DOCSLIB.ORG

Inhibition of RNA Polymerase II Transcription By

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Inhibition of RNA Polymerase II Transcription By Proc. Natl. Acad. Sci. USA Vol. 90, pp. 7186-7190, August 1993 Biochemistry Inhibition of RNA polymerase II transcription by oligonucleotide- RecA protein filaments targeted to promoter sequences (human imiunodeficiency virus long terminal repeat/parvovirus/minute virus of mice) EFIM I. GOLUB*, CHARLES M. RADDING, AND DAVID C. WARD Departments of Genetics, and Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, CT 06510 Communicated by Donald M. Crothers, May 20, 1993 ABSTRACT In the presence of RecA protein, which plays promoter and several regulatory elements which control a major role in genetic recombination in Escherichia colt, an proviral DNA expression (15); (ii) a 600-bp EcoRI-HindIII oligodeoxyribonucleotide can find its homologous counterpart fragment ofplasmid pYT104-1 (16,17), which includes the P6 in double-stranded DNA and form triple-stranded structures. promoter of the human parvovirus B19; part of the B19 A triple-stranded structure formed by an oligonucleotide with sequence relevant to our study is shown in Fig. 1B; and (iii) a sequence overlapping essential regulatory elements of a viral a plasmid, pMB415 digested by Pst I (18), which carries the promoter, such as TATA or GC boxes, inhibited in vitro P4 promoter of minute virus of mice (MVM). Run-off tran- transcription driven by RNA polymerase II. An oligonucleotide scripts made from the HIV-1 LTR, and the P6 and P4 with eight nucleotides homologous to its target suppressed RNA parvovirus promoters were 335, 250, and 210 nucleotides polymerase H activity in HeLa cell extracts. This procedure long, respectively. offers a potential alternative to the usual mutational analysis of The ODN sequences used in this study are listed in Table transcriptional promoters. 1. ODN PBS-T342, which does not share sequence homology with any ofthe templates, served as the heterologous control. Eukaryotic transcription is regulated by complex interactions ODNs were synthesized on a model 394 DNA synthesizer ofvarious sequence-specific DNA-binding proteins with pro- (Applied Biosystems) and purified by separation in a poly- moters (1). Polypurine or polypyrimidine oligodeoxyribonu- acrylamide gel or by using NENSorbPrep cartridges (New cleotides (ODNs) can nonenzymatically form a sequence- England Nuclear). specific triple helix by hydrogen binding to polypyrimidine or Formation of Oligonucleotide Joints by RecA Protein. RecA polypurine tracts within duplex DNA (2-4). Formation of a protein was purified as described (19). ODN at 10 ,uM was triple helix in a region ofDNA that is involved in interactions mixed with 5 ,uM RecA protein in a solution containing 25 with proteins of the RNA polymerase II transcription com- mM Tris acetate (pH 7.2), 2 mM magnesium acetate, and 1 plex can prevent the binding of protein factors and thereby mM adenosine 5'-[L-thio]triphosphate. The 10-,ul mixture the inhibition of was incubated for 5 min at 37°C to allow RecA protein to coat suppress transcription (5-9). However, the ODN. Then, 2 ,ul of template DNA (490-bp Ava I-EcoRI transcription by oligopurine or oligopyrimidine sequences fragment of pEG602, 600-bp EcoRI-HindIII fragment of can be achieved only if the appropriate tracts exist in the pYT104-1, or Pst I-digested pBM415 was added (=30 ,uM) in regulatory sequences. By contrast, ODNs of arbitrary se- 30 mM magnesium acetate. After 15-20 min at 37°C, the quence, when coated by the RecA protein ofEscherichia coli mixture was used as a source of template for in vitro (10) in the presence of ATP or its nonhydrolyzable analog transcription. adenosine 5'-[y-thio]triphosphate can pair with homologous Run-Off Transcription. The transcription mixture con- duplex DNA-RecA protein and form a triple-stranded struc- tained 5 Al (=8 transcriptional units) ofHeLa nuclear extract, ture which is stable in the presence of RecA protein (11). 6 Al of transcription buffer [20 mM Hepes, pH 7.9/100 mM These nucleoprotein complexes, which include RecA protein KCl/0.2 mM EDTA/0.5 mM dithiothreitol/20% (vol/vol) and three strands of DNA, have been shown to prevent the glycerol], 1,ul ofribonucleotide mixture (10 mM ATP/10 mM original duplex DNA sequence from being methylated or CTP/10 mM UTP/0.4 mM GTP), 1 ,ul of [a-32P]GTP (3000 digested by restriction enzymes (12). Ci/mmol, 10 mCi/ml; New England Nuclear; 1 Ci = 37 GBq), Recently, we found that a triple-stranded structure formed and 0.2 Al (50 ng) of plasmid DNA used as internal standard. between ODN-RecA complexes and duplex DNA at specific The mixture was added to 12 ul of the template mixture sequences upstream or downstream of a transcriptional start prepared as described above. After 30 min of incubation at site could inhibit either initiation or elongation of transcrip- 30°C, transcription was stopped by adding 175 ,l4 of stop tion by T3 or T7 phage RNA polymerases (13). In this buffer (0.3 M Tris HCl, pH 7.4/0.3 M sodium acetate/0.5% communication, we describe experiments which show that SDS/2 mM EDTA with tRNA at 3 ,ug/ml). Reaction products specific ODN-RecA protein filaments can markedly inhibit were extracted with 200 Al of phenol/chloroform/isoamyl initiation of transcription by eukaryotic RNA polymerase II. alcohol (25:24:1, vol/vol) and precipitated with 3 volumes of 95% ethanol. Half of the RNA sample was mixed with an MATERIALS AND METHODS equal volume offormamide dye mix (98% formamide/10 mM EDTA/0.1% xylene cyanol/0.1% bromphenol blue), heated Plasmids and ODNs. Three different DNAs were used as a 5 min at 90°C, and subjected to electrophoresis in a denatur- template for transcription: (i) a 490-bp Ava I-EcoRI fragment ing 8% polyacrylamide gel. The gel was autoradiographed for (Fig. 1A) of plasmid pEG602 (14) which carries sequences 12-72 hr at -70°C with an intensifying screen. To quantitate from the long terminal repeat (LTR) of human immunodefi- in vitro transcripts, densitometric scanning was carried out ciency virus type 1 (HIV-1); the LTR contains an HIV-1 Abbreviations: HIV-1, human immunodeficiency virus type 1; LTR, The publication costs ofthis article were defrayed in part by page charge long terminal repeat; MVM, minute virus of mice; ODN, oligode- payment. This article must therefore be hereby marked "advertisement" oxyribonucleotide. in accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. 7186 Downloaded by guest on October 1, 2021 Biochemistry: Golub et al. Proc. Natl. Acad. Sci. USA 90 (1993) 7187 A TgTA ox CC U') . Ln cli co to r- oo v enhancers '? "I GC-b... --, r+ -41 --i I16,II - .-N~~~I,'1 iS EG10730 EG10633 EGl 6050 EG 10842 B -80 -70 -60 GC-box (distal) `50 GC-box (proximal) -4 GTTAGTTTTGTAACGGTTAAA TGGGCGGACIGTAGGCGGGGAI GTTAGTTTTGTAACGGTTAAAATGGGCGGAGCG (EG11033) CGGTTAAAATGGGCGGAGCG (EG11520) C C C C C T C C C CCCCC CGGGCGGAGCG (EG11425) CCC CCC CCC CCC T T TGTTAAAATGG (EG11825) +1 -30 TATA-box -20 -10 +10 +20 CTACA TATATAT GCACGGTACTGCCGCAGCTCTTTCTTTCTGGGCTGCTTTTTCCTGGACT CTACAGTATATATAGCACGGTACTGCCGCAGCT (EG11133) CTTTCTTTCTGGGCTGCTTTTTCCTGGACT (EG11330) FIG. 1. Maps offragments of DNA that were used as a template for transcription, and position of ODNs. (A) Ava I-EcoRI fragment of HIV-1 LTR (from plasmid pEG602). (B) Part ofEcoRI-HindIII fragment ofplasmid pYT104-1 that carries promoter P6 ofhuman parvovirus B19. Arrow shows the transcriptional start site. Numbers depict nucleotide position relative to the transcriptional start site. Lowercase letters indicate ODN sequences that are not homologous to duplex DNA. by using a gel scanner (Molecular Dynamics). To estimate the was used as a template. In the presence of RecA, ODN amounts of specific transcripts, their band intensities were EG10050, whose sequence overlaps a TATA box (see Fig. 1A normalized by dividing by the intensity of the band produced and Table 1), strongly inhibited transcription (Fig. 2, compare by transcription of the internal standard. HeLa cell nuclear lanes 2 and 3). Similarly, ODN EG10633, whose sequence extract and unlabeled ribonucleotides were purchased from overlaps three GC boxes implicated in transcription from the Promega. HIV-1 promoter, also inhibited transcription in a RecA- dependent fashion, albeit to a lesser degree (compare lanes 4 RESULTS and 5). In contrast, two other ODNs, PBS-T342 and EG10730, had no effect on transcription. The former of these ODNs Inhibition of Transcription from an HIV-1 LTR Promoter. does not share any homology with the template, whereas the Fig. 2 shows results of an experiment with in vitro run-off latter overlaps HIV-1 enhancers which are not functional in transcription in which a 600-bp fragment of the HIV-1 LTR uninduced or uninfected HeLa cells (see below). ODN Table 1. ODNs used in this study No. of Name nucleotides Sequence Comment PBS-T342 42 ATTACGCCAAGCTCGAAATTAACCCTCACTAA Has no homology to any template used in AGGGAACAAA this study ("heterologous control") EG100so 50 GATGCTGCAIAIMGCAGCTGCTTTTTGCCTG Homologous to -37 to +13 TACTGGGTCTCTCTGGTT of HIV-1 LTR; overlaps TATA box EG10633 33 GAGGCGTGGCC GG GG AG C Homologous to -78 to -46 of HIV-1 LTR; overlaps GC boxes EG10730 30 CTACAGGGACTTTCCGTTGGGGACTTTCC Homologous to -111 to -82 of HIV-1 LTR; overlaps enhancers EG10842 42 CCTTTTTAAAGACCGTAAAGAAAAATAAGCAC Homologous to +244 to +285 of HIV-1 AAGTTTTATC LTR downstream from HIV-1 promoter EG11033 33 GTTAGTTTTGTAACGGTTAAAAITGCGGAGICG Homologous to -81 to -49 of P6 promoter; overlaps distal GC box EG11133 33 CTACAGIAIATAIAGCACGGTACTGCCGCAGCT Homologous to -38 to -6 of P6 promoter; overlaps TATA box EG11330 30 CTTTCTTTCTGGGCTGCTTTTTCCTGGACT Homologous to -5 to +25 of P6 promoter EG11425 25 CCCCCTCCCCCCCCCGGGCGGAGCG Sequence of last 10 nucleotides is homologous to -58 to -49 of P6 promoter; overlaps part of distal GC box EG11825 25 CCCCCCCCCCCCTTTGTTAAAAITG Sequence of last 10 nucleotides is homologous to -66 to -57 of P6 promoter; overlaps 3 nucleotides of distal GC box EG11520 20 CGGTTAAAAT CGGAGCG Homologous to -68 to -49 of P6 promoter; overlaps distal GC box Sequences homologous to TATA boxes, GC boxes, or HIV-1 enhancers are underlined.
Load more

Recommended publications
  • System with Positive Induction by Glucocorticoid and Metal Ions
    MOLECULAR AND CELLULAR BIOLOGY, Dec. 1990, p. 6141-6151 Vol. 10, No. 12 0270-7306/90/126141-11$02.00/0 Copyright ©3 1990, American Society for Microbiology A Combination of Derepression of the lac Operator-Repressor System with Positive Induction by Glucocorticoid and Metal Ions Provides a High-Level-Inducible Gene Expression System Based on the Human Metallothionein-JIA Promoter MICKEY C.-T. HUt* AND NORMAN DAVIDSON Division ofBiology, California Institute of Technology, Pasadena, California 91125 Received 11 June 1990/Accepted 24 September 1990 We and others have introduced the use of the lac operator-repressor system as a method for providing inducible gene expression for gene transfer experiments in animal cells (M. C.-T. Hu, and N. Davidson, Cell 48:555-566, 1987; J. Figge, C. Wright, C. J. Collins, T. M. Roberts, and D. M. Livingston, Cell 52:713-722, 1988). To improve the dynamic range of such an inducible system, we have investigated the effects of combining the relief by isopropyl-4-D-thiogalactoside (IPTG) of negative control by the lac system with positive induction by the natural inducers glucocorticoids and cadmium ion for a system based on the human metallothionein-HA gene promoter. We used the chloramphenicol acetyltransferase gene as a reporter gene and inserted a lacO sequence into the promoter between the GC box and metal-responsive element 1, between metal-responsive element 1 and the TATA box, or between the TATA box and the transcription start site. Surprisingly, all of these insertions had a significant inhibitory effect on promoter activity even in the absence of repressor.
    [Show full text]
  • Focused Transcription from the Human CR2/CD21 Core Promoter Is Regulated by Synergistic Activity of TATA and Initiator Elements in Mature B Cells
    Cellular & Molecular Immunology (2016) 13, 119–131 ß 2015 CSI and USTC. All rights reserved 1672-7681/15 $32.00 www.nature.com/cmi RESEARCH ARTICLE Focused transcription from the human CR2/CD21 core promoter is regulated by synergistic activity of TATA and Initiator elements in mature B cells Rhonda L Taylor1,2, Mark N Cruickshank3, Mahdad Karimi2, Han Leng Ng1, Elizabeth Quail2, Kenneth M Kaufman4,5, John B Harley4,5, Lawrence J Abraham1, Betty P Tsao6, Susan A Boackle7 and Daniela Ulgiati1 Complement receptor 2 (CR2/CD21) is predominantly expressed on the surface of mature B cells where it forms part of a coreceptor complex that functions, in part, to modulate B-cell receptor signal strength. CR2/CD21 expression is tightly regulated throughout B-cell development such that CR2/CD21 cannot be detected on pre-B or terminally differentiated plasma cells. CR2/CD21 expression is upregulated at B-cell maturation and can be induced by IL-4 and CD40 signaling pathways. We have previously characterized elements in the proximal promoter and first intron of CR2/CD21 that are involved in regulating basal and tissue-specific expression. We now extend these analyses to the CR2/CD21 core promoter. We show that in mature B cells, CR2/CD21 transcription proceeds from a focused TSS regulated by a non-consensus TATA box, an initiator element and a downstream promoter element. Furthermore, occupancy of the general transcriptional machinery in pre-B versus mature B-cell lines correlate with CR2/CD21 expression level and indicate that promoter accessibility must switch from inactive to active during the transitional B-cell window.
    [Show full text]
  • Cat Box Gene Transcription
    Cat Box Gene Transcription Melvyn recommencing perversely. Dangerously abstemious, Dante damns oblong and toggles setter. Ligular Ferdie regiments eftsoons. Department of the identity of the proteins in gene transcription start site are shown to definitively answer Here's JAK2B The Janus kinase 2 gene JAK2 codes for a tyrosine kinase. The need for equity and technological development. Dna polymerase required for pcr results in ne homeostasis during plant biotechnology is oriented so that cats are provided important environmental pressure and. How are sigma factors regulated? Fibronectin and its receptors. The position of indicated RPGs ORF are shown above of the tracks. To provide closure and to make sure students understand the basic concepts of transcription and translations, depending on the changing requirements of the organism. Dna strand of endometriosis patients in mice or in a cooperative involvement of cat gene transcription bacteria a great idea that. Group work activity to practise asking and answering questions. Engineers often use models to simplify complex processes; in this activity, and special activities. These oligonucleotides carried a stop codon in frame. This exotic blend makes him this unique and valuable cat to be associated with. It is likely that competitive DNA binding of Dof proteins with different activity for transactivation may provide a mechanism for transcriptional regulation. The initiation of gene transcription requires the ordered sequential assembly of abundant of. Fungal small rna responsible for activation domain. MYB transcription factors as regulators of phenylpropanoid metabolism in plants. These differences are reflected by subtle nucleotide variations in the sequences spanning OC box I and the TATA box in the three species.
    [Show full text]
  • Distinct Factors with Spl and NF-A Specificities Bind to Adjacent Functional Elements of the Human U2 Snrna Gene Enhancer
    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Distinct factors with Spl and NF-A specificities bind to adjacent functional elements of the human U2 snRNA gene enhancer Manuel Ares, Jr., 1 Jo-San Chung, Linda Giglio, and Alan M. Weiner Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, Connecticut 06510 USA The enhancer regions of mammalian and avian U1 and U2 small nuclear RNA (snRNA) genes are unusual in containing the sequence GGGCGG (GC-box) immediately upstream from the sequence ATGCAAAT (octamer). We made point mutations in the human U2 snRNA enhancer and tested them for the ability to direct U2 transcription in HeLa cells, as well as for the ability to form complexes with factors present in HeLa cell nuclear extracts. We show that neither the GC-box nor the octamer alone is sufficient for enhancer activity in vivo. Mutations in the GC-box reduce the ability of enhancer DNA fragments to bind a factor (probably Spl), whereas mutations in the octamer independently reduce the ability to bind a second factor (probably nuclear factor A, NF-A). The results suggest that adjacent binding of Spl and NF-A is an important feature of some U- snRNA gene enhancers. [Key Words: U2 snRNA~ U2 enhancer~ enhancer binding proteins; transcription factors] Received July 7, 1987~ revised version accepted August 12, 1987. The stable small nuclear RNAs U1-U5 (U-snRNAs) are moter in transfected HeLa ceils were not successful (M. encoded by a special class of genes apparently tran- Ares, unpubl.).
    [Show full text]
  • The Leukemia Associated Nuclear Corepressor ETO Homologue Genes MTG16 and MTGR1 Are Regulated Differently in Hematopoietic Cells
    Ajore et al. BMC Molecular Biology 2012, 13:11 http://www.biomedcentral.com/1471-2199/13/11 RESEARCH ARTICLE Open Access The leukemia associated nuclear corepressor ETO homologue genes MTG16 and MTGR1 are regulated differently in hematopoietic cells Ram Ajore1*, Parveen Kumar1, Rakesh Singh Dhanda2, Urban Gullberg1 and Inge Olsson1 Abstract Background: MTG16, MTGR1 and ETO are nuclear transcriptional corepressors of the human ETO protein family. MTG16 is implicated in hematopoietic development and in controlling erythropoiesis/megakaryopoiesis. Furthermore, ETO homologue genes are 3’participants in leukemia fusions generated by chromosomal translocations responsible of hematopoietic dysregulation. We tried to identify structural and functional promoter elements of MTG16 and MTGR1 genes in order to find associations between their regulation and hematopoiesis. Results: 5’ deletion examinations and luciferase reporter gene studies indicated that a 492 bp sequence upstream of the transcription start site is essential for transcriptional activity by the MTG16 promoter. The TATA- and CCAAT-less promoter with a GC box close to the start site showed strong reporter activity when examined in erythroid/ megakaryocytic cells. Mutation of an evolutionary conserved GATA -301 consensus binding site repressed promoter function. Furthermore, results from in vitro antibody-enhanced electrophoretic mobility shift assay and in vivo chromatin immunoprecipitation indicated binding of GATA-1 to the GATA -301 site. A role of GATA-1 was also supported by transfection of small interfering RNA, which diminished MTG16 expression. Furthermore, expression of the transcription factor HERP2, which represses GATA-1, produced strong inhibition of the MTG16 promoter reporter consistent with a role of GATA-1 in transcriptional activation.
    [Show full text]
  • The Leukemia Associated Nuclear Corepressor ETO Homologue Genes MTG16 and MTGR1 Are Regulated Differently in Hematopoietic Cells
    The leukemia associated nuclear corepressor ETO homologue genes MTG16 and MTGR1 are regulated differently in hematopoietic cells Ajore, Ram; Kumar, Parveen; Dhanda, Rakesh Singh; Gullberg, Urban; Olsson, Inge Published in: BMC Molecular Biology DOI: 10.1186/1471-2199-13-11 2012 Link to publication Citation for published version (APA): Ajore, R., Kumar, P., Dhanda, R. S., Gullberg, U., & Olsson, I. (2012). The leukemia associated nuclear corepressor ETO homologue genes MTG16 and MTGR1 are regulated differently in hematopoietic cells. BMC Molecular Biology, 13(11). https://doi.org/10.1186/1471-2199-13-11 Total number of authors: 5 General rights Unless other specific re-use rights are stated the following general rights apply: Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Read more about Creative commons licenses: https://creativecommons.org/licenses/ Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. LUND UNIVERSITY PO Box 117 221 00 Lund +46 46-222 00 00 Ajore et al.
    [Show full text]
  • Gene Regulation in Eukaryotes
    Gene Regulation in Eukaryotes • All cells in an organism contain all the DNA: – all genetic info • Must regulate or control which genes are turned on in which cells • Genes turned on determine cells’ function – E.g.) liver cells express genes for liver enzymes but not genes for stomach enzymes 1 Proteins act in trans DNA sites act only in cis • Trans acting elements (not DNA) can diffuse through cytoplasm and act at target DNA sites on any DNA molecule in cell (usually proteins) • Cis acting elements (DNA sequences) can only influence expression of adjacent genes on same DNA molecule 2/27 Eukaryotic Promoters trans-acting proteins control transcription from class II (RNA pol II) promoters • Basal factors bind to the core promoter – TBP – TATA box binding protein – TAF – TBP associated factors • RNA polymerase II binds to basal factors 3 Fig. 17.4 a Eukaryotic Promoters • Promoter proximal elements are required for high levels of transcription. • They are further upstream from the start site, usually at positions between -50 and -500. • These elements generally function in either orientation. • Examples include: – The CAAT box consensus sequence CCAAT – The GC box consensus sequence GGGCGG – Octamer consensus sequence AGCTAAAT 4 Regulatory elements that map near a gene are cis-acting DNA sequences Core • cis-acting elements – Core Promoter – Basal level expression • Binding site for TATA-binding protein and associated factors – Promoter Proximal Elements - True level of expression • Binding sites for transcription factors 5 Eukaryotic Promoter Elements • Various combinations of core and proximal elements are found near different genes. • Promoter proximal elements are key to gene expression.
    [Show full text]
  • Chapter 31 Lecture Notes
    BCH 4054 Fall 2000 Chapter 31 Lecture Notes Slide 1 Chapter 31 Transcription and Regulation of Gene Expression Slide Early labeling experiments showed 2 ribosomes as the site of protein Messenger RNA synthesis. An alternate hypothesis was that each protein had its own • Central Dogma (Francis Crick, 1958) specific ribosome where it is made. • DNA ® RNA ® Protein (Fig 31.1) • Jacob-Monod Hypothesis: Four properties • Base composition reflecting DNA • Heterogeneous in size • Can associate with ribosomes • High rate of turnover Slide All forms are made by copying a 3 DNA template (excepting some Other Forms of RNA RNA viruses), so the process of transcription is common to all. • Ribosomal RNA • Major RNA component of cell • Transfer RNA • Small RNA molecules carrying the amino acids in protein synthesis • Eukaryotic “small nuclear” RNA • mRNA processing in eukaryotes • Viral RNA Chapter 31, page 1 Slide 4 Transcription, General Features • A “template” DNA strand is copied using the Watson Crick base pairing rules • See Fig Page 1016 for nomenclature convention • Only small segments of DNA copied at any one time. • Must be specific start and stop sites • Copying must be regulated • Chemistry is similar to that of DNA polymerase • Nucleoside triphosphates add to 3’ OH end with pyrophosphate as the product. Slide 5 Transcription, General Features, con’t. • DNA separates and forms a “transcription bubble” • No 3’-5’ proofreading, so error rate is about 1 in 104 • Topoisomerases needed to introduce negative supercoiling in front, remove it in
    [Show full text]
  • RNA Structure & Synthesis
    (2nd) BIOCHEMISTRY NOTES RNA structure & synthesis [ ☺ ^ `\S ^ / - . – , !"# + P"& ]()* +)& 5a +4 2301 ،،، ا .. رآ ☺ RNA Structure & synthesis ل : Team leader وا ه اا رة ا ه وأ : ﺃﺑﻮ ﻳﺴﺮﺍ ﻋﺒﺪﺍﻟﻌﺰﻳﺰ ﺍﻟﱰﻛﻲ Ocean Blue eye ☺ ﻭﺟﻨﻮﺩﻧﺎ ﺍﻬﻮﻟﲔ (2nd) BIOCHEMISTRY NOTES RNA structure & synthesis RNA STRUCTURE & SYNTHESIS C. Transcription from bacterial operons : ◙ structural genes ( that code for the enzymes of a metabolic pathway ) ◙ regulatory genes ( that determine their transcription as a single long piece of mRNA ) - in bn bacteriab acteria , structural genes are often found grouped together on chromosome together with the regulatory genes ( هااااااااام )(thus , the genes are coordinately expressed (MCQ • ( this entire package is referred to as an operonoperon) & we will speak about the best understood examples –lactose operon of E.coli -- which illustrates both +ve & ---ve-ve regulation . 1. the lactose operon (lac operon) : ( is coordinated expressed gene ) • It (structural portion )(MCQ) codes for 3 enzymes involved in the catabolism of the sugar lactose : lacZ genes lacy genes lacA genes -codes for β– -codes for permease -codes for galactosidase thiogalactoside transacetylase -(which hydrolyzes -(that facilitates the -(its physiologic function lactose to galactose & movement of galactose is un known) glucose into the cell these enzymes are all produced when lactose is availableavailable to the cell (but glucose is notnot) (MCQ) - note : bacteria use glucose as a fuel in preference to any other sugar Biochemistry 1 (2nd) BIOCHEMISTRY NOTES RNA structure & synthesis • the regulatory portion (MCQ) of the operon consists of ::: (MCQ)(always come ) I. catabolite gene activator protein ( CAP , sometimes called : cAMP regulatory portion or CRP) binding site II. the promoter (P): where RNA polymerase binds IIIIIIIII.III ..
    [Show full text]
  • Is There an Aesthetics in Golden Ratio As Regards to the Common Cis-Regulatory Elements Versus to Atomic Numbers of Elements
    Neurology and Neuroscience Reports Review Article ISSN: 2631-4010 Is there an aesthetics in golden ratio as regards to the common cis-regulatory elements versus to atomic numbers of elements with respect to Quantum perspective model? Tahir Ölmez* Selçuk University, Social Sciences Dept., Selcuklu/Konya, Turkey Abstract One of the modern management and organization theory is system approach theory which is consisted of mathematics, biology and genetics. …etc. With the holistic perspective to variety of scientific disciplines have many sustainable relationships between each of them. As regards to numbers and genetic algorithms, system approach is not only seen in golden ratio but also sequenced in nucleotide bases in DNA, too. So at macro level, either in common regulations of many sciences or at micro level in gene expressions, quantum perspective model can be visible. This article is searching for the relation between identical cis regulatory elements and golden mean. Namely, atomic mass structures of TATA Box, CAAT box and GC box relations with golden mean. Researching of TATAA box and CAAT Box gene regulation, the outcome of calculations is approximately very likely to golden mean numbers [1]. Even in one of the step of DNA transcription named as GC Box is also surprisingly unique resemblance to special mathematics number “142”. In sum, pertaining to quantum perspective model at minor level, interrelationship of sciences is ranged from mathematics (Pi and Phi numbers), biochemistry (nucleotide bases and chemical structures), genetics (transcription elements) and also aesthetics in many biological living creatures. At last, the outcome of this article is not only related to golden ratio in mathematics but also nucleotide sequence in cis regulatory elements during transcription in genetics.
    [Show full text]
  • Cdna Cloning and Transcriptional Properties of a Novel GO Box-Binding Protein, BTEB2
    Nucleic Acids Research, 1993, Vol. 21, No. 7 1527-1532 cDNA cloning and transcriptional properties of a novel GO box-binding protein, BTEB2 Kazuhiro Sogawa, Hiroaki Imataka1, Yuichi Yamasaki, Hiroshi Kusume, Hisaku Abe and Yoshiaki Fujii-Kuriyama Department of Chemistry, Faculty of Science, Tohoku University, Sendai 980 and 'institute for Virus Research, Kyoto University, Kyoto 606, Japan Received February 5, 1993; Revised and Accepted March 8, 1993 DDBJ accession no. D14520 ABSTRACT We have cloned a cDNA for a novel GC box-binding transcription of eukaryotic genes through a limited number of protein designated BTEB2 from a human placenta cis-acting elements located in their promoter region. cDNA library using rat BTEB cDNA (Imataka et al. GC box sequence is one of the most widely distributed (1992). EMBO J. 11,3663-3671. as a hybridization promoter elements in cellular and viral genes (1, 2). Tjian and probe. BTEB2 consists of 219 amino acids and contains his colleagues found Spl as the GC box-binding factor, and three contiguous zinc finger motifs at its C-terminus. established its role on transcription by elucidating its molecular The zinc finger domains showed 59% and 64% properties (3, 4). SpI contains three contiguous zinc finger motifs sequence similarity to those of Spl and BTEB, and glutamine-rich domains as the DNA-binding and respectively. Adjacent to the N-terminal of the zinc transcriptional activation domains, respectively. Although Spl finger motifs, a short sequence rich in basic amino has long been thought to be a unique GC box-binding protein, acids is conserved between BTEB2 and Spl.
    [Show full text]
  • ERK Pathway Regulates EZH2 Overexpression in Association with Aggressive Breast Cancer Subtypes
    Oncogene (2011) 30, 4118–4128 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE MEK–ERK pathway regulates EZH2 overexpression in association with aggressive breast cancer subtypes S Fujii1, K Tokita1, N Wada2, K Ito3, C Yamauchi1, Y Ito4 and A Ochiai1 1Pathology Division, Research Center for Innovative Oncology, National Cancer Center at Kashiwa, Kashiwa, Chiba, Japan; 2Breast Surgery Division, National Cancer Center Hospital East, Kashiwa, Chiba, Japan; 3Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki, Japan and 4Cancer Science Institute of Singapore, Proteos, Singapore EZH2 overexpression occurs in various malignancies and some inactivation (Plath et al., 2003). On the other is associated with a poor outcome. We have so far hand, there have been several reports that overexpres- demonstrated that EZH2 downregulates the important sion of EZH2 occurs in various malignancies and that it genes such as E-cadherin and RUNX3 by increasing is associated with a poor outcome in prostate cancer and histone H3K27 trimethylation. However, the mechanism breast cancer (Varambally et al., 2002; Kleer et al., of EZH2 overexpression in various cancer cells remains 2003). In an attempt to determine the functional role of unclear. In this study we carried out a promoter analysis EZH2 overexpression in cancer tissue, we have already of the EZH2 gene and investigated whether a survival demonstrated that EZH2 downregulates important signal that is upregulated in cancer cells is related to genes, such as E-cadherin and RUNX3, by increasing overexpression at the transcription level. We also explored histone H3K27 trimethylation, which suggests that it the clinical relevance of the signaling pathway that leads may be an oncogene (Fujii et al., 2008; Fujii and Ochiai, to EZH2 overexpression in breast cancer and demon- 2008).
    [Show full text]