaries also do not respond to estradiol directly at the pituitary to directly regulate Lhb mRNA directly. The mechanism behind this is unknown and worthy of further exploration.

Regulation of Fshb appears to be quite complicated as activation or inhibition of various receptors had somewhat contradictory results; E2 decreased expression in females, ICI decreased expression in males, E2+ICI had no effect, PPT, DPN, and the

ED had no effect individually, but PPT+DPN increased Fshb in males and PPT, DPN, and the ED increased Fshb in males and females. Unfortunately, no hints are given on the regulation of Fshb by examining the adult, estradiol does not seem to strongly regulate Fshb directly at the pituitary in the adult. In the adult, Fshb mRNA seems to be less regulated by estradiol levels than Lhb because ESR1 KO, ESR2 KO, and ESR1/2

KO mice do not show differences in FSH plasma levels or Fshb mRNA (Couse et al.

2003), showing that in the adult Fshb is more regulated by ovarian factors such as inhibin and activin (Couse et al. 2003). Pituitary gonadotrope specific ESR1 KO mice show no difference in Fshb mRNA or FSH serum levels (Mary C. Gieske et al. 2008).

Similarly cultures of dispersed adult pituitary cells do not have changes in Fshb mRNA after 48hrs of estradiol exposure (Lindzey et al. 2006). Again, this demonstrates that the neonatal period may be unique in its ability for estradiol to regulate it. DES decreased

Fshb levels in neonatal pituitary cultures, however sexes were not separated (Ishikawa et al. 2014). Interestingly, in our study we saw that E2 had no effect in males, however,

ICI alone decreased Fshb in males. ICI has been shown to be able to activate GPER in other studies (Filardo et al. 2000; Y. Chen et al. 2014; Long et al. 2017). Therefore, if

ICI is activating GPER, it is possible that in the neonatal pituitary ESR1 and ESR2

96 regulate Fshb mRNA differently than GPER. There are other documented cases where different estrogen receptors have opposite effects on gene transcription. For example,

ESR1 activates cyclin D1 (Ccnd1) expression, whereas ESR2 inhibits its expression in

HeLa cells (Liu et al. 2002). Similarly, ESR1 has been shown to activate transcription when complexed at AP-1 sites, whereas ESR2 inhibits transcription in reporter assays

(Paech et al. 1997). One possibility is that ESR1 and ESR2 increase Fshb and GPER decreases Fshb so that in males it is balanced out and there is no overall effect with exposure to E2. In females, however, E2 suppressed Fshb and treatment with other compounds had no effect. Perhaps, the activation of GPER outweighs the activation of

ESR1 or ESR2 in females. Additionally, it is possible that the GPER signaling leading to decreased Fshb may be found on the endoplasmic reticulum instead of the plasma membrane because the ED was unable to decrease Fshb in females or block the increase in Fshb in PPT, DPN, and ED cultures. However, it is clear that more studies are necessary to determine which receptors are important during this time period and how they regulate Fshb.

We showed previously that Icam5 is suppressed by E2 directly at the pituitary in both males and females and this suppression is blocked by the ESR1/ESR2 antagonist

ICI (Eckstrum et al. 2016). This suggests ESR1 and/or ESR2 are important in regulation of Icam5. Here we show that in females ESR1 activation was able to slightly decrease levels of Icam5 in females only, however, not to the extent that E2 was able to do. Only when all receptor agonists were added did we observe suppression of Icam5 in both males and females. In terms of what activation of all three receptors means for transcriptional regulation of Icam5, it suggests first of all, a multi-step process.

Membrane signaling through ESR1, ESR2 or GPER can lead to activation of kinases such as ERK/MAPK and PI3/AKT (Levin 2005). Kinases can then do several things.

They can phosphorylate nuclear ER enhancing its transcriptional action (Kato et al.

1995). They can influence the phosphorylation and recruitment of cofactors (Zwijsen et al. 1997). Additionally, they can activate or inhibit transcriptional regulators, leading to activation or inhibition of genes (Liang & Slingerland 2003). Here, we propose that membrane signaling activates a transcriptional repressor whose expression is increased by nuclear ERs, which then represses Icam5 transcription. This model is appealing to us because it takes 24hrs to see a decrease in Icam5 with E2 exposure (data not shown) and the translation inhibitor cycloheximide was able to inhibit the decrease in

Icam5 caused by E2 (data not shown), suggesting a protein needed to be created in order to regulate Icam5. Additionally, there is no known putative ERE in the Icam5 promoter, suggesting indirect mechanisms of regulation. However, further studies are necessary to determine the mechanism by which E2 regulates Icam5 mRNA.

The purpose of E2 regulation of Icam5 and the reason multiple pathways impact mRNA levels is unknown. However, we hypothesize that ICAM5, which is expressed only in gonadotrope cells, may be important in coordinated hormone release of LH and

FSH (Eckstrum et al. 2016). There is evidence in the adult that multiple signaling pathways regulate LH because in membrane only estrogen receptor alpha (MOER) and nuclear only estrogen receptor alpha (NOER) mice LH serum levels are elevated despite high levels of estradiol, indicating that both membrane and nuclear signaling are needed for suppression of LH serum levels (Pedram et al. 2014; Pedram et al. 2009). It could be that membrane and nuclear signaling are required to decrease Icam5 which

98 then decreases LH release and serum levels. Though MOER and NOER mice are globally affected so it may be due to changes in the hypothalamus instead of the pituitary. However, it is clear that both membrane and nuclear signaling are sometimes needed to regulate specific functions. In all, if Icam5 is regulated directly at the pituitary by nuclear and membrane signaling and if ICAM5 is involved in release of LH, it possible that the defects in NOER and MOER mice may be in part carried out by improper transcriptional repression of Icam5, which may impede the ability of E2 to decrease LH serum levels.

At this point, the precise transcriptional mechanism by which Lhb, Fshb, and

Icam5 are regulated remains unclear. It is very interesting that regulation of each of these transcripts appears unique even in so much as which estrogen receptors are important. This study highlights the necessity of studying the mechanism by which genes are regulated because it could differ even in genes that on the surface appear to be regulated similarly. It is also significant that there are age and sex specific effects with regard to regulation. Identification of how each of these genes are specifically regulated will provide insight into the effects of endocrine disrupting chemicals, which may preferentially bind one receptor versus another, leading to effects similar to that of estradiol, but not the exact same. Therefore, it is worth further investigation to clarify the precise mechanisms by which estradiol and compounds with estrogen-like effects decrease gene expression in the neonatal pituitary.

Figures and Tables

Figure 13: Esr1 mRNA increased over the postnatal period whereas Esr2 mRNA decreased. Increased levels of Esr1 mRNA levels (A) and decreased levels Esr2 mRNA levels (B) in males (black) and females (grey) from postnatal day (PND)0 to adult (females in diestrus) compared to PND0 males. (*) indicates p ≤ 0.05 for males and females compared to PND0 male control. n=6-11.

100

Figure 14: Confirmation of estrogen receptor selective agonists. A dose response of ESR1 regulated Cckar levels showed increased Cckar at all doses of PPT (A) and DPN 10-8M to 10-5M, but no increase at 10-9M (B). Membrane regulated Pmaip1 mRNA was decreased with exposure to the estrogen dendrimer (ED) in males but not in females (C). ED slightly increased Cckar (3-fold), however, E2 signaling is able to increase it 50- fold (D). (*) indicates p ≤ 0.05. n=3-6 (Cckar) n=9-10 (Pmaip1).

101

Figure 15: Lhb mRNA was decreased in females by combined ESR1 and ESR2 activation. Co-treatment of E2+ICI blocked suppression of Lhb mRNA in females and ICI alone had no effects and no effect was seen in males with E2, E2+ICI, or ICI alone (A). PPT had no effect on Lhb mRNA in males or females (B). DPN had no effect on Lhb mRNA in males or females (C). ED had no effect on Lhb mRNA (D). Co-treatment of PPT and DPN had no effect in males, but decreased levels of Lhb mRNA in females similar to E2 (E). Treatment with PPT, DPN, and the ED had no effect on Lhb mRNA in males or females (F). (*) indicates p ≤ 0.05. n=7-13.

102

Figure 16: Fshb mRNA was regulated by receptor agonists in opposing ways. Co- treatment of E2+ICI blocked suppression of Fshb mRNA in females and had no effect in males and ICI alone decreased Fshb mRNA in males but not in females (A). PPT had no effect on Fshb mRNA in males or females (B). DPN had no effect on Fshb mRNA in males or females (C). ED had no effect on Fshb mRNA in males or females (D). Co- treatment of PPT and DPN increased Fshb mRNA in males and females (E). Treatment with PPT, DPN, and the ED increased levels of Fshb mRNA in males and females (F). (*) indicates p ≤ 0.05. n=7-13

103

Figure 17: Icam5 mRNA was decreased by nuclear and membrane signaling. PPT slightly decreased Icam5 mRNA in females, but not males (A). DPN did not change Icam5 mRNA levels in males or females (B). The ED did not change Icam5 mRNA in males or females (C). Co-treatment of PPT and DPN did not alter Icam5 mRNA levels (D). Treatment with PPT, DPN, and the ED decreased levels of Icam5 mRNA in both males and females (F). (*) indicates p ≤ 0.05. n=7-13

104

Effects of ER selective agonists and antagonists on gene transcription

Sex Gene E2 E2+ICI ICI ESR1 ESR2 Membrane ESR1+ESR2 ESR1+ESR2+ Membrane Male Lhb NC NC NC NC NC NC NC NC

Female Lhb Decreased NC NC NC NC NC Decreased NC

Male Fshb NC NC Decreased NC NC NC Increased Increased

Female Fshb Decreased NC NC NC NC NC NC Increased

Male Icam5 Decreased NC NC NC NC NC NC Decreased

Female Icam5 Decreased NC NC Decreased NC NC NC Decreased

Table 6: Summary of effects with different estrogen receptor ligands on Lhb, Fshb, and Icam5 mRNA. Gene expression increased, decreased, or not changed (NC) via estradiol (E2), E2+ICI, ESR1, ESR2, membrane signaling, ESR1+ESR2, or ESR1, ESR2, and membrane signaling.

105

Chapter 5: Conclusions/Discussion

Exposure to hormonal and chemical compounds is becoming an increasing problem with the rising production of chemicals. Unfortunately, some of these compounds have adverse effects on endocrine human health including obesity, reproductive disorders, and depression and/or anxiety (Vessey et al. 1983; Vandenberg et al. 2007). The pituitary is an integral component of the endocrine system and thus, disruption of the pituitary gland could potentially lead to the development of disorders caused by endocrine disrupting chemicals (EDCs). Many EDCs interfere with the action of naturally circulating hormones, including estrogen signaling. Bisphenol A is one of these compounds. It is one of the highest volume chemicals produced worldwide because it is found in many consumer products, which contain polycarbonate plastics and epoxy resins (Vandenberg et al. 2007). Because of its presence in so many products, it is hard to avoid exposure to this compound. BPA is found in human serum, urine, amniotic fluid, placental tissue, and umbilical cord blood (Vandenberg et al.

2007), demonstrating that critical developmental periods may experience BPA exposure. Importantly, these developmental periods may be more sensitive to endocrine disruption and have the potential for lasting effects (Hanson & Gluckman

2008). Because of the ubiquitous exposure to EDCs during critical windows of the development, it is important to understand what effect these compounds, as well as naturally circulating hormones, have on the pituitary. Characterization of the effects of naturally circulating hormones and exogenous exposure to E2 and BPA as well as the mechanisms by which these changes occur were analyzed in Chapters 2 through 4.

106

Sex differences in neonatal pituitary due to sex steroids

In order to understand the potential effects of EDCs, like BPA, that can interfere with estrogen signaling, we first sought to determine the effects of naturally circulating hormones. Naturally circulating sex steroids are critical in the development of sex differences in the brain due to the testosterone surge that occurs in males. This testosterone is then converted to estradiol, which is the main hormone involved in masculinization of the brain (McCarthy 2008). We show that the neonatal pituitary also has sex differences in gene expression. Interestingly, these sex differences are confined to the gonadotrope lineage (Eckstrum et al. 2016). Females have higher levels of Lhb, Fshb, and Icam5 mRNA compared to the males and E2 exposure decreases expression of these genes. This demonstrates that the neonatal pituitary is sensitive to estrogen exposure and that sex differences in the HPG axis are apparent early, which may alter the ability of males or females to respond to external stimuli. Though it is interesting that only three genes were differentially expressed between males and females, it is possible that there are differences in protein levels, receptor activation, enzyme activity, etc. that were not examined in this study, which should be analyzed in more detail in the future to better understand the differences between males and females.

BPA has sex specific and developmental window specific effects

Males and females do not always respond similarly to EDCs. In the embryonic period, BPA affected the females, but not the males. In the neonatal period, Pit1 mRNA was regulated in males, but not females and Pomc levels were decreased in females, but not males with 50 mg/kg/day BPA (Chapter 3), although the mechanism behind this

107 is unknown. The differences in the ability of males and females to respond to stimuli are likely due to natural sex differences established by the testosterone surge, which can potentially cause sensitization or desensitization. For example, females may be more sensitive to BPA than males during the embryonic period because males are exposed to higher testosterone levels beginning around embryonic day 13 (Clarkson & Herbison

2016). Females, on the other hand, do not have high levels of circulating estrogen and estrogen that is circulating is bound by alpha-fetoprotein (Montano et al. 1995).

Therefore, it is possible that the testosterone in males leads to desensitization of the pituitary to sex steroid hormonal signals. Alternatively, it could be that due to higher levels of testosterone, BPA is less likely to bind receptors and have effects if it is competing with testosterone or estradiol. BPA is not the only compound that can have sex specific effects. E2 can also have sex specific effects in that E2 decreases Lhb mRNA and Fshb mRNA in females only directly at the pituitary (Eckstrum et al. 2016), showing that there are innate differences in the male and female pituitary itself, without influence from the hypothalamus. This suggests that exposure to sex steroids may be able to sensitize or desensitize the pituitary, allowing for sex specific effects of EDCs to occur.

Not only do males and females have different responses to BPA, but so do different developmental time periods. One of the major findings of our studies was that the embryonic and neonatal pituitaries do not appear to respond the same way to BPA exposure, demonstrating that there are differences between these two periods. Figure

18 summaries the effects of BPA exposure in the embryonic and neonatal pituitary on the different lineages (Figure 18). In the embryonic pituitary, proliferation and the

108 gonadotrope lineage were the most affected, whereas in the neonatal period the PIT1 and TPIT lineages were more affected by similar doses of BPA (Chapter 3). Again, we suggest the difference in embryonic versus neonatal changes may be due to natural hormones, which cause changes in the body leading to desensitization of some axes and sensitization of others. At birth, males have the testosterone surge, which is important in the generation of sex differences (Clarkson & Herbison 2016). Females do not have this surge, however, at 4 hours after birth, which is coincident with the testosterone surge, there are higher levels of free estradiol in females corresponding to free estradiol levels at proestrus (Montano et al. 1995). This increase in estradiol at birth could desensitize the HPG axis and proliferation in the neonatal female similarly to how embryonic testosterone may desensitize the male pituitary leading to a sex specific effects of embryonic BPA exposure. The reason for this increase, which also occurs in males, is not clear, however, it could be changes in isoforms of alpha-fetoprotein that bind estradiol more weakly or it could be due to an increase in glucocorticoids that occurs with birth, which alpha-fetoprotein also binds, making it so that there is more circulating estradiol (Vallette, Benassayag, Belanger, Nunez, & Jayle, 1977).

Additionally, because glucocorticoids increase at birth, it is possible that they may play a role in either desensitizing the HPG axis, or sensitizing the TPIT and PIT1 lineages.

Despite not knowing which factor or factors change from the embryonic to neonatal period leading to alternate effects in each period, it is clear that these two periods are not the same and thus, should not be overlooked when examining exposure to EDCs.

Further experimentation needs to be done to determine which factors contribute to the ability of proliferation and the gonadotrope lineage to be altered in the embryonic

109 pituitary and not the neonatal pituitary and the ability of the TPIT and PIT1 lineages to be affected neonatally, but not embryonically. In the future, more extensive comparison of factors present in the embryonic and neonatal period may be useful in answering this question such as, receptor levels and activation, hormone levels, and gene or protein expression. Very little is known about the differences between these periods, however, these studies suggest that those differences may be very important in terms of sensitivity to EDCs.

Taken together, BPA has sex specific and developmental window specific effects

(summarized in Table 7) showing that the sexes are not the same, even at a very early age, and the developmental windows also are not the same. This demonstrates the importance of examining exposure to environmental compounds throughout development in both sexes as well as long after exposure, as compounds can sometime have lasting effects.

The identification of a novel gene in the pituitary, Icam5, and its potential function and regulation

One of the major findings of this study was the identification of Icam5. This molecule has never been described in the pituitary before. We showed that it is expressed specifically in the gonadotrope cells, however its function is not known. We hypothesize it may be involved in gonadotrope networks and potentially hormone release, due to its role in the brain. In the hippocampus, ICAM5 is expressed on the surface of dendritic filopodia, immature dendrite spines, and it makes connections with

ICAM5 on other dendrites (Tian et al. 2000). The ability of ICAM5 to make homophilic connections with other ICAM5 molecules in the brain suggests that it may be able to do

110 the same in the pituitary. In the pituitary, all the different hormone secreting cell types form networks which allows the cells to function as a unit and coordinate hormone release (Bonnefont et al. 2005; Golan et al. 2016). In order for the cells to form these networks, they must be able to communicate with each other, potentially through various adhesion molecules. Because ICAM5 is only present in gonadotrope cells, it is possible that ICAM5 is the cell adhesion molecule important in forming functional gonadotrope networks allowing for coordinated pulsatile release of LH and FSH.

Therefore, the lower serum levels of LH and FSH seen in male mice after the testosterone surge (Poling & Kauffman 2012) may be not only due to decreased Lhb and Fshb transcription itself, but also due to less Icam5 leading to less coordinated hormone release. In the future, determining the role of ICAM5 will be a necessity.

Analysis of ICAM5 in a pre-gonadotrope cell line, alpha T3 cells, which expresses

Icam5 may be useful to determine if disruption of ICAM5 alters the ability of these cells to connect and move. This would be able to tell us if ICAM5 is important in forming gonadotrope networks. Furthermore, to determine if ICAM5 is important in coordinated hormone release, pituitary cultures using siRNA to suppress Icam5 can be done and the release of LH and FSH in the media could be measured.

Though the effect of ICAM5 on reproductive status is unknown, it is possible it can disrupt synchronized LH and FSH secretion and thus fertility. Interestingly, in gonadotrope specific ESR1 knockout mice Lhb and Fshb mRNA are not altered.

Additionally, basal levels of LH and FSH serum are maintained, however, these mice still exhibit infertility and irregular estrous cyclicity suggesting a disorder in properly regulating LH and FSH release (M C Gieske et al. 2008). It is possible that ICAM5 may

111 be disrupted in these gonadotrope specific ESR1 knockout mice leading to a disruption of synchronized secretion of LH and FSH. Examination of ICAM5 knockout mice would elucidate the function and determine if there is any reproductive outcome on loss of this protein.

Mechanisms of estrogen regulation

Finally, to understand how potentially estrogenic EDCs can influence the pituitary, we really need to understand the mechanism by which estrogen itself regulates transcription in the pituitary. To start, we have examined briefly the mechanisms of estradiol regulation of sexually dichotomous genes Lhb, Fshb, and

Icam5 in the neonatal pituitary. Interestingly, each gene is regulated somewhat differently than the next, which exemplifies the diversity of estrogen signaling. In females, Lhb appears to be regulated by ESR1 and ESR2, whereas Fshb appears to be regulated by all receptors in opposing ways. ESR1 and ESR2 appear to increase Fshb, however, E2 decreases it in females, suggesting GPER may be responsible for the decrease in Fshb. Despite this, Lhb and Fshb mRNA actually appear to be more strongly regulated in vivo than directly at the pituitary, suggesting regulation of these genes directly at the pituitary may be minimal. In fact, Lhb and Fshb mRNA were not regulated in males directly at the pituitary by E2. If Lhb and Fshb are not strongly regulated by estrogen signaling directly at the pituitary, it may be by contributing to the difficulty in determining the mechanism of regulation directly at the pituitary. More importantly, it would suggest that in vivo changes of Lhb and Fshb due to exposure to

EDCs would be more likely to be due to systemic effects, such as effects on the hypothalamus, leading to changes in GnRH. However, more experiments to determine

112 the role of GPER may be worth-while, at least to explain our data and to see if any combination of selective agonist can result in a decrease similar to E2 in females. G1 is a selective agonist for GPER and should be examined in our culture system.

Because Icam5 is a novel gene in the pituitary and is regulated by both E2 and

BPA (Eckstrum et al. 2016), determining how it is regulated is incredibly important and likely to be a focus of the lab in the future. We saw that E2 can decrease expression of

Icam5 in vivo and directly at the pituitary. ICI was able to block this effect, suggesting that ESR1, ESR2, or both are important in regulation of this gene directly at the pituitary. Further analysis, however, demonstrated that it is not that simple and activation of ESR1, ESR2, and membrane signaling were all needed to decrease

Icam5, suggesting that regulation of Icam5 may require multiple steps and ablation of any one of those steps may limit the ability of the regulation to occur. We have only begun to scratch the surface on how this gene is regulated, but we hypothesize a two- step process in which nuclear ESR1 activates transcription of a transcriptional repressor shown in figure 19. Then, in order for this repressor to become activated, it must be phosphorylated by membrane signaling through kinase cascades, possibly through

GPER. The phosphorylated receptor would then bind to the regulatory element of Icam5 and inhibits its transcription. ESR1 may be the nuclear estrogen receptor responsible for the increase in a transcriptional repressor because activation of ESR1 by PPT was able to slightly decrease Icam5 in females. Next, we hypothesize that the transcriptional repressor, may be CREB, which is known to regulate transcription of gonadotrope genes and be regulated by E2 exposure (Iqbal et al. 2007). Additionally, Icam5 possesses putative CREB transcription factor binding sites suggesting CREB may pay a

113 role in its regulation (unpublished observation). However, at this point all we can do is speculate about the potential regulatory element. To narrow, our focus it would be helpful to find the precise regulatory region using promoter deletion analysis. These can potentially be done in the pre-gonadotrope cell line, alpha T3 cells, however, they have not been done yet due to E2 being unable to regulate Icam5 in these cells, suggesting they are missing some necessary factor. In fact, they have low levels of Esr2 and Gper1 mRNA (the mRNA for GPER, unpublished observations).

We have determined that membrane signaling is likely important in transcription of Icam5, however, this does not say which receptor at the membrane is important.

GPER is a membrane bound receptor, which can be located in the plasma membrane.

However, ESR1 and ESR2 have also been shown to associate with the membrane in other studies (Zarate et al. 2012; Filardo & Thomas 2012). We suspect that GPER may be important because PPT should be able to activate membrane ESR1 as well as nuclear and we did not see the same degree of suppression with PPT treatment as we did with PPT+DPN+ED. Clearly, more studies are needed to determine the precise mechanism by which these genes are regulated. Determining the mechanism by which these genes are regulated will be very important in understanding how endocrine disrupting chemicals disrupt endocrine physiology. If all these genes are regulated differently, it is possible that different EDCs would have different effects based on which specific receptors are bound with higher affinity in specific contexts.

Effects of neonatal exposure to BPA, are they dangerous?

Exposure to EDCs such as BPA during the neonatal time period, which equates to the third trimester of human development, has the potential to adversely impact

114 several aspects of the endocrine system. We saw that neonatal exposure to BPA decreased Pit1, Pomc, and Icam5 expression in a dose and sex specific manner

(Chapter 3, (Eckstrum et al. 2016)). Pit1 was decreased by low doses of BPA (0.05 and

0.5µg/kg/day) in males, Pomc was decreased by higher doses of BPA (0.5 in males and

0.5 and 50µg/kg/day in females), and Icam5 was decreased by much higher doses of

BPA (50mg/kg/day in females) (Table 1). The differences in the concentrations of BPA needed to effect each of these genes may again give insight into how sensitive these axes are. For example, the PIT1 and TPIT lineages may be more sensitive to BPA during the neonatal period because less BPA was needed to have an effect than was needed to reduce Icam5. Nevertheless, these data show that under the right conditions,

BPA can alter expression of each of the lineages. Because we did not see any corresponding changes in protein, it is difficult to state the potential adverse effects that may occur due to our dosing paradigm. The reasons we didn’t see any changes in protein expression could be the time we took them after dosing or the age that they were taken. We also did not analyze serum levels of pituitary hormones, so if BPA alters secretion, then we would have missed it. Future studies examining hormone levels of pituitary peptides may be useful to determine if hormone release is altered by neonatal

BPA exposure. Despite our inability to draw a definitive conclusion on the adverse effects of neonatal BPA exposure due to our data alone, in other studies using different doses, timing of exposure, duration of exposure, or age of analysis, all of the endocrine axes have been altered under some conditions. Neonatal BPA treatment in rats, reduced the ability of the pituitary to release LH in response to GnRH in the adult

(Fernandez et al. 2009), increased pituitary GH content at 5 months (Ramirez et al.

115

2012), and increased PRL serum at PND30 (Khurana et al. 2000). Additionally, perinatal exposure increased ACTH and glucocorticoids in males (F. Chen et al. 2014).

Therefore, it is likely that neonatal exposure to BPA has many adverse effects on the endocrine system and perhaps further examination of different ages and different parameters would show some of these effects.

Final conclusions

Our studies to determine the effects of neonatal exposure to E2 and BPA have discovered many things to increase our understanding of neonatal pituitary development as well as point out many items that still need to be discovered. Only recently have people begun to study the neonatal period of pituitary development and very little is known about the effects of hormonal or chemical stimuli on this period. Our studies show that the neonatal period is sensitive to hormonal and chemical exposure, however, this sensitivity is different than the embryonic and adult periods. We observed changes in gene expression with exposure to E2 and BPA and suggest that some axes in the neonatal pituitary are more sensitive than others. There are also sex differences and sex specific effects in this period, showing males and females are not that similar, even before puberty. In addition to the uniqueness of the neonatal pituitary, we also observed that estrogenic regulation of each gene in the pituitary is unique, demonstrating the diversity of ways estrogens can alter the pituitary.

116

Figures and Tables

Figure 18: Summary of effects of BPA on critical windows of pituitary development. Low doses (0.5 and 50µg/kg/day) of BPA exposure during the embryonic period alter the progenitor cells and gonadotrope lineage while neonatal BPA exposure alters the PIT1 and TPIT lineages. Embryonic effects (blue), neonatal effects (red), MSH=melanotropin stimulating hormone, ACTH= Adrenocorticotropic hormone, GH= growth hormone, TSH= thyroid stimulating hormone, PRL= prolactin, LH= luteinizing hormone, FSH= follicle stimulating hormone.

117

Embryonic and neonatal effects on pituitary development Period Lineage Sex Cell number Transcription Embryonic Progenitors Male NC NC Female Increased Increased mKi67 Ki67 NR5A1 Male NC NC Female Increased Increased Lhb (BPA0.5), Decreased Lhb (BPA50) TPIT Male NA NC (Pomc) Female NA NC (Pomc) PIT1 Male NA NC (Gh, Tshb) Female NA NC (Gh, Tshb) Neonatal Progenitors Male NA NC Female NA NC NR5A1 Male NA NC (Nr5a1, Lhb) Female NA NC (Nr5a1, Lhb) Decreased Icam5 (BPA 50mg) TPIT Male NA Decreased Pomc (BPA0.5) Female NC (POMC) Decreased Pomc (BPA0.5, BPA50) PIT1 Male NC Decreased Pit1 (BPA0.05, BPA0.5) Female NA NC (Pit1, Gh, Tshb, Prl)

Table 7: Summary of BPA effects during the embryonic and neonatal period. BPA exposure altered embryonic and neonatal as well as male and female pituitaries differently. The effects are summarized showing differences in cell numbers changed in the embryonic and neonatal period as well as transcriptional changes. NA=not analyzed NC=not changed.

118

Figure 19: Proposed model of Icam5 regulation. We hypothesize that nuclear ER signaling increases transcription of a transcriptional repressor (TR) which then is phosphorylated (P) via the activation of membrane signaling from an estrogen receptor (ER). The activated phosphorylated receptor then can bind to the Icam5 promoter and inhibit transcription.

119

Abbreviations:

ACTH- adreno-corticotropic hormone

ADH- anti-diuretic hormone

AHR- aryl hydrocarbon receptor

AL- Anterior lobe

AP-1- activator protein 1

AVPV- anteroventral periventricular nucleus

BMP- brain morphogenetic protein

BPA- bisphenol A

BSA-bovine serum albumin

Cckar- cholecystokinin A receptor

Cdk4- cyclin-dependent kinase 4

ChIP- chromatin immunoprecipitation

CREB-cAMP response element binding protein

CRH- corticotropin releasing hormone

DES- diethylstilbestrol

DPN-diarylpropionitrile- ESR2 agonist e- embryonic day

E2- estradiol

ED- estrogen dendrimer

EDC- endocrine disrupting chemical

EGR1- early growth response 1

ER- estrogen receptor

120

ERE- estrogen response element

ERM- ezrin/radixin/moesin

ESR1-estrogen receptor alpha

ESR2-estrogen receptor beta

FGF- fibroblast growth factor

Foxl2-forkhead box L2

FSH- follicle stimulating hormone

GDNF- glial cell line-derived neurotrophic factor

GFRa2- glial cell line-derived neurotrophic factor receptor alpha

GH- growth hormone

GHRH- growth hormone releasing hormone

GHRHR- growth hormone releasing hormone receptor

GnRH- gonadotropin releasing hormone

GPER- G protein coupled estrogen receptor

GPR54- Kiss1r- G-protein coupled receptor 54, kisspeptin receptor

GR- glucocorticoid receptor

Hes1- hairy and enhancer of split 1

HPA- hypothalamic-pituitary-adrenal

HPG-Hypothalamic-pituitary-gonadal hpg- Hypogonadal mice

HPT- hypothalamic- pituitary- thyroid

ICAM5-intercellular adhesion molecule 5

IL- intermediate lobe

121

KO- knockout

LH- luteinizing hormone

LOAEL- lowest observed adverse effect level

MSH- melanotropin stimulating hormone

NF-κβ- nuclear factor kappa-light-chain-enhancer of activated B cells

OCT4- octamer-binding transcription factor 4

OT- oxytocin

PIT1 (POU1F1)- POU domain, class 1, transcription factor 1

Pitx2- paired-like homeodomain 2

PL-posterior lobe

PND- postnatal day

POMC- pro-opiomelanocortin

PPT- propyl-pyrazole-triol-ESR1 agonist

PRL- prolactin

RBPJ- recombining binding protein suppressor of hairless

RIA-Radioimmunoassay

SAGE- serial analysis gene expression

SF1- steroidogenic factor 1

SHH- sonic hedgehog

SOX2- SRY (sex determining region Y)-box 2

TGFβ- transforming growth factor

TH- tyrosine hydroxylase

TPIT (TBX19)- T-box transcription factor

122

TRH- thyrotropin releasing hormone

TSH- thyroid stimulating hormone

UGT- uridine diphosphate glucuronosyltransferase

123

References

Abdel-Maksoud, F.M. et al., 2015. Prenatal Exposures of Male Rats to the

Environmental Chemicals Bisphenol A and Di(2-Ethylhexyl) Phthalate Impact the

Sexual Differentiation Process. Endocrinology, 156(12), pp.4672–4683.

Acconcia, F., Pallottini, V. & Marino, M., 2015. Molecular Mechanisms of Action of BPA.

Dose-response : a publication of International Hormesis Society, 13(4),

p.1559325815610582.

Adewale, H.B. et al., 2009. Neonatal bisphenol-a exposure alters rat reproductive

development and ovarian morphology without impairing activation of gonadotropin-

releasing hormone neurons. Biology of reproduction, 81(4), pp.690–699.

Alatzoglou, K.S., Kelberman, D. & Dattani, M.T., 2009. The role of SOX proteins in

normal pituitary development. The Journal of endocrinology, 200(3), pp.245–258.

Alim, Z. et al., 2012. Gonadotrope plasticity at cellular and population levels.

Endocrinology, 153(10), pp.4729–4739.

Alyea, R.A. et al., 2008. The roles of membrane estrogen receptor subtypes in

modulating dopamine transporters in PC-12 cells. Journal of neurochemistry,

106(4), pp.1525–33.

Anderson, E., Clarke, R.B. & Howell, A., 1998. Estrogen responsiveness and control of

normal human breast proliferation. Journal of mammary gland biology and

neoplasia, 3(1), pp.23–35.

Anderson, G.W., Schoonover, C.M. & Jones, S.A., 2003. Control of thyroid hormone

124

action in the developing rat brain. Thyroid : official journal of the American Thyroid

Association, 13(11), pp.1039–1056.

Avtanski, D. et al., 2014. Both estrogen receptor alpha and beta stimulate pituitary GH

gene expression. Molecular endocrinology, 28(1), pp.40–52.

Bakke, J.L., Lawrence, N. & Wilber, J.F., 1974. The late effects of neonatal

hyperthyroidism upon the hypothalamic-pituitary-thyroid axis in the rat.

Endocrinology, 95(2), pp.406–411.

Bancalari, R.E. et al., 2012. Pituitary gland development: an update. Endocrine

development, 23, pp.1–15.

Baram, T.Z. & Lerner, S.P., 1991. Ontogeny of corticotropin releasing hormone gene

expression in rat hypothalamus--comparison with somatostatin. International

journal of developmental neuroscience : the official journal of the International

Society for Developmental Neuroscience, 9(5), pp.473–478.

Bayne, S. et al., 2008. Estrogen deficiency leads to telomerase inhibition, telomere

shortening and reduced cell proliferation in the adrenal gland of mice. Cell

research, 18(11), pp.1141–1150.

Benson, D.L., Yoshihara, Y. & Mori, K., 1998. Polarized distribution and cell type-

specific localization of telencephalin, an intercellular adhesion molecule. Journal of

neuroscience research, 52(1), pp.43–53.

Bonnefont, X. et al., 2005. Revealing the large-scale network organization of growth

hormone-secreting cells. Proceedings of the National Academy of Sciences of the

125

United States of America, 102(46), pp.16880–16885.

Boudouresque, F. et al., 1988. Maturation of the pituitary-adrenal function in rat fetuses.

Neuroendocrinology, 48(4), pp.417–422.

Brannick, K.E. et al., 2012. Prenatal exposure to low doses of bisphenol A increases

pituitary proliferation and gonadotroph number in female mice offspring at birth.

Biology of reproduction, 87(4), p.82.

Brown, P. & McNeilly, A.S., 1999. Transcriptional regulation of pituitary gonadotrophin

subunit genes. Reviews of reproduction, 4(2), pp.117–124.

Budry, L. et al., 2011. Related pituitary cell lineages develop into interdigitated 3D cell

networks. Proceedings of the National Academy of Sciences of the United States of

America, 108(30), pp.12515–12520.

Caglar, A.S. et al., 2015. Localization of the aromatase enzyme expression in the

human pituitary gland and its effect on growth hormone, prolactin, and thyroid

stimulating hormone axis. Endocrine, 49(3), pp.761–768.

Calvo, M. et al., 1988. Fatty acids bound to α-fetoprotein and albumin during rat

development. Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism,

959(3), pp.238–246.

Cao, J. et al., 2012. Neonatal Bisphenol A exposure alters sexually dimorphic gene

expression in the postnatal rat hypothalamus. Neurotoxicology, 33(1), pp.23–36.

Carbajo-Perez, E. & Watanabe, Y.G., 1990. Cellular proliferation in the anterior pituitary

of the rat during the postnatal period. Cell and tissue research, 261(2), pp.333–338.

126

Carretero, J. et al., 1999. Immunohistochemical evidence of the presence of aromatase

P450 in the rat hypophysis. Cell and tissue research, 295(3), pp.419–23.

Cha, K.B. et al., 2004. WNT5A signaling affects pituitary gland shape. Mechanisms of

development, 121(2), pp.183–194.

Chen, F. et al., 2015. Hypothalamic-pituitary-adrenal axis hyperactivity accounts for

anxiety- and depression-like behaviors in rats perinatally exposed to bisphenol A.

Journal of biomedical research, 29(3), pp.250–258.

Chen, F. et al., 2014. Sex differences in the adult HPA axis and affective behaviors are

altered by perinatal exposure to a low dose of bisphenol A. Brain research, 1571,

pp.12–24.

Chen, H.T., 1988. Sexual dimorphism of pituitary gonadotropes during postnatal

development in the rat. Molecular and cellular endocrinology, 57(1–2), pp.33–39.

Chen, Y. et al., 2014. Estrogen and pure antiestrogen fulvestrant (ICI 182 780) augment

cell–matrigel adhesion of MCF-7 breast cancer cells through a novel G protein

coupled estrogen receptor (GPR30)-to-calpain signaling axis. Toxicology and

Applied Pharmacology, 275(2), pp.176–181.

Christian, H.C. & Morris, J.F., 2002. Rapid actions of 17beta-oestradiol on a subset of

lactotrophs in the rat pituitary. The Journal of physiology, 539(Pt 2), pp.557–566.

Chun, T.Y. & Gorski, J., 2000. High concentrations of bisphenol A induce cell growth

and prolactin secretion in an estrogen-responsive pituitary tumor cell line.

Toxicology and applied pharmacology, 162(3), pp.161–165.

127

Clarkson, J. et al., 2014. Sexual differentiation of the brain requires perinatal kisspeptin-

GnRH neuron signaling. The Journal of neuroscience : the official journal of the

Society for Neuroscience, 34(46), pp.15297–15305.

Clarkson, J. & Herbison, A.E., 2016. Hypothalamic control of the male neonatal

testosterone surge. Philosophical transactions of the Royal Society of

London.Series B, Biological sciences, 371(1688), p.20150115.

Couse, J.F. et al., 2003. Characterization of the hypothalamic-pituitary-gonadal axis in

estrogen receptor (ER) Null mice reveals hypergonadism and endocrine sex

reversal in females lacking ERalpha but not ERbeta. Molecular endocrinology,

17(6), pp.1039–1053.

Cunha, G.R. & Lung, B., 1979. The importance of stroma in morphogenesis and

functional activity of urogenital epithelium. In vitro, 15(1), pp.50–71.

Dauvois, S., White, R. & Parker, M.G., 1993. The antiestrogen ICI 182780 disrupts

estrogen receptor nucleocytoplasmic shuttling. Journal of cell science, pp.1377–88.

Davis, S.W. et al., 2013. Pituitary gland development and disease: from stem cell to

hormone production. Current topics in developmental biology, 106, pp.1–47.

Davis, S.W., Mortensen, A.H. & Camper, S.A., 2011. Birthdating studies reshape

models for pituitary gland cell specification. Developmental biology, 352(2),

pp.215–227.

Denef, C., 2003. Paracrine control of lactotrope proliferation and differentiation. Trends

in endocrinology and metabolism: TEM, 14(4), pp.188–195.

128

Dihl, F. et al., 1988. Ontogeny of gonadotropic and thyrotropic cells in fetal mouse

anterior pituitary. Comparison between two species C57 BL6 and Balb/C. Anatomy

and Embryology, 178(1), pp.21–27.

Dodds, E.C. & Lawson, W., 1936. Synthetic strogenic Agents without the Phenanthrene

Nucleus. Nature, 137, p.996.

Doerge, D.R. et al., 2010. Lactational transfer of bisphenol A in Sprague-Dawley rats.

Toxicology letters, 199(3), pp.372–376.

Doerge, D.R. et al., 2011. Pharmacokinetics of bisphenol A in neonatal and adult CD-1

mice: inter-species comparisons with Sprague-Dawley rats and rhesus monkeys.

Toxicology letters, 207(3), pp.298–305.

Dohler, K.D. & Wuttke, W., 1975. Changes with age in levels of serum gonadotropins,

prolactin and gonadal steroids in prepubertal male and female rats. Endocrinology,

97(4), pp.898–907.

DonCarlos, L.L. et al., 1995. Estrogen receptor mRNA levels in the preoptic area of

neonatal rats are responsive to hormone manipulation. Brain

research.Developmental brain research, 84(2), pp.253–260.

Dussault, J.H. & Labrie, F., 1975. Development of the hypothalamic-pituitary-thyroid

axis in the neonatal rat. Endocrinology, 97(5), pp.1321–1324.

Eckstrum, K.S. et al., 2016. Icam5 Expression Exhibits Sex Differences in the Neonatal

Pituitary and Is Regulated by Estradiol and Bisphenol A. Endocrinology, 157(4),

pp.1408–1420.

129

Fernandez, M. et al., 2009. Neonatal exposure to bisphenol a alters reproductive

parameters and gonadotropin releasing hormone signaling in female rats.

Environmental health perspectives, 117(5), pp.757–762.

Filardo, E.J. et al., 2000. Estrogen-induced activation of Erk-1 and Erk-2 requires the G

protein-coupled receptor homolog, GPR30, and occurs via trans-activation of the

epidermal growth factor receptor through release of HB-EGF. Molecular

endocrinology, 14(10), pp.1649–1660.

Filardo, E.J. & Thomas, P., 2012. Minireview: G protein-coupled estrogen receptor-1,

GPER-1: its mechanism of action and role in female reproductive cancer, renal and

vascular physiology. Endocrinology, 153(7), pp.2953–62.

Fujimoto, T., Kubo, K. & Aou, S., 2006. Prenatal exposure to bisphenol A impairs sexual

differentiation of exploratory behavior and increases depression-like behavior in

rats. Brain research, 1068(1), pp.49–55.

Furutani, Y. et al., 2012. Vitronectin induces phosphorylation of ezrin/radixin/moesin

actin-binding proteins through binding to its novel neuronal receptor telencephalin.

The Journal of biological chemistry, 287(46), pp.39041–39049.

Galmiche, G. et al., 2006. The Expression of Aromatase in Gonadotropes Is Regulated

by Estradiol and Gonadotropin-Releasing Hormone in a Manner that Differs from

the Regulation of Luteinizing Hormone. Endocrinology, 147(9), pp.4234–4244.

Gamez, J.M. et al., 2015. Exposure to a low dose of bisphenol A impairs pituitary-

ovarian axis in prepubertal rats: effects on early folliculogenesis. Environmental

toxicology and pharmacology, 39(1), pp.9–15.

130

Garcia-Lavandeira, M. et al., 2009. A GRFa2/Prop1/stem (GPS) cell niche in the

pituitary. PloS one, 4(3), p.e4815.

Gaston-Massuet, C. et al., 2011. Increased Wingless (Wnt) signaling in pituitary

progenitor/stem cells gives rise to pituitary tumors in mice and humans.

Proceedings of the National Academy of Sciences of the United States of America,

108(28), pp.11482–11487.

Gieske, M.C. et al., 2008. Pituitary gonadotroph estrogen receptor-alpha is necessary

for fertility in females. Endocrinology, 149(1), pp.20–27.

Gieske, M.C. et al., 2008. Pituitary Gonadotroph Estrogen Receptor-α Is Necessary for

Fertility in Females. Endocrinology, 149(1), pp.20–27.

Glanowska, K.M., Burger, L.L. & Moenter, S.M., 2014. Development of gonadotropin-

releasing hormone secretion and pituitary response. The Journal of neuroscience :

the official journal of the Society for Neuroscience, 34(45), pp.15060–15069.

Golan, M. et al., 2016. Anatomical and functional gonadotrope networks in the teleost

pituitary. Scientific reports, 6, p.23777.

Goldberg, L.B., Aujla, P.K. & Raetzman, L.T., 2011. Persistent expression of activated

Notch inhibits corticotrope and melanotrope differentiation and results in

dysfunction of the HPA axis. Developmental biology, 358(1), pp.23–32.

González, M. et al., 2008. Oestrogen receptor α and β in female rat pituitary cells: An

immunochemical study. General and Comparative Endocrinology, 155(3), pp.857–

868.

131

Gremeaux, L. et al., 2012. Activated phenotype of the pituitary stem/progenitor cell

compartment during the early-postnatal maturation phase of the gland. Stem cells

and development, 21(5), pp.801–813.

Hall, J.M., Couse, J.F. & Korach, K.S., 2001. The multifaceted mechanisms of estradiol

and estrogen receptor signaling. The Journal of biological chemistry, 276(40),

pp.36869–36872.

Hanson, M.A. & Gluckman, P.D., 2008. Developmental origins of health and disease:

new insights. Basic & clinical pharmacology & toxicology, 102(2), pp.90–93.

Harrington, W.R. et al., 2006. Estrogen Dendrimer Conjugates that Preferentially

Activate Extranuclear, Nongenomic Versus Genomic Pathways of Estrogen Action.

Molecular Endocrinology, 20(3), pp.491–502.

Hazell, G.G. et al., 2009. Localisation of GPR30, a novel G protein-coupled oestrogen

receptor, suggests multiple functions in rodent brain and peripheral tissues. The

Journal of endocrinology, 202(2), pp.223–236.

Herbst, A.L., 1981. The current status of the DES-exposed population. Obstetrics and

gynecology annual, 10, pp.267–278.

Hiroshige, T., Sato, T. & Abe, K., 1971. Dynamic changes in the hypothalamic content

of corticotropin-releasing factor following noxious stimuli: delayed response in early

neonates in comparison with biphasic response in adult rats. Endocrinology, 89(5),

pp.1287–1294.

Homma, T. et al., 2009. Significance of neonatal testicular sex steroids to defeminize

132

anteroventral periventricular kisspeptin neurons and the GnRH/LH surge system in

male rats. Biology of reproduction, 81(6), pp.1216–1225.

Howdeshell, K.L. et al., 1999. Exposure to bisphenol A advances puberty. Nature,

401(6755), pp.763–764.

Howell, A. et al., 2000. ICI 182,780 (Faslodex): development of a novel, “pure”

antiestrogen. Cancer, 89(4), pp.817–825.

Imamura, K. et al., 1990. Variations by layers and developmental changes in expression

of telencephalin in the visual cortex of cat. Neuroscience letters, 119(1), pp.118–

121.

Ingraham, H.A. et al., 1994. The nuclear receptor steroidogenic factor 1 acts at multiple

levels of the reproductive axis. Genes & development, 8(19), pp.2302–2312.

Iqbal, J., Latchoumanin, O. & Clarke, I.J., 2007. Rapid in Vivo Effects of Estradiol-17β in

Ovine Pituitary Gonadotropes Are Displayed by Phosphorylation of Extracellularly

Regulated Kinase, Serine/Threonine Kinase, and 3′,5′-Cyclic Adenosine 5′-

Monophosphate-Responsive Element-Binding Protein. Endocrinology, 148(12),

pp.5794–5802.

Ishikawa, M. et al., 2014. Effects of diethylstilbestrol on luteinizing hormone-producing

cells in the mouse anterior pituitary. Experimental biology and medicine (Maywood,

N.J.), 239(3), pp.311–319.

JACOBSON, A.G., MIYAMOTO, D.M. & MA1, S.H., 1979. Rathke’s Pouch

Morphogenesis in the Chick Embryo. J. EXP. ZOOL., 207, pp.351–366.

133

Japon, M.A., Rubinstein, M. & Low, M.J., 1994. In situ hybridization analysis of anterior

pituitary hormone gene expression during fetal mouse development. The journal of

histochemistry and cytochemistry : official journal of the Histochemistry Society,

42(8), pp.1117–1125.

Kato, S. et al., 1995. Activation of the estrogen receptor through phosphorylation by

mitogen-activated protein kinase. Science, 270(5241), pp.1491–4.

Kelly, D.A. et al., 2013. Differential control of sex differences in estrogen receptor alpha

in the bed nucleus of the stria terminalis and anteroventral periventricular nucleus.

Endocrinology, 154(10), pp.3836–3846.

Kelly, E.A. et al., 2014. Subcellular localization of intercellular adhesion molecule-5

(telencephalin) in the visual cortex is not developmentally regulated in the absence

of matrix metalloproteinase-9. The Journal of comparative neurology, 522(3),

pp.676–688.

Kendziorski, J.A. et al., 2012. Strain specific induction of pyometra and differences in

immune responsiveness in mice exposed to 17α-ethinyl estradiol or the endocrine

disrupting chemical bisphenol A. Reproductive Toxicology, 34(1), pp.22–30.

Khorram, O., Depalatis, L.R. & McCann, S.M., 1984. Hypothalamic control of prolactin

secretion during the perinatal period in the rat. Endocrinology, 115(5), pp.1698–

1704.

Khorram, O., DePalatis, L.R. & McCann, S.M., 1983. Development of hypothalamic

control of growth hormone secretion in the rat. Endocrinology, 113(2), pp.720–728.

134

Khurana, S., Ranmal, S. & Ben-Jonathan, N., 2000. Exposure of newborn male and

female rats to environmental estrogens: delayed and sustained hyperprolactinemia

and alterations in estrogen receptor expression. Endocrinology, 141(12), pp.4512–

4517.

Kiino, D.R. & Dannies, P.S., 1981. Insulin and 17 beta-estradiol increase the

intracellular prolactin content of GH4C1 cells. Endocrinology, 109(4), pp.1264–

1269.

Kim, H.J. et al., 2007. Estrogen receptor alpha-induced cholecystokinin type A receptor

expression in the female mouse pituitary. The Journal of endocrinology, 195(3),

pp.393–405.

Kim, J.C. et al., 2001. Evaluation of developmental toxicity in rats exposed to the

environmental estrogen bisphenol A during pregnancy. Life Sciences, 69(22),

pp.2611–2625.

Kioussi, C. et al., 2002. Identification of a Wnt/Dvl/beta-Catenin --> Pitx2 pathway

mediating cell-type-specific proliferation during development. Cell, 111(5), pp.673–

685.

Kita, A. et al., 2007. Hes1 and Hes5 control the progenitor pool, intermediate lobe

specification, and posterior lobe formation in the pituitary development. Molecular

endocrinology, 21(6), pp.1458–1466.

Konkle, A.T. & McCarthy, M.M., 2011. Developmental time course of estradiol,

testosterone, and dihydrotestosterone levels in discrete regions of male and female

rat brain. Endocrinology, 152(1), pp.223–235.

135

Kruger, T., Long, M. & Bonefeld-Jorgensen, E.C., 2008. Plastic components affect the

activation of the aryl hydrocarbon and the androgen receptor. Toxicology, 246(2–3),

pp.112–123.

Kuiper, G.G. et al., 1998. Interaction of estrogenic chemicals and phytoestrogens with

estrogen receptor beta. Endocrinology, 139(10), pp.4252–4263.

Kumar, D. et al., 2015. In Utero Development of Kisspeptin/GnRH Neural Circuitry in

Male Mice. Endocrinology, 156(9), pp.3084–3090.

Kumar, D. et al., 2014. Murine arcuate nucleus kisspeptin neurons communicate with

GnRH neurons in utero. The Journal of neuroscience : the official journal of the

Society for Neuroscience, 34(10), pp.3756–3766.

Kundakovic, M. et al., 2013. Sex-specific epigenetic disruption and behavioral changes

following low-dose in utero bisphenol A exposure. Proceedings of the National

Academy of Sciences of the United States of America, 110(24), pp.9956–9961.

Kurian, J.R., Olesen, K.M. & Auger, A.P., 2010. Sex differences in epigenetic regulation

of the estrogen receptor-alpha promoter within the developing preoptic area.

Endocrinology, 151(5), pp.2297–2305.

Kushner, P.J. et al., 2000. Estrogen receptor pathways to AP-1. The Journal of steroid

biochemistry and molecular biology, 74(5), pp.311–317.

Lakind, J.S. & Naiman, D.Q., 2008. Bisphenol A (BPA) daily intakes in the United

States: estimates from the 2003-2004 NHANES urinary BPA data. Journal of

exposure science & environmental epidemiology, 18(6), pp.608–615.

136

Lamolet, B. et al., 2004. Tpit-independent function of NeuroD1(BETA2) in pituitary

corticotroph differentiation. Molecular endocrinology, 18(4), pp.995–1003.

Leret, M.L., Molina-Holgado, F. & Gonzalez, M.I., 1994. The effect of perinatal exposure

to estrogens on the sexually dimorphic response to novelty. Physiology & Behavior,

55(2), pp.371–373.

Levin, E.R., 2005. Integration of the extranuclear and nuclear actions of estrogen.

Molecular endocrinology, 19(8), pp.1951–9.

Levin, E.R., 2009. Plasma membrane estrogen receptors. Trends in endocrinology and

metabolism: TEM, 20(10), pp.477–82.

Li, S. et al., 1990. Dwarf locus mutants lacking three pituitary cell types result from

mutations in the POU-domain gene pit-1. Nature, 347(6293), pp.528–533.

Liang, J. & Slingerland, J.M., 2003. Multiple roles of the PI3K/PKB (Akt) pathway in cell

cycle progression. Cell cycle, 2(4), pp.339–45.

Lin, S.C. et al., 1993. Molecular basis of the little mouse phenotype and implications for

cell type-specific growth. Nature, 364(6434), pp.208–213.

Lindzey, J. et al., 1998. Effects of Castration and Chronic Steroid Treatments on

Hypothalamic Gonadotropin-Releasing Hormone Content and Pituitary

Gonadotropins in Male Wild-Type and Estrogen Receptor-α Knockout Mice.

Endocrinology, 139(10), pp.4092–4101.

Lindzey, J. et al., 2006. The bi-modal effects of estradiol on gonadotropin synthesis and

secretion in female mice are dependent on estrogen receptor-alpha. The Journal of

137

endocrinology, 191(1), pp.309–17.

Liu, M.-M. et al., 2002. Opposing action of estrogen receptors alpha and beta on cyclin

D1 gene expression. The Journal of biological chemistry, 277(27), pp.24353–60.

Liu Sheng Cui, J., 2005. Ontogeny of estrogen receptor (ER) alpha and its co-

localization with pituitary hormones in the pituitary gland of chick embryos. Cell

Tissue Res, 320, pp.235–242.

Long, N. et al., 2017. Tamoxifen and ICI 182,780 activate hypothalamic G protein-

coupled estrogen receptor 1 to rapidly facilitate lordosis in female rats. Hormones

and Behavior, 89, pp.98–103.

Losa-Ward, S.M. et al., 2012. Disrupted organization of RFamide pathways in the

hypothalamus is associated with advanced puberty in female rats neonatally

exposed to bisphenol A. Biology of reproduction, 87(2), p.28.

Madak-Erdogan, Z. et al., 2008. Nuclear and extranuclear pathway inputs in the

regulation of global gene expression by estrogen receptors. Molecular

endocrinology, 22(9), pp.2116–27.

Maffini, M. V et al., 2006. Endocrine disruptors and reproductive health: the case of

bisphenol-A. Molecular and cellular endocrinology, 254–255, pp.179–186.

Markakis, E.A., 2002. Development of the neuroendocrine hypothalamus. Frontiers in

neuroendocrinology, 23(3), pp.257–291.

Markey, C.M. et al., 2005. Long-term effects of fetal exposure to low doses of the

xenoestrogen bisphenol-A in the female mouse genital tract. Biology of

138

reproduction, 72(6), pp.1344–1351.

Markey, C.M. et al., 2001. The mouse uterotrophic assay: a reevaluation of its validity in

assessing the estrogenicity of bisphenol A. Environmental health perspectives,

109(1), pp.55–60.

Matsubara, M., Harigaya, T. & Nogami, H., 2001. Effects of diethylstilbestrol on the

cytogenesis of prolactin cells in the pars distalis of the pituitary gland of the mouse.

Cell and tissue research, 306(2), pp.301–307.

Matsuno, H. et al., 2006. Telencephalin slows spine maturation. The Journal of

neuroscience : the official journal of the Society for Neuroscience, 26(6), pp.1776–

1786.

Matthews, J.B., Twomey, K. & Zacharewski, T.R., 2001. In vitro and in vivo interactions

of bisphenol A and its metabolite, bisphenol A glucuronide, with estrogen receptors

alpha and beta. Chemical research in toxicology, 14(2), pp.149–157.

McCarthy, M.M., 2008. Estradiol and the developing brain. Physiological Reviews,

88(1), pp.91–124.

McCormick, C.M. et al., 1998. Neonatal sex hormones have “organizational” effects on

the hypothalamic-pituitary-adrenal axis of male rats. Brain research.Developmental

brain research, 105(2), pp.295–307.

McDermott, M.T. et al., 1999. Reverse transcription polymerase chain reaction analysis

of pituitary hormone, Pit-1 and steroidogenic factor-1 messenger RNA expression

in pituitary tumors. Pituitary, 2(3), pp.217–24.

139

Merchenthaler, I. et al., 2004. Distribution of estrogen receptor alpha and beta in the

mouse central nervous system: in vivo autoradiographic and immunocytochemical

analyses. The Journal of comparative neurology, 473(2), pp.270–291.

Meyers, M.J. et al., 2001. Estrogen Receptor-Potency-Selective Ligands: Structure-

Activity Relationship Studies of Diarylpropionitriles and Their Acetylene and Polar

Analogues. J Med Chem, 44 (24), pp.4230–51.

Micevych, P.E. & Mermelstein, P.G., 2008. Membrane estrogen receptors acting

through metabotropic glutamate receptors: an emerging mechanism of estrogen

action in brain. Molecular neurobiology, 38(1), pp.66–77.

Milkovic, S., Milkovic, K. & Paunovic, J., 1973. The initiation of fetal adrenocorticotrophic

activity in the rat. Endocrinology, 92(2), pp.380–384.

Mitchner, N.A., Garlick, C. & Ben-Jonathan, N., 1998. Cellular distribution and gene

regulation of estrogen receptors alpha and beta in the rat pituitary gland.

Endocrinology, 139(9), pp.3976–3983.

Mitra, S.W. et al., 2003. Immunolocalization of estrogen receptor beta in the mouse

brain: comparison with estrogen receptor alpha. Endocrinology, 144(5), pp.2055–

2067.

Mitsui, S. et al., 2005. A novel phenylalanine-based targeting signal directs

telencephalin to neuronal dendrites. The Journal of neuroscience : the official

journal of the Society for Neuroscience, 25(5), pp.1122–1131.

De Moerlooze, L. et al., 2000. An important role for the IIIb isoform of fibroblast growth

140

factor receptor 2 (FGFR2) in mesenchymal-epithelial signalling during mouse

organogenesis. Development, 127(3), pp.483–492.

Monje, L. et al., 2010. Exposure of neonatal female rats to bisphenol A disrupts

hypothalamic LHRH pre-mRNA processing and estrogen receptor alpha expression

in nuclei controlling estrous cyclicity. Reproductive toxicology, 30(4), pp.625–634.

Montano, M.M., Welshons, W. V & vom Saal, F.S., 1995. Free estradiol in serum and

brain uptake of estradiol during fetal and neonatal sexual differentiation in female

rats. Biology of reproduction, 53(5), pp.1198–1207.

Moors, S., Diel, P. & Degen, G.H., 2006. Toxicokinetics of bisphenol A in pregnant

DA/Han rats after single i.v. application. Archives of Toxicology, 80(10), pp.647–

655.

Mori, K. et al., 1987. Telencephalon-specific antigen identified by monoclonal antibody.

Proceedings of the National Academy of Sciences of the United States of America,

84(11), pp.3921–3925.

Moriyama, K. et al., 2002. Thyroid hormone action is disrupted by bisphenol A as an

antagonist. The Journal of clinical endocrinology and metabolism, 87(11), pp.5185–

5190.

Nantie, L.B. et al., 2014. Notch signaling in postnatal pituitary expansion: proliferation,

progenitors, and cell specification. Molecular endocrinology, 28(5), pp.731–744.

Navratil, A.M. et al., 2007. Neuroendocrine plasticity in the anterior pituitary:

gonadotropin-releasing hormone-mediated movement in vitro and in vivo.

141

Endocrinology, 148(4), pp.1736–1744.

Nemeskeri, A. et al., 1985. Developmental changes of thyroliberin (TRH) in the rat

brain. Neuroscience letters, 53(3), pp.279–284.

Ning, L. et al., 2013. Interactions between ICAM-5 and beta1 integrins regulate neuronal

synapse formation. Journal of cell science, 126(Pt 1), pp.77–89.

Nishida, Y., Yoshioka, M. & St-Amand, J., 2005. Sexually dimorphic gene expression in

the hypothalamus, pituitary gland, and cortex. Genomics, 85(6), pp.679–687.

Nishihara, E. et al., 2000. Ontogenetic changes in the expression of estrogen receptor

alpha and beta in rat pituitary gland detected by immunohistochemistry.

Endocrinology, 141(2), pp.615–620.

Nugent, B.M. et al., 2015. Brain feminization requires active repression of

masculinization via DNA methylation. Nature neuroscience, 18(5), pp.690–697.

Nyman-Huttunen, H. et al., 2006. alpha-Actinin-dependent cytoskeletal anchorage is

important for ICAM-5-mediated neuritic outgrowth. Journal of cell science, 119(Pt

15), pp.3057–3066.

Ogasawara, K. et al., 2009. Hormonal regulation of prolactin cell development in the

fetal pituitary gland of the mouse. Endocrinology, 150(2), pp.1061–1068.

Ohuchi, H. et al., 2000. FGF10 acts as a major ligand for FGF receptor 2 IIIb in mouse

multi-organ development. Biochemical and biophysical research communications,

277(3), pp.643–649.

Okada, H. et al., 2008. Direct evidence revealing structural elements essential for the

142

high binding ability of bisphenol A to human estrogen-related receptor-gamma.

Environmental health perspectives, 116(1), pp.32–38.

Oliver, C. et al., 1980. Brain TRH levels during development of the rat, in neonatal

hypothyroidism and after caloric deprivation. Biology of the neonate, 37(1–2), pp.1–

Olson, L.E. et al., 2006. Homeodomain-mediated beta-catenin-dependent switching

events dictate cell-lineage determination. Cell, 125(3), pp.593–605.

Paech, K. et al., 1997. Differential Ligand Activation of Estrogen Receptors ERα and

ERβ at AP1 Sites. Science, 277(5331).

Panagiotidou, E. et al., 2014. Perinatal exposure to low-dose bisphenol A affects the

neuroendocrine stress response in rats. The Journal of endocrinology, 220(3),

pp.207–218.

Pasqualini, C. et al., 1999. Stage- and Region-Specific Expression of Estrogen

Receptor α Isoforms during Ontogeny of the Pituitary Gland 1. Endocrinology,

140(6), pp.2781–2789.

Patchev, V.K. et al., 1995. Implications of estrogen-dependent brain organization for

gender differences in hypothalamo-pituitary-adrenal regulation. FASEB journal :

official publication of the Federation of American Societies for Experimental

Biology, 9(5), pp.419–423.

Patisaul, H.B., Fortino, A.E. & Polston, E.K., 2006. Neonatal genistein or bisphenol-A

exposure alters sexual differentiation of the AVPV. Neurotoxicology and teratology,

143

28(1), pp.111–118.

Pedram, A. et al., 2009. Developmental Phenotype of a Membrane Only Estrogen

Receptor (MOER) Mouse. Journal of Biological Chemistry, 284(6), pp.3488–3495.

Pedram, A. et al., 2014. Membrane-localized estrogen receptor α is required for normal

organ development and function. Developmental cell, 29(4), pp.482–90.

Peretz, J. et al., 2011. Bisphenol A impairs follicle growth, inhibits steroidogenesis, and

downregulates rate-limiting enzymes in the estradiol biosynthesis pathway.

Toxicological sciences : an official journal of the Society of Toxicology, 119(1),

pp.209–217.

Peretz, J., Craig, Z.R. & Flaws, J.A., 2012. Bisphenol A inhibits follicle growth and

induces atresia in cultured mouse antral follicles independently of the genomic

estrogenic pathway. Biology of reproduction, 87(3), p.63.

Peretz, J., Neese, S.L. & Flaws, J.A., 2013. Mouse Strain Does Not Influence the

Overall Effects of Bisphenol A-Induced Toxicity in Adult Antral Follicles. Biology of

Reproduction, 89(5), pp.108–108.

Pointis, G., Latreille, M.T. & Cedard, L., 1980. Gonado-pituitary relationships in the fetal

mouse at various times during sexual differentiation. The Journal of endocrinology,

86(3), pp.483–488.

Pointis, G. & Mahoudeau, J.A., 1976. Release of immuno-reactive and biologically

active LH from fetal mouse pituitary in response to synthetic gonadotropin releasing

factor (LRF). Experientia, 32(10), pp.1347–1348.

144

Poling, M.C. & Kauffman, A.S., 2012. Sexually dimorphic testosterone secretion in

prenatal and neonatal mice is independent of kisspeptin-Kiss1r and GnRH

signaling. Endocrinology, 153(2), pp.782–793.

Potok, M.A. et al., 2008. WNT signaling affects gene expression in the ventral

diencephalon and pituitary gland growth. Developmental dynamics : an official

publication of the American Association of Anatomists, 237(4), pp.1006–1020.

Prasanth, G.K., Divya, L.M. & Sadasivan, C., 2010. Bisphenol-A can bind to human

glucocorticoid receptor as an agonist: an in silico study. Journal of applied

toxicology : JAT, 30(8), pp.769–774.

Pulichino, A.M. et al., 2004. Tpit-/-NeuroD1-/- mice reveal novel aspects of corticotroph

development. Endocrine research, 30(4), pp.551–552.

Pulichino, A.M. et al., 2003. Tpit determines alternate fates during pituitary cell

differentiation. Genes & development, 17(6), pp.738–747.

Raetzman, L.T., Cai, J.X. & Camper, S.A., 2007. Hes1 is required for pituitary growth

and melanotrope specification. Developmental biology, 304(2), pp.455–466.

Ramirez, M.C. et al., 2012. Neonatal xenoestrogen exposure alters growth hormone-

dependent liver proteins and genes in adult female rats. Toxicology letters, 213(3),

pp.325–331.

Razandi, M. et al., 1999. Cell Membrane and Nuclear Estrogen Receptors (ERs)

Originate from a Single Transcript: Studies of ERα and ERβ Expressed in Chinese

Hamster Ovary Cells. Molecular Endocrinology, 13(2), pp.307–319.

145

Redei, E. et al., 1994. Fast glucocorticoid feedback inhibition of ACTH secretion in the

ovariectomized rat: effect of chronic estrogen and progesterone.

Neuroendocrinology, 60(2), pp.113–123.

Rieutort, M., 1981. Ontogenetic development of the inhibition of growth hormone

release by somatostatin in the rat: in-vivo and in-vitro (perifusion) study. The

Journal of endocrinology, 89(3), pp.355–363.

Rizzoti, K., Akiyama, H. & Lovell-Badge, R., 2013. Mobilized adult pituitary stem cells

contribute to endocrine regeneration in response to physiological demand. Cell

stem cell, 13(4), pp.419–432.

Rochester, J.R., 2013. Bisphenol A and human health: a review of the literature.

Reproductive toxicology, 42, pp.132–155.

Rubin, B.S. et al., 2006. Evidence of altered brain sexual differentiation in mice exposed

perinatally to low, environmentally relevant levels of bisphenol A. Endocrinology,

147(8), pp.3681–3691.

Rudolf, F.O. & Kadokawa, H., 2013. Expression of estradiol receptor, GPR30, in bovine

anterior pituitary and effects of GPR30 agonist on GnRH-induced LH secretion.

Animal Reproduction Science, 139(1), pp.9–17.

Sabatino, M.E. et al., 2015. Evidence of cellular senescence during the development of

estrogen-induced pituitary tumors. Endocrine-related cancer, 22(3), pp.299–317.

Sanchez-Cardenas, C. et al., 2010. Pituitary growth hormone network responses are

sexually dimorphic and regulated by gonadal steroids in adulthood. Proceedings of

146

the National Academy of Sciences of the United States of America, 107(50),

pp.21878–21883.

Sanchez-Criado, J.E. et al., 2012. Estrogen receptor (ESR) 2 partially offsets the

absence of ESR1 in gonadotropes of pituitary-specific Esr1 knockout female mice.

Reproduction, 143(4), pp.549–558.

Schaeffer, M. et al., 2011. Influence of estrogens on GH-cell network dynamics in

females: a live in situ imaging approach. Endocrinology, 152(12), pp.4789–4799.

Schmidt, M. V et al., 2003. The postnatal development of the hypothalamic-pituitary-

adrenal axis in the mouse. International journal of developmental neuroscience :

the official journal of the International Society for Developmental Neuroscience,

21(3), pp.125–132.

Schwanzel-Fukuda, M. & Pfaff, D.W., 1989. Origin of luteinizing hormone-releasing

hormone neurons. Nature, 338(6211), pp.161–164.

Schwarz, J.M., Nugent, B.M. & McCarthy, M.M., 2010. Developmental and hormone-

induced epigenetic changes to estrogen and progesterone receptor genes in brain

are dynamic across the life span. Endocrinology, 151(10), pp.4871–4881.

Scully, K.M. et al., 1997. Role of estrogen receptor-alpha in the anterior pituitary gland.

Molecular endocrinology, 11(6), pp.674–681.

Seuntjens, E. & Denef, C., 1999. Progenitor cells in the embryonic anterior pituitary

abruptly and concurrently depress mitotic rate before progressing to terminal

differentiation. Molecular and cellular endocrinology, 150(1–2), pp.57–63.

147

Shelby, M.D., 2008. NTP-CERHR monograph on the potential human reproductive and

developmental effects of bisphenol A. Ntp Cerhr Mon, (22)(22), p.v, vii–ix, 1-64

passim.

Shupnik, M.A. et al., 1989. An upstream region of the rat luteinizing hormone beta gene

binds estrogen receptor and confers estrogen responsiveness. The Journal of

biological chemistry, 264(1), pp.80–6.

Shupnik, M.A., Gharib, S.D. & Chin, W.W., 1989. Divergent Effects of Estradiol on

Gonadotropin Gene Transcription in Pituitary Fragments. Molecular Endocrinology,

3(3), pp.474–480.

Shupnik, M.A., Gharib, S.D. & Chin, W.W., 1988. Estrogen suppresses rat gonadotropin

gene transcription in vivo. Endocrinology, 122(5), pp.1842–1846.

Simerly, R.B., 1989. Hormonal control of the development and regulation of tyrosine

hydroxylase expression within a sexually dimorphic population of dopaminergic

cells in the hypothalamus. Brain research.Molecular brain research, 6(4), pp.297–

310.

Simerly, R.B. et al., 1985. Influence of perinatal androgen on the sexually dimorphic

distribution of tyrosine hydroxylase-immunoreactive cells and fibers in the

anteroventral periventricular nucleus of the rat. Neuroendocrinology, 40(6), pp.501–

510.

Simerly, R.B., 2002. Wired for reproduction: organization and development of sexually

dimorphic circuits in the mammalian forebrain. Annual Review of Neuroscience, 25,

pp.507–536.

148

Singh, S.P. et al., 2009. Impaired estrogen feedback and infertility in female mice with

pituitary-specific deletion of estrogen receptor alpha (ESR1). Biology of

reproduction, 81(3), pp.488–496.

Sohoni, P. & Sumpter, J.P., 1998. Several environmental oestrogens are also anti-

androgens. The Journal of endocrinology, 158(3), pp.327–339.

Somasekhar, M.B. & Gorski, J., 1988. Two elements of the rat prolactin 5’ flanking

region are required for its regulation by estrogen and glucocorticoids. Gene, 69(1),

pp.13–21.

Stahlhut, R.W., Welshons, W. V & Swan, S.H., 2009. Bisphenol A data in NHANES

suggest longer than expected half-life, substantial nonfood exposure, or both.

Environmental health perspectives, 117(5), pp.784–9.

Stauffer, S.R. et al., 2000. Pyrazole Ligands: Structure-Affinity/Activity Relationships

and Estrogen Receptor-r-Selective Agonists. J. Med. Chem, 43 (26), pp.4934–

4947.

Steinmetz, R. et al., 1997. The environmental estrogen bisphenol A stimulates prolactin

release in vitro and in vivo. Endocrinology, 138(5), pp.1780–1786.

Szabat, E., Vanhatalo, S. & Soinila, S., 1998. The ontogenic appearance of tyrosine

hydroxylase-, serotonin-, gamma-aminobutyric acid-, calcitonin gene-related

peptide-, substance P-, and synaptophysin-immunoreactivity in rat pituitary gland.

International journal of developmental neuroscience : the official journal of the

International Society for Developmental Neuroscience, 16(6), pp.449–460.

149

Takekoshi, S. et al., 2014. A Histopathological Study of Multi-hormone Producing

Proliferative Lesions in Estrogen-induced Rat Pituitary Prolactinoma. Acta

Histochemica et Cytochemica, 47(4), pp.155–164.

Takuma, N. et al., 1998. Formation of Rathke’s pouch requires dual induction from the

diencephalon. Development, 125(23), pp.4835–4840.

Taniguchi, Y. et al., 2001. Proliferation and differentiation of pituitary somatotrophs and

mammotrophs during late fetal and postnatal periods. Anatomy and Embryology,

204(6), pp.469–475.

Taniguchi, Y. et al., 2002. Proliferation and differentiation of rat anterior pituitary cells.

Anatomy and Embryology, 206(1–2), pp.1–11.

Taylor, T. et al., 1990. The paraventricular nucleus of the hypothalamus has a major

role in thyroid hormone feedback regulation of thyrotropin synthesis and secretion.

Endocrinology, 126(1), pp.317–324.

Terentiev, A.A. & Moldogazieva, N.T., 2013. Alpha-fetoprotein: a renaissance. Tumour

biology : the journal of the International Society for Oncodevelopmental Biology and

Medicine, 34(4), pp.2075–2091.

Thomas, P. & Dong, J., 2006. Binding and activation of the seven-transmembrane

estrogen receptor GPR30 by environmental estrogens: a potential novel

mechanism of endocrine disruption. The Journal of steroid biochemistry and

molecular biology, 102(1–5), pp.175–179.

Tian, L. et al., 2007. Activation of NMDA receptors promotes dendritic spine

150

development through MMP-mediated ICAM-5 cleavage. The Journal of cell biology,

178(4), pp.687–700.

Tian, L. et al., 2000. Intercellular adhesion molecule-5 induces dendritic outgrowth by

homophilic adhesion. The Journal of cell biology, 150(1), pp.243–252.

Le Tissier, P.R. et al., 2012. Anterior pituitary cell networks. Frontiers in

neuroendocrinology, 33(3), pp.252–266.

Treier, M. et al., 2001. Hedgehog signaling is required for pituitary gland development.

Development, 128(3), pp.377–386.

Treier, M. et al., 1998. Multistep signaling requirements for pituitary organogenesis in

vivo. Genes & development, 12(11), pp.1691–1704.

Treier, M. & Rosenfeld, M.G., 1996. The hypothalamic-pituitary axis: co-development of

two organs. Current opinion in cell biology, 8(6), pp.833–843.

Tsai, H.W., Grant, P.A. & Rissman, E.F., 2009. Sex differences in histone modifications

in the neonatal mouse brain. Epigenetics : official journal of the DNA Methylation

Society, 4(1), pp.47–53.

Tsukita, S. & Yonemura, S., 1999. Cortical actin organization: lessons from ERM

(ezrin/radixin/moesin) proteins. The Journal of biological chemistry, 274(49),

pp.34507–34510.

Vallette, G. et al., 1977. Rat iso-alpha1-fetoproteins. Purification and interaction with

estradiol-17beta. Steroids, 29(2), pp.277–89.

Vandenberg, L.N. et al., 2012. Hormones and endocrine-disrupting chemicals: low-dose

151

effects and nonmonotonic dose responses. Endocrine reviews, 33(3), pp.378–455.

Vandenberg, L.N. et al., 2007. Human exposure to bisphenol A (BPA). Reproductive

toxicology, 24(2), pp.139–177.

Vankelecom, H., 2010. Pituitary stem/progenitor cells: embryonic players in the adult

gland? The European journal of neuroscience, 32(12), pp.2063–2081.

Velasco-Marinero, E., Herrero-Payo, J.J. & Carretero-Gonzalez, J., 2011. Changes in

pituitary and prolactin cells of Wistar rats after two dental fillings with bisphenolic

resins. Archives of Oral Biology, 56(6), pp.592–598.

Vessey, M.P. et al., 1983. A randomized double-blind controlled trial of the value of

stilboestrol therapy in pregnancy: long-term follow-up of mothers and their

offspring. British journal of obstetrics and gynaecology, 90(11), pp.1007–1017.

Volkel, W. et al., 2002. Metabolism and kinetics of bisphenol a in humans at low doses

following oral administration. Chemical research in toxicology, 15(10), pp.1281–

1287.

Wade, G.N. et al., 1993. ICI 182,780: a pure antiestrogen that affects behaviors and

energy balance in rats without acting in the brain. The American journal of

physiology, 265(6 Pt 2), pp.R1392-8.

Wakeling, A.E., 2000. Similarities and distinctions in the mode of action of different

classes of antioestrogens. Endocrine-related cancer, 7(1), pp.17–28.

Wang, W., Hafner, K.S. & Flaws, J.A., 2014. In utero bisphenol A exposure disrupts

germ cell nest breakdown and reduces fertility with age in the mouse. Toxicology

152

and applied pharmacology, 276(2), pp.157–164.

Wang, Y., Martin, J.F. & Bai, C.B., 2010. Direct and indirect requirements of Shh/Gli

signaling in early pituitary development. Developmental biology, 348(2), pp.199–

209.

Weis, K.E. & Raetzman, L.T., 2016. Isoliquiritigenin exhibits anti-proliferative properties

in the pituitary independent of estrogen receptor function. Toxicology and Applied

Pharmacology.

Wen, S. et al., 2010. Embryonic gonadotropin-releasing hormone signaling is necessary

for maturation of the male reproductive axis. Proceedings of the National Academy

of Sciences of the United States of America, 107(37), pp.16372–16377.

Wendell, D.L., Platts, A. & Land, S., 2006. Global analysis of gene expression in the

estrogen induced pituitary tumor of the F344 rat. The Journal of Steroid

Biochemistry and Molecular Biology, 101(4), pp.188–196.

Wu, Y.J. et al., 2009. Estradiol promotes pituitary cell proliferation and gonadotroph

differentiation at different doses and with different mechanisms in chick embryo.

Steroids, 74(4–5), pp.441–448.

Wynick, D. et al., 1993. Galanin regulates basal and oestrogen-stimulated lactotroph

function. Nature, 364(6437), pp.529–532.

Xi, W. et al., 2011. Effect of perinatal and postnatal bisphenol A exposure to the

regulatory circuits at the hypothalamus-pituitary-gonadal axis of CD-1 mice.

Reproductive toxicology, 31(4), pp.409–417.

153

Xie, B. et al., 2017. TET1-GPER-PI3K/AKT pathway is involved in insulin-driven

endometrial cancer cell proliferation. Biochemical and Biophysical Research

Communications, 482(4), pp.857–862.

Xie, M. et al., 2016. Neonatal bisphenol a exposure induces meiotic arrest and

apoptosis of spermatogenic cells. Oncotarget, 7(9), pp.10606–10615.

Yoshihara, Y. et al., 1994. An ICAM-related neuronal glycoprotein, telencephalin, with

brain segment-specific expression. Neuron, 12(3), pp.541–553.

Yoshimura, F., Harumiya, K. & Kiyama, H., 1970. Light and electron microscopic studies

of the cytogenesis of anterior pituitary cells in perinatal rats in reference to the

development of target organs. Archivum histologicum Japonicum = Nihon

soshikigaku kiroku, 31(3), pp.333–369.

Zalko, D. et al., 2003. Biotransformations of bisphenol A in a mammalian model:

answers and new questions raised by low-dose metabolic fate studies in pregnant

CD1 mice. Environmental health perspectives, 111(3), pp.309–319.

Zarate, S. et al., 2012. Estrogens induce expression of membrane-associated estrogen

receptor alpha isoforms in lactotropes. PloS one, 7(7), p.e41299.

Zhao, L. et al., 2001. Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope

function. Development, 128(2), pp.147–154.

Zhou, R. et al., 2015. Perinatal exposure to low-dose of bisphenol A causes anxiety-like

alteration in adrenal axis regulation and behaviors of rat offspring: a potential role

for metabotropic glutamate 2/3 receptors. Journal of psychiatric research, 64,

154

pp.121–129.

Zhu, X. et al., 2006. Sustained Notch signaling in progenitors is required for sequential

emergence of distinct cell lineages during organogenesis. Genes & development,

20(19), pp.2739–2753.

Zoeller, R.T., Bansal, R. & Parris, C., 2005. Bisphenol-A, an environmental contaminant

that acts as a thyroid hormone receptor antagonist in vitro, increases serum

thyroxine, and alters RC3/neurogranin expression in the developing rat brain.

Endocrinology, 146(2), pp.607–612.

Zwijsen, R.M. et al., 1997. CDK-independent activation of estrogen receptor by cyclin

D1. Cell, 88(3), pp.405–15.

155