(Esp1) Is Required for Anaphase Spindle Elongation Independently of Its Role in Cleavage of Cohesin

The Protease Activity of Yeast Separase (Esp1) Is Required for Anaphase Spindle Elongation Independently of Its Role In Cleavage of Cohesin

Chris Baskerville,* Marisa Segal† and Steven I. Reed*,1 *Department of Molecular Biology, The Scripps Research Institute, La Jolla, California 92037 and †Department of Genetics, University of Cambridge, Cambridge CB2 3EH, United Kingdom Manuscript received November 30, 2007 Accepted for publication January 19, 2008

ABSTRACT Separase is a caspase-family protease required for the metaphase–anaphase transition in eukaryotes. In budding yeast, the separase ortholog, Esp1, has been shown to cleave a subunit of cohesin, Mcd1 (Scc1), thereby releasing sister chromatids from cohesion and allowing anaphase. However, whether Esp1 has other substrates required for anaphase has been controversial. Whereas it has been reported that cleavage of Mcd1 is sufficient to trigger anaphase in the absence of Esp1 activation, another study using a temperature-sensitive esp1 mutant concluded that depletion of Mcd1 was not sufficient for anaphase in the absence of Esp1 function. Here we revisit the issue and demonstrate that neither depletion of Mcd1 nor ectopic cleavage of Mcd1 by Tev1 protease is sufficient to support anaphase in an esp1 temperature- sensitive mutant. Furthermore, we demonstrate that the catalytic activity of the Esp1 protease is required for this Mcd1-independent anaphase function. These data suggest that another protein, possibly a spindle-associated protein, is cleaved by Esp1 to allow anaphase. Such a function is consistent with the previous observation that Esp1 localizes to the mitotic spindle during anaphase.

HE metaphase–anaphase transition is regulated in chromatidstogether(Uhlmannetal.1999).Thecohesin T part by the activity of protein-ubiquitin ligase complex, composed of the two structural-maintenance- known as the anaphase-promoting complex (APC), in of-chromosomes (SMC) family proteins, Smc1 and Smc3, conjunction with its cofactor Cdc20. In budding yeast the and several non-SMC components, including Mcd1, has principal target of the APCCdc20 that enables anaphase is been proposed to form rings around the chromatid pairs Pds1, known generically as securin (Cohen-Fix et al. spaced at intervals along the arms thereby preventing 1996; Shirayama et al. 1999). The activity of APCCdc20 their separation (Gruber et al. 2003). Once the integrity toward Pds1 and other substrates is regulated in several of the cohesin ring has been breached by cleavage of ways: periodic transcription of CDC20 prior to anaphase Mcd1, sister chromatids are then free to separate and be (Prinz et al. 1998; Zhu et al. 2000); inhibition of APCCdc20 drawn to opposite poles by the mitotic spindle. This in an inactive complex with spindle checkpoint pro- model is for the most part supported by genetic and teins Mad2, Mad3, and Bub3, which are part of a larger biochemical analysis. esp1 mutants fail to lose sister signaling pathway that ensures bipolar attachment of chromatid cohesion and undergo an abortive mitosis spindle microtubules to kinetochores (reviewed in Tan (McGrew et al. 1992) and Esp1 can cleave Mcd1, in vivo et al. (2005); degradation of Cdc20 in response to mitotic and in vitro, in a sequence-speciﬁc manner (Uhlmann checkpoints (Pan and Chen 2004); and ubiquitin- et al. 1999, 2000). pds1 mutants, on the other hand, are mediated proteolysis of Cdc20 upon mitotic exit by a unable to maintain sister chromatid cohesion, even different form of the APC, activated by the cofactor Cdh1 under conditions of APC inhibition imposed by the (Huang et al. 2001). Pds1 forms a complex with and spindle checkpoint (Yamamoto et al. 1996; Ciosk et al. inhibits a caspase-like protease, Esp1, also known as 1998). Mcd1 mutants fail to establish sister chromatid separase. It is the ubiquitin-mediated proteolysis of Pds1 cohesion (Guacci et al. 1997; Severin et al. 2001). It has that triggers anaphase by promoting activation of Esp1 been proposed that sister chromatid cohesion mediated (Ciosk et al. 1998). The prevalent model posits that the by intact cohesin is the only force blocking anaphase critical anaphase restraining target of the Esp1 protease spindle elongation in metaphase cells and that Mcd1 is the Mcd1 (Scc1) subunit of cohesin, which binds sister cleavage by Esp1 is sufﬁcient for anaphase (Uhlmann et al. 2000). However, there is not yet a consensus concerning whether Mcd1 is the only critical target of Esp1 for 1Corresponding author: The Scripps Research Institute, Department of Molecular Biology, MB-7, 10550 N. Torrey Pines Rd., La Jolla, CA 92007. anaphase or whether one or more other Esp1-depen- E-mail: [email protected] dent events are required for anaphase. The Mcd1-only

Genetics 178: 2361–2372 (April 2008) 2362 C. Baskerville, M. Segal and S. I. Reed model is based on an experiment where Mcd1 was the cell cycle for 2 hr. Cells were then arrested in G1 for 1.75 hr engineered to have a site cleavable by an ectopically by the addition of a-factor at a concentration of 12.5 ng/ml. expressed protease, Tev, and Esp1 was inhibited indi- The GAL1-HA-TEV-CMV(NLS) construct was then induced for 1 hr by the addition of galactose to 2% (w/v) prior to release rectly by depleting cells of the essential mitotic cofactor from G1. Cells were released from G1 by centrifuging at low of the APC, Cdc20 (Uhlmann et al. 2000). Presumably speed, removing the medium, washing two times in YEPR under conditions of Cdc20 depletion, APC would be containing 2% galactose (gal), and releasing into YEPR 1 2% inactive, Pds1 stabilized, and Esp1 kept inactive. Under gal at 34°. Samples of the synchronized culture were collected conditions of Tev induction and Cdc20 depletion, at regular intervals and either fixed in 10% formalin (1 ml) for microscopic analysis or centrifuged and frozen at 80° (25 ml) anaphase occurred. This result is supported by anaylsis for biochemical analysis. of two different esp1 temperature-sensitive mutants in To compare temperature sensitivity of mutant Esp1 pro- the absence of functional Mcd1 (Severin et al. 2001; teins, overnight cultures grown at room temperature in YEPD Stegmeier et al. 2002). However, a different result was were diluted to OD600 ¼ 0.2 in YEPD 1 12.5 ng/ml a-factor. obtained when Esp1 was inactivated directly using a Cells were arrested for 3 hr, and then collected, washed twice ensen in YEPD, and released into 34° YEPD. Sixty minutes after more stringent temperature-sensitive esp1 allele (J release, a-factor was added back to the cultures to prevent et al. 2001). Under conditions of Mcd1 depletion and reentry into S phase and new synthesis of Mcd1. Aliquots of Esp1 thermal inactivation, anaphase did not occur, even cells were collected at 0, 60, and 120 min after the initial though loss of sister chromatid cohesion could be ob- release from a-factor. Approximately 50 mg of protein were served. This suggests that Esp1 has at least one function, loaded into each lane of an 8% SDS–PAGE gel. To assess in addition to Mcd1 cleavage, required for anaphase. Mcd1 cleavage, blots were probed with anti-myc antibody (9E10). Blots were also probed with anti-a-tubulin (YOL-1) for To resolve this discrepancy and further elucidate the normalization. mitotic functions of Esp1, we have investigated the role To carry plating assays to compare temperature sensitivity of of Esp1 in anaphase in greater detail. We report here esp1 alleles, serial threefold dilutions were prepared in YEPD that multiple temperature-sensitive mutations directed liquid medium and spotted onto YEPD plates so that the most to different regions of the Esp1 polypeptide are blocked concentrated drop contained 5000 cells. Triplicate spotting was carried out with one plate incubated at 22°, a second at at metaphase even if Mcd1 is eliminated and sister 30°, and a third at 33.5°. Plates were incubated until significant chromatid cohesion lost and that active Esp1 protease is colony formation was observed for the wild-type control. specifically required for spindle elongation under such Cell biology protocols: Fluorescence microscopy was per- circumstances. formed on a Zeis Axioskop2 with a 633 objective. Images of cells were captured using Axiovision Rel. 4.3 software. Specif- ically, images for FITC and Cy3 filter sets (Carl Zeis, Thorn- wood, NY) were captured in seven planes of focus. These MATERIALS AND METHODS images were first analyzed for loss of cohesion (FITC) by selecting cells that exhibited two clearly separated chromo- Yeast strains and methods: The yeast strains applicable to some IV dots and then scoring spindle length in the Cy3 this study are listed in Table 1. These strains are isogenic channel. Cells that did not exhibit loss of cohesion were not derivatives of BF264-15DU: MATa ura3Dns ade1 his2 leu2-3,112 scored for spindle length. Cells were scored for budding by trp1-1 (Richardson et al. 1989). Esp1-1 was backcrossed to the counting at least 200 cells using transmission microscopy. Cells BF264-15DU background five times. Genetic procedures and were scored for loss of cohesion by evaluating separation of yeast media were formulated according to (Ausubel et al. chromosome IV dots in 100 cells at each time point. For time- 2002). For enhanced expression of the TET repressor GFP lapse recordings of spindle dynamic behavior, strains CBY128 fusion protein under the CUP1 promoter, CuSO4 was added to and CBY102 (esp1-C113 or ESP1, respectively, and containing a final concentration of 250 mm. The disruption of genes was Mcd1D GAL1:Myc-MCD1 trp1TTET(o)TTRP1 CUP1PTET(rep)- carried out by the PCR-based targeting technique (Wach et al. GFP HIS3:mCherry:TUB1) were grown overnight in selective 1994). galactose-containing medium at 25° to obtain cultures with no For analysis of cells depleted of Mcd1, overnight cultures of more than 20% budded cells. After collecting by centrifuga- yeast bearing the Mcd1D GAL1-MCD1 constructs were allowed tion, cells were resuspended to a concentration of 3 3 106 to reenter the cell cycle by diluting the culture to OD600 0.15 in cells/ml in synthetic glucose-containing medium (to repress room temperature YEP galactose for 2 hr and then were GAL1:MCD1) and incubated for 1.5 hr at 32° before mounting centrifuged to remove the medium and placed in YEP dextrose on the same medium containing 25% w/v gelatin to perform (YEPD) containing 12.5 ng/ml a-factor. Cells were allowed to time-lapse recordings at 32° using a Nikon Eclipse E800 with synchronize in G1 for 2 hr, washed two times in YEPD, and a CFI Plan Apochromat 1003 N.A. 1.4 objective, Chroma released into 34° YEPD. Samples of the synchronized culture Technology triple band filter set 82000v2 and a Coolsnap- were collected at 15-min intervals and fixed for 30 min in 10% HQ CCD camera (Roper Scientific). Five-plane Z-stacks were formalin. Cells were sonicated briefly to break up clumps, acquired at 30-sec or 1-min intervals and images were pro- centrifuged at low speed to remove medium, and washed with cessed as previously described (Maddox et al. 1999; Huisman phosphate-buffered saline (PBS). Cells were stored at 4° in PBS et al. 2004). To avoid excessive photobleaching of tagged containing 25% glycerol until microscopic analysis could be microtubule-based structures, cells were monitored by direct performed. observation to select cells that had undergone loss of sister For analysis of cells in which Mcd1 had been cleaved with chromatid cohesion and contained a short spindle at the start TEV protease, overnight cultures of yeast bearing MCD1(TEV)- of the recording. myc6 as their sole copy of MCD1 were passaged overnight in Cell lysates: Frozen cell pellets were mixed with buffer YEPD. The next morning the culture was transferred to fresh containing 25 mm HEPES, 0.5 mm EGTA, 0.1 mm EDTA, 2 mm YEP raffinose (YEPR) at an OD600 of 0.3 and allowed to reenter MgCl2,1mm NaHSO3, 0.02% NP-40, 20% glycerol, 50 mm NaF, Regulation of Anaphase by Esp1 2363

TABLE 1 Strains used in this study

Strain Relevant genotype Source CBY17 MATa bar1 Duncan Clarke CUP1(pr):TET(r)-GFPTKAN(rep) DCY1662 trp1TTET(o)TTRP1 CBY87 MATa bar1 his2:GAL1(pr):Myc-MCD1:HIS2 Mcd1DTADE1 esp1DTZEO(r) [ESP1TURA3(cen)] This study trp1TTET(o)TTRP1 CUP1(pr):TET(rep):KAN(r)Tcup1 mad2DTKAN CBY102 MATa bar1 his2:GAL1(pr):Myc-MCD1:HIS2 Mcd1DTADE1 esp1DTZEO(r) [ESP1TLEU2(cen)] This study trp1TTET(o)TTRP1 CUP1(pr):TET(rep):KAN(r)Tcup1 mad2DTKAN(r) ura3THIS3(pr):mCherry-TUB1TURA3 CBY103 MATa bar1 his2:GAL1(pr):Myc-MCD1:HIS2 Mcd1DTADE1 esp1DTZEO(r) This study [esp1-b120TLEU2(cen)] trp1TTET(o)TTRP1 CUP1(pr):TET(rep):KAN(r)Tcup1 mad2TKAN(r) ura3THIS3(pr):mCherry-TUB1TURA3 CBY104 MATa bar1 his2:GAL1(pr):Myc-MCD1:HIS2 Mcd1DTADE1 This study esp1DTZEO(r) [esp1-c113TLEU2(cen)] trp1TTET(o)TTRP1 CUP1(pr):TET(rep):KAN(r)Tcup1 mad2DTKAN(r) ura3THIS3(pr):mCherry-TUB1TURA3 CBY105 MATa bar1 his2:GAL1(pr):Myc-MCD1:HIS2 Mcd1DTADE1 This study esp1DTZEO(r) [esp1-n122TLEU2(cen)] trp1TTET(o)TTRP1 CUP1(pr):TET(rep):KAN(r)Tcup1 mad2DTKAN(r) ura3THIS3(pr):mCherry-TUB1TURA3 CBY107 MATa bar1 his2:GAL1(pr):Myc-MCD1:HIS2 Mcd1DTADE1 esp1DTZEO(r) This study [esp1-c113TLEU2(cen)] trp1TTET(o)TTRP1 CUP1(pr):TET(rep):KAN(r)Tcup1 mad2DTKAN(r) ura3THIS3(Pr)mCherry-TUB1:esp1(C1531S)TURA3 CBY122 MATa bar1 MCD1 (CL#1 TEV) MCD1-Myc6THYG(r) This study his2TGAL1(pr)HA-TEV-P-CMV_NLSTHIS2 esp1DTZEO(r) [ESP1TURA3(cen)] trp1TTet(o)TTRP1 CUP1(pr)-Ter(rep)-GFP:KAN(r):cup1 CBY126 MATa bar1 MCD1 (CL#1 TEV) MCD1-Myc6THYG(r) This study his2TGAL1(pr)HA-TEV-P-CMV_NLSTHIS2 esp1DTZEO(r) [ESP1TLEU2(cen)] trp1TTet(o)TTRP1 CUP1(pr)-Ter(rep)-GFP:KAN(r):cup1 ura3THIS3(pr)mCherry-TUB1TURA3 CBY127 MATa bar1 MCD1 (CL#1 TEV) MCD1-Myc6THYG(r) his2TGAL1(pr)HA-TEV-P-CMV_NLSTHIS2 This study esp1DTZEO(r) [esp1-c113TLEU2(cen)] trp1TTet(o)TTRP1 CUP1(pr)-Ter(rep)-GFP:KAN(r):cup1 ura3THIS3(pr)mCherry-TUB1TURA3 CBY128 MATa bar1 his2:GAL1(pr):Myc-MCD1:HIS2 Mcd1DTADE1 esp1DTZEO(r) This study [esp1-c113TLEU2(cen)] trp1TTET(o)TTRP1 CUP1(pr):TET(rep):KAN(r)Tcup1 mad2DTKAN(r) ura3THIS3(Pr)mCherry-TUB1:ESP1TURA3 CBY129 MATa bar1 esp1DTZEO(r) [ESP1TURA3(cen)] MCD1-Myc6THYG(r) This study CUP1(pr):TET(rep):KAN(r)Tcup1 trp1TTET(o)TTRP1 CBY130 MATa bar1 esp1DTZEO(r) [esp1-B3TLEU2(cen)] MCD1-Myc6THYG(r) This study CUP1(pr):TET(rep):KAN(r)Tcup1 trp1TTET(o)TTRP1 CBY131 MATa bar1 esp1DTZEO(r) [esp1-C113TLEU2(cen)] MCD1-Myc6THYG(r) This study CUP1(pr):TET(rep):KAN(r)Tcup1 trp1TTET(o)TTRP1 CBY132 MATa bar1 esp1DTZEO(r) [esp1-N5TLEU2(cen)] MCD1-Myc6THYG(r) This study CUP1(pr):TET(rep):KAN(r)Tcup1 trp1TTET(o)TTRP1 CBY133 MATa esp1-1 Angelika Amon CBY134 MATa esp1-1 MCD1-Myc6THYG(r) CUP1(pr):TET(rep):KAN(r)Tcup1 trp1TTET(o)TTRP1 CBY133 3 CBY129 ﬁve times

m 200 m NaVO3, and complete protease inhibitor cocktail 0.05% NaN3. To probe for the myc epitope, 9E10 was used at a (catalog no. 1697498, Roche, Indianapolis) then transferred dilution of 1:5000, and for detection of a-tubulin the rat to 2 ml screw-cap minimally conical tubes. Glass beads (0.5 monoclonal YOL1/34 was used. Blots were developed using mm, Biospec) were added until their level was just under the antimouse or antirat, as appropriate. meniscus. Cells were lysed in a FastPrep FP120 at power lever Plasmids: The mCherry-TUB1 construct was made in a 4.5 (4 3 30 sec). Soluble lysates were quantitated for protein manner similar to the GFP-tubulin plasmid described pre- using the Lowry method (Bio-Rad, Hercules, CA). viously by (Straight et al. 1997). Briefly, the mCherry-RFP Western blots: Protein samples (50 mg) were resolved on 8% sequence described by Shaner et al. (2004) was amplified by tris-glycine SDS–PAGE gels. Gels were then transferred to PCR and fused to the HIS3 promoter. The TUB1 gene was PVDF. Blots were blocked in 10% milk then probed with fused in-frame to the 39 end of mCherry-RFP. The intergenic antibodies diluted in PBS containing 20 mg/ml BSA and region between CLB1 and CLB6 was added 39 of the TUB1 ORF 2364 C. Baskerville, M. Segal and S. I. Reed for transcriptional termination. The HIS3(pr)-mCherry-TUB1 RESULTS construct was then placed in pRS406 between XhoI and SacI for integration at the URA3 locus. For ESP1 complementation Mutations introducing substitutions throughout the experiments ESP1 was cloned into this construct between XhoI Esp1 polypeptide prevent loss of sister chromatid co- and KpnI. hesion and cause mitotic failure: Separase homologs A genomic replacement of the region encoding the N terminus of the Esp1 cleavage site within Mcd1 with a TEV are identified on the basis of a region of sequence simi- protease cleavage site was created using the pop-in/pop-out larity in their caboxy-termini that corresponds to a CD technique. A cassette of the sequence between Bst EII and Bst clan-like protease motif. The aminotermini of this family BI was created using primer sequences GATTTCGAACATAA of enzymes are poorly conserved. In the Saccharomyces TAATTTGTCTAGTATG and GTTCGAAATCTTCATCTGGAC cerevisiae separase homolog Esp1, the N-terminal region TGAATCCTTGGAAGTATAGGTTTTCAGTATCCCATGGAGC AGCACC. This cassette changed the region encoding the Esp1 comprises approximately the first 850 amino acids (aa) cleavage sequence WDTSLEVGRRFSP to one encoding the of the 1630 aa open reading frame (ORF). This region TEV-P cleavable site WDTENLYFQGFSP and placed a unique is similar to several fungal separases but lacks sequence NcoI site within the MCD1 ORF. The plasmid pRS406 with the similarity to homologs in higher eukaryotes. To further MCD1 gene containing this cassette was digested at the unique elucidate the function(s) of the regions of Esp1 outside Bst EII site 59 to the TEV-P cleavage site. Cells were first selected on uracil dropout medium then on medium contain- of the protease homology domain, we divided the ORF ing 5-FOA to select for loss of the URA3 marker. Pop-outs were into three relatively equal regions that were indepen- identified as being properly recombined by selecting for NcoI dently mutagenized to create a library of temperature- cleavage of the PCR product produced by primers TCTTC sensitive lethal esp1 mutants. We were able to produce AATTGACCCTTCTCGCCCA and TCGGGCACTGTTGCCG stringent temperature-sensitive alleles by indepen- TATATTCT using genomic DNA as a template. To place a C-terminal 63 Myc tag on Mcd1, a portion of the dently targeting all three regions of the ORF, indicating 39 end of the MCD1 ORF was amplified using primer se- that all are required for essential Esp1 function(s). In quences GATGCGGCCGCGAGCATTGATAAACCTTTCAAAT addition, on the basis of phenotypic analysis of a large AGTGC and CGTCGACCAAACTGGCACAAGAAGGAACTC. number of mutant alleles in the three regions (n ¼ 240), This was fused in frame with a sequence encoding six repeats there were no domain-specific phenotypic differences of the Myc epitope EQKLISEEDL followed by the CLB1/6 transcriptional terminator. This sequence was placed in the (data not shown). In synchronized cultures progressing plasmid pAG34 with SalI and SacI linkers, respectively. Yeast through mitosis, there was a failure to lose sister chro- that were resistant to hygromycin B were tested for proper matid cohesion, a failure in anaphase spindle elonga- integration of the Myc-tagging construct using primers TTT tion, and a translocation of the undivided nucleus into CTGTGTAGGCTAGCACCTGG and AGAAGCACCCGCAGG the bud. Although this mutational analysis cannot be CAATATAGA. The galactose-inducible TEV protease expression plasmid assumed to be saturating (only 240 alleles were ana- was created by amplifying the region encoding TEV-P from the lyzed), it appears that the entire Esp1 polypeptide con- tobacco etch virus genome using primer sequences ACTCG tributes to the essential mitotic function of Esp1. AGCCATGGCTGAAAGCTTGTTTAAG and GTCTAGATCA Stringent temperature-sensitive esp1 alleles confer a GTCGACTTGCGAGTACACCAATTCATTC. A cytomegalovi- block to anaphase spindle elongation in the absence of rus nuclear localization signal sequence (CMV_NLS) was added to the pBluescript vector by using the primer sequences Mcd1: We have reported previously that a temperature- CACTCTAGAGTCGACTGTACTCCACCAAAGAAGAAGAGA sensitive allele of ESP1, esp1-B3 was defective in anaphase AAGGTTGCCTAAGCGGCCGCCACCGCGGTG and TGGCC spindle elongation, even under conditions of Mcd1 de- TTTTGCTGGCCTTTTGCTCACATGT. The TEV-P sequence pletion (Jensen et al. 2001). This experiment was carried was fused in frame 59 to the CMV_NLS to make TEV-P- CMV_NLS. To make the expression of TEV-P-CMV_NLS in- out by regulating the synthesis of the cohesin protein ducible with galactose, the GAL1 promoter ½GAL1(pr) was Mcd1 using a heterologous fusion construct of the GAL1 amplified with primer sequences AGGGCCCTTGGATGGAC promoter with the MCD1 ORF. Growth of cells in dex- GCAAAGAAGTTT and ACTCGAGCGCATAGTCAGGAACAT trose medium where the GAL1 promoter is repressed CGTATGGGTAAGCCATGGTATAGTTT TTTCTCCTTGACG leads to depletion of Mcd1. Under these conditions, TTAAAGTATAGAG. Note that this version of the GAL1(pr) will express an HA epitope (YPYDVPDYA) tagged TEV-P-CMV_ even though sister chromatid cohesion was lost, on the NLS (HA-TEV-P-CMV_NLS). basis of scoring of a fluorescent chromosome marker, To introduce the HA-TEV-P-CMV_NLS under histidine spindle elongation did not occur. The esp1-B3 allele was selection, the HIS2 gene was amplified from yeast genomic derived from mutagenesis specifically in the central DNA using primer sequences CTCAGCGATATCATTTTGATT region of Esp1 and was characterized by a low restrictive TACTAAATGCTATTTATCC and CAGTGCAGATCTACAGC TTTTGTTTTTGATTTCTTTGCC. The backbone of pRS404 temperature (31.5°), necessary technically for accurate was amplified with primer sequences GCCAGTCAGGCC scoring of spindle elongation. To determine whether TATGCGGTGTGAAATACCGCAC and GTGCACTGATCATA cohesion-independent failure of spindle elongation is a TGGTGCACTCTCAGTACAATC. The products of these PCRs characteristic of the esp1-B3 allele or whether it is a were ligated together to form the HIS2 selectable integrating general characteristic of Esp1 loss of function, addi- plasmid pRS40-HIS2. The GAL1(pr)-HA-TEV-P-CMV_NLS construct was then ligated into this plasmid between SacI and ApaI. tional stringent temperature-sensitive alleles (restrictive Statistical analysis: The means in Figure 3 were compared temperature #33°) in different regions of the Esp1 ORF using Student’s t-test (Table 3) (Simpson et al. 1960). were chosen for analysis. All temperature-sensitive strains Regulation of Anaphase by Esp1 2365

TABLE 2 observed were measured for spindle length. For each esp1 temperature-sensitive mutations population, .60% of cells fit this criterion at peak mitotic times (supplemental Figure 1A, data not shown). Expected Found It has been reported that chromosomal regions that are Codon no. codon codon Comment centromere-proximal, can separate prior to anaphase (Pearson et al. 2001). However, there was no significant esp1-N5 1 MET (ATG) None (ACG) Codon 2 is MET preanaphase separation at a site 12.7 kb from CEN11, 3 VAL (GTA) ALA (GCT) more centromere-proximal than the Tet operator array 25 LEU (TTA) LEU (CTC) Silent used here (16 kb from CEN4). Consistent with these 63 ILE (ATA) LEU (TTA) observations, the Tet operator array system has been 87 HIS (CAT) ASN (AAT) shown previously not to exhibit preanaphase separation 101 MET (ATG) LYS (AAG) Destroys AflII site in the esp1 mutants (Jensen et al. 2001). Therefore, as 117 VAL (GTT) VAL (GTA) Silent expected, for mutants grown in the presence of galac- 121 ASN (AAT) SER (AGT) , 218 SER (TCT) SER (TCC) Silent tose, so that Mcd1 was not depleted, 10% of cells 305 GLN (CAA) ILE (CTA) showed separated chromosome IV spots, confirming 360 LEU (TTA) ILE (ATA) that esp1 mutation prevents loss of cohesion under the 479 ALA (GCT) ALA (GCC) Silent experimental conditions employed (supplemental Fig- 545 SER (TCA) THR (ACA) ure 1A, data not shown). The spindle-length data are esp1-N122 shown in Table 3 for the peak mitotic time point for the 90 ASN (AAT) SER (AGT) wild-type control (90 min). The peak average pole-to- 511 CYS (TGC) PHE (TTC) pole spindle length for the wild-type strain is 6 mmat90 esp1-C113 min. Although fully extended spindles in S. cerevisiae are 1327 PHE (TTC) LEU (CTC) 8 mm, the smaller length of the average represents 1391 HIS (CAT) TYR (TAT) imperfect synchrony (see Figure 1). On the other hand, esp1-B3 the three temperature-sensitive alleles analyzed, esp1- 503 THR (ACG) SER (AGC) N120 (amino-terminal region), esp1-B120 (central region), 504 LEU (CTA) VAL (GTA) 579 ASN (AAT) ASN (GAT) Silent and esp1-C113 (carboxy-terminal region) exhibited sig- 603 ASP (GAC) ALA (GCC) nificantly less spindle elongation at 90 min and at later esp1-B120 points. The entire time course for wild type and esp1- 782 LYS (AAA) GLU (GAA) C113 is plotted in Figure 1. These data indicate that 818 SER (TCC) SER (TCT) Silent during the entire interval where wild-type cells undergo 841 GLY (GGT) GLY (TCT) Silent mitosis, esp1-C113 cells extend spindles to a maximum 951 ILE (ATT) THR (ACT) length of 4 mm with an average length of 3 mm. 1040 ILE (ATA) THR (ACA) Therefore temperature-sensitive alleles of esp1 across the entire Esp1 ORF confer a defect in anaphase spindle elongation. sequenced contained multiple mutations although we Time-lapse analysis of spindle elongation indicates did not verify which mutations contributed to the phe- that spindle length is not dynamic in esp1 mutants: notype. The specific combinations of mutations in these Even though on the basis of population counts of fixed alleles are shown in Table 2. Mutant strains contained a cells it appears that esp1 spindles do not elongate suf- construct expressing an mCherry-RFP-tubulin fusion ficiently for anaphase, it is possible that these spindles protein for monitoring spindle length and GFP-Tet might go through transient cycles of full elongation and repressor with a Tet operator array integrated at the collapse or that they might collapse during the fixation TRP1 locus on chromosome IV to determine loss of process. We therefore carried out time-lapse photo- sister chromatid cohesion. Mcd1 expression was under microscopy of individual live wild-type and esp1-C113 control of the GAL1 promoter, as described previously cells progressing through mitosis. The same strains used (Jensen et al. 2001). In addition, the strains contained a in analysis of synchronized populations were subject to mad2 deletion to prevent a mitotic delay that occurs in live imaging microscopy following a shift to dextrose the absence of sister chromatid cohesion (Severin et al. medium to deplete Mcd1 and incubation at 32°. Cells 2001). Cells were synchronized by mating pheromone that had undergone loss of sister chromatid cohesion arrest, released into dextrose medium to terminate and contained a short spindle were selected for record- expression of Mcd1, and were harvested as a function ings. Representative time-lapse sequences for two wild- of time after release at 15-min intervals. Populations type controls and two esp1-C113 mutants are shown in were lightly fixed and then scored for spindle length and Figure 2, A and B, respectively. Both wild-type cells loss of chromatid cohesion. Representative images used proceeded to elongate the mitotic spindle within 26.5 for this analysis are shown in Figure 1. Only cells where min. On the other hand, the mutant cells exhibited two well-separated chromosome IV spots could be a marginal elongation (,3.5 mm) of the spindle by 47 2366 C. Baskerville, M. Segal and S. I. Reed

Figure 1.—Mitotic spindles fail to elongate in esp1-C113 cells even after loss of cohesion. (A) Kinet- ics of budding in ESP1 and esp1- C113 cells released from a-factor arrest. (B) Average spindle lengths for the same time courses (n $ 120 for each point). Error bars represent one standard deviation. (C) Representative images of those used to determine spindle elongation kinetics in B. Top, wild-type cells; bottom, esp1-C113 mutant cells. Left, chromosome IV dots; right, spindles. Bar (top left), 2 mm.

min. The corresponding plots for the kinetics of spindle The strain also contains the Tev protease ORF fused to elongation in wild-type vs. esp1-C113 cells is shown in the GAL1 promoter. Growth of these cells in galactose- Figure 2C. These dynamic results are in good agreement containing medium resulted in the induction of the TEV with the still-image counts and measurements obtained protease and cleavage of Mcd1, as observed by the from fixed cell populations (Figure 1). disappearance of the 105-kDa band and the appearance An ectopically cleavable Mcd1 does not rescue the of a 77-kDa band (Figure 3C), and ultimately, lethality spindle elongation defect of esp1-C113: To eliminate (data not shown). To assess the requirement of Esp1 for the possibility that the loss of sister chromatid cohesion spindle elongation in cells where Mcd1 is ectopically at the TRP1 locus in Mcd1-depleted cells was not in- cleaved by Tev protease, we synchronized cells by mating dicative of complete loss of cohesion throughout the pheromone arrest–release and shifted cultures into entire length of all chromosomes because of residual galactose (to induce Tev protease expression) or dextrose Mcd1 protein, we created a strain in which the chromo- (to maintain repression of Tev protease). Once again somal MCD1 gene was replaced by a mutant gene spindle length was visualized in cells that had clearly encoding an Mcd1 protein in which the Esp1 cleavage shown chromatid separation indicating a lack of co- site at amino acid 180 was replaced by a TEV protease hesion. Wild-type cells exhibited mitotic spindle elon- cleavage site (Mcd1-Tev). This leaves one intact Esp1 gation whereas esp1-C113 mutants again demonstrated cleavage site at amino acid 268. To monitor Mcd1 poor spindle elongation (Figure 3B). For each popula- protein we added six copies of the Myc epitope tag at tion, loss of sister chromatid cohesion was determined to the carboxy terminus. Western blot analysis of lysates be .60% at peak mitotic times on the basis of scoring from these cells using anti-Myc antibody revealed a band chromosome IV dots (supplemental Figure 1B). There- that migrates at 105 kDa. This size is consistent with the fore, expression of Tev protease led to loss of cohesion in mobility of Mcd1 reported by Uhlmann et al. (2000). cells containing Mcd1-Tev, even in the absence of Esp1 function. To confirm that the Mcd1 was efficiently cleaved in this experiment, extracts were prepared and subjected to SDS–PAGE followed by Western blotting TABLE 3 (Figure 3C). In both wild-type and esp1-C113 cells, induc- Spindle lengths of esp1 mutants tion of Tev protease by growth in galactose-containing medium led to an almost complete loss of full-length Mean spindle S.D. spindle Mcd1 by 90 min after release from mating pheromone ESP1 gene length at 90 min (mm) length N arrest. Note that this is the time at which wild-type cells ESP1 6.04 2.20 163 exhibit spindle elongation. At the same time, the 77-kDa esp1-N122 2.75 1.24 142 cleavage product was apparent during the entire time esp1-B120 3.66 2.02 163 course for both wild type and mutant. Under conditions esp1-C113 2.17 0.82 126 of growth in dextrose-containing medium, even when Regulation of Anaphase by Esp1 2367

Figure 2.—Time-lapse analysis of spindle elongation following loss of sister chromatid cohesion in cells depleted of Mcd1. Selected frames of representative time-lapse series for spindle elongation in ESP1 (A) or esp1-C113 cells (B). (C) Plots depicting the overall kinetics of spindle elongation in ESP1 and esp1-C113 cells. Cells were selected by direct observation to verify loss of sister chromatid cohesion and the presence of a short spindle at the be- ginning of the recording. Numbers indicate time elapsed in minutes. Bar, 2 mm.

Mcd1 is not completely cleaved by Esp1 (Figure 3C), the FEAR (Cdc fourteen early anaphase release) mitotic cells progress through mitosis normally (data not exit pathway, does not require this activity of Esp1 shown). Therefore complete loss of Mcd1 is not neces- (Stegmeier et al. 2002; Sullivan and Uhlmann sary for loss of cohesion and mitotic progression. The 2003). To determine whether Mcd1-independent ana- mitotic spindle elongation does not appear as robust in phase spindle elongation functions of Esp1 require terms of spindle length for the wild-type control in this endoprotease activity, an active site mutation was created experiment compared to the experiments in Table 3 and (esp1-C1531S). Replacing this cysteine with serine re- Figure 1. The reason for this is that the strains used for moves the protease nucleophile. esp1-C1531S in parallel this experiment did not contain a mad2 deletion, re- with wild-type ESP1 was introduced into the tempera- sulting in poorer synchrony of mitotic progression. This ture-sensitive esp1-C113 mutant strain on a centromeric results in reduced average spindle length at any partic- plasmid. Cells were synchronized using mating phero- ular time point. Nevertheless, statistical analysis com- mone, Mcd1 was depleted by shift to dextrose, and loss paring the mean spindle lengths at every time point after of cohesion and spindle length were scored as a function 75 min indicated that the differences were highly of time (Figure 4). In esp1-C113 mutants expressing esp1- signiﬁcant (P # 0.001) (Table 4). Importantly, the mean C1531S or ESP1, cohesion was lost, as expected (supple- spindle lengths for the esp1-C113 mutant were not mental Figure 1C). However, whereas wild-type ESP1 signiﬁcantly different in this experiment as compared could completely rescue the spindle elongation defect to those in Figure 1, consistent with the conclusion associated with esp1-C113, the catalytic site mutant (esp1- that these spindles do not undergo anaphase spindle C1531S) could not. Therefore, like Mcd1 cleavage, elongation. anaphase spindle elongation functions of Esp1 require The protease activity of Esp1 is required for ana- endoproteolytic activity. phase spindle elongation in Mcd1-depleted cells: The temperature sensitivity of esp1 mutants corre- Whereas cleavage of Mcd1 requires Esp1 endoprotease lates with severity of the protease defect regardless of activity, another role attributed to Esp1, participation in where the mutation resides: One possibility to explain 2368 C. Baskerville, M. Segal and S. I. Reed

Figure 3.—Mitotic spindles fail to elongate in esp1 cells depleted of Mcd1 by Tev-protease cleavage. (A) Kinetics of budding in ESP1 and esp1-C113 cells containing a Tev-protease cleavable Mcd1 released from a-factor arrest under conditions of Tev protease induction (galactose) or repression (dextrose). (B) Average spindle length for the same Tev protease-induced time courses (n $ 120 for each point) described above. Error bars represent one standard deviation. (C) Proteolysis of Tev protease-cleavable Mcd1- 6xMyc. The 105-kDa species (solid arrow) corresponds to full-length Mcd1-Myc6. The 77-kDa species (thin arrow) corresponds to the C-terminal fragment of Mcd1-Myc6 (aa 181–621) after cleavage at amino acid 180 (aa180) by Tev protease. An uncharacterized 42-kDa fragment of Mcd1 (*) is also present in ESP1 lysates. why only highly temperature-sensitive esp1 mutants In Figure 5A, serial dilutions of wild-type and several experience defects in spindle elongation even in the previously described esp1 mutants are plated at 22°,30°, absence of Mcd1 is that spindle elongation requires only and 33.5°, respectively. While several of these have been low levels of protease activity. On the basis of this idea, reported to have spindle elongation defects in the less temperature-sensitive strains would possess sufﬁ- absence of cohesion (esp1-B3, esp1-B120, and esp1- cient residual Esp1 protease activity for spindle elonga- C113) (this study and Jensen et al. 2001), two (esp1-1 tion functions but not for Mcd1 cleavage at the and esp1-N5) have been reported to support spindle restrictive temperature. We therefore compared tem- elongation in the absence of cohesion (Severin et al. perature sensitivity on the basis of a plating assay carried 2001; Stegmeier et al. 2002). Whereas all strains plated out at several temperatures and ability to cleave Mcd1. efﬁciently at 22°, varying degrees of growth defect were

TABLE 4 Comparison of spindle lengths of ESP1 and esp1-C113 also expressing esp1-C1531S (protease active site mutation)

ESP1 esp1-C113 Statistical comparison Time (min) Mean length STD N Mean length STD Nt P 60 2.74 1.64 187 1.73 0.69 88 5.55 ,0.001 75 2.62 0.93 171 2.25 0.90 197 2.87 ,0.01 90 4.22 1.74 188 2.83 0.80 255 11.2 ,0.001 105 4.49 2.03 238 3.04 0.90 283 10.84 ,0.001 120 4.81 2.25 190 3.21 1.32 211 8.79 ,0.001 135 5.15 2.45 245 3.20 0.978 302 12.67 ,0.001 Regulation of Anaphase by Esp1 2369

mined by Western blotting and normalized to a-tubulin levels (Figure 5B). In wild-type cells, high levels of Mcd1 were present at 60 min but not at 0 or 120 min, indicating that Mcd1 is synthesized and then degraded. All esp1 mutants were defective at Mcd1 degradation to varying degrees. esp1-C113, the most temperature-sensitive allele appeared to be completely defective, in that Mcd1 levels were increased between 60 and 120 min. All other temperature-sensitive mutants tested decreased Mcd1 levels by a factor of two between 60 and 120 min. Therefore, on the basis of a combination of two criteria, growth at elevated temperature and ability of Esp1 to cleave Mcd1, esp1 temperature-sensitive mutants tested can be divided into three groups, with esp1-1 and esp1-N5 falling into the least sensitive group and esp1-C113 being the most temperature sensitive. esp1-B3 and esp1-B120 were in an intermediate category, on the basis of the plate test. However, esp1-B120 protease activity was not tested.

DISCUSSION Cleavage of Mcd1 is not the only essential mitotic function of Esp1: It has been previously suggested that tension exerted by the mitotic spindle is sufficient to pull apart sister chromatids once the counterforce of sister chromatid cohesion is neutralized (Uhlmann et al. 2000). This theory predicts that Mcd1 endopro- teolysis relieves the single barrier to anaphase chromo- Figure 4.—Proteolytic activity of ESP1 is required for ana- some segregation. Experiments supporting this idea phase elongation in the absence of sister chromatid cohesion. were conducted in cells that contained a repressible (A) Kinetics of budding in esp1-C113 mutant cells containing plasmids expressing either wild-type ESP1 or a protease active heterologous MET3-CDC20 expression construct and a site mutant esp1-C1531S released from a-factor arrest. (B) Av- TEV-cleavable mutant allele of Mcd1 (Uhlmann et al. erage spindle lengths for the same time courses (n $ 120 for 2000), similar to the one described here. The rationale each point). Error bars represent one standard deviation. for this experiment is that under conditions of MET3 promoter repression (high methionine), the depletion observed at the higher temperatures (Figure 5A). esp1-N5 of Cdc20 should maintain Pds1-dependent inhibition of and esp1-1 (Baum et al. 1988) were not temperature Esp1, which in this case is wild type. The validity of this sensitive at 30°, while esp1-B3, esp1-B120, and esp1-C113, experiment, however, depends on a number of uncharacterized in the current study or in our previous certain assumptions. First, basal expression of the study (Jensen et al. 2001), were quite defective for MET3-CDC20 construct might yield a low but significant growth at 30°. esp1-C113 showed slightly greater temper- amount of active Cdc20 leading to some Pds1 pro- ature sensitivity than the other mutants. None of the teolysis. Second, it is not clear whether all Esp1 mutants grew at 33.5°. To measure the temperature molecules are inhibited by Pds1 or whether Esp1 activity sensitivity of the mutant Esp1 proteases, strains were is completely inhibited by bound Pds1. In the context of constructed that contained the temperature-sensitive the scenarios suggested above, it may be that only low alleles and a 6xMyc-tagged endogenous allele of Mcd1. To levels of Esp1 activity or residual Esp1 activity character- compare efficiency of Mcd1 cleavage, strains were syn- istic of Pds1 inhibition are required for spindle elonga- chronized by a-factor arrest, released into medium at tion functions in contrast to high levels of activity 34°, and then after bud emergence, a-factor was added required for complete loss of sister chromatid cohesion. back (60 min after release). Aliquots were harvested at In another study where the temperature-sensitive Mcd1- the time of release from the a-factor block 60 min later, 73 mutant was combined with a temperature-sensitive which corresponds to late S phase and G2 for the wild- esp1 mutant (esp1-N5) spindle elongation proceeded in type strain and 120 min later, when all cells that a manner comparable to the single Mcd1-73 mutant completed mitosis would be blocked in G1 due to (Severin et al. 2001). However, the esp1-N5 mutation pheromone treatment. The rationale for the second a- derived from our own work (Jensen et al. 2001) is a factor block is to prevent resynthesis of Mcd1 once cells relatively leaky allele (Figure 5A) and is not defective in have completed mitosis. Mcd1 levels were then deter- spindle elongation (data not shown). Therefore, this 2370 C. Baskerville, M. Segal and S. I. Reed

Figure 5.—Analysis of temperature sensitivity of various esp1 mutant alleles. (A) Analysis of growth. Strains harboring the indicated mutant esp1 alleles were serially diluted and spotted on plates at the indicated temperatures. (B) Analysis of Esp1 protease function. Strains harboring the indicated esp1 alleles and containing 6xMyc-tagged Mcd1 were synchronized by a-factor block and released at 34°. Cells were harvested at the indicated times and extracts analyzed for Mcd1 levels by Western blot (left). Mcd1 levels were quantitated and normalized to a-tubulin levels (right). Note that a-factor was added 60 min after the ﬁrst block to prevent cells that had completed mitosis from progressing past G1.

experiment is not informative with respect to Esp1 required to physically interact for full proteolytic activity function. In a third study (Stegmeier et al. 2002), the of SSE. Indeed, interaction of the N-terminal and esp1-1 mutant, also leaky (Figure 5A), was combined caspase-like domains is required for proteolytic activity with an Mcd1 deletion, allowing spindle elongation, of all separases tested including those synthesized as a similarly to esp1-N5. Because these previous studies single polypeptide. Structural predictions suggest that either employed less stringent alleles or used indirect THR adopts an a–a superhelical structure characteristic methods to inactivate Esp1, we feel that they are of ARM/HEAT repeats. Similarly, structural predictions inconclusive with respect to a direct role for Esp1 in have also proposed a–a superhelical structures in the spindle elongation and not in direct conflict with the aminotermini of separases found in humans, Caenorhab- data presented here. ditis elegans, Arabidopsis, Schizosaccharomyces pombe, and The entire Esp1 protein participates in its proteolytic S. cerevisiae (Jager et al. 2004). The a–a superhelical functions: Sequence alignments reveal that Esp1 con- structure is associated with proteins that assume scaffold tains a caspase-like sequence at its carboxy terminus. or adapter roles, such as b-catenin, protein phosphatase The proteolytic activity associated with this region is 2A PR65/A subunit, and importin b. This suggests that essential for Mcd1 cleavage and cohesin dissociation the amino-terminal regions of separases are adapters from sister chromatids (Uhlmann et al. 2000). However, that might recruit substrates to the catalytic site. Consis- Esp1 contains a large amino-terminal extension from tent with this idea, blockage of the active cleft of yeast the proteolytic domain that comprises the bulk of the Esp1 with a substrate-mimetic inhibitor does not inhibit protein. The specific molecular functions associated association of Esp1 and Pds1, indicating that substrate with this region have yet to be fully elucidated. However, recruitment sites are distal from the catalytic site highlighting the critical function of the separase amino (Hornig et al. 2002). In the current study, we carried terminus, insect separase is expressed from two essential out a phenotypic analysis of a large number of temper- genes: Separase (Sse) encoding the protease catalytic ature-sensitive alleles targeted to three distinct regions domain and three rows (Thr) encoding a positive regula- encompassing the entire Esp1 protein. We do not know tory domain (Jager et al. 2001). These two proteins are the precise locations of the mutations, and it is likely due Regulation of Anaphase by Esp1 2371 to the degree of mutagenesis that each allele contains Ciosk, R., W. Zachariae,C.Michaelis,A.Shevchenko,M.Mann multiple point mutations. Nevertheless, in every case, the et al., 1998 An ESP1/PDS1 complex regulates loss of sister chromatid cohesion at the metaphase to anaphase transition in yeast. phenotype was identical to that defined on the basis of the Cell 93: 1067–1076. original temperature-sensitive esp1 allele identified, esp1-1 Cohen-Fix, O., J. M. Peters,M.W.Kirschner and D. Koshland, (Baum et al. 1988; McGrew et al. 1992). Specifically at 1996 Anaphase initiation in Saccharomyces cerevisiae is con- trolled by the APC-dependent degradation of the anaphase in- restrictive temperature, sister chromatid cohesion was hibitor Pds1p. Genes Dev. 10: 3081–3093. not lost, spindles failed to elongate, and eventually the Cottingham, F. R., L. Gheber,D.L.Miller and M. A. Hoyt, undivided nucleus translocated into the bud. We found 1999 Novel roles for Saccharomyces cerevisiae mitotic spindle motors. J. Cell Biol. 147: 335–350. no alleles that were permissive for sister chromatid Gruber, S., C. H. Haering and K. Nasmyth, 2003 Chromosomal separation but defective in spindle elongation. These cohesin forms a ring. Cell 112: 765–777. data suggest that the entire length of the Esp1 protein Guacci, V., D. Koshland and A. Strunnikov, 1997 A direct link between sister chromatid cohesion and chromosome condensa- contributes to an integral biochemical function that tion revealed through the analysis of MCD1 in S. cerevisiae. Cell targets multiple substrates and argues against a sub- 91: 47–57. strate-specific allocation of domains. However, because Hornig, N. C., P. P. Knowles,N.Q.McDonald and F. Uhlmann, 2002 The dual mechanism of separase regulation by securin. the mutant screen, although intensive, was probably not Curr. Biol. 12: 973–982. saturating, this conclusion has to be taken as tentative. Huang,J.N.,I.Park,E.Ellingson,L.E.Littlepage and D. Pellman, The Esp1 target regulating spindle elongation: To 2001 Activity of the APC(Cdh1) form of the anaphase-promoting complex persists until S phase and prevents the premature ex- date, two endoproteolytic targets of Esp1 have been pression of Cdc20p. J. Cell Biol. 154: 85–94. identified. Mcd1 is required for maintenance of sister Huisman, S. M., O. A. Bales,M.Bertrand,M.F.Smeets,S.I.Reed chromatid cohesion (Uhlmann et al. 1999) and Slk19, a et al., 2004 Differential contribution of Bud6p and Kar9p to microtubule capture and spindle orientation in S. cerevisiae. J. Cell kinetochore protein is required for anaphase spindle Biol. 167: 231–244. durability as well as for early mitotic exit (FEAR) Jager, H., A. Herzig,C.F.Lehner and S. Heidmann, 2001 Dro- pathway (Sullivan et al. 2001; Stegmeier et al. 2002). sophila separase is required for sister chromatid separation However, a non-Esp1-cleavable version of Slk19 confers and binds to PIM and THR. Genes Dev. 15: 2572–2584. Jager, H., B. Herzig,A.Herzig,H.Sticht,C.F.Lehner et al., little of any overt phenotype (Sullivan et al. 2001). 2004 Structure predictions and interaction studies indicate ho- Certainly, there is no defect in spindle elongation, mology of separase N-terminal regulatory domains and Drosoph- ruling out Slk19 as the Esp1 target whose cleavage is ila THR. Cell Cycle 3: 182–188. Jensen, S., M. Segal,D.J.Clarke and S. I. Reed, 2001 A novel role required for anaphase spindle elongation. Attempts to of the budding yeast separin Esp1 in anaphase spindle elonga- identify other Esp1 targets on the basis of the rather tion: evidence that proper spindle association of Esp1 is regulated by Pds1. J. Cell Biol. 152: 27–40. degenerate protease cleavage site consensus have failed addox hin allavarapu eh almon ullivan M , P., E. C ,A.M ,E.Y ,E.D.S et al., (S et al. 2004). Therefore, the relevant target(s) 1999 Microtubule dynamics from mating through the first zy- remain(s) unknown. One untested possibility is the gotic division in the budding yeast Saccharomyces cerevisiae. class of microtubule destabilizing motors that have been J. Cell Biol. 144: 977–987. McGrew, J. T., L. Goetsch,B.Byers and P. Baum, 1992 Re- shown to antagonize spindle elongation. Kar3 and Kip3 quirement for ESP1 in the nuclear division of Saccharomyces have been shown to restrain the spindle elongating cerevisiae. Mol. Biol. Cell 3: 1443–1454. activities of Kip1 and Cin8, also microtubule motor pro- Pan, J., and R. H. Chen, 2004 Spindle checkpoint regulates Cdc20p traight ottingham stability in Saccharomyces cerevisiae. Genes Dev. 18: 1439– teins (S et al. 1998; C et al. 1999). It 1451. is conceivable that Esp1 is responsible for inactivating Pearson, C. G., P. S. Maddox,E.D.Salmon and K. Bloom, Kar3 and/or Kip3 (or positive regulators of these pro- 2001 Budding yeast chromosome structure and dynamics during mitosis. J. Cell Biol. 152: 1255–1266. teins) at the metaphase/anaphase transition, thereby Prinz, S., E. S. Hwang,R.Visintin and A. Amon, 1998 The regula- potentiating spindle elongation. Alternatively, Esp1 might tion of Cdc20 proteolysis reveals a role for APC components target negative regulators of Kip1 and/or Cin8, allowing Cdc23 and Cdc27 during S phase and early mitosis. Curr. Biol. 8: 750–760. them to promote spindle elongation. The targeting of Richardson, H. E., C. Wittenberg,F.Cross and S. I. Reed, spindle motors or associated proteins by Esp1 would be 1989 An essential G1 function for cyclin-like proteins in yeast. consistent with localization of Esp1 to spindle during Cell 59: 1127–1133. everin yman iatti anaphase (Jensen et al. 2001). S , F., A. A. H and S. P , 2001 Correct spindle elongation at the metaphase/anaphase transition is an APC- This work was supported by National Institutes of Health grant GM- dependent event in budding yeast. J. Cell Biol. 155: 711–718. haner ampbell teinbach iepmans 38328 to S.I.R. and by grants from Cancer Research UK and The Isaac S , N. C., R. E. C ,P.A.S ,B.N.G , almer Newton Trust to M.S. A. E. P et al., 2004 Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol. 22: 1567–1572. hirayama oth alova asmyth Cdc20 LITERATURE CITED S ,M.,A.T ,M.G and K. N ,1999 APC promotes exit from mitosis by destroying the anaphase inhibitor Ausubel,F.M.,R.Brent,R.E.Kingston,D.D.Moore,J.G.Seidman Pds1 and cyclin Clb5. Nature 402: 203–207. et al. (Editors), 2002 Short Protocols in Molecular Biology: A Com- Simpson, G., A. Roe and R. Lewontin, 1960 Quantitative Zoology. pendium of Methods From Current Protocols in Molecular Biology, Ed. Harcourt, Brace, New York. 5. John Wiley & Sons, New York. Stegmeier, F., R. Visintin and A. Amon, 2002 Separase, polo ki- Baum, P., C. Yip,L.Goetsch and B. Byers, 1988 A yeast gene essen- nase, the kinetochore protein Slk19, and Spo12 function in a tial for regulation of spindle pole duplication. Mol. Cell. Biol. 8: network that controls Cdc14 localization during early anaphase. 5386–5397. Cell 108: 207–220. 2372 C. Baskerville, M. Segal and S. I. Reed

Straight, A. F., W. F. Marshall,J.W.Sedat and A. W. Murray, Uhlmann,F.,F.Lottspeich and K. Nasmyth, 1999 Sister-chromatid 1997 Mitosis in living budding yeast: anaphase A but no meta- separation at anaphase onset is promoted by cleavage of the phase plate. Science 277: 574–578. cohesin subunit Scc1. Nature 400: 37–42. Straight, A. F., J. W. Sedat and A. W. Murray, 1998 Time-lapse Uhlmann, F., D. Wernic,M.A.Poupart,E.V.Koonin and microscopy reveals unique roles for kinesins during anaphase K. Nasmyth, 2000 Cleavage of cohesin by the CD clan protease in budding yeast. J. Cell Biol. 143: 687–694. separin triggers anaphase in yeast. Cell 103: 375–386. Sullivan, M., and F. Uhlmann, 2003 A non-proteolytic function of Wach, A., A. Brachat,R.Pohlmann and P. Philippsen, 1994 New separase links the onset of anaphase to mitotic exit. Nat. Cell heterologous modules for classical or PCR-based gene disrup- Biol. 5: 249–254. tions in Saccharomyces cerevisiae. Yeast 10: 1793–1808. Sullivan, M., C. Lehane and F. Uhlmann, 2001 Orchestrating ana- Yamamoto, A., V. Guacci and D. Koshland, 1996 Pds1p, an inhib- phase and mitotic exit: separase cleavage and localization of itor of anaphase in budding yeast, plays a critical role in the APC Slk19. Nat. Cell Biol. 3: 771–777. and checkpoint pathway(s). J. Cell Biol. 133: 99–110. Sullivan, M., N. C. Hornig,T.Porstmann and F. Uhlmann, Zhu, G., P. T. Spellman,T.Volpe,P.O.Brown,D.Botstein et al., 2004 Studies on substrate recognition by the budding yeast sep- 2000 Two yeast forkhead genes regulate the cell cycle and pseu- arase. J. Biol. Chem. 279: 1191–1196. dohyphal growth. Nature 406: 90–94. Tan, A. L., P. C. Rida and U. Surana, 2005 Essential tension and constructive destruction: the spindle checkpoint and its regulatory links with mitotic exit. Biochem. J. 386: 1–13. Communicating editor: T. Stearns