Distinct Factors with Spl and NF-A Specificities Bind to Adjacent Functional Elements of the Human U2 Snrna Gene Enhancer

Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Distinct factors with Spl and NF-A specificities bind to adjacent functional elements of the human U2 snRNA gene enhancer

Manuel Ares, Jr., 1 Jo-San Chung, Linda Giglio, and Alan M. Weiner Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, Connecticut 06510 USA

The enhancer regions of mammalian and avian U1 and U2 small nuclear RNA (snRNA) genes are unusual in containing the sequence GGGCGG (GC-box) immediately upstream from the sequence ATGCAAAT (octamer). We made point mutations in the human U2 snRNA enhancer and tested them for the ability to direct U2 transcription in HeLa cells, as well as for the ability to form complexes with factors present in HeLa cell nuclear extracts. We show that neither the GC-box nor the octamer alone is sufficient for enhancer activity in vivo. Mutations in the GC-box reduce the ability of enhancer DNA fragments to bind a factor (probably Spl), whereas mutations in the octamer independently reduce the ability to bind a second factor (probably nuclear factor A, NF-A). The results suggest that adjacent binding of Spl and NF-A is an important feature of some U- snRNA gene enhancers. [Key Words: U2 snRNA~ U2 enhancer~ enhancer binding proteins; transcription factors] Received July 7, 1987~ revised version accepted August 12, 1987.

The stable small nuclear RNAs U1-U5 (U-snRNAs) are moter in transfected HeLa ceils were not successful (M. encoded by a special class of genes apparently tran- Ares, unpubl.). scribed by RNA polymerase II. The synthesis of these The snRNA promoters differ from those RNA poly- snRNAs is sensitive to low levels of a-amanitin {Jensen merase II promoters that direct mRNA synthesis. For ex- et al. 1979~ Murphy et al. 1982}, and the nascent snRNA ample, U1 and U2 snRNA promoters lack the TATA or transcripts are capped with a 7-methylguanosine res- CAAT box homologies found in mRNA promoters (for idue, although this cap is subsequently modified to pro- review, see Serfling et al. 1985), but share sequence ho- duce the 2,2,7-trimethylguanosine cap found on the ma- mology with each other in regions of functional impor- ture snRNA species (Hernandez and Weiner 1986~ tance (for review, see Dahlberg and Lund 1987). In addi- Mattaj 1986}. tion, as yet undefined features of the snRNA promoter Many experiments indicate that U1 and U2 genes are required for correct snRNA 3' end formation, and from a number of organisms contain at least two distinct this requirement is not fulfilled by any mRNA promoter elements that contribute to snRNA promoter activity yet tested (Hemandez and Weiner 1986~ Neuman de {for review, see Dahlberg and Lund 1987). The human Vegvar et al. 1986). Despite these differences, certain IJ2 gene contains an upstream activator located near po- snRNA enhancers share at least two sequence elements sition -220 (Westin et al. 1984~ Ares et al. 1985} and a with some mRNA promoters and enhancers: the basal promoter which lies downstream of position -62 GGGCGG motif {GC-box) and the ATGCAAAT motif (Ares et al. 1985). The upstream element has the formal (octamer}. properties of an enhancer in a HeLa cell transfection The GC-box is an essential element of a number of assay, stimulating transcription from the basal promoter viral and cellular promoters and binds transcription in either orientation from upstream or downstream po- factor Spl {for review, see Kadonaga et al. 19861. The sitions, but the element works best in the natural orien- GC-box homology {referred to either as a hexanucleotide tation upstream (Mangin et al. 1986). Although the SV40 GGGCGG or a decanucleotide G/TGGGCGGRRY) has enhancer stimulates accurate initiation directed by the been noted in the enhancer regions of avian and mam- human U2 basal promoter (Mangin et al. 1986J, attempts malian U1 and U2 promoters (Early et al. 1984~ Ares et to use the human U2 enhancer to stimulate transcrip- al. 1985~ Korf and Stumph 1986~ Mangin et al. 1986) and tion from the herpesvirus thymidine kinase (tk) pro- can be identified in many but perhaps not all vertebrate 1present address: Department of Biology, Thimann Laboratories, Univer- U-snRNA promoters {Mangin et al. 1986). The human sity of California, Santa Cruz, Santa Cruz, California 95064. U2 enhancer contains a 9 out of 10 match to the decanu-

808 GENES& DEVELOPMENT 1:808-817 © 1987 by Cold Spring Harbor Laboratory ISSN 0890-9369/87 $1.00 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

U2 enhancer binds Spl and NF-A cleotide GC-box consensus (positions -222 to -231; many if not all cell types, as well as an additional factor Ares et al. 1985; Mangin et al. 1986); however, evidence (NF-A2) found only in lymphoid cells (Landolfi et al. to assess the functional importance of this sequence has 1986; Staudt et al. 1986). been lacking. The octamer or a close variant is also present in The octamer is found in immunoglobulin promoters snRNA promoters, which are usually active indepen- and enhancers (Falkner and Zachau 1984; Parslow et al. dent of cell type; this octamer element resides 220-280 1984) and is important for cell type-specific expression bp upstream of the cap site in all vertebrate U-snRNA of immunoglobulin genes (Bergman et al. 1984; Falkner genes so far sequenced (for review, see Dahlberg and and Zachau 1984; Mason et al. 1985). Paradoxically, the Lund 1987). A 4-bp deletion in the octamer of the human octamer motif is also found within elements whose ac- U2 gene abolishes U2 enhancer activity (Ares et al. tivity is largely independent of cell type. Functional ele- 1985; Mangin et al. 1986) and the human U2 gene can ments of the tk promoter (Parslow et al. 1987) and the compete with the histone H2B promoter for binding of human histone H2B promoter (Sive et al. 1986) contain NF-A1 (Sire and Roeder 1986). In addition, a synthetic the octamer, as does a functionally important region of oligonucleotide containing an octamer sequence can the 8V40 72-bp repeat (Herr and Clarke 1986; Zenke et partly replace the frog U2 enhancer (Mattaj et al. 1985). al. 1986), although more recent evidence suggests the ac- To address the functional importance of the GC-box tivity of the SV40 octamer may be restricted to lym- and octamer elements in snRNA enhancers, we made phoid cells (Ondek et al. 1987; Schirm et al. 1987). In point mutations in the human U2 enhancer and tested vitro, the octamer binds a ubiquitous factor called the mutants for enhancer activity in vivo and factor NF-A1 (formerly IgNF-A; Singh et al. 1986) present in binding in vitro. The results demonstrate that neither the GC-box immediately upstream of the octamer nor the octamer sequence alone is sufficient for full function A~ GC-box octamer of the U2 enhancer, and that the minimal U2 enhancer binds two distinct factors, probably Spl and NF-A. n Binding of each factor to the human U2 enhancer can 9K 51 occur independently in vitro because different muta- 4P J tions abolish the binding of only one or the other factor. 10K Although the wild-type enhancer binds factors over a G 1P 60-bp region extending from -270 to -211, a 5' dele- K P tion to -240 (which leaves the GC-box and octamer ele- HI) ments intact but removes half of the protected region) L 8 appears to be as active as wild type in a transfection 4 assay. We suggest that the interaction of Spl and NF-A is an important feature of the human U2 snRNA gene

12 ...... CTGTCCGAAAT~TTAT-GCAC--]LAGCT ...... enhancer.

Results B Point mutations in the GC-box or in the octamer reduce U2 enhancer activity NE 91( 51 4P J 1OK G 1P K p NO L 4 8 12 Mk d1"556 Point mutations were generated in the enhancer region IU2 of a copy of the human U2 gene carrying an XbaI linker in the coding region, and cloned in pUC13 (Mangin et al. 1986). The sequences of the mutant enhancer regions are shown in Figure 1A. The mutants were introduced into Figure 1. Transcription of U2 enhancer mutants. (A) Point HeLa cells by transfection, together with a ~-globin con- mutations in the human U2 enhancer. The top line represents struct to normalize for variation in transfection effi- the wild-type sequence, present in clone NE. The nucleotides ciency (Mangin et al. 1986). Transcription was assayed changed in each of the other mutants (named at left) appear by primer extension from a site downstream of the XbaI below the corresponding wild-type position. The octamer and linker, so that the marked U2 RNA would produce a the hexanucleotide GC-box elements are shaded, though it longer cDNA than endogenous U2 RNA (Mangin et al. should be noted that the U2 enhancer matches well to the ex- 1986). The results (Fig. 1B) indicate that the upstream tended decanucleotide GC-box consensus and that mutants ND deletion to - 240 (clone NE), which is common to all the and L have changes within the decanucleotide GC-box. (B) U2 mutant enhancers, does not significantly reduce en- primer extension products of RNA from HeLa cells transfected hancer activity (Fig. 1, compare NE with dl-556). We with the enhancer mutants. The transfected U2 genes produce a longer RNA and thus longer reverse transcripts (see Materials will therefore refer to NE as a wild-type enhancer. Cer- and methods for details). Mutant DNA used in each lane is in- tain mutations that alter the GC-box without changing dicated at top, with the exception of dl-556, a construct con- the octamer (Fig. 1B, lanes 51, 9K, and 1P) reduce en- raining U2 promoter sequences to position -556, and Mk, hancer activity. Other mutations that change the oc- which contained the pUC13 vector alone. tamer without altering the GC-box also reduce the ac-

GENES & DEVELOPMENT 809 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Ares et al. tivity of the enhancer (lanes 10K, G, and 8). Two oc- factor in fraction II is sensitive to mutation of the octamer mutations (lanes 4P and J) have less severe effects, tamer, whereas binding of the factor in fraction III is but these alterations are found in naturally occurring sensitive to changes in the GC-box. We did not recover a variants of the snRNA octamer (for example, the human protein fraction able to form C3 by itself, and only those U1 octamer ATGCAGAT is like 4P). A triple mutation mutants able to form both C1 and C2 independently upstream of both the GC-box and the octamer has little with the heparin-agarose fractions are also able to form effect on transcription (lane 4), whereas the triple muta- C3 with crude extract (Fig. 2). In addition, a mixture of tions ND and L containing nucleotide substitutions in fraction II and fraction III is sufficient to produce C3 both the octamer and the extended decanucleotide GC- with a DNA fragment containing two functional binding box consensus have very low activity (lanes ND and L). sites (Fig. 2D), suggesting that C3 may represent a com- The complex substitution mutant 12, lacking wild-type plex with both factors bound simultaneously to the en- sequences upstream of -209, has no detectable activity hancer. (lane 12). We conclude that mutations in either the GC- The C1 complex contains NF-A bound to the U2 box or the octamer have pronounced effects on U2 en- enhancer at the octamer hancer activity in vivo and that neither the GC-box nor the octamer alone is sufficient for wild-type levels of U2 To determine whether the C1 complex contains the U2 enhancer activity. enhancer bound to a factor with NF-A (octamer binding) specificity, we performed methylation interference ex- Point mutations alter formation of enhancer periments (Siebenlist and Gilbert 1980) using fraction II DNA-protein complexes in vitro of HeLa cell nuclear extract and end-labeled DNA frag- To determine whether the mutations had affected the ments representing the wild-type human U2 enhancer ability of the enhancer to bind protein factors, we incu- (positions - 198 to -270). After formation of complexes bated labeled enhancer fragments with crude or partially using fraction II protein and partially methylated DNA, purified HeLa cell nuclear extract and then separated the separation of protein-DNA complexes on native acryla- resulting protein-DNA complexes by native polyacryl- mide gels, and analysis of the bound and unbound DNA amide gel electrophoresis (Fried and Crothers 1981; by chemical cleavage at the methylated purines, we Garner and Revzin 1981). Figure 2 shows the results of found that the factor present in fraction II preferentially such "mobility-shift" experiments with each mutant binds the subpopulation of DNA fragments not methyl- enhancer using either crude nuclear extract (Fig. 2A) or ated at purines within the octamer (Fig. 3). On the non- extract fractionated by heparin-agarose column chroma- template strand, methylation of the N7 position of the G tography (Fig. 2B, C; see Materials and methods). residue at position -219 (major groove) as well as meth- The wild-type U2 enhancer NE forms at least three ylation of the N3 position of the A residues at -215, major complexes when incubated with crude extract (la- - 216, - 217, or - 221 (minor groove) interfere with for- beled C1, C2, and C3 in Fig. 2A, lane NE). Complex C1 mation of the protein-DNA complex C1 (Fig. 3). Methyl- and C2 nearly comigrate, but C1 reproducibly runs ation of the G residue at -223, though not part of the slightly ahead of C2 on this gel system. The wild-type octamer consensus, also inhibits binding. On the tem- fragment forms complex C1 with a factor in fraction II plate strand, only methylation of the G residue at posi- (Fig. 2B, lane NE; Fig. 2C, lane NE/FII) as well as com- tion -218 causes interference (data not shown). With plex G2 with a factor in fraction III (Fig. 2C, lane NE). the exception of the interference by 7-methylguanine at Mutations that alter the octamer but preserve the GC- -223, the pattem of methylation interference we ob- box reduce the yield of C 1 and C3, but retain the ability serve is very similar to that observed by others for the to form C2 after incubation with crude extract (Fig. 2A, interaction of NF-A with the octamer present in the im- lanes 4P, J, 10K, G, and 8) or with fraction III (Fig. 2C, munoglobulin promoters (Staudt et al. 1986) and en- lanes 4P, J, 10K, G, and 8). Mutations that alter se- hancers (Sen and Baltimore 1986) and presumably iden- quences outside the octamer exhibit a complementary tified sites of close approach between the factor and the pattern of complex formation. The clearest of these is enhancer DNA. We conclude that the octamer in the U2 the double mutant 1P, which cannot form C2 and C3 enhancer binds to a factor (present in fraction II) similar but retains the ability to form C1 with crude extract or to NF-A. In addition, the interference by methylation of fraction II (Fig. 2A-C, lanes 1P; the residual complex the A residues at positions - 215, - 216, and - 217 sup- formed with 1P in fraction III has the mobility of C 1 and ports the idea that the factor in fraction II recognizes the is probably due to a small amount of octamer binding octamer rather than an element related to the SV40 factor in this fraction). Enhancer DNA fragments car- SPHI homology (see Zenke et al. 1986; Ondeck et al. rying mutations within both the GC-box and the oc- 1987; Schirm et al. 1987), which might overlap the tamer (lanes P, ND, L, and 12) do not form complexes human U2 octamer. efficiently. The adjacent GC-box and octamer elements can Taken together, these data indicate that two distinct independently and simultaneously bind factors, one present in fraction II and the other in frac- different factors tion III, can bind independently to the human U2 enhancer in vitro. The two factors appear to recognize dif- To determine whether both factors could bind simulta- ferent sites on the enhancer DNA, since binding of the neously and to determine the binding site for the factor

810 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

U2 enhancer binds Spl and NF-A

CR B F II A S NE 9K 51 4P J 101( -G 1P K P ND L 4 8 12 S NE 91( 51 4P d 1OK G 1P K P ND L 8 12

-C3"" e

~: i ¸ • ~ ~ : : ~ :i~ ¸ ~i i¸ :~ ~ ~ :i L/~ i: ~ i~!i~ ~: .... ~.... ~ ~ !~ ~:.ii~i .~i~i~//~i~/i~: ~ ~i~? ~ i~i -Fr-

C F III .,& D CR FII F III FII÷Fill NE NE 9K 51 4P J 1OK G 1P K P ND L 8 12 4 ~1 NE 1P 8 IN~ Ip 8 INE II' 8 INS IP s CR,

Im. !~

.-C2a -C2b

n Figure 2. Binding of HeLa cell nuclear factors to DNA from mutant enhancers. The position of complexes C1 and C2 (which migrate very close to each other), C2a, C2b, and C3 are indicated; complexes C2a and C2b are so named because their appearance always correlated with the appearance of C2. (A) Binding to factors in crude extract. 1 ~1 of crude extract was incubated in binding buffer containing 2.5 mM MgC12. The probes used are indicated at the top of the lanes {see Fig. 1A), (S) The 72-bp Sinai fragment from between positions -198 and -270 of the natural gene; (NE/FII) a reaction containing the wild-type NE fragment and fraction II protein as a marker for C1. (B) Binding to factors in fraction II. 1 Ixl of fraction II was incubated in binding buffer containing 1 mM EDTA. The probes used are indicated (refer to Fig. 1A), (NE/CR) NE fragment bound to crude extract as a marker for C1-C3. (C) Binding to factors in fraction III. Two microliters of fraction III was incubated in binding buffer containing 2.5 mM MgC12). The probes used are indicated (refer to Fig. 1A), (NE/CR) NE bound to crude extract (C1-C3 marker); (NE/FIII NE bound to fraction II protein (C1 marker); (8/CR) mutant 8 bound to crude extract (C2, C2a, C2b marker}. (D/Complex C3 can be formed with a mixture of fraction II and fraction III. The probes and protein fractions used are indicated. {CR) Crude extract (0.5 t~1); (FII) fraction II protein (1.0 txl); (FIII) fraction III protein (2 Ixl); (FII+ FIII) a mixture of fraction II (0.5 ~1) and fraction III (2 t~1) proteins. The composition of the complex migrating between C2 and C3 is not known, but it may be related to C2a by binding of the octamer factor. sensitive to mutation of the GC-box sequences up- over a region encompassing the GC-box homology (lanes stream of the octamer, we performed DNase I protection 8 + and 8 - ). Conversely, the double mutation 1P in (and experiments (Galas and Schmitz 1978). The wild-type upstream of) the GC-box is only protected over a region clone NE is protected from DNase I digestion by crude encompassing the octamer {lanes 1P + and 1P- ). Taken nuclear extract over a 30-bp region extending from 6 bp together, these data reinforce the conclusion that the upstream of the GC-box to 6 bp downstream of the oc- two factors can bind independently. In addition, the data tamer, with partial protection an additional 4 bp down- suggest that both factors can bind simultaneously, al- stream of the octamer (Fig. 4A, cf. lanes NE + and NE - ). though it is formally possible that the double protection The triple mutation 8 in the octamer is only protected represents an extremely rapid equilibrium between two

GENES & DEVELOPMENT 811 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Ages et al.

C1 Fr GC-box homologies, as well as a dyad symmetry (Fig. 4BJ which could bind additional factors. The protection of the template strand is similar to that observed in Figure 4 for the nontemplate strand {data not shown). A summary of the DNase I protection experiments and a model for factor binding to the human U2 enhancer are _t presented in Figure 4B.

i¸ zGGG= Discussion The human U2 snRNA promoter contains an upstream enhancer {Mangin et al. 1986) that shares a GC-box and an octamer element {Ares et al. 1985; Mangin et al. 1986} with other U-snRNA genes {Dahlberg and Lund 1987). To test the functional importance of these sequence homologies, we determined the effects of point mutations on enhancer activity in vivo {Fig. 1) and factor binding in vitro {Figs. 2-4). The results demonstrate || that both sequence elements are essential for full enhancer function in vivo and that the two elements bind distinct transcription factors independently in vitro.

Figure 3. Methylation of purines in the U2 octamer interferes The identity of the factors with complex formation. End-labeled and partially methylated DNA was bound to fraction II protein, and complexes were sep- One of the two factors that interact with the minimal arated on native gels. After purification of the DNA from the human U2 enhancer in vitro resembles transcription complexes, the methylated sites present in DNA in complex factor Sp 1. This factor, present in fraction I11, protects a C1 {lane C1} were compared to those present in free DNA {lane region of the U2 enhancer with strong homology to the Fr} by cleavage at methylated purines. The sequence of the GC-box consensus known to bind Spl {Fig. 4). Whereas nontemplate strand surrounding the region of most obvious in- the binding of Spl is influenced by the total match to terference is written to the right (5' to 3', top to bottom). the decanucleotide consensus G/TGGGCGGRRY {Jones Purines whose methylation interferes with formation of C 1 are et al. 1986; Kadonaga et al. 1986}, the sensitivity of Spl marked with a black square. to mutation in known GC-boxes is similar to the sensitivity of the fraction 111 factor to mutations in the U2 mutually exclusive single protections. Since the DNase I GC-box. For example, GGGTGG is a naturally occurring digestion time is short {60 sec), we favor the idea that variant of the core consensus Spl binding site both factors bind simultaneously. GGGCGG {Jones et al. 1986}, and the equivalent change In the experiments presented in Figures 1-3, we used in the U2 enhancer has little effect on fraction III the NE clone {a 5' deletion to -240) as a wild-type con- binding {Fig. 2}. Mutation of G residues at positions 3, 4, trol, since this deletion did not appear to affect enhancer 6, and 9 of the decanucleotide consensus is detrimental function in the transfection assay {Fig. 1, compare lane to Spl binding {Jones et al. 1986}, and binding of the NE with lane dl - 556). Surprisingly, however, the region factor in fraction I11 to the human U2 GC-box mutants immediately upstream of -240 in the U2 gene is pro- with G-to-T changes at these positions is reduced {mu- tected from DNase I digestion by factors in the HeLa cell tants 1P, ND, and L; Figs. 2 and 4}. In addition, the re- extract (Fig. 4A, lanes dl- 295 + and dl- 295 - ]. This reported elution of Spl from heparin-agarose {Briggs et al. gion contains at least one and possibly three additional 1986} is similar to what we observe for the factor inter-

Figure 4. DNase I protection of mutant and wild-type enhancer regions by crude nuclear extract from HeLa cells. (A) DNase I footprmting maps the binding sites of the factors. Binding conditions were identical to those used for the mobility shift, except that 2 gl of crude extract {lanes +) or BC100 buffer {lanes -) were incubated with 2 x 104 cpm of end-labeled fragment and then treated with DNase I. Lanes dl-295 contain the 251-bp AhalI-DdeI fragment from plasmid dl-295; lanes NE, 8, and lP contain the 221-bp AhalI-PvulI fragment from the corresponding plasmid clones. All fragments were labeled on the nontemplate strand by filling in the AhalI site at - 116. As judged by the mobility shift assay, the conditions used drive all of the DNA into complex {not shown). The protected regions are indicated by brackets. As marker, the same fragments were partially methylated and cleaved at methylated purines (right panel, G>A). The sequence of the nontemplate strand of the U2 enhancer core (5' to 3', top to bottom} is shown to the right of the DNase I protection lanes. The nucleotides altered in the mutant 8 and 1P are indicated to the right of the G>A lanes. {B) Summary of footprinting data and model for factor interactions at the human U2 snRNA gene enhancer. (Top) Protected sequences in the wild-type clone NE {dl - 240), the octamer mutant 8, and the GC-box mutant 1P are indicated by brackets. Nucleotides altered in the mutants are boxed. (Bottom) Protected sequences in the natural U2 gene {dl- 295). Factors proposed to interact with the enhancer DNA {NF-A, circle; Spl, rounded square} are indicated. The protected sequences upstream of the core contain an excellent match to the GC-box consensus around position -265, as well as two weaker matches at -242 (on the opposite strand} and -253. A dyad symmetry not related to the GC-box is centered between positions -244 and -245 and is indicated by the arrows above the line.

812 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

U2 enhancer binds Spl and NF-A acting with the U2 GC-box. The results indicate that tamer homology (Fig. 4) and cannot bind when purines Spl or an Spl-like factor binds the human U2 enhancer in the octamer are methylated (Fig. 3). Binding of this in vitro and suggest that Sp 1 acts in vivo to stimulate U2 factor is reduced by mutations in the U2 enhancer that transcription. alter the octamer sequence (Fig. 2B). In addition, those The other factor that interacts with the U2 enhancer mutations resembling natural variants of the octamer in vitro resembles NF-A. This factor, present in fraction found in other snRNA gene enhancers are the least detri- II, protects a region of the U2 enhancer spanning the oc- mental to the activity of the human U2 enhancer (Fig. 1)

A DNase I G>A 1P dl-295 NE 8 + . NE 8 1P 4. -.+ - +

G-'A] 1P G ~ G G -"T] G s Oi C A --~T" T T---~C] ml 8J -' C T~t

-l,-; TTT ,I.| """

I I CTC~TGAAAGC~GGGGCATGCAAATTCGAAATGAAAGCC 1P GAGAI]~ACTTTCCI/~GCCCCGTACGTTTAAGCTTTACTTTCGG 8 CTCT~TGAAAGGGCGGGGCA~CGAAATGAAAGCC GAGACACTTTCCCGCCCCGTA~TTT~GCTTTACTTTCGG i I NE CTCTGTGAAAGGGCGGGGCATGCAAATTCGAAATGAAAGCC GAGACACTTTCCCGCCCCGTACGTTTAAGCTTTACTTTCGG

-270 - ~ ~ I -200 • ,- -n -" I I / \ I • GCGGCCC CGGGGGCGGAGTCAACGGCGGAGGC CACGCC CTC TGTGAAA~GC GGIGGC~TGCAAAT~?CGAAATGAAAGCC ' Spl? "Spl? ~ Sp I NF-A 1 Figure 4. (See facing page for legend.)

GENES & DEVELOPMENT 813 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Ares et aL

and have less severe but nonetheless detectable effects tify common factors and leaves open the possibility that on binding of the factor (Fig. 2B). These results indicate there exists an snRNA gene-specific octamer binding that NF-A, or a similar octamer-binding protein, recog- protein. nizes the U2 enhancer in vitro and may act in vivo to Exceptional mutations stimulate U2 transcription. U-snRNAs are efficiently expressed in most if not all Most mutations that reduce binding of either factor to cells, suggesting that the factors involved in U-snRNA the enhancer also reduce transcription. The exceptions synthesis should be present and abundant in all cell fall into two classes. In the first class are the octamer types. The transcription factor Spl and the octamer mutants J (ATGCAAAC) and 4P (ATGCAGAT). These binding protein NF-A fulfill both of these criteria, and mutants are only slightly defective in transcription (Fig. the data presented here support the idea that they are 1), but neither binds NF-A in vitro as well as wild type involved in snRNA transcription. However, accurate (Fig. 2). Likewise; the double mutant K is transcribed DNA-dependent in vitro transcription of vertebrate U1 nearly as well as wild type but exhibits reduced ability or U2 genes has not yet been reported, and we are there- to bind the octamer binding factor. However, in the case fore unable to determine whether the factors that are re- of mutant K, we can compare the activity of the double sponsible for enhancer binding in vitro are the same as mutation with the activity of each of the component those responsible for enhancer activity in vivo. This is single mutations. Transcription of the single mutants an important point, since factor binding in vitro may not 9K and 10K is much lower than that of the double mu- reflect factor function in vivo. For example, the octamer tant K, indicating that the double mutation has the motif in immunoglobulin promoters and enhancers is strange but reproducible effect of restoring efficient thought to be an important determinant of lymphocyte- transcription without restoring efficient octamer specific gene expression (Bergman et al. 1984; Falkner binding in vitro. The G-to-A change at position -230 in and Zachau 1984; Mason et al. 1985), but in vitro the mutant K changes the surrounding sequence from immunoglobulin octamer is bound just as well by the TGTGAAAGG to TGTGAAAAG, increasing homology ubiquitous octamer binding protein NF-A1 found in all to the SV40 "enhancer core" consensus TGTGGAAAG, cell types as by the lymphocyte-specific octamer binding whereas the change at -211 generates ATGCAAAG, protein NFA2 (Staudt et al. 1986). Since immunoglob- the version of the octamer present in the SV40 enhancer. ulin promoters do not function in cells that contain the Perhaps this double mutant mimics the SV40 enhancer, ubiquitous octamer binding factor, the simple presence an element known to stimulate transcription from the of octamer binding activity cannot necessarily be taken U2 basal promoter (Mangin et al. 1986). as evidence of function. The implication is that the cell The second class includes the GC-box mutants 9K and type-specific action of certain DNA-binding transcrip- 51. These mutants bind factors nearly as well as wild tion factors may depend on interactions with auxiliary type in vitro, yet are much reduced in transcription. Ad- transcription factors that either do not themselves bind mittedly, the in vitro binding reactions were optimized directly to DNA or bind to the DNA with a particular for the wild-type enhancer fragment, but we were unable geometry relative to the other factors. Until we can to improve or reduce binding of these mutants relative transcribe U2 templates using purified factors, we to wild type by altering the conditions of the binding cannot be certain that our binding assay is detecting reaction (data not shown). One possible explanation for only those functionally important components acting at the anomalous behavior of mutants 9K and 51 is that the the U2 enhancer in vivo. 5' deletion to -240, which is common to all the point An additional complexity is evident after comparison mutants, may remove additional Spl binding sites up- of our methylation interference results using the human stream (Fig. 4). As a result, transcription might become U2 enhancer (Fig. 3) with those of Staudt et al. (1986) more sensitive to subtle mutations in the sole remaining using immunoglobulin promoters. We observed partial GC-box than it would be in the natural U2 gene where interference by methylation at G -223, a position 2 bp the upstream Spl binding sites could partially compen- upstream of the U2 octamer. The octamer-containing sate for the mutation. In fact, multiple Sp 1 binding sites fragments of the immunoglobulin promoters used by are the rule in Spl-responsive promoters (Kadonaga et al. Staudt et al. (1986) also contain a G at this position rela- 1986), lending support to the interpretation that the pa- tive to the octamer, but methylation of these G residues rental - 240 construct used for mutagenesis might mag- did not interfere with octamer binding (Staudt et al. nify the effects of GC-box mutations on transcription. 1986). Most immunoglobulin or snRNA octamers do not The existence of these exceptional mutants suggests contain a G residue in this position, so it does not seem either that the in vitro binding conditions do not effec- likely that octamer binding factors make G-specific con- tively mimic those in vivo or that DNA binding alone is tacts at this position. However, introduction of a methyl not an adequate measure of factor activity. Alterna- group at this nearby position might differentially affect tively, since U1 and U2 3' end formation require snRNA the way that related but subtly different octamer promoter elements (Hemandez and Weiner 1986; binding proteins bind to the octamer DNA. Such differ- Neuman de Vegvar et al. 1986), the exceptional mutants ences may indicate that distinct factors, related to each might affect formation of the 3' end of the transcript other by their ability to bind the octamer sequence, may rather than initiation. Throughout this study we have be acting at different genes. This may draw into question used primer extension to measure accumulation of RNA the use of competition experiments as a means to iden- initiated at the U2 cap site; thus, an enhancer mutation

814 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

U2 enhancer binds Spl and NF-A

that affected the yield or stability of the final transcript In other cases, Spl binding sites may be present farther by altering 3' end formation would be indistinguishable from the octamer, difficult to detect because of poor from a mutation that affected initiation. match to the GC-box consensus, or perhaps replaced by binding sites for other factors. Many of the mutations Is a protein-protein interaction between Spl and NF-A that reduce transcription of U2 in human ceils also re- a special feature of snRNA enhancers? duce binding of one or the other factor, suggesting that binding of both Spl and NF-A is important for efficient Binding sites for Spl and NF-A are adjacent to each other transcription of human U2. This unusual arrangement in the human U2 enhancer as well as in other U-snRNA may also be responsible for some of the unique proper- gene enhancers. With two exceptions, this arrangement ties of these specialized RNA polymerase II promoters, is peculiar to U-snRNA enhancers. The tk promoter such as exceedingly high rates of transcription (a min- contains two essential GC-boxes (McKnight et al. 1984; imum of one transcript/gene/2-4 sec for human U2 Eisenberg et al. 1985) that bind to Spl (Jones et al. 1985), snRNA; Ares et al. 1985) or the ability of the RNA poly- as well as a recently identified octamer that contributes merase to recognize different 3' end formation signals to promoter function in vivo (Parslow et al. 1987). This downstream in the transcription unit (Hernandez and octamer element is 27 bp from one of the tk GC-boxes Weiner 1986; Neuman de Vegvar et al. 1986). and 75 bp from the other. The SV40 enhancer and early promoter contain an octamer-like sequence (ATG- CAAAG) positioned 29 bp from a cluster of 6 GC-boxes Materials and methods that bind Spl (Dynan and Tjian 1983b; Gidoni et al. 1985), although it is not clear whether the important ele- Construction of point mutations ment is the octamer homology itself or the direct repeat of the SPHI element which fortuitously generates an oc- A mixed population of 32-residue oligodeoxynucleotides was synthesized which differed at random from the programmed tamer homology (Zenke et al. 1986; Ondek et al. 1987; wild-type sequence 5'-CGAATTTGCATGCCCCGCCCTTT- Schirm et al. 1987). In neither of these cases is the oc- CACAGAGCT-3', once in every 26 residues on average. This tamer immediately adjecent to a GC-box, as found in mixed population was then phosphorylated and ligated in two many of the U-snRNA enhancers (Mangin et al. 1986). steps (Derbyshire et al. 1987) between the AsuII site at position The frog U2 gene contains an enhancer-like element -211 and the SacI site of the polylinker of the marked human (Mattaj et al. 1985) that is nearly identical in sequence to U2 gene carried in pUC13 (Mangin et al. 1986). The DNA was the human U2 enhancer over the region where Spl and transformed (Hanahan 1983) into E. coli JM101, and plasmid NF-A bind to the human enhancer (Figs. 2-4; see Ares et DNA from clones was sequenced (Chen and Seeburg 1985) al. 1985). Thus, it is not surprising that similar DNase I using a primer complementary to lac sequences adjacent to the protection patterns are obtained with human factors on polylinker (M13 17-mer, P-L Biochemicals). The single mutants 9K and 10K were derived from the double mutant K, and the both the wild-type human enhancer NE (Fig. 4) and frog double mutant 1P and single mutant 4P were derived from the U2 enhancer {Bohmann et al. 1987). Bohmann et al. triple mutant P, by using an EcoRI-SphI or SphI-XbaI fragment (1987) attributed protection of the frog U2 octamer to to replace the corresponding region of the wild-type NE clone. NF-A, but did not comment on protection of the adjacent GC-box. Based on the published chromatographic behavior of Spl on DEAE-Sepharose (Dynan and Tjian Expression of U2 enhancer mutants 1983a) and phosphocellulose columns (Dynan and Tjian Transfection of U2 enhancer mutants into HeLa cells, normal- 1983b), the fractions used by Bohmann et al. (1987) ization to expression of a cotransfected rabbit ~-globin gene, would be expected to contain most of the Sp 1 present in and primer extension using the L15 oligo were all as described the starting material. Our results suggest that the pro- previously (Mangin et al. 1986). tection of the frog U2 GC-box observed by Bohmann et al. (1987) resulted from Spl in their partially purified NF-A fraction and that Sp 1 is also an important factor in Preparation and fractionation of HeLa cell nuclear extracts transcription of frog U2. Extracts of HeLa cell nuclei were prepared according to Heintz The close proximity of the binding sites for Spl and and Roeder (1984), dialyzed into BC100 buffer (20 mM HEPES NF-A (Fig. 2) suggests that these two factors might in- pH 7.9, 20% glycerol, 1 mM dithiothreitol, 0.2 m/vi EDTA, and teract with each other. Alternatively, since the two 100 mM KC1), and frozen at - 70°C. Crude extract was bound to factors bind independently to the enhancer in vitro, an heparin-agarose {Sigma) according to Singh et al. {1986). Mate- auxiliary factor that does not itself bind to DNA might rial not bound at 0.1 M KC1 (flow-through, fraction I) as well as recognize Spl and NF-A when they are bound to adja- material eluting in successive step washes at 0.25 M KC1 {fraction II), 0.4 M KC1 (fraction III), and 0.6 M KC1 (fraction IV) were cent sites on the DNA. The ability of the frog U2 en- precipitated by addition of an equal volume of saturated hancer to promote the formation of stable transcription (NH4)zSO4, resuspended in one-half the original volume of complexes in microinjected oocytes (Mattaj et al. 1985) BC100 and dialyzed against BC100. Protein concentrations leads us to expect that Spl and NF-A will be found to were estimated by spotting a dilution series of known concen- participate in the formation of stable transcription com- tration of bovine serum albumin and unknown samples onto plexes at the human U2 enhancer. nitrocellulose and staining with Ponceau S. Generally the pro- Adjacent binding sites for Spl and NF-A appear to be tein concentration of the crude extract was 25 mg/ml, that of characteristic of some but not all U-snRNA enhancers. fraction II 2 mg/ml, and that of fraction III 2 mg/ml.

GENES & DEVELOPMENT 815 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Ares et al.

Detection of protein-DNA complexes by gel electrophoresis sented here: Janson, L., C. Bark, and U. Pettersson, Nucleic End-labeled DNA fragments were synthesized by cleaving Acids Res. 15: 4997-5016, 1987. DNA from each of the mutants with AvaI, filling the staggered ends with Klenow fragment in the presence of ~-[a2p]dCTP, and redigesting the DNA with EcoRI. Labeled enhancer DNA frag- References ments were fractionated on native 12% polyacrylamide gels, Ares, M., M. Mangin, and A. Weiner. 1985. Orientation-depen- detected by autoradiography, excised, and eluted. Crude extract dent transcriptional activator upstream of a human U2 (-25 ~g) or heparin-agarose fractions (-2 ~g) were incubated snRNA gene. Mol. Cell Biol. 5: 1560-1570. with 1-5,000 cpm of end-labeled DNA fragment in 11 ~1 of 0.1 Bergman, Y., D. Rice, R. Grosschedl, and D. Baltimore. 1984. M NaC1, 10 mM Tris-HC1 (pH 7.6), 1 mM dithiothreitol, 5% Two regulatory elements for kappa immunoglobulin gene glycerol, 0.1 ~g/~l poly(dI-dC) (Sigma), and 2% polyvinyl al- expression. Proc. Natl. Acad. Sci. 81: 7040-7045. cohol with either 2.5 mM MgC12 or 1 mM EDTA as indicated. Bohmann, D., W. Keller, T. Dale, H. Scholer, G. Tebb, and I. Samples were incubated at 20°C for 10 rain, 2 ~1 of a solution Mattaj. 1987. A transcription factor which binds to the en- containing 5% Ficoll and 0.05% xylene cyanol was added, and hancers of 8V40, immunoglobulin heavy chain and U2 the samples were loaded on 2-mm-thick 4% polyacrylamide snRNA genes. Nature 325: 268-272. (30:1, acrylamide:bis-acrylamide) gels, containing 45 mM Briggs, M., J. Kadonaga, S. Bell, and R. Tjian. 1986. Purification Tris, 290 ~ glycine, 1 mM EDTA, pH 8.6-8.8. Gels were and biochemical characterization of the promoter-specific prerun 90 rain (using the above buffer), loaded, and then run transcription factor Spl. Science 234: 47-52. 90-120 rain at constant current, starting at 6 V/cm. Gels were Chen, E. and P. Seeburg. 1985. Supercoil sequencing: A fast and usually dried before autoradiography. simple method for sequencing plasmid DNA. DNA 4: 165- 170. Methylation interference and DNase I footprinting Dahlberg, J. and E. Lund. 1987. SnRNA genes and their transcription. In Structure and function of major and minor Methylation interference (Siebenlist and Gilbert 1980) was snRNPs {ed. M. Birnstiel) Springer-Verlag, Heidelberg. performed by incubating 5 x l0 s cpm of end-labeled DNA frag- Derbyshire, K., J. Salvo, and N. Grindley. 1987. A simple and ment with 5 ~1 (about 10 ~g} of fraction II protein in a 50-~1 efficient procedure for saturation mutagenesis using mixed reaction as above, in binding buffer containing 1 mM EDTA. oligonucleotides. Gene 46: 145-152. After electrophoresis and autoradiography of the wet gel, bands Dynan, W. and R. Tjian. 1983a. Isolation of transcription corresponding to bound and unbound DNA were excised and factors that discriminate between different promoters recog- eluted in 0.5 ml 500 mM Na acetate, 0.1% SDS, 1 mM EDTA at nized by RNA polymerase II. Cell 32: 669-680. 37°C overnight. After phenol extraction and ethanol precipita- ~.1983b. The promoter specific transcription factor Spl tion of the eluted DNA, base cleavage at methylated purines binds to upstream sequences in the SV40 early promoter. was performed as described by Falvey and Grindley (1987), and Cell 35: 79-87. the cleavage products were separated on a 8% polyacrylamide- Early, J., K. Roebuck, and W. Stumph. 1984. Three linked U1 8 M urea gel. Footprinting (Galas and Schmitz 1978) was per- genes have limited flanking DNA sequence homologies that formed using U2 gene fragments labeled by filling in the AhaII reveal potential regulatory signals. Nucleic Acids Res. site at position - 118 with the Klenow fragment of DNA poly- 12: 7411-7421. merase I and recutting the DNA in upstream vector sequences Eisenberg, S., D. Coen, and S. McKnight. 1985. Promoter do- with PvulI (clones NE, 1P, and 8) or DdeI (clone dl-295). La- mains required for expression of plasmid-bome copies of the beled fragments were incubated with crude extract (as for gel herpes simplex virus thymidine kinase gene in virus-in- shift assays with 2.5 rnM MgC12), and 1 ~1 of an empirically fected mouse cells and microinjected frog oocytes. Mol. determined concentration of DNase I in BC100 buffer was Cell. Biol. 5: 1940-1947. added. After incubation for 60 sec at 20°C, the reaction was Falvey, E. and N. Grindley. 1987. Contacts between ~/8 resol- stopped by addition of 250 ~1 of 0.4 M LiC1, 100 mM Tris-HC1 vase and the ~/~ res site. EMBO J. 6: 815-821. (pH 7.4), 10 mM EDTA, 1% SDS, 10 ~g/ml E. coli tRNA, 100 Falkner, F. and H. Zachau. 1984. Correct transcription of an ~g/ml proteinase K, incubated at 42°C for 20 min, extracted immunoglobulin kappa gene requires an upstream fragment with phenol, precipitated with ethanol, and run on denaturing containing conserved sequence elements. Nature 310: 71- 6% polyacrylamide-8 M urea gels. 74. Fried, M. and D. Crothers. 1981. Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel elec- Acknowledgments trophoresis. Nucleic Acids Res. 9: 6505-6525. Thanks to Harinder Singh for advice on gel shift assays and for Galas, D. and A. Schmitz. 1978. DNase footprinting: A simple providing a kappa promoter clone as a control. Thanks to the method for the detection of protein-DNA binding speci- Grindley lab, especially to Keith Derbyshire for help with the ficity. Nucleic Acids Res. 5: 3157-3170. oligonucleotide-directed mutagenesis and to Eileen Falvey for Garner, M. and A. Revzin. 1981. A gel electrophoresis method advice on methylation interference and help with synthesis of for quantifying the binding of proteins to specific DNA re- the mixed oligo (especially mutant 12). Graham Hatfull was an gions: Application to components of the E. coli lactose invaluable source of snippets regarding gel shift and foot- operon regulatory system. Nucleic Acids Res. 9: 3047- printing assays. As always we thank Cathy Joyce for providing 3060. bottomless tubes of Klenow. Also we thank Nouria Hernandez Gidoni, D., J. Kadonaga, H. Barrera-Saldana, K. Takahashi, P. for extremely helpful comments on the manuscript. Chambon, and R. Tjian. 1985. Bidirectional SV40 transcription mediated by tandem Spl binding sites. Science 230: 511-517. Hanahan, D. 1983. Studies on transformation of E. coli with Note added in proof plasmids. J. Mol. Biol. 166: 557-580. A recent paper describes binding results similar to those pre- Heintz, N. and R. Roeder. 1984. Transcription of human his-

816 GENES& DEVELOPMENT Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

U2 enhancer binds Spl and NF-A

tone genes in extracts from synchronized HeLa cells. Proc. Siebenlist, U. and W. Gilbert. 1980. Contacts between E. coli Natl. Acad. Sci. 81: 2713-2717. RNA polymerase and an early promoter of phage T7. Proc. Hemandez, N. and A. Weiner. 1986. Formation of the 3' end of Natl. Acad. Sci. 77: 122-126. U1 snRNA requires compatible snRNA promoter elements. Singh, H., R. Sen, D. Baltimore, and P. Sharp. 1986. A nuclear Cell 47: 249-258. factor that binds a conserved sequence motif in transcrip- Herr, W. and J. Clarke. 1986. The SV40 enhancer is composed of tional control elements of immunoglobulin genes. Nature multiple elements that can compensate for one another. 319: 154-158. Cell 45:461-470. Sive, H. and R. Roeder. 1986. Interaction of a common factor Jensen, E., P. Hellung-Larsen, and S. Frederiksen. 1979. Syn- with conserved promoter and enhancer sequences in histone thesis of low molecular weight RNA components A, C, and H2B, immunoglobulin, and U2 small nuclear RNA genes. D by polymerase II in a-amanitin resistant hamster cells. Proc. Natl. Acad. Sci. 83: 6382-6386. Nucleic Acids Res. 6: 321-330. Sive, H., N. Heintz, and R. Roeder. 1986. Multiple sequence Jones, K., K. Yamamoto, and R. Tjian. 1985. Two distinct tran- elements are required for maximal in vitro transcription of a scription factors bind to the HSV thymidine kinase pro- human histone H2B gene. Mol. Cell. Biol. 6: 3329-3340. moter in vitro. Cell 42: 559-572. Staudt, L., H. Singh, R. Sen, T. Wirth, P. Sharp, and D. Balti- Jones, K., J. Kadonaga, P. Luciw, and R. Tjian. 1986. Activation more. 1986. A lymphoid-specific protein binding to the oc- of the AIDS retrovirus promoter by the cellular transcrip- tamer motif of immunoglobulin genes. Nature 323: 640- tion factor Spl. Science 232: 755-759. 643. Kadonaga, J., K. Jones, and R. Tjian. 1986. Promoter-specific ac- Westin, G., E. Lund, J. Murphy, U. Pettersson, and J. Dahlberg. tivation of RNA polymerase II transcription by Spl. Trends 1984. Human U1 and U2 genes use similar transcription Biochem. Sci. 11: 20-23. signals. EMBO J. 3: 3295-3301. Korf, G. and W. Stumph. 1986. Chicken U2 and U1 genes are Zenke, M., T. Grundstrom, H. Mattes, M. Wintzerith, .C. found in very different genomic environments but have sim- Schatz, A. Wildeman, and P. Chambon. 1986. Multiple se- ilar structures. Biochemistry 25: 2041-2047. quence motifs are involved in SV40 enhancer function. Landolfi, N., D. Capra, and P. Tucker. 1986. Interaction of cell- EMBO J. 5: 387-397. type-specific nuclear proteins with immunoglobulin VH promoter region sequences. Nature 323:548-551. Mangin, M., M. Ares, and A. Weiner. 1986. Human U2 genes contain an upstream enhancer. EMBO J. 5: 987-995. Mason, J., G. Williams, and M. Neuberger. 1985. Transcription cell type specificity is conferred by an immunoglobulin VH gene promoter that includes a functional consensus sequence. Cell 41: 479-487. Mattaj, I. 1986. Cap trimethylation of U snRNA is cytoplasmic and dependent on snRNP protein binding. Cell 46:905-911. Mattaj, I., S. Leinhard, J. Jiricny, and E. De Robertis. 1985. An enhancer-like sequence within the Xenopus U2 gene promoter facilitates the formation of stable transcription complexes. Nature 316: 163-167. McKnight, S., R. Kingsbury, A. Spence, and M. Smith. 1984. The distal transcription signals of the herpes virus tk gene share a common hexanucleotide control sequence. Cell 37: 253-262. Murphy, J., R. Burgess, J. Dahlberg, and E. Lund. 1982. Tran- scription of a gene for human U1 small nuclear RNA. Cell 29: 265-274. Neuman de Vegvar, H., E. Lund, and J. Dahlberg. 1986.3' end formation of U1 snRNA precursors is coupled to transcription from snRNA promoters. Cell 47: 259-266. Ondek, B., A. Shepard, and W. Herr. 1987. Discrete elements within the SV40 enhancer region display different cell-specific enhancer activities. EMBO J. 6:1017-1025. Parslow, T., D. Blair, W. Murphy, and D. Granner. 1984. Struc- ture of the 5' ends of immunoglobulin genes: A novel conserved sequence. Proc. Natl. Acad. Sci. 81: 2650-2654. Parslow, T., S. Jones, B. Bond, and K. Yamamoto. 1987. The immunoglobulin octanucleotide: Independent activity and selective interaction with enhancers. Science 235: 1498- 1501. Schirm, S., J. Jiricny, and W. Schaffner. 1987. The SV40 enhancer can be dissected into multiple segments, each with a different cell type specificity. Genes Dev. 1: 65-74. Serfling, E., M. Jasin, and W. Schaffner. 1985. Enhancers and eukaryotic gene transcription. Trends Genet. 1: 224-230. Sen, R. and D. Baltimore. 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 46: 705-716.

GENES & DEVELOPMENT 817 Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press

Distinct factors with Sp1 and NF-A specificities bind to adjacent functional elements of the human U2 snRNA gene enhancer.

M Ares, J S Chung, L Giglio, et al.

Genes Dev. 1987, 1: Access the most recent version at doi:10.1101/gad.1.8.808

References This article cites 46 articles, 12 of which can be accessed free at: http://genesdev.cshlp.org/content/1/8/808.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the top Service right corner of the article or click here.