The LNX Family of Multi-PDZ E3 Ligases: Using a Mutagenesis- Based Approach to Establish the Role of PDZ Domains in LNX1 Function

Brittany Prevost

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Medical Biophysics University of Toronto

Brittany Prevost

Master of Science

Department of Medical Biophysics University of Toronto

2013 Abstract

LNX1 belongs to a family of multi-PDZ domain containing RING-type E3 ligases. Several interactions have been mapped to its PDZ domains, but the role of each domain in LNX function has not yet been determined. To study individual PDZ domain function in the context of full length protein I generated point mutations in peptide binding sites of each PDZ domain, and in a putative phosphoinositide binding site of LNX1 PDZ4. Peptide binding was successfully disrupted by an arginine or lysine to alanine mutation in the peptide binding cleft. A LNX1

PDZ4 mutant with lysine residues in a putative phosphoinositide binding site mutated to glutamate displayed decreased membrane localization. The impact of each PDZ mutation on cell morphology and substrate ubiquitination was also investigated. I identified a potential role for

PDZ binding in auto-inhibition of RING function. Additionally, novel interactions between

LNX1 and Frizzled family members were identified and characterized.

Acknowledgments

First and foremost I need to thank Jane McGlade for giving me the opportunity to explore cell biology and the trials and tribulations associated with it. I am incredibly thankful for her guidance and insight (some project-related and some not).

The entire McGlade lab needs a collective thank you for making the lab environment inviting, organized, and a pleasure to be a part of each day. I owe tons of gratitude to Donna Berry. Her wealth of experience in the lab was essential for getting me started, and helping me through technical issues. Leanne Wybenga-Groot was a huge help for anything involving proteins, buffers, and cloning. At this point, I suspect her quick-change protocol is on its way to becoming gospel. The support of Fabio Morgese, Nancy Silva-Gagliardi, and Sascha Dho was indispensible for my imaging experiments and the data analysis that followed. I need to thank the other students Chris Smith, Jon Kreiger, Dushyandi Rajendran, and Sarah Di Clemente, as well as Junior West, and Amanda Luck, for helpful/entertaining discussions, and for the never-ending debate of which Toronto radio station is the least worst.

I would like to thank Sean Egan and Vuk Stambolic for their roles as committee members. The discussions that stemmed from our meetings were always helpful for keeping me focused. Together with Jane, their guidance made this thesis into the project that it has become.

I also need to thank NSERC for my CGS-M graduate scholarship and NCIC for LNX project funding.

Last, but surely not least, I need to thank Heather for out-of-lab support, which included listening to nearly endless rants when things were not working, pretending to be interested to endless talk when things were working, and always being game to accompany me when I remembered at 10pm on Sunday night that I needed to split my cells.

iii

Table of Contents

Acknowledgments ...... iii

Table of Contents ...... iv

List of Figures ...... viii

List of Abbreviations ...... ix

Chapter 1 INTRODUCTION ...... 1

1.1 Cell to Cell Communication ...... 1

1.2 PDZ (PSD-95, DLG, ZO-1) Domains ...... 2

1.2.1 C-terminal Ligand Interactions ...... 4

1.2.2 PDZ-PDZ Dimerization ...... 7

1.2.3 Internal Sequence Binding ...... 8

1.2.4 PDZ-Phospholipid Interactions ...... 9

1.3 PDZ Domain-containing Scaffold Proteins ...... 11

1.3.1 PDZ Scaffolds in the Postsynaptic Density (PSD) ...... 12

1.3.2 PDZ Scaffolds and Cell Polarity ...... 14

1.4 The Ubiquitination System ...... 16

1.4.1 Ubiquitination Regulates Signal Transduction ...... 16

1.4.2 RING-type E3 Ligases ...... 18

1.4.3 Outcomes of Ubiquitination ...... 19

1.5 Ligand-of-Numb Protein X Family ...... 20

1.6 Rationale ...... 23

1.7 Thesis Objectives ...... 23

Chapter 2 DESIGN AND CHARACTERIZATION OF PDZ BINDING SITE MUTATIONS IN EACH PDZ DOMAIN OF LNX1 ...... 24

2.1 Abstract ...... 24

2.2 Introduction ...... 24 iv

2.3 Materials and Methods ...... 25

2.3.1 Design of PDZ Binding Site Mutation and Mutagenesis ...... 25

2.3.2 Primers and Cloning into pGEX 4T3 ...... 27

2.3.3 Plasmids ...... 28

2.3.4 Preparation of GST Fusion Proteins ...... 28

2.3.5 Transient Expression of Constructs in 293T cells ...... 29

2.3.6 GST Fusion Protein Binding Experiments ...... 29

2.3.7 In vitro Ubiquitination Assays ...... 29

2.3.8 Co-Immunoprecipitation of LNX1 and Numb, as well as Detection of Numb Ubiquitination and Degradation ...... 30

2.3.9 Sub-cellular Localization and Imaging ...... 31

2.3.10 Statistical Analysis ...... 31

2.4 Results ...... 32

2.4.1 Design and Validation of PDZ Binding Site Mutation in LNX1 PDZs ...... 32

2.4.2 LNX1 Overexpression in HeLa cells ...... 34

2.4.3 Effect of PDZ Domain Mutations on LNX1 Auto-Ubiquitination in vitro ...... 36

2.4.4 LNX1 PDZ1 Domain Mutation Disrupts PDZ-PTBi Interaction ...... 38

2.4.5 Effect of PDZ Domain Mutations on LNX1 Mediated Degradation and Ubiquitination of Numb in 293T Cells ...... 38

2.5 Discussion ...... 43

2.5.1 Using Mutagenesis to Disrupt LNX1 PDZ Interactions ...... 44

2.5.2 The Effect of LNX1 PDZ Mutations on Cell Morphology ...... 44

2.5.3 The Effect of LNX1 PDZ Mutations on Substrate Ubiquitination ...... 45

Chapter 3 ESTABLISHMENT OF FRIZZLED RECEPTORS AS INTERACTING WITH LNX1...... 47

3.1 Abstract ...... 47

3.2 Introduction ...... 47

3.3 Materials and Methods ...... 48

3.3.1 Plasmids and Cloning of GST Fusion Proteins ...... 48

3.3.2 Mutagenesis of GST-Frizzled C-terminal Tail Constructs ...... 49

3.3.3 Expression and Purification of GST Fusion Proteins ...... 50

3.3.4 Transient Expression of Constructs in 293T cells ...... 50

3.3.5 GST Fusion Protein Binding Experiments ...... 51

3.3.6 Cloning and Expression in Mammalian Expression Systems ...... 51

3.3.7 Transient Expression of myc-Frizzled Constructs ...... 52

3.3.8 Expression of LNX1 and myc-Frizzled4 and Imaging in HeLa Cells ...... 52

3.4 Results ...... 53

3.4.1 LNX1 Interacts with Select Frizzled Tails by GST Pulldown ...... 53

3.4.2 Removal of Frizzled C-terminal PDZ Binding Motifs Disrupts Interactions ...... 53

3.4.3 Frizzled3, but not Frizzled4, Interactions Require LNX1 PDZ2 ...... 56

3.4.4 Cloning of Full Length myc-Frizzled3 and Frizzled4, as well as Co-expression of LNX1 and myc-Frizzled4 in HeLa Cells ...... 56

3.4.5 LNX1 PDZs interact with myc-Frizzled4 by GST pulldown ...... 59

3.5 Discussion ...... 59

3.5.1 LNX1 Interacts with Members of the Frizzled Family of GPCRs ...... 59

3.5.2 Characterization of the Interaction with Full Length Fz ...... 61

Chapter 4 SUMMARY AND FUTURE DIRECTIONS ...... 63

4.1 Summary ...... 63

4.2 Regulation of Ubiquitination by LNX1 ...... 64

4.2.1 LNX1 and Numb ...... 64

4.2.2 The Role of LNX1 PDZ Domains in RING Function ...... 65

4.3 LNX1 and Cytoskeletal Dynamics ...... 66

4.4 Role of the LNX1 PDZ Domains in Wnt Signaling ...... 67

4.5 LNX1 and Junction Proteins ...... 67

4.6 Concluding Remarks ...... 68

References ...... 69

vii

List of Figures

Figure 1.1 Labelled Stucture of PSD-95 PDZ3 ...... 3

Figure 1.2 The Range of PDZ-ligand Interactions ...... 5

Figure 1.3 PDZ Domain Containing Scaffold Proteins ...... 13

Figure 1.4 Substrate Ubiquitination...... 17

Figure 1.5 LNX Family of Multi-PDZ E3 Ligases...... 22

Figure 2.1 Design and validation of using mutagenesis to disrupt the binding of C-terminal ligands...... 33

Figure 2.2 LNX1 overexpression results in increased cell length in HeLa cells...... 35

Figure 2.3 Point mutations in LNX1 PDZ4 result in decreased membrane localization ...... 37

Figure 2.4 LNX1 PDZ mutants retain auto-ubiquitination activity in vitro...... 39

Figure 2.5 Mutating PDZ1 disrupts the interaction between PDZ1 and Numb PTBi ...... 40

Figure 2.6: Mutations in LNX1 do not inhibit ubiquitination and degradation of Numb ...... 42

Figure 3.1 LNX interacts with select Frizzled tails...... 54

Figure 3.2 The interaction between LNX1 and Fz requires the Fz C-terminal PDZ binding motif ...... 55

Figure 3.3 LNX1 interactions with Fz3 and Fz4 differ in specificity for LNX1 PDZ domains ... 57

Figure 3.4 Frizzled and LNX1 expression in HeLa cells ...... 58

Figure 3.5 The Frizzled4 interaction with LNX1 is not specific to a single PDZ domain ...... 60

viii

List of Abbreviations

Ala (A) Alanine AlexaFluorA488 Alexa Fluor Absorbing at 488 nm ANOVA Analysis of Variance APC Adenomatous Polyposis Coli aPKC atypical Protein Kinase C Arg (R) Arginine ARVCF Armadillo Repeat gene deleted in Velocardio Facial syndrome Asp (D) Aspartate ATP Adenosine Triphosphate BLAST Basic Local Alignment Search Tool Boz Bozozok BSA Bovine Serum Albumin CAR Coxsackie and Adenovirus Receptor CAST Cytomatrix at the Active zone Structural protein CD8α Cluster of Differentiation 8α CUL Cullin Cys (C) Cysteine DEP Dishevelled, Egl-10 and Pleckstrin domain DIX Dishevelled and aXin DLG Discs Large DMEM Dulbecco's Modification of Eagle's Medium DNA Deoxyribonucleic Acid dNTP Deoxyribonucleotide Triphosphate DTT Dithiothreitol DUB Deubiquitinating Enzyme Dvl Dishevelled E1 Ubiquitin Activating Enzyme E2 Ubiquitin Conjugating Enzyme E3 Ubiquitin Ligase EDTA Ethylenediaminetetraacetic Acid

EGFR Epidermal Growth Factor Receptor EGTA Ethylene Glycol Tetraacetic Acid ErbB2 erythroblastic leukemia viral oncogene homolog 2 eyePKC Eye Specific Protein Kinase C FBS Fetal Bovine Serum FERM 4.1, Ezrin, Radixin, Moesin domain Fz Frizzled GAP GTPase Activating Protein GEF GTPase Exchange Factor GK Guanylate Kinase GLGF Glycine-Leucine-Glycine-Phenylalanine Gln (Q) Glutamine Glu (E) Glutamate Gly (G) Glycine GPCR G-protein Coupled Receptor GRIP Glutamate Receptor Interacting Protein GST Glutathione S-transferase GTPase Guanine Triphosphate Hydrolase HA Hemagglutinin HECT Homologous to the E6-AP C-Terminus HEK 293T Human Embryonic Kidney 293T cells HeLa Henrietta Lacks cells HEPES 4-(2-Hydroxyethyl)-1-Piperazineethanesulfonic acid His (H) Histidine HNTG-ZE HEPES, NaCl, Triton, Glyerol, ZnCl, EDTA Buffer HRP Horseradish Peroxidase INAD Inactivation No After-potential D IPTG isopropyl-β-D-1-thiogalactopyranoside JAM Junctional Adhesion Molecule KCNA4 Potassium voltage gated channel, shaker-related subfamily, member 4 L27 Domain found in Lin-2 and Lin-7 LB Luria Broth

Leu (L) Leucine LGL Lethal Giant Larva LNX Ligand of Numb Protein X LRR Leucine Rich Repeat Lys (K) Lysine MAGI-3 Membrane Associated Guanylate kinase, protein 3 MDCK Madin-Darby Canine Kidney cells NCBI National Center for Biotechnology Information NEM N-Ethylmaleimide Nkd Naked NMR Nuclear Magnetic Resonance nNOS neuronal Nitric Oxide Synthase NPAY Asparagine-Proline-Alanine-Tyrosine OPTI-MEM Optimum Minimal Essential Media PAK6 p21 Activated Kinase 6 PALS1 Protein Associated with Lin-7 1 PAR Partitioning Defective PATJ PALS1 Associated Tight Junction protein PB1 Phox and Bem1 PBK PDZ Binding Kinase PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PDB Protein Data Bank PDZ PSD-95, DLG, ZO-1 PFA Paraformaldehyde PFAM Protein Families database Phe (F) Phenylalanine PIP Phosphoinositol phosphate PKCα Protein Kinase C α PLC Phospholipase C PLEKHG5 Plekstrin Homology domain containing family G member 5 PSD Post Synaptic Density

PTB Phosphotyrosine Binding PTBi Phosphotyrosine Binding Domaind With Insert PTEN Phosphatase and Tensin binding homolog PVDF Polyvinylidene Fluoride RBX1 Ring-Box 1 RING Really Interesting New Gene RNF Ring Finger RPM Revolutions per Minute SAP Synapse Associated Protein SCF Skp1-Cullin-FBOX Protein SDS PAGE Sodium Dodecyl Sulfate Polyacrylimide Gel Electrophoresis Ser (S) Serine SH3 Src Homology Domain 3 siRNA Small Interfering Ribonucleic Acid SKP S-Phase Kinase-associated Protein SMART Simple Modular Architecture Research Tool Src v-src Sarcoma viral oncogene homolog TBS Tris Buffered Saline Thr (T) Threonine TKB Tyrosine Kinase Binding Domain TRP Transient Receptor Potential Trp (W) Tryptophan TYK2 Tyrosine Kinase 2 Tyr (Y) Tyrosine UBD Ubiquitin Binding Domain Wnt Wingless and Int Signaling

xii 1

1 Chapter 1 INTRODUCTION 1.1 Cell to Cell Communication

Multicellular organisms are composed of billions of cells. An organism must be able to interpret its surroundings and respond to changes. In order to fulfill these basic needs, its cells must act together, interpreting environmental cues, communicating information throughout the body, and coordinating appropriate responses. The flow of information from sensing to responding can be within a single cell, between neighbouring cells, or between cells existing in different tissues of the body. Cell to cell communication allows cells of an organism to move in a coordinated fashion, maintain appropriate cell-to-cell connections, and to coordinate growth by controlling processes such as cell division, cell differentiation, and apoptosis (Scott and Pawson 2009). The specific response is often context dependent: a single signal may have different results in distinct types of cells, and different signals may cause the same response in different cells. The result of a signal is also somewhat dependent on the way in which it is transduced through a cell (Pawson 2007). Thus, signal transduction, the process with which external cues are transmitted within the cell, depends on cell type, cell location, and the specific intracellular components that transmit the signals.

Signal transduction is facilitated by protein-protein interactions, and propagates signals inward from the cell surface, and in some pathways outward from the nucleus and cytosol to the cell surface. Interpretation begins when a specific transmembrane receptor is activated upon binding its ligand (signal molecule). The intracellular portion of the activated receptor transmits the signal inwards by recruiting cytosolic proteins. The resulting chain of protein-protein interactions is able to elicit modifications that contribute to the response inside the cell by activating or deactivating specific enzymes, altering the localization of proteins, or by triggering the formation of multi-protein complexes that bring effector proteins together (Pawson 2007). The chain of interactions and modifications continues inwards to destinations such as effector enzymes or the nucleus. The overall response may cause changes to enzyme activity, gene expression, and protein translation.

Individual signal transduction proteins can be subdivided into modular functional units called domains. These domains are able to fold independently and can be likened to building blocks; the proteome contains many examples of different proteins constructed by the reshuffling of domains (Pawson 2007). Isolated domains can possess catalytic activity, such as kinase or protease domains, or be non-catalytic and only able to form interactions with proteins or other biological molecules. Modular domains, catalytic or non-catalytic, often interact with specific conserved sequences in targets. A very common example of non-catalytic domains is the protein- protein interaction domain. These protein binding domains can be found as parts of an enzyme, able to bind substrate molecules, localize the enzyme, or act to regulate the catalytic activity. Domains can also be part of proteins lacking enzymatic functions. These proteins composed entirely of protein-protein interaction domains can be further classified as docking, adaptor, or scaffold proteins (Zeke et al. 2009; Alexa et al. 2010). The diversity of signal pathways and responses is dependent on the combinatorial nature of domain-containing signal proteins; a step in a given pathway may be transmitted by one of several possible proteins, and a particular signaling protein may bring about different responses by participating in several different pathways.

1.2 PDZ (PSD-95, DLG, ZO-1) Domains

Modular protein-protein interaction domains are independently folding units within full-length proteins able to facilitate protein interactions. The list of known protein-protein interaction domains continues to increase as new domains are described and previously described domains assume new functions. The Postsynaptic density-95/Disks large/Zonula occludens-1 (PDZ) domain is one of the most commonly occurring protein-protein interaction domains. Over 250 unique PDZ domains have been identified in the human proteome according to domain detection programs BLAST, PFAM, and SMART (Altschul et al. 1990; Schultz et al. 2000; Finn et al. 2006). PDZ domains can be found in enzymes, adaptor proteins, and multi-domain scaffold proteins. PDZ domain containing proteins are involved in processes such as synapse function and the development and maintenance of cell polarity (Roh and Margolis 2003; Shin et al. 2006; Feng and Zhang 2009). These globular domains are approximately 90 residues in size, and consist of five or six β-strands and two α-helices (Figure 1.1). They have been traditionally described as interacting with the C-terminal tail of target proteins

Figure 1.1 Labelled Stucture of PSD-95 PDZ3 The secondary structure components of a typical PDZ domain include 2 alpha helices and 6 beta strands. The C-terminal ligand (shown in yellow) occupies a space between β2 and α2. The flexible loop between β1 and β2 is the carboxylate binding loop responsible for accommodating the negative C-terminal carboxylate group. (PDB Code: 1TP3)

(Doyle et al. 1996; Jemth and Gianni 2007). More recently, some PDZ domains have been found to bind other PDZ domains, internal peptide sequences, and phosphoinositides (Harris et al. 2001; Wong et al. 2003; Zimmermann 2006; Gallardo et al. 2010; Karlsson et al. 2012) (Figure 1.2). Since the first PDZ domain structure was solved, subsequent studies have characterized binding of PDZ domains to each of these ligand types. A discussion of mechanisms as they are currently understood, as well as the relevance of each type of binding to PDZ domain biology, has been included below.

1.2.1 C-terminal Ligand Interactions

Most PDZ domain ligands are C-terminal tails. The first structure of a PDZ domain was that of the third PDZ domain of PSD-95. This structure described a hydrophobic groove between β2 and α2 that was found to accommodate C-terminal ligands; these ligands form a β-sheet with β2 and β3, as labeled in Figure 1.2A (Doyle et al. 1996). This structure also highlighted a number of PDZ-defining features surrounding the hydrophobic groove, including a GLGF repeat, a highly conserved Arg/Lys in the carboxylate binding loop at the top of the groove, and a His residue opposite the GLGF repeat. The GLGF repeat is part of β2; it forms a hydrophobic backbone of the binding pocket able to complete a β-sheet which includes the ligand. This hydrophobic sequence also accommodates the hydrophobic sidechain of the ligands’ C-terminal residue. A basic Arg/Lys residue in the carboxylate binding loop is essential for C-terminal ligand binding. This basic residue coordinates a water molecule that hydrogen bonds with the ligand C-terminus. The ligands’ negatively charged carboxyl group is otherwise incompatible with the hydrophobic nature of the binding pocket (Doyle et al. 1996). A His residue in the binding groove is responsible for making a hydrogen bond with position -2 of the ligand, leading to a preference for a hydroxyl containing Ser or Thr residue at this position (Songyang 1997). Alternatively, the presence of a hydrophobic or aromatic residue in this position correlates with binding to ligands with hydrophobic residues in position -2.

Since the first PDZ structure published by Doyle in 1996 identified trends for consensus at positions 0 and -2, over 350 PDZ domain structures have been deposited into the Protein Data Bank (Berman et al. 2000). This expanding pool of structural data on PDZ domains and PDZ- ligand interactions has now identified 8 additional PDZ-ligand interactions between the binding

Figure 1.2 The Range of PDZ-ligand Interactions PDZ domains have been described as interacting with C-terminal peptides (A), other PDZ domains (B), internal peptides (C), and phosphoinositides (D). (A) The first PDZ structure, PSD- 95 cocrystallized with an interacting peptide (PDB code: 1TP3), highlights the pocket formed between β2 and α2 that accommodates the hydrophobic peptide and its charged C-terminus. (B) The dimer formed between two ZO-1 PDZ2 monomers (PDB code: 2JWE) utilizes surfaces distinct from the peptide ligand binding site. (C) PAR-6 (PDB code: 1RZX) is able to bind internal sequences using a mechanism similar to that of C-terminal peptides. (D) PAR-3 PDZ2 is one of several PDZ domains that have been shown to bind phosphoinositides in vitro and in vivo. The PAR-3 PDZ2 residues forming the phosphoinositide binding site (green) and the membrane associating positive cluster (yellow) have been marked (PDB code: 2OGP).

6 pocket and positions 0 to -7 of the ligand (Skelton 2002; Tonikian et al. 2008). Several high- throughput screens have been conducted to expand on specificity trends identified in PDZ domain structures (Songyang 1997; Fuh et al. 2000; Song et al. 2006; Stiffler et al. 2007). Data from early structural studies have lead to the most common method for describing C-terminal ligand binding specificity of PDZ domains. This scheme groups them into two classes based on the preferred residues at position 0 and -2 on the ligand: class 1(X-S/T-X-ϕCOOH) and class 2 (X-

ϕ-X-ϕCOOH), where X is any residue and ϕ is a hydrophobic residue. These high-throughput studies utilizing techniques such as yeast two hybrid, and peptide arrays, expanded the scheme to include four classes. Class 1 (X-S/T-X-ϕCOOH) and class 2 (X-ϕ-X-ϕCOOH) were joined by class 3

(X-D/E/K/R-X-ϕCOOH), and class 4 (X-X-ψ-D/ECOOH), where ψ is an aromatic residue (Song et al. 2006). These studies also identified a growing number of PDZ domains that bound ligands not included in the current classification scheme. A more exhaustive study using phage display expanded on the four class system by examining the preferences of over 150 different PDZ domains for residues in positions 0 through -5 (Tonikian et al. 2008). This study resulted in a scheme with sixteen unique groups describing human and C. elegans PDZ domain specificity that included unusual specificities such as (X-S/T-X-CCOOH). The classification scheme created by Tonikian (2008) could also be used to predict specificity for PDZ domains with sufficient sequence similarity to previously mapped domains.

There are many well characterized PDZ domain containing proteins. Many PDZ domain containing proteins can bind to C-terminal PDZ binding motifs in the tails of transmembrane receptors. Cytosolic proteins may also contain C-terminal PDZ binding motifs; the binding of these proteins to PDZ containing scaffolds provides a means for clustering proteins necessary for transduction of a given signal pathway. For example, INAD, a multi-PDZ protein in Drosophila, is required for proper coordination of photoreceptor signal transduction in the fly eye. INAD clusters the necessary components of this pathway with its five PDZ domains, which interact with the C-termini of TRP Ca2+ channels, and enzymes PLC, and eyePKC (Shieh and Zhu 1996; Chevesich et al. 1997; Kumar 2001). These components thereby function together to facilitate a Drosophila photocascade, one of the fastest signaling pathways characterized (Tsunoda and Zuker 1999).

1.2.2 PDZ-PDZ Dimerization

While the primary method for PDZ domain binding involves C-terminal ligands, there are several examples of PDZ domains able to bind to other PDZ domains. For example, the PDZ domain of neuronal nitric oxide synthase (nNOS) is able to bind the PDZ domain of α1- syntrophin and the second PDZ domain of PSD-95 through a β-finger shaped extension of nNOS PDZ domain (Hillier 1999; Tochio et al. 2000; Harris et al. 2001). The β-finger forms a shape very similar to the C-terminus of a conventional PDZ domain ligand and is accommodated between β2 and α2 by the same means as C-terminal peptides. The β-finger of nNOS has a negatively charged Asp residue able to mimic the carboxylate group of a C-terminal peptide. Other examples of PDZ dimers interacting through a surface separate from the canonical binding cleft have also been studied structurally (Im et al. 2003; Im et al. 2003). Such PDZ dimers are formed by a “back to back” interaction that leaves the peptide binding cleft of each PDZ domain free to simultaneously interact with C-terminal ligands (Figure 1.2B). This back-to-back dimerization requires that the β1 strand of each PDZ domain interact to form a β-sheet, as seen in crystal structures of GRIP1 PDZ2, NHERF1, ZO-1 PDZ2, and the PDZ domain of Shank (Fouassier et al. 2000; Im et al. 2003; Im et al. 2003; Utepbergenov et al. 2006). These studies have shown that PDZ domains use a variety of different mechanisms and binding interfaces to interact with one another. More examples of PDZ-PDZ dimer structures may allow for sequence homology based prediction of the method by which two domains can interact.

Until recently, examples of PDZ-mediated dimerization were limited to those mentioned above. To determine the extent of PDZ-PDZ dimerization, Chang et al.(2011) conducted a peptide microarray experiment using all 157 PDZ domains encoded by the mouse genome. They spotted each PDZ domain onto microarray chips and probed them with every PDZ domain, for a total of 12 403 combinations. After accounting for false positives by confirming each hit using a solution phase fluorescence polarization assay, the authors identified 37 PDZ-PDZ interactions, 34 of which were novel. Seven of the novel interactions were also tested by coaffinity purification, which was successful in each case. Furthermore, a survey of protein-protein interaction databases showed that the proteins involved in each of these seven interactions were already known to be connected to each other through protein interaction networks. Unfortunately, the authors did not distinguish whether each interaction was facilitated by pseudo C-terminal or back-to-back

8 binding. Regardless of the mechanism, these results suggest that PDZ-PDZ interactions are more common than previously thought, involving 30% of the PDZ domains found in mice. Additional studies will be required to determine whether the PDZ-PDZ oligomers identified in vitro also form in vivo.

The role of PDZ-PDZ dimerization has been studied for ZO-1. ZO-1 is a scaffold protein that associates with tight junctions in polarized epithelial cells by binding to the C-terminal tails of junction proteins, such as claudins (Itoh et al. 1999). As mentioned above, ZO-1 PDZ2 is able to form dimers through a “back to back” interaction that leaves the C-terminal PDZ binding site of both monomers free to bind targets (Utepbergenov et al. 2006; Wu et al. 2007). Functional characterization by Chen and colleagues (2008) established that the interface created by ZO-1 PDZ dimerization contains a connexin43 binding site. Disrupting the formation of these dimers by mutagenesis is sufficient to attenuate membrane localization of ZO-1in HeLa cells. Interestingly, the dimerization-dependent interaction between ZO-1 and connexin43 is required for cell to cell communication and dynamic remodeling of gap junctions (Rhett et al. 2011). Taken together, these results highlight the importance of ZO-1 PDZ dimerization to its localization and biological function.

PDZ-PDZ dimerization is an efficient means for assembling multi-scaffold signaling complexes downstream of activated transmembrane receptors. Given the number of PDZ domains that can dimerize, more examples of PDZ-PDZ binding downstream of activated receptors may well be uncovered in the future.

1.2.3 Internal Sequence Binding

In addition to reports where PDZ domains have been found to dimerize by interacting with internal sequences belonging to other PDZ domains, some PDZ domains are able to interact with internal sequences of other proteins including transmembrane receptors. One well characterized example of a PDZ domain interation with a protein ligand through internal sequence binding is that of Dishevelled PDZ domain binding to an internal sequence in the C-terminal tail of Frizzled. The Dishevelled PDZ domain interacts with a conserved KTXXXW internal sequence just downstream of the seventh transmembrane domain of Frizzled (Wong et al. 2003). Structural characterization by NMR showed that this interaction utilizes the peptide binding cleft of the

PDZ domain. This internal sequence interaction is important for Wnt signaling downstream of Frizzled, because it allows for the unbound C-terminus of Frizzled to interact with PDZ domain containing scaffold proteins, such as PSD-95, MAGI-3 kinase containing catalytic scaffold, or polarity protein PATJ (Hering and Sheng 2002; Yao et al. 2004; Djiane et al. 2005; Wawrzak et al. 2009). Another published internal sequence binding interaction involves the PDZ domain of polarity protein PAR-6 and an internal sequence of polarity protein PALS1 (Peterson et al. 2004). This interaction is mediated by α2 and the carboxylate binding loop, making the binding site similar to the peptide binding cleft (Figure 1.2C). The interaction between INAD, a Drosphila PDZ scaffold, and the TRP channel is two-fold. An internal sequence of TRP binds INAD via its third PDZ domain, and the TRP C-terminal tail binds its fifth PDZ domain (Liu et al. 2011). This example of tandem PDZ domains binding the same ligand through a combination of internal sequence and C-terminal binding provide evidence that internal sequence interactions add specificity and affinity to PDZ interactions.

A yeast two-hybrid screen of PDZ domain interactions in C. elegans found that over half of the interactions detected were with internal motifs (Lenfant et al. 2010). The authors concluded noncanonical PDZ domain interactions make up a greater fraction of PDZ domain interactions than previously appreciated; the significance of this observation requires more research on internal sequence binding and PDZ domains in vivo.

1.2.4 PDZ-Phospholipid Interactions

PDZ domains are generally considered protein-protein binding domains. Studies over the past decade have uncovered evidence that would suggest some PDZ domains are also able to bind phosphoinositides (PIPs), and that for PAR-3, ZO-1, and Syntenin, this membrane PIP binding is involved in membrane targeting and biological function.

The structural basis for phosphoinositide binding of polarity complex protein PAR-3 PDZ2 has been studied using NMR (Wu et al. 2007). Using a lipid strip assay,Wu and colleagues (2006) found that PAR-3 PDZ2 non-specifically interacted with several phosphoinositides, including phosphatidylinositol 3-phosphate (PIP3), PIP4, PIP5, phosphatidylinositol 3,4-bisphosphate (PI-

3,4-P2), PI-3, 5-P2, PI-4,5-P2, and phosphatidylinositol 3,4,5-triphosphate (PI-3,4,5-P3). They also found that the negatively charged phosphoinositide head group is accommodated by a

10 positively charged binding site formed by Arg and Lys at the top of loops between α2 and β6, as well as between β1 and β2 (Figure 1.2D). A second positively charged cluster on the loop between α1 and β2 is thought to rest against head groups in the lipid bilayer. The physiological relevance of these positively charged clusters were evaluated by introducing mutant forms of PAR-3 lacking the charged clusters into MDCK cells. While many of these PAR-3 mutants showed decreased membrane localization, constructs where R/K residues were mutated to E produced a more dramatic result when compared to R/K to A mutants. Since PAR-3 is involved in formation and maintenance of tight junctions, mutants were also examined for their ability to re-establish tight junctions following calcium-mediated depolarization and repolarization. Cells overexpressing mutated PAR-3 were not able to re-establish tight junctions. These experiments suggest that lipid binding is integral to for the biological function of PAR-3.

Structural, cellular, and mutagenesis studies have been used to characterize binding of Syntenin- 1 to phosphoinositides. Syntenin-1 is a Syndecan-binding scaffold protein containing two PDZ domains. While both PDZ domains show can bind phosphoinositides, high affinity requires both the PDZ domains are in tandem (Zimmermann et al. 2002). Acting together, the Syntenin-1 PDZ tandem binds phosphoinositides, specifically PI-4,5-P2, with transmembrane Syndecan proteins, or with a phosphoinositide and Syndecan protein simultaneously, thus highlighting the flexibility of PDZ domains. Zimmermann and colleagues (2002) characterized a quadruple mutant Syntenin-1 that is unable to bind lipids in vitro and in cells. These mutations are localized to the carboxylate binding loop (K119A) and the N-terminal region of α2 helix (S171H; D172E; K173Q), suggesting that Syntenin-1 lacks a basic cluster seen in other phosphoinositide binding PDZ domains including PAR-3 and ZO-1. The biological role of Syntenin-1 phosphoinositide interaction has been studied in zebrafish, where formation of a complex containing Syntenin-1,

Syndecan, PI-4,5-P2, and GTPase Arf6 is involved in cell spreading and directional cell movements in early zebrafish embryonic development (Lambaerts et al. 2012). Specific cell movements in the zebrafish embryo were disrupted by depletion of Syntenin-1. This phenotype could be rescued through re-introduction of Syntenin-1, but not by the quadruple mutant form that lacks lipid binding ability. It was concluded that although Syntenin-1 lacks a positive charge cluster, it is still able to influence cell movements and development through interaction between its PDZ domains and PI-4,5-P2.

Their diverse methods for ligand binding make PDZ domains dynamic participants of signal transduction. Proteins containing multiple PDZ domains have the potential to interact with target proteins via C-terminal motifs and internal sequences, dimerize with other PDZ domains, and target complexes to biological membranes by interacting with phosphoinositides. The ability to assemble complexes with proteins and other factors is characteristic of scaffold proteins. It follows that PDZ domains can act as integral components of scaffold proteins that organize signal transduction complexes in order to streamline flow of information downstream from cell- surface receptors.

1.3 PDZ Domain-containing Scaffold Proteins

Scaffold proteins contain multiple interaction domains, and as such, they are able coordinate several signaling proteins simultaneously (Pawson 2003; Alexa et al. 2010). Scaffolds bring together components of a given pathway, increasing efficiency. They enable signal specificity by allowing for the activity of signal proteins involved in multiple pathways to be directed by context of other proteins recruited. They often form the central hub of a signaling pathway, making them a point of regulation for an entire signal cascade. Post-translational modifications, such as phosphorylation or ubiquitination, can regulate scaffolds, keeping specific proteins inactive until needed; regulation by ubiquitination will be discussed in detail below (Pawson 2007).

Given their roles in coordination of signaling pathways, insight into the mechanisms that regulate signal transduction can be gained by studying scaffold proteins. The first step in understanding the function of a given scaffold involves close examination of its domain architecture. Many scaffold proteins contain one or more PDZ domains. Almost 300 PDZ domains are present in the human genome in over 100 separate gene products (Tonikian et al. 2008; Te Velthuis et al. 2011) (Figure 1.3). PDZ domain containing proteins are involved in cellular processes including neuron function and cell polarity (Shin et al. 2006; Wawrzak et al. 2009). Each of these examples will be discussed in brief below.

1.3.1 PDZ Scaffolds in the Postsynaptic Density (PSD)

The postsynaptic density is a region of membrane thickening present at dendritic terminals of neurons (Sheng and Hoogenraad 2007; Feng and Zhang 2009). This region has specialized to receive and respond to stimuli from a presynaptic neuron. The arrival of neurotransmitters opens ligand-gated ion channels, which depolarize this region. Scaffold proteins play an integral role in the postsynaptic response to stimuli; these scaffolds, most containing several PDZ domains, are needed to cluster cell-surface receptors together, and to organize signaling complexes required for transmission of signal inwards from receptors (Feng and Zhang 2009). Postsynaptic density 95 (PSD-95) is a multi-PDZ domain scaffold involved in postsynaptic signaling. Originally isolated from preparations of rat PSD, PSD-95 was later shown to interact with glutamate receptors on the postsynaptic membrane (Cho et al. 1992). Presently, PSD-95 describes a family of PDZ scaffold proteins with four members (PSD-95, PSD-93, SAP102, and SAP97). Each family member contains three PDZ domains and two additional protein-protein interaction domains; a Src Homology 3 (SH3) domain and a guanylate kinase-like (GK) domain (Kim and Sheng 2004). PSD-95 is one of the most abundant proteins in the post-synaptic density. Higher order complexes of PSD-95 form through self-associations between palmitoylated N-termini (Christopherson et al. 2003). In addition to glutamate receptors, the PDZ domains of PSD-95 have been shown to interact with other PDZ scaffolds including GRIP, Src family non-receptor tyrosine kinases, GTPase activating proteins (GAPs), GTPase exchange factors (GEFs), ion channels that when activated cause depolarization, cell adhesion proteins, microtubule binding proteins, and motor proteins that move cargo along microtubules (Kim et al. 1995; Irie 1997; Kim et al. 1998; Passafaro et al. 1999; Mok et al. 2002; Kalia and Salter 2003; Akum et al. 2004). The ability of PSD-95 to interact with multiple proteins through its three PDZ domains gives it the potential to act as an integral controller of postsynaptic signaling. The variety of binding partners suggests that PSD-95 may organize signaling events in a dynamic fashion with specific complexes assembling under specific conditions.

Using electron microscopy, Chen and colleagues (2008) determined the structural arrangement of proteins in the postsynaptic density. They established that a network of scaffolds, formed mainly by PSD-95, links transmembrane proteins, including glutamate channels and cell

Figure 1.3 PDZ Domain Containing Scaffold Proteins Domain architecture of PDZ-domain containing scaffold proteins. Proteins have been represented by lines scaled to their length as shown by Ensembl (EBI). Domains shown include PDZ domains, RING (Really Interesting New Gene), SH3 (Src Homology 3), GK (Guanylate Kinase), DIX (DIshevelled and aXin), DEP (Dishevelled, Egl-10 and Pleckstrin), LRR (Leucine Rich Repeats), PB1 (Phox and Bem1), and L27 (Lin-2 and Lin-7).

14 adhesion proteins, to downstream effectors and the cytoskeleton. The interconnected network of PSD-95 and Shank, an ankyrin repeat scaffold, is also able to recruit additional signaling molecules, such as GTPases that are needed for remodeling of the cytoskeleton (Tada and Sheng 2006). The large number of PDZ domains within this network enables near instantaneous binding of activated receptors or ion channels at the plasma membrane (Kim and Sheng 2004; Feng and Zhang 2009). This dense network is also able to restrict lateral motion of receptors and ion channels in the membrane, maintaining high concentrations of receptors and ion channels essential for neurotransmitter binding (Chen et al. 2008). This strategy of using scaffold proteins, mainly PSD-95, to control receptor and ion channel motion and downstream signaling enables the fast response time characteristic of neuronal cells.

1.3.2 PDZ Scaffolds and Cell Polarity

The development and maintenance of polarity is another example of a cellular process that utilizes scaffold proteins to control signal transduction and recruit critical downstream factors. During development, progenitor cells may divide asymmetrically to produce daughter cells with different cell fates. The process of asymmetric cell division can be followed by observing the movement of specific polarity proteins to a particular pole (Iden and Collard 2008). At the level of tissues, cell polarity is a means for creating a barrier between external and internal environments. Epithelial cells have characteristic apico-basal polarity, such that the apical surface is in contact with the lumen/external environment, and the basal surface faces the internal compartment (Yeaman et al. 1999). At a molecular level, epithelial polarity is controlled by three separate polarity complexes, each of which includes PDZ domain mediated protein recruitment. The proteins of the PAR complex (PAR-3, PAR-6, and aPKC) localize to tight junctions that form near the apical surface of epithelial tissue (Suzuki and Ohno 2006; Goldstein 2007). Both PAR-3 and PAR-6 contain PDZ domains. PAR-3 interacts with PDZ-binding motifs at the C- terminus of tight junction proteins, including junctional adhesion molecules (JAMs) (Ebnet et al. 2001). It also interacts with PAR-6 via a PDZ-PDZ interaction (Ohno 2001). PAR-6 and aPKC are bound to each other through their PB1 domains. Appropriate localization and functioning of this complex is crucial for proper junction formation during epithelial cell development as well as for maintenance of the apical domain (Suzuki and Ohno 2006; Goldstein 2007).

A second PDZ containing complex involved in development of polarity is the Crumbs complex, which consists of Crumbs (a transmembrane protein), PALS1 (a PDZ containing guanylate kinase similar to PSD-95), and PATJ (a PDZ scaffold containing 13 PDZ domains) (Roh and Margolis 2003). This complex localizes to tight junctions in mammalian epithelial cells. PALS1 and PATJ form a complex by way of their L27 domains; an interaction between the PALS1 PDZ domain and the C-terminal PDZ binding motif of Crumbs targets PALS1 and PATJ to tight junctions (Roh et al. 2002; Roh and Margolis 2003). The multiple PDZ domains of PATJ are important for protein recruitment to the Crumbs complex, and have been shown to interact with tight junction proteins ZO-3, and claudins (Roh et al. 2002; Roh et al. 2002). An additional interaction between the N-terminus of PALS1 and the PDZ domain of PAR-6 links both apically located polarity complexes, allowing for phosphorylation of Crumbs by aPKC (Hurd et al. 2003; Assemat et al. 2008). The extent to which these complexes are able to regulate one another is a subject of much investigation.

A third PDZ domain containing complex involved in maintenance of cell polarity is the Scribble complex, which contains Scribble (a leucine rich region (LRR) multi-PDZ scaffold), Discs Large (DLG – a guanylate kinase PDZ protein similar to PSD-95), and Lethal Giant Larva (LGL – WD40 repeat containing protein). Unlike the apical complexes discussed above, the Scribble complex is located laterally, and is thought to be involved with maintenance of baso-lateral membrane (Roh and Margolis 2003; Assemat et al. 2008). Scribble and DLG are localized to the membrane, specifically to adherens junctions. Scribble recruitment requires E-cadherin (Navarro et al. 2005). More recently, LGL1 has been found to bind Scribble at its LRR (Kallay et al. 2006). Proper expression of this Scribble complex proteins is required for maintenance of epithelial polarity; knockout of any of these proteins results in loss of apico-basal polarity (Assemat et al. 2008). The role of specific protein-protein interactions in Scribble complex formation and maintenance has yet to be characterized in detail. The PDZ domains of Scribble aid in its lateral localization, as they have been found to interact with lateral junction proteins (Metais et al. 2005). DLG PDZ domains interact with β-catenin, the Wnt-related scaffold APC, tumour suppressor PTEN, and lateral membrane localized protein 4.1R (Lue et al. 1996; Matsumine et al. 1996; Adey et al. 2000). These PDZ-mediated interactions recruit signaling proteins necessary for polarity and junction formation; for example, 4.1R is a FERM domain protein needed to reorganize the cytoskeleton around cell-cell junctions (Han et al. 2000).

Scaffold proteins containing multiple PDZ domains are a common component of polarity related complexes. Many of these scaffolds are critical for cell function. Indeed, disruption of their expression results in extreme phenotypes, including loss of polarity (Assemat et al. 2008). The loss of proper scaffold protein expression is advantageous for tumour cells, and can reactivate developmental transitions that aid in metastasis, transforming cells from an epithelial to a more mesenchymal state (Ellenbroek et al. 2012). In general, scaffold proteins, including PDZ domain containing scaffolds, are indispensible components of cell signaling.

1.4 The Ubiquitination System

1.4.1 Ubiquitination Regulates Signal Transduction

Ubiquitination is a process by which a 76 amino acid Ubiquitin moiety is attached to proteins in order to target them for degradation or altered cellular function (Deshaies and Joazeiro 2009). Ubiquitinating substrates involves the coordinated efforts of three separate enzymes (Pickart and Eddins 2004) (Figure 1.4). The E1 activating enzyme hydrolyzes ATP to form a thioester bond with Ubiquitin. Following activation, Ubiquitin is transferred to an E2 conjugating enzyme. The final attachment of Ubiquitin is facilitated by an RING E3 ligase, which contacts both the E2 and the substrate simultaneously. Ubiquitin is generally described as being attached to the substrate through formation of an isopeptide bond between substrate Lys and the C-terminal Gly residue of Ubiquitin (Deshaies and Joazeiro 2009). Ubiquitin can also be added to the primary amino group at the substrate N-terminus. Ubiquitin can be added singularly (monoubiquitination), or built into long chains (polyubiquitin). Because Ubiquitin has seven different Lys residues, polyubiquitin chains can assume a variety of different topologies depending on the lysine residues utilized for chain linkage (Ikeda et al. 2010). The N-terminal methionine residue (M1) can also be used for mono and polyubiquitin linkage. These topologies include chains of a particular lysine linkage (K6, K11, K27, K29, K33, K48, and K63), chains with mixed linkage, or branching if multiple Lys on a given Ubiquitin are involved (Ye and Rape 2009). The addition of monoubiquitination versus polyubiquitination has implications on the outcome or function of a substrate. Similarly, chains with certain single linkages, for example K48 or K63, are associated with specific substrate fates (Ye and Rape 2009; Ikeda et al. 2010). The different outcomes of Ubiquitin attachment will be discussed in more detail below.

Figure 1.4 Substrate Ubiquitination. (A) Ubiquitination is a multistep process beginning with ATP-dependent activation of Ubiquitin by an E1 activating enzyme. (B) Following activation, E1 transfers the Ubiquitin moiety to an E2 conjugating enzyme. (C) Once conjugated to Ubiquitin, E2 associates with a RING E3 Ligase and substrate. (D) The RING E3 Ligase acts to facilitate the transfer of Ubiquitin from E2 to a specific substrate. The E2 returns to its original state and is able to acquire another activated Ubiquitin moiety from E1. (E) The complex dissociates following ubiquitination. Polyubiquitin chains can be forms by including a ubiquitinated substrate in multiple iterations of this cycle.

The number and complexity of enzymes involved in ubiquitination increases from E1 to E3; humans have 2 E1s, approximately 40 E2s, and over 600 E3s (Ye and Rape 2009). Recent work has established that E2 conjugating enzymes may contribute to the length and topology of Ubiquitin chains; some E2s have a known preference for particular linkages (David et al. 2010). However, E2 enzymes do not bind directly to their substrates, and thus, specificity is largely a function of the E3 ligase, since it contacts and orients the substrate (Pickart and Eddins 2004; Deshaies and Joazeiro 2009). There are two main types of E3 ligases: HECT-type E3 ligases form a covalent bond with Ubiquitin prior to transferring it to substrate. RING-type E3 ligases, introduced above, do not bond to Ubiquitin, they simply facilitate transfer directly from E2 conjugating enzyme to substrate. As RING-type E3 ligases are the focus of this thesis, they will be discussed in more detail.

1.4.2 RING-type E3 Ligases

RING-type E3s may be more aptly described as scaffolds or adaptors than enzymes because they do not possess intrinsic catalytic activity. The human genome contains over 300 putative RING- type E3 ligases (Li et al. 2008). Li (2008) and colleagues have proposed that RING E3s should be considered adaptor proteins or complexes given that 75% of putative RING E3s contain at least one protein-protein binding domain. At the structural level, RING domains are similar to Zn fingers in that they are Zn2+ binding and possess a conserved arrangement of Zn2+ coordinating Cys and His residues (Deshaies and Joazeiro 2009). Using a yeast two-hybrid screen investigating interactions of E2 conjugating enzymes Lorick et al. (1999) showed that E2 UbcH5 interacted with RING containing protein AO7, and that mutations in the conserved Cys residues disrupted E2 dependent ubiquitination. This data was the first to show that the RING domain directly contacted the E2, and that this interaction was required for Ubiquitin transfer. The structural details of E2-RING interaction were shown subsequently by x-ray crystallography on the E3 ligase Cbl in contact with E2 UbcH7 (Zheng et al. 2000). A groove created by arrangement of the Zn2+ coordinating loops of the RING domain makes contact with a hydrophobic surface on the E2. Additional structural and mutagenic studies on other E2-E3 complexes suggest that these contact surfaces are generally conserved (Zheng et al. 2000; Brzovic et al. 2003; Dominguez et al. 2004). Nevertheless, a single model cannot be generated to

19 explain all E2-E3 interactions as multiple variant E3s, such as Rag1, are missing conserved residues (Yurchenko et al. 2003).

Unlike E2-E3 interaction facilitated by the RING domain, interaction between E3 and substrate is often achieved via flanking protein-binding domains on the E3 (Deshaies and Joazeiro 2009). These domains may include domains such as SH2, SH3, and PDZ domains. Cbl, for example, is an E3 ligase that engages substrates, including the epidermal growth factor receptor (EGFR), through an N-terminal tyrosine kinase binding (TKB) domain (Lipkowitz and Weissman 2011). Once bound, phosphorylated receptor tyrosine kinases, like EGFR, become substrates for ubiquitination. A subset of RING-type E3s exist as multi-protein complexes which include Cullin family scaffolds. These multi-protein E3s contain a RING domain protein, RING-binding adaptor protein, and substrate binding protein in complex on a Cullin scaffold (Duda et al. 2011). Such complexes act as a single unit, selectively binding substrates and interacting with E2s, thereby facilitating Ubiquitin transfer. One such example is the SCF (SKP1 – CUL – Fbox) complex. Bound to CUL1, a member of the Cullin family, the SCF complex includes RING protein RBX1, and adaptor protein SKP1 (Cardozo and Pagano 2004). SKP1 is able to recruit substrate recognition Fbox proteins. The diversity proteins that are SCF substrates stems from the variety of Fbox proteins found in the human genome, as over 70 Fbox proteins have been described (Jin et al. 2004). Neither multi-protein E3 complexes nor single protein E3s covalently bind to Ubiquitin. Regardless, these proteins are integral to ubiquitination, and thus are able to determine the outcome of target proteins by influencing Ubiquitin transfer.

1.4.3 Outcomes of Ubiquitination

Ubiquitination was first identified as a means of targeting substrates for proteosomal degradation (Pickart 2004). Since then ubiquitination has also been connected to membrane protein internalization and trafficking, as well as to changing protein activity and subcellular localization (Ikeda and Dikic 2008; Ikeda et al. 2010). We now understand that the nature of Ubiquitin attachment (chain length and topology) has direct consequences for the fate of substrates. E2s and E3s work together to control ubiquitination; it is currently thought that each E2 has a repertoire of linkages they can build, and that by engaging the E2 and orienting substrate, the E3 determines linkage specificity and chain length (Wenzel et al. 2011). Outcomes of ubiquitination require interpretation of chain topology by proteins containing Ubiquitin binding domains (UBD)

(Ikeda et al. 2010). Through mechanisms that have not yet been completely elucidated, UBD proteins connect chain topology to molecular effectors in the cell. For example, chains consisting predominantly of K48 linkage commit a substrate to proteosomal degradation. The proteosome receptor subunit Rpn13 has a UBD able to recognize K48 linkage (Husnjak et al. 2008). K63 and M1 linked chains control receptor trafficking, particularly in inflammatory signal transduction pathways (Wertz and Dixit 2010; Iwai 2012). Monoubiquitination has been implicated in transmembrane receptor transport, DNA damage response, and cell cycle control (Ikeda and Dikic 2008). While there is growing evidence that mixed linkage chains are present in vitro, their relevance in vivo has not yet been determined (Ikeda et al. 2010).

Just as phosphatases catalyze removal of phosphate groups, a group of enzymes called deubiquitinating enzymes (DUBs) are proteases able to cleave Ubiquitin groups off of substrates (Wilkinson 1997; Reyes-Turcu et al. 2009). DUBs are also essential for processing proubiquitin into its mature form, and for regenerating monoubiquitin from polyubiquitin chains that have been previously removed from a substrate by the action of another DUB (Baker and Board 1987; Wilkinson et al. 1995). Because of their ability to modify Ubiquitin signals, DUBs are also involved in regulation of cellular processes, such as receptor trafficking, DNA damage response, and cell cycle control (Reyes-Turcu et al. 2009).

Ubiquitination represents a dynamic means for regulating cellular processes. While the E1, E2, E3, and DUB proteins involved in Ubiquitin transfer and removal appear elegantly simplistic, the range of outcomes that result from their activity is increasingly complex. Ubiquitination is able to control many signal transduction pathways by directing processes such as protein degradation and receptor trafficking. Substrate specificity is mediated by E3 ligase scaffolds and complexes simultaneously linking E2 and substrate. The underlying complexity of protein-protein interaction domains and scaffolds, specifically with respect to PDZ domains, was outlined above. Hence, understanding signal transduction regulation by substrate ubiquitination requires analysis of E3 ligase domain architecture. The section that follows focuses on dissecting the function and regulation of a particular family of multi-PDZ domain E3 ligases.

1.5 Ligand-of-Numb Protein X Family

The multi-PDZ domain E3 ligase Ligand-of-Numb Protein x (LNX1) was originally identified by the McGlade lab as interacting with Numb, a cell fate determinant (Dho et al. 1998). LNX1 is

21 now recognized as belonging to a family containing four members, each with a RING domain and either two or four PDZ domains (Figure 1.5). Our lab has shown that LNX1 facilitates substrate ubiquitination. In the case of Numb, its binding to LNX leads to polyubiquitination and proteosomal degradation of specific Numb isoforms p66 and p72 that contain a PTB domain insert (Nie et al. 2002; Nie et al. 2004). An LNX1 truncation mutant lacking all four PDZ domains is unable to ubiquitinate Numb, suggesting that interaction between Numb and LNX1 PDZ1 is required for Ubiquitin transfer. This result was the first direct evidence that LNX1 PDZ domains can influence RING activity, and that they play a role in substrate recruitment.

In addition to Numb, several potential interactors for the LNX1 PDZ domains have been identified. Our lab conducted a proto array with LNX1 PDZ domains which identified a number of protein interactors, including kinases (PAK6, TYK2, PKCα), transmembrane proteins (KCNA4 channel, ARVCF), and Wnt related proteins (Dvl3, and Nkd2) (Wolting et al. 2011). Wolting et al.(2011) also reported that LNX1 is able to bind phosphoinositides, that this interaction is mediated through PDZ4, and that a cluster phosphoinositide binding residues first identified in PAR-3 is conserved in LNX1 PDZ4. In addition to our data, a number of publications have identified additional LNX binding proteins, including the Coxsackievirus and Adenovirus Receptor (CAR), Junction Adhesion Molecule 4 (JAM4), ErbB2, and presynaptic active zone protein CAST (Sollerbrant 2002; Young et al. 2005; Kansaku et al. 2006; Higa et al. 2007). Documented interactors that are also substrates include Numb, Src, claudins, and the CD8α receptor (Nie et al. 2002; Weiss et al. 2007; Takahashi et al. 2009; D'Agostino et al. 2011). LNX1 overexpression in Madin-Darby Canine Kidney (MDCK) cells resulted in a reduction of tight junction associated claudin staining (Takahashi et al. 2009). Claudin-1 was also shown to be ubiquitinated when co-overexpressed with LNX1 in Human Embryonic Kidney (HEK) 293T cells. Furthermore, the degradation of claudins could be rescued by treating cells with chloroquine, a lysosomal inhibitor.

Examples of LNX1 substrate ubiquitination (Numb and claudin-1) have shown that LNX1 is able to target substrates for proteosomal or lysosomal degradation. To better understand the role that LNX1 PDZs play in recognizing substrates for ubiquitination, Guo and colleagues (2012) designed a proteomics strategy to identify novel substrates of LNX1. They screened a random

Figure 1.5 LNX Family of Multi-PDZ E3 Ligases. Schematic showing the domain architecture of each LNX protein family member. LNX1 and LNX2 have a RING domain and 4 PDZ domains. LNX3 and LNX4 have a RING domain, 2 PDZ domains, and a long C-terminal tail.

23 peptide library for LNX1 interactors, created artificial substrates by fusing a preferential ubiquitination sequence to the PDZ-binding motif containing C-terminal sequences, incubated potential substrates with LNX1, and then identified ubiquitination in the reactions by western blotting with anti-ubiquitin antibody. Using this approach they identified several novel substrates, including PDZ-binding kinase (PBK), Claudin-17, and Potassium channel KCNA4, and connected each substrate protein to the LNX1 PDZ domain by using truncation mutants, thereby determining that proteins bound to PDZs 1-3 are sites for substrate recruitment.

1.6 Rationale

In recent years, several studies have shown a critical role for E3 ligases in substrate recognition. LNX1 is an active E3 ligase, as seen by previous studies involving Numb, Src and claudin-1; however, little is known about how the PDZ domains aid in coupling E2 to substrate, or whether they contribute to LNX1 subcellular localization. Reports on LNX interactions described above suggest that each PDZ domain has distinct transmembrane and cytosolic binding partners. Based on this evidence, we hypothesize that full-length multi-PDZ domain LNX proteins may function as molecular scaffolds. The objective of this thesis was to establish a role for PDZ domains in LNX function.

1.7 Thesis Objectives

1. To design and validate point mutations in each LNX1 PDZ domain in order to disrupt binding of C-terminal ligands, and then to use mutated LNX proteins to elucidate the role for each PDZ domain in LNX1 RING function, substrate binding, and subcellular localization as outlined in Chapter 2.

2. To use the suite of mutated LNX1 proteins to examine the role of LNX in Wnt signaling in vitro and in cells by characterizing interactions between LNX1 and the Frizzled family of Wnt-related GPCRs.

2 Chapter 2 DESIGN AND CHARACTERIZATION OF PDZ BINDING SITE MUTATIONS IN EACH PDZ DOMAIN OF LNX1 2.1 Abstract

Previous studies have identified numerous proteins that bind to its PDZ domains, several binding proteins were found to be substrates of ubiquitination facilitated by LNX1. A complete understanding of how the PDZ domains contribute to LNX1 function has yet to be established. Using mutagenesis, I disrupted C-terminal ligands binding in each LNX1 PDZ domain. I also mutated a putative phosphoinositide binding site in LNX1 PDZ4. After validating that C- terminal ligand binding had been successfully disrupted, these LNX1 PDZ mutants were investigated for their effect on subcellular localization in HeLa cells, intrinsic E3 ligase activity in vitro, and Numb ubiquitination. We found that mutation of the phosphoinositide binding site resulted in decreased membrane localization observed by confocal microscopy. Mutating PDZ1 or PDZ2 resulted in increased ubiquitination activity in vitro. Substrate ubiquitination, examined using Numb, was not disrupted by introduction of PDZ1 or PDZ2 mutations, as these PDZ mutants retained the ability to ubiquitinate Numb in cells. These studies suggest that mutagenesis is a useful approach for disrupting PDZ domain binding in the context of the full length scaffold, and that the characterization of LNX1 function using these mutants identified a potential role for C-terminal ligand binding in the regulation of LNX1 ubiquitination activity.

2.2 Introduction

PDZ domain containing scaffolds have been implicated in regulation of many cellular processes, including cell polarity and neuron function. The LNX protein family is unique among PDZ scaffolds in that all members contain a RING-type E3 ligase domain. Genome analysis has found that LNX family members exist in all vertebrate genomes (Flynn et al. 2011). This genome analysis also identified more distantly related LNX-type genes in some but not all invertebrate phyla, including sponges and flatworms. The ubiquitous inclusion of LNX in vertebrates suggests that acquisition of LNX genes occurred early in vertebrate evolution.

LNX1 was originally described as interacting with the Numb PTB domain in a yeast two-hybrid screen (Dho et al. 1998). Isoform specific ubiquitination of Numb by LNX1 has been well characterized (Nie et al. 2004). Additionally, several proteins have been identified as binding to LNX1 PDZ domains. Close inspection of these interactions has led to hypotheses regarding the function of each PDZ domain; PDZ1 has been implicated in substrate binding for Numb, Src, and PDZ-binding kinase (Nie et al. 2002; Weiss et al. 2007; Guo et al. 2012); PDZ2 interacts predominantly with junctional and transmembrane proteins, including claudin-17, CAST, the Coxsackievirus and Adenovirus Receptor (CAR), Junction Adhesion Molecule 4 (JAM4), and the CD8α receptor (Sollerbrant 2002; Kansaku et al. 2006; Higa et al. 2007; D'Agostino et al. 2011); PDZ4 interacts non-specifically with phosphoinositides (Wolting et al. 2011). Given the dynamic nature of scaffold proteins, it follows that individual PDZ domains may have multiple roles. For example, PDZ2 has also been implicated in substrate binding in the case of CD8α, claudin-17, and Potassium channel KCNA4 (D'Agostino et al. 2011; Guo et al. 2012).

These individual reports on LNX1 PDZ function have yet to provide a full understanding for the role of each PDZ domain in LNX1 biological function. To address this issue we set out to selectively disrupt C-terminal ligand binding to each PDZ domain in the context of full length protein. Once generated, these mutant LNX1 constructs were characterized with respect to their impact on subcellular localization in HeLa cells, intrinsic E3 ligase activity in vitro, and ubiquitination of Numb.

2.3 Materials and Methods

2.3.1 Design of PDZ Binding Site Mutation and Mutagenesis

The amino acid sequence of each LNX1 PDZ domain, as designated by NCBI Conserved Domain Database, was aligned to PDZ domain 3 of PSD-95. In order to disrupt C-terminal protein binding, the Arg or Lys residue with the carboxylate binding loop of each PDZ domain in a murine Flag-LNX1 construct were mutated to Ala using PCR-guided mutagenesis. For LNX1 PDZ1, R283 was mutated to Ala using GGTGAAATTACAAGCATCAAAATCAACGCAGCGGATCCCAGCGAAAG (5’) and CTTTCGCTGGGATCCGCTGCGTTGATTTTGATGCTTGTAATTTCACC (3’). These primers were also used to mutate R283 to A in a previously described isolated GST-PDZ1

26 construct (amino acids 246 – 376) in order to generate an isolated GST-fusion of the mutant PDZ1 domain (Nie et al. 2002). For LNX1 PDZ2, K390 was mutated to A using CCATGTAATCCTCAACGCAAGCAGCCCCGAGGAGC (5’) and GCTCCTCGGGGCTGCTTGCGTTGAGGATTACATGG (3’). For LNX1 PDZ3, K513 was mutated to A using GTTGTAAGTGTCTGGGCAGACCCCAGCGAGTCTC (5’) and GAGACTCGCTGGGGTCTGCCCAGACACTTACAAC (3’). For LNX1 PDZ4, R642 and R643 were both mutated to A using CCTGCATACAATGACGGAGAAATCGAATGTGGTGACATTCTTCTCGTTC (5’) and GAACGAGAAGAATGTCACCACATTCGATTTCTCCGTCATTGTATGCAGG (3’). A putative phospholipid binding site in LNX1 PDZ domain 4, identified by Wolting (Wolting et al. 2011) was disrupted by mutating K710 and K713 to E using CTGGCCAGGATGCTCGAAGAACTTGAAGGGAGAATTACTCTG (5’) and CAGAGTAATTCTCCCTTCAAGTTCTTCGAGCATCCTGGCCAG (3’).

PCR mutagenesis reactions were performed using a QuikChange II kit (Stratagene) containing 1x reaction buffer, 10 ng DNA template, 125 ng of each primer, 1 µL dNTP mix, 3 µL of

QuikSolution and ddH20 to a total volume of 50 µL. A PTC-200 Peltier Thermocycler was used with cycling parameters consisting of 18 cycles of 1 min at 95oC, 50 seconds annealing at 58 – 60oC, and 7 – 8 min extension at 68oC. These cycles were followed by an additional extension time of 7 min at 68oC to ensure that reactions went to completion. Each 50 µL PCR sample was then treated with 1.2 µL of Dpn-1(24 units) for 60 min at 37oC. 45 µL of competent E. coli (DH5α) was transformed with 5 µL of Dpn-1 treated sample. Cells and DNA were incubated on ice for 90 min and heat shocked for 45 sec at 42oC. 1 mL of LB preheated to 42oC was added following heat shock. The samples were then incubated at 37oC for 1 hour. Cells were pelleted by short centrifugation, and the entire sample plated onto LB plates containing 100 mg/mL ampicillin. Following incubation at 37oC, bacterial colonies were picked, DNA was prepped by miniprep (Qiagen) and samples sequenced (ACGT Corp). In order to screen colonies for positive mutations in each PDZ domain, the following sequencing primers were used. For PDZ1 and PDZ2 mutant screening CACCACTGTCCCCGA (5’) was used. For PDZ3 mutant screening GACGCGTCCATCTCG (5’) was used. For PDZ4 mutant screening GCCTGGTGACTGGTC (5’) was used.

2.3.2 Primers and Cloning into pGEX 4T3

A GST-fusion of mutated PDZ1 was generated using the mutagenesis primers and conditions described above. Mutated PDZ domains 2, 3, and 4, were subcloned from the full length Flag- LNX mutants into bacterial expression vector pGEX 4T3 with N-terminal GST tag. The primers used to amplify the inserts by PCR are as follows: for PDZ2 (amino acids 373 – 466) CACGTGCCGGGATCCTATGGACCTCG (5’) and GCTTCTTGAAAGATCTCGAGGCTTCACTGTCGAACC (3’). For PDZ3 (amino acids 498 – 597) GAGAGGAACACAGGATCCAAGCCTGCAGC (5’) and GGCTGCTGGGCTCGAGTCTCACTGGGCCTC (3’). For PDZ4 (amino acids 630 – 725) GGGTCATGTGGCTGGGATCCCCACAGTAC (5’) and CCATCATTGACTCGAGAAAAAAGTTCAAGGCCAAGAAGC (3’). PCR reactions contained 1x Polymerase Buffer (Roche), 200 ng dNTPs (Roche), 1 μM of each primer, and 100 ng template. The general PCR set up used for these PCR reactions includes an initial melting step of 95oC for 2 min, followed by 30 cycles of 30 sec at 95oC, 60 sec annealing at 59oC and 60 extension at 72oC. After the cycles a final 10 min extension at 72oC was used to ensure reaction completion.

Murine LNX1 and LNX1 C45A were previously cloned into pGEX (Nie et al. 2002; Nie et al. 2004). Full length LNX1 mutants (PDZ1, PDZ2, and PDZ4L) were subcloned into pGEX 4T3 by digesting DNA of each full length mutant (R283A, K390A, K710E/K713E) with 1µL of EcoRI (10 units) and 1µL of SalI (10 units) for 2 hours at 37oC. Vector was digested with the same amounts of EcoRI and SalI overnight at 37oC, dephosphorylated with 1 µL of shrimp alkaline phosphatase (Fermentas) for 1 hour at 37oC, and then gel purified from 1% agarose gel using QiaExII kit (Qiagen). LNX1 mutant inserts were ligated into predigested and purified pGEX 4T3 by mixing the appropriate amounts to maintain vector to insert ratio of approximately 1:3. Samples were incubated at 14oC overnight in 1x T4 Ligase buffer (Invitrogen) and then transformed into competent E.coli (DH5α) as described above. Colonies were screened for insert by mini-prepping DNA and digesting a portion of each sample with EcoRI and SalI, and then separating the digestions on 1% agarose gels. Samples containing the correct size insert were verified by 5’ sequencing with pGEX sequencing primer GGGCTGGCAAGCCACGTTTGGTG (5’) (ACGT Corp).

2.3.3 Plasmids

Murine LNX1 and LNX1C45A (pFLAG-CMV2), murine LNX1 PDZ1 (amino acids 246 – 376) (pGEX), HA-Ubiquitin (pMT), as well as human LNX1 PDZ2 (amino acids 373 – 466) and human LNX1 PDZ3 (amino acids 498 – 597) (pEXP15 with N-terminal GST tag) have been previously described (Dho et al. 1998; Nie et al. 2002; Nie et al. 2004; Wolting et al. 2011). GST-tagged murine LNX1 PDZ4 (amino acids 630 – 725) was generated in pGEX 4T3 by using mutagenesis to return the K710/K713E mutant to wildtype using CTGGCCAGGATGCTCAAGGAACTTAAAGGGAGAATTACTCTG (5’) CAGAGTAATTCTCCCTTTAAGTTCCTTGAGCATCCTGGCCAG (3’) and the mutagenesis conditions described above. Full length human PLEKHG5 and PAK6 were previously cloned into Gateway N-terminally tagged destination vector NMyc (Wolting et al. 2011).

2.3.4 Preparation of GST Fusion Proteins

The individual PDZ domains of LNX1, described above, were transformed into BL21 cells and induced to express GST fusion proteins by the addition of 1 mM Isopropyl-Β-D-1- Thiogalactopyranoside (IPTG) (PDZ1 and PDZ4) or 0.2% arabinose (PDZ2 and PDZ3). The cultures were then incubated at 15oC for 6 hours followed by overnight at 4oC with no shaking. After induction, cells were pelleted by centrifugation at 4000 RPM for 20 min and then resuspended in PLC lysis buffer (30 mM HEPES pH 7.5, 150 mM NaCl, 10% glycerol, 1%

Triton X-100, 1.5 mM MgCl2, 1 mM EGTA) at 10 mL of buffer/50 mL of culture. Resuspended cells were sonicated three times at 4oC for 30s using 1s and 1s off pulsing. Following sonication lysates were cleared by ultra-centrifugation for 30 min at 14 000 RPM in a Beckmann centrifuge using rotor JA20. Supernatant was incubated with glutathione sepharose beads for 90 min at 4oC with rotation. Beads were pelleted and then washed 4 times with PLC lysis buffer. After washing, beads were resuspended in an equal volume of PLC lysis buffer plus 2 mM dithiothreitol (DTT). In order to quantify the concentration of GST fusions, 10 µL and 20 µL samples were run in 12.5% SDS-PAGE alongside known quantities of bovine serum albumin (BSA). GST-fusion proteins were aliquoted into 2 µg or 5 µg amounts and stored at -80oC.

For in vitro ubiquitination assays, GST-LNX1, GST-LNX1 C45A, and GST-LNX1 mutants (LNX1 R283A, LNX1 K390A, and LNX1 K710E/K713E) were induced in BL21 cultures by the

29 addition of 1 mM isopropyl-β-D-1-thiogalactopyranoside. The cultures were then incubated at 15oC for 4 hours followed by overnight at 4oC with no shaking. These cells were pelleted and lysed as described above except lysis and washing used PBS+++ (phosphate buffered saline plus 0.1% Triton X-100, 2 mM DTT, and protease inhibitors (Complete). The quantified fusions were aliquoted into 1 µg or 2 µg amounts and stored at -80oC.

2.3.5 Transient Expression of Constructs in 293T cells

HEK 293T cells were maintained in DMEM containing 10% FBS at 37oC. Once at 50 – 60% confluency, each 10 cm plate was transfected with 1 – 3 µg of each plasmid with Lipofectamine 2000 (Invitrogen) and OPTI-MEM. After 24 – 36 hours of incubation, cells were lysed with the appropriate lysis buffer (PLC lysis buffer - containing protease inhibitors (Complete) for myc- PLEKHG5 and myc-PAK6, or in HNTG-ZE lysis buffer: 50 mM HEPES, pH 7.5, 150 mM

NaCl, 1% Triton X-100, 10% glycerol, 100 µM ZnCl2, 2 mM EDTA, and protease inhibitors (Complete) for Flag-PTBi and Numb p72). Lysates were cleared by centrifugation for 30 minutes at 14 000 RPM at 4oC.

2.3.6 GST Fusion Protein Binding Experiments

Transfected 293T cell lysate (1 mg total protein) was added to 2 µg of purified GST fusion protein immobilized on glutathione sepharose beads and brought to a total volume of 1 mL with either PLC lysis buffer (PLEKHG5 and PAK6) or HNTG-ZE lysis buffer (Numb PTB). The lysate and immobilized fusion proteins were mixed for 3 hours at 4oC. Sepharose beads were pelleted and washed four times with 1 mL PLC lysis buffer. The beads were resuspended in 30 µL of 2X SDS sample buffer with 5% β-mercaptoethanol and boiled for 5 min at 100oC. The samples were separated by 10% or 12.5% SDS-PAGE, transferred to PVDF and immunoblotted with mouse monoclonal anti-myc 9E10 (Clonetech) at 1:1000 for PAK6 and PLEKHG5, or mouse monoclonal M2 anti-Flag (Sigma) for Numb PTB. Primary antibody incubation was followed by mouse HRP secondary (GE Healthcare) at 1:10 000.

2.3.7 In vitro Ubiquitination Assays

Ubiquitination experiments were carried out using 1 µg of GST fusion protein, prepared as described above, with 0.18 μM of yeast E1 (Boston Biochem), 0.1 μM E2 (UbcH5b), 1 mM

ATP, 11.6 μM Ubiquitin, and 1x ubiquitination buffer (20 mM Tris HCl pH 7.5, 1 mM MgCl2, 0.2 mM DTT). The mixture was incubated while shaking at 220 RPM at 30oC for 90 minutes. Reactions were stopped by boiling each sample after adding 25 µL of 2X SDS sample buffer with 5% β-mercaptoethanol. The reaction mixture was resolved by SDS-PAGE and analysed by western blotting with mouse anti-ubiquitin monoclonal antibody (Covance) and mouse HRP secondary at 1:10 000.

2.3.8 Co-Immunoprecipitation of LNX1 and Numb, as well as Detection of Numb Ubiquitination and Degradation

Co-immunoprecipitation and detection of Numb degradation were carried out by cotransfecting 293T cells with Numb p72 and Flag-LNX1 or a LNX1 mutant construct (LNX1 C45A, LNX1 R283A, or LNX1 K390A). For the co-immunoprecipiation 293T cells were lysed with HNTG- ZE buffer with 1% Triton X-100. Samples containing 1 mg of total protein were brought to equal volume with lysis buffer and then incubated with Protein A Sepharose beads and 2 μg of anti- NbC affinity purified antibodies for 90 minutes at 4oC. Following incubation the samples were washed 3 times with lysis buffer and resolved by SDS-PAGE. Interactions were detected by western blotting with anti-Flag antibodies. Presence of Numb was verified by probing the same PVDF membrane with rabbit anti-NbC (1:500) and anti-protein A secondary antibodies (1:10 000).

In order to detect Numb degradation the same lysates transiently co-transfected with Numb p72 and Flag-LNX1 and mutants used. 30 μg of each lysate was resolved by SDS-PAGE. The amount of Numb present in each sample was detected by western blotting with anti-NbC antibodies. Anti-α-tubulin antibodies were used as a loading control. The same PVDF membranes were stripped and reprobed with anti-Flag antibodies to determine LNX1 expression. Numb stability was determined by comparing the band intensity of Numb with each the different LNX1 constructs using ImageJ software.

Detection of Numb ubiquitination required co-transfecting 293T cells with equal amounts of HA-Ubiquitin and LNX1, LNX1 mutant (LNX1 C45A, LNX1 R283A, or LNX1 K390A), or pFlag vector control. Cells were lysed with HNTG-ZE buffer supplemented with 1% Triton X- 100, 1% SDS, and 100 μM of deubiquitinase inhibitor N-Ethylmaleimide (NEM) (Thermo

Scientific). Lysates were boiled for 5 minutes. Samples containing 2-3 mg of protein were brought to the same volume using lysis buffer and pre-cleared by incubating with Protein A Sepharose beads at 4oC for 30 minutes. Cleared lysate was transferred to a new tube, diluted 10x with normal HNTG-ZE buffer containing 100 μM NEM, and incubated with Protein A Sepharose beads, and anti-NbC antibodies at 4oC for 4 hours. After incubation the immunoprecipitation samples were washed 3 times with normal HNTG-ZE and resolved by SDS-PAGE. Ubiquitation of immunoprecipitated endogenous Numb was detected by western blotting with anti-HA antibodies (Roche).

2.3.9 Sub-cellular Localization and Imaging

HeLa cells were maintained in DMEM containing 10% FBS at 37oC. In preparation for transfection, confluent plates of HeLa cells were trypsinized and plated in 6 well plates (Nunc) at a density of 400 000 cells per well. Once at 60-70% confluency cells were transfected with 0.5 – 1.0 µg of each plasmid with Lipofectamine 2000 (Invitrogen) and OPTI-MEM. Transfected cells were incubated at 37oC for 6 – 9 h before being trypsinized and reseeded on to glass coverslips in 24 well plates (100 µL cells per well). Coverslips were fixed with 2% paraformaldehyde (PFA) in sterile PBS and permeabilized with PBS containing 0.1% Triton X-100 16-18 h after reseeding. Following this, coverslips were blocked overnight at 4oC in PBS containing 3% donkey serum. Cells were then stained with rabbit anti-LNX antiserum (1:250 in blocking solution), described previously (Dho et al. 1998; Dho et al. 1999), and phalloidin Cy5 at 37oC for 1 h. Subsequently cells were washed three times with PBS plus 0.1% Triton X-100 at room temperature and then incubated with donkey anti-rabbit antibody conjugated to AlexaFluorA488 (1:250 in blocking solution) for 1 h at 37oC. Coverslips were washed three times with PBS plus 0.1% Triton X-100 at room temperature in the dark, mounted onto glass slides using fluorescence mounting media (Dako) and analyzed using confocal microscopy. Cell lengths were measured along the longest cell axis from confocal images using Volocity software. Line profiles of LNX1 staining intensity were collected using Volocity software.

2.3.10 Statistical Analysis

Comparisons were made between each LNX1 construct and the vector control for the cell lengths analysis. Statistical analysis, including ANOVA and Student’s t-test, was completed using Excel

32 for 3 biological replicates, each consisting of 30 measured cells. Cell lengths were measured along the longest cell axis from confocal images using Volocity software.

For the line profile data, comparisons were made between wildtype LNX1 and each LNX1 mutant construct tested. Analysis, including ANOVA and Student’s t-test, was completed using Excel for 3 biological replicates, each consisting of 10 measured cells. Line profiles of LNX1 staining intensity were collected for a single Z-slice using Volocity software. Two lines were measured for a given cell using a line width of 2 μm. The R values calculated for each line using Equation 1 were averaged. The average R value for the 2 lines was calculated for measurements from 10 cells.

Equation 1:

2.4 Results

2.4.1 Design and Validation of PDZ Binding Site Mutation in LNX1 PDZs

Recent work on multi-PDZ domain containing proteins, including Syntenin (Grembecka et al. 2006) has suggested that the context of a PDZ domain in full length protein may be required for biologically relevant PDZ binding. In order to examine the function of each PDZ domain in the context of full length LNX1, mutagenesis was used to disrupt the canonical binding site for each LNX1 PDZ domain. Mutagenesis studies on PSD-95 PDZ3 have identified two polar/charged residues in the ligand binding pocket. The R/K is required to accommodate C-terminal ligands (Figure 2.1 A) (Gee et al. 2000; Chi et al. 2006). Sequence alignment comparing LNX1 PDZ domains to those of PSD-95 was used to confirm that an R or K residue corresponding to R318 of PSD-95 PDZ was conserved in LNX1 (Figure 2.1B). PCR-directed mutagenesis was used to mutate this R/K residue to an A in each LNX1 PDZ domain in the context of full length LNX1. In addition to canonical binding pocket, a putative phosphoinositide binding site in PDZ4 was also targeted. Loss of binding in this phosphoinositide binding mutant was validated by confocal microscopy, and will be discussed below.

Figure 2.1 Design and validation of using mutagenesis to disrupt the binding of C-terminal ligands. (A) The binding site of PSD-95 PDZ3 is a hydrophobic pocket containing 2 conserved polar residues necessary for C-terminal peptide accommodation. Hydrophobic residues (yellow) and charged or polar residues (red) have been coloured as indicated. (B) Sequence alignment with LNX1 and PSD-95 PDZ domains confirmed that the Arg or Lys residue in the carboxylate binding loop (marked red) is conserved in all LNX PDZ domains. Residues that contact the substrate have been underlined. (C) Mutant PDZ domains do not interact with C-terminal ligands. Each mutated PDZ domain was isolated as a GST-fusion domain. Immobilized fusion proteins were incubated with 293T lysate transiently overexpressing a known interactor (myc- PLEKHG5 or myc-PAK6). Interactions were detected by western blotting with anti-myc antibodies.

In order to confirm binding disruption, each mutant PDZ domain was isolated as a GST-fusion protein. Binding disruption was tested by GST pulldown with known interactors (PLEKHG5 for PDZ1 and PDZ3, and PAK6 for PDZ2 and PDZ4). The binding of ligand to each wildtype and mutant PDZ domain was compared by incubating immobilized GST-PDZ domain with 293T lysate expressing myc-tagged target protein. Interactions were detected by western blotting with anti-myc antibodies. In each case, the mutant PDZ domain was unable to interact with the target protein, confirming that mutagenesis has disrupted interactions with C-terminal binding partners (Figure 2.1C). The wildtype PDZ4, or PDZ4 protein binding mutant (R642/R643A) and phosphoinositide binding mutant (K710/K713E) did not show an affinity for peptides. This data agrees with the lack of binding previously described for wildtype PDZ4 by Wolting (2011) and Guo (2012).

2.4.2 LNX1 Overexpression in HeLa cells

Once the disruption of PDZ binding mutations had been validated, steps were taken to characterize the impact of each mutation on the biology and function of LNX1. In order to assess any effects each mutation had on subcellular localization of LNX1, HeLa cells were transiently transfected with wildtype Flag-LNX1, Flag-LNX1 mutants, or pFlag vector control, and co- stained with anti-LNX1 antiserum and donkey anti-rabbit antibody conjugated to AlexaFluorA488 fluorophore, as well as phalloidin Cy5 to detect transfected cells. Cells were then analyzed by immunofluorescence and confocal microscopy. In general, the subcellular localization of the mutant constructs was similar to that of the wildtype control. A PDZ4 mutant with variable subcellular localization will be discussed below. Another initial observation was that HeLa cells overexpressing wildtype LNX1 and LNX1 mutants were elongated when compared to control cells. This observation led us to quantify this phenotype, as seen in Figure 2.2A. Cell lengths were quantified by measuring the longest axis of each cell using Volocity software, with 3 biological replicates of 30 cells measured for each construct. HeLa cells transfected with Flag-LNX1or any Flag-LNX1 mutant were significantly longer than cells transfected with a vector control (Figure 2.2B). Overexpression of LNX1 and mutants led to the following changes in average length: for Flag-LNX1 and LNX1 R283A the increase was 20% ± 6%, for LNX1 K390A, LNX1 R642/R643A, and LNX1 K710/K713E the increase was 40% ± 5%, and for LNX1 K513A the increase was 60% ± 13%. This effect did not appear to

Figure 2.2 LNX1 overexpression results in increased cell length in HeLa cells. HeLa cells were transiently transfected with Flag-LNX1, Flag-LNX1 PDZ mutant, or pFlag vector control, and co-stained with anti-LNX anti-serum and donkey anti-rabbit AlexaFluor488 to detect LNX transfected cells. (A) Cell length was measured along the longest axis of the cell using Volocity. (B) Elongated cell shape and tail retraction defects were observed in each LNX1 or mutant overexpression. Scale bar is 20 µm. (C) The data represent the mean of 30 cells measured for three independent experiments; error bars represent standard error. * (p<0.05) and ** (p<0.01) indicate statistical significance as determined using Student’s t-test when comparing each sample to the pFlag control.

36 depend on a particular PDZ domain as none of the LNX1 mutants produced a change that was significantly different from wildtype LNX1.

As mentioned above, LNX1 PDZ4 has been described as having non-selective affinity for phosphoinositides by lipid strip assay. Our lab previously compared the PDZ4 sequence to the known phosphoinositide binding PAR-3 PDZ2 and determined that a positive cluster of residues in PAR-3 is conserved in LNX1 PDZ4 (Wolting et al. 2011). The phosphoinositide binding site, identified in Figure 2.3A, was targeted by mutagenesis to generate a LNX1 K710/K713E mutant. HeLa cells were transiently transfected with Flag-LNX1 or Flag-LNX1 PDZ4 mutants and stained with anti-LNX1 antiserum as well as phalloidin Cy5. Images collected by confocal microscopy were used to measure line profiles of staining intensity to determine whether LNX1 K710/K713E showed decreased membrane localization when compared to wildtype LNX1 and the protein binding mutant LNX1 R642/R643A. Membrane localization (R) was quantified by comparing the peak membrane staining intensity and the average cytosolic staining intensity using the equation described by Stauffer et al. (1998) (Figure 2.3B). The phosphoinositide mutant LNX1 K710/K713E displayed 50% less membrane localization when compared to wildtype LNX1 (p = 0.02) (Figure 2.3B). The membrane localization of protein binding site mutant LNX1 R642/R643A was comparable to wildtype LNX1 (p = 0.88).

2.4.3 Effect of PDZ Domain Mutations on LNX1 Auto-Ubiquitination in vitro

It has already been established that LNX1 truncation mutants lacking one or more PDZ domains retain in vitro ubiquitination activity (Nie et al. 2002). Of the interactors identified as being substrates for the RING domain, most have been found to bind to either PDZ1 or PDZ2, suggesting these domains are of particular interest for investigating the role of PDZ domains in substrate ubiquitination. To determine whether point mutations in PDZ1 or PDZ2 had any influence on LNX1 auto-ubiquitination in vitro, full-length LNX1 PDZ1 and PDZ2 mutants (LNX1 R283A, LNX1 K390A) were subcloned into pGEX 4T3 for bacterial expression. Resin bound GST-fusion LNX1 and LNX1 mutants were incubated with Ubiquitin, E1, and E2 (UbcH5B), and ubiquitin ligase activity was detected by western blotting with anti-Ubiquitin antibodies. Wildtype LNX1 and RING mutant LNX1 C45A served as controls. When compared

Figure 2.3 Point mutations in LNX1 PDZ4 result in decreased membrane localization (A) Sequence alignment confirms that residues implicated in phosphoinositide binding in PAR-3 PDZ2 (shown underlined) are conserved in LNX1 PDZ4 and not conserved in LNX1 PDZ2. The phosphoinositide binding site of PAR-3 PDZ2 has been indicated in red. (B) Mutating the putative phosphoinositide binding site in LNX1 PDZ4 decreases relative membrane intensity measured with line profiles. Data represents the average R value calculated for three biological replicates of 10 cells per construct. Each cell measurement is the average of 2 line profiles, line width 2 μm. * (p<0.05) indicates statistical significance compared to the wildtype control determined using Student’s t-test. Line profile plots have equal y axes. Error bars represent standard error and scale bars in images correspond to 15 μm.

38 to wildtype LNX1, the LNX1 mutants displayed higher intensity bands, indicating that they may have increased ubiquitination activity in vitro (Figure 2.4). This result confirms that mutation of LNX1 PDZ domains did not impede RING function, and suggests that the PDZ binding abilities of PDZ1 and PDZ2 may have an inhibitory effect on ubiquitination.

2.4.4 LNX1 PDZ1 Domain Mutation Disrupts PDZ-PTBi Interaction

We have previously shown that ubiquitination of Numb requires intact LNX1 PDZ1 and an 11 amino acid insert in the Numb PTB domain (Nie et al. 2004). The structure of the PDZ-PTBi complex has yet to be characterized. To determine whether the PDZ1 binding site mutation had any effect on PDZ-PTBi interaction, immobilized GST-PDZ1 and GST-PDZ1 R283A were incubated with 293T lysate transfected with Flag-PTBi. The interaction was detected by western blot with anti-Flag antibodies. Mutation of PDZ1 abolished interaction with Flag-PTBi (Figure 2.5). Neither PDZ1 nor PDZ1 R283A interacted with Flag-PTB lacking the insert.

2.4.5 Effect of PDZ Domain Mutations on LNX1 Mediated Degradation and Ubiquitination of Numb in 293T Cells

The Numb PTB domain can bind LNX1 via two different interactions: through a PTB binding motif (NPAY) in the linker region between the RING domain and PDZ1, or directly to PDZ1 through PTB-PDZ binding. The ubiquitination of Numb requires that it interacts with LNX1 PDZ1 (Nie et al. 2004). Because the mutated form of PDZ1 could not interact with Numb PTBi by GST pulldown, we investigated the effect that expression of LNX1 R283A had on co- immunoprecipitation with Numb, as well as ubiquitination and degradation. To test for an interaction between full length Numb p72 and LNX1 or mutants, Numb p72 was co- overexpressed in 293T cells with vector control, LNX1, or a LNX1 mutant (LNX1 C45A, LNX1 R2832A, or LNX1 K390A). The second PDZ domain of LNX1 has not been implicated in Numb ubiquitination, allowing for the LNX1 K390A mutant to be used as an additional control. Numb was immunoprecipitated with anti-NbC antibodies. Following incubation, the immunoprecipitated samples were resolved by SDS-PAGE and interactions with LNX1 were detected by western blotting with anti-Flag antibodies. Each of LNX1 constructs tested was detected in the Numb p72 immunoprecipitations (Figure 2.6A).

Figure 2.4 LNX1 PDZ mutants retain auto-ubiquitination activity in vitro. Point mutations in LNX1 R283A and LNX1 K390A do not inhibit ubiquitination activity. Immobilized GST-fusion LNX1, LNX1 C45A, LNX1 R283A, and LNX1 K390A were incubated in an in vitro ubiquitination reaction mixture in the presence of UbcH5b for 90 min at 30oC. The reactions were resolved by SDS-PAGE and ubiquitination was detected by western blotting with anti-ubiquitin antibodies.

Figure 2.5 Mutating PDZ1 disrupts the interaction between PDZ1 and Numb PTBi Immobilized GST-PDZ1 and GST-PDZ1 R283A were incubated with 293T lysate transiently expressing Flag-PTB domain of Numb or Flag-PTB with insert (PTBi). Samples were resolved by SDS-PAGE and interactions were detected by western blotting with anti-Flag antibodies.

Figure 2.6: Mutations in LNX1 do not inhibit ubiquitination and degradation of Numb (A) PDZ mutations do not disrupt the binding of LNX1 to full length Numb. Numb p72 and vector control, Flag-LNX1 or mutants (LNX1 C45A, LNX1 R283A, or LNX1 K390A) were transiently co-expressed in 293T cells. Numb was immunoprecipitated using anti-NbC antibodies were resolved using SDS-PAGE. Co-immunoprecipitated LNX1 was detected by western blotting with anti-Flag antibodies. The same PVDF membrane was probed with anti-NbC antibodies to verify presence of Numb. (B) Co-expression of LNX1 and mutants still results in degradation. 293T cells transiently co-expressing Numb p72 and vector control, Flag-LNX1 or mutants were lysed and prepared with equivalent amounts of protein per sample. Lysates were resolved by SDS-PAGE. Numb degradation was detected by western blotting with anti-NbC antibodies. The same PVDF membrane was reprobed with anti-Flag to verify LNX1 expression, and α-tubulin was used as a loading control. Bands were quantified using ImageJ and calculated as ratios of the vector control. (C) Expression of HA-Ubiquitin with LNX1 R283A or LNX1 K390A still resulted in ubiquitination of endogenous Numb. 293T cells were co-transfected with HA-Ubiquitin and Flag-LNX1 or mutants. Cells were lysed with SDS and boiled to disrupt non- covalent interactions. Numb was immunoprecipitated from diluted lysates using anti-NbC antibodies. Immunoprecipitation samples were resolved using SDS-PAGE and direct ubiquitination of Numb was detected by western blotting with anti-HA antibodies. Lysates were also resolved by SDS-PAGE and western blotted with anti-NbC, anti-Flag, and anti-HA to confirm all constructs were expressed. Detection of α-tubulin using anti- α-tubulin antibodies was used as a loading control.

Ubiquitination of Numb requires the presence of PDZ1 (Nie et al. 2004). Given that the mutant constructs were able to bind full length Numb, but LNX1 R283A could not bind to the isolated PTBi domain, we set out to determine whether this mutation affected degradation of Numb. Numb p72 and vector control, LNX1, or mutants were co-transfected into 293T cells. Transfected cell lysates were resolved by SDS-PAGE and immunoblotted with anti-NbC antibodies. Membranes were stripped and reprobed with anti-Flag antibodies to verify Flag- LNX1 expression. Co-expression of Numb with LNX1 R283A or LNX1 K390A resulted in a decrease in Numb stability, similar to that seen with wildtype LNX1 (Figure 2.6B). These results were further supported by examining ubiquitination of endogenous Numb in 293T lysates co- expressing HA-Ubiquitin and LNX1 mutants. 293T cells were cotransfected with HA-Ubiquitin, and vector control, LNX1, or LNX1 mutants. Cells were lysed in 1% SDS and boiled to disrupt non-covalent interactions. Numb was immunoprecipitated from diluted lysate using anti-NbC antibodies. These immunoprecipitation samples were resolved by SDS-PAGE and anti-HA antibodies were used to detect ubiquitination of Numb. Expression of LNX1 R283A or LNX1 K390A resulted in increased ubiquitination of endogenous Numb when compared to wildtype LNX1 (Figure 2.6C). Empty vector and LNX1 C45A were used as negative controls. Lysates were also western blotted with anti-Flag, anti-NbC, and anti-HA antibodies to confirm that each construct was expressed.

2.5 Discussion Ubiquitination is often used in regulation of cellular processes. Post-translational attachment of Ubiquitin moieties or chains to a target has the potential to cause changes to its stability, subcellular localization, and downstream signaling (Clague and Urbé 2010). As discussed above, E3 ligases are responsible for substrate recognition; RING-type E3 ligases act as adaptor proteins, bridging E2 and substrate to facilitate substrate ubiquitination (Deshaies and Joazeiro 2009). Many RING-type E3 ligases contain multiple protein-protein interaction domains, making them ubiquitin-specific analogs to multi-domain scaffold proteins. PDZ domains are a common feature of multi-domain scaffold proteins (Suzuki and Ohno 2006; Feng and Zhang 2009). They are capable of interacting with C-terminal ligands, internal sequences, other PDZ domains, and phosphoinositides (Ivarsson 2012). It follows that E3 ligases could utilize PDZ domains for substrate recognition. The LNX proteins are part of a unique 4-member family of E3 ligases that contain a RING domain and multiple PDZ domains. Our lab has previously shown that LNX1 is

44 an active E3 ligase able to facilitate Ubiquitin transfer, and that it ubiquitinates Numb in an isoform specific manner causing Numb degradation (Nie et al. 2002; Nie et al. 2004). In the present study I generated point mutations in each LNX1 PDZ domain in order to selectively inhibit binding to C-terminal ligands, and have characterized the effect of each mutant on LNX1 substrate binding, subcellular localization, and ubiquitination.

2.5.1 Using Mutagenesis to Disrupt LNX1 PDZ Interactions

Mutagenesis was a successful strategy for disrupting binding of C-terminal ligands to LNX1 PDZ domains. The peptide binding cleft of a PDZ domain is predominantly hydrophobic. The accommodation of a negatively charged peptide C-terminus requires the presence of a conserved Arg or Lys residue at the top of the cleft. Mutating this Arg or Lys residue to an Ala was sufficient to disrupt binding of C-terminal ligands. It is likely that any differences observed for LNX1 mutants are site specific, rather than being the result of the domain unfolding, as previous studies on PSD-95 PDZ domains have determined that equivalent Arg or Lys to Ala mutations did not change domain folding or secondary structure content (Chi et al. 2006).

Mutagenesis was also used to disrupt putative phosphoinositide binding residues found in LNX1 PDZ4 that are conserved in PAR-3 PDZ2. The LNX1 K710/K713E construct lacking these phosphoinositide binding residues displayed decreased plasma membrane localization in HeLa cells as observed by confocal microscopy. The LNX1 PDZ4 protein binding site mutant R642/R643A displayed plasma membrane localization similar to wildtype LNX1. Additional biochemical studies will be required to determine if this decrease in plasma membrane localization is a direct consequence of decreased phosphoinositide binding. Again, because the original characterization of these phosphoinositide binding mutations in PAR-3 included structural characterization with NMR, it is likely that the effects observed in the LNX1 PDZ4 are site specific and not due to domain unfolding (Wu et al. 2007).

2.5.2 The Effect of LNX1 PDZ Mutations on Cell Morphology

My suite of protein binding and phosphoinositide binding mutants generated in LNX1 were examined for their affect on HeLa cells. LNX1 and LNX1 mutant overexpression resulted in an increase in the total length of cells when compared to a vector control. While certain PDZ domain mutants displayed a greater effect than wildtype LNX1, the resulting changes in cell

45 length were not significantly different, suggesting that this phenotype is not the result of binding to a single PDZ domain. Further investigation of this phenotype in dynamic live-cell assays with strategically created double mutants, such as PDZ2/PDZ4 PIP or PDZ3/PDZ4 PIP, may enhance this cell length phenotype and provide insight into the PDZ domains involved. Given the role of cytoskeleton in cell motion and detachment, biochemical studies, such as Rac GTPase assay, may provide mechanistic insight, especially because LNX1 is able to cause Numb degradation, and Numb knockdown has recently been found to result in increased Rac activity and lamellopodia formation (Lau and McGlade 2011).

2.5.3 The Effect of LNX1 PDZ Mutations on Substrate Ubiquitination

The mechanism of LNX1 mediated ubiquitination of Numb has been well studied. A required interaction between the Numb PTB domain and LNX1 PDZ1 was determined by using a series of truncation mutants (Nie et al. 2002). A construct lacking all PDZ domains had intrinsic ubiquination activity in vitro but was unable to ubiquitinate Numb. This PDZ-PTB interaction was also found to require the PTB insert found in p66 and p72 isoforms of Numb. I have shown that the interaction between isolated PDZ1 and PTBi was disrupted by introduction of an Arg to Ala mutation in the protein binding site of LNX1 PDZ1. In contrast, mutation of PDZ1 did not attenuate the interaction between full-length LNX1 and Numb, presumably because this interaction can also be facilitated by a PTB binding motif (NPAY) in the linker region between the RING domain and PDZ1. Disrupting this motif with a Y188A mutation has been previously described as attenuating but not eliminating interaction between LNX1 and Numb (Nie et al. 2002). This previous work also combined Y188A mutation and deletion of PDZ1 and found that this combination eliminated interaction with Numb. It would be interesting to test whether combining the NPAY motif mutation Y188A and with R283A is sufficient to recapitulate the elimination of binding caused by mutating Y188A and deleting PDZ1. If this combination of Y188/R283A does not eliminate Numb binding, it could be that sequences distinct from the isolated PTBi domain make important contacts with surfaces on PDZ1 distinct from the peptide binding site.

Since Numb ubiquitination requires the presence of a PTB insert and PDZ1, and the isolated PDZ1 R283A did not appear to interact with Numb PTBi, LNX1 R283A was investigated for its effect on Numb ubiquitination. Mutation of PDZ1 in the context of full length LNX1 did not

46 disrupt Numb ubiquitination. In fact, both LNX1 R283A and LNX1 K390A displayed more intense anti-HA signal suggesting that they may have increased ability to ubiquitinate Numb. These constructs also displayed increased ubiquitination in vitro suggesting that intact PDZ1 and PDZ2-mediated protein binding may be have an inhibitory effect on the function of the RING domain. As mentioned above, discrepancy between disruption of isolated PDZ-PTBi binding and successful ubiquitination of Numb by LNX1 R283A may be due to the fact that interaction between isolated domains is missing additional interactions between Numb and PDZ1 that are biologically relevant for substrate recognition. The structure of the PTBi-PDZ complex has yet to be described, so the importance of specific residues is only speculative.

The strategy of using mutagenesis to selectively eliminate binding of targets holds the potential to better establish roles for each PDZ domain in LNX1 function. However, redundancies in domain binding may prevent the discovery of domain specific phenotypes. Generating selective double mutants is one approach to avoid issues caused by redundancies. However, creating a null LNX protein with mutations in each of its PDZ domains may provide a better tool for avoiding redundancies, because it would allow for selective reintroduction of specific domains. In addition, characterization of these mutants with Numb ubiquitination has highlighted that they may be of limited use with interactions not mediated by typical C-terminal PDZ binding. The next chapter utilizes this suite of PDZ mutants to study a novel interaction with canonical PDZ binding motif containing proteins.

3 Chapter 3 ESTABLISHMENT OF FRIZZLED RECEPTORS AS INTERACTING WITH LNX1 3.1 Abstract

The LNX protein family has recently been implicated in regulation of Wnt signaling. The Frizzled family of G-Protein coupled Wnt-ligand receptors have been shown to interact with multi-PDZ domain scaffolds. The majority of these receptors have C-terminal PDZ binding motifs. I chose to examine whether LNX1 interacted with any Frizzled receptors, and to characterize the nature of these interactions using LNX1 PDZ domains mutants. Here I report that LNX1 interacts with two members of the Frizzled family by GST pulldown with isolated Frizzled tails. I was able to map the interaction to Frizzled3 as requiring PDZ2 by repeating the pulldown with mutant LNX1 constructs. Frizzled3 and Frizzled4 were cloned into mammalian expression vectors and the interaction with full length Frizzled4 confirmed by GST pulldown with LNX1 PDZs. I was able to detect Frizzled staining in HeLa cells and examined whether coexpression with LNX1 affected Frizzled4 staining. These studies suggest that LNX1 is able to interact with a subset of Frizzled receptors. The implications of this interaction for receptor function and Wnt signaling output remain to be tested.

3.2 Introduction

Wnt signaling is conserved in all multicellular organisms, making it one example of a signaling pathway that is integral to the development of multicellularity (Logan and Nusse 2004; Windsor and Leys 2010). Wnt signaling is involved in embryonic development, stem cell maintenance, and, diseases such as cancer (Angers and Moon 2009). Recently, several reports have connected LNX family members to Wnt signaling.

A protoarray screen published by our lab (Wolting et al. 2011) identified the Wnt signaling regulators Naked2 (Nkd2) and Dishevelled3 (Dvl3) as interacting with LNX1 PDZ domains. Additionally, a high-throughput siRNA screen by Major (2012) designed to identify novel Wnt regulators found that LNX3 is required for Wnt signal output as measured by a TCF/Lef reporter assay. LNX3 has also been shown to be involved in Wnt signaling in osteoblast precursor cells; in this case LNX3 was found to be an antagonist of Wnt signal transmission (Honda et al. 2010).

Finally, a zebrafish orthologue, LNX-2b, has also been implicated in Wnt signaling in the developing zebrafish embryo (Ro and Dawid 2009). Altered dorso-ventral patterning in the LNX-2b knockdown embryos coincided with increased stabilization of the Wnt inhibitor Bozozok (Boz). This study also showed that LNX-2b could bind and ubiquitinate Boz, causing it to be degraded. LNX-2b mediated degradation of Boz enhanced the output of β-catenin Wnt signaling. These protein interaction studies provide evidence of a LNX-Wnt relationship. However, no study to date has determined a mechanism explaining how LNX is involved in Wnt signaling.

In addition to the evidence tying LNX to Wnt signaling, there are also a number of PDZ domain containing scaffold proteins shown to be involved in regulating activity downstream of Wnt receptors. The Frizzled (Fz) family of G-protein coupled Wnt receptors has been shown to be regulated by PDZ domain containing scaffold proteins (Wawrzak et al. 2009). 8 of 10 Fz receptors in mammals contain C-terminal PDZ binding motifs (Wang et al. 2006). Syntenin and PSD-95 are examples PDZ scaffolds that interact with select Fz receptors by way of their C- termini (Hering and Sheng 2002; Luyten et al. 2008; Wawrzak et al. 2009). Hering and Sheng (2002) found that PSD-95 directly interacted with Fz1, Fz2, Fz4, and Fz7, and was able to form a ternary complex with Wnt scaffold adenomatous polyposis coli (APC). Whether the recruitment of APC had any impact on Wnt signaling output was not examined.

Given that the LNX family may be involved in Wnt signal regulation and that C-terminal PDZ- binding motifs are present in most mammalian Fz receptors, I set out to determine whether any Fz receptor interacted with LNX family members. A subset of Fz receptor tails was tested for binding to LNX1 and LNX2. Positive interactions with LNX1 were characterized further by cloning full length Fz3 and Fz4 into mammalian expression vectors. This data will help to better understand a mechanism by which LNX can regulate Wnt signaling.

3.3 Materials and Methods

3.3.1 Plasmids and Cloning of GST Fusion Proteins

The C-terminal tail domains of mouse Frizzled receptors 3, 4, 6, 7, and 8, were isolated as GST- fusion proteins using boundaries specified by Yao and colleagues (2001; 2004). The primers

49 used to isolate each C-terminal tail domain are as follows: for Frizzled3 (amino acids 500 – 666) CCCTCTATATTTTGGGTTGGATCCAAAAAGAC (5’) and CACATTTCACCTTACTCGAGACTAAGCACTGG (3’). For Frizzled4 (amino acids 496 – 537) CACTTCAGGCATGTGGGGATCCTCTGCCAAAACTCTTCAC (5’) and GGAACGAGGAAGCCCTCGAGTCTTATACCACAGTCTC (3’). For Frizzled6 (amino acids 497 – 709) GCGGTCTTCTGGGTTGGATCCAAAAAGACGTGC (5’) and CTGGGGGAACGCTCGAGTTTTCTTCAAGCGTCGG (3’). For Frizzled7 (amino acids 547 – 572) CGGGCTTCTGGATCGGATCCGGCAAGACCCTG (5’) and GGGTGGGTAAGCTCGAGGGCTCATACCGCAGTTTCC (3’). For Frizzled8 (amino acids 653 – 685) CGGGCGTGTGGGGATCCTCCGGCAAGACTCTGG (5’) and CCCTTCTGGGCATCCTCGAGGGGTTCAGACCTG (3’). PCR reactions followed the same procedure described above with some modifications. The annealing temperature used was 58oC. Frizzled C-terminal tail domains were subcloned into pGEX4T3 by digesting DNA with 1 µL of BamH1 (10 units) and 1 µL of Xho1 (10 units) 2 hours at 37oC. Vector was digested by the same amounts of BamH1 and Xho1 overnight at 37 oC, dephosphorylated with 1 µL of shrimp alkaline phosphatase (Fermentas) for 1 hour at 37oC, and then gel purified from 1% agarose gel using QiaExII kit (Qiagen). Frizzled tail inserts were ligated into predigested and purified pGEX 4T3 by using a vector to insert ratio of approximately 1:3. Samples were incubated at 14oC overnight and then transformed into competent E.coli (DH5α) as described in Chapter 2. Colonies were screened for inserts by mini-induction. Colonies were picked and grown overnight in LB plus ampicillin. Each overnight culture was then diluted 1:40 into 2 vials of LB plus ampicillin and incubated for 2 hours at 37oC. One of each pair of vials was then induced with 1 mM IPTG and incubated at 37oC for an additional 3h. Following induction, each culture was lysed with 150 µL of 2x SDS sample buffer; 5 µL samples of each sample (induced beside non- induced control) were run in 12.5% SDS-PAGE and stained with Coomassie Blue to determine if an additional band of approach size exists in the induced cultures.

3.3.2 Mutagenesis of GST-Frizzled C-terminal Tail Constructs

In order to remove the C-terminal PDZ-domain binding motif from Frizzled3 and Frizzled4 mutagenesis primers were designed to introduce a stop codon at position -1. For GST-Frizzled3, S665 was mutated to a stop codon using

GAGGAGGATGGAACCTAGGCTTAGTCTCGAGGAGG (5’) and CCTCCTCGAGACTAAGCCTAGGTTCCATCCTCCTC (3’). For GST-Frizzled4, V536 was mutated to a stop codon using GGCAACGAGACTTAGGTATAAGACTCGAGGAGGG (5’) and CCCTCCTCGAGTCTTATACCTAAGTCTCGTTGCC (3’). The mutagenesis PCR reactions were completed using the procedure mentioned in Chapter 2 with some changes. The PCR was completed using an annealing temperature of 68oC. After transforming DNA into DH5α, DNA was prepped using miniprep kit (Qiagen), and samples were sequenced with 3’ pGEX primer CCGGGAGCTGCATGTGTCAGAGG (ACGT Corp).

3.3.3 Expression and Purification of GST Fusion Proteins

The individual GST-Frizzled C-terminal tail domains, described above, were transformed into BL21 cells and induced to express GST fusion proteins by the addition of 1 mM IPTG. The cultures were then incubated at 30oC for 3 hours followed by overnight at 4oC with no shaking. After induction, cells were pelleted by centrifugation at 4000 RPM for 20 min and then resuspended in PLC lysis buffer with protease inhibitors at 10 mL of buffer/50 mL of culture. Resuspended cells were sonicated three times at 4oC for 30s using 1s and 1s off pulsing. Following sonication, lysates were cleared by ultra-centrifugation for 30 min at 14 000 RPM in a Beckmann centrifuge using rotor JA20. Supernatant was incubated with glutathione sepharose beads for 90 min at 4oC with rotation. Beads were pelleted and then washed 4 times with PLC lysis buffer. After washing, beads were resuspended in an equal volume of PLC lysis buffer plus 2 mM dithiothreitol. In order to quantify the concentration of GST fusions, 10 µL and 20 µL samples were run in 12.5% SDS-PAGE alongside known quantities of BSA. GST-fusion proteins were then aliquoted into 2 µg or 5 µg amounts and stored at -80oC.

3.3.4 Transient Expression of Constructs in 293T cells

293T cells were maintained in DMEM containing 10% FBS at 37oC. Once at 50 – 60% confluency, each 10 cm plate was transfected with 1 – 2 µg of DNA (Flag-LNX1 or Flag-LNX1 mutant) in Lipofectamine 2000 (Invitrogen) and OPTI-MEM. After 24 – 36 hours of incubation, cells were lysed with NP-40. Lysates were cleared by centrifugation for 30 minutes at 14 000 RPM at 4oC.

3.3.5 GST Fusion Protein Binding Experiments

Transfected 293T cells overexpressing Flag-LNX1 or Flag-LNX1 mutants were lysed with NP 40 lysis buffer. 293T cells overexpressing myc-Fz4 were lysed PLC lysis buffer. Lysate (1 mg of total protein) was added to 2 µg of purified GST fusion protein (Fz tails or LNX1 PDZs) immobilized on glutathione sepharose beads and brought to a total volume of 1 mL with the appropriate lysis buffer. The lysate and immobilized fusion proteins were mixed for 3 hours at 4oC. Sepharose beads were pelleted and washed four times with lysis buffer. The beads were resuspended in 30 µL of 2X SDS sample buffer with 5% β-mercaptoethanol and boiled for 5 min at 100oC. The samples were separated by 12.5% SDS-PAGE, transferred to PVDF and immunoblotted with 1:1000 mouse monoclonal M2 anti-Flag (Sigma). Primary antibody incubation was followed by mouse HRP secondary (GE Healthcare) at 1:10 000.

3.3.6 Cloning and Expression in Mammalian Expression Systems

Full-length Frizzled3 and Frizzled4 were N-terminally myc tagged and subcloned into mammalian expression vectors using two separate cloning steps. First, the full-length constructs lacking endogenous signal peptides were generated using PCR with the following primers: for Frizzled3, CTGGGGCAGATAGGTGGAATTCGTTTGTTTTCTTGTG (5’) and CACATTTCACCTTACTCGAGACTAAGCACTGG (3’), for Frizzled4, GCGGCGCTGCCGGAATTCCGGCCAAGGAGCTGGC (5’) and GGAACGAGGAAGCCCTCGAGTCTTATACCACAGTCTC (3’). The PCR reactions used the same equipment and procedures mentioned in Chapter 2 with some modifications. The annealing temperatures used were 60oC for Fz3 and Fz3 DGT, and 62oC for Fz4 and Fz4 NET. The PCR reactions were then digested by incubating with 1 µL EcoR1 (10 units) and 1 µL Xho1 (10 units) for 2 hours at 37oC. The vector pCMV-Myc (Clontech) was digested using the same amounts of EcoR1 and Xho1 overnight at 37oC, and dephosphorylated with 1 µL of shrimp alkaline phosphatase for 1 hour at 37oC. Frizzled3 and Frizzled4 inserts lacking signal peptide, and digested vector were then gel purified from 1% agarose gel using QiaExII kit (Qiagen). The Frizzled inserts were then ligated into pCMV-Myc by mixing the appropriate amounts to maintain a vector to insert ratio of approximately 1:3. Samples were incubated overnight at 14oC with 1x T4 Ligase Buffer (Invitrogen) and then transformed into competent E. coli (DH5α) as described above. Colonies were screened for insert by digesting mini-prepped DNA with EcoR1

52 and Xho1, and then separating the digestions on 1% agarose gels. Samples were verified by sequencing with pCMV 5’ sequencing primer CGCAAATGGGCGGTAGGCGTG (ACGT Corp). Once cloned into CMV-myc, the myc-Frizzled3 and myc-Frizzled4 lacking signal peptides were amplified by PCR and subcloned into pSECTAG2C (Sigma) using HINDIII and Xho1. A HINDIII site was added at the 5’ end by the 5’ primer. The primers used for PCR amplification of myc-Fz from the CMV-myc vector were GGAATTGTACCCGCGGGCAAGCTTTGGCATCAATGCAG (5’) and GTATCTTATCATGTCTGGATCCC (3’). The same PCR procedure described above was used with 63oC for the annealing temperature. PCR product was digested with1 µL HINDIII (10 units) and 1 µL Xho1 (10 units) for 2 hours at 37oC, Qiaquick PCR purified (Qiagen), and then ligated into digested and SAP treated pSECTAG2C vector by mixing at a vector to insert ratio of approximately 1:3. Ligations were completed as described above. Colonies were screened for insert by digesting mini-prepped DNA with HINDIII and Xho1. Samples were verified by sequencing with T7 primer TAATACGACTCACTATAGGG (5’) and BGH primer TAGAAGGCACAGTCGAGGC (3’).

3.3.7 Transient Expression of myc-Frizzled Constructs

HEK 293T cells were maintained in DMEM plus 10% FBS at 37oC. Cells were transfected when they reached 60-70% confluency. For myc-Frizzled3, cells were transfected with between 1-5 μg DNA with Lipofectamine 2000. For myc-Frizzled4, cells were transfected with between 1.0 μg DNA with Lipofectamine 2000. 24 hours following transfection cells were lysed with PLC lysis buffer and cleared by centrifugation.

3.3.8 Expression of LNX1 and myc-Frizzled4 and Imaging in HeLa Cells

HeLa cells were maintained in DMEM plus 10 % FBS prior to transfection. Transfections were set up using the same protocol as mentioned in Chapter 2. Following seeding, cells were transfected with 0.5-1.0 μg of each plasmid and Lipofectamine 2000. Cells were split onto coverslips, fixed, permeabilized, and blocked as described in Chapter 2. Total myc-Fz4 and Flag- LNX1 were immunostained after blocking with mouse anti-myc antibodies (1:500) with anti- mouse AlexaFluor488 (1:250), and rabbit anti-LNX1 antiserum (1:250) with anti-rabbit secondary conjugated to Cy3 (1:250). In order to immunostain for surface myc-Fz4, the cells

53 were incubated in cold DMEM plus 10% FBS containing 1:500 anti-myc antibodies for 30 minutes at 4oC prior to fixing. Following antibody incubation, each coverslip was washed three times with cold PBS and then fixed as described above.

3.4 Results

3.4.1 LNX1 Interacts with Select Frizzled Tails by GST Pulldown

There are a number of published examples of Frizzled (Fz) receptors interacting with PDZ domain containing proteins; 8 of the 10 Frizzled receptors in mammals contain canonical Type 1 PDZ domain binding motifs (Wang et al. 2006). In order to examine whether any Fz receptors interact with LNX1, the C-terminal tail domains of mouse Frizzled 3, 4, 6, 7, and 8 were isolated as GST fusion proteins using the boundaries identified by Yao and colleagues (2001; 2004) (Figure 3.1A). Binding between LNX1 and each GST-Fz C-terminal tail was tested by incubating immobilized GST-Fz tails with 293T lysate transiently overexpressing Flag-LNX1 or Flag-LNX2. Interactions were identified by western blot with anti-Flag antibody. As shown by Figure 3.1B-C, Flag-LNX1 interacted with the tail domains of Fz3 and Fz4, and Flag-LNX2 interacted with Fz4.

3.4.2 Removal of Frizzled C-terminal PDZ Binding Motifs Disrupts Interactions

Both Fz3 and Fz4 have C-terminal PDZ binding motifs (Fz3: TSA, Fz4: TVV), therefore we investigated whether these interactions required the Fz C-terminal PDZ binding motifs. Both Fz3 and Fz4 were truncated to remove the last two C-terminal residues and subcloned as GST-fusion proteins (GST-Fz3 DGT and GST-Fz4 NET). Again, binding was tested by incubating immobilized GST-Fz tails or truncations with 293T lysate overexpressing Flag-LNX1. The interactions were detected by western blot using anti-Flag antibody. Removing Fz C-terminal PDZ binding motifs disrupted interactions between LNX1 and Fz3 or Fz4 (Figure 3.2).

Figure 3.1 LNX interacts with select Frizzled tails. (A) Schematic representation of the Frizzled tails constructed and expressed as GST fusion proteins. Tail length in amino acids, shown in parentheses, and C-terminal motifs have been noted for each Frizzled tail. (B) LNX1 interacts with the tails of Fz3 and Fz4. GST-fusion proteins were incubated with 293T lysate transiently overexpressing Flag-LNX1. Samples were separated by SDS-PAGE and westernblotted with anti-Flag to detect interactions. (C) LNX2 interacts with Fz4. GST-fusion proteins were incubated with 293T lysate transiently overexpressing Flag-LNX2. Samples were separated by SDS-PAGE and westernblotted with anti-Flag to detect interactions.

Figure 3.2 The interaction between LNX1 and Fz requires the Fz C-terminal PDZ binding motif GST-fusion Fz tails (Fz3 and Fz4) and their corresponding truncation mutants (Fz3 DGT and Fz4 NET) were incubated with 293T lysate transiently overexpressing Flag-LNX1. Samples were resolved by SDS-PAGE and western blotted with anti-Flag to detect interactions.

3.4.3 Frizzled3, but not Frizzled4, Interactions Require LNX1 PDZ2

Once it had been established that LNX-Fz interactions require Fz C-terminal binding motifs, the suite of LNX1 PDZ mutants, described in Chapter 2, was used to investigate whether interactions between LNX1 and Fz3 or Fz4 were specific to a particular LNX1 PDZ domain. Binding was tested by incubating immobilized GST-Fz tails with 293T lysate transiently overexpressing Flag- LNX1 or a Flag-LNX1 mutant (C45A, R283A, K390A, K513A, R642/R643A, K710/K713E). Interactions were detected by western blotting with anti-Flag antibody. Mutating PDZ2 attenuated the interaction between LNX1 and Fz3 (Figure 3.3A). No mutated Flag-LNX1 construct affected binding to Fz4, suggesting that Fz4 may interact with multiple LNX1 PDZ domains (Figure 3.3B). Western blots of total lysate and loading control (Figure 3.3C, D) show that decreased in binding of GST-Fz4 tail to LNX1 R642/R643A corresponds to lower expression of that mutant.

3.4.4 Cloning of Full Length myc-Frizzled3 and Frizzled4, as well as Co- expression of LNX1 and myc-Frizzled4 in HeLa Cells

Proper expression and processing of transmembrane proteins requires an N-terminal signal peptide, which is cleaved prior to membrane insertion. In order to further characterize the interactions between Fz3, Fz4, and LNX1, full-length Fz3 and Fz4 were N-terminally tagged with a myc epitope, and cloned into pSECTAG2, a mammalian expression vector that includes an artificial signal peptide (Figure 3.4A). Transient transfection of myc-Fz3 into 293T or HeLa cells did not result in sufficient protein expression to detect by western blot. Very low expression of myc-Fz3 was visible by immunofluorescence when myc-Fz3 was transfected into HeLa cells, stained with mouse anti-myc and anti-mouse Cy3, and analyzed by immunofluorescence and confocal microscopy (Figure 3.4B). Transient transfection of myc-Fz4 was detectable by western blotting HeLa cell lysates with anti-myc (Figure 3.4C). Expression of myc-Fz4 was also observed by confocal microscopy by surface staining with anti-myc prior to fixing, and by staining for total myc following fixing and permeabilization (Figure 3.4D and H). Co-expression of myc-Fz4 and Flag-LNX1 was observed by co-staining with anti-myc Fz4 for surface (Figure 3.4E) or permeabilized staining (Figure 3.4I), and anti-LNX anti serum following permeabilization (Figure3.4F and J, merged images in G and K). Co-overexpression of Flag- LNX1 did not change the patterns of surface and total staining for myc-Fz4. Additionally, no

Figure 3.3 LNX1 interactions with Fz3 and Fz4 differ in specificity for LNX1 PDZ domains (A) Schematic representation of Flag-LNX1 and Flag-LNX1 PDZ domain mutants. (B) The interaction between LNX1 and Fz3 is attenuated by mutating PDZ2. Immobilized GST-Fz3 tails were incubated with 293T lysate transiently overexpressing the LNX1 constructs shown in (A). Samples were resolved by SDS-PAGE and interactions were detected by western blotting with anti-Flag. (C) All LNX1 mutants interacted with GST-Fz4; the amount of Flag-LNX1 detected paralleled the amount of GST-Fz4 present in fast green. Immobilized GST-Fz4 tails were incubated with 293T lysate transiently overexpressing the LNX1 constructs shown in (A). Samples were resolved by SDS-PAGE and interactions were detected by western blotting with anti-Flag. (D) Whole cell lysates were blotted with anti-Flag and anti-α-tubulin to confirm expression of mutant LNX1 proteins.

Figure 3.4 Frizzled and LNX1 expression in HeLa cells (A) Schematic showing the artificial signal peptides (Sig) and N-terminal tags (myc) added in place of the natural signal peptides of Frizzled3 and Frizzled4. (B) Expression of myc-Fz3 in HeLa cells is weak. (C) Co-expression of myc-Fz4 and Flag-LNX1 in HeLa cells is detectable by western blotting cell lysates with anti-Flag and anti-myc antibodies. (D-K) Fz4 expression can be detected in HeLa cells, and partially colocalizes with Flag-LNX1 staining. HeLa cells were transfected with myc-Fz4 (D, H) or myc-Fz4 and Flag-LNX1 (E-G, I-K), and immunostained with anti-myc and anti-Flag where appropriate. Surface myc levels were immunostained by incubating cells in anti-myc for 30 min at 4oC prior to fixing and immunostaining for Flag- LNX1. Flag-LNX1 and total myc were detected by incubating transfected cells with primary antibodies at 37oC following fixing. Scale bar is 12 μm.

59 change in myc-Fz4 staining intensity was observed in cells co-overexpressing Flag-LNX1. Immunostaining for surface myc-Fz4 partially co-localized with Flag-LNX1 staining proximal to the plasma membrane (Figure 3.4G).

3.4.5 LNX1 PDZs interact with myc-Frizzled4 by GST pulldown

In order to confirm LNX1 binds to Fz4, myc-Fz4 construct tested with GST-PDZs. Immobilized GST-PDZs and GST-LNX1 were incubated with 293T lysate transiently overexpressing myc- Fz4. Following incubation at 4oC the samples were resolved using SDS-PAGE and interactions were detected by western blotting with anti-myc antibody. A weak interaction was observed between full length myc-Fz4 and GST-LNX1, and all GST-PDZ domains (Figure 3.5). The fact that interactions between Fz4 and LNX1 can be mediated by multiple PDZ domains is consistent with the observation that no single PDZ domain mutation attenuated binding between Flag- LNX1 and GST-Fz4 tail.

3.5 Discussion

The mechanisms involved in Wnt signaling regulation remain to be completely understood. While LNX family members have been connected to Wnt signal regulation by a number of separate studies, no mechanistic explanation of their role in Wnt signaling has yet to be determined. Because PDZ domain containing scaffolds have previously been implicated in regulation of signal transduction downstream of the Frizzled (Fz) receptors, the investigation of potential LNX1-Fz interactions may provide insight into how LNX1 regulates Wnt signaling.

3.5.1 LNX1 Interacts with Members of the Frizzled Family of GPCRs

Our lab has previously shown that LNX1 interacts with Wnt related proteins Dishevelled and Naked2. Since neither of these proteins contains a canonical PDZ-binding motif, it is expected that these interactions are not traditional PDZ interactions. In order to utilize the newly generated series of LNX1 PDZ domain mutants, a literature search for Wnt related proteins with PDZ- binding motifs was used to find prospective interactors. The Frizzled family of Wnt-related G- protein coupled receptors were chosen as candidates because the majority contain C-terminal PDZ binding motifs, and they have been previously shown to interact with PDZ scaffolds (Wawrzak et al. 2009). Using GST fusion proteins I was able to demonstrate novel

Figure 3.5 The Frizzled4 interaction with LNX1 is not specific to a single PDZ domain The interaction between full-length LNX1and myc-Fz4 can be mediated by any LNX1 PDZ domain. Immobilized isolated GST-PDZs, and GST- LNX1 were incubated with 293T lysate transiently overexpressing myc-Fz4. Samples were resolved by SDS-PAGE and interactions were detected by western blotting with anti-myc antibodies.

61 interactions between LNX1 and Fz3 or Fz4, and LNX2 and Fz4. The interactions between LNX1 and Fz3 or Fz4 were abolished for truncation mutants lacking the last 2 residues, suggesting that these interactions require PDZ binding motifs. The canonical PDZ domain interaction allowed for PDZ specificity to be probed using LNX1 PDZ mutants. The interaction between Fz3 tail and LNX1 was attenuated by mutating PDZ2. The interaction between LNX1 and Fz4 was not affected by any of the PDZ mutants, which may imply that Fz4 is able to bind to more than one LNX1 PDZ domain.

3.5.2 Characterization of the Interaction with Full Length Fz

After establishing that LNX1 interacts with Fz3 and Fz4 tails, steps were taken to clone these full length receptors in mammalian expression vectors. The use of commercially available C-terminal tagging vectors was avoided because PDZ domain interactions require intact C-terminal sequence. Because of this requirement, a two-step cloning method was utilized to add a myc tag downstream of the natural Fz signal peptide, and then to insert the tagged Fz construct into a vector that adds an artificial signal peptide. This cloning approach had mixed results. The myc- Fz3 construct generated did not express at levels sufficient to observe it in 293T or HeLa cells. It was detected in a small number of HeLa cells using immunofluorescence. The myc-Fz4 construct expressed well and was used to further characterize the nature of the LNX1-Fz4 interaction. By expressing this construct in 293T cells we validated the observation that Fz4 binding non-selectively to LNX1 by GST pulldown with isolated LNX1 PDZ domains.

This myc-Fz4 construct was also examined by immunofluorescence in HeLa cells. The majority of the staining signal was proximal to the nucleus, suggesting that much of the overexpressed protein was not properly trafficked to the plasma membrane and may be retained within the endoplasmic reticulum. By incubating cells with anti-myc antibodies prior to permeabilizing, surface levels of myc-Fz4 were successfully labeled. The pattern and intensity of surface myc- Fz4 did not change if it was coexpressed with Flag-LNX1 rather than vector control. Some co- localization between myc-Fz4 and Flag-LNX1 was observed suggesting they may interact in cells. Co-expressing LNX1 with a myc-Fz4 truncation mutant lacking the PDZ binding motif may better highlight if the co-localization is due to LNX1-Fz interactions, or if it is an artifact of high levels of overexpressed protein. Future experiments focusing on the dynamics of surface Fz4, either by surface labeling with biotin or anti-myc, may provide a more sensitive means to

62 examine any effects of LNX1 coexpression on Fz4. For surface labeling experiments a myc-Fz4 construct lacking the PDZ binding motif could be used as a negative control.

The interactions between LNX1 and Fz further tie LNX1 to Wnt signaling, although the function and relevance of these interactions has not yet been established. Further characterization of LNX1 in the Wnt pathway could involve a PDZ domain specific approach. LNX1 mutants could be included in overexpression experiments examining changes in Wnt activity assays (such as TCF/Lef reporter assay) to determine whether disruption of any of the PDZ domain influences the output of the reporter. The optimal strategy for studying LNX1 and Wnt signaling is one that combines biochemistry and the mechanism of LNX regulation with changes to Wnt reporter output.

Chapter 4 SUMMARY AND FUTURE DIRECTIONS 4.1 Summary

The central objective of this study was to gain a better understanding of the individual roles of the LNX1 PDZ domains in LNX1 function. Mutagenesis was used to inactivate the binding of C- terminal ligands to each LNX1 PDZ domain in the context of full length LNX1. A putative phosphoinositide binding site in PDZ4 was also mutated. Mutation of the LNX1 PDZ domains lead to disrupted C-terminal binding and decreased membrane localization. Following validation, LNX1 mutants were examined for their effect on substrate ubiquitination, overexpression in HeLa cells, and target binding. Mutations in PDZ1 and PDZ2 resulted in increased in vitro ubiquitination activity, and did not disrupt the ubiquitination of known substrate Numb. Overexpression of LNX1 or PDZ domains mutants resulted in an extended length phenotype in HeLa cells. In order to further the understanding of LNX1 in Wnt signaling a subset of the Frizzled family of GPCRs was tested for interactions. Novel interactions between LNX1 and Fz3 and Fz4 were found. LNX1 mutants were used to characterize the PDZ specificity of Fz3 and Fz4 interactions. In summary, mutagenesis was a robust tool for disrupting of multiple types of PDZ interactions. This approach allowed for individual domain function to be studied in the context of the full length LNX1 protein.

4.2 Regulation of Ubiquitination by LNX1

Since being discovered as a Numb interacting protein, LNX1 has been shown to be an active E3 ligase capable facilitating substrate ubiquitination. Known LNX1 substrates include Numb, Src, claudin-17, CD8α, and PBK (Nie et al. 2002; Weiss et al. 2007; D'Agostino et al. 2011; Guo et al. 2012). Using a series of truncation mutants these substrates were mapped as interacting with PDZ1, PDZ2, and PDZ3. LNX1 ubiquitination targets proteins for proteosomal degradation (Numb, Src, PBK) and lysosomal degradation (claudin-17, CD8α). These preliminary results suggest that LNX1 is a dynamic regulator of cell processes capable of causing specific outcomes to particular substrates. An understanding of how ubiquitination facilitated by LNX1 is regulated has not yet been established. In addition, the role of individual PDZ domains in substrate specificity, and substrate outcome, has not been determined. Further studies on LNX1 RING function and regulation can be divided by the type of substrate involved: atypical substrates lacking PDZ-binding motifs, or PDZ-binding substrates.

4.2.1 LNX1 and Numb

Numb was the first identified substrate of LNX1 ubiquitination. Previous work by our lab has established that the Numb PTB insert and first PDZ domain of LNX1 are crucial for Numb ubiquitination to occur (Nie et al. 2002; Nie et al. 2004). Mutating PDZ1 was found to disrupt binding to isolated Numb PTBi. However, this mutation had no effect on Numb ubiquitination or degradation. This result suggests that there are additional interactions beyond the peptide binding pocket that can facilitate ubiquitination of Numb in cells. Given that the molecular nature of this PTB-PDZ interaction has yet to be characterized, structural data showing how these two proteins interact would likely uncover additional residues that stabilize this interaction. These residues could also be targets for mutagenesis.

A comparison study between LNX1 and LNX2 would also aid in understanding the regulation of Numb ubiquitination. While a BLAST search shows that LNX1 and LNX2 share 54% sequence identity, only LNX1 can ubiquitinate Numb and cause its degradation. One main areas of sequence divergence between LNX1 and LNX2 is the linker region bridging the RING domain and PDZ1. Differences in LNX1 and LNX2 ubiquitination suggest that this region may play a role in Numb ubiquitination. Future studies could probe differences in this region using

65 mutagenesis in order to disrupt the ubiquitination of Numb by LNX1, or to enable ubiquitination of Numb by LNX2.

4.2.2 The Role of LNX1 PDZ Domains in RING Function

Ubiquitination can cause vastly different outcomes for a substrate depending on the number of Ubiquitin moieties attached, and the arrangement (topology) with which they are linked (Ikeda et al. 2010). Recent studies characterizing the intrinsic chain building capacity of E2 conjugating enzymes has shown that E2s have a subset of possible chain topologies that they can build without preference (David et al. 2011). This work has highlighted that the role of E3s is to recruit substrates in a way that enforces specificity on the Ubiquitin chain output of the E2.

LNX1 PDZ mutants offer potential to better understand how LNX1 ubiquitination is regulated if they are used to examine the ubiquitination of substrates that bind to LNX1 PDZ domains in a typical C-terminal peptide fashion. As mentioned above, proteins that bind to PDZ1, PDZ2, or PDZ3 can be substrates for LNX1. As LNX1 has been documented as causing both proteosomal and lysosomal degradation, determining whether the PDZ domains have any effect on chain topology is of great interest. Mass spectrometry could be used to distinguish between different Ubiquitin chain topologies because linkages each have their own ion signature (Peng et al. 2003). A mass spectrometry approach could be used to characterize the range of chain topologies seen for each LNX1 PDZ domain mutant. If a PDZ domain is responsible for enabling a particular topology, then disrupting substrate binding at that domain may result in a decrease of a given linkage, or cause a change from mixed linkage to restricted chain formation.

Gaining a better understanding of the role that LNX1 PDZ domains play in substrate recognition would also be aided by the identification of new substrates. Recent advances in proteomic approaches have enabled more effective screening for ubiquitination substrates (Low et al. 2012). One approach enabling substrate discovery is to enrich for substrates. Koo and colleagues (2012) used a strategy of biotinylating surface proteins and enriching for biotin prior to mass spectrometry analysis. They identified that Wnt-related proteins, Fz3 and LRP5, were ubiquitinated by their E3 ligase of interest RNF43. Another approach used to find substrates by high throughput screen is to simplify the system of substrate ubiquitination into an idealized ubiquitination substrate (degron) with a C-terminus that corresponds to a potential substrate. Guo

(2012) used this approach of adding PDZ binding motifs to degrons in order to identify potential substrates for LNX1, some of which were then validated in additional mass spectrometry experiments, as well as in cells. A combination of these approaches may lead to discovery of novel substrates of LNX1. Once a pool of substrates has been identified, the role of each PDZ domain in ubiquitination, chain topology, and substrate outcome can be tested by using LNX1 PDZ mutants.

4.3 LNX1 and Cytoskeletal Dynamics

Having observed that overexpressing LNX1 in HeLa cells leads to an elongated cell phenotype, it would be of interest to further pursue whether how LNX1 is able to regulate cell shape and cytoskeletal dynamics. A recent paper by Bai (2011) used an RNAi screen to identify novel regulators of the cytoskeleton. The screen identified a number of genes including FAM40B, SH3KBP1, and FMNL3, that resulted in an elongated cell phenotype following knockdown. They also characterized the movement, spread, and actin distribution of these knockdown cell lines, and identified that the most elongated cells tended to have increased cell movement. Because the LNX1 overexpressing cells had an elongated cell phenotype, it would be interesting to characterize whether these cells also had perturbed cell movement, or cell spreading, by examining live cell motion with wound healing and invasions assays.

Overexpression of certain LNX1 mutants, particularly PDZ3 mutant LNX1 K513A, appeared to have a more pronounced phenotype than wildtype LNX1. Although this difference was not statistically significant, it has identified PDZ3 as being of interest for live cell assays listed above. It is possible that nonsignificant effects were observed because individual PDZ domains are able to compensate for each other. Redundancies may be uncovered by testing combinations of double mutants, such as constructs lacking protein binding in PDZ2 and PDZ3, or PDZ3 and PDZ4 phosphoinositide binding in additional cell shape and live cell assays.

Recently Numb was implicated as a negative regulator of actin modulator Rac GTPase (Lau and McGlade 2011). Since Numb has been well characterized as a substrate of LNX1, biochemical characterization of LNX1 overexpression on cytoskeletal modifiers, such as Rac, may connect LNX1 degradation of Numb to Rac activation.

4.4 Role of the LNX1 PDZ Domains in Wnt Signaling

The LNX family has been connected to Wnt signaling regulation in a number of recent publications (Major et al. 2008; Ro and Dawid 2009; Honda et al. 2010). PDZ-specific understanding of the role of LNX proteins, for example LNX1, could be gained by examining any impact overexpression of LNX1 PDZ mutants has on canonical or non-canonical Wnt signaling output with TCF/Lef or phospho-JNK/phospho c-jun reporter assays. By comparing Wnt reporter output resulting from wildtype LNX1 to that of LNX1 PDZ mutants or truncation mutants, a particular PDZ domain may be identified as being required for Wnt signal transmission.

Future experiments characterizing functional relevance of LNX1 and Fz4 interaction could involve examining whether LNX1 overexpression influences Fz4 internalization. By surface labeling for myc-Fz4, a time course could be run to investigate whether LNX1 expression causes an increase in Fz4 internalization. Comparing internalization in the presence of LNX1 to RING mutant LNX1 C45A would help to identify whether any effects observed require a functioning RING domain.

4.5 LNX1 and Junction Proteins

Several junction and transmembrane proteins have been identified as interacting with LNX1 PDZ2. Claudin-1, and claudin-17 have also been found to be substrates for ubiquitination by LNX1 (Takahashi et al. 2009). Claudin-1 degradation is not blocked by proteosomal inhibition, suggesting that it is targeted for lysosomal degradation (Takahashi et al. 2009). Takahashi has reported that overexpression of LNX1 in polarized MDCK cells resulted in a marked increase in the permeability of these cells as indicated by an increased flux of FITC-dextran across the LNX1 expressing confluent monolayer. LNX1 PDZ mutants could be used for a PDZ-specific approach to understanding the role of LNX1 in tight junction regulation. By creating a LNX-null line of MDCK cells, we could study the dynamic reformation of junctions following Ca2+ switch depolarization, and compare results of overexpressing wildtype LNX1 to that of each LNX1 PDZ mutant. A specific double mutant lacking PDZ2 binding and PDZ4 phosphoinositide binding would be of particular interest because PDZ2 and PDZ4 may act together to target LNX1 to the plasma membrane. Attempting to rescue any effects seen with a LNX1 construct lacking

68 binding to all PDZ domains with one that only possesses intact PDZ2 could confirm whether any effects are specific to PDZ2.

4.6 Concluding Remarks

Scaffold proteins are capable of forming the regulatory hub of a given signaling pathway because they can link transmembrane receptors with downstream activators. RING-type E3 ligases represent a specialized subset of scaffold proteins designed to connect Ubiquitin transfer machinery with specific substrates. In order to understand function and regulation of a scaffold protein it is essential to examine its individual domains. The reductionist approach of studying isolated domains offers limited insight because certain types of domains, including PDZ domains, only participate in biologically relevant interactions when they are located in the context of full length protein. A more robust means for understanding the role of individual domains in a scaffold requires selectively mutating the domains within full length protein.

The experiments conducted on the multi-PDZ domain containing E3 ligase LNX1 illustrate that mutagenesis is a sufficient tool for inactivating binding to PDZ domains. LNX1 PDZ mutants can be used to probe the role of each domain in an aspect of LNX function, such as substrate ubiquitination, proving especially useful with typical C-terminal interactors. All aspects of LNX1 biology, including substrate recognition and subcellular localization, can be investigated by employing LNX1 PDZ mutants. As the LNX family occupies the unique role of E3 ligase and multi-PDZ domain scaffold, a better understand of the individual domains is essential for understanding how LNX functions. Many E3 ligases and scaffold proteins have been found to act as gate keepers and have been implicated as tumour suppressors. Thus, gaining a better understanding of LNX1 function and regulation could contribute to better understanding of normal and disease cell states.

References

Adey, N. B., P. A. Ormonde, M. L. Baumgard, R. Pero, D. V. Byreddy, S. V. Tavtigian and P. L. Bartel (2000). "Threonine phosphorylation of the MMAC1/PTEN PDZ binding domain both inhibits and stimulates PDZ binding." Cancer Research 60(1): 3.

Akum, B. F., M. Chen, S. I. Gunderson, G. M. Riefler, M. M. Scerri-Hansen and B. L. Firestein (2004). "Cypin regulates dendrite patterning in hippocampal neurons by promoting microtubule assembly." Nature Neuroscience 7(2): 145-152.

Alexa, A., J. Varga and A. Remenyi (2010). "Scaffolds are 'active' regulators of signaling modules." The FEBS journal 277(21): 4376-4382.

Altschul, S., W. Gish, W. Miller, E. Myers and D. Lipman (1990). "Basic Local Alignment Search Tool." Journal of Molecular Biology 215: 8.

Angers, S. and R. T. Moon (2009). "Proximal events in Wnt signal transduction." Nature Reviews Molecular Cell Biology: 468-477.

Appleton, B. A., Y. Zhang, P. Wu, J. P. Yin, W. Hunziker, N. J. Skelton, S. S. Sidhu and C. Wiesmann (2006). "Comparative Structural Analysis of the Erbin PDZ and First PDZ Domain of ZO1." Journal of Biological Chemistry 281(31): 22312-22320.

Assemat, E., E. Bazellieres, E. Pallesipocachard, A. Lebivic and D. Masseyharroche (2008). "Polarity complex proteins." Biochimica et Biophysica Acta (BBA) - Biomembranes 1778(3): 614-630.

Bai, S. W., M. T. Herrera-Abreu, J. L. Rohn, V. Racine, V. Tajadura, N. Suryavanshi, S. Bechtel, S. Wiemann, B. Baum and A. J. Ridley (2011). "Identification and characterization of a set of conserved and new regulators of cytoskeletal organization, cell morphology and migration." BMC biology 9: 54.

Baker, R. T. and P. G. Board (1987). "The Human Ubiquitin Gene Family: structure of a gene and pseudogenes from the Ub B subfamily." Nucleic acids research 15(2): 22.

Berman, H., J. Westbrook, Z. Feng, G. Gilliland, T. Bhat, H. Weissig, I. Shindyalov and P. Bourne (2000). "The Protein Data Bank." Nucleic acids research 28: 8.

Brzovic, P. S., J. R. Keeffe, H. Nishikawa, K. Miyamoto, D. Fox, 3rd, M. Fukuda, T. Ohta and R. Klevit (2003). "Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin-ligase complex." Proceedings of the National Academy of Sciences of the United States of America 100(10): 5646-5651.

Cardozo, T. and M. Pagano (2004). "The SCF ubiquitin ligase: insights into a molecular machine." Nature Reviews Molecular Cell Biology 5(9): 739-751.

Chang, B. H., T. S. Gujral, E. S. Karp, R. BuKhalid, V. P. Grantcharova and G. MacBeath (2011). "A systematic family-wide investigation reveals that ~30% of mammalian PDZ domains engage in PDZ-PDZ interactions." Chemistry & biology 18(9): 1143-1152.

Chen, J., L. Pan, Z. Wei, Y. Zhao and M. Zhang (2008). "Domain-swapped dimerization of ZO-1 PDZ2 generates specific and regulatory connexin43-binding sites." EMBO 27: 11.

Chen, X., C. Winters, R. Azzam, X. Li, J. A. Galbraith, R. D. Leapman and T. S. Reese (2008). "Organization of the core structure of the postsynaptic density." Proceedings of the National Academy of Sciences of the United States of America 105(11): 4453-4458.

Chevesich, J., A. K. Kreuz and C. Montell (1997). "Requirement for the PDZ domain protein, InaD, for localization of the Trp store-operated channel to a signaling complex." Neuron 18: 95-105.

Chi, C. N., A. Engstrom, S. Gianni, M. Larsson and P. Jemth (2006). "Two Conserved Residues Govern the Salt and pH Dependencies of the Binding Reaction of a PDZ Domain." Journal of Biological Chemistry 281(48): 36811-36818.

Cho, K., C. A. Hunt and M. B. Kennedy (1992). "The Rat Brain Postsynaptic Density Fraction Contains a Homolog of the Drosophila Discs-Large Tumour Suppressor Protein.pdf>." Neuron 9: 14.

Christopherson, K. S., N. T. Sweeney, S. E. Craven, R. Kang, D. El-Husseini Ael and D. S. Bredt (2003). "Lipid- and protein-mediated multimerization of PSD-95: implications for receptor clustering and assembly of synaptic protein networks." Journal of Cell Science 116(Pt 15): 3213-3219.

Clague, M. J. and S. Urbé (2010). "Ubiquitin: Same Molecule, Different Degradation Pathways." Cell 143(5): 682-685.

D'Agostino, M., G. Tornillo, M. G. Caporaso, M. V. Barone, E. Ghigo, S. Bonatti and G. Mottola (2011). "Ligand of Numb proteins LNX1p80 and LNX2 interact with the human glycoprotein CD8alpha and promote its ubiquitylation and endocytosis." Journal of Cell Science 124(Pt 21): 3545-3556.

David, Y., N. Ternette, M. J. Edelmann, T. Ziv, B. Gayer, R. Sertchook, Y. Dadon, B. M. Kessler and A. Navon (2011). "E3 ligases determine ubiquitination site and conjugate type by enforcing specificity on E2 enzymes." The Journal of biological chemistry 286(51): 44104-44115.

David, Y., T. Ziv, A. Admon and A. Navon (2010). "The E2 ubiquitin-conjugating enzymes direct polyubiquitination to preferred lysines." The Journal of biological chemistry 285(12): 8595-8604.

Descamps, B., R. Sewduth, N. Ferreira Tojais, B. Jaspard, A. Reynaud, F. Sohet, P. Lacolley, C. Allieres, J. M. Lamaziere, C. Moreau, P. Dufourcq, T. Couffinhal and C. Duplaa (2012). "Frizzled 4 regulates arterial network organization through noncanonical Wnt/planar cell polarity signaling." Circulation Research 110(1): 47-58.

Deshaies, R. J. and C. A. P. Joazeiro (2009). "RING Domain E3 Ubiquitin Ligases." Annual Review of Biochemistry 78(1): 399-434.

Dho, S. E., M. B. French, S. A. Woods and C. J. McGlade (1999). "Characterization of Four Mammalian Numb Protein Isoforms." Journal of Biological Chemistry 274(46).

Dho, S. E., S. Jacob, C. D. Wolting, M. B. French, L. R. Rohrschneider and C. J. McGlade (1998). "mNumb Phosphotyrosine binding domain." Journal of Biological Chemistry 273(15): 9179-9187.

Djiane, A., S. Yogev and M. Mlodzik (2005). "The apical determinants aPKC and dPatj regulate Frizzled-dependent planar cell polarity in the Drosophila eye." Cell 121(4): 621-631.

Dominguez, C., A. M. Bonvin, G. S. Winkler, F. M. van Schaik, H. T. Timmers and R. Boelens (2004). "Structural model of the UbcH5B/CNOT4 complex revealed by combining NMR, mutagenesis, and docking approaches." Structure 12(4): 633-644.

Doyle, D. A., A. Lee, J. Lewis, E. Kim, M. Sheng and R. MacKinnon (1996). "Crystal structure of complexed and peptide-free membrane protein binding domain - Molecular basis of peptide recognition by PDZ." Cell 85: 1067-1076.

Duda, D. M., D. C. Scott, M. F. Calabrese, E. S. Zimmerman, N. Zheng and B. A. Schulman (2011). "Structural regulation of cullin-RING ubiquitin ligase complexes." Current Opinion in Structural Biology.

Ebnet, K., A. Suzuki, Y. Horikoshi, T. Hirose, M. Meyer zu Brickwedde, S. Ohno and D. Vestweber (2001). "Cell polarity protein ASIP/PAR-3 directly associates with junctional adhesion molecule (JAM)." EMBO 20(14): 11.

Ellenbroek, S. I., S. Iden and J. G. Collard (2012). "Cell polarity proteins and cancer." Seminars in cancer biology 22(3): 208-215.

Feng, W. and M. Zhang (2009). "Organization and dynamics of PDZ-domain-related supramodules in the postsynaptic density." Nature reviews. Neuroscience 10(2): 87-99.

Finn, R. D., J. Mistry, B. Schuster-Bockler, S. Griffiths-Jones, V. Hollich, T. Lassmann, S. Moxon, M. Marshall, A. Khanna, R. Durbin, S. R. Eddy, E. L. Sonnhammer and A. Bateman (2006). "Pfam: clans, web tools and services." Nucleic acids research 34(Database issue): D247-251.

Flynn, M., O. Saha and P. Young (2011). "Molecular evolution of the LNX gene family." BMC evolutionary biology 11: 235.

Fouassier, L., C. C. Yun, J. G. Fitz and R. B. Doctor (2000). "Evidence for ezrin-radixin-moesin- binding phosphoprotein 50 (EBP50) self-association through PDZ-PDZ interactions." The Journal of biological chemistry 275(32): 25039-25045.

Fuh, G., M. Pisaberro, Y. Li, C. Quan and L. A. S. Lasky, SS (2000). "Analysis of PDZ domain ligand interactions using carboxyl terminal phage display." Journal of Biological Chemistry 275: 6.

Gallardo, R., Y. Ivarsson, J. Schymkowitz, F. Rousseau and P. Zimmermann (2010). "Structural Diversity of PDZ-Lipid Interactions." ChemBioChem 11(4): 456-467.

Gee, S. H., S. Quenneville, C. R. Lombardo and J. Chabot (2000). "Single amino acid substitutions alter the specificity and affinity of PDZ domains for their ligands." Biochemistry 39: 14638-14646.

Goldstein, B. (2007). "The PAR Proteins: Fundamental Players in Animal Cell Polarization." Developmental Cell 13(5): 609-622.

Grembecka, J., T. Cierpicki, Y. Devedjiev, U. Derewenda, B. S. Kang, J. H. Bushweller and Z. S. Derewenda (2006). "Binding of the PDZ tandem of syntenin to target proteins." Biochemistry 45: 3674-3683.

Guo, Z., E. Song, S. Ma, X. Wang, S. Gao, C. Shao, S. Hu, L. Jia, R. Tian, T. Xu and Y. Gao (2012). "Proteomics Strategy to Identify Substrates of LNX, a PDZ Domain-containing E3 Ubiquitin Ligase." Journal of proteome research 11(10): 4847-4862.

Han, B. G., W. Nunomura, Y. Takakuwa, N. Mohandas and B. K. Jap (2000). "Protein 4.1R core domain structure and insights into regulation of cytoskeletal organization." Nature Structural and Molecular Biology 7: 5.

Harris, B. Z., B. J. Hillier and W. A. Lim (2001). "Energetic Determinants of internal motif recognition by PDZ domains." Biochemistry 40: 5921-5930.

Hering, H. and M. Sheng (2002). "Direct Interaction of Frizzled-1, -2, -4, and -7 with PDZ domains of PSD-95." FEBS Letters 521: 5.

Higa, S., T. Tokoro, E. Inoue, I. Kitajima and T. Ohtsuka (2007). "The active zone protein CAST directly associates with Ligand-of-Numb protein X." Biochemical and Biophysical Research Communications 354(3): 686-692.

Hillier, B. J. (1999). "Unexpected Modes of PDZ Domain Scaffolding Revealed by Structure of nNOS-Syntrophin Complex." Science 284(5415): 812-815.

Honda, T., H. Yamamoto, A. Ishii and M. Inui (2010). "PDZRN3 Negatively Regulates BMP-2- induced Osteoblast Differentiation through Inhibition of Wnt Signaling." Molecular Biology of the Cell 21(18): 3269-3277.

Hurd, T. W., L. Gao, M. H. Roh, I. G. Macara and B. Margolis (2003). "Direct interaction of two polarity complexes implicated in epithelial tight junction assembly." Nature Cell Biology 5(2): 137-142.

Husnjak, K., S. Elsasser, N. Zhang, X. Chen, L. Randles, Y. Shi, K. Hofmann, K. J. Walters, D. Finley and I. Dikic (2008). "Proteasome subunit Rpn13 is a novel ubiquitin receptor." Nature 453(7194): 481-488.

Iden, S. and J. G. Collard (2008). "Crosstalk between small GTPases and polarity proteins in cell polarization." Nature Reviews Molecular Cell Biology 9(11): 846-859.

Ikeda, F., N. Crosetto and I. Dikic (2010). "What Determines the Specificity and Outcomes of Ubiquitin Signaling?" Cell 143(5): 677-681.

Ikeda, F. and I. Dikic (2008). "Atypical ubiquitin chains: new molecular signals. 'Protein Modifications: Beyond the Usual Suspects' review series." EMBO reports 9(6): 536-542.

Im, Y. J., J. H. Lee, S. H. Park, S. J. Park, S. H. Rho, G. B. Kang, E. Kim and S. H. Eom (2003). "Crystal structure of the Shank PDZ-ligand complex reveals a class I PDZ interaction and a novel PDZ-PDZ dimerization." The Journal of biological chemistry 278(48): 48099- 48104.

Im, Y. J., S. H. Park, S. H. Rho, J. H. Lee, G. B. Kang, M. Sheng, E. Kim and S. H. Eom (2003). "Crystal structure of GRIP1 PDZ6-peptide complex reveals the structural basis for class II PDZ target recognition and PDZ domain-mediated multimerization." The Journal of biological chemistry 278(10): 8501-8507.

Irie, M. (1997). "Binding of Neuroligins to PSD-95." Science 277(5331): 1511-1515.

Itoh, M., M. Furuse, K. Morita, K. K, S. M and S. Tsukita (1999). "Direct binding of three tight junction-associated MAGUKs, ZO-1, ZO-2, and ZO-3, with the COOH termini of claudins." Journal of Cell Biology 147(6): 13.

Ivarsson, Y. (2012). "Plasticity of PDZ domains in ligand recognition and signaling." FEBS Letters 586(17): 2638-2647.

Iwai, K. (2012). "Diverse ubiquitin signaling in NF-kappaB activation." Trends in cell biology 22(7): 355-364.

Jemth, P. and S. Gianni (2007). "PDZ Domains - Folding and Binding." Biochemistry 46(30): 8701-8708.

Jin, J., T. Cardozo, R. C. Lovering, S. J. Elledge, M. Pagano and J. W. Harper (2004). "Systematic analysis and nomenclature of mammalian F-box proteins." Genes & Development 18(21): 2573-2580.

Kalia, L. V. and M. W. Salter (2003). "Interactions between Src family protein tyrosine kinases and PSD-95." Neuropharmacology 45(6): 720-728.

Kallay, L. M., A. McNickle, P. J. Brennwald, A. L. Hubbard and L. T. Braiterman (2006). "Scribble associates with two polarity proteins, Lgl2 and Vangl2, via distinct molecular domains." Journal of cellular biochemistry 99(2): 647-664.

Kansaku, A., S. Hirabayashi, H. Mori, N. Fujiwara, A. Kawata, M. Ikeda, C. Rokukawa, H. Kurihara and Y. Hata (2006). "Ligand-of-Numb protein X is an endocytic scaffold for junctional adhesion molecule 4." Oncogene 25: 14.

Karlsson, O. A., C. N. Chi, A. Engstrom and P. Jemth (2012). "The transition state of coupled folding and binding for a flexible beta-finger." Journal of Molecular Biology 417(3): 253- 261.

Kim, E., M. Niethammer, A. Rothschild, Y. N. Jan and M. Sheng (1995). "Clustering of Shaker- type K+ channels by interaction with a family of membrane associated guanylate kinases." Nature 378(2): 4.

Kim, E. and M. Sheng (2004). "PDZ domain proteins of synapses." Nature reviews. Neuroscience 5(10): 771-781.

Kim, J. H., D. Liao, L. F. Lau and R. L. Huganir (1998). "SynGAP: a Synaptic RasGAP that Associates with the PSD-95/SAP90 Protein Family." Neuron 20: 9.

Koo, B. K., M. Spit, I. Jordens, T. Y. Low, D. E. Stange, M. van de Wetering, J. H. van Es, S. Mohammed, A. J. Heck, M. M. Maurice and H. Clevers (2012). "Tumour suppressor RNF43 is a stem-cell E3 ligase that induces endocytosis of Wnt receptors." Nature 488(7413): 665-669.

Kumar, R. (2001). "The Second PDZ Domain of INAD Is a Type I Domain Involved in Binding to Eye Protein Kinase C. MUTATIONAL ANALYSIS AND NATURALLY OCCURRING VARIANTS." Journal of Biological Chemistry 276(27): 24971-24977.

Lambaerts, K., S. Van Dyck, E. Mortier, Y. Ivarsson, G. Degeest, A. Luyten, E. Vermeiren, B. Peers, G. David and P. Zimmermann (2012). "Syntenin, a syndecan adaptor and an Arf6 phosphatidylinositol 4,5-bisphosphate effector, is essential for epiboly and gastrulation cell movements in zebrafish." Journal of Cell Science 125(Pt 5): 1129-1140.

Lau, K. M. and C. J. McGlade (2011). "Numb is a negative regulator of HGF dependent cell scattering and Rac1 activation." Experimental Cell Research 317(4): 539-551.

Lenfant, N., J. Polanowska, S. Bamps, S. Omi, J. P. Borg and J. Reboul (2010). "A genome-wide study of PDZ-domain interactions in C. elegans reveals a high frequency of noncanonical binding." BMC genomics 11: 671.

Li, W., M. H. Bengtson, A. Ulbrich, A. Matsuda, V. A. Reddy, A. Orth, S. K. Chandra, S. Batalov and C. A. P. Joazeiro (2008). "Genome-wide and functional annotation of Human E3 Ubiquitin Ligases Identifies MULAN, a Mitochondrial E3 that Regulates the Organelle's Dynamics and Signaling." PLoS one 3(1): 14.

Lipkowitz, S. and A. M. Weissman (2011). "RINGs of good and evil: RING finger ubiquitin ligases at the crossroads of tumour suppression and oncogenesis." Nature reviews. Cancer 11(9): 629-643.

Liu, W., W. Wen, Z. Wei, J. Yu, F. Ye, C. H. Liu, R. C. Hardie and M. Zhang (2011). "The INAD scaffold is a dynamic, redox-regulated modulator of signaling in the Drosophila eye." Cell 145(7): 1088-1101.

Logan, C. Y. and R. Nusse (2004). "The Wnt Signaling Pathway in Development and Disease." Annual Review of Cell and Developmental Biology 20(1): 781-810.

Lorick, K. L., J. P. Jensen, S. Fang, A. M. Ong, S. Hatakeyama and A. M. Weissman (1999). "RING fingers mediate ubquitin-conjugating enzyme (E2)-dependent ubiquitination." Proceedings of the National Academy of Sciences 96: 6.

Low, T. Y., R. Magliozzi, D. Guardavaccaro and A. J. Heck (2012). "Unraveling the ubiquitin- regulated signaling networks by mass spectrometry-based proteomics." Proteomics.

Lue, R. A., E. Brandin, E. P. Chen and D. Branton (1996). "Two Independent Domains of hDlg are Sufficient for Subcellular Targeting: The PDZ1-2 Conformational Unit and an Alternately Spliced Domain." Journal of Cell Biology 135(4): 13.

Luyten, A., E. Mortier, C. Van Campenhout, V. Taelman, G. Degeest, G. Wuytens, K. Lambaerts, G. David, E. J. Bellefroid and P. Zimmermann (2008). "The postsynaptic density 95/disc-large/zona occludens protein syntenin directly interacts with frizzled 7 and supports noncanonical Wnt signaling." Molecular Biology of the Cell 19(4): 1594- 1604.

Major, M. B., B. S. Roberts, J. D. Berndt, S. Marine, J. Anastas, N. Chung, M. Ferrer, X. Yi, C. L. Stiock-Cooper, P. D. von Haller, L. Kategaya, A. Chien, S. Angers, M. J. MacCoss, M. A. Cleary, W. T. Arthur and R. T. Moon (2008). "New Regulators of Wnt/B-catenin Signaling Revealed by Integrative Molecular Screening." Science Signaling 1(45): 1-11.

Matsumine, A., A. Ogai, T. Senda, N. Okumura, K. Satoh, G. H. Baeg, T. Kawahara, S. Kobayashi, M. Okada, K. Toyoshima and T. Akiyama (1996). "Binding of APC to the Human Homolog of the Drosophila Discs Large Tumour Suppressor Protein." Science 272(5264): 4.

Metais, J. Y., C. Navarro, M. J. Santoni, S. Audebert and J. P. Borg (2005). "hScrib interacts with ZO-2 at the cell-cell junctions of epithelial cells." FEBS Letters 579(17): 3725-3730.

Mok, H., H. Shin, S. Kim, J. R. Lee, J. Yoon and E. Kim (2002). "Association of the Kinesin superfamily motor protein KIF1Bwith Postsynaptic Density-95 (PSD-95), Synapse- Associated Protein-97, and Synaptic Scaffolding Molecule PSD-95/Discs Large/Zona Occludens-1 Proteins." Journal of Neuroscience 22(13): 6.

Navarro, C., S. Nola, S. Audebert, M. J. Santoni, J. P. Arsanto, C. Ginestier, S. Marchetto, J. Jacquemier, D. Isnardon, A. Le Bivic, D. Birnbaum and J. P. Borg (2005). "Junctional recruitment of mammalian Scribble relies on E-cadherin engagement." Oncogene 24(27): 4330-4339.

Nie, J., M. A. McGill, M. Dermer, S. E. Dho, C. D. Wolting and C. J. McGlade (2002). "LNX functions as a RING type E3 ubiquitin ligase that targets the cell fate determinant Numb for ubiquitin-dependent degradation." EMBO 21(1): 93-102.

Nie, J., M. A. McGill, M. Dermer, S. E. Dho, C. D. Wolting and C. J. McGlade (2004). "A Novel PTB-PDZ Domain Interaction Mediates Isoform-specific Ubiquitylation of Mammalian Numb." Journal of Biological Chemistry 279(20): 20807-20815.

Ohno, S. (2001). "Intercellular junctions and cellular polarity: the PAR-aPKC complex, a conserved core cassette playing fundamental roles in cell polarity." Current Opinion in Cell Biology 13(5): 8.

Passafaro, M., C. Sala, M. Niethammer and M. Sheng (1999). "Microtubule binding by CRIPT and its potential role in the synaptic clustering of PSD-95." Nature Neuroscience 2(12): 7.

Pawson, T. (2003). "Assembly of Cell Regulatory Systems Through Protein Interaction Domains." Science 300(5618): 445-452.

Pawson, T. (2007). "Dynamic control of signaling by modular adaptor proteins." Current Opinion in Cell Biology 19(2): 112-116.

Peng, J., D. Schwartz, J. E. Elias, C. C. Thoreen, D. Cheng, M. Marsischky, G. Roelofs, D. Finley and S. P. Gygi (2003). "A proteomics approach to understanding protein ubiquitination." Nature Biotechnology 21(8): 7.

Peterson, F. C., R. R. Penkert, B. F. Volkman and K. E. Prehoda (2004). "Cdc42 Regulates the Par-6 PDZ domain through an allosteric CRIB-PDZ Transition." Molecular Cell 13(5): 12.

Pickart, C. M. (2004). "Back to the future with Ubiquitin." Cell 116: 10.

Pickart, C. M. and M. J. Eddins (2004). "Ubiquitin: structures, functions, mechanisms." Biochimica et biophysica acta 1695(1-3): 55-72.

Reyes-Turcu, F. E., K. H. Ventii and K. D. Wilkinson (2009). "Regulation and cellular roles of ubiquitin-specific deubiquitinating enzymes." Annual Review of Biochemistry 78: 363- 397.

Rhett, J. M., J. Jourdan and R. G. Gourdie (2011). "Connexin 43 connexon to gap junction transition is regulated by zonula occludens-1." Molecular Biology of the Cell 22(9): 1516-1528.

Ro, H. and I. B. Dawid (2009). "Organizer restriction through modulation of Bozozok stability by the E3 ubiquitin ligase Lnx-like." Nature Cell Biology 11(9): 1121-1127.

Roh, M. H., C. J. Liu, S. Laurinec and B. Margolis (2002). "The carboxyl terminus of zona occludens-3 binds and recruits a mammalian homologue of discs lost to tight junctions." The Journal of biological chemistry 277(30): 27501-27509.

Roh, M. H., O. Makarova, C. J. Liu, K. Shin, S. Lee, S. Laurinec, M. Goyal, R. Wiggins and B. Margolis (2002). "The Maguk protein, Pals1, functions as an adapter, linking mammalian homologues of Crumbs and Discs Lost." The Journal of Cell Biology 157(1): 161-172.

Roh, M. H. and B. Margolis (2003). "Composition and function of PDZ protein complexes during cell polarization." American journal of physiology. Renal physiology 285(3): F377-387.

Schultz, J., R. R. Copley, T. Doerks, C. P. Ponting and P. Bork (2000). "SMART: a web-based tool for the study of genetically mobile domains." Nucleic acids research 28: 4.

Scott, J. D. and T. Pawson (2009). "Cell Signaling in Space and Time." Science 326: 1220-1224.

Sheng, M. and C. C. Hoogenraad (2007). "The postsynaptic architecture of excitatory synapses: a more quantitative view." Annual Review of Biochemistry 76: 823-847.

Shieh, B.-H. and M.-Y. Zhu (1996). "Regulation of the TRP Ca2+ Channel by InaD in Drosophila Photoreceptors." Neuron 16: 991-998.

Shin, K., V. Fogg and B. Margolis (2006). "Tight Junctions and Cell Polarity." Annual Review of Cell and Developmental Biology 22: 207-236.

Skelton, N. J. (2002). "Origins of PDZ Domain Ligand Specificity. STRUCTURE DETERMINATION AND MUTAGENESIS OF THE ERBIN PDZ DOMAIN." Journal of Biological Chemistry 278(9): 7645-7654.

Sollerbrant, K. (2002). "The Coxsackievirus and Adenovirus Receptor (CAR) Forms a Complex with the PDZ Domain-containing Protein Ligand-of-Numb Protein-X (LNX)." Journal of Biological Chemistry 278(9): 7439-7444.

Song, E., S. Gao, R. Tian, S. Ma, H. Huang, J. Guo, L. Yingna, L. Zhang and Y. Gao (2006). "A high efficiency strategy for binding property characterization of peptide binding domains." Molecular and Cellular Proteomics 5: 14.

Songyang, Z. (1997). "Recognition of Unique Carboxyl-Terminal Motifs by Distinct PDZ Domains." Science 275(5296): 73-77.

Stauffer, T. P., S. Ahn and T. Meyer (1998). "Receptor-induced transient reduction in plasma membrane PtdIns(4,5)P2 concentration monitored in living cells." Current Biology 8: 4.

Stiffler, M. A., J. R. Chen, V. P. Grantcharova, Y. Lei, D. Fuchs, J. E. Allen, L. A. Zaslavskaia and G. MacBeath (2007). "PDZ domain binding selectivity is optimized across the mouse proteome." Science 317(5836): 364-369.

Suzuki, A. and S. Ohno (2006). "The PAR-aPKC system: lessons in polarity." Journal of Cell Science 119(Pt 6): 979-987.

Tada, T. and M. Sheng (2006). "Molecular mechanisms of dendritic spine morphogenesis." Current opinion in neurobiology 16(1): 95-101.

Takahashi, S., N. Iwamoto, H. Sasaki, M. Ohashi, Y. Oda, S. Tsukita and M. Furuse (2009). "The E3 ubiquitin ligase LNX1p80 promotes the removal of claudins from tight junctions in MDCK cells." Journal of Cell Science 122(7): 985-994.

Te Velthuis, A. J. W., P. A. Sakalis, D. A. Fowler and C. P. Bagowski (2011). "Genome-Wide Analysis of PDZ Domain Binding Reveals Inherent Functional Overlap winthin the PDZ Interaction Network." PLoS One 6(1): 12.

Tochio, H., Y. Mok, Q. Zhang, H. Kan, D. Bredt and M. Zhang (2000). "Formation of the nNOS/PSD-95 PDZ dimer requires a preformed -finger structure from the nNOS PDZ domain." Journal of Molecular Biology 303(3): 12.

Tonikian, R., Y. Zhang, S. L. Sazinsky, B. Currell, J.-H. Yeh, B. Reva, H. A. Held, B. A. Appleton, M. Evangelista, Y. Wu, X. Xin, A. C. Chan, S. Seshagiri, L. A. Lasky, C. Sander, C. Boone, G. D. Bader and S. S. Sidhu (2008). "A Specificity Map for the PDZ Domain Family." PLoS Biology 6(9): e239.

Tsunoda, S. and C. S. Zuker (1999). "Organization of InaD-signaling complexes by a multivalent PDZ domain protein in Drosophila photoreceptor cells ensures sensitivity and speed of signaling." Cell Calcium 26(5): 165-121.

Utepbergenov, D. I., A. S. Fanning and J. M. Anderson (2006). "Dimerization of the scaffolding protein ZO-1 through the second PDZ domain." The Journal of biological chemistry 281(34): 24671-24677.

Wang, H. Y., T. Liu and C. C. Malbon (2006). "Structure-function analysis of Frizzleds." Cellular Signalling 18(7): 934-941.

Wawrzak, D., A. Luyten, K. Lambaerts and P. Zimmermann (2009). "Frizzled–PDZ scaffold interactions in the control of Wnt signaling." Advances in Enzyme Regulation 49(1): 98- 106.

Weiss, A., M. Baumgartner, G. Radziwill, J. Dennler and K. Moelling (2007). "c-Src is a PDZ interaction partner and substrate of the E3 ubiquitin ligase Ligand-of-Numb protein X1." FEBS Letters 581(26): 5131-5136.

Wenzel, D. M., K. E. Stoll and R. E. Klevit (2011). "E2s: structurally economical and functionally replete." The Biochemical journal 433(1): 31-42.

Wertz, I. E. and V. M. Dixit (2010). "Signaling to NF-kappaB: regulation by ubiquitination." Cold Spring Harbor perspectives in biology 2(3): a003350.

Wilkinson, K. D. (1997). "Regulation of ubiquitin-dependent processes by deubiquitinating enzymes." FASEB Journal 11(14): 12.

Wilkinson, K. D., V. L. Tashayev, L. B. O'Connor, C. N. Larsen, E. Kasperek and C. M. Pickart (1995). "Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T." Biochemistry 34(44): 12.

Windsor, P. J. and S. P. Leys (2010). "Wnt signaling and induction in the sponge aquiferous system: evidence for an ancient origin of the organizer." Evolution & development 12(5): 484-493.

Wolting, C. D., E. K. Griffiths, R. Sarao, B. C. Prevost, L. E. Wybenga-Groot and C. J. McGlade (2011). "Biochemical and Computational Analysis of LNX1 Interacting Proteins." PLoS Biology 6(11): e26248.

Wong, H.-C., A. Bourdelas, A. Krauss, H.-J. Lee, Y. Shao, D. Wu, M. Mlodzik, D.-L. Shi and J. J. Zheng (2003). "Direct binding of the PDZ domain of Dishevelled to a conserved internal sequence in the C-terminal region of Frizzled." Molecular Cell 12: 1251-1260.

Wu, H., W. Feng, J. Chen, L.-N. Chan, S. Huang and M. Zhang (2007). "PDZ Domains of Par-3 as Potential Phosphoinositide Signaling Integrators." Molecular Cell 28(5): 886-898.

Wu, J., Y. Yang, J. Zhang, P. Ji, W. Du, P. Jiang, D. Xie, H. Huang, M. Wu, G. Zhang and Y. Shi (2007). "Domain-swapped dimerization of the second PDZ domain of ZO2 may provide a structural basis for the polymerization of claudins." The Journal of biological chemistry 282(49): 35988-35999.

Yao, R. (2001). "Identification of a PDZ Domain Containing Golgi Protein, GOPC, as an Interaction Partner of Frizzled." Biochemical and Biophysical Research Communications 286(4): 771-778.

Yao, R., T. Maeda, S. Takada and T. Noda (2001). "Identification of a PDZ domain containing Golgi protein, GOPC, as an interaction partner of frizzled." Biochemical and Biophysical Research Communications 286(4): 771-778.

Yao, R., Y. Natsume and T. Noda (2004). "MAGI-3 is involved in the regulation of the JNK signaling pathway as a scaffold protein for frizzled and Ltap." Oncogene 23(36): 6023- 6030.

Ye, Y. and M. Rape (2009). "Building ubiquitin chains: E2 enzymes at work." Nature reviews. Molecular cell biology 10(11): 755-764.

Yeaman, C., K. K. Grindstaff and W. J. Nelson (1999). "New Perspective on Mechanism Involved in Generating Epithelial Cell Polarity." Physiological Reviews 79(1): 26.

Young, P., J. Nie, X. Wang, C. McGlade, M. Rich and G. Feng (2005). "LNX1 is a perisynaptic Schwann cell specific E3 ubiquitin ligase that interacts with ErbB2." Molecular and Cellular Neuroscience 30(2): 238-248.

Yurchenko, V., Z. Xue and M. Sadofsky (2003). "The RAG1 N-terminal domain is an E3 ubiquitin ligase." Genes & Development 17(5): 581-585.

Zeke, A., M. Lukacs, W. A. Lim and A. Remenyi (2009). "Scaffolds: interaction platforms for cellular signalling circuits." Trends in cell biology 19(8): 364-374.

Zheng, N., P. Wang, P. D. Jeffrey and N. P. Pavletich (2000). "Structure of a c-Cbl-UbcH7 Complex: RING Domain Function in Ubiquitin-Protein Ligases." Cell 102: 7.

Zimmermann, P. (2006). "The prevalence and significance of PDZ domain–phosphoinositide interactions." Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids 1761(8): 947-956.

Zimmermann, P., K. Meerschaert, G. Reekmans, I. Leenaerts, J. V. Small, J. Vandekerckhove, G. David and J. Gettemans (2002). "PIP2-PDZ domain binding controls association of Syntenin with the plasma membrane." Molecular Cell 9: 11.