Generation and Characterization of CXCR3 Bicistronic Reporter Mice and CXCR3 Transgenic Mice
Dissertation
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University
By
Steve Onyeka Oghumu B.S., M.S.
Graduate Program in Microbiology
The Ohio State University
2010
Dissertation Committee:
Abhay R. Satoskar, Advisor
Daniel Wozniak
William Lafuse
Marshall Williams
Copyright by
Steve Onyeka Oghumu
2010
ABSTRACT
CXCR3 belongs to a group of seven transmembrane G-protein coupled chemokine receptors which participate in the coordination of leukocyte recruitment involved in homeostasis as well as in innate and adaptive immune responses. This chemokine receptor has been shown in numerous studies to play a vital role in the regulation of immunity to viral, bacterial and parasitic infectious diseases as well as in autoimmune disorders, transplant rejection and cancer. However, the mechanisms by which CXCR3 mediates its immunoprotective or pathologic actions in various disease conditions are quite complex and still not completely understood.
The potential of tracking CXCR3 expressing cells in vivo without interfering with cellular receptor function led us to explore the development of a CXCR3 IRES bicistronic EGFP reporter (CIBER) mouse, which enables visualization of CXCR3 mRNA transcript levels in cells via fluorescence of an EGFP reporter. Analysis of T cells from CIBER mouse revealed faithful and proportionate EGFP production by CXCR3 expressing cells. Further characterization using contact hypersensitivity, bacterial and fungal infection models was performed to investigate a role for CXCR3 in these inflammatory disease processes. The utility of these mice in live in vivo cell imaging using intra vital microscopy was also
ii demonstrated. Our results indicate that CIBER mouse will serve as a valuable tool in further understanding CXCR3 regulation, function and cellular expression which could potentially aid in the development of new immunotherapeutic strategies against infectious, neoplastic and autoimmune diseases.
As CXCR3 has been shown to be critical for immunity against a host of infectious diseases, we explored the consequences of transgenic overexpression of CXCR3 in T cells by generating a CXCR3 transgenic mouse in which CXCR3 is expressed under the control of a human CD2 promoter. In vitro analysis revealed cell surface expression of
CXCR3 in virtually all T cells and active migration of transgenic mouse T cells in response to CXCR3 ligands in vivo. We further analyzed the phenotype of the CXCR3 transgenic mouse during infection with Leishmania major, Salmonella typhimurium and
Histoplasma capsulatum in comparison with WT and cxcr3-/- mice to determine a potential role for CXCR3 in these infections. CXCR3 transgenic mice demonstrated increased resistance to L. major but were more susceptible to H. capsulatum and S. typhimurium than in WT and cxcr3-/- mice. We anticipate that our understanding of the role of CXCR3 in disease will be greatly enhanced by using CXCR3 transgenic mice.
These newly generated CIBER mice and CXCR3 transgenic mice have been shown to be tremendous tools that will potentially contribute to our understanding of CXCR3 regulation, expression and function. We believe that these genetically modified mouse strains will help to further define the role of CXCR3 in homeostatic processes as well as
iii in immunity and pathology of a wide range of infectious, autoimmune and neoplastic diseases.
iv
Dedication
Dedicated to my family
v
ACKNOWLEDGEMENTS
First and foremost, I would like to thank Jehovah for making it possible for me to successfully complete this program. I also want to express my deep love and gratitude to my amazing wife, Sapphire Star Oghumu, for all of her encouragement, love and support.
Much gratitude to my parents Eric and Liz Oghumu for helping me get this far in life, I could not have done it without them. Lastly, I would like to thank my dear brother
Stanley Oghumu for his continuous support throughout the years.
My advisor, Dr. Abhay Satoskar, has been extremely helpful in providing the necessary advice and academic guidance. It would have been impossible to complete this intensive project without his professional advice. The expertise and knowledge received from members of my dissertation committee, Dr. Daniel Wozniak, Dr. William Lafuse, and Dr.
Marshall Williams, has been extremely helpful in successfully preparing this dissertation.
I am also indebted to the help of Dr. Chad Rappleye, Dr. Brian Ahmer, Thomas
Kampfrath and Matt Swearingen for assisting with various technical aspects of my research project. Not to forget my lab members and colleagues, past and present, who have helped in different areas during the course of my experimental work. These include
vi my undergraduate helpers who diligently worked to assist me with numerous experiments. Their tremendous help has made my PhD program a success.
vii
VITA
January 2002 ……………...... B.S. Microbiology, Ahmadu Bello University, NIGERIA
2003 – Present …………………………………...... Graduate Teaching and Research Associate, The Ohio State University
June 2007 ……………………………...... M.S. Microbiology, The Ohio State University
PUBLICATIONS
1. Oghumu, S., Lezama-Davila, C. M., Isaac-Marquez, A. P., & Satoskar, A. R. (2010). Role of chemokines in regulation of immunity against leishmaniasis. Experimental Parasitology, PMID: 20206625.
2. Barbi, J., Cummings, H. E., Lu, B., Oghumu, S., Ruckle, T., Rommel, C., Lafuse, W., Whitacre, C. C., & Satoskar, A. R. (2008). PI3Kgamma (PI3Kgamma) is essential for efficient induction of CXCR3 on activated T cells. Blood, 112(8), 3048-3051.
3. Roth, K. M., Oghumu, S., Satoskar, A. A., Gunn, J. S., van Rooijen, N., & Satoskar, A. R. (2008). Respiratory infection with Francisella novicida induces rapid dystrophic cardiac calcinosis (DCC). FEMS Immunology and Medical Microbiology, 53(1), 72-78.
viii 4. Barbi, J., Oghumu, S., Lezama-Davila, C. M., & Satoskar, A. R. (2007). IFN-gamma and STAT1 are required for efficient induction of CXC chemokine receptor 3 (CXCR3) on CD4+ but not CD8+ T cells. Blood, 110(6), 2215-2216.
5. Lezama-Davila, C. M., Isaac-Marquez, A. P., Barbi, J., Oghumu, S., & Satoskar, A. R. (2007). 17Beta-estradiol increases Leishmania mexicana killing in macrophages from DBA/2 mice by enhancing production of nitric oxide but not pro-inflammatory cytokines. The American Journal of Tropical Medicine and Hygiene, 76(6), 1125-1127.
6. Barbi, J., Oghumu, S., Rosas, L. E., Carlson, T., Lu, B., Gerard, C., Lezama-Davila, C. M., & Satoskar, A. R. (2007). Lack of CXCR3 delays the development of hepatic inflammation but does not impair resistance to Leishmania donovani. The Journal of Infectious Diseases, 195(11), 1713-1717.
7. Lezama-Davila, C. M., Oghumu, S., Satoskar, A. R., & Isaac-Marquez, A. P. (2007). Sex-associated susceptibility in humans with chiclero's ulcer: Resistance in females is associated with increased serum-levels of GM-CSF. Scandinavian Journal of Immunology, 65(2), 210-211.
FIELDS OF STUDY
Major Field: Microbiology
ix
TABLE OF CONTENTS
Page
ABSTRACT ………………………………………………………………………….... ii
DEDICATION ………………………………………………………………………… iv
ACKNOWLEDGMENTS .…………………………………………………………...... v
VITA ……………………………………………………………………………………vii
LIST OF FIGURES ………………………………………………………………….. xiv
CHAPTERS:
1. INTRODUCTION………………………………………………………………….. 1
1.1. CHEMOKINES AND CHEMOKINE RECEPTORS ……………………..…… 1
1.2. THE CHEMOKINE RECEPTOR CXCR3 …………………………………….. 2
1.2.1. Cellular Expression …………………………………………………….... 3
1.3. ROLE OF CXCR3 IN DISEASE ……………………………………………..... 5
1.3.1. CXCR3 and Bacterial Infections ……………………………………...... 5
1.3.2. CXCR3 and Viral Infections ……………………………………….…..... 7
1.3.3. CXCR3 and Parasitic Infections ……………………………………...... 8
1.3.4. CXCR3 and Autoimmune Diseases ……………………………………... 9
1.3.5. CXCR3 and Transplantation …………………………………………… 11
1.3.6. CXCR3 and Cancer …………………………………………………….. 12
1.4. CONCLUSION ……………………………………………………………...... 14
x 2. GENERATION OF CXCR3 BICISTRONIC REPORTER MICE …………… 17
2.1. ABSTRACT …………………………………………………………………... 17
2.2. INTRODUCTION …………………………………………………………….. 18
2.3. MATERIALS AND METHODS ……………………………………………... 20
2.3.1. Generation of Targeting Vector ………………………………………... 20
2.3.2. Electroporation and Selection of Embryonic Stem cells ………………. 22
2.3.3. Southern Blot Screening ……………………………………………….. 22
2.3.4. PCR Genotyping of CIBER Mice ……………………………………… 24
2.3.5. Microinjection, Generation of Chimeras and Mouse breeding ………… 24
2.3.6. In vitro T cell Activation …………………………………………….…. 25
2.3.7. Flow Cytometric Analysis ……………………………………………... 25
2.4. RESULTS ……………………………………………………………………... 26
2.4.1. Generation of CIBER Mice ………………………………………….… 26
2.4.2. GFP production by CXCR3 expressing T cells ………………………... 27
2.4.3. Allelic usage of CXCR3 in female CIBER mice ………………………. 28
2.5. DISCUSSION …………………………………………………………………. 29
3. CHARACTERIZATION OF CIBER MICE USING A CONTACT HYPERSENSITIVITY MODEL ……………………………………………...…. 39
3.1. ABSTRACT ………………………………………………………………..…. 39
3.2. INTRODUCTION …………………………………………………………….. 40
3.3. MATERIALS AND METHODS …………………………………………..…. 43
3.3.1. Mice ...... …... 43
3.3.2. Preparation of single cell suspensions from organs ……………………. 44
3.3.3. Contact hypersensitivity model ………………………………………… 45
xi 3.3.4. Isolation of cells from ear pinna ……………………………………….. 45
3.3.5. Histochemical staining of lymph nodes ………………………………... 46
3.3.6. Flow Cytometric Analysis ……………………………………………... 46
3.3.7. Intravital Microscopy …………………………………………………... 47
3.4. RESULTS ……………………………………………………………………... 47
3.4.1. Detection of CXCR3 expression in naïve CIBER mice ……………….. 47
3.4.2. Activation state of GFP+ CD8+ T cells in lymph node, spleens and peripheral blood of CIBER mice ………………………………………. 49
3.4.3. Expression of CXCR3 in B lymphocytes ……………………………… 49
3.4.4. Tracking of CXCR3 positive cells using a contact hypersensitivity model …………………………………………………………………… 50
3.4.5. Detection of GFP positive cells in lymph nodes by fluorescence microscopy ……………………………………………………………... 51
3.4.6. Live imaging of migrating GFP positive cells …………………………. 51
3.5. DISCUSSION …………………………………………………………………. 52
4. CHARACTERIZATION OF CIBER MICE USING A BACTERIAL AND A FUNGAL INFECTION …………………………………………………. 67
4.1. ABSTRACT …………………………………………………………………... 67
4.2. INTRODUCTION …………………………………………………………….. 68
4.3. MATERIALS AND METHODS ……………………………………………... 71
4.3.1. Histoplasma infection protocol ………………………………………… 71
4.3.2. Preparation of single cell suspensions from lymph nodes, spleens and lungs ……………………………………………………………….. 71
4.3.3. Determination of Fungal burdens …………………………………...... 72
4.3.4. Flow Cytometric Analysis ……………………………………………... 73
4.3.5. Salmonella infection protocol ………………………………………….. 73 xii 4.4. RESULTS ……………………………………………………………………... 74
4.4.1. Course of H. capsulatum infection in CIBER mice ……………………. 74
4.4.2. Kinetic analysis of GFP+ T cell recruitment to the spleen and lungs after H. capsulatum infection …………………………………………... 74
4.4.3. Analysis of GFP+ T cell recruitment to the spleen and lungs after S. typhimurium infection ……………………………………………….. 75
4.5. DISCUSSION …………………………………………………………………. 76
5. GENERATION AND CHARACTERIZATION OF CXCR3 TRANSGENIC MICE ……………………………………………………………. 85
5.1. ABSTRACT ………………………………………………………………...... 85
5.2. INTRODUCTION …………………………………………………………….. 86
5.3. MATERIALS AND METHODS …………………………………………...... 88
5.3.1. Generation of CXCR3 Transgenic Mice ……………………………….. 88
5.3.2. Southern Blot and PCR Screening of Transgenic mice ……………...... 90
5.3.3. DNFB induced CHS Model ……………………………………………. 91
5.3.4. Leishmania infection protocol …………………………………………. 92
5.3.5. Histoplasma infection protocol ………………………………………… 93
5.3.6. Salmonella infection protocol ………………………………………….. 94
5.3.7. Preparation of single cell suspensions and flow cytometric analysis ….. 94
5.4. RESULTS ……………………………………………………………………... 95
5.4.1. Generation of CXCR3 Transgenic Mice ……………………………….. 95
5.4.2. Analysis of CXCR3 Expression in CXCR3 Transgenic Mice ………..... 96
5.4.3. Phenotype of DNFB induced CHS in Transgenic mice ………………... 97
5.4.4. Analysis of H. capsulatum infected CXCR3 Transgenic Mice ………... 98
xiii 5.4.5. Analysis of S. typhimurium infected CXCR3 Transgenic Mice ……….. 99
5.4.6. Characterization of Leishmania major infected CXCR3 Transgenic Mice ……………………………………………………………………. 99
5.5. DISCUSSION …………………………………………………………………100
6. CONCLUSION AND FUTURE DIRECTIONS ……..………………………... 114
REFERENCES ………………………………………………………………………. 122
APPENDICES:
A. ROLE OF CHEMOKINES IN REGULATION OF IMMUNITY AGAINST LEISHMANIASIS ………………………………………………………………... 143
B. PI3KGAMMA (PI3KΓ) IS ESSENTIAL FOR EFFICIENT INDUCTION OF CXCR3 ON ACTIVATED T CELLS ……………………………………………. 152
C. RESPIRATORY INFECTION WITH Francisella novicida INDUCES RAPID DYSTROPHIC CARDIAC CALCINOSIS (DCC) ………………………………. 157
D. IFN-GAMMA AND STAT1 ARE REQUIRED FOR EFFICIENT INDUCTION OF CXC CHEMOKINE RECEPTOR 3 (CXCR3) ON CD4+ BUT NOT CD8+ T CELLS ……………………………………………………………………………. 165
E. 17 -ESTRADIOL INCREASES Leishmania mexicana KILLING IN MACROPHAGES FROM DBA/2 MICE BY ENHANCING PRODUCTION OF NITRIC OXIDE BUT NOT PRO-INFLAMMATORY CYTOKINES ……… 168
F. LACK OF CXCR3 DELAYS THE DEVELOPMENT OF HEPATIC INFLAMMATION BUT DOES NOT IMPAIR RESISTANCE TO Leishmania donovani ………………………………………………………...... 172
G. SEX-ASSOCIATED SUSCEPTIBILITY IN HUMANS WITH CHICLERO'S ULCER: RESISTANCE IN FEMALES IS ASSOCIATED WITH INCREASED SERUM-LEVELS OF GM-CSF …………………………………………….…… 178
xiv
LIST OF FIGURES
Figure Page
2.1. Map of Targeting Vector CIBER TV ………………………………………….. 32
2.2. Homologous Recombination of CIBER TV into mouse Genomic DNA locus ……………………………………………………………………………. 33
2.3. Southern Blot results of ES cell Clones ……………………………………...... 34
2.4. PCR genotyping of tails from WT, homozygous and heterozygous CIBER mice …………………………………………………………………………….. 35
2.5. In vitro T cell activation of homozygous CIBER mice ……………………...… 36
2.6. Detection of GFP fluorescence and PE-conjugated anti-CXCR3 antibody in activated T cells …………………………………………………………...… 37
2.7. CXCR3 and GFP expression in activated T cells of WT and heterozygous CIBER mice ……………………………………………………………………. 38
3.1. Flow Cytometric analysis of unstained single cell suspensions from LN and thymus of WT and CIBER mice ………………………………………...… 56
3.2. GFP expression in lymphocytes and macrophages of LN of CIBER mice ……. 57
3.3. GFP expression in cell populations of spleen and peripheral blood of CIBER mice ………………………………………………………………….… 59
3.4. Activation state of CXCR3 expressing CD8+ T cells in peripheral blood …..… 61
3.5. Expression of CXCR3 in B lymphocytes …………………………………..….. 62
3.6. Detection of GFP+ infiltrating cells in inflamed ear tissue after DNFB induced CHS ………………………………………………………………….... 63
xv 3.7. Analysis of GFP expressing CD8+ cells in the cervical LN 24 hrs after DNFB challenge ………………………………………………………………... 64
3.8. Fluorescence microscopic imaging of lymph node sections of CIBER and WT mice ……………………………………………………………………...… 65
3.9. Intra vital microscopic images of cremestric tissue in response to CHS sensitization and challenge …………………………………………………….. 66
4.1. Lung and spleen colonization of CIBER mice by H. capsulatum …………...… 79
4.2. Kinetic analysis of CD4+ and CD8+ cells infiltrating CIBER lungs after infection with H. capsulatum ……………………………………………...…… 80
4.3. Proportion of CD4+ T cells in infected lungs of CIBER mice which are CXCR3 positive ………………………………………………………………... 81
4.4. Kinetic analysis of CD4+ and CD8+ cells in CIBER spleen after infection with H. capsulatum …………………………………………………………..… 82
4.5. Analysis of CD4+ and CD8+ T cells in the spleens of Salmonella infected CIBER mice ………………………………………………………………….… 83
4.6. Analysis of CD4+ and CD8+ T cells in the Peyer‟s patches of Salmonella infected CIBER mice ………………………………………………………...… 84
5.1. CXCR3 transgenic vector and its incorporation into the mouse genomic DNA ………………………………………………………………………...… 104
5.2. Southern blot and PCR of CXCR3 Transgenic mice …………………………. 105
5.3. Expression of CXCR3 on T cells of CXCR3 Transgenic and WT mice ……... 106
5.4. Ear thickness of DNFB sensitized and challenged CXCR3 transgenic and WT mice ………………………………………………………………………. 107
5.5. Analysis of CD8+ T cells from lungs of H. capsulatum infected CXCR3 Transgenic and WT mice at Day 8 …………………………………………… 108
5.6. Fungal counts of spleens and lungs of WT, cxcr3-/- and CXCR3 transgenic mice infected with H. capsulatum ……………………………………………. 109
5.7. Low dose infection of WT, CXCR3 transgenic and cxcr3-/- mice with H. capsulatum ……………………………………………………………………. 110
xvi 5.8. Bacterial counts in spleen and MLN of WT, cxcr3-/-, CXCR3 transgenic and CIBER mice infected with S. typhimurium ………………………………. 112
5.9. Footpad lesion sizes of WT and CXCR3 transgenic mice infected with L. major ……………………………………………………………………….. 113
6.1. Targeting vector and southern blot strategy for generating CXCR3-RFP bicistronic reporter mice ……………………………………………………… 120
6.2 L. major-GFP parasites, L. mexicana-GFP parasites and L. major-GFP parasites inside a mouse macrophage ……………………………………….... 121
xvii
CHAPTER 1
INTRODUCTION
1.1 CHEMOKINES AND CHEMOKINE RECEPTORS
Chemokines are chemotactic cytokines that coordinate recruitment of leukocytes involved in homeostasis as well as in innate and adaptive immune responses. They are single polypeptides of about 67 to 127 amino acid residues in length (Moser and
Willimann, 2004). The arrangement of the cysteine residues which form disulphide bonds to maintain the structure of the polypeptide chain provides the basis for their grouping and nomenclature. While CXC ( ) chemokines have their first two consensus cysteines separated by an amino acid, the CC ( ) chemokines have their first two cysteines adjacent to each other. The other two minor subfamilies include the CX3C chemokines
(containing three amino acids between the first two cysteines) and the C chemokines
(which lack two of the four canonical cysteines) (Rot and von Andrian, 2004).
Approximately 50 human chemokines and 20 chemokine receptors have been identified to date (Viola and Luster, 2008). Some chemokines have been shown to regulate cell
1 differentiation (Gu et al., 2000) and distinct patterns of chemokine secretion has been observed in differentiated cells (Muller et al., 2003).
Chemokines mediate their actions through binding of chemokine receptors, which are cell surface G-protein coupled receptors with seven transmembrane domains. Receptor engagement leads to numerous distinct signal transduction pathways ultimately resulting in a variety of biological functions including integrin activation and coordinated recruitment of leukocytes involved in innate and adaptive immune responses (Viola and
Luster, 2008). Chemokines and chemokine receptors have been shown to play a vital role in the regulation of immunity to infectious diseases and have been implicated in the pathogenesis of a variety of autoimmune disorders (Del Rio et al., 2001; Jones et al.,
2003; Rodriguez-Sosa et al., 2003; Oghumu et al., 2010). Indeed distinct chemokines and chemokine receptor-integrin combinations are associated with particular diseases and control effector cell migration to their respective infected tissue sites (Rot and von
Andrian, 2004).
1.2 THE CHEMOKINE RECEPTOR CXCR3
CXCR3 belongs to the CXC subfamily of chemokine receptors and bind chemokines
CXCL9 (Monokine induced by gamma interferon, MIG), CXCL10 (IFN-inducible protein 10, IP-10) and CXCL11 (IFN-inducible T cell alpha chemoattractant, ITAC) which belong to the ELR negative (Glu-Leu-Arg) subgroup of CXC chemokines (Strieter
2 et al., 1995; Romagnani et al., 2004). CXCR3 contains three extracellular N terminal domain loops (ECL1-3) involved in ligand binding and three intracellular C terminal domain loops involved in signal transduction after chemokine engagement. Signaling occurs through serine and threonine residue phosphorylation in the intracellular C terminal domains followed by calcium flux, activation of kinases including MAPK, Src,
PI3K and Akt, cytoskeletal rearrangements and cell migration (Lacotte et al., 2009).
Evidence indicates that binding of CXCR3 together with T cell receptor engagement produce a synergy resulting in enhanced T cell activation, proliferation and extravasation during an inflammatory process (Newton et al., 2009).
The gene encoding CXCR3 is mapped to the X-chromosome in humans and mice and encode for 40kd proteins that share 86% identity (Liu et al., 2005). The CXCR3 gene is comprised of two exons of about 11bp and 1090bp with about a 1kb intron between the coding regions. An alternatively spliced variant of CXCR3 (CXCR3-B) which binds
CXCL4 (platelet factor 4) with high affinity has been shown to be expressed in human endothelial cells and mediates angiostatic activity. The predicted CXCR3-B protein is
416 amino acids in length and has an extended N terminal extracellular domain (Lasagni et al., 2003). Another splice variant, CXCR3-alt which lacks an intact third and second extracellular loop is generated by post-translational exon skipping. Cells expressing this
CXCR3 variant are able to respond to CXCL11 chemoattraction (Ehlert et al., 2004).
3 1.2.1 Cellular Expression
Cellular expression of CXCR3 is dependent upon the biological role played by the cells that express the receptor. On several immune cell types including natural killer (NK) cells, plasmacytoid and myeloid dendritic cells, monocytes, B cells and especially activated Th1 cells, CXCR3 is expressed and is involved in effector cell migration to inflammatory sites(Liu et al., 2005). Recently, CXCR3 was shown to be expressed on certain Foxp3 expressing regulatory T cells where they mediate the suppression of Th1 immune responses in vivo (Koch et al., 2009). CXCR3 has also been shown on other cell types where they perform different roles. Expression of CXCR3-B on endothelial cells, especially human microvascular endothelial cells in the S phase of their growth cycle, has been associated with angiostatic activity (Romagnani et al., 2001; Romagnani et al.,
2004). This suggests a role for CXCR3 in the processes of wound healing and tissue repair as well as in the regulation of tumor growth. Indeed, in mice lacking CXCR3, wound repair is severely impaired (Yates et al., 2007; Yates et al., 2009). Other cells that have been shown to express CXCR3 include leukemic B cells (Jones et al., 2000), cancer cells of melanoma (Monteagudo et al., 2007), breast cancer (Ma et al., 2009), renal cell carcinoma (Klatte et al., 2008) and colon cancer (Kawada et al., 2007) where they serve as biomarkers of tumor behavior. Cells of the central nervous system (CNS) have also been reported to express CXCR3 indicating a role in CNS physiology and pathology
(Goldberg et al., 2001; Biber et al., 2002). It should be noted that due to the difficulty of generating highly specific monoclonal antibodies against CXCR3, identification of cells expressing this receptor has been rather difficult and some of the reports have been
4 conflicting. Furthermore, detection of CXCR3 expressing cells in vivo has presented an even greater problem.
1.3 ROLE OF CXCR3 IN DISEASE
The importance of CXCR3 in the regulation of immunity to viral, bacterial and parasitic infections has been demonstrated in numerous studies. On the other hand several studies have demonstrated the pathogenic role this receptor plays in inflammatory diseases, autoimmunity, transplantation and cancer. As a result, the use of CXCR3 antagonists as a possible therapeutic approach for these conditions has been extensively studied (Thoma et al., 2009; Trotta et al., 2009). The following sections will address some of the recent advances made in defining the role of CXCR3 in infectious, autoimmune and neoplastic diseases.
1.3.1 CXCR3 and Bacterial Infections
The roles for CXCR3 in immunity to bacterial infections are as varied as the infectious diseases they produce. Studies using WT and cxcr3-/- mice have shown that this receptor plays a significant but limited role in defense against infection with Citrobacter rodentium, a murine model for Enteropathogenic Escherichia coli (EPEC) infection in humans which causes diarrhea mainly in children (Spehlmann et al., 2009). It has also been shown to contribute to host resistance against pulmonary mouse infection with
5 Bordetella bronchiseptica. In this case as well, CXCR3 is not required for bacterial clearance, and mortality rates are similar to infected WT mice (Widney et al., 2005). In mice infected with Rickettsiae, T cells are required for immunity but CXCR3 has no effect in determining bacterial loads and disease outcome (Valbuena and Walker, 2004).
In contrast, CXCR3 impairs antimycobacterial activity and attenuates the host immune response in chronic Mycobacterium tuberculosis infection (Chakravarty et al., 2007). In view of the redundancy that is common with chemokine and chemokine receptor interactions and function, it seems that in the majority of acute bacterial infections, the absence of CXCR3 does not significantly affect the outcome of the disease, probably because they are compensated for by the action of other chemokines and chemokine receptors.
In humans, CXCR3 expression in gastric mucosa associated lymphoid tissue cells has been demonstrated to predict non-responsiveness to therapeutic eradication of
Helicobacter pylori infection (Yamamoto et al., 2008). Furthermore, the presence of
CXCR3+ B cells in circulation was reported in a patient suffering from erythema multiforme due to Gardnerella vaginosis infection, where it has been suggested to play a pathogenic role. Treatment and subsequent resolution of the disease correlated with a proportional significant decrease in the number of circulating CXCR3+ B cells (Sugita et al., 2008). In patients suffering from neuroborreliosis caused by Borrelia burgdorferi
CXCR3 contributes to the recruitment of CD4+ memory T cells into the cerebrospinal fluid where they likely play a role in neuron immunopathology (Lepej et al., 2005).
Similarly, in pulpitis which is mediated by dental caries related bacteria, CXCR3
6 signaling has been suggested to play a role in pulpal immune responses to bacterial invasion due to the production of CXCL10 in the inflamed dental pulp (Adachi et al.,
2007).
1.3.2 CXCR3 and Viral Infections
CXCR3 is crucial to the development of antiviral immunity against a number of viral infections and this is typically mediated by CD8 T cell trafficking to the infected tissue.
In murine infection with respiratory syncytial virus (RSV), dengue virus, West Nile virus
(WNV) and herpes simplex virus type 1 (HSV-1), the absence of CXCR3 or a disregulation of CXCR3 signaling contributes to susceptibility and increased severity of the disease (Hsieh et al., 2006; Carr et al., 2008; Lindell et al., 2008; Wuest and Carr,
2008; Zhang et al., 2008). At the same time, CXCR3 mediated CD4 T cell migration to viral infected tissues might contribute to immunopathology. This is the case in herpetic stromal keratitis (HSK), an immunopathological reaction to HSV-1 infection of the cornea (Komatsu et al., 2008) and parainfluenza virus infection (Kohlmeier et al., 2009).
Targeting CXCR3 in this context has been suggested to limit tissue damage. In herpes simplex virus type 2 (HSV-2) infection, the protective role of CXCR3 is linked to CD8 T cell activation and effector functions and not trafficking (Thapa and Carr, 2009). These observations highlight the multiple roles of CXCR3 in mediating protection and immunopathology in murine models of viral infection.
7 Chronic hepatitis C infection in humans may sometimes lead to liver damage and fibrosis in patients due to intrahepatic inflammation. CXCR3 associated chemokines have been shown to be linked to necroinflammation and fibrosis in the liver parenchyma of these patients and may very well play a role in the process (Zeremski et al., 2008). Viral control after antiviral treatment of chronic hepatitis C infection is associated with an increase in CXCR3 (high) expressing T cells in peripheral blood and could serve as a predictive marker of treatment responses to the disease (Larrubia et al., 2007; Perney et al., 2009).
1.3.3 CXCR3 and Parasitic Infections
The role of CXCR3 in the regulation of immunity to Leishmania has been extensively studied (Oghumu et al., 2010). Cxcr3 knock out mice infected with L. major are able to generate an effective Th1 immune response in the draining lymph nodes but are unable to control parasite growth in the lesion site. Defective CD4+ and CD8+ T cell migration to the site of infection accounts for this observed phenotype (Rosas et al., 2005). More recent studies have shown that BALB/c mice, which are genetically susceptible to L. major, are defective in their ability to induce CXCR3 on their T cells despite their ability to produce comparable amounts of IFN-γ as resistant C57BL/6 mice. It has been suggested that this deficiency might contribute to susceptibility of these mice (Barbi et al., 2008a). The importance of CXCR3 in mediating resistance to L. major as shown by these studies presents a potential target for therapeutic intervention.
8 In contrast, CXCR3 plays a deleterious role by contributing to the development and pathogenesis of fatal murine cerebral malaria caused by Plasmodium falciparum. In this case, migration of CXCR3 positive CD8 T cells to the brain mediates pathogenesis of the disease (Campanella et al., 2008; Miu et al., 2008). Indeed, as in L. major, mouse strain dependent susceptibilities to cerebral malaria (CM) correlates with their ability to upregulate CXCR3 in circulating leukocytes. Resistant BALB/c mice are less efficient in upregulating CXCR3 in T cells than C57BL/6 mice which are susceptible to CM (Van den Steen et al., 2008). The use of minocycline in CM therapy has been suggested due to its ability to downregulate CXCR3 mRNA expression in lymphocytes thereby reducing the homing potential of CXCR3 positive pathogenic T cells to the CNS (Kast, 2008).
1.3.4 CXCR3 and Autoimmune Diseases
Analysis of several autoimmune disorders has revealed a role for CXCR3 in mediating pathogenesis through recruitment of effector cell populations to inflammatory sites. In asthma, mast cell migration to the airway smooth muscle is mediated by CXCR3 and treatment of asthma by inhibition of the CXCR3-CXCL10 axis has been suggested
(Brightling et al., 2005). Indeed, in a mouse model of allergen induced asthma, the use of
TAK-779, a small molecule antagonist of CXCR3 and CCR5, prevents asthma symptoms by reducing pulmonary allergic inflammation (Suzaki et al., 2008).
The role for CXCR3 in multiple sclerosis (MS) is not yet fully understood and conflicting reports about CXCR3 function in the context of this autoimmune disease highlight the
9 need for further study. The implication of CXCR3 in the pathogenesis of MS can be seen in studies with MS patients where the frequency of CXCR3 positive T cells is elevated in peripheral blood and in areas of plaque formation (Balashov et al., 1999). CXCR3 is expressed on lymphocytes in perivascular inflammatory infiltrates of active MS lesions
(Sorensen et al., 1999) and cerebrospinal fluid (Martinez-Caceres et al., 2002).
Furthermore, CXCR3 and CXCL10 are co-localized in active MS lesions (Sorensen et al., 2002). A recent report showed a significant correlation between CXCR3 expression on CD8 cells and tissue injury along with MS disease progression, suggesting a pathogenic role for CXCR3 positive cytotoxic T cells in MS. As such, therapeutically targeting CXCR3 in mouse models of MS has attracted much attention.
TAK-779 has been used successfully to reduce the incidence and severity of experimental autoimmune encephalomyelitis (EAE), a mouse model of MS (Ni et al., 2009). Another
CXCR3 antagonist utilizing a truncated mutant of CXCL11 reduced the pathology of
EAE and inhibited the accumulation of CD4+ cells in the central nervous system (Kohler et al., 2008). Some animal models of multiple sclerosis however present inconsistent results and suggest more intricate and multiple roles for CXCR3 in the pathogenesis of
CNS inflammatory disorders. As an example, studies using cxcr3-/- mice demonstrate increased severity of EAE (Liu et al., 2006)and CXCR3 signaling has been shown to reduce the severity of EAE through the recruitment and distribution of regulatory T cells in the CNS (Muller et al., 2007). It is evident that further studies into the role of CXCR3 in animal models of MS as well as in human disease are required.
10 In a number of other autoimmune or inflammatory diseases, CXCR3 has been shown to play a pathogenic role. These include adjuvant arthritis (Mohan and Issekutz, 2007), artherosclerosis (van Wanrooij et al., 2008) and myasthenia gravis (Feferman et al.,
2005). Furthermore, treatment with anti CXCR3 monoclonal antibodies, CXCR3 antagonist NBI-74330 and CXCR3 antagonist T-487 respectively, significantly reduced the severity of these conditions (Mohan and Issekutz, 2007; van Wanrooij et al., 2008;
Feferman et al., 2009). Other CXCR3 associated autoimmune disorders include psoriasis
(Rottman et al., 2001; Chen et al., 2010), type 1 diabetes (Tanaka et al., 2009; Roep et al.,
2010), experimental lupus nephritis (Steinmetz et al., 2009) and systemic lupus erythematosus, where CXCR3 positive CD4 cells are enriched in inflamed kidneys and urine, and they serve as a valuable biomarker of nephritis in patients(Enghard et al.,
2009). The development and use of synthetic non-peptide compounds (CXCR3 antagonists) as therapeutic tools in the treatment of inflammatory and autoimmune disorders has been widely studied and provides a promising area for further research
(Turner et al., 2007).
1.3.5 CXCR3 and Transplantation
There are conflicting reports about the role of CXCR3 in the acute rejection of allografts.
In animal models of transplantation some reports show that CXCR3 mediates rejection of skin and cardiac allografts (Hancock et al., 2000; Haskova et al., 2007) and that prior treatment of mice with anti CXCR3 monoclonal antibodies prolongs cardiac and islet allograft survival (Uppaluri et al., 2008). Furthermore, blocking the CXCR3 pathway
11 using peptide nucleic acid (PNA) CXCR3 antisense was shown to prolong islet and skin allograft survival (Jiankuo et al., 2003; Yang et al., 2007) and combined CXCR3 and
CCR5 blockade prevented acute and even chronic rejection of cardiac allografts
(Schnickel et al., 2006; Schnickel et al., 2008). In another study using a CXCR3 antagonist, AMG12378, CXCR3 blockade promoted murine cardiac allograft survival
(Rosenblum et al., 2009). On the other hand some recent reports show that CXCR3 is not required for acute rejection of cardiac allografts (Halloran and Fairchild, 2008; Kwun et al., 2008; Zerwes et al., 2008). Clearly, more tools and animal models that study the role for CXCR3 in acute and chronic allograft rejection are required.
Another murine model for transplantation involving transfer of allogeneic hematopoetic stem cells typically results in T cell mediated acute graft versus host disease (GVHD).
CXCR3 interactions with CXCL10 are important mediators of GVHD pathogenesis
(Piper et al., 2007) and administration of neutralizing antibody against CXCR3 ameliorates this condition (He et al., 2008). In human renal transplant recipients, CXCR3 expression on peripheral CD4 positive T cells can serve as a biomarker for transplant rejection even before clinical evidence ensues since levels of CXCR3 remain high and stable (Inston et al., 2007).
1.3.6 CXCR3 and Cancer
The role for CXCR3 in the pathophysiology of cancer is complex. The angiostatic activity mediated by ELR negative chemokines CXCL4/PF4, CXCL9/MIG,
12 CXCL10/IP10 and CXCL11/ITAC binding to CXCR3-B on endothelial cells has been shown to inhibit the proliferation and angiogenesis of tumor associated blood vessels.
Furthermore CXCR3 could contribute to the trafficking of antitumor effector cells like
NK cells thus mediating tumor regression and increased survival in cancer patients
(Vandercappellen et al., 2008; Wendel et al., 2008). Conversely, the expression of
CXCR3 might play a role in the invasion and metastasis of tumor cells. Indeed, CXCR3 has been shown to be expressed on a variety of cancer cell lines and in some cases serve as predictive markers for disease progression (Fulton, 2009). These divergent roles for
CXCR3 make approaches to cancer therapy targeted at this chemokine receptor a difficult task. Nevertheless, there are significant observations both in humans as well as animal models elucidating the contributions of CXCR3 in various forms of cancer.
Tumor metastasis is a major cause of cancer related mortality. In a number of murine models, CXCR3 has been shown to be involved in promoting metastasis to the lungs. In two separate mouse models of colorectal cancer and osteosarcoma, lung metastasis was mediated by CXCR3 and treatment with the CXCR3 antagonist AMG487 significantly reduced dissemination of tumors to lungs (Cambien et al., 2009; Pradelli et al., 2009).
Similarly, in various forms of human cancer, CXCR3 expression correlates with tumor invasion and metastasis. This is demonstrated in cases of hepatocellular carcinoma and lung adenocarcinoma where the lymph node metastatic potential is associated with the expression of CXCR3 (Shi et al., 2006; Maekawa et al., 2008). In studies with melanoma and colon cancer, constitutive expression of CXCR3 accelerated tumor metastasis to lymph nodes (Kawada et al., 2004; Kawada et al., 2007). As these studies show, CXCR3
13 presents a potential therapeutic target which could suppress tumor metastasis in various forms of cancer.
The role of CXCR3 as prognostic indicators of tumor growth or necrosis has been well established. Breast cancer cells express CXCR3 and expression of this receptor has been shown to be associated with poor survival in patients with early stage breast cancer.
Furthermore, in a murine model of breast cancer, CXCR3 promoted tumor metastasis and gene silencing of this receptor inhibited tumor invasion (Ma et al., 2009). Conversely, in renal cell carcinoma, CXCR3 is an independent prognostic factor where its higher expression is a marker for improved disease-free survival following nephrectomy (Klatte et al., 2008). The expression of the alternatively spliced variant, CXCR3-B, is also a determining factor for the extensive tumor necrosis pattern observed in this cancer type
(Gacci et al., 2009). This angiostatic effect of CXCR3-B is well demonstrated since calcineurin inhibitor mediated downregulation of CXCR3-B promotes the progression of renal cancer (Datta et al., 2008).
The development of effective therapies against cancer by targeting CXCR3 depends on a thorough understanding of the mechanisms of CXCR3 mediated tumor metastasis and invasion, CXCR3 angiostatic effects, as well as the antitumor activities of CXCR3 expressing immune cells.
14 1.4 CONCLUSION
The many complex and sometimes conflicting reports on CXCR3 in various animal models seem to indicate diverse functionalities of CXCR3 expressing cell populations and underscores the need for more in depth understanding into the role of this chemokine receptor in mediating host resistance or pathogenesis of infectious, autoimmune and neoplastic diseases. While much about the role of CXCR3 has been discovered through the use of CXCR3 knock out mice, anti CXCR3 monoclonal antibodies and CXCR3 antagonists, the ability to track CXCR3 expressing cells in vivo without interfering with cellular receptor function will offer a definite advantage and provide additional insights into the function of this receptor in physiologic and pathologic conditions.
The use of bicistronic reporter systems to target and characterize gene expressing cells in mice has been used successfully to further elucidate cytokine (interleukin-4 and interleukin-10) and transcription factor (Foxp3) gene expression, regulation and function
(Mohrs et al., 2001; Wan and Flavell, 2005; Kamanaka et al., 2006). A CXCR3 bicistronic reporter system will enable assessment of the contributions made by various
CXCR3 expressing cell populations to the overall immune response in vivo.
Transgenic systems also provide a valuable tool in the understanding of gene function and have greatly increased our knowledge of various elements of the immune system
(Petters, 1987; Babinet et al., 1989; Mountz et al., 1990). The consequence of overexpression of genes in a T cell specific manner has been successfully used to further
15 elucidate the function of a variety of genes including GATA-3 (Yoh et al., 2003), Bcl-3
(Bassetti et al., 2009), programmed death-1 (Keir et al., 2005), interleukin-18 (Finotto et al., 2004), interleukin-12 receptor beta 2 chain (Nishikomori et al., 2000), L selectin
(Galkina et al., 2003), protein kinase B (Jones et al., 2000), the tumour-associated antigen murine double minute-2 (MDM2) (Xue et al., 2008), the T cell adaptor molecule Sin
(Xing et al., 2004), bcl associated death protein (BAD) (Mok et al., 1999) and the role of regulatory T cells (DiPaolo and Shevach, 2009), using T cell transgenic mouse models. It is evident that a CXCR3 transgenic mouse will also contribute to our understanding of
CXCR3 function in the context of infectious, autoimmune and neoplastic diseases.
Here we describe the generation of a CXCR3 bicistronic EGFP reporter mouse which co- express CXCR3 and EGFP from the same mRNA transcript. We also characterize this mouse using contact hypersensitivity and infectious disease models. CXCR3 expressing cells were analyzed in the lymph nodes and spleens of naïve mice, and in dermal inflammatory sites of dinitrofluorobenzene (DNFB) sensitized mice, lungs of mice infected with Histoplasma capsulatum as well as in Peyer‟s Patches and messenteric lymph nodes of Salmonella typhimurium infected mice. We further demonstrate the utility of these mice in live in vivo cell imaging using intra vital microscopy. We believe that this newly generated genetically modified mouse strain will provide further insights into the role of CXCR3 in several disease models.
We also describe the generation of a CXCR3 transgenic mice in which we elected to overexpress CXCR3 under the control of a human CD2 promoter which has been shown
16 to provide optimal gene expression in mouse T cells (Zhumabekov et al., 1995). We then characterized these mice using a DNFB model of contact hypersensitivity, as well as infection models with L major, H. capsulatum and S. typhimurium. We believe that our understanding of the role of CXCR3 in disease will be increased with the newly generated CXCR3 transgenic mice.
17
CHAPTER 2
GENERATION OF CXCR3 BICISTRONIC REPORTER MICE
2.1 ABSTRACT
In vivo analysis of CXCR3 regulation, function and cellular expression can be achieved with the successful generation of a CXCR3 bicistronic reporter (CIBER) mouse. We successfully generated a targeting vector designed for integration by homologous recombination into the CXCR3 locus. The targeting vector, which contains an internal ribosome entry site (IRES) linked to an enhanced green fluorescent protein (EGFP), enables coordinated expression of both CXCR3 and EGFP from a single transcriptional unit. Newly generated CIBER mice appeared normal, viable and healthy with no phenotypic defects. Flow cytometric analysis of in vitro activated CIBER T cells under
CXCR3 inducing conditions revealed proportionate expression of GFP protein in relation to cellular surface CXCR3 expression. Furthermore, analysis of female heterozygous
CIBER mice provides evidence for monoallelic gene expression and X chromosomal inactivation of CXCR3 in T cells. Our results indicate that the CIBER mouse model is a valuable tool in further understanding the role of CXCR3 in immunity.
18 2.2 INTRODUCTION
The roles for CXCR3 in mediating immunity to infectious diseases and pathogenesis of autoimmune and inflammatory disorders are multifaceted and not completely understood.
These many complex and sometimes conflicting reports on CXCR3 in various animal models seem to indicate diverse functionalities of CXCR3 expressing cell populations and underscores the need for more in depth understanding into the role of this chemokine receptor in mediating host resistance or pathogenesis of infectious and autoimmune diseases. While much about the role of CXCR3 has been discovered through the use of
CXCR3 knock out mice, anti CXCR3 monoclonal antibodies and CXCR3 antagonists, the ability to track CXCR3 expressing cells in vivo without interfering with cellular receptor function will offer a definite advantage and provide additional insights into the function of this receptor in physiologic and pathologic conditions.
Bicistronic vectors allow for the expression of two or more gene products from a single promoter element in a eukaryotic system. Translation of eukaryotic messenger RNAs
(mRNAs) depends on the presence of a cap structure at their 5‟ end which facilitates ribosome binding and controls the rate of translation initiation (Shatkin, 1976).
Ribosomes are also able to access eukaryotic mRNAs via a cap independent mechanism, utilizing an internal ribosome entry site (IRES) as a „landing pad‟ for efficient internal initiation of translation of the downstream cistron. This function was first discovered in
1988 by Pelletier and Sonenberg in poliovirus RNA which does not possess a 5‟ cap structure (Pelletier and Sonenberg, 1988) and the IRES element has subsequently been
19 exploited by researchers in the generation of transgenic expression constructs and the creation of polyfunctional RNAs. When the IRES element along with a downstream cassette are incorporated into the 5‟ untranslated region (UTR) of a monocistronic gene locus, coordinated expression of both genes within the mRNA is possible (Mountford and
Smith, 1995).
The use of bicistronic reporter systems to target and characterize immune related gene expressing cells in mice has been used successfully to further elucidate cytokine and transcription factor expression regulation and function. The production of interleukin 4
(IL-4) bicistronic reporter mice enabled the assessment of Th2 immunity generation and regulation in vivo after infection with an intestinal nematode (Mohrs et al., 2001). With the use of this tool, IL-4 producing cells were identified in vivo after induction of a Th1 immune response with aluminum adjuvant immunization (McDonald et al., 2006).
Another example is the production of interleukin 10 (IL-10) reporter knock-in mice which allowed researchers to identify IL-10 producing cells in vivo as well as their location within the intestine (Kamanaka et al., 2006), a remarkable feat considering the short half-life of the secreted protein and that intracellular IL-10 staining produces weak signals. Similarly, previously unreported Foxp3 gene expressing cells were identified using a Foxp3 bicistronic reporter knock-in mouse model (Wan and Flavell, 2005). More recently, an IL-23 receptor (IL-23R) reporter mouse showed IL-23R expressing cells and their effector functions in vivo (Awasthi et al., 2009). Clearly, bicistronic reporter mouse models are valuable tools that will greatly enhance our understanding of the in vivo regulation, function and cellular expression of immune related genes.
20 Using molecular tools, we hereby describe the generation of a CXCR3 bicistronic reporter mouse model which we have named Cxcr3 Ires Bicistronic Egfp Reporter
(CIBER) mice. We generated a targeting vector which was electroporated into embryonic stem cells. Positively screened clones were injected into blastocysts and placed into pseudopregnanat females. Ensuing chimeras were bred with wild type mice and screened for germline transmission of the homologous integrated gene. Our results indicate that
CIBER mice will serve as a valuable tool in further understanding CXCR3 regulation, function and cellular expression which could potentially aid in the development of new immunotherapeutic strategies against infectious, neoplastic and autoimmune diseases.
2.3 MATERIALS AND METHODS
2.3.1 Generation of Targeting Vector
The CXCR3 knock out targeting vector (cxcr3-/- TV) (Hancock et al., 2000) was kindly provided by Dr. Lu and was used as a template for the CXCR3 bicistronic mouse targeting vector (CIBER TV) construction. Cxcr3-/- TV consisted of a 5.8kb flanking sequence and a 3.4kb flanking sequence at the 5‟ and 3‟ ends of the coding region respectively and a 2.5kb HindIII and XbaI fragment containing Phosphoglycerine kinase
Neomycin (PGK-Neo) cassette which replaced the deleted CXCR3 exon 2. The entire fragment was subcloned into the pPNT vector containing the HSV-TK cassette (Figure
2. 1).
21 To generate CIBER TV, exon 2 was first reinserted into the coding region of cxcr3-/- TV in order to restore CXCR3 expression. This was done by PCR amplification of a 1kb fragment containing the CXCR3 exon 2 region from a C57BL/6 mouse genomic DNA template. This fragment was cloned into a TOPO vector, confirmed by sequencing then subcloned in frame into the cxcr3-/- TV using an HpaI site. A PacI, PmeI and BamHI restriction sites were added downstream of the CXCR3 coding region to facilitate subcloning of additional elements of the targeting vector. Subsequently, an internal ribosome entry site sequence linked to an enhanced green fluorescent protein cassette
(IRES-eGFP) of about 1.3kb which was kindly provided by Dr. Locksley (Mohrs et al.,
2001) was cloned into vector downstream of the CXCR3 coding region, before the endogenous poly adenylation (poly A) signal, using the PacI and PmeI site. Furthermore, a bovine growth hormone poly A (Bgh-Poly A) tail was inserted immediately after the
IRES-eGFP cassette of the targeting vector. Finally, the PGK-Neo cassette was flanked by the site specific recombination site, lox P, through extension PCR and relegation of the extended fragment into the vector via a BamHI and an XhoI site. This was done in order to remove this selectable marker if it interfered with the normal functioning of the gene after chimera generation (Figure 2.1).
The resulting 20.5 kb targeting vector sequence was confirmed by restriction digest analysis and complete plasmid sequencing. 300ug of CIBER TV plasmid DNA was prepared using the EndoFree Plasmid Maxi Kit (Qiagen). The targeting vector was linearized by digestion with NotI and purified by phenol chlorophorm extraction and
22 ethanol precipitation. The size, concentration and purity of the linearized targeting vector were confirmed by agarose gel analysis and spectrophotometry.
2.3.2 Electroporation and Selection of Embryonic Stem cells
The linearized targeting vector was sent to the Brigham and Womens Hospital (BWH)
Transgenic Core Facility for electroporation into 129SvE embryonic stem (ES) cells.
Selection of targeted clones was based on resistance to G418 and sensitivity to gancyclovir. Positive clones were picked, cultured in 96 well plates and replicated.
Genomic DNA was isolated from each clone for screening while replicate clones were cryopreserved. Positively screened clones were expanded and rescreened by southern blotting to confirm the presence of targeted recombination event.
2.3.3 Southern Blot Screening
Genomic DNA from ES cell clones or mouse tails was digested using BamHI at 370C for
16hours. Complete digestion was confirmed by running the digest on a 0.8% agarose gel.
10ug of digested DNA was subjected to agarose gel electrophoresis then depurinated with
250mM HCl, denatured in denaturation solution (0.5M NaOH, 1.5M NaCl) for 30 minutes at room temperature, neutralized in neutralization solution (0.5 M Tris-HCl, pH
7.5; 1.5 M NaCl) for 30 minutes at room temperature, then transferred to a nitrocellulose membrane by the capillary transfer method. Transferred DNA was fixed to the membrane by baking at 80°C for 2 hours.
23 Two separate DIG labeled probes were generated by PCR using the PCR DIG probe synthesis kit (Roche Applied Science, Indianapolis IN) and the following primers:
Probe A Fw – GTATCAATCCCCCTGCCTCA,
Probe A Rv – TGCTGTTCTAAGTGGCTCGAT,
Probe B Fw – GTAATGAGGACCAGGGCGTA,
Probe B Rv – CTTCAGCCTCTCTGCCTCTG.
Labeled probes were about 1kb and 500bp in length respectively and the quality of DIG labeling was confirmed by agarose gel analysis.
The membrane containing DNA was prehybridized in prewarmed DIG Easy Hyb buffer
(Roche Applied Science, Indianapolis IN) at 42°C for 30 minutes, then hybridized in DIG
Easy Hyb buffer (Roche Applied Science, Indianapolis IN) containing the denatured probe at 42°C overnight. After low stringency (2x SSC, 0.1% SDS at room temperature) and high stringency (0.5X SSC, 0.1% SDS at 60°C) washes, the membrane was washed then blocked in blocking solution for 30 minutes (Roche Applied Science, Indianapolis
IN) and incubated with anti-DIG antibody (Roche Applied Science, Indianapolis IN) for
30 minutes. Detection of hybridized probe was accomplished by addition of the substrate
CSPD (Roche Applied Science, Indianapolis IN) for 15 minutes. Chemiluminescence was detected after exposure to the Lumi-Imager F1 Workstation and analysis using the
Lumi-Imager computer software.
24 2.3.4 PCR Genotyping of CIBER Mice
Primers for PCR detection of CIBER positive mice were: Primer 1 –
CCTGGGCTTGTAATTCTGGA, Primer 2 – GACTGTGAATACGCCCTGGT
Primer 3 – ACACCGGCCTTATTCCAAG.
Genomic DNA from mouse tails was prepared and used as template for the PCR reaction.
12.5ul Fidelitaq PCR mastermix (USB Corporation, Cleveland OH) was mixed with total volume of 7.5ul of primers 1, 2 and 3 along with 5ul of genomic DNA in a PCR tube.
The PCR reaction was performed according to the following cycling conditions: 95°C for
3 minutes; 35 cycles of 94°C for 40 seconds, 48°C for 40 seconds and 68°C for 1 minute;
68°C for 10 minutes; hold at 4°C.
2.3.5 Microinjection, Generation of Chimeras and Mouse breeding
Positive ES cell clones were microinjected into C57BL/6 blastocyts, which were then implanted into pseudopregnant foster mothers at the BWH Transgenic Core Facility. The resulting male chimeras were transferred to the Ohio State University Animal Facility where they were bred with wild type C57BL/6 females to obtain heterozygous offspring which were screened by Southern blot and PCR. Heterozygous animals were bred to
C57BL/6 mice and the resulting offspring were interbred to obtain homozygous mice.
25 2.3.6 In vitro T cell Activation
Cell suspensions were obtained from excised lymph nodes and spleens of uninfected wild type, cxcr3-/- or CIBER mice. Splenocytes were incubated with Boyle‟s solution at room temp for 10 minutes to lyse red blood cells then washed with RPMI supplemented with
10%FBS. T cell populations were obtained by passing cell suspensions through nylon wool columns. Purified T cells were incubated at 0.5–2.5 x 106 cells/well in a 24-well plate precoated with 3µg/ml anti-CD3 (clone 145–2C11) and 4µg/ml anti-CD28 (clone
37.51) Abs (Biolegend, SanDiego CA) for 48 hrs. Following in vitro activation, cells were transferred to uncoated wells and rested in their conditioned media for 24 hrs, 48 hrs or 72 hrs. Cells were recovered and washed in cold PBS before staining with PE-labeled anti-mouse CXCR3 antibody or a PE-labeled Armenian hamster IgG control (Biolegend,
SanDiego CA). Stained cells were analyzed by flow cytometry.
2.3.7 Flow Cytometric Analysis
Single cell suspensions obtained from various tissues or in vitro cultures were washed with PBS and blocked with normal mouse serum or anti CD16/CD32 antibodies to eliminate non specific binding of labeled antibodies (Biolegend, SanDiego CA). Cells were incubated with conjugated antibodies against various cell surface markers
(Biolegend, SanDiego CA). Cells were acquired on a FACS Calibur flow cytometer and
26 analyzed with CellQuestPro software (Beckton Dickinson) after parameters were set with the use of isotype-matched controls and non fluorescent or unstained cell populations.
2.4 RESULTS
2.4.1 Generation of CIBER Mice
We generated a CXCR3 bicistronic reporter targeting vector designed for integration by homologous recombination into the CXCR3 locus. A 13 kb genomic fragment of the
CXCR3 locus consisting of exons 1 and 2, a 5.8kb flanking sequence and a 3.4kb flanking sequence at the 5‟ and 3‟ ends of the coding region respectively, was used to generate the targeting vector. The vector was modified by introducing an internal ribosome entry site (IRES) element, enhanced green fluorescent protein (EGFP) and a bovine growth hormone polyadenylation signal, followed by a loxP flanked neomycin cassette downstream of the translational stop codon and upstream of the endogenous polyadenylation signal in the 3‟ untranslated region of exon 2. A herpes simplex thymidine kinase cassette was cloned to one flank of the targeting construct to serve as a counter-selectable marker for targeted integration (Figure 2.1). The linearized targeting vector was electroporated into 129SvE embryonic stem (ES) cells. G418 resistant and gancyclovir sensitive clones were screened by Southern blot for targeted integration into the CXCR3 locus.
27 We designed a southern blot strategy to screen for ES cell clones containing the targeted integration into the CXCR3 locus (Figure 2.2). A BamHI site was incorporated into the targeting vector to distinguish between a mutated band (10kb) and a wild type band
(14kb). Of the 339 ES cell clones tested, 3 were found to contain the targeted integration as confirmed by southern blotting (Figure 2.3). Mouse PCR genotyping revealed a 222bp band for CIBER mice or a 448bp band for WT mice, while heterozygous mice showed both bands (Figure 2.4). All mice were viable and healthy with no phenotypic defects.
We have designated these mice as Cxcr3 Ires Bicistronic Egfp Reporter (CIBER) mice.
2.4.2 GFP production by CXCR3 expressing T cells
T cells have been shown to express CXCR3 following activation by plate bound anti CD3 and anti CD28 antibodies and subsequent reculture in conditioned media in the absence of any external stimuli (Nakajima et al., 2002). To determine if CXCR3 expressing cells from the newly generated CIBER mice produce EGFP, and could therefore serve as a suitable reporter for CXCR3 expression in these animals, we purified T cells from spleens and lymph nodes of WT, cxcr3-/- or CIBER mice and activated them under
CXCR3 inducing conditions. Cells were then harvested, washed and stained with PE- conjugated anti CXCR3 antibodies and analyzed by flow cytometry. As shown in Figure
2.5, in vitro activated T cells that express CXCR3 (as determined by anti CXCR3 antibody staining) also express EGFP and expression of CXCR3 in T cells is proportionate to EGFP production. Moreover, cells that do not express CXCR3 do not produce EGFP. This is true for cells from both the spleen and lymph nodes. Furthermore
28 EGFP expression does not seem to affect the synthesis and localization of CXCR3 to the cell surface. Levels of CXCR3 protein expression in CIBER mice were comparable to that of WT mice after in vitro T cell activation (Figure 2.6). Thus, EGFP production is an ideal reporter system for CXCR3 expression in cells of CIBER mice.
As will be seen in the next chapter, fluorescent microscopic analysis of EGFP expressing cells in the lymph node of CIBER mice shows that the intensity of EGFP expression is high and readily detectable. GFP expressing cells were observed in small clusters at specific areas of the lymph node close to blood vessels probably to facilitate prompt exit from the lymph node to the circulation and into inflamed tissue sites (Figure 3.8).
2.4.3 Allelic usage of CXCR3 in female CIBER mice
The gene encoding CXCR3 is mapped to the X-chromosome and is therefore subject to monoallelic expression in females through random X chromosome inactivation (XCI)
(Zakharova et al., 2009). X-chromosome inactivation is known to occur in x-linked genes to equalize gene expression between the sexes. To determine allelic usage of the cxcr3 gene in cells, we analyzed CXCR3 expression and GFP expression in T cells of homozygous and heterozygous female CIBER mice, by staining purified T cells with PE conjugated anti CXCR3 monoclonal antibody and analyzing by flow cytometry. We observed that in heterozygous female CIBER mice, about half of the cells expressing
CXCR3 did not express GFP while the other half expressed GFP (Figure 2.7). However, all GFP expressing cells in heterozygous female CIBER mice also expressed CXCR3.
29 This seemed to indicate monoallelic usage of the CXCR3 gene in T cells while the other allele was inactivated.
2.5 DISCUSSION
Conclusive evidence for the successful generation of an EGFP bicistronic reporter mouse is based on a proportionate expression of GFP protein in relation to cellular surface
CXCR3 expression. Our data demonstrate that CIBER mouse is an ideal reporter system for CXCR3 expression in mice. This tool could significantly contribute to our understanding of CXCR3 gene regulation and function.
It is well known that CXCR3 positive T cells are a source of interferon gamma (IFN-γ) which in turn induces the expression of CXCR3 ligands thereby attracting more CXCR3 positive T cells (Luster et al., 1985; Farber, 1990; Cole et al., 1998). This positive amplification of the Th1 immune response, mediated in part by CXCR3, necessitates tight regulation of CXCR3 expression at the cell surface. It has recently been shown that unlike other chemokine receptors CXCR3 is not recycled back to the cell surface following constitutive or ligand induced internalization but is rapidly degraded. As such, replenishment of cell surface CXCR3 is dependent upon de novo synthesis of CXCR3 protein and subsequent transport through the golgi (Meiser et al., 2008). This makes
CXCR3 mRNA transcript levels a suitable indicator for cell surface expression of the
CXCR3 protein which is the basis of the EGFP bicistronic reporter system. Of course,
30 any post translational control of CXCR3 mRNA will not be reported by this model, but this would afford an opportunity to utilize this model in the study of post translational regulatory mechanisms by correlating GFP production with CXCR3 expression.
XCI is a multi-step process where most genes on one X chromosome are transcriptionally silenced in females to ensure that X-linked gene expression is equalized between the sexes (Zakharova et al., 2009). However, it is well documented that a number of X-linked genes “escape” X-chromosome inactivation and are expressed from both X chromosomes
(Brown et al., 1995; Brown et al., 1997; Carrel and Willard, 1999; Li and Carrel, 2008).
If cxcr3 is among genes which escape X-inactivation in immune cells, then there will be quantitative differences in CXCR3 allele expression between the sexes. This could contribute to sex-associated differences in a variety of diseases. Gender differences in susceptibility to infectious and autoimmune diseases are well documented in mice and humans (Zandman-Goddard et al., 2007; Lleo et al., 2008; Ozcelik, 2008). Females are more resistant than males to infections caused by intracellular pathogens such as malaria
(Wunderlich et al., 1988; Wunderlich et al., 1991; Wunderlich et al., 1993), leishmaniasis
(Alexander, 1988; Satoskar and Alexander, 1995; Satoskar et al., 1998; Roberts et al.,
2001) and trypanosomiasis (Greenblatt and Rosenstreich, 1984) but they are more prone to autoimmune diseases such as lupus, rheumatoid arthritis, multiple sclerosis and thyroiditis (Zandman-Goddard et al., 2007; Lleo et al., 2008; Ozcelik, 2008). These differences are attributed to sex hormones and/or the ability of females to preferentially mount Th1-like responses. However, there are many immunologically important molecules which are encoded by X-linked genes, and their contribution to gender-
31 associated differences is not clear. To help us determine whether the cxcr3 gene undergoes XCI or escapes it, we analyzed CXCR3 expression and GFP expression in T cells of homozygous and heterozygous female CIBER mice. We observed monoallelic usage of the CXCR3 gene in female heterozygous CIBER mice which contrasts with observations with IL-4 and IL-10 bicistronic reporter mice where the respective proteins are transcribed from both alleles (Mohrs et al., 2001; Kamanaka et al., 2006). Our preliminary data seems to suggest that CXCR3 might undergo XCI due to monoallelic
CXCR3 gene expression, but further studies will be needed to determine if this occurs.
The significance of XCI occurring in immune associated genes suggests possible implications in sex associated predisposition to autoimmune diseases.
This is the first report of using an EGFP bicistronic reporter system to track chemokine receptor expressing cells. Protein expression analyses indicate that GFP production in
CIBER mice faithfully reports surface expression of CXCR3 on T cells. No defect in viability or fertility of CIBER mice was observed and immune cell populations appear normal. All evidence point to a successful generation of a CXCR3 bicistronic reporter mouse. The use of CIBER mice as a reporter system for CXCR3 expression is very applicable to in vivo systems were fluorescent antibody staining is impractical. With the development of modern in vivo imaging systems, in vivo tracking of live animals will potentially provide real time data on the generation and maintenance of immunity in a variety of disease models which would contribute to our understanding of the role
CXCR3 plays in these processes.
32 Figure 2.1
Figure 2.1: Map of Targeting Vector CIBER TV. Targeting vector contains 13 kb genomic fragment of the CXCR3 locus which consists of exons 1 and 2, a 5.8kb flanking sequence and a 3.4kb flanking sequence at the 5‟ and 3‟ ends of the coding region respectively. An internal ribosome entry site (IRES) element, enhanced green fluorescent protein (EGFP) and a bovine growth hormone polyadenylation signal, followed by a loxP flanked neomycin cassette downstream of the translational stop codon and upstream of the endogenous polyadenylation signal in the 3‟ untranslated region of exon 2 were introduced into the targeting vector. A herpes simplex thymidine kinase cassette was cloned to one flank of the targeting construct to serve as a counter-selectable marker for targeted integration. The resulting fragment was 20.5kb in length.
33 Figure 2.2
B = BamHI
Figure 2.2: Homologous recombination of CIBER TV into mouse genomic DNA locus. Map of the endogenous CXCR3 locus, CIBER TV and the mutated gene. A southern blot strategy was designed to screen for ES cell clones containing the targeted integration into the CXCR3 locus. A BamHI site [B] was incorporated into the targeting vector to distinguish between a mutated 10kb band and a wild type 14kb band.
34 Figure 2.3
Figure 2.3 Southern Blot results of ES cell Clones. DNA from 339 ES cells clones were digested using BamHI, run in an agarose gel and blotted unto a nitrocellulose membrane then hybridized with probe a. Southern blot results demonstrated 3 clones
(white arrow) which were found to contain the targeted integration, showing only the mutated 10kb band.
35 Figure 2.4
Figure 2.4: PCR genotyping of tails from WT, homozygous and heterozygous
CIBER mice: 3 primers were used for polymerase chain reaction of genomic DNA extracted from mouse tails. PCR genotyping resulted in a 222bp band for CIBER mice, a
448bp band for WT mice and both bands for heterozygous female mice.
36 Figure 2.5
Figure 2.5: In vitro T cell activation of homozygous CIBER mice: T cells from spleens of CIBER mice were activated in vitro using 3µg/ml anti-CD3 and 4µg/ml anti-
CD28 antibodies then rested in conditioned media. Flow cytometric analysis show that activated T cells expressing CXCR3 also express EGFP and expression of CXCR3 in T cells is proportionate to EGFP production. Moreover, cells that do not express CXCR3 do not produce EGFP.
37 Figure 2.6
Figure 2.6: Detection of GFP fluorescence and PE-conjugated anti-CXCR3 antibody in activated T cells: T cells from spleens of CIBER and cxcr3-/- mice were activated in vitro and examined for CXCR3 expression and EGFP production. Results indicate that levels of CXCR3 protein expression in CIBER mice are comparable to production of
EGFP in activated T cells. Furthermore, EGFP expression does not seem to affect the synthesis and localization of CXCR3 to the cell surface.
38 Figure 2.7
Figure 2.7 CXCR3 and GFP expression in activated T cells of WT and heterozygous
CIBER mice. Allelic usage of the cxcr3 gene was analyzed by examining cell surface
CXCR3 protein expression and EGFP expression in T cells of homozygous and heterozygous female CIBER mice. In heterozygous female CIBER mice, about half of T cells expressing CXCR3 do not express GFP while the other half expresses GFP.
However, all GFP expressing cells in heterozygous female CIBER mice also express
CXCR3. This seems to indicate monoallelic usage of the CXCR3 gene in T cells of
CIBER mice.
39
CHAPTER 3
CHARACTERIZATION OF CIBER MICE USING A CONTACT
HYPERSENSITIVITY MODEL
3.1 ABSTRACT
The functionalities of CXCR3 in the context of infectious and autoimmune diseases are diverse and sometimes conflicting. Our newly generated CIBER mouse serves as a faithful reporter of CXCR3 expression based on mRNA transcript levels. To demonstrate the feasibility of this tool we used flow cytometry and intra vital microscopy to track
CXCR3 expressing cells using a DNFB model of contact hypersensitivity. We also analyzed CXCR3 expression in various cell populations in naïve CIBER mice based on
GFP fluorescence. Using these mice, we show that CXCR3 is detectable in a very small subset of B cells in the spleen, and the majority of CXCR3 expressing cells in peripheral blood are central memory CD8+ T cells. Our results also indicate the high sensitivity of our CIBER mouse model and the ability to track CXCR3 expressing cells in vivo and in real time. CIBER mouse combined with advanced in vivo imaging techniques will undoubtedly serve as useful tools in providing further insights into the role of this
40 chemokine receptor in disease processes thereby contributing to the design of better therapeutic strategies.
3.2 INTRODUCTION
The importance of CXCR3 in the regulation of immunity to infectious, autoimmune and neoplastic diseases is well established but not completely understood. CXCR3 has been shown to be crucial to the development of immunity against a number of viral infections including dengue virus, herpes simplex virus type 1 (HSV-1), West Nile Virus (WNV) and respiratory syncytial virus (RSV), by mediating CD8 T cell recruitment to the infectious site (Hsieh et al., 2006; Carr et al., 2008; Lindell et al., 2008). In some cases,
CXCR3 mediated CD4+ T cell migration to viral infected tissues might contribute to immunopathology (Komatsu et al., 2008; Kohlmeier et al., 2009). While CXCR3 is essential to the development of protective immunity against murine Leishmania major infection (Rosas et al., 2005; Barbi et al., 2008a), it plays a deleterious role by contributing to the development and pathogenesis of fatal murine cerebral malaria caused by Plasmodium falciparum (Campanella et al., 2008; Miu et al., 2008; Van den Steen et al., 2008). Analysis of several autoimmune disorders has revealed a function for CXCR3 in mediating pathogenesis through recruitment of effector cell populations to inflammatory sites. These include asthma (Brightling et al., 2005; Suzaki et al., 2008), psoriasis (Rottman et al., 2001), multiple sclerosis (Balashov et al., 1999; Martinez-
Caceres et al., 2002), arthritis (Mohan and Issekutz, 2007) and myasthenia gravis
41 (Feferman et al., 2005; Feferman et al., 2009). In some animal models however, as in the case of multiple sclerosis, inconsistent results abound and this suggests intricate and multiple roles for CXCR3 in the pathogenesis of central nervous system inflammatory disorders (Liu et al., 2005). There are also conflicting reports about the role of CXCR3 in the acute rejection of allografts (Hancock et al., 2000; Haskova et al., 2007; Halloran and
Fairchild, 2008; Kwun et al., 2008; Zerwes et al., 2008). These complex and sometimes conflicting reports on CXCR3 in various animal models seem to indicate diverse functionalities of CXCR3 expressing cell populations and underscores the need for more in depth understanding into the role of this chemokine receptor in mediating host resistance or pathogenesis of infectious and autoimmune diseases. While much about the role of CXCR3 has been discovered through the use of CXCR3 knock out mice, the ability to track CXCR3 expressing cells in vivo without interfering with cellular receptor expression and function will offer a definite advantage and provide additional insights into the function of this receptor in physiologic and pathologic conditions.
Bicistronic reporter mice have served as valuable tools for in vivo characterization of immune related genes in the context of infectious and autoimmune diseases. The generation of the IL-4 bicistronic reporter mice has facilitated understanding of early events during the development of Th2 immune response. Cellular sources of IL-4 production during various infections have been identified as well as their kinetics, localization and migration patterns (Mohrs et al., 2001; Khodoun et al., 2004; Gessner et al., 2005; Mohrs et al., 2005; Schramm et al., 2007; Clay et al., 2009; Moore et al., 2009).
Similar observations have been found with the IL-10 bicistronic reporter mice
42 (Kamanaka et al., 2006). Studies using the recently generated IL-23 receptor (IL-23R) reporter mouse showed in vivo expression of IL-23R in Th17 cells and a subset of myeloid dendritic cells and effector functions of these cell populations were defined in in vivo infection models (Awasthi et al., 2009). Study of the development, regulation and function of Foxp3 expressing regulatory T cells in vivo has been greatly enhanced by the generation of Foxp3 bicistronic reporter mice (Bettelli et al., 2006; Kroemer et al., 2007;
Maynard et al., 2007). With the aid of this genetically engineered tool, it was discovered that initiation of Foxp3 expression occurs within the thymus, and this has led to close examination of natural regulatory T cell (nTreg) development (Fontenot et al., 2005;
Bettini and Vignali, 2010). The concepts of nTreg induction and the role of antigen specific regulatory T cells in organ specific autoimmunity have become better understood
(Korn and Oukka, 2007). Indeed, the development of foxp3 bicistronic reporter mice has provided new insights into Treg biology (McNeill et al., 2007; Zhou et al., 2009). We believe that a CXCR3 bicistronic reporter mouse will similarly enhance our understanding of the contributions made by various CXCR3 expressing cell populations to the overall immune response in vivo.
Development of in vivo imaging techniques to visualize single cells within live animal tissues has increased our understanding of immunological processes including leukocyte trafficking and cellular interactions. Cell movement is a complex and tightly regulated process mediated in part by chemokines and chemokine receptors and plays a key role in immune responses. Several aspects of T and B cell biology as well as other immune cells have been analyzed using advanced microscopic techniques (Mellado and Carrasco,
43 2008). Intra vital imaging of surgically exposed anaesthetized mice has been used successfully to study lymphocyte migratory behavior as well as the dynamics of antigen presentation in secondary lymphoid organs (Cahalan et al., 2003; Miller et al., 2003;
Sarris and Betz, 2009) and this has adjusted previously held views on the mechanisms of these processes. It is evident that the use of these new approaches in combination with fluorescent reporter mouse models offer great potential in the way the immune system is studied. The CIBER mouse model offers a unique opportunity to use intra vital imaging techniques to directly visualize CXCR3 expressing cells in vivo and in real time, which will enable us to better assess its role in infectious, autoimmune and neoplastic diseases thereby contributing to the design of better therapeutic strategies. The feasibility of this tool in in vivo cell tracking using a dinitroflorobenzene (DNFB) contact hypersensitivity model is shown in this study. We also characterize the newly generated CIBER mice by analyzing GFP expression of various cell populations in the spleen liver, lymph nodes, thymus and peripheral blood of naïve animals.
3.3 MATERIALS AND METHODS
3.3.1 Mice
All mice were maintained at a pathogen free animal facility at The Ohio State University in accordance with National and Institutional guidelines. Experiments were performed
44 with 6 to 10 week old sex-matched mice according to protocols approved by the Ohio
State University‟s Institutional Animal Care and Use Committee.
3.3.2 Preparation of single cell suspensions from organs
Spleens, lymph nodes livers and thymus were aseptically harvested from naïve or DNFB challenged mice, disrupted using a sterile syringe and filtered through a 70 m cell strainer into a sterile Petri dish containing 5ml complete RPMI media (Gibco, Grand
Island, NY, USA), supplemented with 10% heat-inactivated FCS (HyClone Laboratories,
Logan, UT, USA), 100 U/ml penicillin, 100 g/ml streptomycin and -mercaptoethanol
(Gibco).
To obtain cells from bone marrow, femurs of CIBER mice were carefully extracted, cleaned of all tissue and kept in ice-cold PBS. Both ends of a clean femur were cut off, and then a 10ml syringe with a 30G needle filled with sterile media was used to aspirate the bone marrow into a clean 15ml falcon tube.
Blood was extracted from tail snips of CIBER mice into heparin containing microcentrifuge tubes. Blood cells were washed with PBS twice in a 15ml falcon tube.
All media containing single cell suspensions from the different samples were transferred to separate 15ml falcon tubes and centrifuged at 1200RPM for 10 minutes. Cell suspensions were incubated with Boyle‟s solution for 10 minutes at room temperature to 45 lyse red blood cells, washed twice with cold PBS, counted and blocked with normal mouse serum or anti CD16/CD32 antibodies to eliminate non specific binding of labeled antibodies, then stained with PE labeled anti-mouse CD4, PE/Cy7 labeled anti-mouse
CD8 and APC labeled anti-mouse CD3 antibodies for T cells, PE/Cy7 labeled anti-mouse
B220 and PE labeled anti-mouse CD19 antibodies for B cells, PE labeled anti-mouse
F4/80 antibodies for macrophages, PE labeled anti-mouse CD49b and APC labeled anti- mouse CD3 antibodies for NK and NKT cells (all antibodies from Biolegend, San Diego
CA), and then analyzed by flow cytometry.
3.3.3 Contact hypersensitivity model
Mice were sensitized to DNFB by painting their shaved abdomen with 25ul of
0.5%DNFB in acetone:olive oil (4:1) and 5ul on their footpads on days 1 and 2. Control mice were painted with acetone:olive oil alone. On day 6 mice were challenged with 10ul of 0.2% DNFB on their ears. Challenge was monitored for 24 hours after which cells were obtained from inflamed ears.
3.3.4 Isolation of cells from ear pinna
Mice were sacrificed in a CO2 chamber and dipped in 70% ethanol. Ear pinnas were cut off, placed in a sterile Petri dish and allowed to dry in a sterile laminar flow hood for 5 minutes. Starting at the cut edge, the inner and outer cuticular aspects of each ear pinna were carefully separated using sterile forceps and floated, with the subcuticular faces
46 down, on 20ml complete RPMI media (Gibco, Grand Island, NY, USA) supplemented with 10% heat-inactivated fetal calf serum (FCS) (HyClone Laboratories, Logan, UT,
USA), 100 U/ml penicillin, 100 g/ml streptomycin, and 2 mM glutamine (Gibco) and
HEPES buffer, in slanted 50ml falcon tubes, then incubated at 37°C and 5% CO2 for 20 hours. After incubation, ear tissue was removed and the media was centrifuged at
1250rpm for 10 minutes. Cells were washed with PBS, then stained with PE labeled anti- mouse CD4 and PE/Cy7 labeled anti-mouse CD8 antibodies and analyzed by flow cytometry.
3.3.5 Histochemical staining of lymph nodes
Lymph nodes were harvested from both CIBER and WT mice and frozen at -20°C in tissue freezing medium. A Leica cryostat 20 CM1850 (Leica Instruments, Germany) was used to cut lymph nodes into 9μm sections, which were fixed onto slides with cold acetone at 4°C. Slides were stained with DAPI (Invitrogen, Carlsbad, CA) for 5 minutes, rinsed twice with PBS and mounted using mounting medium (Invitrogen, Carlsbad, CA), then observed under a fluorescence microscope.
3.3.6 Flow Cytometric Analysis
Single cell suspensions obtained from various tissues or in vitro cultures were washed with PBS and blocked with normal mouse serum or anti CD16/CD32 antibodies to eliminate non specific binding of labeled antibodies (Biolegend, SanDiego CA). Cells
47 were incubated with conjugated antibodies against various cell surface markers
(Biolegend, SanDiego CA). Cells were acquired on a FACS Calibur flow cytometer and analyzed with CellQuestPro software (Beckton Dickinson) after parameters were set with the use of isotype-matched controls and non fluorescent or unstained cell populations.
3.3.7 Intravital Microscopy
Male CIBER mice were sensitized using the contact hypersensitivity model with DNFB as described above, then challenged 6 days later on the skin surface over the cremaster muscle. 16 hours later, mice were anesthetized using tribromoethanol. Under anesthesia, the testicular cremaster muscle was surgically exposed using a dissecting microscope (2x;
Nikon SMZ 645, Japan) and mounted on a coherent cube. The cremaster muscle was bathed with Ringers Lactate at 37°C and leukocyte endothelial interaction was assessed in 5-10 venules using a Nikon Eclipse FN1 microscope (Nikon, Japan) with a 40x/0.80 W water immersed objective at a 2.0 mm working distance. In all experiments video images were captured and digitalized to 12- bit TIF images using Metamorph software (version
7.1.2.0, Metamorph, Downingtown, USA).
48 3.4 RESULTS
3.4.1 Detection of CXCR3 expression in naïve CIBER mice
To determine cellular expression of CXCR3 in naïve CIBER mice in vivo, single cell suspensions of lymph node, spleen, liver, thymus and peripheral blood samples were obtained from healthy 6 – 8 week old CIBER mice, treated with red blood cell lysis buffer, washed twice and stained for different leukocyte markers then analyzed by flow cytometry.
CXCR3 expression in CIBER mice as determined by GFP fluorescence was observed in lymph nodes (Figure 3.1), spleens, thymus, bone marrow, liver and peripheral blood, indicating that CXCR3 expressing cells can be found in these tissues and the majority of them were of the lymphoid lineage. In the lymph node, GFP was detected in 47% of all
NK cells, including NKT cells (Figure 3.2a). A very small percentage of CD4 + T cells
(less than 1%) were GFP+ in the lymph nodes of naïve CIBER mice. The majority of
CXCR3 expressing T cells in the lymph nodes were observed to be CD8+ T cells, approximately 6% of CD8+ T cells were GFP+ (Figures 3.2b and c). CXCR3 expression was also detected in macrophages (Figure 3.2d).
In the spleen, CXCR3 was also detected in NK cells, CD4+ and CD8+ T cells. There was a higher percentage of GFP+ CD4+ T cells detected in the spleen (3.6%) than in the lymph node, although the percentage of CD8+ T cells which were GFP+ was higher (7.25%) than
49 that of CD4+ T cells (Figure 3.3a). Blood samples also contained a much higher percentage of CD8+ T cells that were GFP+ (17%) than in CD4+ T cells (1%) (Figure
3.3b)
3.4.2 Activation state of GFP+ CD8+ T cells in lymph node, spleens and peripheral blood of CIBER mice
Since most CXCR3 expressing cells in the lymph node and peripheral blood were CD8+
T cells we decided to analyze the functional state of the GFP+ CD8+ T cells that express
CXCR3. Further analysis of peripheral blood lymphocytes indicated that almost all (86%)
CXCR3+ CD8+ T cells were CD44high and CD62Lhigh, thus of the central memory phenotype (Figure 3.4). This novel observation could be highly significant and the function of this CD8+ T cell subset requires further investigation. Of course, not all central memory CD8+ T cells expressed CXCR3.
3.4.3 Expression of CXCR3 in B lymphocytes
CXCR3 is known to be expressed in leukemic B cells (Jones et al., 2000) and is elevated in certain human autoimmune diseases like rheumatoid arthritis (Henneken et al., 2005;
Tsubaki et al., 2005; Nanki et al., 2009). To our knowledge, expression of CXCR3 on normal B cells in naïve mice has not been reported. We determined if GFP expression was detectable on a sub population of B cells in lymph nodes and spleens of CIBER mice. In spleens, a very small percentage of B lymphocytes were GFP+ (Figure 3.5).
50 Although low, the presence of this subpopulation of B cells is confirmed when compared to naïve WT mice. Further studies will be required to determine the functional significance of these CXCR3+ B cells.
3.4.4 Tracking of CXCR3 positive cells using a contact hypersensitivity model
Contact hypersensitivity (CHS) is a well established model of T cell mediated inflammation. In order to demonstrate the ability to track CXCR3+ cells in CIBER mice in vivo, we used a CHS model using DNFB to sensitize mice on their shaved abdomen and subsequently challenge them by painting ears 6 days later. After 24 hours cells were isolated from inflamed ears and draining lymph nodes then analyzed by flow cytometry.
As shown in Figure 3.6, GFP+ cells were observed in inflamed ears, most of them being
T lymphocytes. A nearly 6 fold increase in GFP+ CD4+ T cells and over 7 fold increase in
EGFP positive CD8 T cells were detected in the ears of DNFB challenged mice compared to vector treated controls, indicating recruitment of CXCR3 expressing CD4s and CD8s to the inflamed ears. Furthermore, the number of CXCR3+ CD8+ T cells was three times more than CXCR3- CD8+ T cells migrating to the inflamed site suggestive of a role for CXCR3 in the migration of effector CD8+ T cells during DNFB mediated CHS.
Flow cytometric analysis of draining lymph nodes of DNFB challenged CIBER mice indicated that percentage of GFP+ CD8+ T cells that are CD44high and CD62Llow increased significantly compared to naïve CIBER mice (Figure 3.7). It is evident that
51 CD8+ effector cells that express CXCR3 begin to lose the lymph node homing marker,
CD62L, and migrate from the draining lymph node to the inflamed ears. These data demonstrate the utility of CIBER mice in tracking of CXCR3 expressing cells in vivo.
3.4.5 Detection of GFP positive cells in lymph nodes by fluorescence microscopy
GFP+ lymphocytes in the lymph nodes of naïve CIBER mice were detected by flow cytometry. To determine the cellular location of GFP+ cells within the lymph node microenvironment, and to demonstrate the heightened intensity of the expressed GFP signal sufficient to be captured via fluorescence microscopy, lymph node cryosections of
WT and CIBER mice were fixed on slides, stained with DAPI and observed under a fluorescence microscope. In CIBER mice, aggregated GFP+ cells were detected in areas close to blood vessels, while WT mice did not show any green fluorescent cells in lymph node sections (Figure 3.8).
3.4.6 Live imaging of migrating GFP positive cells
To demonstrate the feasibility of tracking migrating GFP+ cells in vivo in real time, we induced DNFB mediated CHS on the skin surface over the cremaster muscle of male
CIBER mice, anaesthetized them 16 hours later and surgically exposed the testicular cremaster muscle for visualization using intra vital microscopy. We observed GFP+ migrating cells rolling over the endothelial wall of inflamed post capillary venules, with accompanied cell adhesion and transmigration. Observation of the vessels under bright
52 field enabled us to determine the position of the migrating cells. A number of GFP+ cells were already out of circulation and within the inflamed tissue while others were tethered to and rolling along the endothelial vessel wall (Figure 3.9). The intensity of GFP fluorescence was sufficient for ease of visualization under the microscope and for video image capture. We thereby show successful intra vital imaging of migrating GFP+ cells in real time using a modified approach to CHS in CIBER mice.
3.5 DISCUSSION
The ability to detect and track CXCR3 positive cells in vivo using CIBER mice provides definite advantages and will potentially contribute greatly to our understanding of
CXCR3 and its role in various disease models. Analysis of cell suspensions from various organs of naïve CIBER mice demonstrates the sensitivity of this method as compared to fluorescent antibody staining. Although most of the lymphocyte subsets analyzed in naïve mice are confirmed by previous work, the detection of GFP+ B cells in the spleens of naïve CIBER mice was not observed using anti CXCR3-173 monoclonal antibody staining (Uppaluri et al., 2008). Furthermore cross-reactivity issues commonly associated with the use of fluorescent antibodies are eliminated in CIBER mice. It also facilitates multicolor staining with the use of other antibodies in the analysis of various cell populations.
53 Previous studies have shown that expression of CXCR3 on unstimulated CD8+ T cells are mostly on memory cells (Uppaluri et al., 2008). We have extended this observation by showing that these cells are central memory cells, expressing both CD44 and CD62L.
The immunological significance of this observation is yet to be determined. It has been suggested that conversion from effector memory T cells (TEFF) to central memory T cells
(TCM) is part of a linear differentiation process after acute infection which culminates in the development of TCM, and TCM have greater proliferative capacity and confer protective immunity more efficiently than TEFF (Wherry et al., 2003). Of course, both T cell subsets are present in the blood and spleen, and CXCR3 is not present in all CD8+
+ + TCM. The reason why some CD8 TCM but not CD8 TEFF cells express CXCR3, mechanisms responsible for the maintenance of CXCR3 levels and functional roles of this T cell subset will require further study.
The utility of CIBER mice as valuable research tool has been demonstrated with its characterization using a CHS model of contact hypersensitivity. Hapten induced contact hypersensitivity (CHS) is a well established model of antigen specific T cell mediated inflammatory response to cutaneous sensitization and subsequent challenge with a hapten and various aspects of the process are well characterized. DNFB mediated CHS responses are primarily mediated by CD8+ T effector cells (Enk, 1997) which produce large amounts of IFN-γ (Xu et al., 1996). Chemokines are involved in attracting effector cells to the challenge site. Hapten induced CHS selectively upregulates the CXCR3 ligands CXCL9 and CXCL10 which peaks at 24 hours after hapten exposure (Meller et al., 2007), hence served as a quick in vivo model for tracking CXCR3 expressing cells in
54 CIBER mice. As expected, detection of GFP in CD4+ and CD8+ T cells was observed in inflamed ears at 24 hours. The percentages of CD8+ T cells that express GFP might indicate a role for CXCR3 in CD8+ T cell recruitment during DNFB mediated CHS.
Migration of CXCR3+ CD4+ cells to inflammatory site after initiation of DNFB mediated
CHS has been shown to be associated with regulatory T cell function. CD4+ T cells migrating to the skin during CHS produce IL-4 and IL-10, negatively regulating the inflammatory response (Xu et al., 1996), and a subset of regulatory T cells is known to express CXCR3 (Huehn et al., 2004; Koch et al., 2009). Consistent with these findings, we observed GFP+ CD4 T cells in the inflamed ears of DNFB sensitized and challenged mice which we believe to negatively regulate the inflammatory response during CHS.
Further characterization of the DNFB model of CHS in CIBER mice will be needed to confirm this possibility. Nevertheless, we demonstrate the ability to track CXCR3 expressing cells in CIBER mice using this model.
Using live intra vital imaging of CHS induced CIBER mice, we were able to directly observe cell migration, extravasation and transmigration of CXCR3 expressing cells in real time. Problems associated with GFP intensity using this approach was not encountered with CIBER mice. The results obtained demonstrates the feasibility of using intra vital imaging techniques in combination with CIBER mouse infection models to examine the kinetics of CXCR3+ T cells migrating to sites of inflammation and to determine cellular interactions of CXCR3 expressing cells with other cells. Intra vital two-photon laser microscopy has enabled detailed study of the migratory behavior of
55 individual lymphocytes deep within lymphoid tissue (Miller et al., 2003). Applying similar techniques will enable visualization and analysis of CXCR3 expressing cells in primary and secondary lymphoid organs of naïve and infected CIBER mice, when and where cells begin to express CXCR3 and how they circulate in vivo. Preliminary data obtained with fluorescence imaging of lymph node sections seem to indicate that they aggregate in areas close to blood vessels, facilitating easy exit from the lymph node to peripheral sites of inflammation. Accumulation and clustering of polarized Th1 cells in draining lymph nodes after a granulomatous liver disease caused by Propionibacterium acnes has been shown to be CXCR3 mediated and is due to CXCL10 production by mature dendritic cells which helps to promote and amplify T cell – dendritic cell interactions thereby optimizing Th1 mediated immune responses (Yoneyama et al.,
2002). This is analogous to our observed data with lymph nodes of naïve CIBER mice.
Recent reports have indicated that mature invariant NKT cells are retained in the thymic medullary epithelium by the expression of CXCR3 on their cell surface (Drennan et al.,
2009). Consistent with these results, we detected CXCR3 expressing cells in the thymus.
Two photon intra vital microscopy may potentially help us to visualize cellular interactions between iNKT cells and thymic epithelial cells that could shed more light on the process and functional consequence of thymic retention of this NK cell subpopulation. On the whole, further insights into the roles for CXCR3 in physiologic, pathologic and homeostatic processes might be gained through intra vital microscopic imaging of CIBER mice.
56 In summary, the utility of CIBER mice in real time in vivo tracking of CXCR3 expressing cells using intra vital microscopy after DNFB induced contact hypersensitivity has been demonstrated. This newly developed tool shows great potential in elucidating migratory patterns of cells that might involve a role for CXCR3.
57 Figure 3.1
Figure 3.1 – Flow Cytometric analysis of unstained single cell suspensions from LN of WT and CIBER mice: Single cell suspensions from lymph nodes of WT and CIBER mice were prepared and analyzed by flow cytometry. CXCR3 expression as determined by GFP fluorescence was observed in lymph nodes of CIBER mice.
58 Figure 3.2
A
B
59 C
D
Figure 3.2 – GFP expression in lymphocytes and macrophages of LN of CIBER mice: Single cell suspensions from the lymph nodes of naïve CIBER or WT mice were prepared and stained with NK cell, T cell or macrophage markers then analyzed by flow cytometry. (A) GFP was detected in at least 47% of all NK cells, including NKT cells of naïve CIBER mice. (B and C) Less than 1% of CD4 + T cells and about 5.6% of CD8+ T
60 cells were GFP+ in naïve CIBER mice. (D) CXCR3 expression was also detected in about
9% macrophages in the lymph nodes of naïve CIBER mice.
Figure 3.3
A
61
B
Figure 3.3 – GFP expression in cell populations of spleen and peripheral blood of
CIBER mice: Single cell suspensions from the spleen and peripheral blood of naïve
CIBER mice were prepared and stained with CD4+ and CD8+ T cell markers then analyzed by flow cytometry. (A) More GFP+ CD4+ T cells were detected in the spleen than in the lymph nodes although the percentage of CD8+ T cells which were GFP+ was higher than that of CD4+ T cells. (B) In the peripheral blood, the majority of CXCR3 expressing T cells were CD8+ T cells and very few CD4+ T cells expressed CXCR3.
62 Figure 3.4
Figure 3.4 – Activation state of CXCR3 expressing CD8+ T cells in peripheral blood:
Peripheral blood CD8+ T cells were stained and analyzed for the expression of memory T cell markers. Results indicated that almost all (86%) CXCR3+ CD8+ T cells in peripheral blood were CD44high and CD62Lhigh, thus of the central memory phenotype.
63 Figure 3.5
Figure 3.5 – Expression of CXCR3 in B lymphocytes: Cells from the spleen of naïve
CIBER mice were stained and analyzed for expression of CXCR3 in B lymphocytes through flow cytometric analysis of EGFP fluorescence. A very small percentage of B lymphocytes were found to be GFP+
64 Figure 3.6
Vector Treated DNFB Treated
Figure 3.6 – Detection of GFP+ infiltrating cells in inflamed ear tissue after DNFB induced CHS: Mice were sensitized with DNFB on their shaved abdomen and challenged on their ears 6 days later. Cells were isolated from inflamed ears and draining lymph nodes 24 hours later and analyzed by flow cytometry. A significant increase in
EGFP expressing CD4+ and CD8+ T cells were detected in the ears of DNFB challenged mice compared to vector treated controls. Results indicate a role for CXCR3 in the migration of effector CD8+ T cells during DNFB mediated CHS.
65 Figure 3.7
Figure 3.7 – Analysis of GFP expressing CD8+ cells in the cervical LN 24 hrs after
DNFB challenge: Single cell suspensions of draining lymph nodes were prepared from control or DNFB challenged CIBER mice, stained with APC conjugated anti CD8, PE conjugated anti CD44 and PE-Cy7 anti CD62L antibodies, then analyzed by flow cytometry. Events were gated on GFP+ CD8+ T cells. Percentages of GFP+ CD8+ T cells which were CD44high and CD62Llow from DNFB challenged CIBER mice increased significantly compared to control CIBER mice. CD8+ effector cells that express CXCR3 lose their lymph node homing marker and migrate away from the draining lymph nodes.
66 Figure 3.8
Figure 3.8 Fluorescence microscopic imaging of lymph node sections of CIBER and
WT mice: CIBER mice demonstrate aggregated GFP+ cells in areas close to blood vessels, while WT mice do not show any green fluorescent cells.
67 Figure 3.9
Figure 3.9 Intra vital microscopic images of cremestric tissue in response to CHS sensitization and challenge: Male CIBER mice were induced with DNFB on the skin surface over the cremaster muscle, anaesthetized and the testicular cremaster muscle was surgically exposed for visualization using intra vital microscopy. A number of GFP+ cells were detected outside of blood vessels and within the inflamed tissue while others were tethered to the endothelial vessel wall.
68
CHAPTER 4
CHARACTERIZATION OF CIBER MICE USING A BACTERIAL AND A
FUNGAL INFECTION
4.1 ABSTRAST
The requirement for Th1 cell mediated immunity, characterized by production of IFN-γ by Th1 cells and subsequent macrophage activation, against infection with Salmonella and Histoplasma is well established. As CXCR3 is expressed mainly by Th1 cells and is required for their migration to inflammatory sites, the importance of CXCR3 during these infections is of interest but has not been investigated. Using CIBER mice, we examined the role of this chemokine receptor in these bacterial and fungal infections by monitoring
CXCR3 expressing cells migrating to infected organs. CXCR3 expressing cells were shown to migrate to the lungs and spleen of Histoplasma infected CIBER mice, and
Peyer‟s patches and spleen of Salmonella infected CIBER mice. Whether these CXCR3 expressing cells play a protective, pathologic or dispensable role during these infections remains to be seen, but the utility of CIBER mice in the study of infectious disease models is well demonstrated.
69 4.2 INTRODUCTION
CXCR3 has been implicated in immunity or pathogenesis of a number of viral and parasitic infectious diseases (Rosas et al., 2005; Chakravarty et al., 2007; Campanella et al., 2008; Carr et al., 2008; Lindell et al., 2008; Wuest and Carr, 2008; Zhang et al., 2008;
Kohlmeier et al., 2009; Spehlmann et al., 2009; Thapa and Carr, 2009; Oghumu et al.,
2010). Except for a few diseases, CXCR3 seems to play a minimal role in bacterial infections and its role during infection with the intracellular bacteria Salmonella remains to be investigated. Furthermore, not much is known about the role of CXCR3 in immunity to the dimorphic fungus Histoplasma capsulatum.
Infection of mice with S. typhimurium has been widely accepted as a suitable murine model for typhoid in humans, which remains a major public health problem in developing countries. Mouse strains differ greatly in their susceptibility to Salmonella infection due to differences in genes encoding major histocompatibility complex (MHC) and the presence of a functional Nramp1 molecule, a transmembrane protein expressed in macrophages, and is a decisive factor in macrophage killing potential of Salmonella
(Vidal et al., 1995). Salmonella preferentially resides within macrophages and although the innate immune system is capable of restricting bacterial replication, acquired immunity is essential for effective control and eventual eradication of the bacteria
(Mittrucker and Kaufmann, 2000). IFN-γ production by Th1 cells is crucial in macrophage activation and subsequent killing of internalized bacteria (Moon and
McSorley, 2009). Using an attenuated strain of Salmonella, it has been shown that mice
70 deficient in T-bet (Ravindran et al., 2005), IFN-γ (VanCott et al., 1998), IFN-γ receptor
(Hess et al., 1996), and IL-12 (Mastroeni et al., 1996) are more susceptible to primary infection. Furthermore protective immunity is conferred to mice immunized with
Salmonella LVS strain but is abrogated in mice deficient in IL-12 (Mastroeni et al., 1996) or IFN-γ (Mastroeni et al., 1992). These reports indicate an important protective role for
CD4 Th1 cells during infection with Salmonella. Since CXCR3 is involved in migration of Th1 cells to the infection site, and CXCR3 expressing Th1 cells are major sources of
IFN-γ, it is of interest to determine if CXCR3 plays a role in immunity to Salmonella in mice. We hypothesize that CXCR3 contributes to protective immunity against
Salmonella.
Histoplasma capsulatum is a dimorphic fungus that causes infection in about 200,000 to
500,000 people every year. It invades reticuloendothelial organs such as the spleen and liver which have high numbers of mononuclear phagocytes and they are usually controlled in immunocompetent hosts. In immunocompromised individuals, particularly
AIDS patients, histoplasmosis is severe and usually fatal. Histoplasma primarily infects macrophages and survive within the phagolysosome through alkalinization of the pH of this compartment (Deepe, 2000). Cell mediated immunity is required for control of fungal growth and dissemination. A number of mouse experiments have demonstrated a requirement for T cells for protection against Histoplasma infection. Mice genetically deficient of T cells or depleted of T cells using anti T cell receptor (TCR) monoclonal antibodies become more susceptible to H. capsulatum (Allendorfer et al., 1999). In naïve mice, selective reduction of CD4+ T cells results in fatal histoplasmosis while adoptive
71 transfer of H. capsulatum reactive CD4+ T cells confers protection (Zhou and Seder,
1998; Allendorfer et al., 1999). This indicates a critical requirement of CD4+ T cells for survival of primary infection with H. capsulatum. CD8+ T cells also play a role in optimal clearance of yeasts from organs during primary infection with H. capsulatum. During secondary infection, either T cell population is sufficient for protection (Zhou and Seder,
1998; Allendorfer et al., 1999). T cells mediate protection against H. capsulatum through release of Th1 associated cytokines namely, TNF- and IFN-γ which activate phagocytic cells. These cytokines along with IL-12 have been shown to be critically required for protection against the fungus (Zhou et al., 1995; Allendoerfer and Deepe, 1997;
Allendoerfer et al., 1997).
Chemokine receptors play a role in immunity to H. capsulatum. CCR2 along with its ligands CCL2 and CCL7 are known to play a role in immunity to H. capsulatum by regulating the production of IL-4. In ccr2-/- mice, inflammatory cell recruitment is defective, IL-4 production is increased leading to decreased host resistance and progressive infection (Szymczak and Deepe, 2009). It has also been shown that H. capsulatum selectively induces high levels of MIP-1α in contrast with the beta-glucan cell wall component of the fungus suggesting that chemokines play a key role in the cellular infiltration of immune cells to the site of infection by H. capsulatum. The chemokine receptor CXCR3 is expressed on activated Th1 cells which mediate protection against H. capsulatum. It is therefore of interest to determine the role of CXCR3 in immunity to H. capsulatum.
72 In order to examine the role of CXCR3 in immunity to S. typhimurium and H. capsulatum, we attempted to use the newly generated CIBER mice to track CXCR3 expressing cells migrating to the Peyer‟s patch and spleen in response to oral infection by
S. typhimurium, as well as the lungs and spleen in response to nasal infection by H. capsulatum.
4.3 MATERIALS AND METHODS
4.3.1 Histoplasma infection protocol
Histoplasma yeast strain G217B was grown to stationary phase in Histoplasma- macrophage medium (HMM). Cells were counted using a hemocytometer and diluted to a concentration of 4.44 x 106 yeast/ml in HMM media. CIBER mice were first anaesthetized with ketamine, then using a micropipettor, 45ul (2 x 105 cells) of the adjusted yeast cell suspension was administered intranasally in a single bolus. Infection was monitored for 4 weeks during which spleens and lung tissues were aseptically harvested from mice on days 4, 8, 12, 16 and 24.
4.3.2 Preparation of single cell suspensions from lymph nodes, spleens and lungs
Lymph nodes, spleens and lungs were aseptically harvested from infected mice. Tissues were disrupted using a sterile syringe and filtered through a 70 m cell strainer into a
73 sterile Petri dish containing 5ml complete RPMI media (Gibco, Grand Island, NY, USA), supplemented with 10% heat-inactivated FCS (HyClone Laboratories, Logan, UT, USA),
100 U/ml penicillin, 100 g/ml streptomycin and -mercaptoethanol (Gibco). The media containing single cell suspensions were transferred to a 15ml falcon tube and centrifuged at 1200RPM for 10 minutes. Cell suspensions were incubated with Boyle‟s solution for
10 minutes at room temperature to lyse red blood cells, washed twice with cold PBS, counted then stained with PE labeled anti-mouse CD4 and PE/Cy7 labeled anti-mouse
CD8 antibodies and analyzed by flow cytometry.
4.3.3 Determination of Fungal burdens
Lungs and spleens were aseptically harvested and placed in 5ml of HMM, homogenized using Dounce homogenizer until only connective tissue remained visible. The homogenate was vortexed well and serial 1:10 dilutions were made in HMM from 10-1 to
10-6. Three dilutions were plated per lung and spleen, depending upon the number of days post-infection, by spreading 50 l of each dilution onto a HMM plate. Plates were monitored for colonies between days 6 and 12 after plating. Fungal burdens were calculated based on the number of colonies counted and dilution factor plated in CFU per tissue.
74 4.3.4 Flow Cytometric Analysis
Single cell suspensions obtained from various tissues or in vitro cultures were washed with PBS and blocked with normal mouse serum or anti CD16/CD32 antibodies to eliminate non specific binding of labeled antibodies (Biolegend, SanDiego CA). Cells were incubated with conjugated antibodies against various cell surface markers
(Biolegend, SanDiego CA). Cells were acquired on a FACS Calibur flow cytometer and analyzed with CellQuestPro software (Beckton Dickinson) after parameters were set with the use of isotype-matched controls and non fluorescent or unstained cell populations.
4.3.5 Salmonella infection protocol
CIBER mice were infected with the attenuated aroA-/- mutant strain of S. typhimurium.
Bacteria were injected by intragastric gavage of 2 x 108 bacteria in a volume of 200 μl
PBS. Mice were sacrificed 10 days after infection and cells from Peyer‟s patches and spleens were prepared and analyzed by flow cytometry
75 4.4 RESULTS
4.4.1 Course of H. capsulatum infection in CIBER mice
To establish a reproducible model of H. capsulatum infection in CIBER mice, we determined the fungal burdens of the lungs and spleen of CIBER mice infected with 2 x
105 yeast cells. We observed that fungal burdens in the spleens and lungs gradually increased until they peaked at day 12, then decreased thereafter (Figure 4.1), indicating that CIBER mice were resolving infection as in WT mice. Gross examination of lung tissue of infected mice indicated severe lung pathology at day 12 which was resolving at day 24. CIBER mouse spleens were enlarged during the course of infection. Fungal counts were reproducible between animals in the same group.
4.4.2 Kinetic analysis of GFP+ T cell recruitment to the spleen and lungs after H. capsulatum infection
We used CIBER mice to analyze expression of CXCR3 in cells recruited to the lungs during infection with H. capsulatum. CIBER mice were infected intra nasally with H. capsulatum then sacrificed at days 5 and 12. Lungs and spleens were harvested and analyzed for GFP expression by flow cytometry. At day 5, GFP+ cells were similar to basal levels found in uninfected lungs. An increase in GFP+ CD4+ T cells was detected in the lungs at day 12 post infection (Figure 4.2). Analysis of GFP+ cells indicated that at day 12, about 32% of CD4+ T cells expressed CXCR3, while about 31.6% of CD8+ T
76 cells were CXCR3+. Increases in fungal burdens correlated with increases in the percentage of GFP expressing CD4+ T cells in the lungs (Figure 4.3). In the spleen, over
2-fold increase in GFP+ CD4+ and CD8+ T cells in infected CIBER mice was detected at day 12 post infection (Figure 4.4).
4.4.3 Analysis of GFP+ T cell recruitment to the spleen and lungs after S. typhimurium infection
S. typhimurium is an enteropathogenic bacterium that is known to induce profuse inflammation in the intestinal tract. We therefore tested our CIBER mice using this bacterial infection model to track CXCR3 expressing cells infiltrating the Peyer‟s patches and spleen. CIBER mice were infected orally with 2 x 108 cells of an attenuated strain of
S. typhimurium (aroA-/-), sacrificed at day 10 and the presence of GFP+ cells in the spleen and Peyer‟s patches was investigated using flow cytometry. A two to three fold increase in GFP expressing CD4+ and CD8+ T cells was observed in the spleens of infected
CIBER mice compared to uninfected CIBER mice (Figure 4.5). In the Peyer‟s patches a four fold increase in GFP expressing CD4+ and CD8+ T cells was detected (Figure 4.6) relative to uninfected CIBER mice.
77 4.5 DISCUSSION
Infection of mice with H. capsulatum leads to immune responses that typically involve the action of macrophages and CD4+ T cells which are required to control infection.
Adaptive immune responses initiated in the draining lymph nodes result in effector T cell migration to the spleen and lungs where they exert their protective effects by production of TNF- and IFN-γ (Zhou et al., 1995; Allendoerfer and Deepe, 1997; Allendoerfer et al., 1997). Using this fungal infection model, we have demonstrated the ability to track
CXCR3 expressing T cells migrating to the lungs of infected CIBER mice. These cells are a major source of IFN-γ, so we hypothesized that CXCR3 will play a major role in immunity to H. capsulatum infection of CIBER mice. Results obtained with H. capsulatum infection of CIBER mice indicated that CXCR3 expressing T cells do migrate to the lungs from day 8. Furthermore, a correlation between fungal burdens and the number of CXCR3+ CD4+ cells migrating to the lungs was observed. The functional significance of CXCR3+ T cell migration to the lungs and whether they mediate protection or susceptibility to H. capsulatum will be addressed in the next chapter, but our preliminary studies with CIBER mice seem to indicate that they play a role in the outcome of infection. Our results also highlight additional factors that could affect fungal burdens and disease outcome.
It should be noted that the infected CIBER mice were outbred between 129SvE in which they were generated and C57BL/6 in which they are backcrossed to. Outbred mice generally seem to display increased resistance to infections than inbred mice and genetic
78 predisposition to infections in mice is widely recognized (Brett and Butler, 1986;
Hancock et al., 1988; Autenrieth et al., 1994; Sacks and Noben-Trauth, 2002). Indeed,
CIBER mice had fewer fungal burdens in the spleens and lungs than WT C57BL/6 age and sex matched counterparts. At this time we are proceeding with backcrossing CIBER mice to the C57BL/6 background. Nevertheless, the utility of CIBER mice as a tool to track CXCR3 cell expression using a fungal infection model has been demonstrated.
We have also demonstrated the utility of CIBER mice using a bacterial infection model with S. typhimurium, which induces profuse inflammation in the intestinal tract. Since
CXCR3 is preferentially expressed by cells of the adaptive immune system, we decided to use a mutant strain, aroA-/- which is a valuable tool for the study of adaptive immunity to Salmonella in highly susceptible mice (Mittrucker and Kaufmann, 2000). Trafficking of GFP+ T cells to infected organs was observed in this model and might imply a role for this T cell subset in immunity to Salmonella. Previous work has showed that transfer of
Salmonella antigen specific CD4+ T cell lines significantly protects against murine salmonellosis in susceptible naïve mice (Paul et al., 1985; Paul et al., 1988). Future research will determine if adoptive transfer of GFP+ CD4+ T cells from CIBER mice will confer protection to otherwise susceptible naïve congenic recipient mice against
Salmonella. This will establish a protective role for CXCR3.
Numerous studies have established a requirement for Th1 cells producing IFN-γ to resolve Salmonella infection. Furthermore, with the development of technology to identify and track Salmonella specific CD4+ T cells endogenously using peptide-MHC
79 tetramers (Hataye et al., 2006; Moon et al., 2007; Moon and McSorley, 2009), we will be able to utilize CIBER mice to determine if these Salmonella specific CD4+ T cells express CXCR3 and whether CXCR3 is required for recruitment of these cells to the liver, spleen and intestine. This approach could be extended to other microbial disease models in mice for which antigenic T cell epitopes have been defined and peptide-MHC tetramers are available.
In conclusion, we show the ability to track CXCR3 expressing cells migrating to sites of inflammation during a bacteria and fungal infection with S. typhimurium and H. capsulatum respectively. Our data also suggests a potential role for this chemokine receptor in these infections. The utility of CIBER mice in the study of infectious disease processes is well demonstrated.
80 Figure 4.1 A
B
Figure 4.1 – Lung and spleen colonization of CIBER mice by Histoplasma capsulatum: Fungal burdens in the lungs (A) and spleens (B) gradually increase until it
81 peaks at day 12 and then decrease thereafter. Fungal counts are reproducible between
animals in the same group.
Figure 4.2
A Day 0 Day 5 Day 12
B
Figure 4.2 – Kinetic analysis of CD4+ and CD8+ cells infiltrating CIBER lungs after
infection with H. capsulatum: An increase in GFP+ CD8+ T cells (A) and a significant
increase in GFP+ CD4+ T cells (B) is detectable in the lungs on infected CIBER mice at
day 12 post infection. At day 5, GFP+ cells are similar to basal levels found in uninfected
lungs.
82 Figure 4.3
Figure 4.3 – Proportion of CD4+ T cells in infected lungs of CIBER mice which are
CXCR3 positive: An increase in the percentage of GFP expressing CD4+ T cells is detected in the lungs is which correlates with increases in fungal burdens during the same time period.
83 Figure 4.4
Day 0 Day 5 Day 12
Figure 4.4 – Kinetic analysis of CD4+ cells infiltrating CIBER spleen after infection with H. capsulatum: A moderate increase in GFP+ CD4+ T cells is detectable in the spleens of infected CIBER mice at day 12 post infection.
84 Figure 4.5
Uninfected Day 10
Figure 4.5 – Analysis of CD4+ and CD8+ T cells in the spleens of Salmonella infected
CIBER mice: A two to three fold increase in GFP expressing CD4+ and CD8+ T cells is observed in the spleens of infected CIBER mice compared to uninfected CIBER mice.
85 Figure 4.6
Uninfected Day 10
Figure 4.6 – Analysis of CD4+ and CD8+ T cells in the Peyer’s patches of Salmonella infected CIBER mice: A four fold increase in GFP expressing CD4+ and CD8+ T cells is detectable in the Peyer‟s patches of infected CIBER mice relative to uninfected controls.
86
CHAPTER 5
Generation and Characterization of CXCR3 Transgenic Mice Using Leishmania,
Salmonella and Histoplasma Infection Model
5.1 ABSTRACT
Additional insights into the role of CXCR3 can be gained through transgenic over expression of the gene in mouse T lymphocytes. We therefore designed a targeting vector consisting of mouse CXCR3 cDNA cloned into a VA-hCD2 cassette containing the human CD2 promoter and locus control region (LCR), designed for optimal gene expression in mouse T cells. CXCR3 transgenic mouse demonstrated integration of the transgene and CXCR3 protein expression in virtually all T cells of the mouse.
Furthermore, T cells of CXCR3 transgenic mouse demonstrated active migration in response to CXCR3 ligands in vivo. We analyzed the phenotype of the CXCR3 transgenic mouse during infection with L. major, S. typhimurium and H. capsulatum in comparison with WT and cxcr3-/- mice to determine a potential role for CXCR3 in these infections. We believe that our newly generated CXCR3 transgenic mouse will serve as a useful tool in further understanding the role of CXCR3 in infectious diseases and autoimmune disorders.
87 5.2 INTRODUCTION
The importance of CXCR3 in the regulation of immunity to various diseases is well established. This is well demonstrated during infection with Leishmania, an obligate intracellular parasite transmitted by the sand fly vector causing a wide range of diseases, including cutaneous, mucocutaneous and visceral leishmaniasis in over 12 million people world wide, hence a major global health problem (www.who.int/tdr). Successful immunity to Leishmania major depends on recruitment of appropriate immune effector cells to the site of infection and CXCR3 plays a crucial role in the process (Oghumu et al., 2010). Genetically resistant C57BL/6 mice that have the CXCR3 gene knocked out are able to generate an effective Th1 immune response in the draining lymph nodes but are unable to control parasite growth in the lesion site. Defective CD4+ and CD8+ T cell migration to the site of infection accounts for this observed phenotype (Rosas et al.,
2005). More recent studies have shown that BALB/c mice, which are genetically susceptible to L. major, are defective in their ability to induce CXCR3 on their T cells despite their ability to produce comparable amounts of IFN-γ as resistant C57BL/6 mice.
It has been suggested that this deficiency might contribute to susceptibility of these mice
(Barbi et al., 2008a). It will be of interest to determine if compensating this deficiency through transgenic overexpression of CXCR3 in T cells of BALB/c mice could reduce susceptibility to L. major.
While CXCR3 has been demonstrated to be critical in regulating immunity against a host of infectious diseases, its role in Salmonella and Histoplasma infections have not yet
88 been fully identified. Previous studies have shown that IFN-γ producing CD4 Th1 cells have an important protective role during infection with Salmonella (VanCott et al., 1998;
Moon and McSorley, 2009). Since CXCR3 is involved in migration of Th1 cells to the infection site, and CXCR3 expressing Th1 cells are major sources of IFN-γ, we started to examine if CXCR3 plays a role in immunity to Salmonella in mice. In the previous chapter, we showed that CXCR3+ T cells were detectable in the spleens and Peyer‟s patches of Salmonella infected mice. Whether these CXCR3 expressing cells play a protective, pathologic or dispensable role during this infection remains to be seen. In a similar vein, protection against the intracellular fungal pathogen H. capsulatum depends on the presence of pathogen specific CD4+ T cells which produce TNF- and IFN-γ that activate macrophages and induce fungal killing (Allendoerfer and Deepe, 1997; Zhou and
Seder, 1998). Furthermore CXCR3+ T cells in CIBER mice are recruited to the infected lungs during H. capsulatum infection. To determine the contribution of these cells during infections with these intracellular pathogens, we sought to examine if genetic deletion, or transgenic overexpression, of CXCR3 will give rise to increased protection or susceptibility to H. capsulatum and S. typhimurium.
Cxcr3-/- mouse was first generated and characterized in 2000 (Hancock et al., 2000) and since then, has greatly contributed to our understanding of the role of CXCR3 in infectious and autoimmune diseases. Transgenic mice have also long been used in the study of gene function, and have greatly enhanced our understanding of numerous elements of the immune system (Petters, 1987; Babinet et al., 1989; Mountz et al., 1990).
The consequence of overexpression of genes in a T cell specific manner has been
89 successfully used to further elucidate the function of a variety of genes including GATA-
3 (Yoh et al., 2003), Bcl-3 (Bassetti et al., 2009), programmed death-1 (Keir et al., 2005), interleukin-18 (Finotto et al., 2004), interleukin-12 receptor beta 2 chain (Nishikomori et al., 2000), L selectin (Galkina et al., 2003), protein kinase B (Jones et al., 2000), the tumour-associated antigen murine double minute-2 (MDM2) (Xue et al., 2008), the T cell adaptor molecule Sin (Xing et al., 2004), bcl associated death protein (BAD) (Mok et al.,
1999) and the role of regulatory T cells (DiPaolo and Shevach, 2009), using T cell transgenic mouse models.
We therefore describe the generation and characterization of a CXCR3 transgenic mouse, and analyze its phenotype in response to infections with L. major, H. capsulatum and S. typhimurium. We also investigate if genetic deletion of CXCR3 contributes to immunity or susceptibility to H. capsulatum and S. typhimurium. We believe that this new transgenic mouse will further contribute to our understanding of CXCR3 function in the context of infectious, autoimmune and neoplastic diseases.
5.3 MATERIALS AND METHODS
5.3.1 Generation of CXCR3 Transgenic mice
Mouse CXCR3 cDNA from a C57BL/6 background was kindly provided by Dr. Bao Lu
(Harvard Medical School, Boston MA). A 1.1kb fragment was generated from the cDNA
90 template containing the CXCR3 gene with EcoRI sites incorporated at the flanking regions of the PCR product. Using this restriction enzyme sites, the CXCR3 PCR fragment was cloned into the VA CD2 vector. The resulting 15kb plasmid was checked for correct insertion of the CXCR3 cDNA cassette by restriction digest analysis and the plasmid sequence was confirmed by DNA sequencing.
100ug of CXCR3trans TV plasmid DNA was prepared using the Qiagen plasmid maxi kit
(Qiagen, Valencia CA). 15ug of the targeting vector was linearized by digestion with
NotI and run on a 0.8% agarose gel. The targeting vector band was excised, gel purified using the Qiagen gel extraction kit (Qiagen, Valencia CA) and eluted with 20ul of clean, sterile, DNase free microinjection buffer (10 mM Tris-HCl; 0.25 mM EDTA, pH 8.0).
The size, concentration, purity and integrity of the targeting vector DNA were verified by agarose gel analysis and spectrophotometry.
500ng of CXCR3trans TV in 30ul was sent to Brigham and Women‟s Hospital Transgenic
Mouse Facility for microinjection into pronuclei of C57BL/6 embryos and reimplantation into pseudopreganant females. Resulting litters were transferred to The Ohio State
University Animal Facility where they were screened for integration of the CXCR3 transgene.
91 5.3.2 Southern Blot and PCR Screening of Transgenic mice
Genomic DNA from mouse tails was digested using HindIII at 370C for 16hours.
Complete digestion was confirmed by running the digest on a 0.8% agarose gel. 10ug of digested DNA was subjected to agarose gel electrophoresis then depurinated with
250mM HCl, denatured in denaturation solution (0.5M NaOH, 1.5M NaCl) for 30 minutes at room temperature, neutralized in neutralization solution (0.5 M Tris-HCl, pH
7.5; 1.5 M NaCl) for 30 minutes at room temperature, then transferred to a nitrocellulose membrane by the capillary transfer method. Transferred DNA was fixed to the membrane by baking at 80°C for 2 hours.
A DIG labeled probe was generated by PCR using the PCR DIG probe synthesis kit
(Roche Applied Science, Indianapolis IN) and the following primers:
Fw – CACGCCACCCAGATCTACC, Rv – GGAGGCCTCAGTTGTCTCAG.
Labeled probe was about 630bp in length and the quality of DIG labeling was confirmed by agarose gel analysis. The membrane containing DNA was prehybridized in prewarmed DIG Easy Hyb buffer (Roche Applied Science, Indianapolis IN) at 42°C for
30 minutes, then hybridized in DIG Easy Hyb buffer (Roche Applied Science,
Indianapolis IN) containing the denatured probe at 42°C overnight. After low stringency
(2x SSC, 0.1% SDS at room temperature) and high stringency (0.5X SSC, 0.1% SDS at
60°C) washes, the membrane was washed then blocked in blocking solution for 30 minutes (Roche Applied Science, Indianapolis IN) and incubated with anti-DIG antibody
(Roche Applied Science, Indianapolis IN) for 30 minutes. Detection of hybridized probe
92 was accomplished by addition of the substrate CSPD (Roche Applied Science,
Indianapolis IN) for 15 minutes. Chemiluminescence was detected after exposure to the
Lumi-Imager F1 Workstation and analysis using the Lumi-Imager computer software.
Two primer sets were used for PCR detection of transgenic mice:
Primer set 1 – P1: CGTCATCTTCACGGAGAGAA,
P2: TGTTGACCACATGGCTGAGT,
P3: CAGACAGAATGTGGCAGGAA.
Primer set 2 – P4: TCGTAGGGAGAGGTGCTGTT,
P5: GCGCTCTTGCTCTCTGTGTA,
P6: GGTCACCTTCCCAGTCTGAGT.
Genomic DNA from mouse tails was prepared and used as template for the PCR reaction.
12.5ul Fidelitaq PCR mastermix (USB Corporation, Cleveland OH) was mixed with total volume of 7.5ul of P1, P2 and P3 or P4, P5 and P6, along with 5ul of genomic DNA in a
PCR tube. The PCR reaction was performed according to the following cycling conditions: 95°C for 3 minutes; 35 cycles of 94°C for 40 seconds, 48°C for 40 seconds and 68°C for 1 minute; 68°C for 10 minutes; hold at 4°C.
5.3.3 DNFB induced CHS Model
WT or CXCR3 transgenic mice were sensitized to DNFB by painting their shaved abdomen with 25ul of 0.5%DNFB in acetone:olive oil (4:1) on day 1. Control mice were painted with acetone:olive oil alone. On day 6 mice were challenged with 10ul of 0.2%
93 DNFB on their ears. Challenge was monitored for 24 hours after which inflamed ears were measured with a dial-gauge micrometer (Mitutoyo, Kanagawa Japan)
5.3.4 Leishmania infection protocol
L. major (LV39) was maintained by serial passage of promastigotes inoculated into the footpads of BALB/c mice. Amastigotes isolated from infected lesions were grown in
M199 medium (Gibco, Grand Island NY) supplemented with 20% heat-inactivated Fetal
Calf Serum (HyClone Laboratories, Logan UT), 100 U/ml penicillin, 100 g/ml streptomycin, and 2 mM glutamine (all Gibco) at 26°C to stationary phase promastigotes as described previously(Rodriguez-Sosa et al., 2003).
L. major promastigotes derived from passage 3-6 were centrifuged at 3000 rpm for 10 minutes, supernatants were then decanted and the parasites were resuspended in supplemented, fresh M199. A 1:5 dilution of parasite suspension was then made for counting purposes, using 10% formalin as the diluent. The quantity of parasites in the initial solution was determined by counting the number of parasites present using an improved Neubauer hemacytometer. Parasites were adjusted to 8 x107/mL and 25ul was injected subcutaneously using a 30-gauge needle (Becton Dickson) and glass micro- syringe (Hamilton, Reno, NV) into the right footpads of WT, cxcr3-/-, and cxcr3trans mice.
Footpad swellings were monitored weekly for 8 weeks using a dial-gauge micrometer
(Mitutoyo, Kanagawa Japan) to determine susceptibility or resistance to infection.
94 Parasite loads were determined by the serial dilution assay. First the footpads of infected mice were homogenized in M199 medium (Gibco, Grand Island, NY) by smashing through a 70 micron filter into a sterile petri dish, transferred to a 15ml falcon tube and centrifuged for 10 minutes at 3000RPM. After decanting the supernatant, the pellet was resuspended in 400ul M199. Ten-fold serial dilutions were made across a 96 well plate which was incubated for 7 days and observed for the presence of parasites.
5.3.5 Histoplasma infection protocol
Histoplasma yeast strain G217B was grown to stationary phase in Histoplasma- macrophage medium (HMM). Cells were counted using a hemocytometer and diluted to a concentration of 4.44 x 106 yeast/ml in HMM media. WT, cxcr3-/-, and cxcr3trans mice were first anaesthetized with ketamine, then using a micropipettor, 45ul (2 x 105 cells) of the adjusted yeast cell suspension was administered intranasally in a single bolus.
Infection was monitored for 4 weeks during which spleens and lung tissues were aseptically harvested from mice on days 4, 8, 12, 16 and 24.
To determine fungal load, lungs and spleens were aseptically harvested and placed in 5ml of HMM, homogenized using Dounce homogenizer until only connective tissue remained visible. The homogenate was vortexed well and serial 1:10 dilutions were made in HMM from 10-1 to 10-6. Three dilutions were plated per lung and spleen, depending upon the number of days post-infection, by spreading 50 l of each dilution onto a HMM plate.
Plates were monitored for colonies between days 6 and 12 after plating. Fungal burdens
95 were calculated based on the number of colonies counted and dilution factor plated in
CFU per tissue.
5.3.6 Salmonella infection protocol
WT, cxcr3-/-, and cxcr3trans mice were infected with the attenuated aroA-/- mutant strain of S. typhimurium. Bacteria were injected by intragastric gavage of 2 x 108 bacteria in a volume of 200 μl PBS. Mice were sacrificed 10 days after infection and cells from
Peyer‟s patches and spleens were prepared and analyzed by flow cytometry
To determine bacterial loads in the spleens, Peyer‟s patches and MLNs, mice were sacrificed 10 days after infection and organs were homogenized in 3 ml PBS. Serial 10 fold dilutions were made using LB broth and plated on SS agar plates to determine colony-forming units.
5.3.7 Preparation of single cell suspensions and flow cytometric analysis
Lymph nodes, spleens and lungs were aseptically harvested from infected mice. Tissues were disrupted using a sterile syringe and filtered through a 70 m cell strainer into a sterile Petri dish containing 5ml complete RPMI media (Gibco, Grand Island, NY, USA), supplemented with 10% heat-inactivated FCS (HyClone Laboratories, Logan, UT, USA),
100 U/ml penicillin, 100 g/ml streptomycin and -mercaptoethanol (Gibco). The media containing single cell suspensions were transferred to a 15ml falcon tube and centrifuged 96 at 1200RPM for 10 minutes. Cell suspensions were incubated with Boyle‟s solution for
10 minutes at room temperature to lyse red blood cells, washed twice with cold PBS, and blocked with normal mouse serum or anti CD16/CD32 antibodies to eliminate non specific binding of labeled antibodies, then stained with PE labeled anti-mouse CD4,
PE/Cy7 labeled anti-mouse CD8, APC labeled anti-mouse CD3 or PE labeled anti-mouse
CXCR3 antibodies (all Biolegend, SanDiego CA). Cells were acquired on a FACS
Calibur flow cytometer and analyzed with CellQuestPro software (Beckton Dickinson) after parameters were set with the use of isotype-matched controls and unstained cell populations.
5.4 RESULTS
5.4.1 Generation of CXCR3 Transgenic Mice
A CXCR3 transgenic targeting vector (CXCR3trans TV) was designed for transgenic expression of CXCR3 in mouse T cells by inserting a mouse CXCR3 cDNA into the VA vector (Figure 5.1) (Zhumabekov et al., 1995). A southern blot strategy was designed to determine integration of the targeting vector into mouse genomic DNA. A HindIII digest of mouse genomic DNA resulted in a 1.2kb CXCR3 transgene fragment and a 6.3kb fragment of the endogenous CXCR3 gene after hybridization with a 630bp probe. 15 mice were generated after microinjection of linearized CXCR3trans TV into the pronuclei of C57BL/6 embryos and reimplantion into pseudo-pregnant females. Southern blot
97 analysis of genomic DNA obtained from tails of these mice showed 2 that were positive for the transgene, clones 827 and 833 (Figure 5.2a). Clone 833 had a higher copy number than clone 827 and so was used for subsequent breeding. CXCR3 transgenic mice were viable and healthy with no phenotypic defects.
A PCR strategy was designed for genotyping of progeny mice that contained the CXCR3 transgene and allowed for quicker identification of transgenic positive mice. Two separate primer pairs were used to independently confirm the presence of the CXCR3 transgene and distinguish it from the natural CXCR3 genomic DNA band. PCR results showed a 295bp transgene band or a 558bp WT band for primer set 1, and a 402bp transgene band or a 267bp WT band for primer set 2 (Figure 5.2b).
5.4.2 Analysis of CXCR3 Expression in CXCR3 Transgenic Mice
As demonstrated from previous work and from phenotypic analysis of CIBER mice,
CXCR3 is expressed only in a very small percentage of T cells in the spleen and lymph nodes, and expression in naïve mice is restricted to CD44high subclass of T cells, characteristic of activated or memory cells. The CXCR3trans TV was engineered for constitutive and optimal expression of CXCR3 in T cells, being driven under the control of the human CD2 promoter which has been shown to efficiently express genes in mouse
T cells (Zhumabekov et al., 1995). Although incorporation of the CXCR3 transgene into the mouse genome was verified by southern blotting and PCR, CXCR3 transgenic mice will only be useful if the CXCR3 protein is expressed by mouse T cells. To confirm
98 CXCR3 protein expression in T cells and determine whether expression of CXCR3 is constitutive in all T cells of CXCR3 transgenic mice, single cell suspensions from spleens of WT and CXCR3trans mice were prepared and stained with fluorescently labeled anti-
CD3 and anti-CXCR3 antibodies then analyzed by flow cytometry.
Analysis of T cells from spleens of CXCR3trans mice demonstrates expression of CXCR3 by 97.5% of T cells. In contrast, CXCR3 was expressed on 7% of T cells in WT mice
(Figure 5.3). Phenotypic analysis of CXCR3 transgenic mice did not reveal any defect in the number of lymphocytes in the spleen and lymph nodes when compared to WT mice.
5.4.3 Phenotype of DNFB induced CHS in Transgenic mice
DNFB mediated contact hypersensitivity induces the production of CXCR3 ligands at the challenge site (Meller et al., 2007). To determine if over-expression of CXCR3 in transgenic mice results in increased recruitment of T cells in vivo and therefore increased ear swelling after induction of CHS, WT and CXCR3 transgenic mice were sensitized and challenged with DNFB in the ear pinna. The thickness of inflamed ears was measured with a micrometer to determine the degree of inflammation. We observed a significant increase in ear thickness of DNFB challenged transgenic mice over WT mice
(Figure 5.4), suggesting functional migration of CXCR3 expressing T cells to the ears in response to the induced CXCR3 ligands at the challenge site.
99 5.4.4 Analysis of H. capsulatum infected CXCR3 Transgenic Mice
The presence of Th1 cells in infected tissue is known to be required for protective immunity to H. capsulatum. Since CXCR3 is expressed predominantly by Th1 cells and
CXCR3 expressing cells were detected in the lungs of infected CIBER mice, we determined if CXCR3 is required for immunity to H. capsulatum by infecting WT, cxcr3-
/- and cxcr3trans mice with H. capsulatum, measured fungal burdens in spleens and lungs, and analyzed infiltrating cells in these tissues. At day 8, the percentage of T cells recruited to the lungs of cxcr3trans mice was 5 times more than that of WT or KO mice.
Further analysis indicated that these were mostly CD8+ T cells in the lungs of cxcr3trans mice (Figure 5.5). However CD4+ T cell recruitment was not affected significantly.
Similar results were obtained in the spleen.
Fungal burdens in the spleens of cxcr3trans mice on day 8 were about 1 log higher than in
WT and cxcr3-/- mice. Furthermore, cxcr3-/- mice showed a little less fungal load in the spleens and lungs than WT mice at day 16 (Figure 5.6). On the whole, cxcr3-/- mice were able to control infection a little better than the other groups while transgenic mice were the most susceptible to fungal infection. To further establish a contrasting phenotype between CXCR3 transgenic mice and WT mice, thereby defining a role for CXCR3 after
Histoplasma infection, we infected CXCR3 transgenic, cxcr3-/- and WT mice using a low dose model (1000 yeast cells) of H. capsulatum and monitored fungal burdens in the lungs over a period of 4 weeks. At day 18, a significant difference in fungal counts between CXCR3 transgenic mice and WT mice was observed. While WT and cxcr3-/-
100 mice were able to control infection and significantly reduce fungal load at this time,
CXCR3 transgenic mice were unable to do so (Figure 5.7). Although CXCR3 transgenic mice eventually controlled infection, there was a significant delay in their ability to do so.
This preliminary data suggests that CXCR3 plays a deleterious role during infection with
H. capsulatum.
5.4.5 Analysis of S. typhimurium infected CXCR3 Transgenic Mice
IFN- γ producing Th1 cells are important in immunity to Salmonella. Since CXCR3 is a chemokine receptor expressed on Th1 cells and CXCR3 expressing Th1 cells produce
IFN- γ, we examined if transgenic over expression or genetic deletion of CXCR3 will affect resistance to Salmonella in mice. Bacterial burdens in the mesenteric lymph node show an increase in transgenic mice over WT mice and a very slight increase over cxcr3-/- mice. In the spleen, the bacterial load in transgenic mice was also higher than in WT and cxcr3-/- mice. Cxcr3-/- bacterial counts were higher than WT in the mesenteric lymph nodes but lower in the spleens (Figure 5.8).
5.4.6 Characterization of Leishmania major infected CXCR3 Transgenic Mice
CXCR3 has been shown to be critical for immunity against cutaneous leishmaniasis caused by L. major. While cxcr3-/- mice are unable to control L. major infection due to a deficiency in T cell recruitment to the infected site, WT C57BL/6 mice are able to control infection (Rosas et al., 2005). To further characterize the newly generated cxcr3trans mice,
101 and to determine the consequence of CXCR3 over expression during L. major cutaneous infection, we infected WT and cxcr3trans mice with 2 million parasites in their right foot pads and monitored lesion sizes for 8 weeks. Preliminary results obtained with these infections indicated that cxcr3trans mice are able to control L. major infection better than their WT counterparts (Figure 5.9). At week 8 parasite dilution assays revealed no detectable parasites in both WT and CXCR3 transgenic mice.
5.5 DISCUSSION
Under the control of the human CD2 promoter along with a locus control region located in the 3‟ untranslated region of the human CD2 gene, the VA-hCD2 cassette has been designed and used for over-expression of genes in T cells of transgenic mice
(Zhumabekov et al., 1995). The newly generated CXCR3 transgenic mouse showed
CXCR3 expression on virtually all T lymphocytes in the mouse, and these T cells functionally migrated to CXCR3 ligands in vivo. This tool serves as an ideal system for studying CXCR3 mediated T cell responses in numerous infectious and autoimmune disease models for which T cells are important in immunity.
Infective dose of H. capsulatum is critical in establishing an infection model that highlights the role for CXCR3. Since differences in fungal burdens between the various groups of infected mice were small using the high dose model, we employed a low dose infection model which established a resolving phenotype in WT mice and displayed a
102 significantly higher fungal load in sex and age matched infected CXCR3 transgenic mice at day 18. This increased susceptibility of CXCR3 transgenic mice to H. capsulatum compared to WT or cxcr3-/- mice might suggest a pathogenic role for CXCR3 during this fungal infection. Since increase in fungal burdens correlates with migration of CD8+ T cells to the lungs of transgenic mice, we think that this T cell population might play a role in mediating susceptibility. Previous studies have shown that a requirement for CD4+ T cells is critical for survival of mice infected with H. capsulatum while CD8+ T cells are needed for optimal clearance of the fungus (Zhou and Seder, 1998; Allendorfer et al.,
1999). Furthermore, analysis of the T cell receptor repertoire of T cells recruited to the infected lung during the peak of infection demonstrates a bias and restriction for an antigen specific T cell clone necessary for protection. The presence of non antigen specific CD8+ cells recruited to the lungs of infected transgenic mice could interfere or play a deleterious role during infection. Further studies will be needed to establish this possibility. It is evident though that altered migration of T cells can interfere with the immune response to an infectious challenge (Gomez et al., 1998).
Our preliminary data with L. major infection of CXCR3 transgenic mice suggests that transgenic animals are better able to control infection than WT mice. WT C57BL/6 mice are genetically resistant to cutaneous infections with L. major, as they are eventually able to resolve infections after 8 weeks (Scott, 1991). They have also been shown to efficiently upregulate CXCR3 in vitro compared to the WT BALB/c strain, which are genetically susceptible to infection (Barbi et al., 2008a). CXCR3 expressing CD4+ and
CD8+ T cells were observed in lesions of WT C57BL6 mice infected with L. major
103 (Rosas et al., 2005). It is therefore not surprising to observe smaller lesion sizes in L. major infected CXCR3 transgenic mice. Further studies will be directed at analyzing cytokine production at the lesion site, proliferation responses of antigen specific T cells as well as enumeration and characterization of T cells recruited to the infected area, so as to define the mechanism of increased resistance to L. major in transgenic mice. Future studies will also be aimed at determining whether CXCR3 transgenic BALB/c mice would be more resistant to L major in contrast to the highly susceptible WT BALB/c mice.
Salmonella infection of transgenic mice resulted in increased bacterial burdens in the spleens and mesenteric lymph nodes compared to WT and cxcr3-/- mice. Possible reasons as to why this so will require further investigation. It does seem that transgenic over- expression of CXCR3 highly affects T cell migration and function during S. typhimurium infection more so than genetic deletion of CXCR3 does. Of course, only one time point was taken in this study, so a more extensive analysis of the role of CXCR3 in Salmonella infection will need to be conducted. However, in view of the redundancy that is common with chemokine and chemokine receptor interactions and function, it does seem that as in the majority of acute bacterial infections, the absence of CXCR3 does not significantly affect the outcome of S. typhimurium infection in mice, probably because they are compensated for by the action of other chemokines and chemokine receptors.
In summary, the generation of a CXCR3 transgenic mouse potentially serves as a useful tool in further understanding the role of CXCR3 in infectious diseases and autoimmune
104 disorders. The functional consequences of CXCR3 over-expression in T cells in vivo could reveal new insights into mechanisms and importance of CXCR3 regulation in homeostatic and pathologic processes.
105 Figure 5.1
H – HindIII b – probe 1.2kb
H H
CXCR3 Transgenic 5kb CD2 promoter CXCR3 cDNA 5.5kb CD2 LCR Targeting Vector b
6.3kb
H H H
CXCR3 Genomic DNA Locus E1 E2 b
Figure 5.1 – CXCR3 transgenic vector and its incorporation into the mouse genomic
DNA: The transgenic targeting vector contains a 1.1kb CXCR3 cDNA cassette cloned into the VA CD2 vector. This vector has 5kb of the human CD2 promoter and 5.5kb of the human CD2 locus control region (LCR), designed for optimal gene expression in mouse T cells. A HindIII site present in the CXCR3 targeting vector was employed as a strategy to distinguish the CXCR3 transgene from the endogenous CXCR3 gene
106 Figure 5.2
A
B
Figure 5.2 – Southern blot and PCR of CXCR3 Transgenic mice: (A) After digestion of genomic DNA from mouse tails with HindIII and hybridization with a probe b, a 1.2kb band was detected in two CXCR3 transgenic mice (827 and 833) which contained the
CXCR3 transgene, while a 6.3kb band was detected in mice containing the endogenous
CXCR3 gene. (B) PCR of genomic DNA from mouse tails of mice using primer set 1 showed a 558bp WT fragment or a 295bp CXCR3 transgenic fragment; while PCR using primer set 2 demonstrated a 267bp WT fragment or a 402bp CXCR3 transgenic fragment.
107 Figure 5.3
A
B
108 Figure 5.3 – Expression of CXCR3 on T cells of CXCR3 Transgenic and WT mice:
Single cell suspensions from spleens of WT and CXCR3trans mice were prepared and stained with FITC conjugated anti-CD3 and PE conjugated anti-CXCR3 antibodies then analyzed by flow cytometry. (A) Results indicated that virtually all T cells from
CXCR3trans mice expressed CXCR3 while in WT mice, only 7% of T cells showed
CXCR3 expression. (B) Histogram plot of CXCR3 expressing cells from WT or transgenic mice. Events were gated on CD3+ cells.
Figure 5.4
Figure 5.4 – Ear thickness of DNFB sensitized and challenged CXCR3 transgenic and WT mice: WT and CXCR3 transgenic mice were sensitized and challenged with
DNFB in the ear pinna and ear thickness was measured with a micrometer. A significant
109 increase in ear thickness of DNFB challenged CXCR3 transgenic mice was observed over DNFB challenged WT mice.
Figure 5.5
Figure 5.5 – Analysis of CD8+ T cells from lungs of H. capsulatum infected CXCR3
Transgenic and WT mice at Day 8: Cells infiltrating the lungs of H. capsulatum infected WT or CXCR3 transgenic mice were isolated and analyzed by flow cytometry.
The percentage of CD8+ T cells recruited to the lungs of cxcr3trans mice was 5 times more than that of WT mice.
110 Figure 5.6
A
P < 0.05 P = 0.05 P = 0.05
B
P = 0.05
Figure 5.6 – Fungal counts of spleens and lungs of WT, cxcr3-/- and CXCR3 transgenic mice infected with H. capsulatum: (A) Fungal burdens in the spleens of cxcr3trans mice on day 8 were about 1 log higher than in WT and cxcr3-/- mice. (B) On
111 day 16, cxcr3-/- mice showed a little less fungal load in the spleens and lungs than WT and cxcr3trans mice. In general, cxcr3-/- mice were able to control infection a little better than the other groups while CXCR3 transgenic mice were the most susceptible to fungal infection. These results suggest a role for CXCR3 during infection with H. capsulatum.
Analysis was performed with a graph pad prism software using a ManWhitney test.
Figure 5.7
A
112
B
C
113
D
Figure 5.7: Low dose infection of WT, CXCR3 transgenic and cxcr3-/- mice with H. capsulatum: 103 H. capsulatum yeast cells were used to infect WT mice (A), cxcr3-/- mice (B) and CXCR3 transgenic mice (C) and fungal burdens in the lungs were monitored for 4 weeks. At day 18, a significantly larger fungal load was detectable in the lungs of CXCR3 transgenic mice than in WT or cxcr3-/- mice. Analysis was performed with a graph pad prism software using a ManWhitney test (D)
114 Figure 5.8
Figure 5.8 – Bacterial counts in spleen and MLN of WT, cxcr3-/-, CXCR3 transgenic and CIBER mice infected with S. typhimurium: Bacterial burdens in the mesenteric lymph node show an increase in transgenic mice over WT mice and a very slight increase over cxcr3-/- mice. In the spleen, the bacterial load in transgenic mice was also higher than in WT and cxcr3-/- mice. Cxcr3-/- bacterial counts were higher than WT in the mesenteric lymph nodes but lower in the spleen.
115 Figure 5.9
Figure 5.9 – Footpad lesion sizes of WT and CXCR3 transgenic mice infected with
L. major: WT and cxcr3trans mice were infected with 2 million parasites in their right foot pads and monitored for lesion sizes for 8 weeks. Results demonstrate higher lesion sizes in WT mice than in cxcr3trans mice. This suggests that cxcr3trans mice are able to control
L. major infection better than WT matched control mice.
116
CHAPTER 6
CONCLUSIONS AND FUTURE DIRECTIONS
The chemokine receptor, CXCR3 is one of the most widely studied chemokine receptors to date. The role it plays in homeostatic processes, bacterial, fungal, viral and parasitic infections, autoimmune diseases, transplantation and cancer, makes exploration of therapeutic approaches that target CXCR3 expression and regulation a promising area for further research (Mohan and Issekutz, 2007; Watson et al., 2007; Kohler et al., 2008;
Watson et al., 2008; Feferman et al., 2009; Ni et al., 2009; Thoma et al., 2009; Trotta et al., 2009). While much is known about its role in immunity and pathology of disease processes, there still remains a great deal to be discovered and resolved. In this document we have described the generation of tools that will facilitate our further understanding of
CXCR3 and its cellular expression, regulation and function in homeostatic and disease models.
We have successfully generated the CXCR3 Ires Bicistronic EGFP Reporter (CIBER) mouse. CIBER mouse was designed as a bicistronic reporter system that enables direct visualization of CXCR3 mRNA transcript levels through EGFP fluorescence. With this tool, in vivo analysis of CXCR3 regulation, function and cellular expression can be
117 achieved. In vivo and in vitro assays revealed proportionate expression of GFP protein in relation to cellular surface CXCR3 expression. Our results indicate that CIBER mice will serve as a valuable tool in further understanding CXCR3 regulation, function and cellular expression which could potentially aid in the development of new immunotherapeutic strategies against infectious, neoplastic and autoimmune diseases.
One interesting finding observed by utilization of CIBER mice was monoallelic usage of the CXCR3 gene, suggesting that X-chromosomal inactivation (XCI) occurs in this x- linked gene. XCI is known to occur in x-linked genes to equalize gene expression between the sexes and the significance of this phenomenon occurring in immune associated genes suggests possible implications in sex associated predisposition to autoimmune diseases. To explore this possibility further, we are embarking on the generation of a CXCR3EGFP/RFP dual bicistronic reporter mouse carrying CXCR3 alleles which are linked to EGFP and RFP, respectively (Figure 6.1). By replacing the EGFP cassette with RFP in the CIBER targeting vector, electroporating the new targeting vector into ES cells and injecting positive ES cell clones into blastocyts and then foster mothers as described before, an RFP bicistronic reporter mouse will be generated which will then be crossed with the CIBER mouse to obtain a CXCR3EGFP/RFP dual reporter mouse. We expect that similar to CIBER mice, CXCR3-RFP reporter mice will contain RFP+ cells in their secondary lymphoid organs, and these cells will express CXCR3. It is difficult to predict whether CXCR3EGFP/RFP dual reporter mice will contain single (EGFP+ or RFP+) cells or dual positive cells in their organs. The latter would suggest that CXCR3 gene escapes X-chromosome inactivation in certain cells. We hypothesize that the CXCR3
118 gene escapes X-inactivation in certain immune cells in females. This will allow females to mount a more robust inflammatory response than males and will contribute to sex- associated differences in a variety of diseases. CXCR3EGFP/RFP dual reporter mice will allow us to test this hypothesis and to determine whether the CXCR3 gene escapes XCI in certain immune cells during inflammatory reactions.
Regulation of CXCR3 expression in vivo is not completely understood. The transcription factor T-bet and the protein kinase PI3Kγ have been shown to be regulators of CXCR3 expression (Matsuda et al., 2007; Barbi et al., 2008b). Most analyses of CXCR3 regulation are performed in vitro. By crossing CIBER mice with different gene knock-out mice, we can determine the roles of these genes in the regulation CXCR3 expression in vivo and in various infectious disease conditions. Some of these genes we propose to analyze include STAT1, NF B and T-bet. We believe that studying CXCR3 gene regulation using this method will enhance our knowledge of CXCR3 function and will be useful for therapeutic applications.
Real time Intra vital imaging of GFP+ cells in CIBER mice has been well demonstrated in this study. Interactions of these cells with other cells in inflammatory or infectious processes will potentially shed some new lights on the functions of these cell populations during these conditions. Using 2-photon intra-vital imaging techniques and flow cytometry, interactions of fluorescently labeled neutrophils and L. major-RFP parasites have been intensely studied, and this has revealed how these parasites exploit the hosts‟ innate immune system in the establishment of infection (Peters et al., 2008). We have
119 developed L. major-GFP parasites, which contains EGFP integrated into the parasite chromosome at the 18s rRNA locus, designed for optimal GFP expression in both amastigote and promastigote stages (Misslitz et al., 2000) (Figure 6.2). We also possess
L. major-RFP and L. donovani-RFP parasites. We are interested in looking at cellular interactions between CXCR3 expressing T cells and macrophages containing fluorescently labeled phagocytized parasites. This will allow us to fully understand if
CXCR3 expressing cells actually do physically interact with infected phagocytic cells, thereby evaluating the contribution of CXCR3 expressing T cells to immunity against
Leishmania in vivo at the cellular level.
We have also shown the successful generation of CXCR3 transgenic mice, designed for constitutive over expression of CXCR3 in mouse T cells. Further experiments showed that CXCR3 was expressed on virtually all T cells and they responded to CXCR3 ligands induced in vivo. It is our belief that our newly generated CXCR3 transgenic mouse will serve as a useful tool in further understanding the role of CXCR3 in infectious diseases and autoimmune disorders.
Preliminary results obtained with the CXCR3 transgenic mice reveal that over expression of CXCR3 in mouse T cells might contribute to susceptibility to H. capsulatum. Possible reasons why this phenotype is observed will require further investigation. Analysis of infiltrating cells, cytokines produced and any upregulation of mRNA transcripts of immune genes will provide further information on mechanisms of susceptibility to H. capsulatum by CXCR3 transgenic mice. Nevertheless, from experiments performed using
120 CIBER mice, CXCR3 transgenic mice and cxcr3-/- mice, it does seem that CXCR3 plays a role in immunity to H. capsulatum which is a novel finding in this study.
Corroborative evidence for the immunoprotective role of CXCR3 during cutaneous infection with L. major was demonstrated by preliminary experiments with CXCR3 transgenic mice, which showed reduced lesion sizes compared to WT mice. It may be that increased levels of Th1 cytokines produced by T cells migrating to the lesion contribute to increased parasite killing and reduced pathology. Kinetic analysis of cytokine profiles and parasite burdens at the lesion site coupled with the number and activation state of T cells at the lymph nodes and lesion will enable us determine immune responses of CXCR3 transgenic mice to L. major.
It is widely accepted that susceptibility of BALB/c mice to L. major is largely due to the
Th2 response mounted during the course of infection. However, further evidence indicates that genetically regulated mechanisms other than Th1/Th2 cytokine production may also control the outcome of L. major infection in BALB/c mice (Lohoff et al., 1989;
Sommer et al., 1998; Mohrs et al., 2000; Noben-Trauth, 2000). It has recently been demonstrated that BALB/c mice have a deficiency in upregulating CXCR3 on their T cells and this may contribute to L. major susceptibility observed in these mice (Barbi et al., 2008a). To further demonstrate this hypothesis, we intend to generate CXCR3 transgenic mice in the BALB/c background, and analyze immune responses of these mice to L. major infections. We anticipate that CXCR3 transgenic BALB/c mice will show increased resistance to L. major than the susceptible WT BALB/c mice.
121
Acute allograft rejection is mediated by alloreactive leukocytes (monocytes, effector and memory T cells) that infiltrate the graft through interactions between adhesion molecules and chemokines with their receptors. However, the processes by which these cells enter and persist in the graft are not fully understood. CXCR3 has long been implicated in the pathogenesis of transplant rejections, but more recently the role of CXCR3 in acute cardiac allograft rejection has been questioned (Halloran and Fairchild, 2008). The utilization of CXCR3 transgenic mice in transplantation models might shed more light on the role of CXCR3 in the rejection of allografts.
In summary, the newly generated CIBER mice and CXCR3 transgenic mice have been shown to be tremendous tools that will potentially contribute to our understanding of
CXCR3 regulation, expression and function. We believe that these genetically modified mouse strains will help to further define the role of CXCR3 in homeostatic processes as well as in immunity and pathology of a wide range of infectious, autoimmune and neoplastic diseases.
122 Figure 6.1
Figure 6.1 – Targeting vector and southern blot strategy for generating CXCR3-
RFP bicistronic reporter mice: The targeting vector will be generated by replacing the
EGFP cassette with a td tomato RFP cassette using standard cloning techniques.
Screening of targeted ES cell clones will be performed as described for the CIBER mice.
Genomic DNA from ES cell clones will be digested using BamHI and then analyzed by southern blot using probe a. Positively targeted clones are expected to have an 11 kb band size while WT mice will have a 14kb band size.
123
Figure 6.2
A B C
Figure 6.2 – L. major-GFP parasites, L. mexicana-GFP parasites and L. major-GFP parasites inside a mouse macrophage: (A) Leishmania major GFP parasites inside a mouse macrophage. L. major GFP parasites (B) and L. mexicana GFP parasites (C) both containing EGFP integrated into the parasite chromosome at the 18s rRNA locus, designed for optimal GFP expression in both amastigote and promastigote stages.
124
REFERENCES
Adachi, T., Nakanishi, T., Yumoto, H., Hirao, K., Takahashi, K., Mukai, K., Nakae, H., Matsuo, T., 2007. Caries-related bacteria and cytokines induce CXCL10 in dental pulp. Journal of Dental Research 86, 1217-1222.
Alexander, J., 1988. Sex differences and cross-immunity in DBA/2 mice infected with L. mexicana and L. major. Parasitology 96 ( Pt 2), 297-302.
Allendoerfer, R., Deepe, G.S.,Jr, 1997. Intrapulmonary response to Histoplasma capsulatum in gamma interferon knockout mice. Infection and Immunity 65, 2564- 2569.
Allendoerfer, R., Biovin, G.P., Deepe, G.S.,Jr, 1997. Modulation of immune responses in murine pulmonary histoplasmosis. The Journal of Infectious Diseases 175, 905-914.
Allendorfer, R., Brunner, G.D., Deepe, G.S.,Jr, 1999. Complex requirements for nascent and memory immunity in pulmonary histoplasmosis. Journal of Immunology (Baltimore, Md.: 1950) 162, 7389-7396.
Autenrieth, I.B., Beer, M., Bohn, E., Kaufmann, S.H., Heesemann, J., 1994. Immune responses to Yersinia enterocolitica in susceptible BALB/c and resistant C57BL/6 mice: an essential role for gamma interferon. Infection and Immunity 62, 2590-2599.
Awasthi, A., Riol-Blanco, L., Jager, A., Korn, T., Pot, C., Galileos, G., Bettelli, E., Kuchroo, V.K., Oukka, M., 2009. Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells. Journal of Immunology (Baltimore, Md.: 1950) 182, 5904-5908.
Babinet, C., Morello, D., Renard, J.P., 1989. Transgenic mice. Genome / National Research Council Canada = Genome / Conseil National De Recherches Canada 31, 938-949.
Balashov, K.E., Rottman, J.B., Weiner, H.L., Hancock, W.W., 1999. CCR5(+) and CXCR3(+) T cells are increased in multiple sclerosis and their ligands MIP-1alpha and IP-10 are expressed in demyelinating brain lesions. Proceedings of the National Academy of Sciences of the United States of America 96, 6873-6878.
125 Barbi, J., Brombacher, F., Satoskar, A.R., 2008a. T cells from Leishmania major- susceptible BALB/c mice have a defect in efficiently up-regulating CXCR3 upon activation. Journal of Immunology (Baltimore, Md.: 1950) 181, 4613-4620.
Barbi, J., Cummings, H.E., Lu, B., Oghumu, S., Ruckle, T., Rommel, C., Lafuse, W., Whitacre, C.C., Satoskar, A.R., 2008b. PI3Kgamma (PI3Kgamma) is essential for efficient induction of CXCR3 on activated T cells. Blood 112, 3048-3051.
Bassetti, M.F., White, J., Kappler, J.W., Marrack, P., 2009. Transgenic Bcl-3 slows T cell proliferation. International Immunology 21, 339-348.
Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T.B., Oukka, M., Weiner, H.L., Kuchroo, V.K., 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441, 235-238.
Bettini, M.L., Vignali, D.A., 2010. Development of thymically derived natural regulatory T cells. Annals of the New York Academy of Sciences 1183, 1-12.
Biber, K., Dijkstra, I., Trebst, C., De Groot, C.J., Ransohoff, R.M., Boddeke, H.W., 2002. Functional expression of CXCR3 in cultured mouse and human astrocytes and microglia. Neuroscience 112, 487-497.
Brett, S.J., Butler, R., 1986. Resistance to Mycobacterium lepraemurium is correlated with the capacity to generate macrophage activating factor(s) in response to mycobacterial antigens in vitro. Immunology 59, 339-345.
Brightling, C.E., Ammit, A.J., Kaur, D., Black, J.L., Wardlaw, A.J., Hughes, J.M., Bradding, P., 2005. The CXCL10/CXCR3 axis mediates human lung mast cell migration to asthmatic airway smooth muscle. American Journal of Respiratory and Critical Care Medicine 171, 1103-1108.
Brown, C.J., Carrel, L., Willard, H.F., 1997. Expression of genes from the human active and inactive X chromosomes. American Journal of Human Genetics 60, 1333-1343.
Brown, C.J., Miller, A.P., Carrel, L., Rupert, J.L., Davies, K.E., Willard, H.F., 1995. The DXS423E gene in Xp11.21 escapes X chromosome inactivation. Human Molecular Genetics 4, 251-255.
Cahalan, M.D., Parker, I., Wei, S.H., Miller, M.J., 2003. Real-time imaging of lymphocytes in vivo. Current Opinion in Immunology 15, 372-377.
Cambien, B., Karimdjee, B.F., Richard-Fiardo, P., Bziouech, H., Barthel, R., Millet, M.A., Martini, V., Birnbaum, D., Scoazec, J.Y., Abello, J., Al Saati, T., Johnson, M.G., Sullivan, T.J., Medina, J.C., Collins, T.L., Schmid-Alliana, A., Schmid-
126 Antomarchi, H., 2009. Organ-specific inhibition of metastatic colon carcinoma by CXCR3 antagonism. British Journal of Cancer 100, 1755-1764.
Campanella, G.S., Tager, A.M., El Khoury, J.K., Thomas, S.Y., Abrazinski, T.A., Manice, L.A., Colvin, R.A., Luster, A.D., 2008. Chemokine receptor CXCR3 and its ligands CXCL9 and CXCL10 are required for the development of murine cerebral malaria. Proceedings of the National Academy of Sciences of the United States of America 105, 4814-4819.
Carr, D.J., Wuest, T., Ash, J., 2008. An increase in herpes simplex virus type 1 in the anterior segment of the eye is linked to a deficiency in NK cell infiltration in mice deficient in CXCR3. Journal of Interferon & Cytokine Research : The Official Journal of the International Society for Interferon and Cytokine Research 28, 245- 251.
Carrel, L., Willard, H.F., 1999. Heterogeneous gene expression from the inactive X chromosome: an X-linked gene that escapes X inactivation in some human cell lines but is inactivated in others. Proceedings of the National Academy of Sciences of the United States of America 96, 7364-7369.
Chakravarty, S.D., Xu, J., Lu, B., Gerard, C., Flynn, J., Chan, J., 2007. The chemokine receptor CXCR3 attenuates the control of chronic Mycobacterium tuberculosis infection in BALB/c mice. Journal of Immunology (Baltimore, Md.: 1950) 178, 1723-1735.
Chen, S.C., de Groot, M., Kinsley, D., Laverty, M., McClanahan, T., Arreaza, M., Gustafson, E.L., Teunissen, M.B., de Rie, M.A., Fine, J.S., Kraan, M., 2010. Expression of chemokine receptor CXCR3 by lymphocytes and plasmacytoid dendritic cells in human psoriatic lesions. Archives of Dermatological Research 302, 113-123.
Clay, B.S., Shilling, R.A., Bandukwala, H.S., Moore, T.V., Cannon, J.L., Welcher, A.A., Weinstock, J.V., Sperling, A.I., 2009. Inducible costimulator expression regulates the magnitude of Th2-mediated airway inflammation by regulating the number of Th2 cells. PloS One 4, e7525.
Cole, K.E., Strick, C.A., Paradis, T.J., Ogborne, K.T., Loetscher, M., Gladue, R.P., Lin, W., Boyd, J.G., Moser, B., Wood, D.E., Sahagan, B.G., Neote, K., 1998. Interferon- inducible T cell alpha chemoattractant (I-TAC): a novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. The Journal of Experimental Medicine 187, 2009-2021.
Datta, D., Contreras, A.G., Grimm, M., Waaga-Gasser, A.M., Briscoe, D.M., Pal, S., 2008. Calcineurin inhibitors modulate CXCR3 splice variant expression and mediate
127 renal cancer progression. Journal of the American Society of Nephrology : JASN 19, 2437-2446.
Deepe, G.S.,Jr, 2000. Immune response to early and late Histoplasma capsulatum infections. Current Opinion in Microbiology 3, 359-362.
Del Rio, L., Bennouna, S., Salinas, J., Denkers, E.Y., 2001. CXCR2 deficiency confers impaired neutrophil recruitment and increased susceptibility during Toxoplasma gondii infection. Journal of Immunology (Baltimore, Md.: 1950) 167, 6503-6509.
DiPaolo, R.J., Shevach, E.M., 2009. CD4+ T-cell development in a mouse expressing a transgenic TCR derived from a Treg. European Journal of Immunology 39, 234-240.
Drennan, M.B., Franki, A.S., Dewint, P., Van Beneden, K., Seeuws, S., van de Pavert, S.A., Reilly, E.C., Verbruggen, G., Lane, T.E., Mebius, R.E., Deforce, D., Elewaut, D., 2009. Cutting edge: the chemokine receptor CXCR3 retains invariant NK T cells in the thymus. Journal of Immunology (Baltimore, Md.: 1950) 183, 2213-2216.
Ehlert, J.E., Addison, C.A., Burdick, M.D., Kunkel, S.L., Strieter, R.M., 2004. Identification and partial characterization of a variant of human CXCR3 generated by posttranscriptional exon skipping. Journal of Immunology (Baltimore, Md.: 1950) 173, 6234-6240.
Enghard, P., Humrich, J.Y., Rudolph, B., Rosenberger, S., Biesen, R., Kuhn, A., Manz, R., Hiepe, F., Radbruch, A., Burmester, G.R., Riemekasten, G., 2009. CXCR3+CD4+ T cells are enriched in inflamed kidneys and urine and provide a new biomarker for acute nephritis flares in systemic lupus erythematosus patients. Arthritis and Rheumatism 60, 199-206.
Enk, A.H., 1997. Allergic contact dermatitis: understanding the immune response and potential for targeted therapy using cytokines. Molecular Medicine Today 3, 423- 428.
Farber, J.M., 1990. A macrophage mRNA selectively induced by gamma-interferon encodes a member of the platelet factor 4 family of cytokines. Proceedings of the National Academy of Sciences of the United States of America 87, 5238-5242.
Feferman, T., Maiti, P.K., Berrih-Aknin, S., Bismuth, J., Bidault, J., Fuchs, S., Souroujon, M.C., 2005. Overexpression of IFN-induced protein 10 and its receptor CXCR3 in myasthenia gravis. Journal of Immunology (Baltimore, Md.: 1950) 174, 5324-5331.
Feferman, T., Aricha, R., Mizrachi, K., Geron, E., Alon, R., Souroujon, M.C., Fuchs, S., 2009. Suppression of experimental autoimmune myasthenia gravis by inhibiting the
128 signaling between IFN-gamma inducible protein 10 (IP-10) and its receptor CXCR3. Journal of Neuroimmunology 209, 87-95.
Finotto, S., Siebler, J., Hausding, M., Schipp, M., Wirtz, S., Klein, S., Protschka, M., Doganci, A., Lehr, H.A., Trautwein, C., Khosravi-Far, R., Strand, D., Lohse, A., Galle, P.R., Blessing, M., Neurath, M.F., 2004. Severe hepatic injury in interleukin 18 (IL-18) transgenic mice: a key role for IL-18 in regulating hepatocyte apoptosis in vivo. Gut 53, 392-400.
Fontenot, J.D., Dooley, J.L., Farr, A.G., Rudensky, A.Y., 2005. Developmental regulation of Foxp3 expression during ontogeny. The Journal of Experimental Medicine 202, 901-906.
Fulton, A.M., 2009. The chemokine receptors CXCR4 and CXCR3 in cancer. Current Oncology Reports 11, 125-131.
Gacci, M., Serni, S., Lapini, A., Vittori, G., Alessandrini, M., Nesi, G., Palli, D., Carini, M., 2009. CXCR3-B expression correlates with tumor necrosis extension in renal cell carcinoma. The Journal of Urology 181, 843-848.
Galkina, E., Tanousis, K., Preece, G., Tolaini, M., Kioussis, D., Florey, O., Haskard, D.O., Tedder, T.F., Ager, A., 2003. L-selectin shedding does not regulate constitutive T cell trafficking but controls the migration pathways of antigen- activated T lymphocytes. The Journal of Experimental Medicine 198, 1323-1335.
Gessner, A., Mohrs, K., Mohrs, M., 2005. Mast cells, basophils, and eosinophils acquire constitutive IL-4 and IL-13 transcripts during lineage differentiation that are sufficient for rapid cytokine production. Journal of Immunology (Baltimore, Md.: 1950) 174, 1063-1072.
Goldberg, S.H., van der Meer, P., Hesselgesser, J., Jaffer, S., Kolson, D.L., Albright, A.V., Gonzalez-Scarano, F., Lavi, E., 2001. CXCR3 expression in human central nervous system diseases. Neuropathology and Applied Neurobiology 27, 127-138.
Gomez, F.J., Cain, J.A., Gibbons, R., Allendoerfer, R., Deepe, G.S.,Jr, 1998. Vbeta4(+) T cells promote clearance of infection in murine pulmonary histoplasmosis. The Journal of Clinical Investigation 102, 984-995.
Greenblatt, H.C., Rosenstreich, D.L., 1984. Trypanosoma rhodesiense infection in mice: sex dependence of resistance. Infection and Immunity 43, 337-340.
Gu, L., Tseng, S., Horner, R.M., Tam, C., Loda, M., Rollins, B.J., 2000. Control of TH2 polarization by the chemokine monocyte chemoattractant protein-1. Nature 404, 407-411.
129 Halloran, P.F., Fairchild, R.L., 2008. The puzzling role of CXCR3 and its ligands in organ allograft rejection. American Journal of Transplantation : Official Journal of the American Society of Transplantation and the American Society of Transplant Surgeons 8, 1578-1579.
Hancock, G.E., Schaedler, R.W., MacDonald, T.T., 1988. Multigenic control of resistance to Yersinia enterocolitica in inbred strains of mice. Infection and Immunity 56, 532-533.
Hancock, W.W., Lu, B., Gao, W., Csizmadia, V., Faia, K., King, J.A., Smiley, S.T., Ling, M., Gerard, N.P., Gerard, C., 2000. Requirement of the chemokine receptor CXCR3 for acute allograft rejection. The Journal of Experimental Medicine 192, 1515-1520.
Haskova, Z., Izawa, A., Contreras, A.G., Flynn, E., Boulday, G., Briscoe, D.M., 2007. Organ-specific differences in the function of MCP-1 and CXCR3 during cardiac and skin allograft rejection. Transplantation 83, 1595-1601.
Hataye, J., Moon, J.J., Khoruts, A., Reilly, C., Jenkins, M.K., 2006. Naive and memory CD4+ T cell survival controlled by clonal abundance. Science (New York, N.Y.) 312, 114-116.
He, S., Cao, Q., Qiu, Y., Mi, J., Zhang, J.Z., Jin, M., Ge, H., Emerson, S.G., Zhang, Y., Zhang, Y., 2008. A new approach to the blocking of alloreactive T cell-mediated graft-versus-host disease by in vivo administration of anti-CXCR3 neutralizing antibody. Journal of Immunology (Baltimore, Md.: 1950) 181, 7581-7592.
Henneken, M., Dorner, T., Burmester, G.R., Berek, C., 2005. Differential expression of chemokine receptors on peripheral blood B cells from patients with rheumatoid arthritis and systemic lupus erythematosus. Arthritis Research & Therapy 7, R1001- 13.
Hess, J., Ladel, C., Miko, D., Kaufmann, S.H., 1996. Salmonella typhimurium aroA- infection in gene-targeted immunodeficient mice: major role of CD4+ TCR-alpha beta cells and IFN-gamma in bacterial clearance independent of intracellular location. Journal of Immunology (Baltimore, Md.: 1950) 156, 3321-3326.
Hsieh, M.F., Lai, S.L., Chen, J.P., Sung, J.M., Lin, Y.L., Wu-Hsieh, B.A., Gerard, C., Luster, A., Liao, F., 2006. Both CXCR3 and CXCL10/IFN-inducible protein 10 are required for resistance to primary infection by dengue virus. Journal of Immunology (Baltimore, Md.: 1950) 177, 1855-1863.
Huehn, J., Siegmund, K., Lehmann, J.C., Siewert, C., Haubold, U., Feuerer, M., Debes, G.F., Lauber, J., Frey, O., Przybylski, G.K., Niesner, U., de la Rosa, M., Schmidt, C.A., Brauer, R., Buer, J., Scheffold, A., Hamann, A., 2004. Developmental stage,
130 phenotype, and migration distinguish naive- and effector/memory-like CD4+ regulatory T cells. The Journal of Experimental Medicine 199, 303-313.
Inston, N., Drayson, M., Ready, A., Cockwell, P., 2007. Serial changes in the expression of CXCR3 and CCR5 on peripheral blood lymphocytes following human renal transplantation. Experimental and Clinical Transplantation : Official Journal of the Middle East Society for Organ Transplantation 5, 638-642.
Jiankuo, M., Xingbing, W., Baojun, H., Xiongwin, W., Zhuoya, L., Ping, X., Yong, X., Anting, L., Chunsong, H., Feili, G., Jinquan, T., 2003. Peptide nucleic acid antisense prolongs skin allograft survival by means of blockade of CXCR3 expression directing T cells into graft. Journal of Immunology (Baltimore, Md.: 1950) 170, 1556-1565.
Jones, D., Benjamin, R.J., Shahsafaei, A., Dorfman, D.M., 2000. The chemokine receptor CXCR3 is expressed in a subset of B-cell lymphomas and is a marker of B-cell chronic lymphocytic leukemia. Blood 95, 627-632.
Jones, E., Price, D.A., Dahm-Vicker, M., Cerundolo, V., Klenerman, P., Gallimore, A., 2003. The influence of macrophage inflammatory protein-1alpha on protective immunity mediated by antiviral cytotoxic T cells. Immunology 109, 68-75.
Jones, R.G., Parsons, M., Bonnard, M., Chan, V.S., Yeh, W.C., Woodgett, J.R., Ohashi, P.S., 2000. Protein kinase B regulates T lymphocyte survival, nuclear factor kappaB activation, and Bcl-X(L) levels in vivo. The Journal of Experimental Medicine 191, 1721-1734.
Kamanaka, M., Kim, S.T., Wan, Y.Y., Sutterwala, F.S., Lara-Tejero, M., Galan, J.E., Harhaj, E., Flavell, R.A., 2006. Expression of interleukin-10 in intestinal lymphocytes detected by an interleukin-10 reporter knockin tiger mouse. Immunity 25, 941-952.
Kast, R.E., 2008. Minocycline in cerebral malaria. Journal of Neuroscience Research 86, 3257.
Kawada, K., Sonoshita, M., Sakashita, H., Takabayashi, A., Yamaoka, Y., Manabe, T., Inaba, K., Minato, N., Oshima, M., Taketo, M.M., 2004. Pivotal role of CXCR3 in melanoma cell metastasis to lymph nodes. Cancer Research 64, 4010-4017.
Kawada, K., Hosogi, H., Sonoshita, M., Sakashita, H., Manabe, T., Shimahara, Y., Sakai, Y., Takabayashi, A., Oshima, M., Taketo, M.M., 2007. Chemokine receptor CXCR3 promotes colon cancer metastasis to lymph nodes. Oncogene 26, 4679-4688.
131 Keir, M.E., Latchman, Y.E., Freeman, G.J., Sharpe, A.H., 2005. Programmed death-1 (PD-1):PD-ligand 1 interactions inhibit TCR-mediated positive selection of thymocytes. Journal of Immunology (Baltimore, Md.: 1950) 175, 7372-7379.
Khodoun, M.V., Orekhova, T., Potter, C., Morris, S., Finkelman, F.D., 2004. Basophils initiate IL-4 production during a memory T-dependent response. The Journal of Experimental Medicine 200, 857-870.
Klatte, T., Seligson, D.B., Leppert, J.T., Riggs, S.B., Yu, H., Zomorodian, N., Kabbinavar, F.F., Strieter, R.M., Belldegrun, A.S., Pantuck, A.J., 2008. The chemokine receptor CXCR3 is an independent prognostic factor in patients with localized clear cell renal cell carcinoma. The Journal of Urology 179, 61-66.
Koch, M.A., Tucker-Heard, G., Perdue, N.R., Killebrew, J.R., Urdahl, K.B., Campbell, D.J., 2009. The transcription factor T-bet controls regulatory T cell homeostasis and function during type 1 inflammation. Nature Immunology 10, 595-602.
Kohler, R.E., Comerford, I., Townley, S., Haylock-Jacobs, S., Clark-Lewis, I., McColl, S.R., 2008. Antagonism of the chemokine receptors CXCR3 and CXCR4 reduces the pathology of experimental autoimmune encephalomyelitis. Brain Pathology (Zurich, Switzerland) 18, 504-516.
Kohlmeier, J.E., Cookenham, T., Miller, S.C., Roberts, A.D., Christensen, J.P., Thomsen, A.R., Woodland, D.L., 2009. CXCR3 directs antigen-specific effector CD4+ T cell migration to the lung during parainfluenza virus infection. Journal of Immunology (Baltimore, Md.: 1950) 183, 4378-4384.
Komatsu, K., Miyazaki, D., Morohoshi, K., Kuo, C.H., Kakimaru-Hasegawa, A., Komatsu, N., Namba, S., Haino, M., Matsushima, K., Inoue, Y., 2008. Pathogenesis of herpetic stromal keratitis in CCR5- and/or CXCR3-deficient mice. Current Eye Research 33, 736-749.
Korn, T., Oukka, M., 2007. Dynamics of antigen-specific regulatory T-cells in the context of autoimmunity. Seminars in Immunology 19, 272-278.
Kroemer, A., Xiao, X., Vu, M.D., Gao, W., Minamimura, K., Chen, M., Maki, T., Li, X.C., 2007. OX40 controls functionally different T cell subsets and their resistance to depletion therapy. Journal of Immunology (Baltimore, Md.: 1950) 179, 5584- 5591.
Kwun, J., Hazinedaroglu, S.M., Schadde, E., Kayaoglu, H.A., Fechner, J., Hu, H.Z., Roenneburg, D., Torrealba, J., Shiao, L., Hong, X., Peng, R., Szewczyk, J.W., Sullivan, K.A., DeMartino, J., Knechtle, S.J., 2008. Unaltered graft survival and intragraft lymphocytes infiltration in the cardiac allograft of Cxcr3-/- mouse recipients. American Journal of Transplantation : Official Journal of the American
132 Society of Transplantation and the American Society of Transplant Surgeons 8, 1593-1603.
Lacotte, S., Brun, S., Muller, S., Dumortier, H., 2009. CXCR3, inflammation, and autoimmune diseases. Annals of the New York Academy of Sciences 1173, 310-317.
Larrubia, J.R., Calvino, M., Benito, S., Sanz-de-Villalobos, E., Perna, C., Perez-Hornedo, J., Gonzalez-Mateos, F., Garcia-Garzon, S., Bienvenido, A., Parra, T., 2007. The role of CCR5/CXCR3 expressing CD8+ cells in liver damage and viral control during persistent hepatitis C virus infection. Journal of Hepatology 47, 632-641.
Lasagni, L., Francalanci, M., Annunziato, F., Lazzeri, E., Giannini, S., Cosmi, L., Sagrinati, C., Mazzinghi, B., Orlando, C., Maggi, E., Marra, F., Romagnani, S., Serio, M., Romagnani, P., 2003. An alternatively spliced variant of CXCR3 mediates the inhibition of endothelial cell growth induced by IP-10, Mig, and I-TAC, and acts as functional receptor for platelet factor 4. The Journal of Experimental Medicine 197, 1537-1549.
Lepej, S.Z., Rode, O.D., Jeren, T., Vince, A., Remenar, A., Barsic, B., 2005. Increased expression of CXCR3 and CCR5 on memory CD4+ T-cells migrating into the cerebrospinal fluid of patients with neuroborreliosis: the role of CXCL10 and CXCL11. Journal of Neuroimmunology 163, 128-134.
Li, N., Carrel, L., 2008. Escape from X chromosome inactivation is an intrinsic property of the Jarid1c locus. Proceedings of the National Academy of Sciences of the United States of America 105, 17055-17060.
Lindell, D.M., Lane, T.E., Lukacs, N.W., 2008. CXCL10/CXCR3-mediated responses promote immunity to respiratory syncytial virus infection by augmenting dendritic cell and CD8(+) T cell efficacy. European Journal of Immunology 38, 2168-2179.
Liu, L., Callahan, M.K., Huang, D., Ransohoff, R.M., 2005. Chemokine receptor CXCR3: an unexpected enigma. Current Topics in Developmental Biology 68, 149- 181.
Liu, L., Huang, D., Matsui, M., He, T.T., Hu, T., Demartino, J., Lu, B., Gerard, C., Ransohoff, R.M., 2006. Severe disease, unaltered leukocyte migration, and reduced IFN-gamma production in CXCR3-/- mice with experimental autoimmune encephalomyelitis. Journal of Immunology (Baltimore, Md.: 1950) 176, 4399-4409.
Lleo, A., Battezzati, P.M., Selmi, C., Gershwin, M.E., Podda, M., 2008. Is autoimmunity a matter of sex? Autoimmunity Reviews 7, 626-630.
133 Lohoff, M., Sommer, F., Solbach, W., Rollinghoff, M., 1989. Coexistence of antigen- specific TH1 and TH2 cells in genetically susceptible BALB/c mice infected with Leishmania major. Immunobiology 179, 412-421.
Luster, A.D., Unkeless, J.C., Ravetch, J.V., 1985. Gamma-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature 315, 672-676.
Ma, X., Norsworthy, K., Kundu, N., Rodgers, W.H., Gimotty, P.A., Goloubeva, O., Lipsky, M., Li, Y., Holt, D., Fulton, A., 2009. CXCR3 expression is associated with poor survival in breast cancer and promotes metastasis in a murine model. Molecular Cancer Therapeutics 8, 490-498.
Maekawa, S., Iwasaki, A., Shirakusa, T., Kawakami, T., Yanagisawa, J., Tanaka, T., Shibaguchi, H., Kinugasa, T., Kuroki, M., Kuroki, M., 2008. Association between the expression of chemokine receptors CCR7 and CXCR3, and lymph node metastatic potential in lung adenocarcinoma. Oncology Reports 19, 1461-1468.
Martinez-Caceres, E.M., Espejo, C., Brieva, L., Pericot, I., Tintore, M., Saez-Torres, I., Montalban, X., 2002. Expression of chemokine receptors in the different clinical forms of multiple sclerosis. Multiple Sclerosis (Houndmills, Basingstoke, England) 8, 390-395.
Mastroeni, P., Villarreal-Ramos, B., Hormaeche, C.E., 1992. Role of T cells, TNF alpha and IFN gamma in recall of immunity to oral challenge with virulent salmonellae in mice vaccinated with live attenuated aro- Salmonella vaccines. Microbial Pathogenesis 13, 477-491.
Mastroeni, P., Harrison, J.A., Chabalgoity, J.A., Hormaeche, C.E., 1996. Effect of interleukin 12 neutralization on host resistance and gamma interferon production in mouse typhoid. Infection and Immunity 64, 189-196.
Matsuda, J.L., George, T.C., Hagman, J., Gapin, L., 2007. Temporal dissection of T-bet functions. Journal of Immunology (Baltimore, Md.: 1950) 178, 3457-3465.
Maynard, C.L., Harrington, L.E., Janowski, K.M., Oliver, J.R., Zindl, C.L., Rudensky, A.Y., Weaver, C.T., 2007. Regulatory T cells expressing interleukin 10 develop from Foxp3+ and Foxp3- precursor cells in the absence of interleukin 10. Nature Immunology 8, 931-941.
McDonald, F., Mohrs, M., Brewer, J., 2006. Using bicistronic IL-4 reporter mice to identify IL-4 expressing cells following immunisation with aluminium adjuvant. Vaccine 24, 5393-5399.
134 McNeill, A., Spittle, E., Backstrom, B.T., 2007. Partial depletion of CD69low-expressing natural regulatory T cells with the anti-CD25 monoclonal antibody PC61. Scandinavian Journal of Immunology 65, 63-69.
Meiser, A., Mueller, A., Wise, E.L., McDonagh, E.M., Petit, S.J., Saran, N., Clark, P.C., Williams, T.J., Pease, J.E., 2008. The chemokine receptor CXCR3 is degraded following internalization and is replenished at the cell surface by de novo synthesis of receptor. Journal of Immunology (Baltimore, Md.: 1950) 180, 6713-6724.
Mellado, M., Carrasco, Y.R., 2008. Imaging techniques: new insights into chemokine/chemokine receptor biology at the immune system. Pharmacology & Therapeutics 119, 24-32.
Meller, S., Lauerma, A.I., Kopp, F.M., Winterberg, F., Anthoni, M., Muller, A., Gombert, M., Haahtela, A., Alenius, H., Rieker, J., Dieu-Nosjean, M.C., Kubitza, R.C., Gleichmann, E., Ruzicka, T., Zlotnik, A., Homey, B., 2007. Chemokine responses distinguish chemical-induced allergic from irritant skin inflammation: memory T cells make the difference. The Journal of Allergy and Clinical Immunology 119, 1470-1480.
Miller, M.J., Wei, S.H., Cahalan, M.D., Parker, I., 2003. Autonomous T cell trafficking examined in vivo with intravital two-photon microscopy. Proceedings of the National Academy of Sciences of the United States of America 100, 2604-2609.
Misslitz, A., Mottram, J.C., Overath, P., Aebischer, T., 2000. Targeted integration into a rRNA locus results in uniform and high level expression of transgenes in Leishmania amastigotes. Molecular and Biochemical Parasitology 107, 251-261.
Mittrucker, H.W., Kaufmann, S.H., 2000. Immune response to infection with Salmonella typhimurium in mice. Journal of Leukocyte Biology 67, 457-463.
Miu, J., Mitchell, A.J., Muller, M., Carter, S.L., Manders, P.M., McQuillan, J.A., Saunders, B.M., Ball, H.J., Lu, B., Campbell, I.L., Hunt, N.H., 2008. Chemokine gene expression during fatal murine cerebral malaria and protection due to CXCR3 deficiency. Journal of Immunology (Baltimore, Md.: 1950) 180, 1217-1230.
Mohan, K., Issekutz, T.B., 2007. Blockade of chemokine receptor CXCR3 inhibits T cell recruitment to inflamed joints and decreases the severity of adjuvant arthritis. Journal of Immunology (Baltimore, Md.: 1950) 179, 8463-8469.
Mohrs, K., Harris, D.P., Lund, F.E., Mohrs, M., 2005. Systemic dissemination and persistence of Th2 and type 2 cells in response to infection with a strictly enteric nematode parasite. Journal of Immunology (Baltimore, Md.: 1950) 175, 5306-5313.
135 Mohrs, M., Holscher, C., Brombacher, F., 2000. Interleukin-4 receptor alpha-deficient BALB/c mice show an unimpaired T helper 2 polarization in response to Leishmania major infection. Infection and Immunity 68, 1773-1780.
Mohrs, M., Shinkai, K., Mohrs, K., Locksley, R.M., 2001. Analysis of type 2 immunity in vivo with a bicistronic IL-4 reporter. Immunity 15, 303-311.
Mok, C.L., Gil-Gomez, G., Williams, O., Coles, M., Taga, S., Tolaini, M., Norton, T., Kioussis, D., Brady, H.J., 1999. Bad can act as a key regulator of T cell apoptosis and T cell development. The Journal of Experimental Medicine 189, 575-586.
Monteagudo, C., Martin, J.M., Jorda, E., Llombart-Bosch, A., 2007. CXCR3 chemokine receptor immunoreactivity in primary cutaneous malignant melanoma: correlation with clinicopathological prognostic factors. Journal of Clinical Pathology 60, 596- 599.
Moon, J.J., McSorley, S.J., 2009. Tracking the dynamics of salmonella specific T cell responses. Current Topics in Microbiology and Immunology 334, 179-198.
Moon, J.J., Chu, H.H., Pepper, M., McSorley, S.J., Jameson, S.C., Kedl, R.M., Jenkins, M.K., 2007. Naive CD4(+) T cell frequency varies for different epitopes and predicts repertoire diversity and response magnitude. Immunity 27, 203-213.
Moore, M.L., Newcomb, D.C., Parekh, V.V., Van Kaer, L., Collins, R.D., Zhou, W., Goleniewska, K., Chi, M.H., Mitchell, D., Boyce, J.A., Durbin, J.E., Sturkie, C., Peebles, R.S.,Jr, 2009. STAT1 negatively regulates lung basophil IL-4 expression induced by respiratory syncytial virus infection. Journal of Immunology (Baltimore, Md.: 1950) 183, 2016-2026.
Moser, B., Willimann, K., 2004. Chemokines: role in inflammation and immune surveillance. Annals of the Rheumatic Diseases 63 Suppl 2, ii84-ii89.
Mountford, P.S., Smith, A.G., 1995. Internal ribosome entry sites and dicistronic RNAs in mammalian transgenesis. Trends in Genetics : TIG 11, 179-184.
Mountz, J.D., Zhou, T., Johnson, L., 1990. Production of transgenic mice and application to immunology and autoimmunity. The American Journal of the Medical Sciences 300, 322-329.
Muller, K., Bischof, S., Sommer, F., Lohoff, M., Solbach, W., Laskay, T., 2003. Differential production of macrophage inflammatory protein 1gamma (MIP- 1gamma), lymphotactin, and MIP-2 by CD4(+) Th subsets polarized in vitro and in vivo. Infection and Immunity 71, 6178-6183.
136 Muller, M., Carter, S.L., Hofer, M.J., Manders, P., Getts, D.R., Getts, M.T., Dreykluft, A., Lu, B., Gerard, C., King, N.J., Campbell, I.L., 2007. CXCR3 signaling reduces the severity of experimental autoimmune encephalomyelitis by controlling the parenchymal distribution of effector and regulatory T cells in the central nervous system. Journal of Immunology (Baltimore, Md.: 1950) 179, 2774-2786.
Nakajima, C., Mukai, T., Yamaguchi, N., Morimoto, Y., Park, W.R., Iwasaki, M., Gao, P., Ono, S., Fujiwara, H., Hamaoka, T., 2002. Induction of the chemokine receptor CXCR3 on TCR-stimulated T cells: dependence on the release from persistent TCR- triggering and requirement for IFN-gamma stimulation. European Journal of Immunology 32, 1792-1801.
Nanki, T., Takada, K., Komano, Y., Morio, T., Kanegane, H., Nakajima, A., Lipsky, P.E., Miyasaka, N., 2009. Chemokine receptor expression and functional effects of chemokines on B cells: implication in the pathogenesis of rheumatoid arthritis. Arthritis Research & Therapy 11, R149.
Newton, P., O'Boyle, G., Jenkins, Y., Ali, S., Kirby, J.A., 2009. T cell extravasation: demonstration of synergy between activation of CXCR3 and the T cell receptor. Molecular Immunology 47, 485-492.
Ni, J., Zhu, Y.N., Zhong, X.G., Ding, Y., Hou, L.F., Tong, X.K., Tang, W., Ono, S., Yang, Y.F., Zuo, J.P., 2009. The chemokine receptor antagonist, TAK-779, decreased experimental autoimmune encephalomyelitis by reducing inflammatory cell migration into the central nervous system, without affecting T cell function. British Journal of Pharmacology 158, 2046-2056.
Nishikomori, R., Ehrhardt, R.O., Strober, W., 2000. T helper type 2 cell differentiation occurs in the presence of interleukin 12 receptor beta2 chain expression and signaling. The Journal of Experimental Medicine 191, 847-858.
Noben-Trauth, N., 2000. Susceptibility to Leishmania major infection in the absence of IL-4. Immunology Letters 75, 41-44.
Oghumu, S.O., Lezama-Davila, C.M., Isaac-Marquez, A.P., Satoskar, A.R., 2010. Role of chemokines in regulation of immunity against leishmaniasis. Experimental Parasitology .
Ozcelik, T., 2008. X chromosome inactivation and female predisposition to autoimmunity. Clinical Reviews in Allergy & Immunology 34, 348-351.
Paul, C., Shalala, K., Warren, R., Smith, R., 1985. Adoptive transfer of murine host protection to salmonellosis with T-cell growth factor-dependent, Salmonella-specific T-cell lines. Infection and Immunity 48, 40-43.
137 Paul, C.C., Norris, K., Warren, R., Smith, R.A., 1988. Transfer of murine host protection by using interleukin-2-dependent T-lymphocyte lines. Infection and Immunity 56, 2189-2192.
Pelletier, J., Sonenberg, N., 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334, 320-325.
Perney, P., Turriere, C., Portales, P., Rigole, H., Psomas, C., Blanc, F., Clot, J., Corbeau, P., 2009. CXCR3 expression on peripheral CD4+ T cells as a predictive marker of response to treatment in chronic hepatitis C. Clinical Immunology (Orlando, Fla.) 132, 55-62.
Peters, N.C., Egen, J.G., Secundino, N., Debrabant, A., Kimblin, N., Kamhawi, S., Lawyer, P., Fay, M.P., Germain, R.N., Sacks, D., 2008. In vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted by sand flies. Science (New York, N.Y.) 321, 970-974.
Petters, R.M., 1987. Transgenic mice in immunological research. Veterinary Immunology and Immunopathology 17, 267-278.
Piper, K.P., Horlock, C., Curnow, S.J., Arrazi, J., Nicholls, S., Mahendra, P., Craddock, C., Moss, P.A., 2007. CXCL10-CXCR3 interactions play an important role in the pathogenesis of acute graft-versus-host disease in the skin following allogeneic stem-cell transplantation. Blood 110, 3827-3832.
Pradelli, E., Karimdjee-Soilihi, B., Michiels, J.F., Ricci, J.E., Millet, M.A., Vandenbos, F., Sullivan, T.J., Collins, T.L., Johnson, M.G., Medina, J.C., Kleinerman, E.S., Schmid-Alliana, A., Schmid-Antomarchi, H., 2009. Antagonism of chemokine receptor CXCR3 inhibits osteosarcoma metastasis to lungs. International Journal of Cancer.Journal International Du Cancer 125, 2586-2594.
Ravindran, R., Foley, J., Stoklasek, T., Glimcher, L.H., McSorley, S.J., 2005. Expression of T-bet by CD4 T cells is essential for resistance to Salmonella infection. Journal of Immunology (Baltimore, Md.: 1950) 175, 4603-4610.
Roberts, C.W., Walker, W., Alexander, J., 2001. Sex-associated hormones and immunity to protozoan parasites. Clinical Microbiology Reviews 14, 476-488.
Rodriguez-Sosa, M., Rosas, L.E., Terrazas, L.I., Lu, B., Gerard, C., Satoskar, A.R., 2003. CC chemokine receptor 1 enhances susceptibility to Leishmania major during early phase of infection. Immunology and Cell Biology 81, 114-120.
Roep, B.O., Kleijwegt, F.S., van Halteren, A.G., Bonato, V., Boggi, U., Vendrame, F., Marchetti, P., Dotta, F., 2010. Islet inflammation and CXCL10 in recent-onset type 1 diabetes. Clinical and Experimental Immunology 159, 338-343.
138 Romagnani, P., Lasagni, L., Annunziato, F., Serio, M., Romagnani, S., 2004. CXC chemokines: the regulatory link between inflammation and angiogenesis. Trends in Immunology 25, 201-209.
Romagnani, P., Annunziato, F., Lasagni, L., Lazzeri, E., Beltrame, C., Francalanci, M., Uguccioni, M., Galli, G., Cosmi, L., Maurenzig, L., Baggiolini, M., Maggi, E., Romagnani, S., Serio, M., 2001. Cell cycle-dependent expression of CXC chemokine receptor 3 by endothelial cells mediates angiostatic activity. The Journal of Clinical Investigation 107, 53-63.
Rosas, L.E., Barbi, J., Lu, B., Fujiwara, Y., Gerard, C., Sanders, V.M., Satoskar, A.R., 2005. CXCR3-/- mice mount an efficient Th1 response but fail to control Leishmania major infection. European Journal of Immunology 35, 515-523.
Rosenblum, J.M., Zhang, Q.W., Siu, G., Collins, T.L., Sullivan, T., Dairaghi, D.J., Medina, J.C., Fairchild, R.L., 2009. CXCR3 antagonism impairs the development of donor-reactive, IFN-gamma-producing effectors and prolongs allograft survival. Transplantation 87, 360-369.
Rot, A., von Andrian, U.H., 2004. Chemokines in innate and adaptive host defense: basic chemokinese grammar for immune cells. Annual Review of Immunology 22, 891- 928.
Rottman, J.B., Smith, T.L., Ganley, K.G., Kikuchi, T., Krueger, J.G., 2001. Potential role of the chemokine receptors CXCR3, CCR4, and the integrin alphaEbeta7 in the pathogenesis of psoriasis vulgaris. Laboratory Investigation; a Journal of Technical Methods and Pathology 81, 335-347.
Sacks, D., Noben-Trauth, N., 2002. The immunology of susceptibility and resistance to Leishmania major in mice. Nature Reviews.Immunology 2, 845-858.
Sarris, M., Betz, A.G., 2009. Shine a light: imaging the immune system. European Journal of Immunology 39, 1188-1202.
Satoskar, A., Alexander, J., 1995. Sex-determined susceptibility and differential IFN- gamma and TNF-alpha mRNA expression in DBA/2 mice infected with Leishmania mexicana. Immunology 84, 1-4.
Satoskar, A., Al-Quassi, H.H., Alexander, J., 1998. Sex-determined resistance against Leishmania mexicana is associated with the preferential induction of a Th1-like response and IFN-gamma production by female but not male DBA/2 mice. Immunology and Cell Biology 76, 159-166.
139 Schnickel, G.T., Hsieh, G.R., Garcia, C., Shefizadeh, A., Fishbein, M.C., Ardehali, A., 2006. Role of CXCR3 and CCR5 in allograft rejection. Transplantation Proceedings 38, 3221-3224.
Schnickel, G.T., Bastani, S., Hsieh, G.R., Shefizadeh, A., Bhatia, R., Fishbein, M.C., Belperio, J., Ardehali, A., 2008. Combined CXCR3/CCR5 blockade attenuates acute and chronic rejection. Journal of Immunology (Baltimore, Md.: 1950) 180, 4714- 4721.
Schramm, G., Mohrs, K., Wodrich, M., Doenhoff, M.J., Pearce, E.J., Haas, H., Mohrs, M., 2007. Cutting edge: IPSE/alpha-1, a glycoprotein from Schistosoma mansoni eggs, induces IgE-dependent, antigen-independent IL-4 production by murine basophils in vivo. Journal of Immunology (Baltimore, Md.: 1950) 178, 6023-6027.
Scott, P., 1991. IFN-gamma modulates the early development of Th1 and Th2 responses in a murine model of cutaneous leishmaniasis. Journal of Immunology (Baltimore, Md.: 1950) 147, 3149-3155.
Shatkin, A.J., 1976. Capping of eucaryotic mRNAs. Cell 9, 645-653.
Shi, M., Guo, R.P., Zhang, C.Q., Zhong, C., Lin, X.J., Li, J.Q., 2006. Expression of CXCR3 in hepatocellular carcinoma. Ai Zheng = Aizheng = Chinese Journal of Cancer 25, 1232-1237.
Sommer, F., Meixner, M., Mannherz, M., Ogilvie, A.L., Rollinghoff, M., Lohoff, M., 1998. Analysis of cytokine patterns produced by individual CD4+ lymph node cells during experimental murine leishmaniasis in resistant and susceptible mice. International Immunology 10, 1853-1861.
Sorensen, T.L., Trebst, C., Kivisakk, P., Klaege, K.L., Majmudar, A., Ravid, R., Lassmann, H., Olsen, D.B., Strieter, R.M., Ransohoff, R.M., Sellebjerg, F., 2002. Multiple sclerosis: a study of CXCL10 and CXCR3 co-localization in the inflamed central nervous system. Journal of Neuroimmunology 127, 59-68.
Sorensen, T.L., Tani, M., Jensen, J., Pierce, V., Lucchinetti, C., Folcik, V.A., Qin, S., Rottman, J., Sellebjerg, F., Strieter, R.M., Frederiksen, J.L., Ransohoff, R.M., 1999. Expression of specific chemokines and chemokine receptors in the central nervous system of multiple sclerosis patients. The Journal of Clinical Investigation 103, 807- 815.
Spehlmann, M.E., Dann, S.M., Hruz, P., Hanson, E., McCole, D.F., Eckmann, L., 2009. CXCR2-dependent mucosal neutrophil influx protects against colitis-associated diarrhea caused by an attaching/effacing lesion-forming bacterial pathogen. Journal of Immunology (Baltimore, Md.: 1950) 183, 3332-3343.
140 Steinmetz, O.M., Turner, J.E., Paust, H.J., Lindner, M., Peters, A., Heiss, K., Velden, J., Hopfer, H., Fehr, S., Krieger, T., Meyer-Schwesinger, C., Meyer, T.N., Helmchen, U., Mittrucker, H.W., Stahl, R.A., Panzer, U., 2009. CXCR3 mediates renal Th1 and Th17 immune response in murine lupus nephritis. Journal of Immunology (Baltimore, Md.: 1950) 183, 4693-4704.
Strieter, R.M., Polverini, P.J., Kunkel, S.L., Arenberg, D.A., Burdick, M.D., Kasper, J., Dzuiba, J., Van Damme, J., Walz, A., Marriott, D., 1995. The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. The Journal of Biological Chemistry 270, 27348-27357.
Sugita, K., Nishio, D., Kabashima, K., Honda, M., Tokura, Y., 2008. Erythema multiforme associated with Gardnerella vaginosis and elevated circulating CXCR3+ B cells. Clinical and Experimental Dermatology 33, 351-353.
Suzaki, Y., Hamada, K., Nomi, T., Ito, T., Sho, M., Kai, Y., Nakajima, Y., Kimura, H., 2008. A small-molecule compound targeting CCR5 and CXCR3 prevents airway hyperresponsiveness and inflammation. The European Respiratory Journal : Official Journal of the European Society for Clinical Respiratory Physiology 31, 783-789.
Szymczak, W.A., Deepe, G.S.,Jr, 2009. The CCL7-CCL2-CCR2 axis regulates IL-4 production in lungs and fungal immunity. Journal of Immunology (Baltimore, Md.: 1950) 183, 1964-1974.
Tanaka, S., Nishida, Y., Aida, K., Maruyama, T., Shimada, A., Suzuki, M., Shimura, H., Takizawa, S., Takahashi, M., Akiyama, D., Arai-Yamashita, S., Furuya, F., Kawaguchi, A., Kaneshige, M., Katoh, R., Endo, T., Kobayashi, T., 2009. Enterovirus infection, CXC chemokine ligand 10 (CXCL10), and CXCR3 circuit: a mechanism of accelerated beta-cell failure in fulminant type 1 diabetes. Diabetes 58, 2285-2291.
Thapa, M., Carr, D.J., 2009. CXCR3 deficiency increases susceptibility to genital herpes simplex virus type 2 infection: Uncoupling of CD8+ T-cell effector function but not migration. Journal of Virology 83, 9486-9501.
Thoma, G., Baenteli, R., Lewis, I., Wagner, T., Oberer, L., Blum, W., Glickman, F., Streiff, M.B., Zerwes, H.G., 2009. Special ergolines are highly selective, potent antagonists of the chemokine receptor CXCR3: discovery, characterization and preliminary SAR of a promising lead. Bioorganic & Medicinal Chemistry Letters 19, 6185-6188.
Trotta, T., Costantini, S., Colonna, G., 2009. Modelling of the membrane receptor CXCR3 and its complexes with CXCL9, CXCL10 and CXCL11 chemokines: putative target for new drug design. Molecular Immunology 47, 332-339.
141 Tsubaki, T., Takegawa, S., Hanamoto, H., Arita, N., Kamogawa, J., Yamamoto, H., Takubo, N., Nakata, S., Yamada, K., Yamamoto, S., Yoshie, O., Nose, M., 2005. Accumulation of plasma cells expressing CXCR3 in the synovial sublining regions of early rheumatoid arthritis in association with production of Mig/CXCL9 by synovial fibroblasts. Clinical and Experimental Immunology 141, 363-371.
Turner, J.E., Steinmetz, O.M., Stahl, R.A., Panzer, U., 2007. Targeting of Th1-associated chemokine receptors CXCR3 and CCR5 as therapeutic strategy for inflammatory diseases. Mini Reviews in Medicinal Chemistry 7, 1089-1096.
Uppaluri, R., Sheehan, K.C., Wang, L., Bui, J.D., Brotman, J.J., Lu, B., Gerard, C., Hancock, W.W., Schreiber, R.D., 2008. Prolongation of cardiac and islet allograft survival by a blocking hamster anti-mouse CXCR3 monoclonal antibody. Transplantation 86, 137-147.
Valbuena, G., Walker, D.H., 2004. Effect of blocking the CXCL9/10-CXCR3 chemokine system in the outcome of endothelial-target rickettsial infections. The American Journal of Tropical Medicine and Hygiene 71, 393-399.
Van den Steen, P.E., Deroost, K., Van Aelst, I., Geurts, N., Martens, E., Struyf, S., Nie, C.Q., Hansen, D.S., Matthys, P., Van Damme, J., Opdenakker, G., 2008. CXCR3 determines strain susceptibility to murine cerebral malaria by mediating T lymphocyte migration toward IFN-gamma-induced chemokines. European Journal of Immunology 38, 1082-1095. van Wanrooij, E.J., de Jager, S.C., van Es, T., de Vos, P., Birch, H.L., Owen, D.A., Watson, R.J., Biessen, E.A., Chapman, G.A., van Berkel, T.J., Kuiper, J., 2008. CXCR3 antagonist NBI-74330 attenuates atherosclerotic plaque formation in LDL receptor-deficient mice. Arteriosclerosis, Thrombosis, and Vascular Biology 28, 251-257.
VanCott, J.L., Chatfield, S.N., Roberts, M., Hone, D.M., Hohmann, E.L., Pascual, D.W., Yamamoto, M., Kiyono, H., McGhee, J.R., 1998. Regulation of host immune responses by modification of Salmonella virulence genes. Nature Medicine 4, 1247- 1252.
Vandercappellen, J., Van Damme, J., Struyf, S., 2008. The role of CXC chemokines and their receptors in cancer. Cancer Letters 267, 226-244.
Vidal, S., Tremblay, M.L., Govoni, G., Gauthier, S., Sebastiani, G., Malo, D., Skamene, E., Olivier, M., Jothy, S., Gros, P., 1995. The Ity/Lsh/Bcg locus: natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene. The Journal of Experimental Medicine 182, 655-666.
142 Viola, A., Luster, A.D., 2008. Chemokines and their receptors: drug targets in immunity and inflammation. Annual Review of Pharmacology and Toxicology 48, 171-197.
Wan, Y.Y., Flavell, R.A., 2005. Identifying Foxp3-expressing suppressor T cells with a bicistronic reporter. Proceedings of the National Academy of Sciences of the United States of America 102, 5126-5131.
Watson, R.J., Allen, D.R., Birch, H.L., Chapman, G.A., Hannah, D.R., Knight, R.L., Meissner, J.W., Owen, D.A., Thomas, E.J., 2007. Development of CXCR3 antagonists. Part 2: Identification of 2-amino(4-piperidinyl)azoles as potent CXCR3 antagonists. Bioorganic & Medicinal Chemistry Letters 17, 6806-6810.
Watson, R.J., Allen, D.R., Birch, H.L., Chapman, G.A., Galvin, F.C., Jopling, L.A., Knight, R.L., Meier, D., Oliver, K., Meissner, J.W., Owen, D.A., Thomas, E.J., Tremayne, N., Williams, S.C., 2008. Development of CXCR3 antagonists. Part 3: Tropenyl and homotropenyl-piperidine urea derivatives. Bioorganic & Medicinal Chemistry Letters 18, 147-151.
Wendel, M., Galani, I.E., Suri-Payer, E., Cerwenka, A., 2008. Natural killer cell accumulation in tumors is dependent on IFN-gamma and CXCR3 ligands. Cancer Research 68, 8437-8445.
Wherry, E.J., Teichgraber, V., Becker, T.C., Masopust, D., Kaech, S.M., Antia, R., von Andrian, U.H., Ahmed, R., 2003. Lineage relationship and protective immunity of memory CD8 T cell subsets. Nature Immunology 4, 225-234.
Widney, D.P., Hu, Y., Foreman-Wykert, A.K., Bui, K.C., Nguyen, T.T., Lu, B., Gerard, C., Miller, J.F., Smith, J.B., 2005. CXCR3 and its ligands participate in the host response to Bordetella bronchiseptica infection of the mouse respiratory tract but are not required for clearance of bacteria from the lung. Infection and Immunity 73, 485- 493.
Wuest, T.R., Carr, D.J., 2008. Dysregulation of CXCR3 signaling due to CXCL10 deficiency impairs the antiviral response to herpes simplex virus 1 infection. Journal of Immunology (Baltimore, Md.: 1950) 181, 7985-7993.
Wunderlich, F., Mossmann, H., Helwig, M., Schillinger, G., 1988. Resistance to Plasmodium chabaudi in B10 mice: influence of the H-2 complex and testosterone. Infection and Immunity 56, 2400-2406.
Wunderlich, F., Maurin, W., Benten, W.P., Schmitt-Wrede, H.P., 1993. Testosterone impairs efficacy of protective vaccination against P. chabaudi malaria. Vaccine 11, 1097-1099.
143 Wunderlich, F., Marinovski, P., Benten, W.P., Schmitt-Wrede, H.P., Mossmann, H., 1991. Testosterone and other gonadal factor(s) restrict the efficacy of genes controlling resistance to Plasmodium chabaudi malaria. Parasite Immunology 13, 357-367.
Xing, L., Donlin, L.T., Miller, R.H., Alexandropoulos, K., 2004. The adapter molecule Sin regulates T-cell-receptor-mediated signal transduction by modulating signaling substrate availability. Molecular and Cellular Biology 24, 4581-4592.
Xu, H., DiIulio, N.A., Fairchild, R.L., 1996. T cell populations primed by hapten sensitization in contact sensitivity are distinguished by polarized patterns of cytokine production: interferon gamma-producing (Tc1) effector CD8+ T cells and interleukin (Il) 4/Il-10-producing (Th2) negative regulatory CD4+ T cells. The Journal of Experimental Medicine 183, 1001-1012.
Xue, S.A., Bendle, G.M., Holler, A., Stauss, H.J., 2008. Generation and characterization of transgenic mice expressing a T-cell receptor specific for the tumour-associated antigen MDM2. Immunology 124, 315-321.
Yamamoto, H., Nakamura, T., Matsuo, K., Tajika, M., Kawai, H., Ohmiya, N., Niwa, Y., Goto, H., Nakamura, S., 2008. Significance of CXCR3 expression in gastric low- grade B-cell lymphoma of mucosa-associated lymphoid tissue type for predicting responsiveness to Helicobacter pylori eradication. Cancer Science 99, 1769-1773.
Yang, L., Liu, Y.F., Wu, G., Cheng, Y., Liu, F.F., Zhang, J.L., 2007. Effects of blocking the CXC chemokine receptor 3 pathway on acute rejection of islet allograft. Zhonghua Wai Ke Za Zhi [Chinese Journal of Surgery] 45, 210-213.
Yates, C.C., Whaley, D., Hooda, S., Hebda, P.A., Bodnar, R.J., Wells, A., 2009. Delayed reepithelialization and basement membrane regeneration after wounding in mice lacking CXCR3. Wound Repair and Regeneration : Official Publication of the Wound Healing Society [and] the European Tissue Repair Society 17, 34-41.
Yates, C.C., Whaley, D., Kulasekeran, P., Hancock, W.W., Lu, B., Bodnar, R., Newsome, J., Hebda, P.A., Wells, A., 2007. Delayed and deficient dermal maturation in mice lacking the CXCR3 ELR-negative CXC chemokine receptor. The American Journal of Pathology 171, 484-495.
Yoh, K., Shibuya, K., Morito, N., Nakano, T., Ishizaki, K., Shimohata, H., Nose, M., Izui, S., Shibuya, A., Koyama, A., Engel, J.D., Yamamoto, M., Takahashi, S., 2003. Transgenic overexpression of GATA-3 in T lymphocytes improves autoimmune glomerulonephritis in mice with a BXSB/MpJ-Yaa genetic background. Journal of the American Society of Nephrology : JASN 14, 2494-2502.
144 Yoneyama, H., Narumi, S., Zhang, Y., Murai, M., Baggiolini, M., Lanzavecchia, A., Ichida, T., Asakura, H., Matsushima, K., 2002. Pivotal role of dendritic cell-derived CXCL10 in the retention of T helper cell 1 lymphocytes in secondary lymph nodes. The Journal of Experimental Medicine 195, 1257-1266.
Zakharova, I.S., Shevchenko, A.I., Zakian, S.M., 2009. Monoallelic gene expression in mammals. Chromosoma 118, 279-290.
Zandman-Goddard, G., Peeva, E., Shoenfeld, Y., 2007. Gender and autoimmunity. Autoimmunity Reviews 6, 366-372.
Zeremski, M., Petrovic, L.M., Chiriboga, L., Brown, Q.B., Yee, H.T., Kinkhabwala, M., Jacobson, I.M., Dimova, R., Markatou, M., Talal, A.H., 2008. Intrahepatic levels of CXCR3-associated chemokines correlate with liver inflammation and fibrosis in chronic hepatitis C. Hepatology (Baltimore, Md.) 48, 1440-1450.
Zerwes, H.G., Li, J., Kovarik, J., Streiff, M., Hofmann, M., Roth, L., Luyten, M., Pally, C., Loewe, R.P., Wieczorek, G., Banteli, R., Thoma, G., Luckow, B., 2008. The chemokine receptor Cxcr3 is not essential for acute cardiac allograft rejection in mice and rats. American Journal of Transplantation : Official Journal of the American Society of Transplantation and the American Society of Transplant Surgeons 8, 1604-1613.
Zhang, B., Chan, Y.K., Lu, B., Diamond, M.S., Klein, R.S., 2008. CXCR3 mediates region-specific antiviral T cell trafficking within the central nervous system during West Nile virus encephalitis. Journal of Immunology (Baltimore, Md.: 1950) 180, 2641-2649.
Zhou, P., Seder, R.A., 1998. CD40 ligand is not essential for induction of type 1 cytokine responses or protective immunity after primary or secondary infection with histoplasma capsulatum. The Journal of Experimental Medicine 187, 1315-1324.
Zhou, P., Sieve, M.C., Bennett, J., Kwon-Chung, K.J., Tewari, R.P., Gazzinelli, R.T., Sher, A., Seder, R.A., 1995. IL-12 prevents mortality in mice infected with Histoplasma capsulatum through induction of IFN-gamma. Journal of Immunology (Baltimore, Md.: 1950) 155, 785-795.
Zhou, X., Bailey-Bucktrout, S., Jeker, L.T., Bluestone, J.A., 2009. Plasticity of CD4(+) FoxP3(+) T cells. Current Opinion in Immunology 21, 281-285.
Zhumabekov, T., Corbella, P., Tolaini, M., Kioussis, D., 1995. Improved version of a human CD2 minigene based vector for T cell-specific expression in transgenic mice. Journal of Immunological Methods 185, 133-140.
145
APPENDIX A: ROLE OF CHEMOKINES IN REGULATION OF IMMUNITY AGAINST LEISHMANIASIS.
146
147 148 149 150 151 152 153
154
APPENDIX B: PI3KGAMMA (PI3Kγ) IS ESSENTIAL FOR EFFICIENT INDUCTION OF CXCR3 ON ACTIVATED T CELLS.
155
156 157 158
159
APPENDIX C: RESPIRATORY INFECTION WITH FRANCISELLA NOVICIDA INDUCES RAPID DYSTROPHIC CARDIAC CALCINOSIS (DCC).
160 161 162 163 164 165 166
167
APPENDIX D: IFN-γ AND STAT1 ARE REQUIRED FOR EFFICIENT INDUCTION OF CXC CHEMOKINE RECEPTOR 3 (CXCR3) ON CD4+ BUT NOT CD8+ T CELLS.
168
169
170
APPENDIX E: 17β-ESTRADIOL INCREASES LEISHMANIA MEXICANA KILLING IN MACROPHAGES FROM DBA/2 MICE BY ENHANCING PRODUCTION OF NITRIC OXIDE BUT NOT PRO-INFLAMMATORY CYTOKINES.
171
172
173
174
APPENDIX F: LACK OF CXCR3 DELAYS THE DEVELOPMENT OF HEPATIC INFLAMMATION BUT DOES NOT IMPAIR RESISTANCE TO LEISHMANIA DONOVANI.
175
176 177
178 179
180
APPENDIX G: SEX-ASSOCIATED SUSCEPTIBILITY IN HUMANS WITH CHICLERO'S ULCER: RESISTANCE IN FEMALES IS ASSOCIATED WITH INCREASED SERUM-LEVELS OF GM-CSF.
181 182
183