Virus Reviews and Research Journal of the Brazilian Society for Virology

Virus Reviews & Research Vol 20 (2), August-December 2016 Annals of the XXVII Brazilian Congress of Virology & X Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil Editors Edson Elias da Silva Fernando Rosado Spilki

BRAZILIAN SOCIETY FOR VIROLOGY BOARD OF DIRECTORS (2015-2016)

Officers Area Representatives

President: Dr. Bergmann Morais Ribeiro Basic Virology (BV) Vice-President: Dr. Célia Regina Monte Barardi Dr. Luciana Jesus da Costa, UFRJ (2015 – 2016) First Secretary: Dr. Fernando Rosado Spilki Dr. Luis Lamberti Pinto da Silva, USP-RP (2015 – 2016) Second Secretary: Dr. Mauricio Lacerda Nogueira First Treasurer: Dr. Alice Kazuko Inoue Nagata Environmental Virology (EV) Second Treasurer: Dr. Zélia Inês Portela Lobato Dr. Adriana de Abreu Correa, UFF (2015 – 2016) Executive Secretary: Dr Fabrício Souza Campos Dr. Jônatas Santos Abrahão, UFMG (2015 – 2016

Human Virology (HV) Fiscal Councilors Dr. Eurico de Arruda Neto, USP-RP (2015 – 2016) Dr. Viviane Fongaro Botosso Dr. Paula Rahal, UNESP (2015 – 2016) Dr. Davis Fernandes Ferreira Dr. Maria Ângela Orsi Immunobiologicals in Virology (IV) Dr. Flávio Guimarães da Fonseca, UFMG (2015 – 2016) Dr. Jenner Karlisson Pimenta dos Reis, UFMG (2015 – 2016)

Plant and Invertebrate Virology (PIV) Dr. Maite Vaslin De Freitas Silva, UFRJ (2015 – 2016) Dr. Tatsuya Nagata, UNB (2015 – 2016)

Veterinary Virology (VV) Dr. João Pessoa Araújo Junior, UNESP (2015 – 2016) Dr. Marcos Bryan Heinemann, USP (2015 – 2016)

Address Universidade Feevale, Instituto de Ciências da Saúde Estrada RS-239, 2755 - Prédio Vermelho, sala 205 - Laboratório de Microbiologia Molecular Bairro Vila Nova - 93352-000 - Novo Hamburgo, RS - Brasil Phone: (51) 3586-8800 E-mail: F.R.Spilki - [email protected] http://www.vrrjournal.org.br Organizing Committee Dr. Adriana de Abreu Correa, UFF Dr. Aguinaldo Roberto Pinto, UFSC Dr. Alice Kazuko Inoue Nagata, EMBRAPA Dr. Bergmann Morais Ribeiro, UNB - President of SBV Dr. Carlos Roberto Zanetti, UFSC Dr. Célia Regina Monte Barardi, UFSC – President of XXVI CBV Dr. Clarice Weis Arns, UNICAMP Dr. Cláudia Maria Oliveira Simões, UFSC Dr. Daniel Santos Mansur, UFSC Dr. Davis Fernandes Ferreira, UFRJ Dr. Eurico de Arruda Neto, USP Dr. Fernando Rosado Spilki, FEEVALE Dr. Flávio Guimarães da Fonseca, UFMG Dr. Jenner Karlisson Pimenta dos Reis, UFMG Dr. João Pessoa Araújo Junior, UNESP Dr. Jônatas Santos Abrahão, UFMG Dr. Luciana Jesus da Costa, UFRJ Dr. Luis Lamberti Pinto da Silva, USP Dr. Maite Vaslin de Freitas Silva, UNB Dr. Marcos Bryan Heinemann, USP Dr. Maria Ângela Orsi, LANAGRO Dr. Mauricio Lacerda Nogueira, FAMERP Dr. Paula Rahal, UNESP Dr. Tatsuya Nagata, UNB Dr. Viviane Fongaro Botosso, BUTANTAN Dr. Zélia Inês Portela Lobato, UFMG

Hélio Gelli Pereira Award Committee Fernando Spilki - President Davis Fernandes Ferreira Aguinaldo R. Pinto Luciana Barros de Arruda

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 Financial Support General Information

CAPES Secretary Office Hours Coordenação de Aperfeiçoamento de Pessoal de Nível Superior September, 18 th - 1:00 p.m. - 8:30 p.m. CNPQ September, 19 th - 8:30 a.m. - 8:00 p.m. September, 20 th - 8:30 a.m. - 8:00 p.m. Tecnológico September, 21 sh - 7:30 a.m. - 1:00 p.m. FAPEGConselho Nacional de Desenvolvimento Cientifico e Fundação de Amparo à Pesquisa do Estado de Goiás Name Badge MINISTÉRO DA SAÚDE Name Badges will be required for access in all activities, including lunch.

Exhibitors Media Desk (for lecturers only) CIENCOR The media desk will be openned as scheduled for the BIO-RAD EUROIMMUN must be delivered at the media desk at least 2 hours before PROMEGA thesecretary scheduled of the time meeting. for the Data presentation. - files with Please presentations note that - QIAGEN personal computers will not be allowed in presentation room. SIGMA-ALDRICH Presentations will be copied and made available to members SINAPSE of SBV after the meeting at the institutional homepage unless not authorized by the speakers.

Sponsors Certificates Silver Sponsorship - Roche

meeting.Certificates of attendance will be available on line at http:// Organizers www.sbv.org.br/congresso 15 days after the end of the Office Marketing Eventos Poster Presentations The posters must be displayed from 10:00 a.m. until the end of the session, and then removed.

POSTER SESSION 1: MONDAY – 19 SEPTEMBER, 6:30 - 8:00 P.M. Human Virology Basic Virology • Environmental Virology • POSTER• SESSION 2: TUESDAY - 20 SEPTEMBER, 6:30 – 8:00 P.M. Immunobiologicals in Virology Plant and Invertebrate Virology • Veterinary Virology • •

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 XXVII Brazilian Congress of Virology - Scientific Program TIME ACTIVITY Round Table 1 - Enteric viruses / Ita e Alaor Room Adriana Luchs, Instituto Adolfo Lutz, São Paulo, Brazil – “Epidemiology of noroviruses: challenges and developments” • Alejandro Andrés Castello, National University of Quilmes, Quilmes, Argentina – “Rotaviruses

• genotype frequencies and strain characteristics?” Marielacirculating Martínez in Argentina Gómez during, FIOCRUZ, the lastRio de years. Janeiro, Could Brazil massive – “Monitoring vaccination the genetic in Brazil diversity influence of human Rotavirus A strains in Brazil after vaccine introduction” • Fernando Rosado Spilki, FEEVALE, Rio Grande do Sul, Brazil (Chair) Round Table 2 - Invertebrate virus diversity / Noemi Jaime Room Daniel Mendes Pereira Ardisson de Araújo, UFSM, Rio Grande do Sul, Brazil – “Insect viruses in Brazil” • Cintia Bittar Oliva João Trindade Marques, UFMG, Minas Gerais, Brazil - “Surveillance of insect viromes using 2:00 – 4:00 P.M. • virus-derived small, RNAs”UNESP, São Paulo, Brazil - “Culex flavivirus diversity” • Bergmann Morais Ribeiro, UnB, Distrito Federal, Brazil (Chair) Round Table 3 - RNA viruses cell biology / Principal Room • Ronaldo da Silva Mohana Borges NS1 protein on host cell regulation” • , UFRJ, Rio de Janeiro,, UFRJ, Brazil Rio – de “Zika Janeiro, virus Brazil impairs – “Unveiling brain development” the role of flavivirus

Sunday, September 18 September Sunday, Patricia Garcez Luis Lamberti Pinto da Silva, USP, São Paulo, Brazil – “Mechanisms of Oropouche virus assembly • in mammalian cells” (Chair) Round• Table 4 - Emergent viruses in veterinary / Cavalhadas Room Leila Sabrina Ullmann, UNESP, São Paulo, Brazil - “Exploring the virome of diseased horses” Eduardo Furtado Flores, UFSM, Rio Grande do Sul, Brazil – “HoBi-like pestivirus infection” • Ana Carolina Diniz Matos, UFMG, Minas Gerais, Brazil – “Bluetongue: the emergence of clinical • disease in Brazil” • Zélia Inês Portela Lobato, UFMG, Minas Gerais, Brazil (Chair) Opening Ceremony - CONFERENCE 1 / Principal Room 7:00 - 9:00 P.M. • Charles M. Rice, The Rockefeller University, New York, United States – “Hepatitis C and beyond: Never a dull moment” 9:00 - 11:00 P.M. • Centro de Convenções Luciano Peixoto Hall

Cocktail reception and visit to exhibits / TIME ACTIVITY CONFERENCE 2 / Principal Room 9:00 - 10:00 A.M. Pedro Fernando da Costa Vasconcelos, Instituto Evandro Chagas, Pará, Brazil – “Zika virus in

• 10:00 - 10:30 A.M. the Americas: Early epidemiologicalCentro de andConvenções genetic findings”Luciano Peixoto Hall CoffeeRound break Table and 5 - Viralvisit to diagnosis exhibits / and treatment / Noemi Jaime Room Isabel Guedes Mello, Butantan, São Paulo, Brazil – “Antivirals: mechanisms of action” Celso Francisco Hernandes Granato, UNIFESP, São Paulo, Brazil – “The use of laboratory tests • in diagnosis and monitoring of infected hepatitis virus types B and C patients” • Menira Souza, UFG, Goiás, Brazil – “Viral detection and molecular characterization” Paula Rahal, UNESP, São Paulo, Brazil (Chair) Round• Table 6 - Plant viruses vector interactions / Principal Room 10:30 - 12:00 A.M • Renate Krause Sakate, UNESP, São Paulo, Brazil - “Virus transmission by Brazilian native and Monday, September 19 September Monday, invasive species of Bemisia tabaci” • Jesús Navas-Castillo, IHSM-UMA-CSIC, Algarrobo-Costa, Málaga, Spain – “Differential

• William M. Wintermantel, USDA, Salinas, United States - “Understanding the connection transmission of criniviruses and begomoviruses by whiteflies” • Tatsuya Nagata, UNB, Brasília, Brazil (Chair) between gene expression in the whitefly and the biology of crinivirus transmission” XXVII Brazilian •Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 TIME ACTIVITY Round Table 7 - Environmental virology / Ita e Alaor Room Ana Cláudia Franco, UFRGS, Rio Grande do Sul, Brazil - “Giant viruses in environmental samples” Fernando R. Spilki, FEEVALE, Rio Grande do Sul, Brazil – “In the name of Poseidon, what’s in • Olympic waters?” • Célia R. M. Barardi, UFSC, Santa Catarina, Brazil – “New insights in Environmental Virology: approaches for infectivity and disinfection evaluation” (Chair) 10:30 - 12:00 A.M Round• Table 8 - Virus cell interaction / Cavalhadas Room Daniele da Glória de Souza, UFMG, Minas Gerais, Brazil – “Dengue virus requires the CC- chemokine receptor CCR5 for replication and infection development” • Renato Santana de Aguiar, UFRJ, Rio de Janeiro, Brazil – “Clinical Neuropathogenesis and Immuneactivation of arboviruses (Zika, Chikungunya and Dengue)” • Luciana Jesus da Costa, UFRJ, Rio de Janeiro, Brazil – “HIV-1 nef inhibits protease activity of viral particles” (Chair) Mini-course• 1 / Noemi Jaime Room Fernando Melo, UNB, Distrito Federal, Brazil - “Next generation sequencing technologies for viral metagenomic analyses” Mini-course• 2 / Cavalhadas Room Antônio Augusto Fonseca Júnior, LANAGRO, Minas Gerais, Brazil - “Viral phylogeny and 12:00 - 1:00 P.M. sequence analysis” Mini-course• 3 / Principal Room Vitor Bortolo de Rezende Mini-course 4 / Ita e Alaor Room • Luciana Jesus da Costa, UFRJ,, BD RioBiosciences de Janeiro, - “Uses Brazil of - flow“Viral cytometry replication in mechanism”virology” 12:00 - 2:00 P.M. Lunch break • Oral presentations: Session 1 – Human Principal Room - Chair: Eurico de Arruda Neto 30 - HEPATIC MIRNA PROFILE IN DENGUE HEMORRHAGIC FEVER AND ASSOCIATION WITH APOPTOSIS• REGULATION, VASCULAR/ INJURY AND INFLAMATION Oliveira, L.F.; Vianez, J.L.G.; Pagliari, C.; Carvalho, L.V.; Silveira, T.S.; Telles, A.L.; Cardoso, J.F.; Vasconcelos, J.M.; Moreira-Nunes, C.A.; Burbano, R.M.R.; Nunes, M.R.T.; Santos, E.J.M.

Monday, September 19 September Monday, 179 - MUTATIONS PROFILE IN HIV TRANSCRIPTASE REVERSA AND PROTEASE GENES IN HIV/ HBV AND HIV/HCV COINFECTED PATIENTS Grotto, R.M.T.; Cantão, N.M.; Fogaça, L.; Wolf, I.; Almeida, R.; Cruz, A.A.; Barbosa, A.N.; Silva, G.F.; Valente, G.T.; Pardini, M.I.M.C.; Grotto, R.M.T. 207 - EFFICIENT PRODUCTION OF GP64 FREE HIV-1 VIRUS-LIKE PARTICLES (VLPS) USING BACULOVIRUS EXPRESSION SYSTEM Chaves, L.C.S.; Ribeiro, B.M.; Blissard, G.W. 234 - IN SITU EVIDENCE ON INFLUENZA VIRUS INFECTION OF LYMPHOID CELLS IN HUMAN TONSILLAR TISSUES 2:00 - 3:30 P.M. Castro, I.A.; Martins Junior, R.B.; Jesus, B.L.S.; Pontelli, M.C.; Prates, M.C.; Silva, M.L.; Carenzi, L.R.; Tamashiro, E.; Anselmo-Lima, W.T.; Arruda, E. Session 2 – Veterinary Noemi Jaime Room - CHAIRS: Marcos Bryan Heinemann and João Pessoa Araújo Junior 9 - RECONSTRUCTION• OF THE SPATIAL/ DISPERSION OF INFECTIOUS BRONCHITIS VIRUS: IBV FINDS ITS ROOTS Saraiva, G.L.; Vidigal, P.M.P.; Pereira, C.G.; Figueiredo, J.F.; Campo, A.J.; Fietto, J.L.R.; Bressan, G.C.; Silva Júnior, A.; Almeida, M.R. 62 - SYSTEMIC AND MUCOSAL ANTIBODY RESPONSES INDUCED BY A VACCINE OF INACTIVATE AVIAN INFECTIOUS BRONCHITIS VIRUS (IBV) ENCAPSULATED IN CHITOSAN NANOPARTICLES Lopes, P.D.; Okino, C.H.; Casagrande, V.M.; Pavani, C.; Fernando, F.S.; Tamanini, M.L.F.; Montassier, M.F.S.; Lopez, R.F.V.; Montassier, H.J. 74 - GENOMIC CHARACTERIZATION OF A NOVEL HUMAN INFLUENZA A(H1N2) VARIANT DETECTED IN BRAZIL Resende, P.C.; Born, P.S.; Matos, A.R.; Motta, F.C.; Caetano, B.C.; Debur, M.C.; Riediger, I.; Brown, D.; Siqueira, M.M.

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 TIME ACTIVITY 80 - GENETIC CHARACTERIZATION OF INFLUENZA VIRUSES CIRCULATING WITHIN BRAZILIAN SWINE BETWEEN 2009 AND 2016 Schaefer, R.; Gava, D.; Nelson, M.I.; Haach, V.; Ciacci-Zanella, J.R.; Cantão, M.E. 85 - NEONATAL PIG MORTALITY ASSOCIATED WITH SENECAVIRUS A Gava, D.; Lorenzett, M.P.; Haach, V.; Driemeier, D.; Joshi, L.R.; Mohr, K.A.; Diel, D.G.; Caron, L.; Morés, N.; Morés, M.A.Z.; Schaefer, R. 143 - BRAZILIAN BATS AS CARRIERS OF VIRUSES WITH ZOONOTIC POTENTIAL Simas, P.V.M.; Barnabé;, A.C.S.; Caserta, L.C.; Martini, M.C.; Durões Carvalho, R.; Fellippe, P.A.N.; Ferreira-Neto, D.L.; Beck, R.M.; Nascimento, G.M.; Jacomassa, F.A.F.; Moraes, A.P.; Miller, M.E.; Arns, C.W. 166 - EVALUATION OF SEROLOGICAL AND VIREMIC PROFILE FOR PORCINE CIRCOVIRUS TYPE 2 IN NATURALLY INFECTED PIGS FROM FARROW-TO-FINISH FARMS IN MINAS GERAIS STATE, BRAZIL Dias, A.S.; Rehfeld, I.S.; Gallinari, G.C.F.; Costa, A.G.; Guedes, M.I.M.C.; Lobato, Z.I.P. Session 3 – Basic Ita e Alaor Room - Chair: Luis Lamberti Pinto da Silva 75 - IDENTIFICATION OF CELL PROTEINS THAT INTERACT WITH HUMAN RESPIRATORY SYNCYTIAL VIRUS• M2-1 PROTEIN / Araujo, C.L.; Eléouët, J.F.; Ventura, A.M. 79 - TROPOMIOSIN INTERACTION WITH HUMAN RESPIRATORY SYNCYTIAL VIRUS MATRIX PROTEIN Dias, T.D.; Oliveira, A.P.; Ogawa, J.K.; Eléouët, J.F.; Ventura, A.M. 168 - EVALUATION OF APOPTOTIC MECHANISMS MEDIATED BY UNFOLDED PROTEIN RESPONSE PATHWAY IN JURKAT CELLS STIMULATED WITH HIV-1 TAT PROTEIN Campestrini, J.; Costa-Junior, A.O.; Pinto, A.R. 2:00 - 3:30 P.M. 214 - RESPIRATORY SYNCYTIAL VIRUS MRNA TRANSCRIPTOME REVEALS SURPRISING PROFILES DURING ONE-STEP REPLICATION CYCLE Jesus, B.L.S.; Cardoso, R.S.; Criado, M.F.; Souza, M.M.; Oliveira, A.S.; Prates, M.C.M.; Ventura, A.M.; Arruda, E. 215 - OROPOUCHE VIRUS ASSEMBLY IN MAMMALIAN CELLS REQUIRES THE ACTIVITY OF HOST ESCRT PROTEINS Barbosa, N.S.; Mendonca, L.L.R.; Criado, M.; Arruda, E.; da Silva, L.L.P. Session 4 – Plant and Invertebrates Cavalhadas Room - Chairs: Alice Nagata and Tatsuya Nagata 102 - MOLECULAR CHARACTERIZATION OF GRAPEVINE ENAMO-LIKE VIRUS, A NOVEL PUTATIVE MEMBER OF THE• GENUS ENAMOVIRUS / Silva, J.M.F.; Fajardo, T.V.M.; Al Rwahnih, M.; Blawid, R.; Nagata, T. 117 - IDENTIFICATION AND FUNCTIONAL ANALYSES OF THE COTTON BLUE DISEASE RESISTANCE LOCUS Fausto, A.K.S.; Moura, M.O.; da Franca, T.S.; Romanel, E.; Vaslin, M.F.S.

Monday, September 19 September Monday, 118 - DICER-LIKE PROFILE EXPRESSION DURING VIRAL INFECTION IN SUSCEPTIBLE AND RESISTANT

COTTON Moura, M.O.; Fausto, A.K.S.; da Franca, T.S.; Romanel, E.; Vaslin, M.F.S. 175 - ARRACACIA XANTHORRIZA (MANDIOQUINHA-SALSA): A RESERVOIR OF PLANT VIRUS Orílio, A.F.; Inoue-Nagata, A.K.; Nagata, T.; Madeira, N.R.; Resende, R.O.; Blawid, R. 209 - THE COMPLETE GENOME SEQUENCE OF A NOVEL BETABACULOVIRUS ISOLATED FROM MOCIS SP. REVEALS AN ANCIENT GENOME EXPANSION AND A TENDENCY IN NOCTUID-INFECTING BETABACULOVIRUS Ardisson-Araújo, D.M.P.; Melo, F.L.; Sosa-Gómez, D.R.; Ribeiro, B.M. 244 - STUDY OF BEGOMOVIRUS DIVERSITY IN TOMATO PLANTS USING NEXT-GENERATION SEQUENCING Rêgo, C.M.; Nakasu, E.Y.T.; Blawid, R.; Nagata, T.; Inoue-Nagata, A.K. 3:30 - 4:00 P.M. Centro de Convenções Luciano Peixoto Hall CONFERENCE 3 / Principal Room Coffee break and visit to exhibits / 4:00 - 5:00 P.M. Santiago F. Elena, Instituto de Biología Molecular y Celular de Plantas, València, Spain - “Evolutionary and systems biology of RNA virus emergence” Round• Table 9 - Update to arboviral diseases / Principal Room Mauricio Lacerda Nogueira, FAMERP São Paulo, Brazil – “Lessons from zika virus infection in São Paulo state” (Chair) 5:00 – 6:30 P.M. • Paolo Marinho de Andrade Zanotto, USP, São Paulo, Brazil – “A Zika virus-associated microcephaly case with background exposure to STORCH agents” • Renato Santana de Aguiar, UFRJ, Rio de Janeiro, Brazil – “Zika outbreak: more questions than answers” Poster• Session 1 and Visit to Exhibits / Centro de Convenções Luciano Peixoto Hall Human Virology; 6:30 – 8:00 P.M. Basic Virology; • Environmental Virology • • XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 TIME ACTIVITY Round Table 10 – Animal coronaviruses / Ita e Alaor Room Paulo Eduardo Brandão, USP, São Paulo, Brazil – “Mutant spectrum and molecular markers in Feline Coronavirus” • Luiz Gustavo Bentim Góes, USP, São Paulo, Brazil – “Coronavirus in bats” Hélio Montassier, UNESP, São Paulo, Brazil – “Molecular epidemiology and evolution of avian • infectious bronchitis virus” • Marcos Bryan, USP, São Paulo, Brazil (Chair) Round Table 11 – Respiratory viruses - Noemi Jaime Room • Edison Durigon, USP, São Paulo, Brazil – “RSV mutations: implications for molecular diagnosis and resistance to neutralization” • Nancy Bellei, UNIFESP, São Paulo, Brazil – “Role of polyomavirus in severe respiratory disease in hospitalized patients” • Eurico de Arruda Neto, USP, São Paulo, Brazil – “Respiratory virus infection of lymphoid tissues”.(Chair) 9:00 – 10:30 A.M. Round Table 12 – Dengue virus vaccine development - Principal Room • Eric Plennevaux for Dengue virus” • David McIntosh, ,Takeda Sanofi-Pauster, Vaccines Paris,Inc. – “Takeda’sFrance – “GlobalDengue strategicVaccine Candidate: program management Program Update” head Flavio Guimarães Fonseca, UFMG, Minas Gerais, Brazil (Chair) Round• Table 13 – Plant virology and phytopathology / Cavalhadas Room • Santiago F. Elena, Instituto de Biología Molecular y Celular de Plantas, València, Spain - “Resistance to RNA virus based on the expression of amiRNAS: promises and disappointments” • Maité Vaslin de Freitas Silva of the locus cbd associate to Cotton blue disease resistance” • Francisco Murilo Zerbini, UFV,, UFRJ, Minas Rio Gerais, de Janeiro, Brazil Brazil – “Finding - “Identification the needle(s) and in molecularthe haystack: characterization investigating within-host begomovirus populations with NGS” • Renato de Oliveira Resende, UNB, Distrito Federal, Brazil (Chair) 10:30 - 11:00 A.M. Centro de Convenções Luciano Peixoto Hall • CONFERENCE 4 / Principal Room Coffee break and visit to exhibits / 11:00 - 12:00 A.M. Concepta Margaret McManus Pimentel, Diretora de Relações Internacionais da CAPES - “The role of Capes for internacionalization of Brazilian Universities” Mini-course• 1 / Noemi Jaime Room Fernando Melo, UNB, Distrito Federal, Brazil - “Next generation sequencing technologies for viral metagenomic analyses” Tuesday, September 20 September Tuesday, Mini-course• 2 / Cavalhadas Room Antônio Augusto Fonseca Júnior, LANAGRO, Minas Gerais, Brazil - “Viral phylogeny and 12:00 - 1:00 P.M. sequence analysis” Mini-course• 3 / Principal Room Vitor Bortolo de Rezende Mini-course 4 / Ita e Alaor Room • Luciana Jesus da Costa, UFRJ,, BD RioBiosciences de Janeiro, - “Uses Brazil of - flow“Viral cytometry replication in mechanism”virology” 12:00 - 2:00 P.M. Lunch break • Oral presentations: Session 5 – Human Principal Room - Chair: Eurico de Arruda Neto 11 - INCREASED PRO-INFLAMMATORY CYTOKINES IN AMNIOTIC FLUID FROM ZIKA VIRUS ASSOCIATED MICROCEPHALY• / Ornelas, A.M.M.; Pezzuto, P.; Silveira, P.P.; Melo, F.O.; Ferreira, T.A.; Oliveira-Szejnfeld, P.S.; Leal, J.I.; Amorim, M.M.R.; Cardoso, C.C.; Nixon, D.F.; Tanuri, A.; Melo, A.S.; Aguiar, R.S. 156 - ACTIVATION OF INTRINSIC COAGULATION PATHWAY AND LIPID METABOLISM IN DENGUE VIRUS PATHOGENESIS Coelho, S.V.A.; Vellasco, L.; Marques J.R.E.T.A.; Scharfstein, J.; Arruda, L.B. 2:00 - 3:30 P.M. 206 - IDENTIFICATION AND SELECTION OF DENGUE VIRUS SPECIFIC PEPTIDES FOR DIFFERENTIAL DIAGNOSTIC TESTS Versiani, A.F.; Mendes, T.A.O.; Bartholomeu, D.C.; Nogueira, M.L.; da Fonseca, F.G. 254 - SALIVA AS THE BIOLOGICAL SAMPLE OF CHOICE FOR THE MOLECULAR DIAGNOSIS OF ZIKA Monteiro, D.C.S.; Mejía, M.C.C.; Abdalla, L.F.; Santos. J.H.A.; Almeida, T.P.A.; Corado, A.L.G.; Souza, V.C.; Nascimento, V.A.; Naveca, F.G. 256 - ETIOLOGY OF THE ACUTE FEBRILE ILLNESS IN THE AMAZON STATE BRAZIL, DURING THE EMERGENCE OF ZIKA VIRUS Nascimento, V.A.; Monteiro, D.C.S.; Silva, M.S.; Souza, V.C.; Corado, A.L.G.; Naveca, F.G.

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 TIME ACTIVITY 258 - SOROPREVALENCE DENGUE IGG IN PATIENTS IN A PROSPECTIVE COHORT STUDY OF SÃO JOSÉ DO RIO PRETO Silva, R.A.; Silva, G.C.D.; Zini, N.; Kanazawa, T.; Estofolete, C.F.; Watanabe, A.S.A.; Terzian, A.C.B.; Nogueira, M.L. Session 6 – Environmental / Ita e Alaor Room - Chair: Célia R. M. Barardi 14 CORROSION AND BIOFILM REDUCED BY ECOPHAGES IN A PILOT ANAEROBIC SYSTEM Dias,• R.S.; Oliveira, M.D.; Silva, J.D.; Bicalho, K.M.; Sousa, M.P.; Santos, V.V.C.M.; Silva, E.D.; Akamine, R.N.; Silva, C.C.; de Paula, S.O. 49 - ENTERIC PATHOGENS SURVIVAL, PERCOLATION AND LEACHING IN BIOFERTILIZED SOILS USING SWINE DIGESTATE Fongaro, G.; García-González, M.C.; Hernández, M.; Kunz, A.; Barardi, C.R.M.; Rodríguez-Lázaro, D. 54 - ROTAVIRUS AND OTHER HUMAN ENTERIC VIRUSES IN GASTROPODS Gularte, J.S.; Staggemeier, R.; Demoliner, M.; Heck, T.M.S.; Heldt, F.H.; Ritzel, R.G.F.; Henzel, A.; Spilki, F.R. 88 - DETECTION AND MOLECULAR CHARACTERIZATION OF GEMYCIRCULARVIRUS FROM ENVIRONMENTAL SAMPLES IN BRAZIL Assis, M.R.S.; Vieira, C.B.; Fioretti, J.M.; Rocha, M.S.; Almeida, P.N.; Miagostovich, M.P.; Fumian, T.M. 177 - ADENOVIRUS INVESTIGATION BY MOLECULAR ANALISYS IN PUBLIC WATER SUPPLY NETWORK Ferreira, C.S.; Sa-Oliveira, J.C.; Resque, R.L.; Ferreira, C.L.; Silva, E.S.; Muller, E.C.A. 229 - CONSTRUCTED WETLANDS AS AN ALTERNATIVE SYSTEM TO REMOVE ENTERIC VIRUSES FROM WASTEWATER Moresco, V.; Magri, M.E.; Sezerino, P.H.; Barardi, C.R.M. 265 - VIRAL STUDY IN UNTREATED AND TREATED SEWAGE WATER Moriya, N.M.N.; Blawid, R.; Silva, J.M.F.; Batista, L.F.; Nagata, T. Session 7 – Basic / Noemi Jaime Room - Chair: Luciana Jesus da Costa 26 - THE ASIAN-AMERICAN VARIANT OF HUMAN PAPILLOMAVIRUS TYPE 16 EXHIBITS HIGHER ACTIVATION• OF MAPK AND PI3K/AKT SIGNALING PATHWAYS, TRANSFORMATION, MIGRATION AND 2:00 - 3:30 P.M. INVASION OF PRIMARY HUMAN KERATINOCYTES Hochmann, J.; Sobrinho, J.S.; Villa, L.L.; Sichero, L. 174 - ACTIVATION AND DEATH PATHWAYS INDUCED BY DENGUE VIRUS IN INFECTED AND BYSTANDER ENDOTHELIAL CELLS Papa, M.P.; Slongo, J.; Arruda, L.B. 192 - SCREENING TESTS TO EVALUATE THE EFFECTIVENESS AND TOXICITY OF TEN ANTIVIRAL DRUG CANDIDATES DEVELOPED BY BIOISOTERISM

Tuesday, September 20 September Tuesday, Fonseca, V.W.P.; Menegatti, R.; Costa, L.J. 205 - THE NON-GLYCOSILATED HRSV PROTEINS M AND N ARE ADDRESSED TO THE VIRAL ASSEMBLY SITE THROUGH THE SECRETORY PATHWAY Cardoso, R.S.; Jesus, B.L.S.; Carvalho, A.N.; Criado, M.; Viana, R.M.M.; Milani, E.R.; Viana, R.M.M.; Prates, M.; Rosales, R.; Ventura, A.M.; Silva, L.L.P.; Arruda, E. 213 - HUMAN TONSIL EXPLANTS SUPPORT RHINOVIRUS INFECTION EX VIVO Martins Junior, R.B.; Gagliardi, T.B.; Criado, M.F.; Cardoso, R.S.; Jesus, B.L.; Silva, M.L.; Carenzi, L.R.; Tamashiro, E.; Valera, F.; Lima, W.; Arruda, E. 243 - DELETION OF THE M SEGMENT NON STRUCTURAL PROTEIN (NSm) OF OROPOUCHE VIRUS AFFECTS VIRUS ASSEMBLY AND THE ARCHITECTURE OF VIRAL FACTORIES Cardoso, R.S.; Barbosa, N.S.; Acrani, G.O.; da Silva, L.L.P.; Arruda, E. Session 8 – Plant and invertebrates / Cavalhadas Room - Chair: Bergmann Ribeiro 6 - TRANSLATIONALLY CONTROLLED TUMOR PROTEIN IS NECESSARY FOR AN EFFICIENT POTYVIRUS REPLICATION• Bruckner, F.P.; Laliberté, J.F.; Alfenas-Zerbini, P. 28 - VIROME IN ORNAMENTAL PLANTS FROM DISTRITO FEDERAL, BRAZIL Brant, P.M.; Nagata, T.; Pereira-Carvalho, R.C. 72 - SEQUENCING OF THE COTTON ANTHOCYANOSIS VIRUS BY SMALL RNA DEEP SEQUENCING AND ITS SIVRNAS PROFILE IN COTTON Santos, R.O.; Fausto, A.K.S.; Andrade, R.; da Franca, T.S.; Giband, M.; Vaslin, M.F.S. 99 - dsRNA DEEP SEQUENCING REVEALS FIVE VIRAL SPECIES IN COMMON BEANS Alves-Freitas, D.M.T.; Melo, F.L.; Faria, J.C.; Ribeiro, S.G. 3:30 - 4:00 P.M. Centro de Convenções Luciano Peixoto Hall CONFERENCE 5 - Microcephaly and Zika Virus / Principal Room Coffee break and visit to exhibits / 3:30 - 5:00 P.M. Paulo Zanotto, USP, São Paulo, Brazil – “Sequencing of Zikavirus from fetuses wit microcephaly in Brazil • XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 TIME ACTIVITY Helio Gelli Pereira Award Oral Presentations / Principal Room Chair: Maurício Lacerda Nogueira Session 9 – Human Virology / Noemi Jaime Room - Chair: Paula Rahal 2• - DETECTION OF THE EMERGING ROTAVIRUS G12P[8] GENOTYPE AT HIGH FREQUENCY IN BRAZIL IN 2014:• SUCCESSIVE REPLACEMENT OF PREDOMINANT STRAINS Luchs, A.; Cilli, A.; Morillo, S.G.; Gregorio, D.S.; Souza, K.A.F.; Vieira, H.R.; Fernandes, A.M.; Carmona, R.C.C.; Timenetsky, M.C.S.T. 35 - PREVALENCE AND VIROLOGICAL CHARACTERISTICS OF HEPATITIS B VIRUS INFECTION AMONG MEN WHO HAVE SEX WITH MEN IN CENTRAL BRAZIL: A RESPONDENT-DRIVEN SAMPLING Oliveira, M.P.; Silva, A.M.C.; Andrade, A.A.; Santana, E.B.R.; Freitas, N.R.; Matos, M.A.D.; Lopes, C.L.R.; Spitz, N.; Araujo, N.M.; Martins, R.M.B. 5:00 - 6:30 P.M. 41 - SAPOVIRUS IN CHILDREN WITH ACUTE GASTROENTERITIS ATTENDED AT HOSPITAL IN GOIÂNIA, GOIÁS Silva, T.N.; Dábilla, N.A.S.; Fiaccadori, F.S.; Cardoso, D.D.P.; Sousa, T.T.; Almeida, T.N.V.; Leite, R.A.; Souza, M. 157 - SEROLOGICAL EVIDENCE OF CIRCULATION OF ALPHAVIRUS (VENEZUELAN EQUINE ENCEPHALITIS VIRUS AND UNA VIRUS) IN PARAGUAYAN POPULATION (2012-2013) Cardozo, F.M.; Konigheim, B.; Albrieu-Llinás, G.; Rivarola, M.E.; Aguilar, J.; Rojas, A.; Páez, M.; Guillén, Tuesday, September 20 September Tuesday, Y.; Diaz, L.A.; Vallejos, M.A.; Herebia, L.; Recalde, M.L.; Contigiani, M.S.; Mendoza, L.P. 212 - HIGH RATES OF DETECTION OF HUMAN RHINOVIRUS AND LACK OF ADENOVIRUS AND BOCAVIRUS SHEDDING IN ASYMPTOMATIC PATIENTS POST TONSILLECTOMY Martins Junior, R.B.; Prates, M.C.M.; Biasoli, B.; Rocha, L.P.; ARAGON, D.C.; Silva, M.L.; Tamashiro, E.; Valera, F.; Lima, W.; Arruda, E. Poster Session 2 and Visit to Exhibits / Centro de Convenções Luciano Peixoto Hall Immunobiologicals Virology; 6:30 - 8:00 P.M. Plant and Invertebrate Virology; • Veterinary Virology • TIME • ACTIVITY CONFERENCE 6 / Principal Room 8:00 - 9:00 A.M. Claudio L. Afonso, USDA, Georgia, United States – “Exotic and emerging avian viral diseases” 9:00 - 9:30 A.M. Centro de Convenções Luciano Peixoto Hall • 9:30 - 12:00 A.M. Principal Room Coffee break and visit to exhibits / Mini-course 1 / Noemi Jaime Room SBV BusinessFernando Meeting Melo / , UNB, Distrito Federal, Brazil - “Next generation sequencing technologies for viral metagenomic analyses” Mini-course• 2 / Cavalhadas Room Antônio Augusto Fonseca Júnior, LANAGRO, Minas Gerais, Brazil - “Viral phylogeny and 12:00 - 1:00 P.M. sequence analysis” Mini-course• 3 / Principal Room Wednesday, September 21 September Wednesday, Vitor Bortolo de Rezende Mini-course 4 / Ita e Alaor Room • Luciana Jesus da Costa, UFRJ,, BD RioBiosciences de Janeiro, - “Uses Brazil of - flow“Viral cytometry replication in mechanism”virology”

•

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 Hélio Gelli Pereira Award

Hélio Gelli Pereira Award PHYLODYNAMICS OF INFLUENZA A(H3N2) IN SOUTH AMERICA, 1999–2012 Born, P.S.; Siqueira, M.M.; Faria, N.R.; Resende, P.C.; Motta, F.C.; Bello, G. CHARACTERIZATION OF NOVEL INTRAGENOTYPE RECOMBINATION EVENTS AMONG NOROVIRUS PANDEMIC GII.4 VARIANTS Siqueira, J.A.M.; Bandeira, R. da S.; Justino, M.C.A.; Linhares, A. da C.; Gabbay, Y.B. DIVERSITYOFBETA-PAPILLOMAVIRUSATANOGENITALANDORALANATOMICSITES

Principal Room OF MEN:THEHIMSTUDY 5:00 p.m - 6:30 p.m 5:00 p.m Nunes, E.M.; Sudenga, S.L.; Gheit, T.; Tommasino, M.; Baggio, M.L.; de Ferreira, S.; Galan, L.; Silva, R.C.; Campbell, C.M.P.; Ponce, E.L.; Giuliano, A.R.; Villa, L.; Sichero, L.

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 Oral Presentation

SESSION 1 – Human Virology HV30 - HEPATIC MIRNA PROFILE IN DENGUE HEMORRHAGIC FEVER AND ASSOCIATION WITH APOPTOSIS REGULATION, VASCULAR INJURY AND INFLAMATION Oliveira, L.F.; Vianez, J.L.G.; Pagliari, C.; Carvalho, L.V.; Silveira, T.S.; Telles, A.L.; Cardoso, J.F.; Vasconcelos, J.M.; Moreira-Nunes, C.A.; Burbano, R.M.R.; Nunes, M.R.T.; Santos, E.J.M. HV179 - MUTATIONS PROFILE IN HIV TRANSCRIPTASE REVERSA AND PROTEASE GENES IN HIV/HBV AND HIV/HCV COINFECTED PATIENTS Grotto, R.M.T.; Cantão, N.M.; Fogaça, L.; Wolf, I.; Almeida, R.; Cruz, A.A.; Barbosa, A.N.; Silva, G.F.; Valente, G.T.; Pardini, M.I.M.C.; Grotto, R.M.T. HV207 - EFFICIENT PRODUCTION OF GP64 FREE HIV-1 VIRUS-LIKE PARTICLES (VLPS) USING BACULOVIRUS

2:00 p.m - 3:30 p.m 2:00 p.m EXPRESSION SYSTEM Chaves, L.C.S.; Ribeiro, B.M.; Blissard, G.W. HV234 - IN SITU EVIDENCE ON INFLUENZA VIRUS INFECTION OF LYMPHOID CELLS IN HUMAN TONSILLAR TISSUES Castro, I.A.; Martins Junior, R.B.; Jesus, B.L.S.; Pontelli, M.C.; Prates, M.C.; Silva, M.L.; Carenzi, L.R.; Tamashiro, E.;

Principal Room - Chair Eurio de Arruda Neto - Chair Eurio Principal Room Anselmo-Lima, W.T.; Arruda, E. SESSION 2 – Veterinary Virology VV9 - RECONSTRUCTION OF THE SPATIAL DISPERSION OF INFECTIOUS BRONCHITIS VIRUS: IBV FINDS ITS ROOTS Saraiva, G.L.; Vidigal, P.M.P.; Pereira, C.G.; Figueiredo, J.F.; Campo, A.J.; Fietto, J.L.R.; Bressan, G.C.; Silva Júnior, A.; Almeida, M.R. VV62 - SYSTEMIC AND MUCOSAL ANTIBODY RESPONSES INDUCED BY A VACCINE OF INACTIVATE AVIAN INFECTIOUS BRONCHITIS VIRUS (IBV) ENCAPSULATED IN CHITOSAN NANOPARTICLES Lopes, P.D.; Okino, C.H.; Casagrande, V.M.; Pavani, C.; Fernando, F.S.; Tamanini, M.L.F.; Montassier, M.F.S.; Lopez, R.F.V.; Montassier, H.J. VV74 - GENOMIC CHARACTERIZATION OF A NOVEL HUMAN INFLUENZA A(H1N2) VARIANT DETECTED IN BRAZIL Resende, P.C.; Born, P.S.; Matos, A.R.; Motta, F.C.; Caetano, B.C.; Debur, M.C.; Riediger, I.; Brown, D.; Siqueira, M.M. VV80 - GENETIC CHARACTERIZATION OF INFLUENZA VIRUSES CIRCULATING WITHIN BRAZILIAN SWINE BETWEEN 2009 AND 2016 Schaefer, R.; Gava, D.; Nelson, M.I.; Haach, V.; Ciacci-Zanella, J.R.; Cantão, M.E.

Monday, September 19 September Monday, VV85 - NEONATAL PIG MORTALITY ASSOCIATED WITH SENECAVIRUS A Gava, D.; Lorenzett, M.P.; Haach, V.; Driemeier, D.; Joshi, L.R.; Mohr, K.A.; Diel, D.G.; Caron, L.; Morés, N.; Morés, M.A.Z.; Schaefer, R. VV143 - BRAZILIAN BATS AS CARRIERS OF VIRUSES WITH ZOONOTIC POTENTIAL Simas, P.V.M.; Barnabé;, A.C.S.; Caserta, L.C.; Martini, M.C.; Durões-Carvalho, R.; Fellippe, P.A.N.; Ferreira-Neto, D.L.; Beck, R.M.; Nascimento, G.M.; Jacomassa, F.A.F.; Moraes, A. P.; Miller, M.E.; Arns, C.W.

João Pessoa Araújo Junior - 2:00 p.m - 3:30 p.m Junior - 2:00 p.m Araújo João Pessoa VV166 - EVALUATION OF SEROLOGICAL AND VIREMIC PROFILE FOR PORCINE CIRCOVIRUS TYPE 2 IN NATURALLY INFECTED PIGS FROM FARROW-TO-FINISH FARMS IN MINAS GERAIS STATE, BRAZIL

Noemi Jaime Room - Chairs: Marcos Bryan Heinemann and Bryan - Chairs: Marcos Noemi Jaime Room Dias, A.S.; Rehfeld, I.S.; Gallinari, G.C.F.; Costa, A.G.; Guedes, M.I.M.C.; Lobato, Z.I.P. SESSION 3 – Basic Virology BV75 - IDENTIFICATION OF CELL PROTEINS THAT INTERACT WITH HUMAN RESPIRATORY SYNCYTIAL VIRUS M2-1 PROTEIN Araujo, C.L.; Eléouët, J.F.; Ventura, A.M. BV79 - TROPOMIOSIN INTERACTION WITH HUMAN RESPIRATORY SYNCYTIAL VIRUS MATRIX PROTEIN Dias, T.D.; Oliveira, A.P.; Ogawa, J.K.; Eléouët, J.F.; Ventura, A.M. BV168 - EVALUATION OF APOPTOTIC MECHANISMS MEDIATED BY UNFOLDED PROTEIN RESPONSE PATHWAY IN JURKAT CELLS STIMULATED WITH HIV-1 TAT PROTEIN Campestrini, J.; Costa-Junior, A.O.; Pinto, A.R. BV214 - RESPIRATORY SYNCYTIAL VIRUS MRNA TRANSCRIPTOME REVEALS SURPRISING PROFILES DURING ONE- STEP REPLICATION CYCLE da Silva - 2:00 p.m - 3:30 p.m - 2:00 p.m da Silva Jesus, B.L.S.; Cardoso, R.S.; Criado, M.F.; Souza, M.M.; Oliveira, A.S.; Prates, M.C.M.; Ventura, A.M.; Arruda, E. BV215 - OROPOUCHE VIRUS ASSEMBLY IN MAMMALIAN CELLS REQUIRES THE ACTIVITY OF HOST ESCRT PROTEINS

IIta e Alaor Room - Chair: Luis Lamberti Pinto - Chair: Luis Lamberti Pinto IIta e Alaor Room Barbosa, N.S.; Mendonca, L.L.R.; Criado, M.; Arruda, E.; da Silva, L.L.P.

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 SESSION 4 – Plant and Invertebrates Virology PIV102 - MOLECULAR CHARACTERIZATION OF GRAPEVINE ENAMO-LIKE VIRUS, A NOVEL PUTATIVE MEMBER OF THE GENUS ENAMOVIRUS Silva, J.M.F.; Fajardo, T.V.M.; Al Rwahnih, M.; Blawid, R.; Nagata, T. PIV117 - IDENTIFICATION AND FUNCTIONAL ANALYSES OF THE COTTON BLUE DISEASE RESISTANCE LOCUS Fausto, A.K.S.; Moura, M.O.; da Franca, T.S.; Romanel, E.; Vaslin, M.F.S. PIV118 - DICER-LIKE PROFILE EXPRESSION DURING VIRAL INFECTION IN SUSCEPTIBLE AND RESISTANT COTTON Moura, M.O.; Fausto, A.K.S.; da Franca, T.S.; Romanel, E.; Vaslin, M.F.S. PIV175 - ARRACACIA XANTHORRIZA (MANDIOQUINHA-SALSA): A RESERVOIR OF PLANT VIRUS Orílio, A.F.; Inoue-Nagata, A.K.; Nagata, T.; Madeira, N.R.; Resende, R.O.; Blawid, R. PIV209 - THE COMPLETE GENOME SEQUENCE OF A NOVEL BETABACULOVIRUS ISOLATED FROM MOCIS SP. REVEALS Monday, September 19 September Monday, AN ANCIENT GENOME EXPANSION AND A TENDENCY IN NOCTUIDINFECTING BETABACULOVIRUS Ardisson-Araújo, D.M.P.; Melo, F.L.; Sosa-Gómez, D.R.; Ribeiro, B.M.

Tatsuya Nagata - 2:00 p.m - 3:30 p.m - 2:00 p.m Nagata Tatsuya PIV244 - STUDY OF BEGOMOVIRUS DIVERSITY IN TOMATO PLANTS USING NEXT-GENERATION

Cavalhadas Room - Chairs: Alice Nagata and Nagata - Chairs: Alice Room Cavalhadas SEQUENCING Rêgo, C.M.; Nakasu, E.Y.T.; Blawid, R.; Nagata, T.; Inoue-Nagata, A.K. SESSION 5 – Human Virology HV11 - INCREASED PRO-INFLAMMATORY CYTOKINES IN AMNIOTIC FLUID FROM ZIKA VIRUS ASSOCIATED MICROCEPHALY Ornelas, A.M.M.; Pezzuto, P.; Silveira, P.P.; Melo, F.O.; Ferreira, T.A.; Oliveira-Szejnfeld, P.S.; Leal, J.I.; Amorim, M.M.R.; Cardoso, C.C.; Nixon, D.F.; Tanuri, A.; Melo, A.S.; Aguiar, R.S. HV156 - ACTIVATION OF INTRINSIC COAGULATION PATHWAY AND LIPID METABOLISM IN DENGUE VIRUS PATHOGENESIS Coelho, S.V.A.; Vellasco, L.; Marques, J.R.E.T.A.; Scharfstein, J.; Arruda, L.B. HV206 - IDENTIFICATION AND SELECTION OF DENGUE VIRUS SPECIFIC PEPTIDES FOR DIFFERENTIAL DIAGNOSTIC TESTS Versiani, A.F.; Mendes, T.A.O.; Bartholomeu, D.C.; Nogueira, M.L.; da Fonseca, F.G. HV254 - SALIVA AS THE BIOLOGICAL SAMPLE OF CHOICE FOR THE MOLECULAR DIAGNOSIS OF ZIKA Monteiro, D.C.S.; Mejía, M.C.C.; Abdalla, L.F.; Santos. J.H.A.; Almeida, T.P.A.; Corado, A.L.G.; Souza, V.C.; Nascimento, V.A.; Naveca, 2:00 p.m - 3:30 p.m 2:00 p.m F.G. HV256 - ETIOLOGY OF THE ACUTE FEBRILE ILLNESS IN THE AMAZON STATE BRAZIL, DURING THE EMERGENCE OF ZIKA VIRUS Nascimento, V.A.; Monteiro, D.C.S.; Silva, M.S.; Souza, V.C.; Corado, A.L.G.; Naveca, F.G.

Principal Room - Chair: Eurico de Arruda Neto - Chair: Eurico Principal Room HV258 - SOROPREVALENCE DENGUE IGG IN PATIENTS IN A PROSPECTIVE COHORT STUDY OF SÃO JOSÉ DO RIO PRETO Silva, R.A.; Silva, G.C.D.; Zini, N.; Kanazawa, T.; Estofolete, C.F.; Watanabe, A.S.A.; Terzian, A.C.B.; Nogueira, M.L. SESSION 6 – Environmental Virology EV14 CORROSION AND BIOFILM REDUCED BY ECOPHAGES IN A PILOT ANAEROBIC SYSTEM Dias, R.S.; Oliveira, M.D.; Silva, J.D.; Bicalho, K.M.; Sousa, M.P.; Santos, V.V.C.M.; Silva, E.D.; Akamine, R.N.; Silva, C.C.; de Paula, S.O. Tuesday, September 20 September Tuesday, EV49 - ENTERIC PATHOGENS SURVIVAL, PERCOLATION AND LEACHING IN BIOFERTILIZED SOILS USING SWINE DIGESTATE Fongaro, G.; García-González, M.C.; Hernández, M.; Kunz, A.; Barardi, C.R.M.; Rodríguez-Lázaro, D. EV54 - ROTAVIRUS AND OTHER HUMAN ENTERIC VIRUSES IN GASTROPODS Gularte, J.S.; Staggemeier, R.; Demoliner, M.; Heck, T.M.S.; Heldt, F.H.; Ritzel, R.G.F.; Henzel, A.; Spilki, F.R. EV88 - DETECTION AND MOLECULAR CHARACTERIZATION OF GEMYCIRCULARVIRUS FROM ENVIRONMENTAL SAMPLES IN BRAZIL Assis, M.R.S.; Vieira, C.B.; Fioretti, J.M.; Rocha, M.S.; Almeida, P.N.; Miagostovich, M.P.; Fumian, T.M.

2:00 p.m - 3:30 p.m 2:00 p.m EV177 - ADENOVIRUS INVESTIGATION BY MOLECULAR ANALISYS IN PUBLIC WATER SUPPLY NETWORK Ferreira, C.S.; Sa-Oliveira, J.C.; Resque, R.L.; Ferreira, C.L.; Silva, E.S.; Muller, E.C.A. EV229 - CONSTRUCTED WETLANDS AS AN ALTERNATIVE SYSTEM TO REMOVE ENTERIC VIRUSES FROM WASTEWATER Moresco, V.; Magri, M.E.; Sezerino, P.H.; Barardi, C.R.M. Ita e Alaor Room - Chair: Célia R. M. Barardi - Chair: Célia Ita e Alaor Room EV265 - VIRAL STUDY IN UNTREATED AND TREATED SEWAGE WATER Moriya, N.M.N.; Blawid, R.; Silva, J.M.F.; Batista, L.F.; Nagata, T.

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 SESSION 7 – Basic Virology BV26 - THE ASIAN-AMERICAN VARIANT OF HUMAN PAPILLOMAVIRUS TYPE 16 EXHIBITS HIGHER ACTIVATION OF MAPK AND PI3K/AKT SIGNALING PATHWAYS, TRANSFORMATION, MIGRATION AND INVASION OF PRIMARY HUMAN KERATINOCYTES Hochmann, J.; Sobrinho, J.S.; Villa, L.L.; Sichero, L. BV174 - ACTIVATION AND DEATH PATHWAYS INDUCED BY DENGUE VIRUS IN INFECTED AND BYSTANDER ENDOTHELIAL CELLS Papa, M.P.; Slongo, J.; Arruda, L.B. BV192 - SCREENING TESTS TO EVALUATE THE EFFECTIVENESS AND TOXICITY OF TEN ANTIVIRAL DRUG CANDIDATES DEVELOPED BY BIOISOTERISM Fonseca, V.W.P.; Menegatti, R.; Costa, L.J.

- 3:30 p.m BV205 - THE NON-GLYCOSILATED HRSV PROTEINS M AND N ARE ADDRESSED TO THE VIRAL ASSEMBLY SITE THROUGH THE SECRETORY PATHWAY Cardoso, R.S.; Jesus, B.L.S.; Carvalho, A.N.; Criado, M.; Viana, R.M.M.; Milani, E.R.; Viana, R.M.M.; Prates, M.; Rosales, R.; Ventura, A.M.; Silva, L.L.P.; Arruda, E. BV213 - HUMAN TONSIL EXPLANTS SUPPORT RHINOVIRUS INFECTION EX VIVO Martins Junior, R.B.; Gagliardi, T.B.; Criado, M.F.; Cardoso, R.S.; Jesus, B.L.; Silva, M.L.; Carenzi, L.R.; Tamashiro, E.; Valera, F.; Lima, W.; Arruda, E. BV243 - DELETION OF THE M SEGMENT NON STRUCTURAL PROTEIN (NSM) OF OROPOUCHE VIRUS AFFECTS VIRUS ASSEMBLY AND THE ARCHITECTURE OF VIRAL FACTORIES

Noemi Jaime Room - Chair: Luciana Jesus da Costa - 2:00 p.m - 2:00 p.m - Chair: Luciana Jesus da Costa Noemi Jaime Room Cardoso, R.S.; Barbosa, N.S.; Acrani, G.O.; da Silva, L.L.P.; Arruda, E. SESSION 8 – Plant and invertebrates Virology PIV6 - TRANSLATIONALLY CONTROLLED TUMOR PROTEIN IS NECESSARY FOR AN EFFICIENT POTYVIRUS REPLICATION Bruckner, F.P.; Laliberté, J.F.; Alfenas-Zerbini, P. PIV28 - VIROME IN ORNAMENTAL PLANTS FROM DISTRITO FEDERAL, BRAZIL Brant, P.M.; Nagata, T.; Pereira-Carvalho, R.C. PIV72 - SEQUENCING OF THE COTTON ANTHOCYANOSIS VIRUS BY SMALL RNA DEEP SEQUENCING AND ITS SIVRNAS

Tuesday, September 20 September Tuesday, PROFILE IN COTTON Santos, R.O.; Fausto, A.K.S.; Andrade, R.; da Franca, T.S.; Giband, M.; Vaslin, M.F.S. Ribeiro2:00 p.m - 3:30 p.m p.m Ribeiro2:00 PVI99 - DSRNA DEEP SEQUENCING REVEALS FIVE VIRAL SPECIES IN COMMON BEANS Cavalhadas Room - Chair: Bergmann - Chair: Bergmann Room Cavalhadas Alves-Freitas, D.M.T.; Melo, F.L.; Faria, J.C.; Ribeiro, S.G. SESSION 9– Human Virology HV2 - DETECTION OF THE EMERGING ROTAVIRUS G12P[8] GENOTYPE AT HIGH FREQUENCY IN BRAZIL IN 2014: SUCCESSIVE REPLACEMENT OF PREDOMINANT STRAINS Luchs, A.; Cilli, A.; Morillo, S.G.; Gregorio, D.S.; Souza, K.A.F.; Vieira, H.R.; Fernandes, A.M.; Carmona, R.C.C.; Timenetsky, M.C.S.T. HV35 - PREVALENCE AND VIROLOGICAL CHARACTERISTICS OF HEPATITIS B VIRUS INFECTION AMONG MEN WHO HAVE SEX WITH MEN IN CENTRAL BRAZIL: A RESPONDENT-DRIVEN SAMPLING Oliveira, M.P.; Silva, A.M.C.; Andrade, A.A.; Santana, E.B.R.; Freitas, N.R.; Matos, M.A.D.; Lopes, C.L.R.; Spitz, N.; Araujo, N.M.; Martins, R.M.B. HV41 - SAPOVIRUS IN CHILDREN WITH ACUTE GASTROENTERITIS ATTENDED AT HOSPITAL INGOIÂNIA, GOIÁS Silva, T.N.; Dábilla, N.A.S.; Fiaccadori, F.S.; Cardoso, D.D.P.; Sousa, T.T.; Almeida, T.N.V.; Leite, R.A.; Souza, M.

p.m - 3:30 p.m p.m HV157 - SEROLOGICAL EVIDENCE OF CIRCULATION OF ALPHAVIRUS (VENEZUELAN EQUINE ENCEPHALITIS VIRUS AND UNA VIRUS) IN PARAGUAYAN POPULATION (2012-2013) Cardozo, F.M.; Konigheim, B.; Albrieu-Llinás, G.; Rivarola, M.E.; Aguilar, J.; Rojas, A.; Páez, M.; Guillén, Y.; Diaz, L.A.; Vallejos, M.A.; Herebia, L.; Recalde, M.L.; Contigiani, M.S.; Mendoza, L.P. HV212 - HIGH RATES OF DETECTION OF HUMAN RHINOVIRUS AND LACK OF ADENOVIRUS AND BOCAVIRUS SHEDDING IN ASYMPTOMATIC PATIENTS POST TONSILLECTOMY lhadas Room - Chair: Bergmann Ribeiro - 2:00 Ribeiro - Chair: Bergmann lhadas Room Martins Junior, R.B.; Prates, M.C.M.; Biasoli, B.; Rocha, L.P.; Aragon, D.C.; Silva, M.L.; Tamashiro, E.; Valera, F.; Lima, W.; Arruda, E.

XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology, Pirenópolis, Goiás, Brazil Virus Reviews & Research Vol 20 (2), August-December 2016 HELIO GELLI PEREIRA AWARD XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazill

16 Helio Gelli Pereira Award

PHYLODYNAMICS OF INFLUENZA A(H3N2) IN SOUTH CHARACTERIZATION OF NOVEL INTRAGENOTYPE AMERICA, 1999–2012 RECOMBINATION EVENTS AMONG NOROVIRUS Born, P.S.; Siqueira, M.M.; Faria, N.R.; Resende, P.C.; PANDEMIC GII.4 VARIANTS Motta, F.C.; Bello, G. Siqueira, J.A.M.; Bandeira, R. da S.; Justino, M.C.A.; Linhares, A. da C.; Gabbay, Y.B. 1. Respiratory Viruses and Measles Laboratory, Oswaldo Cruz Institute/Fiocruz, Av. Brasil 4365, 21040-360 Rio de Janeiro, RJ, Brazil Recently, there has been an increase in the number 2. Department of Zoology, University of Oxford, South of children hospitalized due to norovirus infection Parks Road, Oxford OX1 3PS, United Kingdom in Brazil. This is due both to the occurrence of more 3. AIDS and Molecular Immunology Laboratory, severe norovirus-related gastroenteritis cases after the Oswaldo Cruz Institute/Fiocruz, Av. Brasil 4365, introduction of the rotavirus vaccine and an increase in 21040-360 Rio de Janeiro, RJ, Brazil the tools for the detection of the disease. This pathogen is transmitted by the fecal-oral route, and the illness is characterized by diarrhea, vomiting, nausea and from the Southern Hemisphere (particularly from abdominal cramps. The genome of the virus is organized AfricaThe limited and Latin influenza America), A(H3N2) constrains genetic datathe availableaccurate into three open reading frames showing strong mutation reconstruction of viral dissemination dynamicswithin rates. Additionally, homologous recombination events, those regions. Our objective was to describe the spatial which can increase the virulence of the virus and lead to genotyping mistakes in molecular epidemiological South America. A total of 469 sequences of the HA1 dissemination dynamics of influenza A(H3N2) within studies, frequently occur. The purpose of this study was to describe two recombination events among different GII.4 A(H3N2) viruses sampled in temperate and tropical variants that infected children who were hospitalized Southportion American of the hemagglutinin countries between gene 1999 (HA) and frominfluenza 2012 were for severe acute gastroenteritis during distinct periods combined with available contemporary sequences from of time in Belém, Brazil. The recombination among the Australia, Hong Kong, United Kingdom and the United Yerseke_2006a were observed in May 2003 and February A(H3N2) sequences from South America were highly 2009,variants respectively. US95_96/Kaiso_2003 In both cases, andthe association Den Haag_2006b/ between intermixedStates. Phylogenetic with sequences analyses from revealed other that geographical influenza the dominant variant at that point in time and another regions, although a clear geographic virus population that was circulating at a low frequency in the population of Belém was demonstrated. Interestingly, the position of the breakpoint of the recombination event in the Southstructure American was detected countries. globally. Bayesian We identified phylogeographic 14 clades mostly (≥80%) composed of influenza sequences from genome was the polymerase gene and was located at the nucleotide positions 4.834 and 5.002, which is an temperate and tropical regions in the introduction and analyses of those clades support a significant role of both unusual location for the occurrence of recombination as other studies have previously reported the junction South America and identify an intensive bidirectional region as a breakpoint. In this study, both recombinant viraldissemination exchange of between new influenza different A(H3N2) geographical strains withinareas. variant strains were related to severe cases of diarrhea that lead to hospitalization, demonstrating the viral A(H3N2) epidemics in South America are seeded by evolution of GII.4 in response to selective pressures, bothThese the findings continuous indicate importation that seasonal of viral influenzavariants which ultimately lead to the emergence of novel viral from other geographic regions and the short-term types in the pediatric population. The cases discussed persistence of local lineages. This study also supports here reinforce the need for continuous norovirus surveillance. To our knowledge, these two GII.4 variant dissemination in South America,with no preferential directiona complexmetapopulation in viral movement model between of influenza temperate A(H3N2) and tropical regions.

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Helio Gelli Pereira Award XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazill

17 Helio Gelli Pereira Award

DIVERSITY OF BETA-PAPILLOMAVIRUS AT ANOGENITAL AND ORAL ANATOMIC SITES OF MEN: THE HIM STUDY Nunes, E.M.; Sudenga, S.L.; Gheit, T.; Tommasino, M.; Baggio, M.L.; de Ferreira, S.; Galan, L.; Silva, R.C.; Campbell, C.M.P.; Ponce, E.L.; Giuliano, A.R.; Villa, L.; Sichero, L. anatomic site samong 717 men from Brazil, Mexico and USOur enrolledgoal was into thedescribe HPV prevalenceInfectionin ofMen(HIM) β-HPVs at Study.three

β-HPVs were genotype dusing Luminex technology. Overall, 77.7%, 54.3% and 29.3% men were positive for any β-HPV atthegenitals, analcanal, and oralcavity, respectively. Men from US and Brazil were significantly atless the like anal lyto canal have compared β-HPV atto theyounger anal men. canal Prevalence than men from Mexico. Older men were more like lytohave β-HPV with country of origin and age. Currents mokers were of β-HPV at the oral cavity was significantly associated than men who never smoked. Lack of associations significantly less like lytohave β-HPV in the oral cavity routes of contact such as auto inoculation which need to bebetween explored β-HPV further. and sexual behaviors may suggest other

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Helio Gelli Pereira Award ORAL PRESENTATION XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

19 Oral Presentation

HV30 - HEPATIC MIRNA PROFILE IN DENGUE analysis of KEGG pathways and GO terms with predicted HEMORRHAGIC FEVER AND ASSOCIATION WITH target genes of over expressed miRNA found regulatory APOPTOSIS REGULATION, VASCULAR INJURY AND pathways of apoptosis and immune response, involving INFLAMATION MAPK gene, RAS, CDK and FAS; immune response Oliveira, L.F.; Vianez, J.L.G.; Pagliari, C.; Carvalho, L.V.; pathways showed NF- kB, CC and CX families, IL and TLR. Silveira, T.S.; Telles, A.L.; Cardoso, J.F.; Vasconcelos, The same analysis with target genes of downregulated J.M.; Moreira-Nunes, C.A.; Burbano, R.M.R.; Nunes, M.R.T.; Santos, E.J.M. and biosynthetic pathways of metabolism. In our miRNAs also identified in most pathways of apoptosis 1. INSTITUTO EVANDRO CHAGAS 2. UNIVERSIDADE DE SÃO PAULO knowledge, this is the first description of the liver 3. FUNDAÇÃO ONCOCENTRO DE SÃO PAULO feasible relationship of miR-126-5p, miR-122-5p and miRNA profile in DHF, the results together show a 4. FACULDADE DE MEDICINA DE SÃO JOSÉ DO miR-146a-5p with liver pathogenesis of DHF, through RIO PRETO endothelial repair and vascular permeability regulation, 5. UNIVERSIDADE FEDERAL DO PARÁ control of homeostasis and liver expression regulation 6. UNIVERSIDADE FEDERAL DO CEARÁ

Dengue is the most prevalent arbovirosis in the world ofHV179 inflammatory - MUTATIONS cytokines. PROFILE IN HIV TRANSCRIPTASE caused by Dengue virus (DENV) and is present in all REVERSA AND PROTEASE GENES IN HIV/HBV AND continents, for more than three decades has been a HIV/HCV COINFECTED PATIENTS constant public health concern and often fatal by dengue Grotto, R.M.T.; Cantão, N.M.; Fogaça, L.; Wolf, I.; hemorrhagic fever (DHF). The pathogenesis of dengue Almeida, R.; Cruz, A.A.; Barbosa, A.N.; Silva, G.F.; is closely related to the host immune response, reaching Valente, G.T.; Pardini, M.I.M.C. All tissues are affected, which liver is one of the most UNIVERSIDADE ESTADUAL PAULISTA importantexacerbated in inflammation severe conditions, and transient due its autoimmunity. intense viral The use of antiretroviral combinations has demonstrated highly effectiveness in controlling of the progression study of microRNAs (miRNA) as regulatory elements of HIV infection and increased of the patients’ survival ofreplication metabolism and and its significantimmune response role in metabolism.during infection The Although in the last years several advances have been is crucial to understanding the regulatory mechanisms achievement in the antiHIV therapeutic these drugs can of gene expression on DENV infection, and can help be have yours activities reduced due to development in diagnostic development of anti-viral therapies. We of drug resistance. HIV drug resistance is consequence sequenced the miRNoma in MiSeq platform (Illumina) to of the mutations in genes that encodes viral enzymes, representing the major obstacle to successful therapeutic. The resistance mutations in reverse transcriptase (RT) identify the miRNA profile expressed in formalin-fixed and protease (PR) genes have already been described expressionparaffin-embedded analysis (FFPE)performed liver in tissue. edgeR, Ten followed DHF fatal by and there are several laboratory tests to detected them. targetcases were gene compared prediction to infive TargetScan control cases and by enrichment differential However, all tests and algorithms to interpretation of analysis of functional pathways in DAVID v6.7, this the test\’s results are based in information obtained results were visualized in a gene-pathway network from HIV monoinfected patients. In the moment there built in Cytoscape. Eight miRNAs exhibited differential are no studies about the HIV RT and PR resistance expression in DHF FFPE liver, miR-126-5p (logFC = 3,09; mutations in patients coinfected with hepatotropic FDR = 0,00675), a regulatory molecule of endothelial virus, mainly, Hepatitis B Virus (HBV) and Hepatitis C cells, and miR-133a-3p are up regulated in dengue. The Virus (HCV). Then, the goal of this study was evaluate others miRNA were down regulated in DHF: miR-122- miRNA, miR-146a-5p, interferon regulator, miR-10b-5p, specializedgenetic sequences health thatservices encoded in Botucatu HIV RT andcity, PR Sao in Paulo HIV/ miR-204-5p,5p (logFC = -6,59;miR-148a-5p FDR < 0,00000001),and miR-423-5p. a liver-specific Functional State,HBV and/or Brazil. HIV/HCV Samples coinfectedfrom 86 patients patients infected assisted by in HIV the

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

20 Oral Presentation were included in this study. The patients were divided particles. Since VLPs are usually produced for vaccine in two groups: G1 (52 patients HIV monoinfected) and development, the contamination with other virus particles or immunogenic proteins is a concern. In this patients). RNA or DNA viral isolated from plasma was work, we showed that VLP and BV particles cannot be usedG2 (34 as patientssource to HIV/HBV genotyped and/or the HIV HIV/HCV RT and coinfected PR genes separated by ultracentrifugation in sucrose gradient. using automatic sequencing. The consensus sequence Thus, to block BV production during VLP assembly, a obtained were analyzed using the Genotypic Resistance recombinant baculovirus containing the gag HIV1 gene Interpretation Algorithm of Stanford University (HIVdb) but lacking the baculovirus gp64 gene (vGAGHIV1 GP64 and the subtyping was performed by REGA HIV1 null) was constructed. This recombinant baculovirus Subtyping Tool and by RIP 3.0 program. The sequences was then used to infect Sf9 cells and shown to correctly were used to generated phylogenetic trees using produce HIV1 VLPs without BVs particles. GP64 protein SeaView. The results showed that although G1 presented more resistant\’s mutations than G2 the mutations\’ deletion of the gp64 gene. Furthermore, the presence ofwas the not GAG detected protein in was these detected cells, confirmingand it was thepossible correct to phylogenetic trees showed clusters of the sequences see HIV1 VLPs produced from cells infected with this profile in G1 and G2 was similar. On the other hand, the GP64 defective recombinant virus. Therefore, this work separated of the clusters built from HIV monoinfected sequences.from coinfected These patients results (HIV/HBVsuggest that and the HIV/HCV) hepatotropic well in insect cells without the contamination of baculovirus virus presence seems to be provided selective pressure BVdescribes, particles for or the proteins. first time, a new way of producing VLPs in HIV strains. HV234 - IN SITU EVIDENCE ON INFLUENZA VIRUS HV207 - EFFICIENT PRODUCTION OF GP64 FREE INFECTION OF LYMPHOID CELLS IN HUMAN HIV-1 VIRUS-LIKE PARTICLES (VLPS) USING TONSILLAR TISSUES BACULOVIRUS EXPRESSION SYSTEM Castro, I.A.; Martins Junior, R.B.; Jesus, B.L.S.; Pontelli, Chaves, L.C.S.; Ribeiro, B.M.; Blissard, G.W. M.C.; Prates, M.C.; Silva, M.L.; Carenzi, L.R.; Tamashiro, 1. UNIVERSIDADE DE BRASÍLIA E.; Anselmo-Lima, W.T.; Arruda, E. 2. BOYCE THOMPSON INSTITUTE, CORNELL RIBEIRAO PRETO MEDICINE SCHOOL, UNIVERSITY UNIVERSITY OF SAO PAULO Virus like particles (VLPs) are composed of viral capsid proteins that selfassemble into particles resembling episodes of seasonal acute respiratory infections natural virions. The baculovirus expression vector (ARI)Influenza and virusesapproximately cause more 500,000 than twodeaths million worldwide. annual system (BEVS) is a powerful tool that has been widely Evidence from several models indicate that depending on virus strain and host immune status, acute infections VLPs samples from insect cells are known for being contaminatedused to produce with VLPs baculovirus in insect cells. Budded However, virus purified (BV) than the respiratory tract, such as kidneys, intestines, particles. Besides that, these VLPs can have some mucosalby seasonal lymphoid influenza tissues A and virus lymph may nodes. reach Infection sites other of host insect proteins expressed on their surface. The enveloped VLPs assembly depends on the capsid (or that these cells could represent potential sites of matrix) formation and then membrane enclosure for lymphoid cells by influenza virus raises the possibility budding from a host cell membrane. Through this virus nucleic acids and antigens were searched for in mechanism, enveloped VLPs can incorporate host tissuespersisting of palatine infection. tonsils In the and present adenoids study removed influenza from A proteins, which is the case of the baculovirus envelope 102 patients who underwent surgery for tonsillar protein GP64 that is expressed on the surface of hypertrophy, in the absence of ARI symptoms. A qRTPCR insect cells during the baculovirus infection. During screening revealed that tonsillar tissues from 7 of 102 budding of BV and enveloped VLPs, the GP64 protein is captured and displayed on the surface of these patients (6.9%) were positive for influenza A virus. Of Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersthose, formalin - Oral Presentationfixed, paraffin embedded tonsillar tissues XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

21 Oral Presentation were analyzed by immunohistochemistry with antibody and reconstructing its dispersion pattern. This analysis was conducted in the Beast software version 2.2.1 with staining was seen in tissue sections from 6 patients: 4 50,000,000 generations and sampling frequency of adenoidsto the influenza and 3 palatine A virus tonsils. nucleoprotein Staining was (NP). observed Strong 1,000. Parameter convergence was analyzed using Tracer mostly on epithelia, both on the surface and within the crypts, but also in interfollicular lymphoid cells. Serial to produce the consensus tree using TreeAnnotator immunoperoxidase labeling and erasing (SIMPLE) of version 2.2.1 and 10% of generated trees were discarded loaded into the Spread application to generate a kml infection of epithelial cells. Interestingly, staining with version 2.2.1. The consensus tree file generated was antibodiestissue sections to CD3, with CD4, antibodies CD8, CD11c to cytokeratin and CD14 confirmed strongly the graphs of the IBV dispersion patterns over time. The indicated that CD3+CD8+ lymphocytes and CD11c+CD14 format file that was then read by Google Earth to obtain

latestresults events indicate of IBVthat evolution.analysis of Therefore, the N gene an may integrated reflect bloodcells could mononuclear harbor influenza cells from virus. healthy To confirm donors T CD8+were studythe earliest of these events genes and may analysis be a useful of the tool S1 gene for the reflects analysis the lymphocyte susceptibility to influenza virus, peripheral of full evolutionary history of the IBV. Our hypothesis is that the point of origin of all current strains of IBV may Furtherinfected investigation with Influenza is Aunderway H1N1(2009) to understand and the results the be China. After dispersion throughout Asia, IBV reached comfirmed the in situ findings on tonsil tissue sections. the United States and dispersed from there to different cells on human tonsils removed from people in the continents, ultimately achieving worldwide distribution. absencemeaning of of symptoms influenza of A acute virus respiratory detection ininfections, lymphoid a This hypothesis is consistent with the theory of virus– host coevolution, since previous researches suggest that domesticated birds were taken from a single center of transmissionfinding that suggestsin the community. that human hypertrophic tonsils domestication in Asia to various locations, with dispersal may be reservoirs of influenza virus for shedding and VV9 - RECONSTRUCTION OF THE SPATIAL DISPERSION of poultry are associated with bones found in China. OF INFECTIOUS BRONCHITIS VIRUS: IBV FINDS ITS routes converging in the Americas; and oldest traces ROOTS anthropic action on the dispersion of animal infectious Saraiva, G.L.; Vidigal, P.M.P.; Pereira, C.G.; Figueiredo, agentsThis study around also the highlights world. a significant influence of the J.F.; Campo, A.J.; Fietto, J.L.R.; Bressan, G.C.; Silva Júnior, A.; Almeida, M.R. UNIVERSIDADE FEDERAL DE VIÇOSA Infectious bronchitis virus (IBV) is a Coronavirus associated with a highly contagious disease that primarily affects the upper respiratory tract of chickens, in addition to the epithelial cells of the urogenital and

IBV has achieved worldwide distribution, becoming endemicgastrointestinal in most tracts. chicken Sinceproducing its identification countries. in This the 1930s, study aimed to reconstruct the IBV spatial dispersal routes, through phylogeography analysis in order to understand biological events along the evolutionary history of IBV. The databases included 256 and 142 complete sequences of S1 and N genes, respectively, obtained from GenBank from 24 countries. The Relaxed Random Walk (RRW) method was used to test hypotheses about the spatial dispersion of the IBV, inferring, visualizing

22 Oral Presentation

VV62 - SYSTEMIC AND MUCOSAL ANTIBODY RESPONSES or oil adjuvant (L+Oil) developed higher levels of anti INDUCED BY A VACCINE OF INACTIVATE AVIAN IBV IgG antibodies in serum and tear samples, either in INFECTIOUS BRONCHITIS VIRUS (IBV) ENCAPSULATED pre and postchallenge periods, and there was a marked IN CHITOSAN NANOPARTICLES increase in IgG levels at 11 dpi compared to other groups. Lopes, P.D.; Okino, C.H.; Casagrande, V.M.; Pavani, C.; The tear antiIBV IgA levels were higher at 5 dpi in chicks Fernando, F.S.; Tamanini, M.L.F.; Montassier, M.F.S.; vaccinated with nanoparticle vaccine (Nano) compared Lopez, R.F.V.; Montassier, H.J. to L+Oil and NC chicks groups. Additionally, IgA reached the highest levels at 11 dpi in PC, Nano, L+Nano and L+Oil 1. FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS, UNIVERSIDADE ESTADUAL groups when compared to the NC group. In conclusion, PAULISTA, CAMPUS JABOTICABAL the nanoparticle vaccine administered by oculonasal 2. EMPRESA BRASILEIRA DE PESQUISA route was capable to induce high levels of mucosal and AGROPECUÁRIA systemic antibody responses and the nanoparticles 3. FACULDADE DE CIÊNCIAS FARMACÊUTICAS, of chitosan prove to be a potent mucosal adjuvant for UNIVERSIDADE DE SÃO PAULO, CAMPUS mass use in veterinary vaccines due to their easier RIBEIRÃO PRETO administration and non invasiveness.

Relevant vaccine failures are favoring the continuous VV74 - GENOMIC CHARACTERIZATION OF A NOVEL occurrence of outbreaks of IBV infection in Brazil. HUMAN INFLUENZA A(H1N2) VARIANT DETECTED The most likely reason is the low effectiveness of the IN BRAZIL available commercial vaccines to confer crossimmunity Resende, P.C.; Born, P.S.; Matos, A.R.; Motta, F.C.; against the emerging IBV variants. Another constraint is Caetano, B.C.; Debur, M.C.; Riediger, I.; Brown, D.; related to the inability of the current inactivated vaccines Siqueira, M.M. to provide a strong activation of immune responses at the respiratory mucosa that is the primary site of 1. INSTITUTO OSWALDO CRUZ FIOCRUZ IBV infection. Thus, the objective of this study was to 2. LABORATÓRIO CENTRAL DO ESTADO DO evaluate the systemic and mucosal antibody responses induced by an inactivated vaccine formulated with a BR human, avian and especially swine populations over variant IBV encapsulated in chitosan nanoparticles and theInfluenza years. A(H1N2)In contrast virus to the has widespread been described circulation to infect of administered to SPF chicks, by oculonasal route, and comparing the antibody responses with those induced subtype has been observed sporadically in humans. In by a conventional inactivated vaccine prepared with thisseasonal study, H1N1 we report and H3N2 the detection influenza and A viruses, characterization the H1N2 oil adjuvant, administered intramuscularly. A set of of a H1N2 variant (H1N2v) strain with a genomic 160 SPF chicks, divided into six groups was used. Four combination not previously reported in humans. The groups of chicks were vaccinated with different vaccine protocols, associating or not with a previous dose of a nasopharyngeal aspirate collected on November 26th, attenuated live vaccine (strain H120). Four weeks later, 2015,virus A/Parana/720/2015 from a 16 years old female (H1N2v) patient was from identified a rural from area the chicks were challenged with the homologous strain. from Castro city, Paraná, located in the Southern region of Brazil. Castro has approximately 67,000 inhabitants and a strong agricultural center for dairy cattle, poultry unimmunized).Two other groups Serum were and kept tear as samples positive were control collected (PC; and pigs. The patient did not present any risk factor for ofinfected chickschicks) at one and day negative before infection control (NC; and uninfected at 1, 5 and and 11 days postinfection (dpi). The levels of anti IBV IgG were symptoms on November 23rd, 2015. Direct contact with measured in tear and serum samples and the levels of pigsinfluenza was not and reported had influenza in the epidemiological like illness with investigation an onset of antiIBV IgA were measured only in tear samples, using the sandwichELISAconcanavalin A technique. The chicks her clinical outcome was uneventful and no antiviral vaccinated with live attenuated vaccine followed by treatmentform. She did was not necessary. receive previous Basic Local anti Alignmentinfluenza vaccine, Search vaccination with the nanoparticles vaccine (L+Nano) Tool (BLAST) was performed for each gene segment

23 Oral Presentation sequenced and revealed strong identity with an H1N2 are widespread in Brazilian pig herds. From 2009 to genome detected in swine in Brazilian Santa Catarina 2016 (July), a total of 1952 nasal swabs and 1871 sera collected from nursery and growing pigs, and 165 with more identity with this novel H1N2v were a 2003 lung tissue samples collected from suckling, nursery Southern State, in 2011 (9799%). The human viruses and fattening pigs from 171 pig farms located in the southern, midwest and southeast regions of Brazil were H1N2 human lineage for HA gene (95%), a 1998 H3N2 submitted to ELISA, HI assay, RTqPCR, virus isolation human seasonal lineage for NA (93%), and H1N1pdm09 and genomic sequencing. Swine from all tested farms suggestslineage fora recent the otherhuman genes introduction (9899%). of this Phylogenetic Brazilian H1N2vreconstructions strain, from strengthens swine, once the these BLAST similar findings swine and of sera tested by ELISA were positive for FLUAV strains were detected around 300 kilometers distance had antibodies to FLUAV. Seventyfive percent (75.2%) where the human case occurred. Regarding analyses of genetic markers associated to antivirals resistance, this 24antibodies. out of 48 The of theHI analysistested pig revealed farms. specificAntibodies antibodies against novel virus presented the S31N marker in M2 protein, for H1N1/2009, H1N2 and H3N2/2015 in pig sera from which confers resistance to adamantane antiviral class, as H1N1pdm09 viruses. To date, no further H1N2 human two or more influenza virus subtypes were detected in cases have been detected, however other samples from samplespigs in seven (nasal of swabs those and24 farms.lungs). Influenza Virus isolation A virus of wasthe this region and period are being investigated to verify detected by RTqPCR in 306 (14.45%) of the 2117 tested by the inoculation of lung tissue supernatant or nasal swabinfluenza samples positive into samplesMDCK cells by or RT intoqPCR SPF was embryonated performed their occurrence. This finding highlights the importance chicken eggs and resulted in 162 virus isolates. Complete whenof influenza infectivity surveillance is high. Surveillance in humans should and animals be focused and and partial sequences of 58 FLUAVs were obtained by ontheir geographical interface, areas especially where during human influenzaanimal contact season is genetic sequencing and together with RTPCR subtyping

H3N2 FLUAVs. The sequence analysis showed that the frequentVV80 - GENETIC to ensure CHARACTERIZATION early detection of influenza OF INFLUENZA variants. HAresults, genes revealed of subtypes 23 H1N1/2009, H3N2 and H1N2 15 H1N2 are most and closely seven VIRUSES CIRCULATING WITHIN BRAZILIAN SWINE related to human seasonal H3N2 and H1N2 viruses that BETWEEN 2009 AND 2016 circulated in humans in the 1990s and early 2000s, Schaefer, R.; Gava, D.; Nelson, M.I.; Haach, V.; Ciacci- respectively. A novel N1 gene closely related to a human Zanella, J.R.; Cantão, M.E. 1. EMPRESA BRASILEIRA DE PESQUISA three H1N1 viruses isolated in 2014 and 2015. These AGROPECUÁRIA influenza virus that circulated in 2007 was detected in 2. FOGARTY INTERNATIONAL CENTER OF THE NATIONAL INSTITUTES OF HEALTH infindings swine highlightin Brazil theand importancerepresent a ofchallenge human toforswine the 3. UNIVERSIDADE DO OESTE DE SANTA designtransmission of effective in the cross evolutionprotective of influenza vaccines. virus diversity CATARINA Although Brazil has one of the largest pig populations in the world (~ 41 million pigs), very few and scattered in pigs prior 2009 is available. Since 2009, with the information about influenza A virus (FLUAV) infection viaintroduction reassortment of H1N1 between pandemic co circulating (H1N1/2009) viruses, virus in pig farms, influenza virus diversity has increased including H1N1/2009. As a result of the increased influenza surveillance efforts in pigs, we have found Virusthat Reviews H1N1/2009, & Research human Vol 20like (2), H1N2August-December and H3N2 2016 FLUAVs - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

24 Oral Presentation

VV85 - NEONATAL PIG MORTALITY ASSOCIATED WITH SENECAVIRUS A was associated with neonatal mortality based on RT 93% nt identity with the prototype strain SVV001. SVA Gava, D.; Lorenzett, M.P.; Haach, V. Driemeier, D.; PCR, virus isolation and sequencing results. The genetic Joshi, L.R.; Mohr, K.A.; Diel, D.G.; Caron, L.; Morés, N.; analysis shows the diversity of the Brazilian SVA isolates Morés, M.A.Z.; Schaefer, R. and that more studies are needed to demonstrate if there are differences between SVA from neonatal mortality 1. EMBRAPA SUÍNOS E AVES and vesicular cases. SVA is clinically and economically 2. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL important due to its resemblance with vesicular diseases, 3. UNIVERSIDADE DO OESTE DE SANTA 4. SOUTH DAKOTA STATE UNIVERSITY investigation. so the diagnosis tools are critical to confirm the initial Senecavirus A (SVA) is an emerging picornavirus that VV143 - BRAZILIAN BATS AS CARRIERS OF VIRUSES has been associated with outbreaks of vesicular disease WITH ZOONOTIC POTENTIAL in swine. In 2015, neonatal mortality affecting piglets Simas, P.V.M.; Barnabé, A.C.S.; Caserta, L.C.; Martini, of 07 days of age correlated with SVA, was reported M.C.; Durães-Carvalho, R.; Fellippe, P.A.N.; Ferreira- in Brazil. Here, we present an investigation carried Neto, D.L.; Beck, R.M.; Nascimento, G.M.; Jacomassa, F.A.F.; Moraes, A.P.; Miller, M.E.; Arns, C.W. operations in Southern Brazil showing an increased 1. UNIVERSIDADE ESTADUAL DE CAMPINAS neonatalon during mortality 20152016 and in also five vesicular farrowto finishdisease swine that 2. UNIVERSIDADE DE SOROCABA have been associated to SVA infection. Piglets were 3. UNIVERSIDADE FEDERAL DO PAMPA lethargic and had a watery diarrhea. The mortality 4. FUNDAÇÃO OSWALDO CRUZ 5. BOSQUE DOS JEQUITIBÁS of mortality was observed. Despite of a relatively fast onsetrate increased of wasting in syndrome23% and inprogressing some littermates to mortality, a 100% all Bats are animals of importance to veterinary and herds recovered to baseline mortality levels within 410 epidemiological surveillance. Since SARS, MERS virus days. Piglets were necropsied and tissue samples were and coronavirus ancestors of all mammals have been collected for histopathology, RTPCR for SVA detection Coronaviridae family evolution. Tadarida brasiliensis is targeting the VP1 VP3 region, and for viral isolation in identified in bats, they have being highlighted in the H1299 cell culture. Genome sequences of VP1 gene of the bat specie most widely distributed in the Americas, has colony numerous and cohabits with humans. available on GenBank. Necropsy of six piglets revealed The aim of this study was to identify Coronavirus in emptyfive SVA stomach isolates wereand comparedmesocolonic to otheredema. SVA In sequences general, asymptomatic bats of a colony in the city of Campinas, it was observed enlargement and edema of inguinal S.P. Brazil using metagenomic and next generation lymph nodes, pulmonary edema, ascites and ulcerative sequencing analysis. This analysis was performed using lesions on the snout and coronary band. Microscopic oral and anal swabs of 10 T. brasiliensis bat specimens lesions were characterized by necrotic epidermitis and collected in 2011. Samples were submitted to pre dermatitis of coronary band, mild enteritis with villus and the RNA extraction was conducted with a QIAamp degeneration on small intestine, marked mesocolon treatment (filtration and DNAse/Proteinase K reaction) edema and multifocal hemorrhage with lung edema. Viral RNA Mini Kit. From an equimolar pool, the RNA Senecavirus A was detected by RTPCR in tonsil, lung, library was prepared and it was submitted to RNASeq liver, intestine and coronary band. SVA was isolated in in HiSeq 2500 Sequencing System (Illumina), paired cell culture from tonsil, lung, intestine and coronary band end (2x 100bp). The genome assembly was made with 2 from piglets of all farms. Sequence comparisons based platforms, Metavelvet and Metavir 2, and the annotation on a region of the VP1 gene (541 base pairs) revealed with UniRef 90, ViPR e CoVDB databases. We obtained that the Brazilian isolates characterized here share 96 Metavelvet assembled 10,742 scaffolds and the similarity 345,409,110 reads, of which 76.47% had Q>30 score. 99% of nucleotide (nt) identity with contemporary BrazilianVirus Reviews isolates, & Research 95 98%Vol 20 nt(2), identityAugust-December with US 2016 and - Abstracts/Posters 90 analyses - Oralidentified Presentation 98 viral and 35 Coronavirus matches. XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

25 Oral Presentation

Metavir 2 assembled 9,179 scaffolds, 827 viral, 44 ssRNA immunoperoxidase monolayer assay (IPMA) assays to and 6 Alphacoronavirus matches. In the Coronavirus quantify viral genome loads and to detect antibodies anti with HCoVNL63. The 4936_Scaffold_0, assembled with the studied farms and three of them had breeding MetavirDatabase, 2, it represented was identified a hypothetical 3 matches with Coronavirus PEDV, 2 femalesPCV2, respectively. with antibody Serological titers profileslower than varied farrowing between genome containing 24,688bp and presented similarities piglets. Since breeding females are usually vaccinated late in the pregnancy to provide passive antibodies to neonates through colostrum, these results were not with human Coronavirus (NL63 – NC_005831.2; expected and suggest natural infection in the farrowing 229E – NC_002645.1; OC43 – NC_005147.1; HKU1 age. Overall, means of antibody titers decreased over the with– NC_006577.2; strains of importance SARS –in veterinary NC_019843.3; health MERS (PEDV – NC_004718.3; Human enteric – NC_012950.1) and also the lowest means, suggesting that these animals were Can conclude that metagenomic and NGS analysis were moreage and susceptible pigs from to growing viral infection and finishing than other categories categories had NC_003436.1; FIV – NC_002306.3; IBV – NC_001451.1). at the production system. Four farms were negative by the assembly’s platforms were complementary. Several real time PCR and the positive farms had PCV2 detected Coronavirussensitive, fast of and human efficient and inanimal the virus health detection importance and in most of the categories, suggesting that the virus was circulating in these farms, despite the use of vaccine as understanding of molecular ecoepidemiology of these viralwere agents. identified and these results contributed to the changed in the herds over the years since the virus was a disease control method. Profile of PCV2 circulation has VV166 - EVALUATION OF SEROLOGICAL AND systemic disease. At that time, PCV2 associated disease VIREMIC PROFILE FOR PORCINE CIRCOVIRUS TYPE affectedfirst reported mainly as pigs an importantat nursery pathogenage, since associatedthey were more with 2 IN NATURALLY INFECTED PIGS FROM FARROW-TO- susceptible due to the decrease in passive immunity. FINISH FARMS IN MINAS GERAIS STATE, BRAZIL Dias, A.S.; Rehfeld, I.S.; Gallinari, G.C.F.; Costa, A.G.; are now more susceptible to PCV2, suggesting that the Guedes, M.I.M.C.; Lobato, Z.I.P. Our results showed that growing and finishing pigs UNIVERSIDADE FEDERAL DE MINAS GERAIS despite of vaccination. viral infection profile is changing in Minas Gerais herds, Porcine circovirus type 2 (PCV2) is an important BV75 - IDENTIFICATION OF CELL PROTEINS THAT pathogen associated with systemic disease in swine INTERACT WITH HUMAN RESPIRATORY SYNCYTIAL VIRUS M2-1 PROTEIN in 2004 and since then, it has been used in piglets and worldwide. Vaccine against the disease was first available Araujo, C.L.; Eléouët, J.F.; Ventura, A.M. of viral circulation in the herds has been changing over 1. UNIVERSIDADE DE SÃO PAULO thesows time, as ansuggesting efficient that control PCV2 measure. is infecting However, different profile ages 2. INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE in the production system, despite of vaccination. The Human respiratory syncytial virus (HRSV) is one of the leading causes of acute respiratory illnesses in children theobjective virus. of Serum this study samples was to were evaluate collected the profile from ofMay PCV2 to six months to 2 years of age. So far there is no effective circulation in farrowtofinish farms using vaccines against drug or vaccine approved against this virus. In this work vaccine against PCV2 in the herds. At each farm, blood we focused on the interactions between the HRSV M21 samplesAugust 2012were fromrandomly eight collected farrowto fromfinish 20 farms animals using in protein, fundamental for viral genome transcription, and each production cycle category: breeding animals (sows cellular proteins of HEK293T cell line. Using the amino and gilts), farrowing (2–3 weeks), nursery (4–7 weeks), acid sequence of M21 (HRSV A2 strain, GI: 3089381) we asked for M21 gene synthesis with optimization of codons for expression in human cells. This gene was Serumgrower samples(8–14 weeks), were andsubmitted finishing to pigsreal (15–16 time PCR weeks), and sub cloned into the pcDNAFLAG vector, generating totaling 100 samples/farm and 800 animals in the study. Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

26 Oral Presentation pcDNAFLAG M2 1 that expresses M21 protein with an evidence of interaction of the viral protein matrix (M) FLAG peptide fused to its amino terminus. FLAGM2 1 with the cellular protein tropomiosin isoform 3 (Tm3) by expression allows a co immunoprecipitation strategy coimunoprecipitation. Both genes were synthesized with codon sequence optimized for expression in bacteria. M21 interacting proteins. The functionality of this These genes were cloned in the pET and pGEX vectors vectorwith the was highly shown efficient by transfection antiFLAG inantibodies HEK293T to cells identify and and we present results showing in vitro interaction of western blotting detection by antiFLAG and anti M21 antibodies. In pcDNAFLAGM2 1 transfected cells, we did an immunoprecipitation with antiFLAG coupled beads inthe HRSVpurified Hep2 HisM infected and GST Tm3cells, proteins. reinforcing We also that show these by proteinsconfocal immunofluorescenceinteract in vivo. We asked that Tm3 then and if a Mvariation colocalize in the cellular coimmunoprecipitated proteins by mass expression level of Tm3 would have some effect on HRSV spectrometry.(pcDNAFLAG The transfection M21 interacting as control) protein and highest identified score replication. We did experiments with siRNAs targeting was for a cytoplasmic isoform of polyA binding protein. Tm3 and didn’t found changes in virus replication. On the other direction, we did experiments to overexpress Tm3 transfecting its cDNA cloned in a mammalian weA validation have previously will be performedworked with with HRSV specific nucleoprotein antibodies expression vector. Interestingly we observed a consistent (N)for thisand andphosphoprotein other identified (P), proteins.optimized In for the mammalian laboratory inhibition of HRSV replication in Hep2 cells with Tm3 expression. They are also components of the replication overexpressed. Previous data from the literature complex and form inclusion body like structures when coexpressed in a cell. We asked if coexpressing N, P and affected by HRSV infection. Since tropomiosin associates FLAGM2 1, FLAGM2 1 would be incorporated onto these report that the arrangement of actin microfilaments is structures. This was done by transfection of the respective similar phenomena by confocal microscopy labeling and stabilizes these microfilaments we could show a assay. Interestingly the result shows a NP M21 co Hep2 infected and noninfected cells. We also observed localizationexpression in vectors inclusion followed bodies. by This immunofluorescence allow us to propose the microfilaments with anti Tm3 antibody comparing a coimmunoprecipitation of this complex using the anti structure is more resistant to HRSV replication effect. FLAG coupled beads strategy to analyze what cellular Ourthat workingin cells with hypothesis overexpressed is that the Tm3 interaction the microfilaments of M with components are added up with the higher complexity of Tm is a driven force for the viral particle budding, and this viral replication related structure. These data have the potential to contribute for elucidation of the virus replication process and identify new therapeutic targets. inthat the greater cell membrane. stabilization of the filaments by Tm excess hinders the fluidity necessary for the budding of viruses BV79 - TROPOMIOSIN INTERACTION WITH HUMAN BV168 - EVALUATION OF APOPTOTIC MECHANISMS RESPIRATORY SYNCYTIAL VIRUS MATRIX PROTEIN MEDIATED BY UNFOLDED PROTEIN RESPONSE Dias, T.D.; Oliveira, A.P.; Ogawa, J.K.; Eléouët, J.F.; PATHWAY IN JURKAT CELLS STIMULATED WITH HIV- Ventura, A.M. 1 TAT PROTEIN 1. UNIVERSIDADE DE SÃO PAULO Campestrini, J.; Costa-Junior, A.O.; Pinto, A.R. 2. INSTITUT NATIONAL DE LA RECHERCHE UNIVERSIDADE FEDERAL DE MINAS GERAIS AGRONOMIQUE HIVpositive individuals usually have a high depletion The Human respiratory syncytial virus (HRSV) is one of of CD4 T lymphocytes. The death of cells infected or the most important pathogens of the respiratory tract, not by the HIV is a result, among many other factors, causing respiratory illness particularly in newborns and of apoptosis mediated by viral proteins. The Unfolded babies. The genome of HRSV encodes eleven proteins, and Protein Response (UPR) is one of the cellular pathways is essential to understand its relationship with the host, that regulates cell survival or cell death. UPR also to characterize the interactions between those proteins regulates the Endoplasmic Reticulum (ER) stress caused and cellular components. In a previous work we found by the accumulation of misfolded or unfolded protein,

27 Oral Presentation by blocking the cell protein translation, increasing BV214 - RESPIRATORY SYNCYTIAL VIRUS MRNA expression of chaperones that assist in protein folding TRANSCRIPTOME REVEALS SURPRISING PROFILES and lead misfolded proteins for the degradation pathway DURING ONE-STEP REPLICATION CYCLE associated with the ER. When the ER stress is prolonged, Jesus, B.L.S.; Cardoso, R.S.; Criado, M.F.; Souza, M.M.; as in the case of viral infections, the UPR induces apoptosis Oliveira, A.S.; Prates, M.C.M.; Ventura, A.M.; Arruda, through the expression of proapoptotic molecule CHOP. E. With the aim to investigate the involvement of UPR UNIVERSIDADE DE SÃO PAULO pathway in cell death induced by the Tat protein of HIV1, Jurkat cells were stimulated with different concentration Human respiratory syncytial virus (HRSV) is a leading of the Tat HIV1 subtype C (50, 100 and 200nM) for 24, cause of acute respiratory infection (ARI), mainly 48 and 72 hours. The evaluation of apoptosis rate was bronchiolitis and pneumonia in children and the elderly. performed by staining cells with Anexin V FITC and It is widely accepted that HRSV mRNA transcription are propidium iodide and acquired in the FACSVERSE Flow produced in quantities that follow a descending gradient Cytometry (BD). The total RNA was also extracted, from the 3\\\’ to 5\\\’ of the negativestranded template. quantitated and the cDNA synthesized was used for This has been assumed based on assays done with othe qPCR in order to quantify the levels of transcripts of viruses of the family Paramyxoviridae. In the present genes which encode proteins of the UPR as well genes study the kinetics of mRNA transcript accumulation for whose proteins are related with apoptosis activation. all HRSV genes was evaluated in comparison to that of It was observed that after 72 hours of stimulation with mRNAs actively engaged for translation in polysomes. In addition, certain HRSV gene products were quantitated at different times post infection in HEp2 cell cultures. that200nM Tat ofprotein Tat protein most likelythere exertswas a asignificant biologic effect increase which in triggersapoptosis the rate apoptosis in Jurkat cellspathway. (10%, Cells p<0.005), stimulated indicating also were developed and standardized by the SyberGreen strategyFor quantification for all 10 of HRSVHRSV RNAs, genes. real Proteintime RT PCRexpression assays encoding proteins of the UPR pathway such as eIF2?, IRE1,show significantCHOP, BIP, ATF4,changes GADD34 in transcription and NOXA. profile These of results genes blot. As expected, mRNA quantities by real time RT analysis was done by immunofluorescence and western indicate that the Tat protein induces cellular changes that PCR increased over time during the viral replication lead to ER stress and activation of the UPR pathway. The cycle. However, when the quantities of individual viral increase in transcription of CHOP indicate that ER stress mRNAs were compared among themselves, there can be involved in the process of cell apoptosis. Other was no decreasing pattern of viral gene transcription. experiments will be performed in order to elucidate Surprisingly, the same overall pattern of quantities of the involvement of CHOP in the induction of apoptosis mRNAs for virus gene was nearly uniform over time in cells infected with high MOI. Strikingly, large relative increase in protein expression of key molecules involved quantities of mRNA for SH and M22 proteins were inand ER Western stress andblot apoptosis.analysis is Cytochromeundergoing toc releaseconfirm andthe consistently found. The analyses of viral RNAs engaged activation of caspase 3, 7 and 12 will be performed to evaluate the role of ER in the activation of the intrinsic similar to that found for the overall detection of viral in polysomes showed that the translation profile was apoptosis pathway. for viral proteins for which antibodies are available wereRNAs. in Western agreement blot with and this, immunofluorescence revealing that viral analysisprotein F was present in larger quantities than M over time post infection. These results are novel and may help to understand the relative importance of different HRSV gene products in the replication of tis agent in diferent tissues and cell types.

28 Oral Presentation

BV215 - OROPOUCHE VIRUS ASSEMBLY IN AAATPase Vps4A, which disrupts the MVB pathway, MAMMALIAN CELLS REQUIRES THE ACTIVITY OF led to an enlargement in the area of the viral factories HOST ESCRT PROTEINS Barbosa, N.S.; Mendonca, L.L.R.; Criado, M.; Arruda, Together our data presents new insights into cell (146%±63.2%), where the Vps4A mutant accumulated. E.; Dasilva, L.L.P. compartments and host factors involved in OROV biogenesis indicating that OROV requires the host MVB RIBEIRÃO PRETO MEDICAL SCHOOL, pathway with the recruitment of the ESCRT machinery UNIVERSITY OF SAO PAULO for a proper virus formation. Oropouche virus (OROV) is a Bunyavirus that can cause Oropouche fever in humans, a febrile illness that PIV102 - MOLECULAR CHARACTERIZATION OF can lead to meningitis. Because little is known about GRAPEVINE ENAMO-LIKE VIRUS, A NOVEL PUTATIVE OROV replicative cycle this study aimed to describe MEMBER OF THE GENUS ENAMOVIRUS the intracellular pathway and host factors involved in Silva, J.M.F.; Fajardo, T.V.M.; Al Rwahnih, M.; Blawid, OROV assembly in HeLa cells. Toward this goal, cells R.; Nagata, T. were inoculated with OROV (MOI = 1) and the dynamics 1. UNIVERSIDADE DE BRASÍLIA of viral onestep replication cycle was monitored at 2. FOUNDATION PLANT SERVICES UNIVERSITY OF CALIFORNIA The genus Enamovirus, family Luteoviridae, consists of intracellulardifferent time viral points titers post wereinfection continuously (p.i.). A quantification reduced and one recognized viral species, Pea enation mosaic virus 1 barelyby TCID50 detected assay at showed6 h p.i., indicating that during virus the eclipse. first hours This (PEMV1) and two putative members, Alfalfa enamovirus1 was followed by a rapid increase in viral titers in cell (AEV1) and Citrus vein enation virus (CVEV). We lysates and culture supernatants, reaching peak levels encountered a novel Enamovirus, tentatively named at 24h p.i. Accordingly, viral proteins were detected Grapevine enamolike virus (GELV), in a Vitis vinifera by immunoblot in cell lysates at 9 h p.i and in culture supernatants at 24 h p.i. After 9h p.i. large vesiclelike municipality of Bento Gonçalves, Brazil. The symptoms in structures enriched in OROV proteins were detected by this’Cabernet host were Sauvignon’ those of vine severe in an grapevine experimental leafroll field disease in the and reddish leaves. To characterize the viromes of this viral factories. These factories contained early endosome sample, dsRNA was extracted from 30g of bark scrapings. proteinimmunofluorescence and the endoplasmic at a pericuclear reticulum region, (ER) indicating resident Sequencing data was generated from a cDNA library that membrane protein. A transGolgi marker showed a was constructed by Macrogen. The Illumina HiSeq2000 dispersed pattern throughout the cytoplasm and also platform was used to generate about 20 million reads. colocalized with the viral factories. In contrast, a cis CLC Genomics Workbench software was used for quality Golgi marker did not colocalize at any time point p.i. with trimming and de novo contig assembly from the reads. these factories suggesting that Golgi apparatus may not All contigs were analyzed using NCBI’s Blastx program be the main site of viral assembly. ImmunoEM analysis against the viral RefSeq database. Bioinformatic analysis of infected cells revealed large multivesicular bodies indicated that the longest contig (6206 bp, GenBank structures (MVBs) that contained virus particles and were often associated with the ER. This data prompted us to verify a possible role for the ESCRT (Endosomal thusaccession indicating code that KX645875) GELV is sharesa distinct only member 49% identity of the Sorting Complexes Required for Transport) machinery genuswith PEMVEnamovirus1 (Query based coverage on established 25%, E value: criteria. 9e130) To and Alix led to a strong reduction in OROV production in viral replication. Knockdown of Tsg101/ESCRTI dsRNA and total RNA were extracted from fresh plant confirm the high throughput sequencing (HTS) results, compromised the formation of prominent viral factories, primers (SetF: 5’TTCCCTTGGGAGACTCGGTTCTAT3’ as(40% intracellular ±13.3% OROV and 35%±14.8%,staining remained respectively) restricted and to andmaterial SetR: and 5’AAACATGACCACCCGTCTCATAGC3’). screened by RTPCR using the specific The small puncta dispersed throughout the cytoplasm. The resulting amplicon (735 bp) was cloned, sequenced and superexpression of a dominant negative form of the Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

29 Oral Presentation

189x induced in all points (24 hpi, 5, 15 and 25dpi) in sequences generated by HTS. Grafttransmissibility susceptible cv. However, its expression suffer just a determined to be 99% identical with corresponding slight variation in the resistant cv. along the infection. of GELV was confirmed by grafting source vines onto (7x reduced) and induced at 5dpi (12x more expressed) theP1103 family cultivar Luteoviridae rootstock infecting(13+/16) grapevines.and confirming Further the inBy susceptiblethe other side, cvs. GhCBD2/ATE An opposite was pattern suppressed was seen 24hpi in investigationinfection by RT usingPCR. HTSThis islead the to first the report discovery of a virusof this in the resistant cv (4x more expressed at 24 dpi and novel virus in three different samples of grapevines (cvs. 5x reduced at 5 dpi). Investigation of similar effects CG 90450, Semillon, and Cabernet Franc) and using RT in Arabidopsis thaliana Col. under CLRDV infection PCR in another sample (cv. Malvasia Longa). To gain insight into the virus organization and evolution, the CLRDV infection. Arabidopsis pATE1:GUS revealed an 6206 bp contig was subjected to further bioinformatics increaseshowed GUS a significant activity in increaseshoot and (8x) root ofapical AtATE1 meristems after analysis. Five ORFs were predicted and analyzed for as well in young leaves compared with noninfected conserved elements. Field surveys and biological studies plants. 35S:ATE1 plants blocked viral infectivity. Thus, are currently underway to determine the prevalence of the data suggest that to prevent CLRDV spreading, the GELV in Brazil, evaluate its potential natural spread, and assess its effect on vine performances and wine quality. orexpression viral spread. of CBD2/ATE In this sense, must we be sawinduced that inthe 24hpi. CLRDV’s So, PIV117 - IDENTIFICATION AND FUNCTIONAL movementCBD2/ATE couldprotein act (ORF4)by inhibition has ofthe the necessary replication amino and/ ANALYSES OF THE COTTON BLUE DISEASE RESISTANCE LOCUS be a candidate protein to generate resistance, possibly, Fausto, A.K.S.; Moura, M.O.; da Franca, T.S.; Romanel, leadingacids to viralbe an movement ATE target. protein We suggests, to 26S proteasomeCBD2/ATE canfor E.; Vaslin, M.F.S. degradation via the Nend rule. 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PIV118 - DICER-LIKE PROFILE EXPRESSION DURING 2. ESCOLA DE ENGENHARIA DE LORENA/ VIRAL INFECTION IN SUSCEPTIBLE AND RESISTANT UNIVERSIDADE DE SÃO PAULO COTTON Cotton blue disease (CBD) is a major cotton disease in Moura, M.O.; Fausto, A.K.S.; da Franca, T.S.; Romanel, Brazil. It is transmitted by Aphis gossypii and its causal E.; Vaslin, M.F.S. agent is the Cotton leaf roll dwarf virus (CLRDV). CBD 1. UNIVERSIDADE FEDERAL DO RIO DE resistance is controlled by one single dominant locus, JANEIRO however nothing is known about it. Previously, we 2. ESCOLA DE ENGENHARIA DE LORENA/ mapped the Cbd resistance locus, identifying two ORFs, UNIVERSIDADE DE SÃO PAULO named Cbd1 and Cbd2, respectively. The promoter RNA silencing is an important antiviral defense region of these two genes is bidirectional and presented mechanism in plants. RNA silencing ou RNAi pathway many cis elements related to: salicylic acid, auxin is triggered when viral doublestrand intermediary responses and biotic and abiotic stress. CBD1 is a low RNAs (dsRNA) are generated during viral replication density lipoprotein receptor (LDL) and CBD2, an arginyl tRNA transferase (ATE) implicated in the Nend rule (DCL) ribonucleases, specially DCL2 and 4, recognize thesein the dsRNA first stepsstrands of and virus dicers infection. then, Plantproducing Dicer 21–like proteasome. The expression of GhCBD1 and GhCBD2 in 24 nucleotide short interfering RNAs (siRNAs). The leading target specific proteins to degradation by 26S viral siRNAs are incorporated into RISC complexs, and one showing middle resistance to CLRDV) showed which recognizes and destroys siRNA complementary noorgans differences of five cotton that cvscould (two justify susceptible, their responsestwo resistant in target RNAs. Arabidopsis thaliana presents four DCLs infection. Studying GhCBD1 relative expression during (DCL1–4), however, the cotton DCLs have not yet been viral infection we observed that its expression is 9to characterized. The objective of this study is characterize

30 Oral Presentation the DCLs of commercial cotton, Gossypium hirsutum, and to perform a survey on viruses occurring in this crop and to evaluate the losses they cause, appropriate tools is Based on Gossypium raimondii cotton 2n ancestral essential, enabling detection and characterization of the speciesanalyze genome, their expression primers were profile designed during viralto amplify infection. the viruses. Nextgeneration sequencing is the most advanced distinct cotton DCLs (1, 2a, 2b, 3a, 3b e 4). Previously, technique for studying viral metagenomics. The major aim of this study was to apply metagenomic approach which has never been shown before in eudicots plants. to characterize the viral biodiversity in arracacha plants So,we havewe looked identified for athe duplication presence of of DCL3 the 6in putative G. raimondii, DCL in Brazil. To this extent, in 2015 plants were collected (including DCL3 duplication) in 4n commercial cotton. from different areas: arracacha germplasm collection of Embrapa Vegetables (Brasília) and green belt in São Paulo. Leaf tissues were subject to viral enrichment by PCRFirstly, in theplants cotton from DCLs two expression cvs.: FM and profiles DO. FM was cottn analyzed cv is susceptiblein distinct organs to the (leaf,cotton stem, blue rootviral and disease flower) (CBD), by qRT and DO cv is resistant. CBD is an important cotton disease RNAultracentrifugation was sequenced on athrough 20% sucrose Illumina cushion HiSeq followed 2000 for Brazil and it is caused by the Cotton leafroll dwarf platform.by nucleic 21,048,084acid extraction million (AllprepDNA/RNA reads were generated Kit, Qiagen). by polerovirus (CLRDV). We observed that GhDCL4 (the the joint data analysis after adapter and quality trimming DCL mainly responsible for antiviral defense in plant) is using Trimmomatic. Assemble was performed with four more expressed in resistant cultivars in the stem, root different tools, SPAdes, Velvet, MEGAHIT and ABySS, in

FM. Expression levels of the 6 DCLs were also analyzed complete set of viral species. All assembled contigs were duringand flower CLRDV than viral in theinfection same in organs FM and of theDO susceptibleplants. For submittedorder to explore to Blastx the datasearches efficiently against and the to RefSeqidentify viral the that, systemic leaves were collected 24 hpi and 5, 15 database. A total of 1442 (SPAdes), 6502 (Velvet), 1568 and 25 dpi and analyzed in pools of 35 leaves. As mock, plants from both cvs inoculated with aviruliferous aphids hits with viral sequences. With our sequencing pipeline were used. DCL expression analysis showed that most we(Megahit), were able 7388 to (ABySS)identify contigsat least produced10 new plant significant virus of the DCLs genes were downregulated 24 hpi in the species infecting arracacha plants, possible members susceptible plants, except DCL1 and DCL2a. However, all of the families: Closteroviridae, Rhabdoviridae, the DCLs showed increased levels of expression at 5 dpi. In the cultivars DO, all DCL genes have shown increased expression levels at 24 hpi and 5dpi. Upregulation of thatBetaflexiviridae, have been already Luteoviridae, described belonging Endornaviridae, to the family DCL genes in cvs DO seems to be helping the plant in the Secoviridae and Tymoviridae; as well as plant viruses viral defense and systemic distribution of small RNAs, improving the plant ability to face the virus infection. conservedPotyviridae gene and of the Betaflexiviridae. 10 species. Arracacha To validate plants thesefrom theresults, main specific producing primers areas were of Brazil designed were from analyzed the most and PIV175 - ARRACACIA XANTHORRIZA (MANDIOQUINHA- plants were found infected with up to 9 different species. SALSA): A RESERVOIR OF PLANT VIRUS This work reveals arracacha plants as a reservoir of plant Orílio, A.F.; Inoue-Nagata, A.K.; Nagata, T.; Madeira, N.R.; Resende, R.O.; Blawid, R. and characterizing novel viruses, in order to increase the 1. UNIVERSIDADE DE BRASÍLIA effectivenessviruses and represents and reliability a first of stepcontrol towards measures discovering against 2. EMBRAPA HORTALIÇAS viruses in arracacha crops. Arracacha (Arracacia xanthorrhiza), known as mandioquinhasalsa in Brazil, is vegetatively propagated, and therefore it probably accumulates degenerative pathogens such as viruses. Arracacha plants with viral symptoms are frequently found in Brazil, and so far, only two potyviruses have been reported in the country. Thus,

31 Oral Presentation

PIV209 - THE COMPLETE GENOME SEQUENCE OF A PIV244 - STUDY OF BEGOMOVIRUS DIVERSITY NOVEL BETABACULOVIRUS ISOLATED FROM MOCIS IN TOMATO PLANTS USING NEXT-GENERATION SP. REVEALS AN ANCIENT GENOME EXPANSION SEQUENCING AND A TENDENCY IN NOCTUID-INFECTING Rêgo, C.M.; Nakasu, E.Y.T.; Blawid, R.; Nagata, T.; BETABACULOVIRUS Inoue-Nagata, A.K. Ardisson-Araújo, D.M.P.; Melo, F.L.; Sosa-Gómez, D.R.; 1. UNIVERSIDADE DE BRASÍLIA Ribeiro, B.M. 2. EMBRAPA HORTALIÇAS 1. UNIVERSIDADE FEDERAL DE SANTA MARIA Tomato (Solanum lycopersicum) is one of the most 2. UNIVERSIDADE DE BRASILIA economically important vegetables in the world, 3. EMBRAPASOJA being widely cultivated in Brazil. However, the yield is In this report, we described the genome of a baculovirus substantially impaired by the occurrence of many diseases, isolated from the insect pest, Mocis sp. The genome is particularly those of viral etiology. Begomoviruses (family Geminiviridae) cause one of the most important on the concatenated sequence of the 37 baculovirus core diseases in tomatoes, occurring at high frequency rates in proteins,134,272 bp we in found length that with the a G+C virus content is a betabaculovirusof 38.2%. Based the major growing regions of the country. Currently, the closely related to other noctuidinfecting betabaculovirus use of moderately resistant cultivars is the most effective including Pseudaletia unipuncta granulovirus, method for controlling this disease. The aim of this work Helicoverpa armigera granulovirus, and Xestia c nigrum was to study the begomovirus diversity in susceptible granulovirus. We called this novel species by Mocis sp. (BSP 0031, BSP 0034 and Sheena) and resistant (TY granulovirus (MospGV). Only three ORFs were found 2006, Tinto, BRS Sena and Candieiro) cultivars using to be unique to MospGV and several auxiliary genes NextGeneration Sequencing. Twenty samples of each were found including iap3, iap5, broa, brob, and three cultivar showing typical symptoms of begomovirus enhancins. The virus genome lacked both chitinase and cathepsin. Interestingly, when we analyzed the the viral infection by PCR using universal primers for enhancins, we found that the betabaculovirus genes infections were collected in LuziâniaGO. After confirming were acquired from alphabaculovirus and underwent several duplications during evolution. Duplication andbegomovirus, resistant viralcultivars circular were DNA pooled was amplifiedand sequenced by rolling on also happened to an endonucleaselike gene. Moreover, ancircle Illumina amplification platform. (RCA). Two RCA libraries products were of susceptibleproduced, genomic and gene content analyses revealed both a one for susceptible samples (DNAsus, with 20,158,352 strict collinearity and gene expansion into the genome reads) and another for resistant samples (DNAres, with of the MospGV related species. Betabaculovirus genome 20,205,324 reads). All reads were trimmed in Geneious software (Q20) and assembled using the Velvet algorithm are publicly accessible. Mocis sp. is a secondary pest (71 kmer), resulting in 1,129 contigs for DNAsus and ofsequencing maize crops is of inimportance Brazil and to other the field cultures. as few Certainly,genomes 1,668 for DNAres. Following a MegaBLAST analysis both discovery and description of novel baculoviruses (max. Evalue=1e20) against a geminivirus RefSeq may lead to development of green and safe pesticides in order to counteract and effectively control crop damage with Tomato severe rugose virus (ToSRV, 753 matched causing insect population. contigs),database, Tomato DNAsus mottle contigs leaf shared curl highvirus identity (ToMoLCV, (> 91%) 110 contigs), Bean golden mosaic virus (BGMV, 14 contigs), Euphorbia yellow mosaic virus (EuYMV, 31 contigs) and Sida micrantha mosaic virus (SiMMV, 81 contigs) sequences. On the other hand, DNAres contigs presented identity only with ToSRV (1000 contigs), ToMoLCV (12 contigs) and SiMMV (2 contigs). In addition, two contigs

yellow spot virus (CeYSP), indicating that a new of DNAres library share < 85% identity with Centrosema Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

32 Oral Presentation begomovirus species might be present in the sample. observed in AF from ZIKV women could partially explain The results indicate a difference in the population neurodevelopmental defect. The downregulation of MCP1 or IL6 promotes the differentiation of human diversity in resistant than in susceptible plants. Analyses ofcomposition the viral genomes of begomoviruses will be conducted in the to field, verify with whether lower (MePR2B) to a neuroglial phenotype, and the increase in the isolates are undergoing a genetic variation process MCPamniotic1 and fluidIL6 levels derived couldmesenchymal be a developmental progenitor blockade cells due to the selective pressure imposed by the use of to differentiation of derivedmesenchymal progenitor resistant plants. cells to mature neuroglial cells in the fetus, contributing with microcephaly. Higher levels of IL6, IL8 and MCP HV11 - INCREASED PRO-INFLAMMATORY CYTOKINES 1 and decreased levels of IL5, IL13, Eotaxin and PDGF IN AMNIOTIC FLUID FROM ZIKA VIRUS ASSOCIATED are associated with undifferentiated MePR2B cells. MICROCEPHALY In contrast, we found elevated GCSF in the AF of ZIKV Ornelas, A.M.M.; Pezzuto, P.; Silveira, P.P.; Melo, positive pregnant women, and a previous study had F.O.; Ferreira, T.A.; Oliveira-Szejnfeld, P.S.; Leal, J.I.; suggested that this growth factor acts as an autocrine Amorim, M.M.R.; Cardoso, C.C.; Nixon, D.F.; Tanuri, A.; protective signaling mechanism in response to neural Melo, A.S.; Aguiar, R.S. 1. UNIVERSIDADE FEDERAL DO RIO DE activation in the neuropathogenesis of ZIKVassociated JANEIRO injury. Our findings support the relevance of immune 2. INSTITUTO DE PESQUISA PROFESSOR in the ZIKV infected uterine environment should be JOAQUIM AMORIM NETO microcephaly cases. Finally, the inflammatory response 3. UNIVERSIDADE FEDERAL DE SÃO PAULO could also damage neuron cells, interfere with fetal 4. THE GEORGE WASHINGTON UNIVERSITY developmentfurther investigated, and be sinceused proasinflammatory biomarker candidates cytokines Recent advances in the understanding of associated with a poor outcome in Zika infected pregnant neuropathogenesis associated to Zika infection have women. led to descriptions of neonatal microcephaly cases. HV156 - ACTIVATION OF INTRINSIC COAGULATION However, any of these reports evaluated the humoral PATHWAY AND LIPID METABOLISM IN DENGUE immune response during ZIKV infection. We investigated VIRUS PATHOGENESIS 27 cytokines, chemokines, adhesion molecules and Coelho, S.V.A.; Vellasco, L.; Marques J.R.E.T.A.; Scharfstein, J.; Arruda, L.B. microcephaly.growth factors All in thepregnant amniotic women fluid (AF)enrolled of pregnant in this 1. UNIVERSIDADE FEDERAL DO RIO DE women with confirmed diagnose of Zika and neonate JANEIRO 2. FUNDAÇÃO OSWALDO CRUZ, CENTRO DE study presented Zika infection symptoms in the first PESQUISAS AGGEU MAGALHÃES transabdominaltrimester of pregnancy amniocentesis. confirmed byThe PCR microcephaly testes from Dengue virus (DENV) infection induces increased amniotic fluids collected during ultrasoundguided vascular permeability and plasma leakage, which is neonate circumference measurement. We observed a was confirmed through intrauterine ultrasound and dysregulation. Activation of the intrinsic coagulation orrelated contact to pathway exacerbated promotes inflammation the release and of hemostasisbradykinin positiveremarkable pregnant increase women of the with inflammatory neonate microcephaly.cytokines IL (BK), which has vasodilation and hypotensive action, In6, ILcontrast,15, IL8, weMCP observed1, G CSF lower in the levels amniotic of IFN fluid ?, ILof5, Zika IL 13, Eotaxin, RANTES and PDGF compared with ZIKV This pathway is triggered by activation of factor XII byand anionic is an inflammatory polymers, such modulator as dextran in infectious sulfate diseases.(DXS) or caused by ZIKV infection could in part determine the polyphosphates (PolyP) derived from activated platelets, differentiation,negative controls. proliferation, The inflammatory migration microenvironment and survival culminating in conversion of prekalikrein (PKa) to of neural progenitor cells. The cytokine changes we kalikrein, and cleavage of kininogen, thus producing BK.

33 Oral Presentation

Increased BK levels are detected in individuals submitted to plasma apheresis with DXS to remove low density virus (YFV), Saint Louis Encephalitis virus (SLEV) and lipoproteins (LDL), indicating that contact pathway may especiallythe co circulation Zika virus of (ZIKV) other flavivirushighlights asthe Yellow importance fever be regulated by lipid metabolism. Here, we investigated of the development of differential diagnostic tests able the status of contact pathway and LDL content in to segregate acute febrile illnesses that are known to the plasma of dengue patients with different clinical have serological crossreactivity with Dengue. The goal outcomes, by evaluating a kinetic hydrolysis of FITC of this work is to identify conserved and polymorphic conjugated PKa substrate, in the presence or absence of linear Dengue virus (DV) epitopes which could be used DXS. Plasmas from patients with classic dengue or dengue with complications showed diminished activation of we aligned predicted viral proteomes based in genome contact system, and this inhibition was detected since sequencesfor ELISA orof lateralthe four flow DV chromatography. serotype and performed To this end, an early infection. On the other hand, plasma from severe in silico epitope mapping. We developed a script in dengue patients presented an extensive activation of Perl integrating alignment and prediction information this pathway. These data suggest that severe disease may be associated to enhanced contact activation and excluded epitopes what are also present in the ZIKV and increased plasma BK levels, whereas patients with mild YFVto identify genomes. potential A total of serotype 15 peptidesspecific were epitopes. found to Webe dengue seem to present inhibitory elements in plasma, polymorphic among DV serotypes and 9 peptides were contributing to protection of the system and control of found to be conserved among all serotypes. A peptide hemostasis and vascular damage. Preliminary RMN data array containing the predicted epitopes was prepared suggested that the samples showing higher activation on a cellulose membrane. The reactivity of the peptides of contact pathways presented lower LDL content, was tested using sera from rabbits monoinfected with indicating a potential crossregulation between lipid each dengue serotype. Seven peptides were considered metabolism and contact pathway. We then investigated reactive with the test sera and not reactive with sera whether DXS affect lipid content and virus replication from noninfected rabbits, of which three were selected in endothelial cells infected with DENV. Addition of DXS for soluble synthesis. After that, we perform a screening to DENVinfected endothelial cells removed membrane ELISAs for the selected three peptides with 80 DV sterols and inhibited the release of viral particles, as positive human sera, 20 DV negative human sera, 6 YFV demonstrated by amplex red assay and plaque titration, positive human sera and 12 ZIKV positive mouse sera. respectively. Since DXS may aggregate LDL, and given that None of the three peptides were recognized by YFV and lower levels of plasma LDL was previously associated to ZIKV positive sera, differently from the full recombinant severe dengue outcome, we believe that lower LDL levels DV envelope protein which was recognized by the allow increased activation of contact pathway and BK release, what may then contribute to vasodilation and plasma leakage, while limiting virus replication. inheterologous silico and sera.in vitro The analyzes best peptide allowed showed the selection 82% of ofsensibility three peptides, and 87% conserved of specificity among in ELISA all DV tests. serotypes, These HV206 - IDENTIFICATION AND SELECTION OF DENGUE VIRUS SPECIFIC PEPTIDES FOR recognized by antibodies against other relevant and co DIFFERENTIAL DIAGNOSTIC TESTS that present potential as dengue specific antigens not Versiani, A.F.; Mendes, T.A.O.; Bartholomeu, D.C.; Nogueira, M.L.; da Fonseca, F.G. circulating flaviviruses LABORATÓRIO DE VIROLOGIA BÁSICA E APLICADA Dengue is one of the most important infectious diseases in Brazil and the early diagnosis is a determining factor with the most severe forms of infections. Meanwhile, for disease outcome, particularly for those afflicted Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

34 Oral Presentation

HV254 - SALIVA AS THE BIOLOGICAL SAMPLE OF Our results strongly suggest that saliva is the best body CHOICE FOR THE MOLECULAR DIAGNOSIS OF ZIKA Monteiro, D.C.S.; Mejía, M.C.C.; Abdalla, L.F.; Santos. the acute phase. Furthermore, saliva collection is secure fluid for the molecular detection of ZIKV RNA during J.H.A.; Almeida, T.P.A.; Corado, A.L.G.; Souza, V.C.; and non invasive, requiring nearly no training. The Nascimento, V.A.; Naveca, F.G. testing might improve the molecular diagnosis of Zika, 1. INSTITUTO LEÔNIDAS E MARIA DEANE findings of this study suggest that the adoption of saliva 2. UNIVERSIDADE DO ESTADO DO AMAZONAS 3. HOSPITAL ADVENTISTA increasingHV256 - ETIOLOGY the number OF of THE laboratorial ACUTE FEBRILEconfirmed ILLNESS cases. The Zika virus (ZIKV) is an Arthropodborne virus IN THE AMAZON STATE BRAZIL, DURING THE belonging to the Flaviviridae family, genus Flavivirus. EMERGENCE OF ZIKA VIRUS It is mainly transmitted by the bite of infected female Nascimento, V.A.; Monteiro, D.C.S.; Silva, M.S.; Souza, Aedes mosquitos. This virus is considered an emerging V.C.; Corado, A.L.G.; Naveca, F.G. pathogen since 2007 when an outbreak was reported at 1. INSTITUTO LEÔNIDAS E MARIA DEANE the Yap Island in the Federated States of Micronesia. At the 2. SECRETARIA DE ESTADO DE SAÚDE DO AMAZONAS cases in Americas. Currently, Brazil is experiencing abeginning massive of outbreak, 2015, ZIKV with was allidentified states inreporting autochthonous cases. Arthropodborne viruses (arboviruses) are important The success of RNA detection for the diagnosis of viral infectious agents, notably for people living in tropical infections has a direct relationship to the correct choice and subtropical regions around the planet. Arboviruses infections may cause an acute febrile illness with Different studies reported the detecting of ZIKV in blood symptoms frequently related to viral infections, andof body saliva fluids, until at theten appropriate days after onsettime post of the infection symptoms, (p.i.). or other infectious agents, which may disguise the while others reported urine as an alternative specimen emergence of new human pathogens. Recently, Brazil in cases with more than ten days p.i.. Therefore, the aim faced the emergence of two important arboviruses, the of this study was to evaluate the best biological sample Chikungunya virus (CHIKV) and the Zika virus (ZIKV) for the diagnosis of ZIKV infection, during the acute that led to outbreaks along with the Dengue virus phase of illness. Between February and April 2016, three (DENV). This epidemiological situation strengthens the types of biologicals samples (serum, urine, and saliva) necessity to conduct the differential diagnosis for these were collected from patients suspected of ZIKV infection, arboviruses. From October 2015 to February 2016, attended at Hospital Adventista de Manaus, a sentinel the Laboratory of Infectious Diseases Ecology in the unit for the ZIKV surveillance in the Amazonas state, Amazon, at Leônidas and Maria Deane Institute – Fiocruz Brazil. Samples were sent to the Laboratory of Infectious Amazônia was responsible for the molecular diagnosis Diseases Ecology in the Amazon, at Leônidas and Maria of Zika virus in the Amazonas State, as a request of the Deane Institute – Fiocruz Amazônia. The serum, urine, state health surveillance authorities. During this period, and saliva from 74 randomly selected patients were a total of 423 samples, 130 from males and 293 from tested by RTqPCR, according to a previously described females, including 73 pregnant women, all suspected of arbovirus infection were submitted to an RTqPCR protocol for ZIKV, CHIKV, and DENV testing. Additionally, protocol. Among the tested samples, 50% (n=37) were negative samples were further processed for the positive to in ZIKV serum, in 17.6%the three (n=13) specimens, in urine and and 11 75.7% were detection of Mayaro (MAYV) and Oropouche (OROV) negative(n=56) in in the all samples. saliva. Only Statistical seven patientsanalysis (9.5%)support were that viruses, by an RTqPCR protocol previously developed by our group. Moreover, selected samples were also higher than in serum (McNemar’s test p= 0.0005, OR the number of positives samples in saliva is significantly 5.5, CI 1.89 – 15.96). Furthermore, the median of saliva submitted to viral isolation in C6/36 or Vero cells and andnucleotide 5 in the sequencing. elderly. From We theidentified six Zika 140 RT qPCRZIKV positive Ct values was significantly lower (KruskalWallis test samples (33.1%), 37 in pregnant women, 14 in children serumVirus Reviews vs. saliva & Research p=0.0034; Vol 20 (2), urine August-December vs. saliva p=0.0025). 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

35 Oral Presentation samples submitted to viral isolation, one was isolated patients in this cohort had contact with the DENV other arboviruses, we obtained two positive samples for ataverage. least onceThe data in life,showed since that the at class least 73.06%of IgG antibodies of studied DENV,in C6/36 two cells. for CHIKV,In the experimentsone for MAYV for and the six detection for OROV, of shown this throughout the patient\’s life. According to all from patients that live in Manaus, with no travel history. These data indicate that in addition to ZIKV, more affected. São José do Rio Preto is hyperendemic to dengueliterature, and regions data presented with lower highlights financial the conditionsimportance are of in Manaus. This data is of particular concern since these this region for the surveillance and control of dengue, virusesDENV, and also CHIKV; have MAYVthe potential and OROV to are cause also circulatingoutbreaks, as well as the importance in maintaining basic patient worsening the current epidemiological situation at least care, surveillance and control of dengue, improving in the Amazonas State. The results of the present study indicate a need to increase the surveillance programs for and care for severe cases of dengue. Moreover, it is very other arboviruses, especially in places with close contact importantnotification to and raise control awareness of the about disease, the early need diagnosis to keep with extensive forest areas, as observed throughout the control of vectors and their breeding, mainly in the case Amazon region. of A. aegypti.

HV258 - SOROPREVALENCE DENGUE IGG IN PATIENTS EV14 - CORROSION AND BIOFILM REDUCED BY IN A PROSPECTIVE COHORT STUDY OF SÃO JOSÉ DO ECOPHAGES IN A PILOT ANAEROBIC SYSTEM RIO PRETO Dias, R.S.; Oliveira, M.D.; Silva, J.D.; Bicalho, K.M.; Silva, R.A.; Silva, G.C.D.; Zini, N.; Kanazawa, T.; Sousa, M.P.; Santos, V.V.C.M.; Silva, E.D.; Akamine, Estofolete, C.F.; Watanabe, A.S.A.; Terzian, A.C.B.; R.N.; Silva, C.C.; de Paula, S.O. Nogueira, M.L. 1. UNIVERSIDADE FEDERAL DE VIÇOSA FACULDADE DE MEDICINA DE SÃO JOSÉ DO 2. CENTRO DE PESQUISAS E RIO PRETO DESENVOLVIMENTO LEOPOLDO AMÉRICO MIGUEZ DE MELLO Dengue is a viral infectious disease and one of the most important arboviral diseases in the world. The virus Iron corrosion in an anoxic environment, like industrial is maintained in an urban transmission cycle: human mosquito human. Dengue studies, often only consider the cases reported without grouping data on past reducingpipelines, bacteria, cause large which economic cause losses;the iron and deposition are highly epidemics. Prospective studies offer the advantage of ininfluenced pipelines by inner. microorganisms, BRS are ubiquitous especially anaerobic sulphate determining the true incidence of a disease in a cohort for information on relative risk and absolute, the spectrum with consequent hydrogen sulphate production. It is of clinical outcomes, risk factor analysis for severe microorganisms that uses iron as final electron acceptor, disease development and spatial and temporal diversity roleestimated in carbon that and 50% sulfur of the cycle. total 7 mineralized distinct phylogenetic carbon in aim of this study was to evaluate the seroprevalence of groupsoceanic divide floor was BRS, converted among them by BRS,5 are which found takein Eubacteria a central DENVin transmission in population serotype by ELISA specific for anti of dengueDengue IgG virus. in 1481 The domain and 2 in Archaea. Due the high diversity of BRS, in patients enrolled in a prospective cohort study in São control and consequent corrosion by BRS in a pilot anaerobicthis work wesystem evaluated (loop). an TheEcophage system cocktail began foroperating biofilm José do Rio Preto / SP. The results showed that in 1082 with 77 specimens that were removed throughout the forpatients dengue. (73.06%) Of the were patients positive, who 15reported were inconclusive not having (1.01%) and 384 patients (25.93%) were negative degree. After 7 days bacterial cultures grown in selective mediaexperiment (BRS toand evaluate heterotrophic) the biofilm were and inoculated the corrosion in the DENV (506 patients, 34.17%), 414 patients, 27.95 (%) system and then nutrient solution was added in order Thehad antibodiesfamily income to DENV. of the Among patients women, is R $ 59.08% 2,106.00 were on to promote bacterial growth. All parameters were positive, while among men 40.20% were positive. Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

36 Oral Presentation observed for about 1 month after the bacteria injection and kept in horizontal position. Afterwards, soils in the until the bacterial culture reach the order of 104 by PVC tubes were biofertilized by spraying with swine

mesophilic biodigestor containing 5.3 ×107 CFU mg1 of Siphoviridaethe MPN method. and MyoviridaeAt this time, families, the phage all isolatedcocktail using(final S.effluent Typhimurium, (corresponding 4.8×107 to 50m3/CFU mg hectare)1 of E. coli,derived 6.2×105 from bacteriatitle in 1010) Escherichia was inoculated coli species. containing The samplesfive phages were of PFU mg1 of vMCo and 3.4×105 PFU mg1 of PhiX. To collected throughout the experiment and evaluated by estimate the percolation of the enteric microorganisms it was collected 1 g of soil sample at depths of 10, 20, 30, the day 34, 37 and 41 after phages inoculation. One day 40 and 50 cm by performing holes of 1 cm in diameter afteroptical adding profiler, the on phages day: 1, in 4, the 7, 12, system, 22, 34, little 37 and reduction 41, being in in the PVC tubes using a sterile probe. Samples were roughness of the specimens could be observed, reaching collected at 0, 0.12, 0.24, 0.5, 1, 2, 4, 8, 15 and 20 days after baseline levels about 7 days after inoculation. The data biofertilization. The vMCo and PhiX174 stability in clay

(2log10 of difference), and PhiX174 showed the faster previouslydemonstrate described the effectiveness in a lab scale of experiment, nonspecific phages percolationsoil was significantly and leaching lower in (p=0.002) sandy soil than (3.4log10) in sandy than soil evolutionto biofilms by and host corrosion range expansion control in(HRE) a pilot could system. explain As clay soil (2.2log10). E. coli proved to be a good microbial those results, since it is a closed system and the results biomarker of depth contamination and leaching in clay could be better observed about 7 days after inoculation. and sandy soils, while bacteriophages showed potential to be biomarkers of enteric pathogens persistence in both EV49 - ENTERIC PATHOGENS SURVIVAL, PERCOLATION soils. These results can contribute to the development AND LEACHING IN BIOFERTILIZED SOILS USING SWINE of predictive models of enteric pathogens behavior in DIGESTATE different soils, as well for water and food contamination Fongaro, G.; García-González, M.C.; Hernández, M.; by biofertilization, considering the risks management Kunz, A.; Barardi, C.R.M.; Rodríguez-Lázaro, D. and mitigation in the swine digestate recycles. 1. UNIVERSIDADE FEDERAL DE SANTA CATARINA EV54 - ROTAVIRUS AND OTHER HUMAN ENTERIC 2. INSTITUTO TECNOLÓGICO AGRARIO DE VIRUSES IN GASTROPODS CASTILLA Y LEÓN, VALLADOLID, SPAIN Gularte, J.S.; Staggemeier, R.; Demoliner, M.; Heck, 3. AIRTON KUNZ EMBRAPA SUÍNOS E AVES T.M.S.; Heldt, F.H.; Ritzel, R.G.F.; Henzel, A.; Spilki, F.R. Enteric pathogens present in biofertilizers can be UNIVERSIDADE FEEVALE accumulated in the soil, affecting water and foods. In Worldwide, the principal causes of waterborne diseases this context, the present study evaluated the stability, are related to viral infections. In this context the enteric percolation and leaching of enteric pathogens in viruses, those that infect the gastrointestinal tract, won clay and sandy soils after biofertilization with swine special attention about their use in monitoring water digestate, using the bacteriophage PhiX174, mengovirus pathogens. Within this group we highlight the rotavirus (vMCo), Salmonella enterica Thiphymurium and E. (RV), human adenovirus (HAdV), enterovirus (EV) and the hepatitis E virus (HEV). They are mainly introduced plaque assay technique (PFU) and bacteria by colony into water bodies through anthropogenic activities, as formingcoli as biomarker units (CFU). models. The Virusesstability were of these quantified enteric by microorganisms was evaluated up to 120 days using and water samples were collected bimonthly for one sentinel chambers (Eppendorf LidBac membrane lids, the launch of domestic effluents. P. canaliculata snails Eppendorf, Germany). Each sentinel chamber was dispersed along of the Sinos River basin. The waters wereyear (October/2014concentrated from August/2015) the adsorption fromelution 4 wetlands method. in clay and sandy soil microcosms (1020 cm of depth). The snails were removed from shells and the body was filled with biofertilized soils and allocated vertically For percolation assay PVC tubes (60 cm length × 30 completely macerated. One gram of tissue was diluted cm diameter), were closed with a cap at the bottom, in 1 mL Eagle’s minimal essential minimum (EMEM)

37 Oral Presentation homogenized and centrifuged, the supernatant was used for viral detection. The snail hemolymph was However, other pathogenic microorganisms such as drained from the mantle region. Real time polymerase protozoa,identification cyanobacteria of bacteria and from enteric the virus, coliform associated group. chain reaction (qPCR) targeting HAdV hexon gene, with waterborne diseases have not been effectively and conventional polymerase chain reaction was used eliminated from the water supply through conventional treatment. Among the viruses, adenoviruses are samples tested were positive for HAdV, including water, highlighted, which are present in the environment and hemolymphfor RV, EV and and HEV. gastropod Twenty sixtissues. percent Positive (19/72) samples of the were tested for the presence of RNA viruses. RV was rivers, groundwater and water for human consumption. Therepresent objective great of this risk study to public was to health; evaluate contaminating the quality were absent. HAdV and RV were detected, suggesting of the water by detection of adenoviruses in the water fecaldetected contamination, in 11% (2/19) which of samples,may hamper while the EV ecosystem and HEV supplied to the population from Macapá by the public services provided by these wetlands. These results also supply system CAESA. Water samples from the Amazon indicate that the snails have the ability to bioaccumulate River captured for treatment and from the outputs of enteric viruses. the treated water distribution reservoirs supplied by the Company of water in the city of MacapaAP were EV88 - DETECTION AND MOLECULAR analyzed, 14 points over the months of May, June and July, CHARACTERIZATION OF GEMYCIRCULARVIRUS FROM totalizing 42 samples. The investigation of adenovirus in ENVIRONMENTAL SAMPLES IN BRAZIL Assis, M.R.S.; Vieira, C.B.; Fioretti, J.M.; Rocha, M.S.; adsorptionelution technique in unpolarized membrane, Almeida, P.N.; Miagostovich, M.P.; Fumian, T.M. followedwater was bybased the on nucleic the concentration acid extraction (ultrafiltration) using Mini by FUNDAÇÃO OSWALDO CRUZ Kit (RTP Molecular Stratec), and detection of genetic Gemycircularvirus (GemyCV) is a group of viruses material by conventional PCR and nested PCR. Among which has been recently proposed as a new viral genus detected in fecal and environmental samples around the the presence of human adenovirus in both samples, the 42 samples examined so far, none (0/42) revealed world. GemyCVs have been detected in human blood, from the river and from the distribution network. Therefore, the implementation of this molecular analysis method in the evaluation of the water distributed to molecularbrain tissue, detection cerebrospinal and characterization, fluid, and stool sample. the presence In the the population in the city of Macapa quality showed ofpresent GemyCVs study, in we environmental demonstrate samplesfor the first from time, Brazil. through Our no contamination by adenoviruses, but contributed to results show a percentage of positivity ranging from the training of human resources in molecular biology collected in Manaus, Amazon region, and wastewater basic sanitation in Amapá, which provide subsidies to field focused on the monitoring of water quality and from69 (25/36) a wastewater to 97 %treatment (35/36) plant in river located water in samples Rio de control the prevalence of waterborne disease of viral Janeiro, respectively, revealing GemyCVs as an important etiology in the population and in effective contribution environmental contaminant. to the Ministry of Environment and State and Municipal Health secretariats databases. The project transcends EV177 - ADENOVIRUS INVESTIGATION BY MOLECULAR ANALISYS IN PUBLIC WATER SUPPLY the state, evaluating the presence of virus in water by in importance by being the first survey conducted in NETWORK

Ferreira, C.S.; Sa-Oliveira, J.C.; Resque, R.L.; Ferreira, genomic amplification technique. C.L.; Silva, E.S.; Muller, E.C.A. UNIFAP In Brazil, the quality control of the water distributed by supply systems has been done by laboratory

38 Oral Presentation

EV229 - CONSTRUCTED WETLANDS AS AN ALTERNATIVE SYSTEM TO REMOVE ENTERIC VIRUSES FROM WASTEWATER fromviral genomeApril to recovery June, 2016 was 49.8were % then and 11concentrated % by PEG and by flocculation method, respectively. The samples collected Moresco, V.; Magri, M.E.; Sezerino, P.H.; Barardi, PEG methodology adding murine norovirus (MNV1) C.R.M. as internal control. No reduction of RV genome copies were observed along the different stages of the wetland 1. LABORATÓRIO DE VIROLOGIA APLICADA, treatment system, being detected an average of 1.0 x DEPARTAMENTO DE MICROBIOLOGIA, IMUNOLOGIA E PARASITOLOGIA, UNIVERSIDADE FEDERAL DE SANTA of MNV1 recovery (internal control) ranged from 1.2 105 gc/ml in both CWs configurations. The percentages CATARINA 2. GRUPO DE ESTUDOS EM SANEAMENTO samples. A secondary treatment using UV light will be DESCENTRALIZADO, DEPARTAMENTO DE furtherto 10%, evaluated respectively in order for the to improve raw sewage RV inactivation and VSF exit in ENGENHARIA SANITÁRIA E AMBIENTAL, the exit samples. UNIVERSIDADE FEDERAL DE SANTA EV265 - VIRAL STUDY IN UNTREATED AND TREATED Wetlands systems are designed and constructed to SEWAGE WATER utilize the natural functions of wetland vegetation, Moriya, N.M.N.; Blawid, R.; Silva, J.M.F.; Batista, L.F.; soils and their natural microbial populations to remove Nagata, T. pathogens present in surface water, groundwater or wastewater. The presence of different pathogenic 1. UNIVERSIDADE DE BRASILIA microorganisms, highlighting the high concentration of 2. COMPANHIA DE SANEAMENTO AMBIENTAL enteric viruses, is a challenge regarding their removal DO DISTRITO FEDERAL using wetlands for wastewater treatment. The aim of this Contamination of human pathogen in wastewater is study was to evaluate the presence of human rotavirus an important matter, especially where sanitation is not ideal condition. Next Generation Sequencing (NGS) recently has been applied in several viral metagenomes (RV) in two different configurations of constructed (viromes) studies. Besides describing gene diversity, it is wetlands (CW). The configurations evaluated in this a helpful tool to analyze virome in sewage water. Despite study consisted of: 1) one vertical saturated flow CW the interest in wastewater treatment, Brasilia city lacks is(VSF); located and at2) UFSCone vertical being fedflow by CW raw (VF) sewage followed from by the an a census study and information aiming to assess the universityhorizontal flowneighborhood CW (HF) (hybrid using system).Thypha Thisdomingensis wetland pollution in Paranoa lake. For this purpose, virome in as a macrophyte plant. Five samples were collected untreated and treated wastewater was investigated monthly representing the whole system: i) raw sewage using highthroughput sequencing technology (NGS). Untreated and treated wastewater samples were collected at the treatment station of wastewater in v)in theVF and system HF entrance;exits, from ii) the wetland hybrid entrance system. (effluentIn order Brasília, Brazil and the samples were maintained on ice toprimarily choose treatedthe best in concentration a septic tank); method, iii) VSF a exit;pool ivof andthe samples collected in the different stages of the wetland other debris were removed from the samples by low was spiked with a known amount of RV RotaTeq vaccine speedfor transport centrifugation. to the laboratory. The resulting At first, supernatant bacterial was and strain followed by concentration using skimmed milk sucrose cushion. The pellet was resuspended and total was evaluated by plaque assay (infectivity) and genome collected and subjected to ultracentrifugation with 20% flocculation or PEG methodology. Rotavirus recovery kit (Zymo Research). The total RNA was treated by a higher viral recovery when compared with skimmed RiboRNA Zerowas extractedrRNA removal using kit ZR for Soil/Fecal bacteria RNA (Illumina) MicroPrep and quantification by RTqPCR. PEG concentration showed the cDNA construction was performed using TruSeq Stranded Total RNA Library Prep Kit (Illumina). For milk flocculation method being the percentage of treated water sample, the yield of RNA was very low, so infectious virus recovery 7.67% and 0.68% respectively forVirus PEG Reviews and &skimmed Research Vol milk 20 (2),flocculation. August-December By RT 2016qPCR, - Abstracts/Posters the - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

39 Oral Presentation it was necessary to amplify cDNA by SMARTer Universal EMT induction prompting AA immortalized PHKs to low RNA library kit (Clontech). The cDNA libraries from both samples were sequenced using Illumina HiSeq 2000 with the condition of 100 base paiedend. The NGS reads moreBV174 efficiently - ACTIVATION surpass carcinogenesis AND DEATH steps. PATHWAYS INDUCED BY DENGUE VIRUS IN INFECTED AND BYSTANDER ENDOTHELIAL CELLS were trimmed by Trimmomatic (http://www.usadellab. Papa, M.P.; Slongo, J.; Arruda, L.B. org/cms/index.php?page=trimmomatic) and the contigs UNIVERSIDADE FEDERAL DO RIO DE JANEIRO were assembled using Megahit (https://github.com/ by BlastX against RefSeqVirus using Geneious Software Dengue virus (DENV) infects endothelial cells, leading voutcn/megahit). The assembled contigs were analyzed to cellular activation and death, which may contribute human pathogens as Aichi virus, Human astrovirus, v.8.1 (BioMatters). In untreated water, we could find Norovirus GI and GII, Rotavirus A, Human picobirnavirus Here, we investigated the mechanisms of endothelial and Enterovirus. However, these viruses were not found cellto the death amplification induced ofby inflammation DENV, using and a vascular human injury.brain in treated water. This result is very indicative that the microvascular endothelial cell line (HBMEC). Cells treatment process is effective to eliminate such viruses. were infected with DENV2 and death markers in DENV BV26 - THE ASIAN-AMERICAN VARIANT OF HUMAN infected and bystander cells were evaluated at different PAPILLOMAVIRUS TYPE 16 EXHIBITS HIGHER ACTIVATION OF MAPK AND PI3K/AKT SIGNALING infected HBMECs showed decreased viability after 4872h time points by flow cytometry and western blot. DENV2 PATHWAYS, TRANSFORMATION, MIGRATION AND p.i., evidenced by diminished mitochondrial metabolism, INVASION OF PRIMARY HUMAN KERATINOCYTES increased Annexin V (AnV) and Propidium Iodide (PI) staining, and release of LDH in the supernatants, Hochmann, J.; Sobrinho, J.S.; Villa, L.L.; Sichero, L. demonstrating that both apoptosis and necroptosis 1. INSTITUTO DO CÂNCER DO ESTADO DE markers were detected in the cultures. Separate analysis SÃO PAULO of infected (DENV+) and bystander cells (DENV 2. FACULDADE DE MEDICINA DA ) demonstrated that, at 72h p.i., the great majority of UNIVERSIDADE DE SÃO live cells were DENV+, whereas DENV cells were mostly AsianAmerican (AA) HPV16 variants are associated with AnV+PI+, suggesting that bystander, non infected cells higher risk of cancer. Abnormal activation of intracellular were mostly affected at this time point. Western blot signaling play a critical role in cancer development and analysis demonstrated an increase in caspase 8 and 9 progression. Our aim was to elucidate mechanisms activation at 24h p.i., and increased RIPK1 expression at underlying the higher oncogenic potential attributed to 72h p.i., indicating that apoptosis was triggered at early infection, and might be followed by necroptosis. Culture AKT pathways in primary human keratinocytes (PHKs) of infected HBMECs with caspase inhibitors decreased AA variant. We evaluated activation of MAPK and PI3K/ apoptosis in DENV+ and DENV cells, whereas blocking AA, E350G. Phenotypes examined included migration, of RIPK1 increased the frequency of late apoptotic cells anchoragetransduced independent with E6/E7 growth of three and HPV invasion. 16 variants: AA PHKs EP, presented the highest levels of active proteins involved was actually triggered in bystander cells, counteracting in all cascades analyzed: MAPK ERK, MAPKp38 and apoptoticin the DENV pathways. population Importantly, only; indicating inhibition that necrosisof cell death resulted in increased frequency of DENV+ cells, anchorage independent growth, and in stimulating cell indicating that this might be a mechanism to control PI3KAKT. AA PHKs were more efficient in promoting migration and invasion. MEK1 inhibition decreased viral dissemination. We then investigated whether migration. The mesenchymal phenotype marker supernatants obtained from DENVinfected HBMECs vimentin was increased in AA PHKs. Our results suggest would induce death of non infected cells. Cells were infected for 48h, the supernatants we harvested, cellular behavior by means of GSK3b inactivation and inactivated by U.V. radiation, and cultured with non that MEK1, ERK2, AKT2 hyperactivation influence infected HBMECs. Indeed, increased cell death was

40 Oral Presentation observed, indicating that secreted mediators induced by infecting TZMbl susceptible cells with HIV1 in a M.O.I. of DENV infection might promote death of bystander cells. 0.5 and incubated in the presence of the substances after Interestingly, RIGI silencing on DENVinfected inhibited the virus adsorption step. In this assay, almost all the the death of bystander cells. These results indicate that substances inhibited the viral replication varying from RIGI activation triggered by DENV infection induce the secretion of mediators that affect the survival of bystander cells, contributing to endothelial lesion, and 62,8 92,3% of inhibiton, except the drug 182, which controlling virus dissemination. eachstimulated substance the viral in both replication TZM bl byand 37,1%. MOLT The cells inhibitory was also concentration of 50% of the viral replication (IC50%) of BV192 - SCREENING TESTS TO EVALUATE THE were 0.0183, 0.0444, 0.0586 and 0.0657µM. Together, EFFECTIVENESS AND TOXICITY OF TEN ANTIVIRAL theseevaluated results and suggest for the the most potential potent of compounds these substances IC50% DRUG CANDIDATES DEVELOPED BY BIOISOTERISM developed by bioisoterism in inhibiting the early stages Fonseca, V.W.P.; Menegatti, R.; Costa, L.J. of HIV1 replication. Experiments will be performed in 1. UNIVERSIDADE FEDERAL DO RIO DE order to precisely determine the mechanism of action JANEIRO of these compounds as expected for the mechanism of 2. UNIVERSIDADE FEDERAL DE GOIÁS action of Delavirdine.

BV205 - THE NON-GLYCOSILATED HRSV PROTEINS M AND N ARE ADDRESSED TO THE VIRAL ASSEMBLY replicationSince the first of HIV.report Currently, of AIDS, thethere combined is a constant use of search viral SITE THROUGH THE SECRETORY PATHWAY proteasefor therapies inhibitors, that prevent reverse the transmissiontranscriptase and/orinhibitors the Cardoso, R.S.; Jesus, B.L.S.; Carvalho, A.N.; Criado, M.; highly active antiretroviral therapy (HAART), is the Viana, R.M.M.; Milani, E.R.; Viana, R.M.M.; Prates, M.; mostand/or effective inhibitors therapy of theagainst viral AIDS. Integrase, However, known HAART as Rosales, R.; Ventura, A.M.; Silva, L.L.P.; Arruda, E. is not able to completely stop the viral replication and 1. CENTER FOR VIROLOGY RESEARCH, therefore to cure HIV infection. So it is urgent to search SCHOOL OL MEDICINE IN RIBEIRAO PRETO, for new drugs with antiviral potential against HIV, thus UNIVERSITY OF SAO PAULO increasing the therapeutic arsenal against AIDS. Our 2. BIOMEDICAL SCIENCES INSTITUTE OF UNIVERSITY OF SAO PAULO work aims at conducting screening tests to evaluate the effectiveness and toxicity of ten candidates to antiviral Human respiratory syncytial virus (HRSV) is the most drugs, developed by bioisoterism. All the compounds relevant cause of respiratory infection in children were designed based on the NNRTI Delavirdine, in worldwide. Despite its importance in public health, which the A and B subunities were substituted by the phenilpirazole group and in the D subunity, the pirimidine viral structural proteins remain unclear. In the present was substituted by a phenyl. In our preliminary results, some aspects of the mechanisms of the trafficking of the maximum nontoxic concentration of each substance how the virus matrix (M) and nucleocapsid (N)proteins, was determined in Hek293T, TZM and MOLT human cell whichstudy, are immunofluorescence nonglycosylated , are was addressed used to to understand inclusion lines. To test the antiviral potential of each compounds, bodies in Hep2 cells (MOI=3). M and N proteins followed infectious clone NL43 and 5 hours later incubated with to the glycosylated fusion (F) viral protein. Moreover, thefirst maximum Hek293T non cellstoxic concentration were transfected of each withcompound. HIV1 Msimilar and N intracellular proteins co localized trafficking with routes two askey comparedelements Supernatants from these cultures were collected 24 of the secretory pathway: transGolgi network46 hours later and tested for levels of viral infectivity (TGN46) and sorting nexin2 (SNX2). Viral proteins M by titration in TZMbl indicator cells. In this assay, as and N appear to be involved in the recruitment of cell expected for inhibitors of Reverse Transcriptase, none of proteins to the inclusion bodies, as shown for Glucose the compounds inhibited viral production and infectivity transporter 1 (Glut1). The data suggest that HRSV M and in the transfected cells. Next, we performed assays N proteins follow the secretory pathway, initiating in

41 Oral Presentation early endosomes, as indicated by the colocalization with TGN46 and SNX2. In addition, these host cell proteins tagged RV by intravital microscopy in tonsillar explants. accumulate in inclusion bodies that are viral factories, underway to trace the infection pathway of fluorescence and can be part of budding viral progeny. Therefore, BV243 - DELETION OF THE M SEGMENT NON HRSV M and N proteins, even though they are not STRUCTURAL PROTEIN (NSM) OF OROPOUCHE VIRUS glycosylated, take advantage of the secretory pathway AFFECTS VIRUS ASSEMBLY AND THE ARCHITECTURE to reach virus inclusion bodies. Confocal images suggest OF VIRAL FACTORIES that SNX2, which is known for its membranedeforming Cardoso, R.S.; Barbosa, N.S.; Acrani, G.O.; Da Silva, properties, could play a pivotal role in HRSV budding. L.L.P.; Arruda, E. FACULDADE DE MEDICINA DE RIBEIRÃO BV213 - HUMAN TONSIL EXPLANTS SUPPORT PRETO RHINOVIRUS INFECTION EX VIVO Oropouche virus (OROV) is an arbovirus in the family Martins Junior, R.B.; Gagliardi, T.B.; Criado, M.F.; Cardoso, R.S.; Jesus, B.L.; Silva, M.L.; Carenzi, L.R.; a dead sloth in the early 1960s, and has caused more Tamashiro, E.; Valera, F.; Lima, W.; Arruda, E. thanBunyaviridae 30 outbreaks that was in isolatedthe Amazon for the region first timeinfecting from FACULDADE DE MEDICINA DE RIBEIRÃO more than half million people. OROV is transmitted by PRETO the bite of the midge Culicoides paraensis and causes Rhinovirus (RV) is the causative agent of common colds an acute febrile disease. OROV genome is composed and the most frequent cause of asthma exacerbations of three singlestranded RNAs (L, M e S) of negative in children and adults. RV is frequently detected within polarity, that encode 3 structural proteins, plus the hypertrophic human tonsils, indicating that the virus polymerase and 2 other nonstructural proteins – NSm can infect epithelium and lymphoid cells from adenoid and NSs. NSm is a product from the maturation cleavage and palatine tonsils. In the present study, tridimensional of the M polypeptide precursor, and studies with other cultures of explants of hypertrophic tonsils were bunyaviruses have shown that NSm plays important roles infected ex vivo with RV. Small tonsil explants (3 mm3) in the assembly and morphogenesis of virus particles were obtained by mincing surgical specimens with razor in tubular structures associated with viral factories. blades, extensively washed in cold Hank’s balanced salt However, nothing is known about the functions of NSm solution to remove blood and debris. Explants were placed in OROV replication. To address this question, a plasmid apical side up in the upper chamber of Transwell culture based reverse genetics approach was taken, based on fulllength cDNA copies of the three OROV genome humid atmosphere, and RPMI medium was added to the segments to generate a recombinant OROV lacking lowerinserts chamber in 100mm of the well transwell, dishes at maintaining 5% CO2 and an 37°C airliquid in a the entire NSm protein (rOROV?NSm) and a wild type interface. Explants from tonsils found to be negative (rOROVwt). Successful rescue of recombinant viruses for picornaviruses by qPCR were infected around day and sequencing. To analyze the morphological changes ml) were inoculated on the apical (epithelial) side, with inwere organelles, confirmed HeLa by cells indirect monolayers immunofluorescence were infected with (IF) care7 with to prevents RV16. Five spillage microliters into the of media. HRV16 After (106 overnight TCID50/ incubation, the tissue was washed three times with non paraformaldehyde at 0h, 12h, 18h and 24h post infection supplemented RPMI in order to remove the excess virus, (pi),rOROV and?NSm stained and byrOROV IF with (MOI=1). mouse Cellspolyclonal were antifixed OROV with and fresh medium was replaced. Tissue was incubated antibody. Dual labeling experiments were done with rabbit monoclonal anticalnexin, antiTGN46, anti HRS or antigiantin. Cell nuclei were stained with DAPI and slides forat 37ºC the VP2and 5%capsid CO2 protein for another of HRV 3 days16 showed and then detection fixed in were examined by confocal microscopy. Our results Carnoy’s fixative. Immunohistochemistry with antibody show that at 12h pi rOROVwt is predominantly located at the endoplasmic reticulum, while rOROV? NSm is tonsilin stratified explants squamous sustain RVepithelium infection and ex vivo.in few Studies lymphoid are diffusely dispersed through the cytoplasm. Disruption of cells in extrafollicular regions. The findings suggest that Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

42 Oral Presentation the transGolgi network was delayed in rOROV?NSm as However, TCTP did not coimunoprecipitate with 6K2 indicated by diffusion of TGN46 at 24h pi and formation in potyvirus replication, protoplast of silenced and noted in the cisGolgi network and in endosomes. The controlGFP in infectedplants were plants. infected To find with out TuMV if TCTP and TuMVVNN, is involved resultsof inclusions indicate bodies. that OROV No significantNSm plays an differences important were role in OROV assembly. Financial support: FAPESP, CAPES, accumulation in both pulls of protoplasts showed CNPq. thata non TuMV replicative accumulation TuMV mutant. decreases Quantification in silenced of cells, viral suggesting an involvement in virus replication. Taken PIV6 - TRANSLATIONALLY CONTROLLED TUMOR together, these results show that TCTP is a plant factor PROTEIN IS NECESSARY FOR AN EFFICIENT POTYVIRUS REPLICATION and may be involved in virus replication. Bruckner, F.P.; Laliberté, J.F.; Alfenas-Zerbini, P. necessary for an efficient infection by different potyvirus PIV28 - VIROME IN ORNAMENTAL PLANTS FROM 1. UNIVERSIDADE FEDERAL DE VIÇOSA 2. INSTITUT NATIONAL DE LA RECHERCHE DISTRITO FEDERAL, BRAZIL SCIENTIFIQUE Brant, P.M.; Nagata, T.; Pereira-Carvalho, R.C. The Translationally Controlled Tumor Protein (TCTP) UNIVERSIDADE DE BRASÍLIA is a ubiquitously distributed protein in eukaryotes. It The growing ornamental plant production in the Federal is involved in the regulation of basic processes such as District (DF), Brazil, is facing with the increase of cell cycle progression, cell growth, stress protection and diseases. The research towards detection of viral species apoptosis. Increase expression of its mRNA is observed occurring in ornamentals are still few not only in DF during the early stages of tomato (Solanum lycopersicum) but also in Brazil. Next Generation Sequencing (NGS) infection by the potyvirus Pepper yellow mosaic virus. Downregulation of its mRNA reduces virus accumulation of emerging or unknown virus species without having in both tomato and Nicotiana benthamiana plants. Aiming anyapproach background makes itfor possible the causative to explore agents. the identification The main to understand the role of TCTP in potyvirus infection, objective of this work was to identify and analyze the viral N. benthamiana plants silenced for TCTP by VIGS were diversity present in different ornamental plant species by agroinoculated with Turnip mosaic virus (TuMV). NGS. For this purpose, plant samples showing viral (like) Western blot analysis showed that silenced plants symptoms were collected at an important production accumulated fewer viruses than control plants. Also, the and distribution center: Nursery I of NOVACAP, Brasília effect of TCTP overexpression in infection was analyzed (Companhia Urbanizadora da Nova Capital do Brasil). in plants expressing TCTP transiently. As expected, TCTP The plant species used were: Coreopsis lanceolata, overexpression increases TuMV accumulation when Epipremnum pinnatum, Impatiens hawkeri, Jasminum compared to control plants. To analyze TCTP subcellular nitidum, Streptosolen jasmonii, Pachystachys lutea, localization in infection context, TCTP fused to GFP was Pinanga kuhlii, Anthurium lindmanianum, Pelargonium coexpressed with TuMV engineered to express the viral sp. and Neomarica candida. Leaf samples of each species protein 6K2 fused to mCherry and imaged by confocal were stored at freezer 80 ºC and total RNA was extracted microscopy. 6K2 is a membraneassociated protein individually. For NGS, two grams of each plant sample implicated in the formation of vesicles involved in both were mixed and used as a pooled sample. The viral virus replication and movement. TCTPGFP partially colocalized with 6K2induced vesicles and with the sample, then the total RNA was extracted from this perinuclear globular structure that is typically formed preparation.semipurification Total procedure RNA was sentwas toapplied Macrogen for thisInc. pooled(Seoul, during potyvirus infection. Cellular fractioning showed Korea) for the DNA library construction and posterior that TCTP is mainly present in soluble fraction, but it is NGS sequencing by Illumina HiSeq 2000. The NGS of also present in membranous fraction in both infected pooled sample resulted in 45,449,068 reads and a high and healthy plants. Since it colocalize with some vesicles number of contigs as well in each assembler used, Velvet and is membrane associated, it could interact with 6K2. (1.2.09), AbYSS (1.9.0) and SPAdes (3.7), with 1,657,028,

43 Oral Presentation

2,882,857 and 95,736 contigs respectively. Blastx search ssRNA + genomes with seven ORFs. In a previous work of these contigs with viral reference genomes resulted in we sequenced part of CAV genome corresponding to 4,981 contigs detected as viral sequences. The category viral capsid (ORF3) and part of its replicase (ORF2) and of these sequences varied from bacteriophages to plant observed a a high homology between these ORFs and viruses. In plant viruses, some viral families of DNA ORFs 2 and 3 from Cotton leafroll dwarf virus (CLRDV) (Caulimoviridae) and RNA viruses (Tombusviridae, responsible for Cotton blue disease, reaching more than Luteoviridae, Rhabdoviridae, Potyviridae and Umbravirus) were more evident. Viral genomes were sequencing performed in Illumina platform at Fasteris assembled in silico using the Geneious (R9) software, Co.,90% identity.Geneva, UsingSwitzerland, siRNA libraries almost obtain complete through genome deep resulting in six possible new viral species, including of CAV was mapped using SearchSmallRNA software. three from Rhabdoviridae, one from Potyviridae, one The analyzes showed that siRNA generated during the from Tombusviridae and one from Umbravirus. With process of infection range from 1826 nts, with siRNA of these results, we can assume that important entities of 22 nts as the most abundant, followed by 24 nts. Some plant virus are present in ornamental plants produced in small genomic portions were not covered by mapping the DF, which can be a risk to ornamental production as well to other crops distributed around the area. For gaps sequencing, sets of primers were design for reverse(gaps) correspondingtranscription tofollowed less than Reaction 5% of thePolymerase genome. PIV72 - SEQUENCING OF THE COTTON ANTHOCYANOSIS Chain (RTPCR) and subsequent sequencing by Sanger. VIRUS BY SMALL RNA DEEP SEQUENCING AND ITS CAV genome has about 6000 nucleotides. Mapping SIVRNAS PROFILE IN COTTON results were validate by Sanger nucleotide sequencing. Santos, R.O.; Fausto, A.K.S.; Andrade, R.; da Franca, Alignment of the CAV ORFs nucleotide and amino acids T.S.; Giband, M.; Vaslin, M.F.S. sequences with other members of Luteoviridae family 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO 2. UNIVERSIDADE ESTADUAL DE SÃO PAULO confirmedPIV99 - DSRNA that it is DEEP a Polerovirus. SEQUENCING REVEALS FIVE LORENA VIRAL SPECIES IN COMMON BEANS 3. CENTRO NACIONAL DE PESQUISA EM Alves-Freitas, D.M.T.; Melo, F.L.; Faria, J.C.; Ribeiro, ALGODÃO S.G. Small RNAs or siRNAs (interfering RNAs) are small 1. EMBRAPA RECURSOS GENÉTICOS E RNA molecules originated when plants and animals BIOTECNOLOGIA are infected by viruses. After virus entry into the cell, 2. UNIVERSIDADE DE BRASÍLIA its genome is released and recognized by cellular 3. EMBRAPA ARROZ E FEIJÃO proteins called Dicerlike. These proteins fragment viral Common bean (Phaseolus vulgaris L.) is an economically genome producing small interfering viral RNA (sivRNA), important leguminous crop cultivated worldwide. sequences that exhibit at approximately 2124 nucleotides (nts). The sequences of the siRNA are complementary to productivity and quality of this crop. Transgenic bean the viral genome. Total siRNA from Cotton anthocyanosis goldenViral pathogens mosaic playvirus aresistant significant common role in reducingbean plants the virus (CAV) infected plants were sequenced by deep sequencing in order to obtain the complete sequence of experiments with transgenic lines presented diverse the CAV genome. The disease caused by CAV is restrict typeswere of recently symptoms, developed probably in due Brazil. to infection However, by RNA field to Brazil, where is called “Vermelhão do algodoeiro”. virus. To investigate which viruses were present in these Symptoms are the intense reddening of leaves and plants, we performed highthroughput sequencing from stems. Until now, its agent causal was not known at preparations enriched for viral dsRNA. Leaves from molecular level. CAV was describing in Brazil in 1961 at transgenic BGMVresistant common bean breeding line Brazil by Santos and collaborators as belonging to the CNFCT16207 showing severe crinkling were collected Luteoviridae family, Polerovirus genus. Polerovirus have in Goiás, Brazil. dsRNA extraction was conducted using

44 Oral Presentation

STEPhenol and cellulose column protocol. Pooled specimens were collected from collaborating centers dsRNA samples were pairedend sequenced using MiSeq across Southern, Southeastern and Midwest Brazil, Ilumina® high performance platform. Sequencing and likely to be representative of Brazilian population. results were analyzed in CLC Genomics Workbench and All specimens were screened for RVA using ELISA, and Geneious® program software for contig construction genotyped by RTPCR. Differences in proportions were and comparison with viral sequences in public database tested using Chi Squares. A pvalue of less than 0.05 was and gene annotation. A total of 27,897 contigs were assembled from 13,780,310 reads obtained in the Illumina sequencing. Six viral RNA genomes were considered statistically significant. RVA was detected in 19.7% (677/3441). G3P[8] remained prevalent in 2012 (37.6%, 69/185) and 2013 (40.1%, 74/186) (?2=0.107, recovered and identified as Cowpea mild mottle virus p=0.743), but declined markedly in 2014 (3.5%, 10/281) Secoviridae),(CpMMV; Carlavirus, two species Betaflexiviridae), of the genus Endornavirus, Bean rugose (?2=71.770, p=0.000). G12P[8] was second highest Phaseolusmosaic virus vulgaris (RNA endornavirus 1 and RNA 21 BRMV;and 2 (PvEV Comovirus,1 and strain in 2012 (22.7%, 42/185), decrease rapidly in 2013 (2.7%, 5/186) (?2=26.224, p=0.000) and re Cytorhabdovirus (Rhabdoviridae). The size of the viral emerged as the predominant genotype in 2014 (86.6%, contigsPvEv2; ranged Endornavirus, from 3.7 to Endornaviridae), 14.8 kb. Based on the and consensus a new studied.243/281) The (?2=118.299, present study p=0.000). raised the From hypothesis July/2014, of a sequences obtained through nextgeneration sequencing, possibleG12P[8] wasG12 the outbreak single genotype being in detected progress. in Nationally,all regions the Hospitalbased Information System surveillance specific primers were designed for each virus species hospitalization observed in Brazil after RVA vaccine virusesidentified. in thePrimers plants. were Large usedscale in PCRsequencing reaction technology to recover introduction.data confirmed Nevertheless, the long term thedecline sharp in gastroenteritis increase in andvirus advancedderived fragments, bioinformatics confirming platforms the presencehave allowed of all diarrhea hospitalization prevalence from 2013 to the discovery of new viral species and four other RNA 2014 observed in Southern and Southeastern regions viruses in common bean plants from the state of Goiás, is consistent with what appears to be an outbreak of being an attractive tool for studying viral diversity in plants. Additionally, dsRNA enriched samples permitted held in Brazil, and the introduction a novel RVA strain was recover the RNA genomes in the replicative form, aG12P[8]. real threat, Furthermore, given large in numbers 2014, the of FIFA visitors World from Cup areas was of a Cytorhabdovirus infecting common bean plants. this event occurred right before the beginning of the RVA selecting specifically RNA viruses. This is the first report seasonalitywith ongoing in G12P[8] the country. genotype Worldwide, transmission. the emergence Moreover, HV2 - DETECTION OF THE EMERGING ROTAVIRUS G12P[8] GENOTYPE AT HIGH FREQUENCY IN strain could raise new concerns for RVA vaccine BRAZIL IN 2014: SUCCESSIVE REPLACEMENT OF development.of genotype G12P[8] However, as despitean epidemiologically the possible emergence important PREDOMINANT STRAINS of new strains, vaccination has been shown to reduce Luchs, A.; Cilli, A.; Morillo, S.G.; Gregorio, D.S.; Souza, the disease incidence of RVA infection and remain below K.A.F.; Vieira, H.R.; Fernandes, A.M.; Carmona, R.C.C.; prevaccination levels. Continued surveillance is needed Timenetsky, M.C.S.T. to verify the effectiveness of the RotarixTM vaccine in INSTITUTO ADOLFO Brazil together with potential emergence of unusual The continuum characterization of circulating RVA genotypes. genotypes is essential to understand how vaccine introduction could impact virus epidemiology. In the present study, an unexpected rapid changing pattern of RVA genotypes distribution in Brazilian population during three followed seasons is described. From

January/2012Virus Reviews & Research to December/2014, Vol 20 (2), August-December a total of 34412016 - fecalAbstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

45 Oral Presentation

HV35 - PREVALENCE AND VIROLOGICAL (responsible for decreased HBeAg expression and CHARACTERISTICS OF HEPATITIS B VIRUS INFECTION has been linked to HBV oncogenesis) in sample Y431, AMONG MEN WHO HAVE SEX WITH MEN IN CENTRAL BRAZIL: A RESPONDENT-DRIVEN SAMPLING G1862T/G1888A (characteristic of subgenotype A1) in Oliveira, M.P.; Silva, A.M.C.; Andrade, A.A.; Santana, No mutations were detected in X and overlapping HBV Y494, and G1862T (genotype specific HBV/A1) in Y513. E.B.R.; Freitas, N.R.; Matos, M.A.D.; Lopes, C.L.R.; polymerase regions. In conclusion, HBV DNA was found Spitz, N.; Araujo, N.M.; Martins, R.M.B. in all HBsAgpositive MSM, showing that they have active hepatitis B and a higher potential for HBV transmission. 1. INSTITUTO DE PATOLOGIA TROPICAL E SAÚDE PÚBLICA/ UNIVERSIDADE FEDERAL DE GOIÁS corroborating the greater circulation of this genotype The genotype A identified in this study population 2. FACULDADE DE ENFERMAGEM/ in Brazil. The presence of mutations on HBV isolates UNIVERSIDADE FEDERAL DE GOIÁS indicates the need for expert assistance and monitoring 3. INSTITUTO OSWALDO CRUZ/ FUNDAÇÃO of HBV DNApositive individuals to prevent progression OSWALDO CRUZ to more severe diseases. Men who have sex with men (MSM) are at increased risk HV41 - SAPOVIRUS IN CHILDREN WITH ACUTE of exposure to hepatitis B virus (HBV) compared with GASTROENTERITIS ATTENDED AT HOSPITAL IN the general population. This study aims to determine the GOIÂNIA, GOIÁS prevalence of HBV current infection (HBsAg carriers) Silva, T.N.; Dábilla, N.A.S.; Fiaccadori, F.S.; Cardoso, and virological characteristics in a sample of MSM in D.D.P.; Sousa, T.T.; Almeida, T.N.V.; Leite, R.A.; Souza, Brazil. A crosssectional study was conducted among M. MSM in the City of Goiânia, Central Brazil. From March to November 2014, participants were recruited using INSTITUTO DE PATOLOGIA TROPICAL E SAÚDE PÚBLICA respondentdriven sampling (RDS). After signing the consent form, participants were interviewed and a blood sample collected. All samples were tested for family, and together with noroviruses (NoVs) are HBV serological markers and HBV DNA. Nucleotide importantSapovirus (SaVs)causing areacute classified gastroenteritis in the Caliciviridae(AGE). SaV sequences of the ampli?ed regions were determined have been mainly detected in samples from AGE by direct sequencing. Sequences were aligned and outbreaks, involving especially children and the elderly. edited using SeqMan II, Clustal W and BioEdit. MEGA The SaVs can be transmitted by the fecaloral route program was used to determined the HBV genotypes through personto person contact, by ingestion of food or and subgenotypes by phylogenetic analysis, and also contaminated water and fomites. The respiratory route to identify mutations in the HBV genome. Of the 522 SaV had not yet been investigated in samples from the HBV DNA positive. Of these, two (Y431 and Y494) were respiratoryhas been speculated tract. The for objectives NoVs; however, of this the study presence were toof successfullysamples, five ampli?ed (0.6%; 95% for full CI: length 0.21.6) HBV were genome, HBsAg andone evaluate the positivity rate for SaVs and the viral loads in clinical samples of children under six years of age, in association with symptoms presented by these children. region.(Y513) Phylogeneticfor PreS/S, BCP analysis (basal of core the Spromoter) gene showed and thatPre Therefore, 204 samples were obtained from 102 children allC/C, isolates one (Y02) belonged for Pre to S/S,HBV and genotype one (Y413) A, subgenotypes for S gene (a stool sample and a nasopharyngeal swab from each A1 (n=3) and A2 (n=2). These results were further child) aged 065 months (mean 17 months). Samples were collected from May 2014 to May 2015 in Materno regions. Additionally, sequence analysis revealed that Infantil Hospital. Stool samples and nasopharyngeal allconfirmed HBV isolates by analysishad the T131N of other amino amplified acid substitution genomic swabs were extracted using a commercial kit (Qiagen in the S region (associated with persistence of the HBV Hilden, Germany), and screened by an RTqPCR Taqman

genogroups I, II and IV. To determine the viral load of as well as with vaccine escape). In the BCP and PreC/C assay, with specific primers and probe targeting SaVs regions,Virus Reviews we found& Research the Voldouble 20 (2), mutation August-December A1762T/G1764A 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

46 Oral Presentation the samples a standard curve using serial dilutions of a Argentina, where it was associated with undifferentiated recombinant plasmid was constructed. A positivity rate febrile illness. The Mayaro (MAYV), Chikungunya and Una (UNAV) viruses belong to Semliki Forest virus children, with a mean viral load of 5.12x109. The virus complex, being recognized MAYV activity in Central and of 18.6% (19/102) was observed in fecal samples from South American countries, with recent activity in Mexico. swab samples, with a mean viral load of 2.21x109. Also, In addition, the UNAV has been detected in several was also detected in 36.2% (37/102) of nasopharyngeal countries in South America. The present study aimed in both samples, with mean viral load in fecal samples to determine RNV, MAYV and UNAV seroprevalence of7.8% 1.21x1010 (8/102) and of the of 4.65x109children were in nasopharyngeal positive for the swabs. virus by plaque reduction neutralization test (PRNT) in 650 samples of Paraguayan individuals mainly from Central Department, period 20122013. Seroprevalence for RNV ofRegarding the children the symptoms, who were 89% positive (17/19) in ofnasopharyngeal children were swabspositive had for diarrhea. SaV in fecalVomiting samples, was andthe most 94% common (35/37) antibodies against MAYV were detected in the studied was 5.8%, and for UNAV it was 0.46%. No neutralizing positive in both samples (fecal and nasal swab). Data showsymptom the presentedoccurrence by of 87%SaV at of thehigh children viral loads that in were the whichpopulation. would The indicate 50.1% a of recent neutralizing virus antibodycirculation. titers In addition,against RNV it waswere observed high (equal a seroprevalence to or greater than increment 1/640), tendency as age increases, which suggests an endemic however,studied population. further studies We also are report, needed for to the better first elucidatetime, the presence of SaV in samples from the respiratory tract; indication of RNV and UNAV circulation in Paraguay, and thesebehavior data of will this serve virus. as These the basisresults for represent future studies the first to thisHV157 finding. - SEROLOGICAL EVIDENCE OF CIRCULATION OF search potential hosts and vectors of these viruses in the ALPHAVIRUS (VENEZUELAN EQUINE ENCEPHALITIS region. VIRUS AND UNA VIRUS) IN PARAGUAYAN POPULATION (2012-2013) HV212 - HIGH RATES OF DETECTION OF HUMAN Cardozo, F.M.; Konigheim, B.; Albrieu-Llinás, G.; RHINOVIRUS AND LACK OF ADENOVIRUS AND Rivarola, M.E.; Aguilar, J.; Rojas, A.; Páez, M.; Guillén, BOCAVIRUS SHEDDING IN ASYMPTOMATIC PATIENTS Y.; Diaz, L.A.; Vallejos, M.A.; Herebia, L.; Recalde, M.L.; POST TONSILLECTOMY Contigiani, M.S.; Mendoza, L.P. Martins Junior, R.B.; Prates, M.C.M.; Biasoli, B.; Rocha, 1. INSTITUTO DE INVESTIGACIONES EN L.P.; Aragon, D.C.; Silva, M.L.; Tamashiro, E.; Valera, F.; CIENCIAS DE LA SALUD, UNIVERSIDAD Lima, W.; Arruda, E. NACIONAL DE ASUNCIÓN FACULDADE DE MEDICINA DE RIBEIRÃO 2. INSTITUTO DE VIROLOGÍA “DR. J. M. PRETO VANELLA”, FACULTAD DE CIENCIAS Several studies have shown respiratory viruses infecting MÉDICAS, UNIVERSIDAD NACIONAL DE patients with chronic or recurrent tonsillar hypertrophy. CÓRDOBA 3. INSTITUTO DE PREVISION SOCIAL Recent studies by our group revealed high frequencies 4. HEMOCENTRO HOSPITAL DE CLINICAS tissues and nasopharyngeal secretions (NS) in the The Alphavirus genus includes viral species that produce absenceof respiratory of signs viruses and (97%)symptoms in samples of acute from respiratory lymphoid encephalitis in horses and humans, as well as febrile infection (ARI). We managed to obtain NS from 85 of illness with rash and arthralgia in humans. Among the those children (mean age 6 years) in posttonsillectomy producers of encephalitis are found epizootic subtypes of followup visits (mean time = 4.2 years), in the absence of Venezuelan Equine Encephalitis Virus (VEEV) complex. ARI symptoms. At the time of tonsillectomy, the overall This complex also includes enzootic subtypes that, frequency of virus detection in NS from those 85 children although they doesn’t cause disease in horses (except subtype IE), it can cause them in humans. The Rio detection posttonsillectomy in NS collected from the Negro Virus (RNV VEEV subtype VI), that circulates in was 71.7% (61/85). The overall frequency of virus Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

47 Oral Presentation same children in the absence of ARI symptoms dropped to 58.8%. Rhinovirus (RV) was the most frequently detected virus, in 38 of the subjects (44.7%), followed by enterovirus (EV) in 7 (8.2%), human metapneumovirus (HMPV) in 6 (7%), human respiratory syncytial virus timeHRSV of in tonsillectomy 3 (3.5%) and for human the same coronavirus 85 children HCoV were: in RV 1 (1.1%). The previous virus detection rates in NS at the in 27 (31.7%), human adenovirus (HAdV) in 19 (22.3%), EV in 18 (21.7%), HRSV and HMPV in 10 (11.7%) each, infollowed NS were by HBoV,generally HCoV lower. and RV influenza was the virus agent in ratesmost frequentlylower than 10%.detected Except overall, for RV, and the alsovirus the detection viral agentrates

3 with HMPV and 2 with EV. Tonsillectomy reduced the most frequently detected in coinfection (5 cases, 5.8%): at the time of tonsillectomy. The most striking result wasfrequency the absolute of virus lack co detectionof detection in NS,of HAdV which or was HBoV 70% in asymptomatic sheddingpatients post of HAdV tonsillectomy. and HBoV Thein NS. findings strongly indicate that tonsillectomy significantly reduces

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Oral Presentation BASIC VIROLOGY - BV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

49 Basic Virology: BV

BV8 - HISTOPATHOLOGICAL EVALUATION OF (siRNA) as viral replication inhibitor. In this work, siRNA MUSCULAR DAMAGE INDUCED BY MAYARO VIRUS targeting UL39 region was evaluated for HSE treatment USING ANIMAL MODEL Santos, F.M.; Silva, I.E.P.; Dias, R.S.; Oliveira, M.D.; intranasal with HSV1 and treated with siRNA:RVG9R in vivo. Methods: BALB/C mice were inoculated via Costa, I.C.T.A.; de Paula, S.O. antiHSV1. Mice were divided in experiments to evaluate UNIVERSIDADE FEDERAL DE VIÇOSA the kinetics of HSV1 replication inhibition, number of administered doses (one or two doses) of siRNA:RVG9R The Mayaro virus is an alphavirus of the Togaviridae antiHSV1 and treatment with siRNA:RVG9R antiHSV1 family, endemic in South American countries. It mainly combined with acyclovir in HSE experimental model. affects people in touch with forest areas, because it is a Besides that, HSE clinical signs, mortality and viral sylvatic cycle virus. The Mayaro fever is characterized replication inhibition in brain and trigeminal ganglia were evaluated to measure siRNA therapy. Results: present as severe and debilitating as a result of the In kinetics experiment, treated group demonstrated developmentas an acute selfof limitinglong lasting illness, crippling but it canarthritis. sometimes Now arthralgia induced alphavirus. The aim of this study reduction of HSE clinical signs and a significant virus a days there is no specific treatment for arthritis and was to evaluate the histological damage induced by treatedreplication with inhibition two doses varying of siRNA from 43.6%showed to prolonged 99.9% in Mayaro virus using a murine animal model. For this we survivalbrain and time, from reduction53% to 98% of in HSE trigeminal clinical ganglia. signs and Animals viral were infected in the left rear footpad, the control group used BALB / c mice with fifteen days old. The animals received only phosphate buffer (PBS). At 3, 7, 10, 15 and 9Rreplication antiHSV inhibition1 combined in brainwith acyclovir (67.7%) anddemonstrated trigeminal ganglia (85.7%). Also, animals treated with siRNA:RVG

20 days three animals were sacrificed and the organs reduction of HSE clinical signs and survival of 100%, as and tissue of interest were removed and fixed. They and stained with hematoxylineosin (HE). The analysis of demonstratedwell as viral replication that siRNA inhibition was capable in brain of reducing (83.2%) HSEand were then embedded in paraffin, cut into 5?m sections muscle sections of both, hind limbs and forelimbs, at 7 clinicaltrigeminal signs, ganglia prolonging (74.5%). survival Conclusions: time Theseand inhibiting findings HSV1 replication in mice. Thus, siRNA can be a potential alternative to standard HSE treatment especially to days post infection showed the presence of inflammatory analyses in other tissues and in other days are yet to extend survival time and reduce the clinical signs of HSE infiltrates and winding muscle fibers. However, damage be made and also other histological techniques such as in vivo. immunohistochemistry to determine target cells in the affected tissues. BV19 - MOLECULAR CHARACTERIZATION OF A INOVIRUS THAT INFECTS RALSTONIA SOLANACEARUM BV13 - RNA INTERFERENCE ANTIVIRAL THERAPY Andrade, P.O.; Almeida, J.C.F.; Xavier, A.S.; Cascardo, AGAINST HERPETIC ENCEPHALITIS R.S.; Andrade, P.O.; Lopes, C.A.; Alfenas-Zerbini, P. Silva, A.S.; Raposo, J.V.; Pereira, T.C.; Pinto, M.A.; de 1. UNIVERSIDADE FEDERAL DE VIÇOSA Paula, V.S. 2. CENTRO NACIONAL DE PESQUISA DE HORTALIÇAS 1. FUNDAÇÃO OSWALDO CRUZ, INSTITUTO OSWALDO CRUZ Viruses that infect bacteria are the most abundant 2. UNIVERSITY OF SÃO PAULO RIBEIRÃO PRETO organisms on the planet, and can have its genome DNA or RNA. Currently, due to increasing resistance of bacteria Introduction: Herpetic encephalitis (HSE) is an acute to antibiotics, phages can be an important biocontrol encephalitis caused mainly by Herpes simplex virus 1 tool, which is known as phage therapy. An important phytopathogenic bacterium to be controlled is the inhabitants. Nowadays, HSE treatment has encountered (HSV1) with an annual incidence of 14 cases/million of Ralstonia solanacearum, which causes a disease known as bacterial wilt, an infection that affects more than 50 toxicity, metabolic side effects and HSV1 resistance. An plant families and is responsible for the annual loss of alternativedifficulties tosuch antivirals as utilization is the use of antiviralsof small interfering with elevated RNA

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Basic Virology: BV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

50 Basic Virology: BV several crops such as, tomatoes, potatoes, eggplant and banana. This study aims to characterize a bacteriophage best models to predict the number of cases in a time at a molecular level isolated from a R. solanacearum periodthe models after to the minimize one contemplated the prediction in theerrors; data apply set. The the from Ceará, Brazil. Morphological characterization of the viral particle was performed by transmission electron CHIKV, climatological data and number of searches for thepredictive word \"chikungunya\" variables used were on the the Internet confirmed through cases the of with aprox. 2,000nm. The viral genome has aprox. Google Trends (GTRENDS) tool. The data was collected 8.000nt.microscopy, The the genome particules sequence are flexuousus and the morphologicaland alongated characterization suggest that the virus belongs to the using the statistical package R. Training and testing of Inoviridae family, genus Inovirus, which multiplies thefrom model 09/2014 were to performed 09/2015, using organized the package and normalized caret. It in a pseudo lysogenic manner, establishing a close was observed that the variables mean temperature, relationship with the host. Biological characterization of maximum temperature and GTRENDS combined showed the virus showed that isolates of Ralstonia solanacearum infected by these viruses, still maintained the ability in the number of cases with low error (RMSE=11.25). to colonize its host, bur was no longer pathogenic. The the best results, being able to predict the fluctuation virus isolated here showed a high sequence similarity with other Inovirus TypeRSM, that reduce the virulence We evaluated the increase/decrease of cases, and of their hosts. Studies of virus host interaction in this ofthe climatic results variables were even in the better dispersion (100% specificityof vectorborne and pathosystem will be usefull to better undestand the diseases,100% sensibility). corroborating We couldother studies, observe which the importance show that pathogenicity mechanisms of R. solanacearum. the climate plays a fundamental role in the life cycle of the vectors. We can also see the importance of the use of BV25 - PREDICTION OF THE FLUCTUATION OF THE keyword search data via the web, today being a manner CASE NUMBERS OF CHIKUNGUNYA FEVER IN FEIRA widely used to search for information, and which can DE SANTANA – BAHIA, USING TECHNIQUES OF help us in monitoring of diseases. We argue that this MACHINE LEARNING digital surveillance approach can be as effective as and Costa, J.D.D.; Vianez Junior, J.L.S.G. cheaper than the traditional techniques employed by the INSTITUTO EVANDRO CHAGAS Ministry of Health for epidemiological surveillance. The chikungunya virus (CHICKV) is a member of the BV61 - VIRTUAL SCREENING STUDY OF COMPOUNDS family Togaviridae, genus Alphavirus. The vectors AGAINST PROTEIN C MAYARO VIRUS FOR are the mosquitoes of the genus Aedes, especially A. IDENTIFICATION OF ANTIVIRAL Ferreira, P.G.; Figueiredo, J.E.; Ferraz, A.G.; Taranto, was in September 2014, with reported cases in Amapá A.G.; Magalhães, C.L.B.; Ferreira, J.M.S.; Magalhães, andaegypti. Feira The de firstSantana. report One of autochthonousof the possible transmissionapplications J.C. of the techniques of machine learning (ML), devised in this study is the development of statistical models UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL REI able to predict, using various variables, when a future The Mayaro fever, caused by the Mayaro virus (MAYV) is a sublethal disease to humans, and symptoms are quite the case numbers a disease already installed, allowing similar to another arboviruses like dengue, chikungunya tooutbreak assist the may development occur, or even of strategies predict fluctuationsfor combating of and yellow fever. Symptoms of arthralgia associated with epidemics. The objectives of this work were to infection by MAYV can cause a highly disabling disorder, determine whether selected predictive variables are similar to that caused by Chikungunya virus. In recent years, they have been widely documented outbreaks in metropolitan areas and, to date, there is no therapy able to determine the fluctuation in the number of available. Therefore, this study aimed to perform the whichCHIKV casesenvironmental in Feira devariables Santana; are determine most useful the best to Virtual Screening method using the threedimensional technique of ML for the problem at hand; determine model of the C protein of MAYV as a target for the predictVirus Reviews the & number Research of Vol cases; 20 (2), adjustAugust-December the parameters 2016 - Abstracts/Posters of - Basic Virology: BV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

51 Basic Virology: BV screening and development of new antiviral drugs. The epitope prediction is a useful tool for vaccine design Previously, the threedimensional model of C protein of because we could assess structural properties, cross MAYV was constructed using C protein of Aura virus reactions and recognition by the immunoglobulins in complexed with dioxane (PDB 4AGJ_A) as template. a cheaper and faster way, working with large amounts Initially, the dioxane was transferred to C protein of of data so that various experimental stages of vaccine MAYV through Discovery Studio 3.1 software. Then, in development can be abbreviated. Therefore, this study the AutoDock program was built a box centered in this aimed to predict CD4+ Tcell epitopes in HPV proteome that could be used for human immunization. In order to be anchored. In order, to validate the method, we carried do this, a local database was created for all HPV protein outligand the to redocking, define the consistedregion in whichto anchor the molecule the dioxane would in the region delimited by the box and superimpose the with information regarding their physicochemical and conformation obtained for that ligand to crystallized structuralsequences characteristics. retrieved from UsingProtein/NCBI IEDB Analysis database, Resource, along conformation. The molecules obtained from the ZINC epitopes for these proteins were predicted using MHCII database and literature had their charge calculated Binding Predictions tool according to the most frequent to physiological pH and threedimensional structure HLAA alleles. The analysis showed that 34 epitopes were highly immunogenic, and they presented high identity preparation, the molecules were anchored protein C with other HPVs. These epitopes are intrinsically defined by the MarvinSketch 15.8.24 program. After a cube with dimensions of 14x14x14 Å and coordinates HLAA alleles in the world population. Finally, these X,using Y and the frameworkZ 23833, 11281 Octopus and 1.0. 9142, The box respectively. was defined The as epitopesassociated were with mapped the response into theof more 3D structure than 70% of of HPV the superimposition of conformations of dioxane provides the RMSD value of 1.92 Å, validating the methodology. surface. Therefore, it was possible to predict a promising The value obtained for the binding energy of dioxane was CD4+proteins, Tcell confirming epitope set their in accessibilityHPV proteome on thewith protein high protein, and 6 molecules belonging to the same chemical of individuals worldwide, being a strong candidate for 2.8 kcal/mol. A total of 590 molecules were anchored C animmunogenicity epitopebased thatvaccine may with present high a capacity response to in activate >70% mol. These results show promising antiviral molecules immune response and the possibility of crossprotection class, show favorable binding energy of around 7.0 kcal/ among different HPV types. These promising results can which is believed to interact with E2 protein to promote serve as basis for further studies to develop synthetic viralagainst budding. MAYV, since they have affinity to a protein site peptides and test their immunological response, which could lead to new prophylactic strategies to prevent BV64 - COMPUTATIONAL PREDICTION OF CD4+ cervical cancer. TCELL EPITOPES IN HUMAN PAPILLOMAVIRUS PROTEOME BV91 - EVALUATION OF THE CORAL EXTRACT OF Batista, M.V.A.; Prado, F.O.; Rocha, P.A.S.; Matos, A.S. MUSSISMILIA BRAZILIENSIS AS AN INHIBITOR OF UNIVERSIDADE FEDERAL DE SERGIPE HTLV1 REPLICATION Carvalho, L.D.; Martins, C.P.S.; Reis, J.K.P.; Kassar, T.; Human papillomavirus (HPV) is the major cause of Resende, C.F.; França, J.P.; Melo, S.R.G.; Marin, L.J.; cervical cancer worldwide. Tumors associated with HPV França, L.P.; Franco, G.M.; Dantas, A.N.G.; Pellizoni, in the cervical region are common and constitute a serious T.A.; Souza, G.O.S. public health problem. Until now, there are approximately 200 HPV types already known. However, only 18 HPV UNIVERSIDADE ESTADUAL DE SANTA CRUZ types are associated with malignant transformation, Human T cell lymphotropic virus type 1 (HTLV1) is known which are called as highrisk HPVs. Although there are a to be a major agent of severe and fatal lymphoproliferative tetravalent vaccine available, it cannot prevent against all highrisk HPV types. In this way, wider spectrum vaccines should be developed in order to prevent HPV infections. disease named adult Tcell leukemia/lymphoma (ATLL), and HTLV1 associated myelopathy/tropical spastic Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersparaparesis - Basic (HAM/TSP), Virology: BV a neuroinflammatory disease. XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

52 Basic Virology: BV

no variation does not present enough phylogenetic signal in order to proper group together the studied Moreover, HAM/TSP is very common in Brazil, and until havethe present been attempting time, there to is isolateno consensus and characterize on the specific new phylogenetic informative regions in a genome that extractstreatment which for HAM can / TSP).inhibit For HTLV this reason,1 replication researchers and presentstaxa. So, aa relevant balanced task quantity in phylogeny of sequence is to find variation. the most In infection. Mussismilia braziliensis (phylum Cnidarian, this context, Shannon entropy has been shown to be a class Anthozoam, family Mussidae) is endemic in Brazil and is found along the coast of Bahia state. The potential In addition, in many viral epidemiological and population antimicrobial activity of several cnidarian species against geneticsgood measure studies, in orderthe number to find ofthose samples informative analyzed regions. could different microorganisms has been shown previously by be enormous, which makes the whole genomic approach others. However, M. braziliensis has never been tested as very expensive. Therefore, the entropy approach has an antiviral agent. The present study aimed to investigate the potential antiviral effect of M. braziliensis coral with satisfactory phylogenetic signal that could be used extract in MT2 cell lines permanently infected with HTLV inbeen larger applied studies. with Recently,success in some finding attempts genomic have markers been 1. Coral extract from M. braziliensis was obtained and made to develop degenerate primer design tools. One of dissolved in RPMI. To perform cell viability assay, HTLV1 them uses the entropy measure to position the primers, infected (MT2 cells) and not infected (Jurkat cells) were but the problem is that the user has to inform the incubated in the presence or absence of coral extract (cell control) at concentrations of 10, 30, 80 or 100mg a novel entropybased computational tool that selects using MTT method. No cytotoxicity was observed in any phylogeneticregion that has informative to be amplified. genomic Therefore, regions coupled we present with concentration of the extract tested. The mRNA levels degenerate primer design applied to the detection and using realtime PCR. . The results demonstrated that M. phylogenetic markers and proposes suitable degenerate braziliensisof the viral extract genes tax/rexwas able and to inhibit gag/pol the were expression evaluated of primersgenotyping to amplifyof viral andsamples. sequence This toolthem, identified which could proper be used in different viral epidemiological and population based genetic studies. To evaluate the tool, we selected tax/rex mRNA at concentration of 80 mg with significant 12 different types of Bovine papillomavirus (BPV) and Hence,p value coral(p < 0.05).extract Antiviral from M. activity braziliensis on gag/pol may inhibitmRNA viralwas not replication observed inat anypermanently concentration HTLV tested1infected (p > 0.05).MT2 suitable for phylogenetic analysis. Thereafter, multiple sequencewe have identified alignment a usinggenomic the regionalgorithm in L1 implemented gene that was in it may be useful for development of new treatment for software MEGA5 was performed. It was calculated the HTLVcells, reducing1 infection. expression of viral mRNAs of tax/rex and, average value of entropy, site to site, and low entropy regions were selected. Subsequently, primers were BV95 - A NOVEL ENTROPYBASED COMPUTATIONAL designed and developed in conventional PCR. Four TOOL TO IDENTIFY MOLECULAR MARKERS AND different concentrations of new primers were tested DESIGN PRIMERS FOR VIRAL DETECTION AND and all BPV samples were detected. Thus, new primers GENOTYPING were designed from the entropy method, which showed Santos, F.L.S.G.; Barreto, D.M.; Barros, G.S.; Araújo, E.D.; Paiva Júnior, S.S.L.; Balbino, V.Q.; Batista, M.V.A. BPV DNA. In conclusion, this tool could be implemented 1. UNIVERSIDADE FEDERAL DE SERGIPE very good sensitivity and specificity for the detection of 2. UNIVERSIDADE FEDERAL DE PERNAMBUCO methods. Phylogenetic analyzes of molecular sequences are to increase the efficacy of different viral diagnostic an integral part of many modern molecular and evolutionary biology studies. In phylogenetic analysis, a genomic region that presents high mutational rate are affected by the saturation effect, and a region with

53 Basic Virology: BV

BV105 - SYNTHETIC AMINOCHALCONES INHIBIT BV113 - INVESTIGATION OF ARBOVIRUS IN HEPATITIS C VIRUS REPLICATION CHIROPTERA Pereira, C.M.; Oliva, C.B.; Santos, M.B.; Regasini, L.O.; Machado, R.R.G.; Comelis, M.T.; Cornacini, F.H.; Rahal, P.; Jardim, A.C.G. Beguelini, M.R.; Versute, E.M.; Nogueira, M.L.; Rahal, 1. INSTITUTO DE BIOCIÊNCIAS, LETRAS E CIÊNCIAS P.; Bittar, C. EXATAS/UNIVERSIDADE ESTADUAL PAULISTA 1. UNIVERSIDADE ESTADUAL PAULISTA \ JÚLIO DE 2. INSTITUTO DE CIÊNCIAS BIOMÉDICAS/ MESQUITA FILHO'' INSTITUTO DE BIOCIÊNCIAS, UNIVERSIDADE FEDERAL DE UBERLÂNDIA LETRAS E CIÊNCIAS EXATAS Hepatitis C is a liver disease caused by the hepatitis C 2. FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETO virus (HCV) and about 170 million people are estimated 3. UNIVERSIDADE FEDERAL DO OESTE DA BAHIA to be infected worldwide. The current therapy available to CENTRO DAS CIÊNCIAS BIOLÓGICAS E DA SAÚDE the chronically infected patients is based on interferon?, The arbovirus, are characterized by being maintained ribavirin and direct acting antivirals (DAAs). However, in nature in cycles involving hematophagous arthropod this treatment is expensive, presents several side effects vectors and a wide range of hosts. These hosts are often and the antiviral resistance has been documented, vertebrates, especially mammals and birds. Among demonstrating the need of new therapeutical mammals, it is believed that various zoonosis originates approaches. In this context, natural compounds have on bats. They present a broad geographical distribution, demonstrated medical interest due to their biological direct or indirect contact with the human population. secondary metabolites with several properties, including Lately,being able such to flyvertebrates, long distances, have beingreceived often increasingcome into antiactivities.HCV activity. Among The them, addition flavonoids of an amino are a group class ofinto plant the attention as an important source for the emergence chemical structure of the precursors chalcones results of zoonosis and possibly as viral reservoirs. Among in the aminochalcones. This subclass of compounds has the arbovirus, there are many representatives of the previously showed to possess antiseptic, antifungal, genus Flavivirus and Alphavirus, being responsible for antitumor, and antimalarial activities. Here we evaluated important epidemics such as Dengue virus, Zika virus the antiviral effects of 35 synthetic aminochalcones on and Chikungunya virus. This study aims to investigate the HCV replication by using a subgenomic replicon system presence of arbovirus of the Flavivirus and Alphavirus of HCV (genotype 2a SGRFeo JFH1). Huh7.5 cells stably genus, in bats, based on the importance of the analysis harboring SGRFeOJFH1 were treated with compound for of potential viral reservoirs for zoonosis control. Also, 72 h and cell viability (MTT) and replication (luciferase to provide information that can contribute to the assay) were analyzed. The results demonstrated that epidemiological surveillance of high impact diseases in the compounds D15 and D18 at nontoxic concentration public health. Bats were collected from São José do Rio Preto (São Paulo) and Barreiras (Bahia), were euthanized, The favorable ratio of cytotoxicity to antiviral potency inhibited 35 and 70% of HCV replication, respectively. followed by removal of the liver of each individual. The

(SI = CC50/EC50) was evaluated for both compounds analysis, cDNA was synthesized. PCR for the endogenous RNA was extracted and after quantification and quality (Selective Index – SI, D15 1.0; D18 4.9) by calculating gene betaactin was performed for all samples in order the ratio of cytotoxic concentration of 50% (CC50 – D15 to evaluate the cDNA quality. Samples were tested for Flavivirus and Alphavirus by PCR and nestedPCR using conclusion,= 9.4 µM; D18 the = aminochalcones 10.0µM) and effective D15 and concentration D18 exhibited of antiinhibitionHCV activity. of 50% Further(EC50 D15 analysis = 9.2 willµM; beD18 performed = 2.0µM). Into analyzed on one percent agarose gels. Fiftyseven bats investigate the action of these compounds on the other samplesspecific primers.tested so Finally, far were the negative nested PCRfor theproducts presence were of steps of the HCV replicative cycle. Flavivirus and Alphavirus. The results indicate that the animals examined were not infected with arbovirus at the time of collection, indicating that they probably do not constitute a reservoir for these viruses in the studied Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Basic Virology: BV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

54 Basic Virology: BV areas. Serological tests are required to determine These results indicate that after intranasal inoculation, whether the animals had previous arbovirus infection VCJS induces acute encephalitis in adult mice which is that did not become persistent. associated with intense histopathological changes in the brain parenchyma and meninges. Morphological BV131 - CHARACTERISATION OF CEREBRAL INJURIES AND MICROGLIAL ACTIVATION DURING INFECTION INDUCED BY CARAJAS VIRUS microglial activation and inflammatory histopathological Diniz, J.A.P.; Cavalcante, M.S.B.; Santos, D.S.; changesBV133 - wereINHIBITION fatal to 60% OF ZIKA of infected VIRUS, animals. CHIKUNGUNYA Vasconcelos, P.F.C. VIRUS REPLICATION AND DERIVED FROM NATURAL INSTITUTO EVANDRO CHAGAS PRODUCT EXTRACTS Campos, R.M.; Cirne Santos, C.C.; Barros, C.S.; The Carajas virus (VCJS) is a Rhabdoviridae family Nogueira, C.C.R.; Paixão, I.C.P.; Teixeira, V.L.; Campos, member, genus Vesiculovirus. It was isolated from R.M.; Ferreira, D.F. (Carajás region, Pará State, Brazil), in 1983. Although 1. DEPARTAMENTO DE VIROLOGIA, INSTITUTO DE MICROBIOLOGIA PAULO DE GÓES itssandflies isolation (Lutzomyia occurred spp) more caught than intwo the decades Serra Norte ago, 2. DEPARTAMENTO DE BIOLOGIA MARINHA little is known about its neuropathological features. INSTITUTO DE BIOLOGIA OBJECTIVES: The aim of this study was to characterize Viruses transmitted by arthropods (commonly called the experimental neuropathology induced by VCJS in arboviruses) normally circulating in nature through adult mice, after intranasal inoculation. MATERIAL biological transmission between susceptible vertebrate AND METHODS: VCJS infected animals were observed hosts and bloodfeeding arthropods, such as mosquitoes. twice a day for clinical signs followed by histological and immunohistochemistry procedures to detect an accurate diagnosis of arboviral diseases that currently viral antigens and activated microglia at the 5th, 10th haveSeveral had studies major haveimpact shown on health, a wide such difficulty as infection of reaching Zika and 15th postinoculation days (d.p.i.). RESULTS: VCJS virus and Chikungunya. Moreover, as there is no effective infected mice showed bristling, hunched posture, treatment or vaccine available, and such viruses may be hyperemic conjunctiva, hind limb paralysis, circular associated with serious diseases such as microcephaly unintentional movements and weight loss. Sixty in case of infection Zikavirus, as well as severe muscle percent of the individuals died between 14 and 16 d.p.i. and joint injuries with prolonged recovery time for Histopathological increased as disease progressed from Chikungunya. The aim of this study was to assess 5th to 15th postinoiculation. At 5th d.p.i. it was observed inhibition of marine natural product extracts and others. To perform the tests, 96well plates containing 2.0 X 104 whereas at 15 d.p.i, midbrain and diencephalon areas aroundonly discrete the ventricles,leukocyte infiltrate cerebral and aqueduct vascular and congestion, vessels bovinevero cells serum, were 2mM maintained L glutamine at , 37ºC plus 100?g with 5%of Penicillin CO2, in proliferation and vascular ectasia, lytic necrosis, pyknotic andModified Streptomycin. Dulbeco Medium Initially supplemented the cells were with 5%exposed fetal nuclei,vicinity, cariorrexis,showed mixed small leukocyte hemorrhagic infiltrate, foci, endothelial capillary to increasing concentrations of 8 different extracts congestion and in some cortical regions, meningeal evaluated for obtaining CC50. Subsequently, infected cells were isolated and Zika an Chikungunya at an MOI detected viral antigens in the same regions as described of 0.01 and treated with different concentrations of the above,inflammation especially was at later observed. stages. Immunohistochemistry Cortical changes were also apparent in the frontal, temporal and entorhinal ml respectively. The extracts evaluated, we found that at areas, hippocampus and olfactory bulb. The greatest extracts evaluated, 0.5, 1.0, 5.0, 10.0, 20.0 and 40.0?g/ degree of microglial activation occurred at 10 d.p.i. More both Zika as the Chikungunya dose dependent manner. intense morphological signs of microglial activation Interestinglyleast 4 of the theextracts four werebest resultsable to areinhibit seaweeds, significantly as is coincided with the same regions where the viral antigens the case of Osmundaria and Caulerpa who had EC50 of and cellular lesions were detected. CONCLUSION:

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Basic Virology: BV 1.4µg/mL and 4.2µg/mL to Zika virus and 1.82µg/mL XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

55 Basic Virology: BV

and 1,98µg/ml for Chikungunya. Both extracts showed were better seen in Vero cells than in C6/36 cells from respectively.indices of promising The results selectivity, of our 420/288 group for showed Osmundaria large cell.the thirdSyncytia subculture were seen (T3), within however 4 days the C6/36in Vero showed cells, substancesand 174.2/369.7 development Caulerpa possibilities to Zika and with Chikungunya antiviral more intense fluorescence when compared with Vero potential for Chikungunya and Zika, demonstrating the possibility of reducing the aggravation of frames and while in C6/36 cells syncytia were seen in 6 to 10 days. severity of these infections. cycleC6/36 thresholds cells were, (Ct) on bythe qPCR other were hand, T1=17.26, more efficient T2=15.5 to andproduce T3=9.52. quantitatively The Vero the ZIKV.subcultures The C6/36 Cts subcultures by qPCR BV136 - ANALYSIS OF A PROTOCOL FOR ZIKA VIRUS CULTURE IN VITRO subculture titers by PRNT were T1=6x108, T2=7.5X106, Mendes, E.A., Melo S.R.; Mesquita, F.S.; Braconi, T3=4X1012.were T1=20.0, The T2=19.89 Vero subculture and T3=14.17. titers by PRNT The C6/36 were C.T.; Silveira, V.B.; Thomazelli, L.M.; Zanotto, P.M.A.; T1=9.5x104, T2=3x102, T3=2x104. Conclusions. The Botosso, V.F.; Araújo, D.B.; Favoretto, S.R.; Durigon, E.L.; Oliveira, D.B.L. produces higher titers and lower Cts compared to Vero 1. LABORATÓRIO DE VIROLOGIA CLÍNICA cellresults line showed in the same that the subculture, growth of although ZIKV in C6/36 Vero cells cell lineare E MOLECULAR, INSTITUTO DE CIÊNCIAS better to detect cytopathic effects of ZIKV and formation BIOMÉDICAS, UNIVERSIDADE DE SÃO PAULO of syncytia. 2. INSTITUTO BUTANTAN Introduction. Zika virus (ZIKV) is a RNA virus that BV 140 - GENOTYPIC DIVERSITY OF CLINICAL belongs to the Flaviviridae family, like dengue and yellow ISOLATES OF CANTAGALO VIRUS fever viruses. After the ZIKV outbreak in Brazil and in Oliveria, L.S.; Resende, B.C.; Damaso, C. the context of a global emergency, researchers all over INSTITUTO DE BIOFISICA CARLOS CHAGAS FILHO the world, especially in Brazil, needed to standardize UNIVERSIDADE FEDERAL DO RIO DE JANEIRO diagnostic methods for this virus. With this purpose, the Vaccinia virus (VACV) is the prototypic species of the ability to grow the virus in vitro as an option to provide family Poxviridae and has been isolated from pustular diagnosis in cases of doubt is a useful tool. Further, lesions in dairy cows in Brazil for the last two decades. with reports of microcephalic babies and brain damage associated with ZIKV, it was necessary to start studies to clarify the physiopathology of ZIKV, in order to bring a studiesCantagalo based virus on (CTGV) full genomeis a field sequencesstrain of VACV shows and thatwas better understanding of how the virus is causing these CTGVfirst isolated shares a inmost 1999 recent in Rioancestor de Janeiro. with the Phylogenetic VACV strain problems. With this purpose, we started to expand ZIKV IOC used as smallpox vaccine in Brazil. After 1999, other in cell culture to be distributed for research laboratories outbreaks of CTGV or viruses similar to CTGV (CTGVlike) interested in basic and applied research on it. This have been reported in several Brazilian states. Analysis was an important support for the research community of the whole genome sequences showed differences interested in ameliorate the current knowledge of between CTGV1999 and other CTGVlike isolated ZIKV. In this context, we present results obtained with afterwards in other regions. CTGV1999 has a deletion of about 4.5 kb in 5’ region of the genome corresponding to the CPXV 77kDa and C9L virulence genes, but these the culture of one of the first Brazilian isolates of ZIKV as a contribution for the begging of efforts on ZIKV in genes are present in other few CTGV like that were obtained from Evandro Chagas Institute/PA (ZIKVIEC) Brazil. Methods. ZIKV was grown in Vero cell line and examined. Nevertheless, only a few genome sequences of CTGVlike are available in public databases, which Reverse TranscriptionPCR (qPCR) was used to follow all limit our understanding on the genetic diversity of the C6/36 cell line in three subcultures (T1T3). Quantitative the subcultures, along with titration by Plaque reduction different clinical isolates of CTGVlike in Brazil. Therefore, the goal of this study is to detect major deletions in monoclonal antibodies for Zika virus was also used CTGVlike genomes, mainly the presence or absence of forneutralization virus characterization. test (PRNT). Results. Immunofluorescence Cytopathic effects with Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Basic Virology: BV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

56 Basic Virology: BV the 4.5 kb deletion. PCR assays were performed with signs, similarly to the effects of the licensed smallpox vaccine Acam2000. Infection with the parental VACVIOC collected from milkers and cows between 1999 and caused weight loss at intermediate levels between both 201364 clinical in the isolatesNorth, Central identifiedWest as and CTGV Southeastlike that regions were clones. Moreover, mice were fully protected from a lethal challenge with VACVWR. Genome sequencing revealed a 4.5kb deletion in the 3’ inverted terminal repeat (ITR) andof Brazil; 48 samples nine samples did not presentedpresent the the deletion. genetic The pattern data junction of B388 genome. More importantly, orthologs of revealof CTGV a1999 relationship relative toof the temporal CPXV 77kDa/C9L and geographical deletion K3L and C3L genes were fragmented in B141 genome but intact in B388. To further investigate VACVIOC diversity, caused outbreaks in the Southeast Brazil and presented disposition; all CTGVlike samples isolated until 2003 the genome terminal regions of the 30 clones by long 2013 were collected in CentralWest or North regions PCRwe isolatedrevealed thirtythree different additional patterns: clones. a Amplification 9 kbend similar of the CTGV1999 signature; most CTGVlike from 2006 to to B141, a 4.5kb pattern at the 3’ end similar to B388, and an 8kb end similar to clone A111 that was recently isolatesand only from6 were RJ isolated collected in Southeastin January Brazil; 2003 allpresented of them sequenced. The genomes of four clones were sequenced, bothhad the signatures, CPXV 77kDa/C9L suggesting genes. a potential Interestingly, cocirculation 2 clinical of and two had a 7.7kb deletion at the 5’ variable region genetically distinct viruses. Another region at the 3’ end of the genomes was analyzed and corresponded to the PCR. Nevertheless, the plaque phenotype varied greatly betweenof the genome clones outside sharing the regionthe same amplified terminal by the region long Serro2 virus, a CTGVlike virus isolated in Minas Gerais pattern, suggesting that these deletion patterns might inB16R/B17L 2006. None genes, of the which 39 samples are absent analyzed in the so far genome had the of not correlate with differences in plaque phenotype or virus production. VACVIOC clones branched within a results suggest the existence of a genetic diversity in the novel, independent phylogenetic cluster formed also BrazilianB16R/B17L CTGV deletion clinical similarly isolates. to CTGV1999. Thus, the and Serro2, and the supposedly VACV ancestor horsepox BV142 - GENETIC AND BIOLOGICAL DIVERSITY OF virus.by the Interestingly,field strains of this Brazilian novel clustervaccinia branched virus Cantagalo as the VACCINIA VIRUS STRAIN IOC Medaglia, M.L.G.; Santos, I.P.F.; Moussatché, N.; to the Eurasian cluster. A historical investigation was Damaso, C. undertakensister group and to suggested the American/Dryvax that both the cluster, Dryvax andand notthe INSTITUTO DE BIOFISICA CARLOS CHAGAS FILHO IOC strains were derived from the Beaugency strain, UNIVERSIDADE DEFERAL DO RIO DE JANEIRO which would explain their phylogenetic relationship.

BV144 - MOLECULAR AND BIOLOGICAL Poxviridae) was the vaccine strain used for the CHARACTERIZATION OF AN AURA VIRUS ISOLATE manufactureVaccinia virus of strainthe Brazilian IOC (VACV smallpoxIOC; vaccine Orthopoxvirus, by the Instituto Oswaldo Cruz–RJ until late 1970s. It confers Mosimann, A.L.P.; de Siqueira, M.K.; Ceole, L.F.; Duarte crossimmunity against variola virus and possibly dos Santos, C.N. originated from the Beaugency strain imported from INSTITUTO CARLOS CHAGAS, FIOCRUZ France in 1887. In this work, we investigate the genetic Aura virus (AURAV) is a member of the Alphavirus genus, and biological features of VACVIOC, and its phylogenetic that encompasses different arthropod borne viruses relationships with other VACV strains. Hereto, we (arboviruses), many of which are involved in the etiology initially isolated VACVIOC clones B141 and B388. Both of encephalitis or diseases whose main symptoms are clones showed similar virus production and spread fever, rash and arthralgia. Its genome is constituted of in cell culture. However, intranasal infection of mice a positivesense singlestranded RNA of approximately 11,7 kb. Previous studies have shown a closer antigenic whereas infection with clone B141 did not. Furthermore, and phylogenetic relationship with Western equine infectionwith clone clone B388 B141 caused did a not transitory cause any 10% other weight clinical loss, encephalitis virus and Sindbis virus, however only a

57 Basic Virology: BV single complete genome sequence is available in the drugs capable of inhibiting viral replication without interfering with the host cell metabolism. In this context, it has been widely reported the use of natural products, beenGenBank collected database in the (NC_003900.1). vicinity of the city The of first Belém isolates (Brazil) of mainly medicinal plants as a material for the antiviral andAURAV in werethe Misiones identified province in pools (Argentina).of mosquitoes There that hadare drugs development. Thus, this study aims to evaluate no posterior accounts of new virus isolations and the the antiviral activity of compounds isolated from available data indicate it does not have another known native medicinal plants of CentroOeste against human host, therefore it is considered nonpathogenic to humans herpesvirus 1 and aichivirus as well as determine their and its distribution restricted to South America. During a work with a sample in which it had been previously adamantiumaction mechanisms. and CampomanesiaFor this, five previously xanthocarpa purified were and phenotypes in insect and mammalian cell cultures that testedidentified against substances herpesvirus extracted humano from 1 Campomanesiaand aichivirus. wereidentified not compatible a dengue virus with serotype dengue virus3, we infection. have identified Using transmission electron microscopy and sequencing of comparative and preparative thinlayer chromatography, The substances were prefractionated and purified by of an AURAV was possible. Considering the scarce cultures were performed and the cytopathic effects were informationnonspecifically on amplified AURAV and PCR the products medical the importance identification of observedand identified by inverted by spectroscopic microscope. analyzes.The cytotoxic Vero assay cell other members of the same genus, the present work was performed by the MTT method and the antiviral aimed at the genetic and biological characterization of activity was determined by the viral titer reduction using this new isolate. The genetic analysis involved sequencing the statistical method of Reed & Muench, expressed in viral inhibition index (IIV) and percentage inhibition (PI). The index of selectivity (IS) was calculated as theof the new whole isolate genome was compared after amplification to the only throughother complete RTPCR the ratio of CC50 and ED50. The tests showed that the sequenceusing sequence available specific many primers. nucleotide When and the sequenceamino acid of differences were observed throughout the genome. Moreover, with regard to the biological characterization, 44,05substance of IS. This 5,7 substance dihydroxy also6,8di showedCmethylflavanone antiviral activity was active against HSV1 presenting 99,8% of inhibition and AURAV infection than the BHK21 cell line. The complete and 27,95 of IS. The remaining substances showed no characterizationthe C6/36 cell lineof this seems isolate to be will more contribute susceptible to the to antiviralagainst aichivirus,effect. Before with that, 99,8% the study of antiviral prove that inhibition one of knowledge on the basic biology of viruses belonging to the substances tested showed activity against HSV1 and this genus and possibly open avenues for its use as a aichivirus, allowing potential antiviral effect. According biotechnological tool. antiviral activity of Campomanesia sp. BV148 - ANTIVIRAL EVALUATION OF VEGETABLE to the literature review, this is the first study related to COMPOUNDS AGAINST HUMAN HERPESVIRUS 1 AND BV152 - ANTIVIRAL BACTERIOCIN EVALUATION AICHI VIRUS PRODUCED BY LACTOBACILLUS PLANTARUM ST8SH Berlanda, R.L.A.; Mendes, G.S.; Jesus, M.G.; Vilas AGAINST HERPES VIRUS HUMAN TYPE 1 Boas, L.C.P.; Teixeira, L.C.G.C.L.; Lima, L.M.P.; Cardoso, Jesus, M.G.; Berlanda, R.L.A.; Nunes, L.M.; Lima, L.M.P.; C.A.L.; Silva, P.A. Franco, O.L.; Todorov, S.D.; Silva, P.A. 1. UNIVERSIDADE CATÓLICA DE BRASÍLIA 1. UNIVERSIDADE CATÓLICA DE BRASÍLIA 2. UNIVERSIDADE FEDERAL DA GRANDE DOURADOS 2. UNIVERSIDADE FEDERAL DE VIÇOSA Viral infections are a serious worldwide public health The viruses are present in a wide range of organisms and problem and despite the emergence of prophylactic some of them are a public health problem. Considering measures, such as vaccines and development of some that some drugs are available for the treatment of viral antivirals, the treatment of viral infections remains a infections, health managers and vaccination programs have been reinforced to prevent human viral infections.

Viruschallenge, Reviews especially & Research Vol for 20 the(2), August-December difficulty in developing 2016 - Abstracts/Posters - Basic Virology: BV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

58 Basic Virology: BV

Natural compounds represent an abundant source of pregnancy, being related as a cause of microcephaly and pharmacological activities, among them the antiviral, offering new options for drug therapies. From these vaccine or licensed drug to treat zika virus infection and compounds it is possible to extract active substances make givenother severethe current fetal brainepidemic defects. situation, As there it has is no become specific a structural changes, making them more effective and less global public health problem. The aim of the present study toxic. It can also be used as a model for synthetic drugs was to evaluate the antiviral activity of the compounds with pharmacological activities similar to the originals. Nacetyllcysteine (NAC), 2Ć? methylguanosine (2Ć ? MeG) and 2Ć ? methylguanosine tryptamine phosphoramidate as an antiviral peptide against different microorganisms, monoester (phosphoramidate monoester) against Zika includingThese substances viruses, havemaking demonstrated them candidates significant for antiviral effects virus. NAC is an antioxidant compound with known drugs. This study aimed to carry out the antiviral analysis of the bacteriocin produced by Lactobacillus plantarum virus, 2Ć ?MeG is a nucleoside analog inhibitor of viral ST8SH (BacST8SH) against human herpesvirus 1. RNAantiviraldependent activity RNA against polymerase seasonal previously human influenza developed A for hepatitis C virus and the monoester phosphoramidate compound is a tryptamine phosphoramidate nucleoside MATERIALS AND METHODS: BacST8SHsemipurified in prodrug designed to enhance the intracellular delivery of Allisopropanol experiments different were concentrationsperformed in Vero (20%, cell 40%, cultures 60% monophosphorylated nucleoside analogs. Cytotoxicity of and 80%)cytopathic was quantified effects were by fluorometric observed methodby microscopy. (Qubit). the compounds was measured by the neutral red uptake assay to verify the maximum nontoxic dose (MNTD). All tested by MTT method and antiviral activity against the experiments were performed in triplicate. Vero cells herpesThe cytotoxic simplex effect virus of 1 the (HSV semi1) purified was determined bacteriocin by wasthe were infected with ZIKV at a multiplicity of infection of reduction in the viral titer using the statistical method 0.05. After adsorption period, cells were treated with of Reed and Muench, expressed in inhibition index viral 100 ?M of each compound and incubated for 72 hours, (IIV) and Percent Inhibition (PI). RESULTS: The antiviral once a day for cytophatic effect (CPE) observation. Supernatantat 37°C in 5% was CO2 harvested atmosphere. 72 h The post cells infection were analyzedand viral assays showed that the semipurified bacteriocin ST8SH replication was detected by real time polymerasechain in isopropanol concentrations of 20%, 40%, 60% and reaction (qPCR) assay. No cytopathic effects (CPE) were against80% showed HSV1. CONCLUSIONS: PI 93.7%; 96.8%; The 99.9%study showed respectively, that observed up to 48 h of infection, but at 72 h it was possible and only BacST8SH80% showed no antiviral effect to notice more CPE on infected nontreated cells when plantarum ST8SH showed antiviral effect with potential compared to infected and treated cells. The treatment application.the semipurified It will bacteriocin require further produced testing by forLactobacillus statistical validation. replication, while phosphoramidate monoester and NAC with 2Ć ? MeG was capable to reduce 96,06% of viral BV158 - ANTIVIRAL ACTIVITY OF NACETYLL data suggest a tendency of viral replication inhibition by CYSTEINE AND NUCLEOSIDE ANALOGS AGAINST 2´treatmentC ? MeG and inhibited a most relevant 99,99% antiviral of viral activity replication. of NAC These and ZIKA VIRUS phosphoramidate monoester in Vero cells infected with Souza, M.R.M.; Gaspar, D.M.; Costa, L.J. ZIKV. Viral plaque reduction assay will be performed in 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO 2. UNIVERSIDADE FEDERAL DO CEARÁ Zika virus (ZIKV) is a member of the Flavivirus genus order to complement these preliminaries findings. within the Flaviviradae family and has a positivestrand RNA genome of about 11,000 nucleotides. This virus can be transmitted to people primarily through the bite of an infected Aedes species mosquito (Ae. aegypti and Ae. albopictus) and vertically by placental passage during

59 Basic Virology: BV

BV170 - STUDY OF ANTIVIRAL ACTIVITY OF BV171 - DENGUE VIRUSINDUCED REACTIVE OXYGEN ESSENTIAL OIL OF PITANGA (EUGENIA UNIFLORA L.) SPECIES AFFECTS CELL VIABILITY AND VIRAL ON HERPES SIMPLEX VÍRUS ON TYPE 1 (HSV1) REPLICATION IN HUMAN ENDOTHELIAL CELLS Candeias, J.M.G.; Zago, G. Meuren, L.M.; Papa, M.P.; Arruda, L.B. INSTITUTO DE BIOCIÊNCIAS UNESP UNIVERSIDADE FEDERAL DO RIO DE JANEIRO Due to the increasing observed resistance on antivirals, Dengue virus (DENV) infection is associated to vascular natural products extracts have been studied as alternative alterations, including vasodilation and increased known as Pitanga) had already been used on popular endothelial lesion. We have previously demonstrated medicineproducts ondue current to it’s therapies. antioxidant, Eugenia antitumor, uniflora analgesic, L. (also thatpermeability, endothelial as acells result were of permissivesystemic inflammation to DENV, which and triggered activation of RNA sensors, leading to cytokine there are no studies, until the present moment, showing b production and cell death. Virus sensing is related theanti potentialinflammatory antiviral and activity diuretic of activities.Pitanga essential Besides oil that, for not only to cellular activation, but also to cellular stress the treatment against herpetic pathologies. Objective: responses, including mitochondrial stress and reactive evaluate the antiviral activity of essential oil of Eugenia oxygen species (ROS) production. These mediators, in turn, may regulate cellular activation and survival. Here, virus type 1 (HSV1). Methods: After extracting the we investigated if DENV infection induced ROS production essentialuniflora L. oil (Pitanga) by the Clevenger on viral replication method, ofthe herpes oil maximum simplex by endothelial cells, and whether these mediators would nontoxic concentration (MNTC) was evaluated in Vero affect viral replication, endothelial activation, and cell cells and three experiments in duplicate were done. death. We used human brain microvascular endothelial Pretreatment of Vero cells with a MNTC of the essential cells (HBMECs) as an endothelial cell model. The cells oil, followed by the infection with different dilutions of were infected with DENV2 (16681 strain) and ROS HSV1. Viral inactivation method done by exposing the HSV1 to a MNTC of the oil and then infecting the Vero cells to see the presence or absence cytopatic effect production was analyzed by immunofluorescence and (CPE) inhibition. Posttreatment where Vero cells were flow cytometry. Virus replication was evaluated by qRT inoculated with HSV1 followed by exposure of the cells productionPCR, flow cytometry was analyzed and plaqueby qRT assay.PCR and Cell ELISA. death wasWe with a MNTC of Pitanga essential oil and evaluation observedevaluated that by flowdengue cytometry infection and on XTT HBMECs assay. results Cytokine in for CPE. Results: The MNTC of Pitanga essential oil in increased ROS production, which was dependent on viral replication. ROS inhibition resulted in decreased viral Pitanga essential oil could inhibit replication of HSV1 load, prolonged cell survival, and was also associated throughVero Cells the was different 156,25 experiments µg/ml. We couldused tonotice evaluate that the to apoptosis of bystander cells. Interestingly, inhibition of ROS resulted in diminished cytokine secretion by viral replication inhibition was observed at the 10?17 HBMECs. These data suggest that DENVinduced ROS viraldifferent dilution, replication with similar phases. results On pre noticedtreatment, on the a 50%viral production in HBMECs may be an essential primary signal inactivation test. On the posttreatment test, however, the to virus replication, and to PRRmediated cell activation. Sustained ROS production results in endothelial cell was 10?19. The highest antiviral activity was seen when death, which may contribute to in vivo, vascular lesion. HSVdilution1 was which incubated showed with 50% the of oilinhibition before cellof replication infection. essential oil could inhibit HSV1 replication regardless theConclusion: treatment Our considering findings showedit’s possible that use Eugenia as an antiviraluniflora product.

60 Basic Virology: BV

BV195 - INFLUENZALIKE VIRUS AND PARAMYXOVIRUS in EasyMag BioMerieux. Randomic cDNA synthesis was SCREENING IN BRAZILIAN BAT performed with High Capacity kit. cDNA samples were Campos, A.C.A.; Góes, L.G.B.; Carvalho, C.; Ambar, screened by PCR assay targeting the PB1 gene using G.; Costa, J.C.C.S.; Oliveira, D.N.; Alvarenga, C.F.; primers developed by CII – Columbia University (New Souza, M.C.P.; Ruckert, A.; Oliveira, D.C.; Martorelli, L.F.; Kataoka, A.P.G.; Queiroz, L.H.; Cruz Neto, A.P.; PCR assay designed for the detection of the presence of York, USA) to Influenzalike virus and by a Semi Nested Durigon, E.L. viral RNA paramyxoviruses. PCR fragment was observed 1. DEPARTAMENTO DE MICROBIOLOGIA, INSTITUTO in electrophoresis analysis and the samples were DE CIÊNCIAS BIOMÉDICAS (ICB), UNIVERSIDADE DE SÃO PAULO 2. FACULDADE DE MEDICINA VETERINÁRIA DE viruspurified and and two sequenced samples was by positive Sanger methodto Paramyxovirus. in 3130xl ARAÇATUBA, UNIVERSIDADE ESTADUAL PAULISTA Oneequipment. Morbillivirus None samplelike was was detected confirmed in an to insectivorousInfluenzalike 3. DEPARTAMENTO DE ZOOLOGIA, INSTITUTO DE BIOCIÊNCIAS (IB), UNIVERSIDADE ESTADUAL was found in one hematophagous bat Desmodus PAULISTA bat Molossus rufus and an Unclassified Paramyxovirus 4. UNIVERSIDADE NOVE DE JULHO rotundus. This preliminary study report the absence of 5. FACULDADES METROPOLITANAS UNIDAS 6. FUNDAÇÃO UNIVERSITÁRIA VIDA CRISTÃ Brazil, and the presence of Paramyxovirus genotypes in 7. UNIVERSIDADE DE SANTO AMARO batsInfluenza commonlylike virus found in in bats rural from and Atlanticurban area Forest reinforcing Biome, 8. CENTRO DE CONTROLE DE ZOONOZES DA CIDADE the necessity of expanded and continuous surveillance SÃO PAULO 9. FACULDADE DE MEDICINA VETERINÁRIA DE of potential emergent virus in the bat fauna of this hot ARAÇATUBA, UNIVERSIDADE ESTADUAL PAULISTA spot biome. Bats are recognized as natural reservoirs of emergent BV197 - CORONAVIRUSES DIVERSITY IN BATS FROM viruses related to severe human disease outbreaks URBAN AND ATLANTIC FOREST FRAGMENTS OF SÃO including Rabies, Nipah, Hendra and SARS coronavirus. PAULO STATE Since the discovery of Hendra and Nipah emergent Góes, L.G.B.; Campos, A.C.A.; Carvalho, C.; Costa, J.C.C.S.; Oliveira, D.N.; Alvarenga, C.F.; Ruckert, A.; Australia and Asia, others batborne paramyxovirus have Oliveira, D.C.; Martorelli, L.F.; Kataoka, A.P.G.; Nardi, paramyxovirus (PAR) in late 90’s in flying foxes bats from M.S.; Summa, J.L.; Azevedo, R.M.; Durigon, E.L. species from Australia, Asia, Africa and South America. been identified in bats across the globe including bats 1. DEPARTAMENTO DE MICROBIOLOGIA, INSTITUTO Moreover, bats have also been described as possible hosts DE CIÊNCIAS BIOMÉDICAS (ICB), UNIVERSIDADE DE SÃO PAULO are rodents and birds respectively. The importance of 2. FACULDADE DE MEDICINA VETERINÁRIA DE theof influenza circulation virus of andthese hantavirus, virus in bats whose and mainits relationship reservoirs ARAÇATUBA, UNIVERSIDADE ESTADUAL PAULISTA to human infections has not been determined. Despite 3. UNIVERSIDADE NOVE DE JULHO 4. FACULDADES METROPOLITANAS UNIDAS the great diversity of viruses recently detected in bats 5. FUNDAÇÃO UNIVERSITÁRIA VIDA CRISTÃ from different continents and the recent spillover 6. CENTRO DE CONTROLE DE ZOONOZES DA CIDADE events of virus from bats to humans, few studies had SÃO PAULO analyzed the occurrence and geographical distribution 7. DIVISÃO TÉCNICA DE MEDICINA VETERINÁRIA E MANEJO DA FAUNA SILVESTRE (DEPAVE3), bats. The present study aims to evaluate the occurrence SECRETARIA DO VERDE E MEIO AMBIENTE, of influenzalike virus and paramyxovirus in Brazilian’s PREFEITURA DO MUNICÍPIO DE SÃO PAULO, SÃO PAULO in different bat species from Brazil. For that, intestine tissueand diversity from 533 of bats Influenza (25 specieslike virus and threeand Paramyxovirus families) from Epidemiological and phylogenetic studies indicate that urban, continuous and fragmented forest areas were four out of six coronavirus (CoV) capable of infecting humans are the result of spill over events of virus from Total Nucleic Acid was extracted by automatized method bats to humans. Over the past 13 years, two highly screened for Influenzalike virus and Paramyxovirus. The Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Basic Virology: BV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

61 Basic Virology: BV pathogenic CoV were isolated from humans, CoVSARS BV202 - MOLECULAR ANALYSIS OF NOROVIRUS (Severe Acute Respiratory Syndrome) and the CoV MERS SPECIMENS FROM CHILDREN ENROLLED IN A 1982 (Middle East Respiratory Syndrome) with a mortality 1986 COLLECTION SAMPLES IN BELÉM, BRAZIL: A COMMUNITYBASED LONGITUDINAL STUDY Siqueira, J.A.M.; Júnior, E.C.S.; Linhares, A.C.; Gabbay, rate of 10 and 42%, respectively. Subsequent studies CoV with great genetic similarity and capable to use the Y.B. have identified CoV in bats all over the world including same cell receptor of SARS and MERSCoV. Despite the INSTITUTO EVANDRO CHAGAS great diversity of CoV in bats, the large number of bat Several molecular studies have shown a high degree Biome (AFB) as a hotspot region for emergence of new of norovirus (NoV) genetic diversity, and although infectiousspecies in Brazildisease, and studies the classification about the ofoccurrence Atlantic Forest and numerous genotypes are known to infect humans, diversity of CoV in bats in Brazil are scarce. The present genogroup II strains have remained dominant in most study aims to evaluate the diversity of coronavirus in outbreaks of gastroenteritis (GE) and cases of GE at bats from Urban and Forest Fragments of São Paulo both hospital and community levels. Specimens were State located inside the Atlantic Forest biome. Intestine collected during a longitudinal, communitybased study samples from bats received by the Center of Zoonosis carried out in the city of Belém, North Brazil, over 3 years (October 1982 to March 1986), where 20 children Rectal Swabs Samples collected from bats from Forest were followedup from birth to 3 years of age. A total of Fragments,Control of Sãoinside Paulo or close Municipality to São Paulo (N=132) Metropolitan and Oral/ 229 samples were screened for NoV by Real Time PCR area, were screened for CoV RNA (N=119). Shortly, total targeting polymerase gene (RdRp) and the positives nucleic acid were obtained from 30mg of intestine tissue were characterized by the regions B (RdRp) and C or D extracted in NucliSENS® easyMAG® automatic extractor (VP1 gene). In case of a disagreement between the two (BioMerieux). cDNA was prepared using random regions genotyped, the junction region between ORFs

NestedPCR. We screened a total of 251 individuals of 31 1/2 was considered to suggest a recombination event. distinctprimers species and subjected including to members a modified of Phyllostomidae, pancoronavirus region to determine the current variants. Nucleotide Samples classified as GII.P4/GII.4 were analysed by P2 Molossidae and Verpertilionidae bat family. sequences analyses were made by maximum likelihood Alphacoronavirus RNA was detected in one intestine method with 1000 bootstrap replicates. An overall sample obtained from CCZSP (Phyllostomus discolor) and 7 swabs samples from bats of Forest Fragments of positivity of 16.1% (37/229) was observed, including SP state (Artibeus lituratus, Glossophaga soricina and Cases of NoV reinfection in at least twomonth intervals GI (16.2%6/37) and GII (83.8%31/37) genogroups. Sturnira lilium) presenting a general prevalence of 0,7 were observed and 12 children developed at least one bats of same genus presented high nucleotide sequence NoVpositive samples were subjected to nucleotide case of asymptomatic NoV infection. 48.6% (18/37) withand 5,9%sequences respectively. detected ?CoV in other sequences studies obtained from bats from of sequencing analysis targeting at RdRp gene: GI.P3 (n=1), geographically distant regions. Similar results were GII.Pa (n=1), GII.Pc (n=1), GII.P4 (n=5), GII.P6 (n=5), GII. previously reported for a variety of bat CoVs and are P7 (n=3), GII.P12 (n=1) and GII.P22 (n=1). The VP1 gene taken as evidence of coevolution of CoV genotypes and the 18 previously genotyped: GI.3 (n=1), GII.2 (n=1), allowed the characterization of 14 (77.8%) samples of for expanded and continuing surveillance of CoVs in bat GII.4 (n=4), GII.6 (n=4), GII.7 (n=1), GII.12 (n=1), GII.14 fauna,specific including host genera. those Our in the results AFB regionsdemonstrate of Brazil. the need (n=1), GII.22 (n=1). In three cases were suggested

wererecombination analysed toevents identify (GII.P12/GII.2, variants, but GII.P7/GII.14, any one showed GII. contemporaryPa/GII.12) and counterparts.four samples Threegenotyped children as GII.P4/GII.4 developed consecutive NoV infections by different genotypes. The present report documents the importance of NoV as a

62 Basic Virology: BV cause of childhood infection during a longitudinal study conducted more than 30 years ago, demonstrating (58.8%), GII.P6 (11.8%), GII.Pa (5.8%), GIIinconclusive (11.8%) and GII.Pnew (11.8%). For genogroup I it was betweenprolonged breast shedding;feeding highand susceptibility prevalence to in infections controls; infectionobserved was the detected genotypes: in the GI.P5 age range (25%), of 6 GI.P7to 12 months (25%), atpossible community resistance level, besides to infections; a broad andgenetic relationship diversity (p=0.0024)GI.Pd (25%) and and it GI.Pfwas not(25%). determined The highest no seasonality frequency for of likewise it can be currently be observed. NoV in the period of study, showing peaks in November 1983, August 1984 and September 1985. These results BV203 - NATURAL HISTORY OF NOROVIRUS demonstrated the diversity of NoV in children in the INFECTIONS IN CHILDREN FROM BELÉM, PARÁ: A community circulating in the 1980s, causing mainly COMMUNITYBASED LONGITUDINAL STUDY asymptomatic cases. In addition, it was observed that Siqueira, J.A.M.; Santos, L.F.P.; Bandeira, R.S.; the GII.4 was the most prevalent genotype since that Linhares, A.C.; Gabbay, Y.B. time. This study contributed to a better understanding INSTITUTO EVANDRO CHAGAS of this pathogen in gastrointestinal infections. Norovirus (NoV) are the most important pathogen when BV222 - EVALUATION OF MYRCIARIA FLORIBUNDA considered outbreaks of AGE in human populations. The IN VITRO ACTIVITY AGAINST ZIKA VIRUS genotype GII.4 is the most prevalent worldwide and is Oliveira, M.C.; Gomes, R.P.S.; Oliveira, M.C.; Gomes, responsible by the majority of the global epidemics G.R.; Gomes, M.W.L.; Melchiades, V.A.; Andrade, A.S.; (pandemics) of viral aetiology. The objective of this study Barbosa, V.G.; Garrido, V.; Barros, C.S.; Teixeira, V.L.; was to detect and characterize the infections by NoV Rocha, L.; Paixão, I.C.P.N. that occurred in children followed up in the ccommunity from birth until the three years old, residents in UNIVERSIDADE FEDERAL FLUMINENSE neighbourhoods of low socioeconomic status from Zika virus (ZIKV) had an increase in the number of cases Belém, between 1982 and 1986. Fecal specimens were reported in the past few years. Diseases like microcephaly obtained during a communitybased longitudinal study and GuillainBarre syndrome are commonly associated whose total of 2.013 samples were collected. It was with the ZIKV infection. Due to its upsurge severity tested a subset of 216 fecal samples belonging to three studies in the development of medicines to inhibit children residents in the districts of Barreiro (n=69), virus replication have become essential. In this sense, Marco (n=77) and Terra Firme (n=70) of which were collected feces fortnightly or when they have diarrhea. in the north of Brazil, whose essential oil properties have Samples were tested by quantitative PCR (qPCR) using Myrciaria floribunda is a widely spread tree, especially the kit Superscript III OneStep RTPCR Systems with and antitumor activities. The stem and leaf of M. Platinum Taq (Invitrogen) for the detection of GI and GII been documented for antimicrobial, antiinflammatory genogroups. Positive samples by qPCR were submitted to acetate and hexane. To evaluate the antiviral activity of thefloribunda extracts, were VERO extracted cells, growing with dichloromethane, in 24 wells plates ethylwith step)Seminested for GI RT andPCR GII, reaction respectively. using primers The positive JV13I/JV12Y ones were(first sequenced step) and aiming JV13I/G1 the or partial JV12Y/NoroII characterizationR (second of CO21 x 105atmosphere. cells/well Afterwards, density, were the cellsinfected were with treated ZIKV with (1 region A of the viral polymerase gene. The phylogenetic x 104 PFU) using 0,1 MOI for one hour at 37ºC in 5% construction was performed using the method of NeighborJoining Kimura 2parameters, with bootstrap andthe extractsthawing in cycles, two concentrations, the supernatant 10 andwas 30?g/mL,titrated byin plaque5% FBS essay. medium. The The plaque cells remained were lysed in byan threeincubator freezing for of 1000 replicates. The positivity of 14.3% (31/216) and crystal violet was added. The inhibition percentage was observed, being 13% (28/216) for GII and 1.8% five days, subsequently the supernatant was removed (4/216) for GI. One sample was positive for both GI and GII. It was possible to classify 60.7% (17/28) of GII and of M. floribunda hexane, dichloromethane and acetate 100%Virus Reviews (4/4) & of Research GI, being Vol 20observed (2), August-December the genotypes 2016 GII.P4 - Abstracts/Posters leaf extracts - Basic atVirology: 30?g/mL BV was above 85%. On the other XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

63 Basic Virology: BV

BV236 - ALTERATIONS IN GENES OF DNA DAMAGE REPAIR PATHWAYS ARE CRITICAL FOR CERVICAL concentration,hand, at 10?g/mL the other concentration, substances the presented ethyl acetate lower CANCER DERIVED CELLS TUMORIGENIC POTENTIAL: leaf extract resulted in 95% of inhibition. At the same POTENTIAL ROLE OF TREX1 AND RPA1 IN CERVICAL CANCER ONSET AND PROGRESSION inhibition percentage, being above 40%. The hexane Abjaude, W.S.; Prati, B.; Abjaude, W.S.; Termini, L.; and dichloromethane stem extracts at 10?g/mL Morale, M.; Nunes, R.A.L.; Boccardo, E. productionconcentrations of viral inhibited particles. the Theseviral replication results show over that 38% M. whereas the acetate stem extract inhibited 96% the 1. UNIVERSIDADE DE SÃO PAULO 2. INSTITUTO DO CÂNCER DO ESTADO DE SÃO PAULO ZIKV, but further tests are needed. floribunda extracts may be useful as an antiviral against Alterations in the dna damage repair mechanisms BV224 - SUSCEPTIBILITY OF HUMAN PERIPHERAL associated with the presence of hpv have been described BLOOD MONONUCLEAR CELLS TO “IN VITRO” in different experimental models. however, the effect INFECTION WITH ZIKA VIRUS of hpv on the expression of genes involved in theses Souza, J.P.; Pontelli, M.C.; Castro, I.A.; Cardoso, R.S.; pathways has not been analyzed in detail. in the present Arruda, E. involved in dna damage repair pathways between UNIVERSIDADE DE SÃO PAULO primarystudy, we human compared keratinocytes the expression (phk), profile hpv-positive of 135 genes (siha Zika virus (ZIKV) is a member of the family Flaviviridae and hela) and hpv-negative (c33a) cervical cancer that became a major public health concern since the derived cell lines. we observed that tumor derived cell recognition of its association with microcephaly and other fetal damage. However, very little is known about of genes from several dna damage repair pathways. the pathogenesis of this virus. To assess whether ZIKV thelines expression exhibited major of 18 alterations was consistently in the expression altered profilein all can infect peripheral blood mononuclear cells (PBMCs), three transformed cell lines compared to normal cells. 5mL of peripheral blood was collected from healthy donors and cells were isolated using centrifugation in genes that distinguished hpv-positive tumor cell lines percoll density gradients. PBMC were infected after 2 interestingly, we identified 9 differentially expressed time pcr and western-blot. moreover, the expression post infection. Slides were incubated with primary offrom two c33a. selected gene expressiongenes, rpa1 data and were trex1, confirmed was silenced by real- in antibodieshours in culture (mouse (MOI=1), polyclonal and antibody formalin against fixed 24ZIKV hours and antibodies against CD3, CD4, CD8, CD11c, and CD20), shrna. we observed that rpa1 and trex1 silencing greatly affecttumor tumor cells using cells lentiviralclonogenic vectors potential expressing and anchorage specific The nuclei were stained with DAPI and preparations independent growth ability. we observed that the effect following incubation with specific secondary antibodies. were examined by confocal microscopy. The results of trex1 and rpa 1 silencing was dependent on both indicated that CD20+ (B lymphocytes) and CD11c+ hpv16 e6 and e7 expression. furthermore, the effect (monocytes) cells are seem to be susceptible “in vitro” of these genes silencing was more dramatic in human to infection by ZIKV. On the other hand, ZIKV did not keratinocytes immortalized by hpv16 oncoproteins than infect cells positive for CD3, CD4 or CD8, indicating that T lymphocytes are not susceptible. The present results an analysis conducted in human cervical tissues samples open new possibilities of investigation of the biology showedin those acutelythat trex1 transduced expression with levels hpv oncogenes. are upregulated finally, of ZIKV infection of B lymphocytes and monocytes in precancer lesions, squamous carcinoma and as a way to understand basic mechanisms of ZIKV adenocarcinoma. our results support the presence of

dna damage repair pathways in cervical cancer derived pathogenesis. In addition, these findings suggest that provide a way to make rapid diagnosis of ZIKV infections. cellsignificant lines. besides, changes we in show the expression that some of of genes these involvedalterations in immunofluorescence of peripheral blood smears may may be important for tumor cells survival, tumorigenic

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posterspotential - Basic and Virology:tumor establishment/progression. BV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

64 Basic Virology: BV

BV238 - ATM PATHWAY IS IMPORTANT FOR HUMAN BV259 - COCAL VIRUS INDUCES ENCEPHALITIS PAPILLOMAVIRUSTRANSFORMED CELLS SURVIVAL IN MICE BALB/C ADULTS AFTER INTRANASAL Abjaude, W.S.; Prati, B.; Montenegro, A.; Lino, V.; INOCULATION: HISTOPATHOLOGICAL AND Morale, M.V.; Herbster, S.; Boccardo, E. IMMUNOHISTOCHEMICAL ANALYSIS UNIVERSIDADE DE SÃO PAULO Diniz, J.A.P.; Freitas, P.S.L.; Vasconcelos, P.F.C.; Diniz, J.A.P. Human Papillomaviruses (HPV) are nonenveloped DNA viruses that infect epithelial cells. Persistent infection INSTITUTO EVANDRO CHAGAS with some HPV types is the main risk factor for the The Cocal virus (COCV) belonging to the Rhabdoviridae development of cervical cancer. DNA repair machinery family, genus Vesiculovirus. The COCV infection affects plays an essential role in several stages of the HPV life cycle livestock including cattle and horses in South America, and is crucial for tumor cells’ survival. During malignant (including Argentina, Uruguay and Brazil). Humans were transformation, HPV E6 and E7 oncoproteins induce rarely infected. It is already known that in newborn mice, structural and numerical chromosome alterations and intranasal inoculation of COCV caused acute infection modulate DNA damage response. These observations followed by death oneday postinoculation, however, little suggest that cellular DNA repair machinery may play is known about this viral encephalitis in adult mice. The a dual role in both HPV biology and pathogenesis. In aim of this study was to describe the neuropathological the present study, we sought to investigate the role features of COCV adult mice encephalitis. To that end of DNA repair proteins in cervical cancer derived cells we investigated the distribution of viral antigens and biology. In order to achieve this goal, the expression of 189 genes was silenced in HeLa (HPV16) and SiHa adult mice, after intranasal inoculation. Histopathology (HPV18) cells as well as in primary normal human (hematoxylinmicroglial activationeosin stained) in the brain and parenchymaimmunohistochemical of BALB/c epidermal keratinocytes (NHEK) using lentiviral vectors assays to detect microglial morphological response were done at 3th and 6th day post inoculation (d.p.i.). was determined by cell viability assay, cell growth RESULTS: COCV infection induced cortical perivascular analysis,expressing clonogenic specific shRNA. and soft The agareffect colony of gene formation silencing edema and hemorrhagic foci, associated with signs of test. We observed that ATM, BRCA1 and CHEK2 down cell death by apoptosis and necrosis in the cortex and regulation decreased growth rate, clonogenic potential and cellular anchorageindependent growth of HPV Microglial cells with activated morphology were mainly transformed cervical cancerderived cell lines with no foundolfactory in the bulb, olfactory and leukocyte bulb, cortex infiltrate and inhippocampus. the cortex. effect in normal keratinocytes. Treatment of cells with drugs that inhibit ATM and CHEK2 activity showed detected in olfactory bulbs and frontal cortices at 3th that tumor cells are more sensitive to the inhibition of d.p.i.,The viral and in antigens the hippocampus, and activated brainstem, microglia striatum were firstand these proteins than NHEK. Besides, we show that NHEK cerebellum at 6th d.p.i. CONCLUSION: Our results suggest expressing HPV16 E6 alone or along with HPV16 E7 were that infection of the central nervous system of mice by more sensitive to these inhibitors than control NHEK or the COCV, after intranasal inoculation, invade the central NHEK expressing only E7. Moreover, NHEK expressing nervous system through the olfactory receptors causing E6 mutants defective for p53 degradation were less sensitive than NHEK expressing E6wt. Altogether, these results indicated that these genes are required for HPV encephalitis, with an intense inflammatory response transformed cells survival. Besides, our results suggest and cell death leading to 100% mortality. that this effect is related to HPV16 E6 oncoprotein expression and its capacity to degrade p53.

65 Basic Virology: BV

BV274 - AUTOPHAGY INHIBITION BY A VACCINIA to have a cytoprotective role. Financial support: CAPES, VIRUS VIRULENCE FACTOR CNPq, FAPERJ and Pró-Defesa. Schnellrath, L.C.; Damaso, C. INSTITUTO DE BIOFISICA CARLOS CHAGAS FILHO – UNIVERSIDADE FEDERAL DO RIO DE JANEIRO (IBCCF- UFRJ). Vaccinia virus (VACV) encodes many virulence factors that are involved in the antiviral pathway triggered by interferons. During infection this response leads to an increased expression and activation of PKR (doublestranded RNA-dependent protein kinase), culminating initiation factor 2) phosphorylation and inhibition of cellularin eIF2α protein (alpha subunitsynthesis. of The the eukaryoticproduct of translation VACV059 gene is a VACV-encoded protein that antagonizes dsRNA formed as a result of viral convergent transcription. The absence of VACV059 causes host restriction and reduction of pathogenicity. Previous data showed that wild-type VACV does not induce apoptosis or autophagy. However, we recently observed that the absence of VACV059 during infection results in autophagy and apoptosis. Therefore, our goal is to evaluate how autophagy is induced during VACV infection in the absence of VACV059 and how it interferes with cell death through apoptosis. During wild-type VACV infection we observed pathway is blocked and we do not observe autophagy. PKRthat despiteis involved dsRNA in autophagy production, during activation infection of PKR/eIF2 with the ofmutant PKR phosphorylation,VACV through eIF2α already phosphorylation induces autophagy. pathway. In theHowever, absence only of viral eIF2α DNA phosphorylation, replication and post-replicative in the absence phase there was no production of dsRNA, and we did not observe the induction of autophagy or apoptosis during infection with the mutant VACV. Complementing cells were capable of inhibiting autophagy and of rescuing viral replication during the infection with the mutant that the induction of autophagy occurred through the canonicalVACV. We pathway. silenced The Beclin-1 addition and of Atg7a synthetic and confirmed dsRNA to dsRNA produced during infection. When the autophagy pathwaycells confirmed was impaired, our results we observedmimicking that the infection effect of withviral the mutant VACV led to early apoptosis and reduced cell viability when compared with autophagy-competent cells. Therefore, in these conditions, autophagy seems

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Basic Virology: BV ENVIRONMENTAL VIROLOGY - EV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

67 Environmental Virology: EV

EV38 - WIDESPREADED CONTAMINATION BY HUMAN EV42 - MAMMALIAN ADENOVIRUSES: DNA ADENOVIRUS IN SURFACE AND GROUNDWATER IN POLIMERASE GENE DIVERSITY IN SURFACE WATER WATER COLLECTED FROM FARMS IN THE SINOS FROM BELO STREAM IN CAXIAS DO SUL RS RIVER BASIN, BRAZIL Girardi, V.; Albino, S.M.; Demoliner, M.; Pressi, G.; Demoliner, M.; Gularte, J.S.; Staggemeier, R.; Gras, Rigotto, C.; Schneider, V.E.; Paesi, S.; Spilki, F.R. C.K.; Pressi, G.F.; Henzel, A.; Spilki, F.R. 1. UNIVERSIDADE FEEVALE UNIVERSIDADE FEEVALE 2. UNIVERSIDADE DE CAXIAS DO SUL Enteric virus are ubiquitous in the environment and Environmental water samples may harbour an immense their occurrence are attributed mainly to improper microbiological diversity, since it may be contaminated disposal of animal and agricultural waste and lack of sanitation facilities. Therefore, the rural areas are more are often found in the aquatic ecosystems, since current likely prone to dispersal of waterborne diseases. Human sewageby different treatment sources methods of effluents. are not Adenoviruses fully effective (AdV) into adenovirus (HAdV) are members of Adenoviridae family removal of viral particles. AdV can cause respiratory and has been considered as an excellent indicator of tract infections, conjunctivitis and gastroenteritis in fecal contamination of water matrices. HAdV are double human, and a plethora of clinical manifestations in other stranded DNA genomes nonenveloped viruses being relatively high resistant in the environment. The aim of the Caí River watershed, is inserted Caxias do Sul of this study was to detect and quantify the genome of municipalityanimal species. (Brazil), The Belo being Stream impacted is one by of discharges the affluent of HAdV in different water matrices, in order to determine sources of fecal pollution by human origin along the study was to evaluate the AdV diversity in Belo Stream Rio dos Sinos river basin. A total of 86 groundwater surfacedomestic waters, and industrial both in concentrated effluents. The and main unconcentrated goal of this samples were collected from springs and artesian wells. samples. Samplings were performed from March 2015 Another 38 surface water samples from stream, river to April 2016 in Belo Stream in four sites: P1 and P2 and ponds were also surveyed. Samples were collected from November to December 2015, in 34 farms from 11 stretch of the river, which is mainly used for recreational municipalities located along the Sinos River basin. Water purposes,in urban region,totaling P3 55 in samples. countryside Concentrated and P4 in thesamples final (using ultracentrifugation method) and unconcentrated and genetic material were extracted using a commercial samples were subsequently submitted to nucleic silicasamples based were kit. first Real concentratedtime polymerase by ultracentrifugation chain reaction acid extraction with a commercial kit (Biopur®). For (qPCR) using VTB2 primers for the conserved region of screening the presence of AdVs, a partial sequence of hexon gene of HAdVC was performed for viral detection PCR aiming the detection of several AdV types from the had between one and two points of contamination. In generathe DNA Mastadenovirus polymerase (pol) and gene Atadenovirus. was amplified Sequencing by nested and quantification. Of the analyzed farms, 47% (16/34) was performed in all positive samples. In a total of 55 concentrated samples, AdV DNApol gene was detected detected,which, 20% ranging (17/86) to samples9,40x104 of to groundwaters 6,59x107 genomic and in 13% (5/38) of surface water, the genome of HAdV was all samples were negative for HAdV. Generally HAdV in 43.6% (24), from these, different AdV species were contaminationscopies /L. In only occurs 18% most (2/11) often of thein municipalitiesurban areas, hostsfound: were human also adenovirus found, including (HAdV) speciesbovine adenovirusC (4;7.2%), D3 due to higher population density. However this can be (6;10.9%), E (2;3.6%), and F (9;16.3%). AdV from other overpassed by the lack of basic sanitation. (1;1.8%) and murine adenovirus 1 (2; 3.6%). From the unconcentrated samples, 23.6% (13/55) were positive andfor HAdV unconcentrated belonging tosamples, species we C (6;achieved 10.9%), more D (1; positive 1.8%) samplesand F (6; 10.9%).when they Thus, were in thesubmitted comparison to this of stepconcentrated allowing also a wide diversity of AdV species, including other

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Environmental Virology: EV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

68 Environmental Virology: EV hosts than human. It is important to state that when ultrapure water samples, respectively. Thus, for surface water matrix the ultracentrifugation method was more the same diversity using only one of them mainly due to thecomparing interference both protocolsof factors itas is volume, not always inhibitors, possible and to find the relation between the diversity and molecular detection. differentefficient, extraction while for methods, ultrapure the water use absorptionof commercialelution kit showedmethod wasthe highermore efficient. values of From recovery the evaluation rate, as follow: of the EV43 - EVALUATION OF DIFFERENT CONCENTRATION AND EXTRACTION METHODS FOR HUMAN Thus, in this study either for virus suspensions and ADENOVIRUS TYPE 5 IN WATER environmental1900% for viral matrices suspension samples and 802% evaluated, for surface the steps water. of Girardi, V.; Demoliner, M.; Pressi, G.; Ruskowski, L.; heating or treatment with proteinase K did not improve Albino, S.M.; Rigotto, C.; Fleck, J.D.; Spilki, F.R. UNIVERSIDADE FEEVALE theEV44 further - ENVIRONMENTAL quantification of nucleic SURVEILLANCE acids by qPCR. OF HAV Viral analysis of water samples usually require IN THE AURÁ RIVER HIDROGRAPHIC BASIN IN techniques involving concentration steps allowing the METROPOLITAN REGION OF BELÉM, PARÁ, BRAZIL increase of viral recovery indices. The extraction step Morais, L.L.C.S.; de Paula, V.S.; Lima, M.O.; Aranha, is also an important factor on viral recovery, where D.P.; Pinto, W.V.M.; Silva, L.V.M.; Martins, R.P.G.; Vale, nucleic acids losses might occur during the process. The E.R. main goal of this study was to establish and standardize concentration and extraction protocols effective 1. INSTITUTO EVANDRO CHAGAS 2. FUNDAÇÃO OSWALDO CRUZ for viral recovery from different water matrices. To standardize the concentration method, recovery rate Hepatitis A, considered a serious public health problem, of human adenovirus type 5 (HAdV5) was evaluated is an acute infectious disease caused by hepatitis A virus by ultracentrifugation protocol and compared with the (HAV). Its transmission is mainly by fecaloral route, and adsorptionelution method from ultrapure and surface being directly related to the socioeconomic conditions of each region. This study aims to detect HAV particles in water samples from Aurá River hydrographic basin, waswater extracted artificially from inoculated the samples with previously viral suspensions concentrated at where the main surface water sources that supply the bydifferent commercial concentrations kit (Biopur®). (103 In 108the tests gc/5uL). for methods\’ The DNA metropolitan region of Belém are located, and may have standardization for DNA extraction HAdV5 suspensions were used and surface water samples previously microbiological and physicochemical variables. Between Februarybeen impacted 2015 byand Aurá April landfill 2016, in 40 Belém, samples PA, correlating of surface assayed.concentrated In the by extraction ultracentrifugation tests three andprotocols artificially were points of collection distributed along the Aura River inoculated with HAdV5 (2.20 x 108 gc/5?L) were also andwater Uriboquinha were collected River, (flood Pará. andHAV ebb)search in was five based different on (100ºC10 minutes) followed by proteinase K treatment analyzed : 1silica columncommercial kit; 2Heating followed by RNA extraction with a commercial kit end reversethe method transcription of adsorption withelution SSIIIRT. in membraneSubsequently,the filter, was(37°C performed1 hour); by 3 samereal time as PCR Protocol (qPCR) and 2, followedthe recovery by ratesextraction were calculatedusing the commercial based on the kit. values Viral achieved quantification before of coliforms was performed with Colilert kit 18. and after concentration and the nucleic acids extraction Thesamples physicochemical were subjected variables to nested–PCR. were measured Quantification with multiparameter probe and spectrophotometry. Statistical concentrations in the ultracentrifugation evaluation, analysis were performed in softwares BioEstat 5 and R. steps. Apart from the artificial inoculation of different submitted sequencing with BigDye Terminator v3.1 Cycle the minimumadsorption recoveryelution methodrates obtained the minimum were 848% recovery and SequencingPositive sample kit on were the purified platform with 3130xl Pure Genetic link kit andanalyzer. were 42% respectively for surface and ultrapure water. In ratesVirus Reviews obtained & Research were Vol 37% 20 (2), and August-December 87% in surface 2016 - Abstracts/Posters and The HAV - Environmental RNA was detected Virology: EVin 5% of the samples with XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

69 Environmental Virology: EV high similarity with Brazilian sequences highlighting the endemic circulation of VHA in the region. The thermotolerant coliform concentrations varied from 160 results showed prevalence of 37,5% (12/32) for enteric adenoviruses and 21,8% (7/32)for group C human revealedadenovirus. the occurrence ICCqPCR assays of HAdVs showed infectious 12,5% particles (4/32) in theto 3.87 cases x 104according MPN/100 to the mL, limits and established Escherichia by coli CONAMA varied Arroiofor HAdV BeloF waters, and 28,1% thussuggesting (9/32)for HAdVa riskC. to Thispublic study and from 100 to 1.21 x 104 MPN/100 mL, exceeding 70% of environmental health. there was no association between the presence of HAV and357/05. physicochemical The logistic and regression bacteriological analysis parameters showed that of EV83 - THERMAL STABILITY EVALUATION OF the water. The results showed the circulation of HAV in ADENOVIRUS SEROTYPE 5 AND HEPATITIS A VIRUS this region, providing additional information about the IN DIFFERENT STORAGE CONDITIONS environmental epidemiology of HAV in Brazil, as well as Souza, F.G.; Pressi, G.; Demoliner, M.; Manfro, I.; the high degree of microbiological contamination has Posser, K.; Girardi, V.; Rigotto, C.; Fleck, J. impacted those water bodies, showing the results of a UNIVERSIDADE FEEVALE Temperature is one of the factors with the greatest deficientEV52 - ASSESSMENT sanitation service. OF ADENOVIRUS INFECTIVITY the maintenance of its integrity or its disintegration. IN SURFACE WATER SAMPLES FROM ARROIO BELO, influence on the stability of viruses, which may influence CAXIAS DO SUL RS Girardi, V.; Albino, S.M.; Gras, C.K.; Posser, K.C.; Pressi, andConsidering infectivity the of HAdV possible and temperatureHAV suspensions, influence, as well the as G.; Rigotto, C.; Spilki, F. objective of this study was to evaluate the quantification UNIVERSIDADE FEEVALE Human adenoviruses (HAdV) are often detected HAVthe quantification(HM 175 strain) of their suspensions genomes were in several submitted storage to in drinking and recreational waters. The source of conditions. To this, in the first experiment HAdV5 and water contamination by HAdV is usually untreated or different periods and temperatures of storage:4°C (1, 5 the second leading cause of recreational waterborne and 10 days); 20°C (30, 60 and 90 days) and 80°C (60 diseasesinsufficiently is HAdV. treated Human domestic exposure sewage. to these Consequently, pathogens µL,and respectively.90 days). The To initial HAV quantification these values ofwere HAdV 9.50x107,5, at 4°C, is a public concern worldwide. Realtime PCR (qPCR) is 20°C and 80°, was 1.01x108, 8.24x107, 9.36x106 cg/ commonly used for detected DNA virus in water, however respectively. In the second assay, the evaluation of this method is not able to discern infectious to defective thermal8.24x108 stability and 1.54x107 of nucleic cg/µL, acids at previously 4°C, 20°C andextracted 80°C, particles. Use of integrated cell culture PCR (ICCPCR) allows inferring the presence of infectious viruses in the sample, even if they do not produce cytopathic performedfrom HAdV 5allocating and HAV samplessuspensions under with different quantifications storage conditions:of 1.58x108/1.09x106 4ºC (1 day), 20ºC cg/µL, (30 days) respectively, and 80ºC was(90 This study aimed to assess the presence, integrity and days). In all assays, samples were analyzed in duplicate. viabilityeffect in cellof HAdV cultures, in surface in a sensitive water (n=32) and specific collected manner. from To evaluate the infectivity, ICCqPCR and ICCRTqPCR four sites of Arroio Belo, Caxias do Sul, Brasil. Water were performed in all samples. The qPCR analysis for samples were aseptically collected, concentrated using HAdV5 was performed with SYBR green detection and oligonucleotides that amplify the hexon protein and wereultracentrifugation used to differentiate and HAdV HAdV genomeF and HAdV quantifiedC especies. by oligonucleotides to 5’UTR region were applied. The ViralqPCRafter integrity nucleic and acidsinfectivity extraction, assays specificwere performed reactions for HAV quantification by RTqPCR, TaqMan probe and respectively by DNAse exposure previous to DNA viruses, reducing around 2 to 3 logs for HAdV5 and HAV, extraction and ICCqPCR. Both nonconcentrated and respectively.results showed The infectivity that the storage of HAV declined at 4°C affectedaround 4 both logs concentrated samples were analyzed. The real time PCR

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersafter 10 - daysEnvironmental at 4°C, however Virology: EV in the evaluation of HAdV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

70 Environmental Virology: EV

5 there were an increase of almost 2 logs in the same EV86 - DETECTION, FEASIBILITY AND GENOTYPING condition. We were not able to detect HAV genome after OF ENTEROVIRUS AND ROTAVIRUS A IN SURFACE WATER FROM MOSQUEIRO ISLAND, BELÉM, PARÁ, BRAZIL, 2012 TO 2014 the period of 30 days at 20°C. The freeze at 80°C resulted was exposed for a period of 90 days. Considering these Alves, J.C.S.; Teixeira, D.M.; Wanzeller, A.L.M.; Alves, in a decay of 1 log in the HAdV5 quantification when this A.S.; Silveira, E.; Oliveira, D.S.; Smith, V.C.; Deus, to maintain the infectivity of viral particles for longer D.R.; Morais, L.L.C.S.; Monteiro, J.C.; Siqueira, J.A.M.; findings, the 80ºC temperature was the best condition periods. It is observed that temperature is one important Primo, E.G.; Soares, L.S.; Mascarenhas, J.D.P.; Tavares, factor to be considered to prevent losses in the viral F.N.; Gabbay, Y.B. EVANDRO CHAGAS INSTITUTE indicated that genome extraction or infectivity assays of viralgenomes samples quantification. should be taken Then, around in an idealthe time scenario, of their is Enteric viruses are the major causes of waterborne evaluation and when it is not possible, they should be diseases. These agents are present in the stools of allocated in ultrafreezers. infected individuals in large amounts. They remain viable and infective for months in the environment EV84 - METHODS FOR RECOVERY OF HEPATITIS E and may contaminate the water used for consumption VIRUS (HEV) FROM FOOD SAMPLES and recreation. So, its monitoring is required, since Souza, F.G.; Rigotto, C.; Henzel, A.; Demoliner, M.; bacteriological indicators used to assess the water Pressi, G.; Spilki, F. quality do not have relation with viral contamination. UNIVERSIDADE FEEVALE In addition, some pathogens transmitted by water are fastidious, such as Enterovirus (EV) and Group Consumption of raw or undercooked wild boar or A Rotavirus (RVA). The purpose of this study was to pig meat from infected animals is an important cause detect EV and RVA in surface water samples from four of humans hepatitis E (HEV) infections. HEV, a small beaches (Paraíso, Murubira, Farol and Areião) located in Mosqueiro Island, Belém, Brazil. Water samples Hepevirus genus within the Hepeviridae family, may nonenveloped RNA virus classified as member of were collected monthly in the period of January 2012 spread through the food chain to humans from animal to December 2014, with exception of July when it reservoirs and it’s an emerging pathogen. The infections was collected fortnightly. Two liters of water were are usually asymptomatic affecting mainly adults, however in immunosuppressed patients and pregnant volumeconcentrated of 2mL. by adsorptionRNA was elutionobtained method using inthe filtering silica importance of ensuring the safety of food the objective of extraction.membrane, The followed seminested by centrifugation PCR with primers to obtain P2, P3a final and thewoman work the was mortality the standardization increases significantly. of extraction Given methods the in experimentally inoculated food with HEV comparing three different lysis buffers. Six sausage and salami P10 for EV, and Nested PCR using primers VP6F/VP6R samples were experimentally inoculated with monkey and VP6NF/VP6NR for RVA were employed. The total positivity obtained was 28.2% (44/156), being 25% after inoculation, samples were fragmented and rinsed the(11/44) beaches related studied, to EV, with 56.8% the (25/44) highest to positivity RVA and on18.2% the usingfeces containingEagle\’s Minimum 1,000 HEV Essential genome Medium copies/g. (E OneMEM, hour pH (8/44) to both viruses. These agents were detected in all 7,1), phosphate buffered salin (PBS, pH 7,0) or MilliQ water. After, RNA extraction, cDNA synthesis and PCR withParaíso E. beachcoli acceptable(33.3%). The concentration greatest positivity (<2000) occurred were for amplication of ORF1 viral target were used equally at high tide. A total of 26.5% (39/147) of the samples for the 3 treatments. PBS and Distilled water allowed RVA when submitted to cell culture showed infectivity. recovery of HEV only from sausage samples. On the other positive for EV and/or RVA. Two positive samples for hand, EMEM allowed detection of HEV from all sausage and salami samples, demonstrating to be a better lysis After EV phylogenetic analysis, 63.2% (12/19) were buffer for further studies. classified as nonpolio enterovirus, 15.8% (3/19) as polio 1 vaccine and in 21% (4/19) the sequence obtained did Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - not showEnvironmental sufficient quality Virology: for EV analysis. These beaches XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

71 Environmental Virology: EV

directly in them, contributing with their contamination, treatment was able to reduce the FC counting into 2 logs and,are contaminatedconsequently, exposing through people sewage who galleries use these that places, flow inwas all 100%, samples 95.8%, analyzed. 70.8% However, and 75%, reductions respectively. of Sewage12 logs mainly susceptible children. These viruses are of great in the HAdV viral load were observed in some, but not relevance in terms of public and environmental health, as they have an enormous potential spread due to their treatment was able to reduce the FC counting, it was not extended maintenance into the environment. in all treated effluent samples. Although the secondary Thus, more studies on the impact of sewage treatment in EV87 - ENVIRONMENTAL SURVEILLANCE OF HUMAN viralalways removal efficient should to HAdV be accomplished removal in domestic to establish sewage. new ADENOVIRUSES IN A WASTEWATER TREATMENT and effective wastewater management policies. PLANT Assis, A.S.F.; Otenio, M.H.; Domigues, A.L.S.; Drumond, EV92 - ABSENCE OF HEPATITIS A VIRUS (HAV) IN B.P.; Fumian, T.M.; Miagostovich, M.P.P.; Rosa e Silva, AFFLUENT AND EFFLUENT SAMPLES FROM SEWAGE M.L. TREATMENT PLANTS LOCATED IN NOVO HAMBURGO, 1. UNIVERSIDADE FEDERAL DE JUIZ DE FORA BRAZIL 2. EMBRAPA GADO DE LEITE Manfro, I.D.; Pressi, G.F.; Demoliner, M.; Souza, F.G.; 3. UNIVERSIDADE FEDERAL DE MINAS GERAIS Hamerski, F.; Spilki, F.R.; Rigotto, C.; Fleck, J.D. 4. INSTITUTO OSWALDO CRUZ UNIVERSIDADE FEEVALE Hepatitis A virus (HAV) is responsible for the largest elimination of pathogenic microorganisms such as number of cases of acute viral hepatitis worldwide. entericSewage viruses.treatment Nevertheless, may be insufficient the fecal for coliforms the complete (FC) HAV is a member of Hepatovirus genus, Picornaviridae are widely used as indicators for evaluating the quality family, and viral particles are composed by naked icosahedral capsids protecting a positive singlestranded of the effluent in wastewater treatment plant (WWTP). RNA genome. HAV particles may remain viable in environment and food for long periods. It is estimated theThus, importance the return of thethe treated waterborne effluent pathogens. to the nature Human can that 1.4 million people in the world suffer annually for adenovirusesprovide significant (HAdV) harm are associated to public health,with sporadic considering cases hepatitis A, whose prevalence is related to sanitation and and outbreaks of gastroenteritis. These agents are present socioeconomic conditions. HAV is detected sporadically in various types of aquatic environments and also have in environmental matrices and only one sample out of been described as the most prevalent enteric viruses 100 was positive for HAV in surface waters from Novo in sewage. In this environmental surveillance study we Hamburgo (pop. approximately 250,000 inhab.) in a investigated the HAdV presence in four different points survey conducted in 2015. The goal of the present work of the sewage treatment, evaluated the impact of sewage treatment with activated sludge in HAdV viral load and samples from two sewage treatment plants (STPs) of in FC counting in a WWTP from Juiz de ForaMG. For this Novowas evaluate Hamburgo, if HAV through is also the rare polymerase in affluent chain and reactioneffluent purpose, raw sewage (n=24), primary sewage (n=24), real time (RTqPCR). In the period from November 10th 2015 to May 17th 2016, fortnightly collections were collected bimonthly, between January and December carried out from an STP running in parallel activated 2014.sludge The (n=24) samples and treated were concentrated effluent samples using (n=24) elution were and using a sequential treatment process consisting of were extracted using a commercial kit and the viral load sludge and floating macrophytes, and another STP wasskimmed determinedmilk flocculation using real procedure.time PCR. Viral The nucleicFC counting acids reactor. Sixty six (n=66) samples were collected, being was determined monthly in each point. HAdV were UASB reactor, aerobic filter, activated sludge and anoxic from activated sludge, 10 anoxic reactor residual waters viral loads values ranging from 3.27E+02 to 2.42E+06 22 raw sewage, 10 UASB reactor effluents, 12 effluents genomedetected copies in 85.4% per milliliter.(82/96) of HAdV the testedpositivity samples, rate in with raw were concentrated by ultracentrifugation method and and 12 floating macrophytes effluents. The samples Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Environmental Virology: EV sewage, primary sewage, sludge and treated effluent XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

72 Environmental Virology: EV subjected to extraction of viral RNA. The cDNA was synthesized and subsequently submitted to molecular detection by RT qPCR, using primers targeting 5\’UTR as GII and 4.3% (2/47) as GI+GII. This pathogen was of HAV genome. Results were revealed using TaqMan® identified in all the analyzed beaches and although the highest positivity was found on PA beach (38.5% 15/39), semiit was nested not observed RTPCR significant were retested difference for the from 5\’ theend others ORF2 ofHAV thespecific virus under probes. environmental HAV was absent conditions throughout in the Novo thus (FR/AR p=0.63 and MU p=0.13). Positive samples by Hamburgocorroborating city. previous findings of a very low prevalence ofand the NoV other was sequences detected in(n=10) 29.8% did (14/47). not allow Of these,genotyping three EV94 - OCCURRENCE OF NOROVIRUS IN sevenwere classified for GI and asthree GII.4 for and GII. oneStatistically, as GI.8. Thepositivity low quality found RECREATIONAL WATER FROM MOSQUEIRO ISLAND, BELÉM CITY, PARÁ STATE, NORTHERN BRAZIL Teixeira, D.M.; Deus, D.R.; Smith, V.C.; Santos, D.S.A.S.; periodsin the years of more of 2012 and2013, less rainy was not (p=0.06), influenced corresponding by rainfall Alves, J.C.S.; Siqueira, J.A.M.; Bandeira, R.S.; Morais, to(p=0.87), the 1st also, and no 2nd relation semesters, was verified respectively. comparing Of the L.L.C.S.; Gabbay, Y.B. 1. SEÇÃO DE VIROLOGIA – INSTITUTO EVANDRO in water with acceptable concentrations of Escherichia CHAGAS/SVS/MS colipositive (<2000) samples by Brazilian for NoV, resolution. 91.5% (43/47) This studywere providesdetected 2. PROGRAMA DE PÓSGRADUAÇÃO EM BIOLOGIA evidence of a risk of acute gastroenteritis on users of PARASITÁRIA NA AMAZÔNIA, UNIVERSIDADE recreational water, mainly children, and highlights the ESTADUAL DO PARÁ 3. SEÇÃO DE MEIO AMBIENTE – INSTITUTO EVANDRO importance of including enteric viruses in the quality CHAGAS/SVS/MS monitoring of recreational water.

The precarious sewage infrastructure favors the viral EV103 - ASSESMENTOF THE PRESENCE OF HUMAN particles spread in aquatic environments and causes ADENOVIRUS, SEROTYPES 40 AND 41 ON SURFACE public health problems. Noroviruses (NoV) and others WATERFROMRIO CAÍ WATERSHED IN RIO GRANDE enteric viruses has been described in sea water, lagoon DO SUL STATE, BRAZIL and river, and are considered the major cause of Oliveira, F.C.; Heck, T.M.S.; Staggemeier, R.; Ritzel, gastroenteritis outbreaks worldwide. This study aimed R.G.F.; Dutra, J.M.M.; Silva, L.G.A.; Schneider, T.; Almeida, S.E.M. surface water samples from four beaches: Paraíso (PA), UNIVERSIDADE FEEVALE Murubirato detect (MU), and genotyping Farol (FR) NoVand Areião genogroups (AR) located GI/GII on the Mosqueiro Island, metropolitan region of BelémPa, By linking human presence and the precariousness of the collection system and treatment of industrial and were collected monthly with exception of July when they domestic sewage we are faced with a big problem. The occurredfrom January/2012 fortnightly. toNoV December/2014. particles were Theconcentrated samples water quality has been compromised by this precarious system. As cities grow due to increased population Viral RNA was obtained by silica method and subjected density problems tend to increase.The concept of by adsorptionelution method in filtering membrane. environmental quality is directly linked to quality of life and related to other factors, including biological. We can to semi nested RTPCR using in the first step the primer consider that humans are largely responsible for the respectively.pair JV13I/JV12Y Positive and samples in the second by semi the nested JV13I/GI RT PCR and pollution and spread of pathological microorganisms. wereJV12Y/Noro analyzedR pairsfor 5\’ for end specific ORF2 region detection (capsid) of GI by and nested GII, Viruses are one example of microorganisms that cause these diseases. Among them we can mention the Human Adenovirus (HAdV), which are highly and(GI) andsubjected seminested to molecular (GII) for characterization. identification of circulatingFrom 156 contaminating group responsible for several diseases genotypes, which were purified using commercial kit such as gastroenteritis affecting millions of people around the world, this is mainly caused by the serotypes samples tested, 30.1% (47/156) were positive for NoV, andVirus 63.8% Reviews (30/47) & Research were Vol 20 classified (2), August-December as GI, 31.9% 2016 (15/47) - Abstracts/Posters - Environmental Virology: EV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

73 Environmental Virology: EV

40 and 41.They are eliminated in the faeces by infected resistance to many chemical compounds, and are spread persons. When they dispersed in the environment, to at large number in the faeces, turning into a public health remain stable, adherent to environmental substrates for problem. The human Adenovirus (HAdV) type F serotype long periods and thus contaminate other individuals. 41 it’s one of the major precursor of infectious diarrhea Through its detection in the environment, we can say in the world, becoming fatal for elders and children. The that there is an indicator of human fecal contamination. Rio Caí, located at the Rio Grande do Sul state, it has his This study linked the presence of these viruses in the water used for many functions, like irrigation, recreation environment and the quality of surface water in parts of and supply. However, it is one of the most polluted rivers the lower stretchfromRio Caí in the state of Rio Grande in Brazil, because of degradation and environment do Sul. A total of 10 water samples were collected in June problems, providing the proliferation of pathologic 2016 in 10 points. Concentrations were carried out by microorganisms. The HAdV has the capacity to connect ultracentrifugation method and viral DNA extraction. with the sediment and percolate through the soil, hitting Viral molecular detection occurred via qPCR, primers underground waters, and staying viable for more time at particulate material. With these information, this study have the objective to detect the human Adenovirus presenceofspecific hybridization adenovirus to serotype the viral 40 genome. or 41 Thein surface results enteric type 41 on samples of sediment from the water.show thatThe viral 90% load (9/10) ranged of thefrom samples 1.82 x 106 confirm genome the watershed of Rio Caí, with the goal of relationate the region’s environment quality, searching to understand point 9. According to the results, we can say that there is the actions and effects that viral agents can cause. There fecalcopies/L contamination in point8 toof human 9.70 x 106origin, genome present copies/L in surface in were made 10 collects of sediment on different locations water of the Rio Caí. And relate to the quality of water at down of the river stretch at June 2016. The samples used by the population for various purposes such as were conserved until processed. The viral genomes were consumption, hygiene and recreation, and the methods extracted with the commercial extraction kit Biopur, used today in accordance with Brazilian law are not following the recommended methodology. The molecular suitable for viral elimination in the treated water. So in detection was realized by the qPCR technician, using this way, the use of this water brings risk for the human health, becoming a major public health problem. showed 3 out of 10 samples of sediment were positive specific primers for the HAdV detection. The results EV104 - DETECTION OF HUMAN ADENOVIRUS AT presence means that the sediment samples from Rio Caí, SEDIMENTS SAMPLES FROM RIO CAÍ WATERSHED, indicatesfor the presence faeces contamination,of the Adenovirus and F shows 40/41. the The presence HAdV’s RIO GRANDE DO SUL STATE, BRAZIL of an anthropology environmental impact, that, may Dutra, J.M.M.; de Oliveira, F.C.; Schneider, T.; Ritzel, compromise the population’s life quality since the virus R.G.F.; Silva, L.G.A.; Heck, T.M.S.; Staggemeier, R.; can reach underground waters or returning to the water Almeida, S.E.M. column, infecting again the hydric resource. UNIVERSIDADE FEEVALE The Adenovirus belong to a heterogeneous group of viral agents denominated as enteric virus, making yourself steady in the gastrointestinal tract as in the environment, when eliminate with the faeces. His resistance allows him to contaminate the water and the soil for a long period of time. It can be used as a strong indicator of fecal contamination. The residual a dispersion and contamination of many ecosystems by pathologicaltreatment lack microorganisms, and the industries like effluents,the Adenovirus, had caused able to infect humans and animals. Those virus have a high

74 Environmental Virology: EV

EV111 - DETECTION OF HUMAN ADENOVIRUS IN WATER AND SEDIMENT SAMPLES FROM PARANHANA RIVER IN RIO DOS SINOS WATERSHED, BRAZIL with variation in viral quantifying 1.07x10^5 to 6.98x10^8gc/L. In relation to the sediment, the viral Heck, T.M.S.; Ritzel, R.G.F.; Oliveira, F.C.; Schneider, genome was detected in 79.2% (57/72) on average T.; Dutra, J.M.M.; Silva, L.G.A.; Röhnelt, N.M.S.; Jesus, 1.58x10^6gc/g, showing variation of 1.22x10^4 to L.F.; Nascimento, C.A.; Spilki, F.R.; Staggemeier, R.; strong anthropic impact demonstrated by the presence 3.50x10^7gc/g. From this study it is possible to realize a Almeida, S.E.M. of HAdV in the region of the sub basin of Rio Paranhana, UNIVERSIDADE FEEVALE an important source of water catchment for public supply of RSW. Paranhana river is situated in the centralnorthwest region of the Rio dos Sinos Watershed (RSW) in the EV112 - ADENOVIRUS AS A TRACKER OF HUMAN state of Rio Grande do Sul (RS) and is one of the main FECAL CONTAMINATION IN PUBLIC RECREATIONAL tributaries of the Rio dos Sinos. Its springs are located WATERS IN THE STATE OF RIO GRANDE DO SUL, on the border between the municipalities of São BRAZIL Francisco de Paula and Canela and its mouth in the city Heck, T.M.S.; Röhnelt, N.M.S.; Ritzel, R.G.F.; Oliveira, F.C.; Jesus, L.F.; Staggemeier, R.; Rigotto, C.; which receives possible contaminants carried along its Nascimento, C.A. of Taquara, place of its confluence with the Rio dos Sinos, route to the RSW. Enteric viruses are excreted in large UNIVERSIDADE FEEVALE amounts in human faeces and are considered good markers of environmental pollution. Among them, the Enteric viruses have frequently been implicated in Human Adenovirus (HAdV) to be doublestranded DNA recreational waterrelated gastrointestinal (G.I.) disease and non enveloped remains infectious for longer in and most infections can be contracted by ingestion of HAdV contaminated water or inhalation of dropletsas viruses. This pathogen is included in the \”Contaminant a result of swimming, canoeing or other recreational Candidatewater and Listsoil /4\” sediment of the Unitedthan a Statessimple Environmental stranded RNA use of sewagepolluted water may be viral in nature. Protection Agency (USEPA) for their health importance, Human adenoviruses (HAdVs) have been considered frequent occurrence in many aquatic environments and critical emerging viruses since the potential health risks due to disease outbreaks mainly in children under 4 associated with their waterborne transmission. Recent years associated with fecaloral route, as gastroenteritis. studies suggest HAdV as a marker of viral contamination It is very important the use of biomarkers that allow in the environment, since its presence in water indicates monitoring and identifying the source of contamination, human fecal contamination and present themselves as and therefore the anthropic impact on river basins, such a better marker than bacterial indicators (E. coli and as the subbasin of Paranhana river, which contributes thermotolerant), that are currently used in Brazilian to the public water supply in the region. Contamination legislation for balneability assessment. Although HAdVs

such as waste water drinking waters, groundwater, have frequently been identified in various environments returningof water resourcesthe water is column influenced and by contaminate soil/sediment water due surface waters and recreational waters, quantitative catchmentto potential sources adhesion/desorption particularly in ofregions the viral where particle the information for HAdV occurrence at public lake or system is poor or is devoid of sanitation. This study aims study was to asses the HAdV presence in water samples to assess the environmental quality through molecular river beaches is still insufficient. The overall goal of this detection of HAdV at different points from its spring from a river beach located at the Rio dos Sinos basin, to its mouth in the Rio dos Sinos. Bimonthly samples by quantitative polymerase chain reaction (qPCR). of water and sediment samples were performed at 12 Water samples were collected from João Martins Nunes points along the Paranhana river from May 2015 to beach, located in the county of Taquara, Rio Grande do March 2016, totaling 72 samples. Among the results in Sul. One sample was collected weekly in sterile bottles

December 17, 2015). For the viral concentration, 36mL water, it was verified the presence of the viral genome of 500mL for a period of five weeks (November 19 to Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - in 87.5% (63/72) observing an average 4.20x10^7gc/L Environmental Virology: EV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

75 Environmental Virology: EV of each sample were subjected to ultracentrifugation method followed by nucleic acids extraction through from 2,14E+08 maximum to 2,89E+00, minimum. In Spin kit Plus 250 (Biopur ®). The detection and alland water 38% oftreatment treated waterplants samples.variation Theof HAdV values removal ranged was observed. When reductions in the viral load across the qPCR (commercial SYBR ® Green Platinum kit qPCR the treatment were observed, they are below the 4logs quantification of the viral genome was performed from required by many international standards. It was also noticeable samples in which there was an increase in the SuperMixUDG, Invitrogen) using specific primers for the Hexon gene of HAdV. The results present 40% (2/5) of positive samples for HAdV from the first two consecutive andlevels contamination of HAdV especially during water after thetreatment. filtration step. This preliminarysamples of November study, the with search quantification of HAdV highlighted of 2.1x106 andthe finding may point to operational errors and misconducts need1.5x103gc/l of viral (genomic evaluation copies/liter), in recreational respectively. waters to In track this EV116 - ADENOVIRUS AS HUMAN CONTAMINATION the source of fecal contamination together with fecal INDICATOR FECAL IN WATERSHED OF RIO TRAMANDAI, RS Ritzel, R.G.F.; Andriguetti, N.B.; Oliveira, F.C.; bacteriaEV114 -identification. ADENOVIRUS REMOVAL AND SHEDDING Heck, T.M.S.; Luz, R.B.; Gularte, J.S.; Rocha, C.M.; IN DRINKING WATER FROM CONVENTIONAL Heinzelmann, L.S.; Bianchi, E.; Staggemeier, R.; TREATMENT PLANTS Almeida, S.E.M. Staggemeier, R.; Jesus, L.F.; Heck, T.M.S.; Röhnelt, 1. UNIVERSIDADE FEEVALE N.M.S.; Nascimento, C.A.; Spilki, F.R. 2. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL UNIVERSIDADE FEEVALE Enteric Viruses are important etiological agents of Contamination of water resources and the increase of infection of the gastrointestinal tract. The contamination waterborne diseases are directly related to sanitation is faecaloral route, one of the forms of propagation of and inadequate water treatment.Water treatment plants aims to reduce the impacts on health and the environment viruses, adenoviruses have a capsid which preserves the of biological and chemical agents present in raw water. DNAsuch molecule,microorganisms nonenveloped, are the effluents with an icosahedral.From the enteric form. Lately it has been questioned whether conventional The Adenoviruses are resilient to the environment and water treatment processes are capable of removing the usual water treatment. It has the ability to infect microbial and chemical contaminants. The goal of this several human tissues, such as the gastrointestinal mucosa and cause respiratory infections, there is a human adenovirus C (HAdVC) in the four conventional bigger incidence of transmission occur in children under waterstudy wastreatment to evaluate stages the in presence eight (8) and conventional quantification water of four years. According to the Tramandaí Committee, it’s treatment plants from Rio Grande do Sul comprising 8 released every year four thousand of pollution load in municipalities along the Sinos River (Santo Antônio da Rio Tramandaí’s watershed, adding to the untreated Patrulha, Rolante, Esteio, Taquara, Três Coroas, Parobé, sewage, industrial waste, livestock and agriculture. The Campo Bom, and Nova Santa Rita). From May 2011 to May present study goal is to evaluate the fecal contamination by human Adenovirus ( HAdV ) in complex ponds of (drinking) water were collected monthly, in a total of Tramandaí’s watershed . Sixty samples were collected 8322013 samples. samples Adsorption–elution from raw, decanted concentration , filtered , and methodtreated using a negatively charged membrane was performed. 2014. The method used for water concentration was by Viral nucleic acids were extracted with a commercial kit from 10 lakes between December / 2013 and May / and quantitative real time polymerase chain reaction extraction of the viral DNA samples. Viral detection was (qPCR) was performed using primers designed to amplify obtainedadsorption by / elutionquantitative negative polymerase membrane chain was reactiontook after ( the hexon protein gene of HAdVC. Comparing different were positive for HAdV. Evaluating seasons separately, qPCR ). In the analyzed period, 58% ( 35/60 ) of samples treatment steps 56% of raw water samples were positive forVirus HAdV, Reviews 13% & Research of decanted Vol 20 (2),water, August-December 23% of filtered 2016 water, - Abstracts/Posters 30 samples - Environmental on the summerVirology: EV were tested, 20 (66.6 %) XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

76 Environmental Virology: EV were positive, and 30 samples were assessed on the the period December to February there is a seasonality for HAdV 2/5, followed by HAdV 40/41 (35.9%), RV season,autumn, increasing only 15 showed the number the presence viral levels. of virus However, (50 %). the At (26%), and EV (20.8%). The viral loads ranged from contamination of lakes it’s eminent, demonstrating a the102 description gc/L up to 109of viral gc/L genomes (water), in and water from and 101 sediment gc/g to samples108 gc/g taken (sediment). from the This streams is the in firstRSW, report contamination showing significantEV120 - antropic ENTERIC impact VIRUSES on Rio Tramandaí IN SEDIMENT watershed. AND of sanitary sewage services, carelessness with domestic SURFACE WATER FROM URBAN AREAS IN THE RIO wastewaterof waters and and sediments intense urbanization. in the region reflects the lack DOS SINOS WATERSHED, SOUTHERN BRAZIL Staggemeier, R.; Heck, T.M.S.; Ritzel, R.G.F.; EV201 - ADENOVIRUS CAN BE DETECTED OVER Andriguetti, N.B.; Oliveira, F.C.; Spilki, F.R.; Almeida, TIME IN DIFFERENT FREQUENCIES ON HOSPITAL S.E.M. SURFACES, EQUIPMENT AND SUPPLIES UNIVERSIDADE FEEVALE Rigotto, C.; Posser, K.C.; Pressi, G.; Albino, S.; Rigotto, C.; Spilki, F.R. Enteric viruses are considered good biological indicators of environmental pollution by human faeces. They may UNIVERSIDADE FEEVALE be deposited on the soil or water, are very resistant both The contaminations caused by viruses in hospital in the gastrointestinal tract as in the environment for facilities are often not reported due to lack of virological long periods, bringing risks to human health of those who monitoring routine in most hospitals, that is restricted consume the water coming from these contaminated to bacterial indicators. Human Adenoviruses (HAdV) are sources. The anthropic action in particular has affected common pathogens often associated with respiratory important to evaluate the quality of these environmental young people and were selected to be used in the matricessignificantly by theusing quality different of soil biomarkers, and water, thusand becomingsearching presentand gastrointestinal study as a marker. illness These and/or viruses conjunctivitis belong to in the source of environmental contamination to develop Adenoviridae Family and Mastadenovirus genus, are solutions that mitigate the human impact. The present nonenveloped with doublestranded DNA genome work aims to assess the frequency of human enterovirus and great resistance in the environment, even after (EV), human adenovirus (HAdV), and group A rotavirus cleaning, disinfection and sterilization. In the present (RV) in soil and water samples from four streams in study we evaluated the presence and viability of HAdV the municipalities of Campo Bom, Estância Velha, Novo on fomites from a hospital in the Vale dos Sinos region, Hamburgo and Portão, Rio dos Sinos Watershed (RSW), Brazil. Samples were collected with sterile swabs, from Rio Grande do Sul state, Brazil. Twelve bimonthly November 2015 to February 2016. The target sites were collections of water and sediment samples were carried divided into two groups of samples: a) Group 1: total out from September 2012 to July 2014 in 16 different of 64 samples from the surfaces of hospital sections sites from four streams in RSW, southern Brazil, b) Group 2: total of 32 samples from the materials of totaling 192 samples of each matrix. Water samples autoclaving sterilization process. These samples were were concentrated by adsorptionelution method, while subjected to viral DNA extraction procedure with the extraction. For RNA viruses (RV and EV) was performed onethe sedimentmore step was of eluted, reverse followed transcriptase. by viral DNA/RNAMolecular genecommercial by polymerase kit Biopur® chain reaction and for in quantification real time (qPCR) we detection was performed using quantitative polymerase applied the partial amplification of the HAdV hexon chain reaction (qPCR). Of the 192 samples collected VTB2f sequences (5\\\’GAGACGTACTTCAGCCTGAAT3 \\\’)using and specific VTB2 primersr (5 \\\’ GATGAACCGCAGCGTCAA to identify HAdVC as follows:3\\\’). from water, 79.2% showed positive for the presence of \\\’ GCCTGGGGAACAAG TTCAGA3\\\’) and VTB1r HAdV 2/5, 24.5% for HAdV 40/41, 34.4% for EV, and (5\\\’To identifyGCGTAAAGCGCACTT HAdVF we used TGTAAGspecific 3\\\’).primers HAdV VTB1 Fwas (5 12.5% for RV. Regarding the detection of nucleic acids in sediments,Virus Reviews 63% & Research of the Vol samples 20 (2), August-December were detected as2016 positive - Abstracts/Posters - Environmental Virology: EV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

77 Environmental Virology: EV

EV246 - ENTERIC VIRUSES IN WATERS FROM 2016 G1 with variations in positivity rates over the months. OLYMPIC VENUES present in 14,06% (9/64) of the total samples of group From group G2, we were not able to detect any positive Spilki, F.R.; Staggemeier, R.; Venker, C.A.; Heck, T.M.S.; sample for HAdV. Positive samples were also evaluated Demoliner, M.; Ritzel, R.G.F.; Röhnelt, N.M.S.; Girardi, by Infectivity by performing ICCqPCR assays, resulting V. in three possible samples, all from the same collection UNIVERSIDADE FEEVALE month (February). The viable samples were obtained from mouse and work table the of professionais of uti Rio de Janeiro\\\’s inner and coastal waters are heavily and a patient clipboard interned in pediatrics. These impacted by human sewage pollution for decades. Even results reveal contamination in hospital fomites, thus though authorities promised in their 2009 winning Olympic emphasizing the extreme importance of the effectiveness bid that cleaning the waterways were a legacy of the event. of the cleaning process, highlighting the need to improve Enteric viruses, including human adenoviruses (HAdV), virological monitoring in health facilities. human enterovirus (EV) and group A rotavirus (RV) are more likely to be found in contaminated surface waters and have EV227 - DETECTION OF KLASSEVIRUS IN been the focus of many studies, because of their persistence in WASTEWATER IN RIO DE JANEIRO, BRAZIL the environment its importance in public health. The present Seglia, M.; Fioretti, J.M.; Ferreira, M.S.R.; Miagostovich, work aimed to assess the frequency and loads of EV, HAdVC M.P. and F species, and RV in sediment and water samples from FUNDAÇÃO OSWALDO CRUZ Guanabara Bay, Rodrigo de Freitas Lagoon, and beaches of Ipanema, Copacabana, Marina da Glória, Leblon and Barra Enteric infections are responsible for clinical cases da Tijuca, in water venues used during the 2016 Summer of acute diarrhea (AD), affecting millions of people Olympics and by tourists attending the event. Sixteen monthly worldwide, with a major impact in children less than 5 collections of water (and sediment samples were carried out from March 2015 to July 2016 in 12 different sites from of diarrhea are of unknown etiology it is increasing the Rio de Janeiro, Brazil, totaling 146 water samples and 45 numberyears in developingof emerging countries. virus associated Although with 40% this of alldisease. cases sediment samples. Water samples (0,5l) were concentrated by The main objective of our study was to demonstrate ultracentrifugation method, while the sediment was eluted in the presence of Klassevirus (KV) in sewage samples obtained from wastewater treatment plant (WWTP) extraction. For RNA viruses (RV and EV) cDNA sysnthesis was in Rio de Janeiro. KV is an emerging virus described minimum essential medium, both followed by viral DNA/RNA performed one more step of reverse transcriptase. Molecular detection was performed using quantitative polymerase this study, 52 wastewater samples obtained from June chain reaction (qPCR). All samples were further investigated 2013in 2009 to andMay classified2014. were into previously Piconarviridae concentrated family. Forby by integrated cell culture PCR (ICC PCR) to check about the presence of HAdV infectious virus particles. From all water viral detection a quantitative realtime PCR (qPCR) usingorganic TaqMan® flocculation system using was skimmed employed milk to method.amplify Forthe least one viral target. Regarding the viruses individually, samples collected, 95.9% showed contamination with at viral concentration ranging from 3.93 to 1.77 x103 region 3D. KV was detected in 84.6% of samples with the following results were found (% for water and sediment respectively): HAdVC and F (93.1% and 64.9%), RV (12.3% points were the Rodrigo de Freitas Lagoon, where Olympic autumn,genome copyalthough (gc) /the reaction. small Anumber higher percentageof samples ofdoes KV and 10%) and EV (26.7% and 8.8%). The most contaminated rowing will take place, and the Marina da Glória, the starting not(11.36%) allow inferring was detected the seasonality in the months of these of summerviruses. The and point for the sailing races, in which adenoviral and rotaviral shows the circulation of those emerging viruses in the RV and HAdV were also found in Copacabana and Ipanema metropolitandetection of KV region in almost of the 85% state, of whichthe samples has not studied been loads in samples ranged from 105 to 109 genome copies/L. sand and water samples. Many samples presented infectious recognized by the absence of diagnosis or by association with asymptomatic infections. particles at the first passage in A549 cell cultures, and up to Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters90% of all - Environmental sites presented Virology: viable EV viruses. XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

78 Environmental Virology: EV

EV253 - GENETICS CHARACTERIZATION OF METAVIRUS ASSOCIATED WITH AMAZON SOIL FUNGUS Oliveira, R.R.; Barata, R.R.; Cardoso, J.F.; Oliveira, R.S.; Vasconcelos, J.M.; Lemos, P.L.; Franco Filho, L.C.; Nunes, M.R.T. INSTITUTO EVANDRO CHAGAS/CENTRO DE INOVAÇÕES TECNOLÓGICAS The retrotransposons are present at various eukaryotic two viral families: Pseudoviridae and Metaviridae. Between organisms, such as fungi. Currently, they are classified into metavirus genus, three Hemivirus and three pseudovirus). viral fungi species, only 11 are officially recognized (five from The presence of reverse transcriptase is common in both families, but the presence and order of its protein domains fungi isolated from soil samples of Environmental Protection is specific for each family. To detect the viruses presence in Area of the Combu island (Belém – State of Pará), the genetic material of three fungi was extracted and sequenced using Ion PGM platform. The generated readings were assembled with Mira v.4 software and the contigs were compared with the non redundant sequences database of NCBI, using BlastX algorithm. The viruslike contigs were annotated and its coding regions were submitted to InterProScan (EMBLEBI) for the conserved protein domains prediction. The domains were compared with representative species sequences of Metavirus, Hemivirus and Pseudovirus by aligning the secondary structure using the PROMALS3D. Only one fungi showed viral contigs, (polyprotein of 3186 bp) with 9.5x coverage. The predicted polyprotein presented domains similar to Metavirus (Metaviridae Family), with a conserved polymerases domain followed by a Hlike ribonuclease. The with the Schizosaccharomyces pombe virus Tf1, while complete polyprotein alignment showed 17.97% identity the secondary structure region alignment of polymerases between this metavirus and specimens database, arguing that showed 28.05%. These identity values show a large difference a possible new retrotransposon for Metaviridae family.

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Environmental Virology: EV HUMAN VIROLOGY - HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

80 Human Virology: HV

HV3 - OUTBREAK OF G2P[4] ROTAVIRUS presented here suggests that RVA should be considering GASTROENTERITIS IN A RETIREMENT COMMUNITY, as a possible cause of gastroenteritis during outbreaks BRAZIL, 2015: AN IMPORTANT PUBLIC HEALTH investigations in residential facilities, and raise the RISK? question if the current licensed RVA vaccines for children Luchs, A.; Madalosso, G.; Cilli, A.; Morillo, S.G.; Martins, could also be helpful for the elderly. Our investigation S.R.; Souza, K.A.F.; Namiyama, G.M.; Gonçalves, C.R.; also highlights the importance of a tight collaboration Carmona, R.C.C.; Timenetsky, M.C.S.T. between nursing home staff, public health authorities 1. INSTITUTO ADOLFO LUTZ and reference laboratories. As far as we aware this is the 2. CENTRO DE CONTROLE DE DOENÇAS 3. COORDENADORIA REGIONAL DE SAÚDE home in Brazil. first documented report of RVA outbreak in elderly care Group A Rotavirus (RVA) gastroenteritis outbreaks in HV7 - INFECTION ASSESSMENT BY EBV AND H. PYLORI agedcare facilities have been reported globally, and can AMONG GASTRIC ADENOCARCINOMA PATIENTS IN represent an important public health risk. In Brazil, the PARA STATE, NORTHERN BRAZIL frequency of RVA outbreaks among elderly in nursing Brasil Costa, I.; Souza, C.O.; Barros, I.C.; Paixão, L.C.F.; homes is virtually unknown. The aim of the present study Santos, L.F.P.; Monteiro, T.A.F.; Burbano, R.R. was to describe a RVA outbreak in a private residential 1. UNIVERSIDADE FEDERAL DO PARÁ care home in São Paulo, Brazil, using epidemiologic and 2. INSTITUTO EVANDRO CHAGAS molecular diagnostic methods. A descriptive clinical, epidemiological and environmental investigation was conducted. Stool samples were collected and screened gastric cancer cases and it is a major public health problemGastric adenocarcinomain the State of Pará, accounts Northern for aboutBrazil. 95% Belém, of the state capital, has already been in 11th place among RTforPCR, RVA, qRT NorovirusPCR, electron (NoV), microscopy Enteric Adenovirus and sequencing 40/41 the cities with the highest prevalence of the disease in methods.(AdV 40/41) Because and Astrovirus viral etiology (AstV) was using suspected ELISA, PAGE,from the 1990s. Viral and bacterial infections may contribute the outset, bacteria and protozoa were not searched for. to increase individual susceptibility to the gastric Outbreak occurred during 26th29th October, 2015, and adenocarcinoma development. The infectious agents of major importance for the development of gastric cancer are EpsteinBarr Virus (EBV) and Helicobacter age:affected 85.5 28 individualsyears) and (22 staff residents; (median 6 staff).age: 28 The years), attack pylori. The objectives of this study were to investigate respectively.rate was 25.9% Symptoms and 8.5% were among mild and residents hospitalization (median the prevalence of these agents in patients with gastric adenocarcinoma and the association of such infections index case. State of hygiene of the nursing home was with age, gender, histological type, location, stage and was not required. A female staff was identified as the metastasis. A cross sectional, observational and analytical study was conducted, enlisting DNA extracted from assessed as suitable. RVA was detected in 87.5% (7/8) tumor tissue samples from 203 patients treated at the of the collected samples, and characterized as G2P[4] Ophir Loyola Hospital, during 1998 and 1999. Detection PCRgenotype assay. with This short unique dsRNA positive profile. NoV NoV sample genogroup was also GII of EBV was carried out by using the qPCR test. The was detected in one sample (12.5%; 1/8) only by qRT however NoV was not linked to the presented outbreak. with the commercial kit qPCRAlert EBV® (Nanogen). positive for RVA, highlighting one case of mixed infection; Foramplification detection of theH. pylori, EBNA1 a genePCR was region performed, was performed having Genetic analysis of VP7 and VP4 genes demonstrated as targets conserved regions of the urease A (ureA) and All samples were negative for AdV 40/41 and AstV. 16S ribosomal RNA (16S) genes, being considered as alsothat grouped the outbreak within involvedthe lineages one currently single G2P[4] circulating strain, in positive result if noticed the amplification for one or childrensuggesting worldwide, a common hintingsource that infection. institutionalized G2P[4] elderly strains both targets. Among the tested tumor samples, 22.7% are susceptible to the same types of RVA as kids. Data (46/203) were positive for both agents, 6.9% (14/203) Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersonly for - Human H. pylori, Virology: 31% HV (63/203) only for EBV and XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

81 Human Virology: HV

Mexico. Age was marginally associated with anal HPV by simple logistic regression demonstrated that the presence39.4 % (80/203) of a pathogen negative has for been both. associated Statistical with analysis the for 3144 years) being more likely to have any ?HPV at presence of the other (p <0.0001, OR = 4.1723 CI = 2.11 theprevalence, anal canal with compared older men to (aOR=1.59,younger men 95% (18 CI30 0.98 years).2.58 to 8.26). It was not possible to determine the direction of Prevalence of any ?HPV at the oral cavity was strongly this association, that is, which agent produces favoring infection by the other. A relationship of coinfection with ages 45–70 years compared to men 1830 years). Current advanced age and presence of metastasis was observed, associated with age (aOR=1.79, 95% CI 1.092.96 for men strengthening the hypothesis of a synergistic action by the two agents. These results reinforce the important smokers were significantly less likely to have ?HPV in the role that EBV and H. pylori have in the development and sexualoral cavity behaviors than men and who ?HPV never detection smoked (aOR=0.50,suggests digital 95% progression of gastric adenocarcinoma. contactCI 0.32 0.80).and autoinoculation The lack of association as surrogate between routes specificof viral transmission. HV10 - DISTRIBUTION OF BETA-PAPILLOMAVIRUS AT ANOGENITAL AND ORAL ANATOMIC SITES OF HV17 - DETECTION OF NOROVIRUS IN MEN: THE HIM STUDY IMMUNOSUPRESSED PATIENTS SUBMITTED TO Nunes, E.M.; Sudenga, S.L.; Gheit, T.; Tommasino, M.; KIDNEY TRANSPLANT IN BELÉMPA Baggio, M.L.; Ferreira, S.; Galan, L.; Silva, R.C.; Pierce Resque, H.R.; Lucena, S.S.; Silva, V.P.; Brasil Costa, I.; Campbell, C.M.; Lazcano-Ponce, E.; Giuliano, A.R.; Migone, S.R.C.; Silva, A.B.; Viana, C.A.; Gabbay, Y.B. Villa, L.L.; Sichero, L. 1. HOSPITAL OPHIR LOYOLA 1. MOLECULAR BIOLOGY LABORATORY, CENTER FOR 2. INSTITUTO EVANDRO CHAGAS TRANSLATIONAL RESEARCH IN ONCOLOGY Gastroenteritis is one of the most common complications 2. INSTITUTO DO CÂNCER DO ESTADO DE SÃO PAULO, observed in immunosuppressed individuals, either by 3. HOSPITAL DAS CLÍNICAS DA FACULDADE DE MEDICINA DA UNIVERSIDADE DE SÃO PAULO clinical condition or by that undergoing organ transplant, and its cause is often unknown. Norovirus (NoV), a Beta human papillomaviruses (?HPV) comprises viral member of the Caliciviridae family, is a major cause of types ubiquitously distributed throughout cutaneous gastroenteritis outbreaks worldwide, involving people of surfaces from body since early infancy, suggesting these all ages and is generally observed in closed environments such as cruise ships, hotels, restaurants and hospitals, describe the prevalence and distribution of 43 ?HPV due to its easy personto person transmission. NoV has typesmay be among part ofsamples the commensal collected at flora. the Oursame goal time was point to already been described in studies involving transplant from the external genital skin, the anal canal, and the oral patients, worldwide and in Brazil. This study aims to cavity from 717 men participating in the HPV Infection detect NoV in the feces of kidney transplant recipient in Men (HIM) Study. ?HPV detection and genotyping was patients, with and without gastroenteritis, hospitalized, treated and followed up at the Ophir Loyola Hospital in BelémPA. Each patient included in this research is atconducted the genital, using anal the canal, Luminex and technology.oral cavity, respectively.Overall, 77.7%, ?1 monitored for a period of 2 years, having their stool and54.3% ?2 andspecies 29.3% were men the were most positive prevalent for atany all ? sites,HPV type and HPV21, 22, 24, and 38 were the most frequent. Multiple ? every two months for another six months and every three HPV types were more commonly detected at the genital monthssamples incollected the last monthly year, when for thepossible. first six At months, the Evandro then (ranged from 2 to 19 types detected) than at the anal canal (29) or oral cavity (211). Men from the US and tested by a commercial enzyme immunoassay (EIA). FromChagas May Institute/SVS/MS, 2014 to April 2016, the 69 stool patients sample were is included initially Brazil were significantly less likely to have any ?HPV at in the project. Of the 275 samples collected until now, the anal canal (adjusted OR (aOR)=0.55, 95% CI 0.38– 0.80 to US and aOR=0.49, 95% CI 0.33 0.73 to Brazil) samples belong to 5 patients, coded as PTR041 (1), 7 (2.5%) tested positive for NoV by EIA. These positive and oral cavity (aOR=0.39, 95% CI 0.26–0.60 to US and Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV aOR=0.46, 95% CI 0.310.70 to Brazil) than men from XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

82 Human Virology: HV

PTR046 (1), PTR055 (1), PTR060 (1) and PTR064 (3). been established. to tackle this problem at the molecular Regarding patient PTR064, all 3 positive samples were level, we employed whole transcriptome sequencing of collected in 2016, on February 15th, April 6th and April human neurospheres derived from neural stem cells 29th, wherein the transplant occurred in February 8th. exposed to zikv isolated in brazil (asian genotype). Due to the proximity of collection dates, molecular tests differential gene expression analysis of control (mock) and nucleotide sequencing will be performed to clarify if and zikv infected neurospheres generated a list of 26 this is a case of single infection with prolonged shedding down-regulated and 64 up-regulated genes. Among or multiple infections by different NoV strains. With the up-regulated detected genes, the cyclin-dependent regard to symptoms, only patients PTR041 and PTR046 reported diarrhea episodes when questioned. The other acidic protein gene (gfap) were found. cdkn1a prevents patients were asymptomatic or had no data available. kinase inhibitor 1a (cdkn1a) and the glial fibrillary Therefore, it is concluded that NoV is circulating acting as a regulator of cell cycle progression during among immunosupressed patients submitted to kidney g1the andactivation gfap is of a the known cyclin marker e/cdk2 of astrocytes.c o m p we l e also x , transplant, corroborating some studies described in the observed a decrease in the expression of the neurogenic literature. Lastly, it is worth mentioning that this is a differentiation 1 gene (neurod1), which is directly pioneering study in Brazil, as regards the transplanted kidney recipient patients, and that it is still in progress, suggest that zikv infection induces cell cycle arrest and informing that molecular tests will also be performed, inhibitsinvolved the in neuronal the neurogenic differentiation, program. resulting Those not findings only aiming for NoV genotyping and the research of other in the reduction of the size, but in a deeper disruption of enteric viruses as well. the normal development of the human brain.

HV20 - WHOLE TRANSCRIPTOME ANALYSIS REVEALS HV21 - EVOLUTIONARY ANALYSIS AND THAT ZIKA VIRUS HALTS CELL CYCLE PROGRESSION CHARACTERIZATION OF WALIKE AND DS1LIKE AND DISRUPTS NEURONAL DIFFERENTIATION IN G12P[6]ROTAVIRUS STRAINS RECOVERED FROM HUMAN NEUROSPHERES DIARRHEIC CHILDREN IN BRAZIL Vianez Júnior, J.L. da S.G.; de Vasconcelos, J.M.; Garcez, Bezerra, D.A.M.; Guerra, S.F.S.; Serra, A.C.S.; P.P.; Nascimento, J.M.; da Costa, R.M.; Delvecchio, Fecury, P.C.M.S.; Sousa Junior, E.C.; Bandeira, R.S.; R.; Trindade, P.; Loiola, E.C.; Higa, L.M.; Cassoli, J.S.; Junior, E.T.P.; Lobo, P.S.; Linhares, A.C.; Soares, L.S.; Vitória, G.; Fuzii, H.T.; Sochacki, J.; Tanuri, A.; de Mascarenhas, J.D.P. Filippis, A.M.B.; Rehen, S.K. INSTITUTO EVANDRO CHAGAS 1. CENTER FOR TECHNOLOGICAL INNOVATION, The G12 genotype of group A rotaviruses (RVAs) has EVANDRO CHAGAS INSTITUTE become the sixth most prevalent genotype associated 2. INSTITUTE OF BIOMEDICAL SCIENCES, FEDERAL UNIVERSITY OF RIO DE JANEIRO, RIO DE JANEIRO with human infections. The genomic constellation 3. D'OR INSTITUTE FOR RESEARCH AND EDUCATION IDOR 4. INSTITUTE OF BIOLOGY, FEDERAL UNIVERSITY OF designates a specific genotype that is assigned to each of RIO DE JANEIRO VP1the 11VP2 segmentsVP3 NSP1 GxNSP2 P[x]NSP3 IxRxCxNSP4 MxAxNSP5),NxTx culminatingExHx, wherein in 5. INSTITUTE OF BIOLOGY, DEPT OF BIOCHEMISTRY three"x" defines main genetic the genotype groups ofas thefollows: VP7 VP4Walike, genes DS 1 (VP6 like, AND TISSUE BIOLOGY, UNIVERSITY OF CAMPINAS 6. FEDERAL UNIVERSITY OF PARÁ Brazil is facing an unprecedented growth in the number and AU1 like. The G12 genotype is associated with P[6], of microcephaly cases in babies. this phenomenon P[8] and P[9]. The most frequent constellation belongs coincided with the recent zika virus (zikv) outbreak in thoseto the Wabelonginglike; however, to the the DS availability1 constellation) of gene sequencesis scarce. this country. although the brazilian ministry of health was Therefore,of the G12 genotypethe aim of in thecombination present study with P[6]was (especiallyto analyse quick to recognize that zikv was probably the cause of microcephaly in newborns, the underlying mechanisms Walike and DS1 like constellations isolated from children leading to the development of this pathology have not the evolutionary dynamics of G12P[6].RVA strains of the Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

83 Human Virology: HV with diarrhoea in Brazil. For the present study, 30 trend of the cytokines and chemokines in accordance with the progression of the disease. The increased genes. The results obtained in the present study exhibited levels of IL1?, MIP1?, MCP1, TNF?, IL8, IL6 and IL10 was theG12P[6] Walike samples (16 samples), were selected DS1 like for (13 partial samples) analysis and of Wa the x associated with dengue severe and dengue with warning signs. Furthermore, MIP1? was negatively correlated with platelets counts and hematocrit, enquanto IL4 was I.DS In1 likerelation constellations to the evolutionary (1 sample). mechanisms, G12 was classified there was as belonging to lineage III and P[6] as belonging to lineage reassortment was observed in a VP2 gene of swine origin andcorrelated detected with by hematocrit. a multiplex This bead cytokine immunoassay, profile pattern favour inno one evidence sample, of andrecombination intergenogroup in the reassortment samples; however, events earlyin dengue prediction identified of SD herein, in DwWS from and a DwoWS Brazilian patients population who in the NSP4 gene were detected in another sample. The are at risk of developing severe outcome. The increased molecular clock of the VP6 gene indicated Walike G12 levels of IL1?, MIP1?, MCP1, TNF?, IL8, IL17 and IL10 to a lesser extent at different phases of illness can indicate the disease progression related to more severe cases and andwith VP4ancestry genes related belonging to G1P[8] to the and DS DS1 like1like constellation G12 related contribute to the establishment of more attention and hadto G2P[4]. genetic Generally, signatures the that results distinguished suggested them that fromthe VP7 the aminoacid changes that were not part of the antigenic therapeutic/hospitalizationHV46 - ANALYSIS OF BACTERIAL procedures. DIVERSITY IN sitesWalike described constellation; for these however, proteins. these The mutations study provides led to HIV/HPV COINFECTED PATIENTS WITH CERVICAL INTRAEPITHELIAL LESIONS THROUGH NEXT and DS1 constellations. GENERATION SEQUENCING important insights into the G12P[6] genome of the Wa Curty, G.; Siqueira, J.D.; Meyrelles, Â.R.; Machado, HV34 - CYTOKINE PROFILE PATTERN AS PREDICTOR E.S.; Soares, M.A. OF SEVERE DENGUE DISEASE IN PATIENTS AT RISK 1. INSTITUTO NACIONAL DE CÂNCER Ornelas, A.M.M.; Cardoso, C.C.; Aguiar, R.S. 2. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO The main factor associated with the development of 2. HOSPITAL NAVAL MARCÍLIO DIAS cervical cancer is the infection by human papillomavirus Dengue is an arthropodborne emerging viral disease with clinical manifestations ranging from asymptomatic cervical cancer. Several studies have shown an increase to severe forms including severe plasma leakage, in(HPV). bacterial HPV isdiversity necessary, in HPV but positive not sufficient cervical to cancer cause bleeding and hypovolemic shock in affected individuals. Although patients with severe forms present a ‘cytokine cervical intraepithelial lesions. However, little is known storm’, with high levels of circulating cytokines and aboutpatients cervical and the microbiome association of of specificHIVHPV bacteriacoinfected in chemokines which may exacerbate DENV pathogenesis, patients. HIV patients have a high prevalence of highrisk a cytokine pattern is not well established. Herein, we HPV and a greater chance of developing persistent HPV infection. The aim of this study is to evaluate the bacterial dengue patients as a tool for early predicting dengue severityinvestigated in dengue the potential with warning of cytokine signs (DwWS) profile fromand patients, looking for a putative association of such dengue without warning signs (DwoWS) patients whose profiles of the cervical region of HIVHPV coinfected may later develop severe dengue (SD). Plasma levels of this, we are analyzing 140 HIV+ cervical smear samples 17 different types of cytokines, chemokines, adhesion fromprofiles women with cervicalfollowed intraepithelial at Instituto lesions.de Puericultura To achieve e molecules and growth factors were assessed by multiplex Pediatria Martagão Gesteira (IPPMG), collected from 2010 to 2013. Samples have been categorized according at the 3 different phases of illness. The association to their collection point, CD4+ Tcell counts and cervical betweenfluorescent levels microbead of cytokines immunoassay and clinical in dengue parameters patients intraepithelial lesion. Total DNA was extracted, the were analyzed. We observed a remarkable growing

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersbacterial - Human 16S rRNAVirology: gene HV was amplified and libraries XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

84 Human Virology: HV were generated for nextgeneration sequencing, using an Illumina HiSeq 2500 platform. After sequencing, of B19VDNA in order to evaluate the role of the B19V reads were processed and compared against the 16S asreal etiological time PCR agent (qPCR) of acute for detection and FHF hepatitis. and quantification DNA was Greengenes database. All bioinformatics analyses were extracted from clinical samples using QIAAmp DNA mini carried out using an opensource bioinformatics pipeline Kit (Qiagen) and qPCR was performed by Sybr Green and for performing microbiome analysis named QIIME. A Taqman methodologies using primers for NS1 region total of 89 samples have been analyzed to date. The most abundant genus found was Lactobacillus, representing examine the suitability of qPCR, sera from patients with (E1905/E1987) and a synthetic standard curve. To also observed the presence of Gadernella, Atopobium, were tested: antiB19V IgM+ (n=12), antiB19V IgM Provotella,30% of the Streptococus, bacterial population Fusobaterium, in the Sneathia samples. and We (n=17) or without (n=40) confirmed B19V infection Megasphaera. These bacteria are described in other antiDENV IgM+ (n=9), HIV+ (n=5), HAV+ (n=4), HBV+ microbiome studies in HPV patients. Of note, the samples (n=6), B19VDNA+/HIV+ (n=5), antirubella IgM+ (n=9), showed an unequal frequency distribution of bacteria and liver biopsy samples from 11 patients with FHF in the different study groups. So far, it is not possible to were(n=3), tested. HSV1/2+ The (n=4). standard After curvethat standardization, parameters were serum for ofassociate bacterial specific communities bacteria have with been cervical observed intraepithelial according Sybr Green (R2=0.99; Efficiency=97%) and for Taqman tolesion lesions classifications. and to CD4+On the Tothercell hand,counts, distinct and profilesfurther µL,(R2=0.99; respectively. Efficiency=95%). None false Thepositive detection or negative limits ofresults Sybr wereGreen detected and Taqman by Taqman. were 4.32x10¹ Using Sybr and Green 1.83 copies/a false positive result from antiDENV IgM+ serum sample was refinement of the conducted analyses is necessary to observed. The Taqman assay was then used to test the evidenceHV50 - the DIFFERENTIAL significance of DIAGNOSTICthose differences. OF HUMAN samples from FHF patients. Among then, 8 liver biopsy PARVOVIRUS B19 INFECTION IN FULMINANT and 6 serum samples were positive for B19VDNA, with HEPATIC FAILURE PACIENTS Alves, A.D.R.; Amado Leon, L.A.; Garcia, R.C.N.C.; Melgaço, J.G.; Pinto, M.A. FHFviral patientsloads ranging with fromB19V 4.4 DNA, to 1.6x10² one was copies/µL coinfected in withliver 1. LABORATÓRIO DE DESENVOLVIMENTO HAV,biopsy, one and was 3.5 co infectedto 1.1x10¹ with copies/µL HBV and insix serum. were hepatitis Among TECNOLÓGICO EM VIROLOGIA, INSTITUTO cases of unknown etiology (cryptogenic). In conclusion, OSWALDO CRUZ, FUNDAÇÃO OSWALDO CRUZ the Taqman qPCR was more suitable for detection and 2. INSTITUTO BIOMÉDICO, DEPARTAMENTO DE MICROBIOLOGIA E PARASITOLOGIA, UNIVERSIDADE FEDERAL FLUMINENSE coinfections with HAV and HBV. These results indicate 3. LABORATÓRIO DE HEPATITES VIRAIS, thatquantification B19V should of B19V be andconsidered was able in tothe identify differential B19V INSTITUTO OSWALDO CRUZ, FUNDAÇÃO diagnosis of cryptogenic and FHF hepatitis and OSWALDO CRUZ demonstrate the importance of establishing sensitive The parvovirus B19 (B19V) infection is usually acute infection. manifestations, as erythema infectiosum, transient and specific molecular methods to clarify these cases of aplasticand self limitedcrisis, butchronic also provokesbone marrow a variety failure of clinical in immunocompromised hosts and nonimmune hydrops fetalis. Recent studies have suggested that B19V may cause hepatitis in immunocompetent patients in the absence of coinfection with other hepatotropic viruses. The hepatic manifestations of B19V can range from biochemical changes until fulminant hepatic failure (FHF). The objective of this study was to establish a

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

85 Human Virology: HV

HV51 - MULTIPLEX PCR FOR SIMULTANEOUS Consideration of Betaherpesvirus in the differential DETECTION AND QUANTIFICATION OF diagnosis in fulminat hepatitis is important and early BETAHERPESVIRINAE FROM PATIENTS WITH initiation of antiviral treatment may be lifesaving in this FULMINANT HEPATITIS OF UNKNOWN ETIOLOGY situation. Raposo, J.V.; Lopes, A.O.; Pinto, M.A.; de Paula, V.S. HV58 - HIV1 GENETIC DIVERSITY AND ANTIRETROVIRAL LABORATÓRIO DE DESENVOLVIMENTO TECNOLÓGICO DRUG RESISTANCE AMONG INDIVIDUALS FROM EM VIROLOGIA, INSTITUTO OSWALDO CRUZ, FUNDAÇÃO RORAIMA STATE, NORTHERN BRAZIL OSWALDO CRUZ Corado, A.L.G.; Bello, G.; Leão, R.A.C.; Granja, F.; Cytomegalovirus (HCMV), Human Herpes Virus 6 Naveca, F.G. (HHV6), human herpes virus 7 (HHV7) belong to the 1. INSTITUTO LEÔNIDAS E MARIA DEANE genus herpesvirus, family Herpesviridae, subfamily 2. LABORATÓRIO DE AIDS E IMUNOLOGIA Betaherpesvirinae and have linear doublestranded DNA. MOLECULAR The HCMV causes an infection similar to mononucleosis 3. LABORATÓRIO CENTRAL DE SAÚDE PÚBLICA syndrome, while HHV6 and HHV7 cause roseola DE RORAIMA infantum, febrile seizures and other febrile syndromes 4. UNIVERSIDADE FEDERAL DE RORAIMA in children. After infection, the Betaherpesvirus can The HIV1 epidemic in Brazil had spread towards the Northern country region, but little is known about HIV1 reactivation. HHV6 and HHV7 have quite homologies, subtypes and prevalence of HIV strains with resistance remain latent until an immune deficiency host favors its genetic and biological each other and are the main mutations to antiretrovirals in some Northern states. HIV1 protease (PR) and reverse transcriptase (RT) sequences were obtained from 73 treatmentnaïve and cause of sudden rash. The primary HCMV infection and/ hepatitis in immunocompetent patients. Complications experienced subjects followed between 2013 and 2014 or HHV6 can also generally cause mild and selflimited resulting from HHV7 infection have also been shown to at a public health reference unit from Roraima, the be a factor in organ transplantations. However, acute northernmost Brazilian state. The most prevalent HIV1 and fulminant forms of hepatitis may also be associated clade observed in the study population was the subtype viruses of the family Herpesviridae. The poor prognosis of evolution for hepatitis in cases of herpes is associated 1 strains from treatmentnaïve patients, only one had a transmittedB (91%), followed drug resistance by subtype mutation C (9%). for Among NNRTI. 11 Among HIV antiviral therapy. Therefore, the need for early diagnosis with late diagnosis and delayed treatment with specific for initiating the therapy is evident. For virus detection HIV1 strains with acquired drug resistance mutations (ADRM)59 treatment that experiencedreduce the susceptibility patients, 12 to(20%) two classesharbored of antiretroviral drugs (NRTI and NNRTI or NRTI and PI). theand quantificationsynthetic standard was used curve. the multiplexAfter optimization realtime PCR of TaqMan. The virus quantification was performed using reaction and standard curves were tested 21 serum and reduced susceptibility to only one class of antiretroviral 14 liver samples from patients with fulminant hepatitis drugsOther five(NNRTI (8%) harboredor PI). NoHIV 1patients strains withharboring ADRM thatHIV of unknown etiology by realtime PCR monoplex and strains with reduced susceptibility to all three classes of antiretroviral drugs were detected. A substantial multiplex. For HCMV 14.2% (3/21) were positive in serum, and 7.1% (1/14) were positive in liver, to HHV6 fraction of treatmentexperienced patients with (63%) 4.76% (1/21) in serum was positive and 42.8% (6/14) positive in liver and none of the serum samples was Amongand without treatment (70%)experienced ADRM had with undetectable plasma viral plasma loads positive.were positive All positive in liver samples and for inHHV real7,14,2% time PCR (2/14) was tested were viral loads (<40 copies/ml) at the time of sampling. in conventional PCR for future sequencing. The samples data showed that HIV1 epidemic in Roraima displayed a that were positive in monoplex, also were positive in muchabove lower2,000 level copies/ml, of genetic 44% diversity displayed than no that ADRM. described This multiplex showing that it is possible to perform only one in other Brazilian states. The relatively high frequency realtime PCR to detect and differentiate Betaherpesvirus. of undetectable plasma viral load and the low overall

86 Human Virology: HV prevalence of ADRM observed among patients on context, it is necessary for continued monitoring of RVA treatment, also supports for a high rate of success of in the human population consideration the vaccination antiretroviral therapy in this northernmost part of the process. country. HV65 - PHYLOGENETIC ANALYSIS OF GROUP A HV60 - THE OCCURRENCE OF ROTAVIRUS G12P[8] OF ROTAVIRUS ISOLATES FROM BRAZIL EVIDENCES HOSPITALIZED CHILDREN AT REFERRAL HOSPITAL CHANGES IN GENOTYPE CONSTELLATIONS OF GOIÂNIA, GOIÁS ASSOCIATED WITH THE VACCINE Badr, K.R.; Almeida, T.N.V.; Sousa, T.T.; Souza, M.; Fiaccadori, F.S.; Cardoso, D.D.P. Batista, M.V.A.; Barreto, D.M.; Santos, F.L.S.G.; Barros, G.S.; Araujo, E.D.; Batista, M.V.A. INSTITUTE OF TROPICAL PATHOLOGY AND PUBLIC HEALTH/ FEDERAL UNIVERSITY OF GOIAS UNIVERSIDADE FEDERAL DE SERGIPE Acute gastroenteritis (AG) is important cause of Rotaviruses cause approximately 1.7 billion episodes morbidity and mortality in worldwide, especially in of acute diarrhoea, leading to nearly 700,000 deaths worldwide annually. In March 2006, it was introduced (RVA) is one of the major causative agents of the disease. in Brazil the monovalent vaccine Rotarix containing a Inchildren this context, up to five since years 2006, old, whereastwo vaccines Rotavirus Rotarix® species and A Rotateq® have been used for control and prevention of single human genotype, G1P[8]. Traditionally, a dual the infection causated by this virus. Both vaccines are (RVA) based on two genes (VP4 and VP7). However, a classification system was established for Rotavirus A Immunization Program in 2006. Once the vaccination all 11 genes. Therefore, the objective of this study was new classification system has been proposed including processused in Brazil; is started, Rotarix® studies has been have included shown in the Nationalgradual to evaluate the genomic diversity of RVA circulating in reduction in AG cases, as well as the severity of symptoms Brazil in the last 30 years in order to investigate possible associated with this disease. Thereby, the present study changes in the prevalence of genotypes before and after the implementation of the vaccine according to the years old, with or without AG, hospitalized in a referral genomic constellation of RVA. In total, 820 gene sequences hospitalaimed to forverify pediatric the occurrence care in Goiânia, of RVA in Goiás children from up 2014 to five to were obtained from the Virus Sequence Database. It 2015. The study material consisted of 335 fecal samples, was possible to recover 368 isolates of Brazilian human 134 samples from children with AG and 201 children RVA from 1986 to 2011. Then, BLAST tool were used to without AG. RVA detection was done by polyacrylamide obtain the sequence identity of the isolates. Sequence gel electrophoresis, and the characterization of genotype alignments were performed using ClustalW program. G (VP7) and P (VP4) was done after sequencing using Phylogenetic analyses were performed under the GTR the online automated genotyping tool RotaC. Of the total + I and HKY + G models of nucleotide substitution by using jModelTest2 program, and Maximum Likelihood for RVA, of which eight were from children with AG. The phylogenetic trees were inferred for each gene using characterizationsamples it was observed of the G thatand nineP genotypes (2.7%) were showed positive that PhyML 3.0 program. It was possible to observe that VP4, VP7, NSP4, and VP6 gene sequences were more frequently found in the database. In relation to P Gof and the P. nine Phylogenetic positive samples, analysis fourof the were sequences G12P [8], coding one G12, two P [8] and the other could not be genotyped for genotype, we found that P[8] was more frequent than to the lineage III. The results showed the decline in RVA and G2 were more frequent than G1. The most frequent VP4 and VP7 genes showed that G12 and P[8] belong P[6] and P[4]. When it comes to the genotype G, G9 in the postvaccination period. These data reinforce the we compared the genomic constellation of the vaccine combinations were G2P[4], G1P[8], and G9P[8]. When importancedetection, and of the vaccinationoccurrence ofprocess. G12 and Additionally, P [8] samples the other isolates of the study we found that the VP2 gene isRotarix the most genotype associated (G1P[8] withI1 R1genomicC1A1 M1 constellationN1E1 T1H1) of with the prevalence of samples G12 and P [8] indicate a tendency vaccine, and the lowest was the G1 genotype. Most of the Virusto fluctuation Reviews & Research of genotypes Vol 20 (2), August-December RVA over time. 2016 In - Abstracts/Posters this - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

87 Human Virology: HV genes are distributed phylogenetically according to the for the ACB and ASC groups. The RAP1 expression was genotypes (NSP1, NSP2, NSP3, NSP5, VP1, VP2, VP6, and positive in most of the samples of the group \"ACB\" VP7). NSP2 and VP7 were distributed throughout the years, and VP3 and VP4 showed no pattern of distribution (15/27 or 55.56%) and most negative in the sample circulating in the country, so it is important to study reactionsgroup \"ASC\" for p16 (4/7 and or Ki 57.14%)67 showed with predominance a sensitivity of theby year, genomic location constellation and/or genotypes. of Brazilian New isolates genotypes in order are negative16.66% and or specificityall negative of 75%.staining The immunocytochemicalin both groups. HPV to understand the genetic diversity of circulating isolates, and thus assess the further effectiveness of the implemented vaccine, serving as basis for possible HPVDNA16 was was detected detected in 9 in (33.33%) 4 samples of theASC 27 group. samples Samples of the future formulations. fromACB groupthe group and ACBin 4 HPV(57.14%)16 were of detected7 ASC group in 5 samples.samples, HPV58 in 2 samples, HPV45, HPV1 sample, and 66 in HV71 - IMMUNOCYTOCHEMISTRY CHARACTERIZATION one sample. We observed no relationship between the OF RAP1 PROTEIN EXPRESSION IN SQUAMOUS CELL presence of HPV and immunostaining of RAP1 in both BLOCKS FROM CERVICAL CYTOLOGY IN LIQUID MEDIUM groups. In conclusion, cell blocks can be a ancillary tool Figueiredo, A.C.C.; Santos Silva, A.H.; Ferreira, P.C.P.; to the Pap test for cervical cancer in screening and the Pacoal Xavier, M.A.; Oliveira, J.G. expression of the RAP1 protein is increased in cervical 1. CENTRO DE PESQUISAS RENÉ RACHOU 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS the presence of HPV. The accurate early diagnosis of cervical cancer, relevant cells in an inflammatory environment, with or without HV89 - MOLECULAR CHARACTERIZATION OF public health problem worldwide and in Brazil by ENTEROVIRUS FROM CHILDREN WITH ACUTE cytology (Pap test), is hampered by its subjectivity and GASTROENTERITIS IN BELEM AND METROPOLITAN variability of false positive and false negative results, REGION, PARÁ STATE particularly on atypical squamous cell (ASC). Recent technical innovations, such as based liquid cytology Coutinho, C.R.M.; Machado, R.S.; Linhares, A.C.; and immunocytochemistry for with cell proliferation Monteiro, J.C.; Wanzeller, A.L.M.; Tavares, F.N. biomarkers, increased the expectation cervical INSTITUTO EVANDRO CHAGAS cancer screening. However, the applicability of these Acute gastroenteritis (AGE) remains an important public innovations in early stages of epithelial dysplasia and health problem and a common cause of morbidity and mortality among children and elderly in worldwide. It is estimated 35 billion cases of acute gastroenteritis and asatypia a biomarker remains diagnosisuncertain. of Considering cervical dysplasia, previous this findings study 1.52 million deaths occur each year in children under aimsof our to research characterize group, the which expression identified of RAP1the RAP1 (compared protein to the expression of p16 and Ki67 biomarkers) by diarrheal cases still remain unknown etiology although immunocytochemistry in cell blocks of cervical more5 years. sensitive A causative molecular agent inmethods approximately are available. 40% of squamous cells, for possible applicability in screening Currently, several reports highlighting enteroviruses for cervical cancer. For this purpose, 27 patients with as one of the viral etiologies of AGE have been also benign cellular changes (ACB) and 7 patients with ASC documented. Identify enterovirus detected in stool diagnosis were collected in Hospital das Clínicas from samples collected from children under 5 years old with AGE and presented diarrhea in Belém, Para State. 175 cell blocks were satisfactory for morphological analysis stool samples of children under 5 years of age presenting andUFMG. also The that results the cytological indicated that technique 85% of reproduces the samples the of main parameters of the conventional cytology. Regarding the object of study. Samples were previously screened by its use for diagnosis, the cell block had a sensitivity of RealAGE time collected PCR and during all positive May/2010 samples and April/2011 were inoculated were for viral isolation using HEp2 and RD cell lines. Samples presenting cytopathic effect (CPE) were submitted 38.46%, specificity of 90.47% and an interobserver Virusvariability Reviews with & Research concordance Vol 20 (2), rate August-December of approximately 2016 - 30%Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

88 Human Virology: HV to viral RNA extraction, cDNA synthesis and PCR for to March 1986. The children were regularly monitored, being the feces collected daily at the hospital and Samples with no CPE were submitted to SemiNested fortnightly after discharge or when presented diarrhea. amplification and partial nucleotide sequencing of VP1. Samples were tested by the quantitative reverse Sequences were edited, analyzed and compared to the transcription polymerase chain reaction (RTqPCR) using GenBankPCR and nucleotidedatabase of sequencing NCBI. From for 16 viral isolated identification. samples the commercial ID AgPath™ OneStep RTPCR kit. Of the in cell culture, 9 different enterovirus serotypes were

(EV) EVC99, EVC96, CVA5, CVA6, CVA13, Echovirus (E) 216 samples tested, 137 (63.4%) were positive for EV, identify [Coxsackievirus (CV) CVB3, CVB4, Enterovirus one.being Samples 47/69 (68.1%)with cycle related threshold to the (ct) first equal child; or 44/70 less than(62.9%) 42 were to the considered second; and positives. 46/77 (59.4%)The mean to ct the of lastthe possibleE6 e E7]. identify Of the 309 samplesanalyzed with fecal 8 suspension different serotypes samples positive samples was 32.1, and the second child had the CV(noA5, CPE), CV A9,22 wereCVA10, amplified CVB3, byEV Semi C99, Nested E9, E PCR.15 e It PV3. was lower values with ct varying from 16,1 to 40, indicating a This study show a high circulation and diversity of enterovirus serotypes circulating in childrens presenting AGE suggesting a possible association of enterovirus as higher viral load. Of the 216 samples, only 6.5% (14/216) Thiswere studysymptomatic, demonstrated with 50% a high(7/14) circulation of positivity. of EVIn the in for future research and to establish a monitoring system fecalasymptomatic samples collectedones the positivityfor over 30was years. 63.9% The (129/202). positive foretiologic enterovirus, agente. aiming The findings to identify are ofand great monitoring importance the asymptomatic cases may be related to a constant contact

cause disease in the host, as well as a prolonged excretion emergenceHV90 - DETECTION of new variants/genotypes. OF ENTEROVIRUS IN CHILDREN ofwith the the virus virus due through to episodes insufficient of diarrhea inoculums experienced intake to FROM OUTSKIRTS OF BELÉM, PARÁ, IN THE PERIOD many weeks before. All positive samples will be tested OF 1982 TO 1986 in cell culture, because this technique is considered the Coutinho, C.R.M.; Siqueira, J.A.M.; Santos, L.F.P.; gold standard for the virus detection and in the positive Machado, R.S.; Alves, J.C.S.; Silveira, E.; Wanzeller, ones will be perform the molecular characterization of A.L.M.; Tavares, F.N.; Gabbay, Y.B. 1. INSTITUTO EVANDRO CHAGAS 2. PROGRAMA DE PÓSGRADUAÇÃO EM BIOLOGIA theHV93 positive - GENOTYPING fluids. OF HUMAN PAPILLOMAVIRUS PARASITÁRIA NA AMAZÔNIA IEC/UEPA AND ITS RELATIONSHIP WITH THE PRESENCE OF Acute gastroenteritis (AGE) is one of the most common CERVICAL LESIONS IN WOMEN COINFECTED WITH diseases in humans and remains the leading cause of HIV morbidity and mortality worldwide. It affects mainly Badial, R.M.; Dias, M.C.; Stuqui, B.; Melli, P.P.S.; children from developing countries, being responsible Quintana, S.M.; Bonfim, C.M.; Calmon, M.F.; Provazzi, P.J.S.; Rahal, P. old. Recently, members of the Picornaviridae family, 1. INSTITUTO DE BIOCIÊNCIAS, LETRAS E CIÊNCIAS suchfor 25 as30% the of enteroviruses all deaths among (EV), children have been less than considered 5 years EXATAS UNESP SÃO JOSÉ DO RIO PRETO as agents associated with cases of diarrhea in humans. 2. HOSPITAL DAS CLÍNICAS DA FACULDADE DE MEDICINA DE RIBEIRÃO PRETO, DEPARTAMENTO Thus, the knowledge of the involvement of EV in DE GINECOLOGIA E OBSTETRÍCIA sporadic cases and outbreaks of AGE is very important to establish the real impact of these agents in diarrheal Papillomaviruses are doublestranded DNA viruses with diseases. The aim of this study was to detect EVinfections size of 55nm and icosahedral form. The HPV is a non in three children living in the outskirts of BelémPA, who enveloped and can induce squamous epithelial tumors were followed from birth until three years old. The study in different anatomical locations. They belong to the used 216 stool samples collected during a community Papillomaviridae family and have a genome of about based longitudinal study conducted from October 1982 eight thousand base pairs, protected by capsid proteins. More than 200 different types of human papillomavirus Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

89 Human Virology: HV

etiological agents the adenovirus (AdV), Adenoviridae groups, high risk and low risk, depending on their family, Mastadenovirus genus, composed of DNA double association(HPV) have with been the identified development and of classified cancer. intoThe HPV two strand, not enveloped, consisted of seven species (AG) genomic integration is a mechanism of persistent viral and 57 distinct serotypes. The species F, serotypes 40 infections, which eventually develops in cancerization and 41 are the most prevalent in outbreaks and sporadic phase. This is typically a random process and can occur cases of GA. This work aimed to detect and genotype the anywhere in the DNA of the host cell. In some cases, AdV in serum samples from children hospitalized with the integration can contribute to the development of acute gastroenteritis in Belém city, Brazilian Northern cervical carcinoma, which is preceded by precursor region. The specimens were collected from children lesions such as cervical intraepithelial neoplasia hospitalized with GA in two clinics of Belém, from or squamous intraepithelial lesions. Chronic HPV infections, which are often characterized by high viral for the presence of rotavirus and norovirus, and only load, can be facilitated by coinfection with HIV, which theMarch/2012 negatives to ones June/2015. were tested Sera were for initiallyAdV. The analyzed serum reduces the likelihood of spontaneous elimination of samples were only tested for AdV when the children HPV. On this basis we investigated the presence of HPV as well as their genotype in 80 samples, collected in two DNA Mini Kit (Qiagen) was used for the nucleic acid different years, of 40 patients coinfected with HIV and extraction,had positive according results in manufacturer’s the feces. The QIAmp recommendation. Viral RNA/ diagnosed with cervical lesions. For this purpose we The detection of AdV was made by PCR and NestedPCR in the polymerase chain reaction (PCR) to detect the virusused and the sequencing oligonucleotides reaction PGMY09/11 according andto the GP5+/6+ Sanger theemploying 2X Reaction the pairMix (a of buffer primers containing Hex1deg/Hex2deg 0.4 mM of each and method for HPV genotyping. As a result it was observed dNTP,Nehex3deg/Nehex4deg, 3.2 mM MgSO4) and respectively, Platinum Taq besides DNA Polymerase the use of (Invitrogen) to increase its sensibility. Positive samples these samples were successfully genotyped. The high riskthe presencewere predominant of HPV in between 65 samples the HPV(81.3%), types where detected all in the PCR and/or NestedPCR that showed a good quality Extrationof amplified (Qiagen) product accordingwere purified to thewith manufacturer\'s the commercial agreement(65%) specifically, with the the literature most frequent that shows types thewere presence HPV56 instructions.kits QIAquick® The samples PCR Purification were sequenced and QIAquick® with the use Gel of (22%) following by HPV16 (17%). The results are in the kit Big Dye Terminator (v.3.1) (Applied Biosystems) mostlyof HPV inHPV16, up to 88.4%and thus of patientscan lead co toinfected occurrence with HIV or progressionas well as the of prevalencecervical lesions. of highrisk HPV types (60%), serumin an automatic were also sequencer. tested for A this total virus, of 111 with (43%) a positivity children had their feces positive for AdV, and in 80 (72.1%) their HV96 - DETECTION OF ADENOVIRUS IN SERUM SAMPLES FROM HOSPITALIZED CHILDREN of 63.7% (51/80). The nucleotide sequencing was done WITH ACUTE GASTROENTERITIS IN BELÉM CITY, in 78.4% (40/51) samples with predominance of the NORTHERN BRAZIL species F (80% 32/40), followed by species C (12.5% Fiuza, M.K.C.; Portal, T.M.; Teixeira, D.M.; Lima, detection5/40), A (5%of this 2/40) virus and in serum B (2.5% of children 1/40). The with results AGE, I.C.G.; Reymão, T.K.A.; Siqueira, J.A.M.; Quinderé withdemonstrated a high percentage, for the first suggesting time in Northern the extra Brazil, intestinal the Neto, G.A.; Justino, M.C.A.; Mascarenhas, J.D.P.; Silva, L.D.; Resque, H.R.; Sousa Junior, E.C.; Linhares, A.C.; Gabbay, Y.B. thecirculation elevated of circulation this virus. of Alsothis type it was in cases verified of AGE. that the SEÇÃO DE VIROLOGIA – INSTITUTO EVANDRO CHAGAS/ specie F, types 40/41 was the most prevalent, confirming SVS/MS The acute gastroenteritis (AGE) is characterized as a gastrointestinal tract infection, having as one of its viral

90 Human Virology: HV

HV97 - DETERMINATION OF A NOVEL PRIMER SET HV107 - PHYLOGEOGRAPHIC DISPERSION OF FOR HUMAN PAPILLOMAVIRUS DETECTION BASED INFLUENZA VIRUSES ISOLATED IN AMAZON REGION ON ENTROPY Barbagelata, L.S.; Junior, W.D.C.; Santos, M.C.; Ferreira, Santos, F.L.S.G.; Barros, G.S.; Araújo, E.D.; Barreto, J.A.; Silva, A.M.; Sousa Junior, E.C.; Gomes, E.R.; Sousa, D.M.; Batista, M.V.A. E.M.A.; Gonçalves, M.S.; Medeiros, R.; Mello, W.A. UNIVERSIDADE FEDERAL DE SERGIPE 1. INSTITUTO EVANDRO CHAGAS 2. UNIVERSIDADE FEDERAL DO PARÁ/NÚCLEO DE Papillomaviruses are circular doublestranded DNA MEDICINA TROPICAL epithelium of mammals, reptiles and birds, causing asymptomaticviruses that specifically infections, infectbenign skin and ormalignant mucocutaneous lesions. The flu or Influenza is a disease of the respiratory tract caused by the influenza virus, which has the potential to L1 gene sequence identity. However, several studies affect about 10% of the population each year. Influenza onThe Human classification papillomavirus of papillomaviruses (HPV) diversity is based make onuse the of Orthomyxoviridae family. The viral particle is spherical viruses belong to the genus Influenza A, B and C of the only 450 bp fragment in L1 in order to classify novel and enveloped, where are inserted the hemagglutinin HPV types, subtypes, and variants. It has been observed protein (HA) and neuraminidase (NA), the main targets that this fragment is not appropriated for detection and of the host immune response, which gives high variability genotyping of HPV. So, the aim of this study was to develop and apply a novel computational tool based on entropy virus has a pattern of global distribution with distinct of the genes encoding such proteins. The influenza in order to identify phylogenetic informative genomic dispersion directions. In this context, the phylogeography regions that could be used as markers for the detection has become an important epidemiological tool to predict and genotyping of HPV. To develop the method, a the areas where the emergence and spread of infectious comparative analysis was performed to assess the genetic agents may occur from the construction dispersal routes variability of L1 sequences from Alphapapillomavirus, analyzing phylogenetic data. In this context, this study Betapapillomavirus and Gammapapillomavirus genera. Shannon entropy was calculated. Informative sites were strains isolated in the Amazon region between 2010 andaims 2015 to characterizeand contribute genetically to the molecular the Influenza epidemiology virus Phylogenetic trees were constructed based on those generating information on entry routes and spread informativeidentified by sites. using Degenerate a cutoff of primers 1.0 bits were of information. designed to of these viruses in the region. Material and Methods: amplify this region in the largest possible number of HPV MDCK cell culture through genetic characterization of theIsolated HA gene strains encoding of influenza into four viruses main steps: were a) analyzed extraction in types. To test the efficiency of the primers, PCR tests were toperformed compare to the detect sequences HPV DNA with and reference the confirmation sequences of of viral RNA; b) complementary DNA synthesis; c) depositedthe amplified in GenBank. products All were samples sequenced. tested Blastpositive was for used the Results: In the analyzed period 1,254 positive samples Amplification of cDNA by PCR and d) sequencing. presence of HPV. Different HPV types were tested and the primer set was able to detect them, which evidences isolatedfor influenza in cell were culture, found, of whichbeing 1,05048 were (83.2%) sequenced. influenza The A and 212 (16.8%) influenza B. Of these, 222 were we were able to observe that the primers were capable tohigh detect specificity. HPV DNA A test in severalof sensibility dilution was series. performed This result and analysis of seasonal profile showed that the peaks of shows a high sensitivity of the developed marker. The influenza virus circulation were in March with 398 cases degenerate primers proposed in this study proved to be (31.53%), April with 263 (20.83%) and May with 198 effective in the detection of HPV DNA. Thus, we propose B virus had the State of São Paulo as the place of entry in cases (15.69%). As for the dynamics of spread, influenza the utilization of a new molecular marker that are Brazil, Acre, Amazonas and Roraima acting as dispersal capable of detecting different viral types and it can assist routes in the Amazon region. Regarding the virus A in the improvement of HPV detection and genotyping. (H3N2) strains have emerged in the states of Acre and

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/PostersPará. Pará - Human has Virology: the largest HV number of leakage fluxes of XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

91 Human Virology: HV

these strains. Conclusions: The peak of influenza virus tothe 53.2) 93 samples showed tested, expression 33 (35.5%) of p16INK4a. (CI 95%: The 26.3 correlation to 45.6) circulatingcirculation in thethe AmazonAmazon region region occurred indicates in the the states first six of betweenshowed positive the presence HPV DNA of HPVand 40DNA (43.0%) and p16INK4a (CI 95%: 33.2was Acremonths and of Pará the main year. routesThe dynamics of dispersal. of influenza viruses

HV108 - ANALYSIS AND CORRELATION OF THE 63.6% (CI 95%: 46.3 to 78.6). Although there is no EXPRESSION OF THE P16INK4A PROTEIN AND HPV theexpression presence of of p16INK4a viral DNA in and 100% expression of cases of positive p16INK4a for DNA IN INDIVIDUALS WITH PENILE CANCER IN THE (pHPV <0.003).DNA, there Some was studies statistical suggest significance that the standard between STATE OF GOIAS, BRAZIL knowledge of the expression of the p16INK4a protein Araújo, L.A.; de Paula, H.S.C.P.; Ramos, J.E.P.; Saddi, may be a useful marker for HPV activity in patients with V.A.; Duarte, E.C.B.; Alencar, R.C.G.; de Paula, A.A.P.; penile cancer. The results of this study showed that there da Silva, R.C.; Caixeta, G.N.; Matos, M.A.D.; Silva, J.R.M.; Del Rios, N.H.A.; Paes, J.F.; Carneiro, M.A.S. this protein in positive and negative HPV DNA samples. 1. UNIVERSIDADE FEDERAL DE GOIÁS are significant differences between the expression of 2. PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS HV119 - ASSOCIATION BETWEEN CCR5DELTA32 AND 3. UNIVERSIDADE DE BRASÍLIA HEPATITIS B IN PATIENTS FROM RORAIMA 4. HOSPITAL ARAÚJO JORGE Sousa, D.D.; Xavier, M.V.A.; Lima Jr., W.P.; Silva, C.R.S.; Penile carcinoma (PC) is a rare disease, however it is still Corado, A.L.G.; Naveca, F.G.; Acosta, P.O.A.; Granja, F. considered a serious public health problem accounting 1. UNIVERSIDADE FEDERAL DE RORAIMA for high morbidity and mortality in developing countries. 2. INSTITUTO LEONIDAS E MARIA DEANE FIOCRUZ Lack of hygiene, compounded by the persistence of AMAZÔNIA phimosis in adulthood may promote infection with Hepatitis B virus is a hepatotropic, noncytopathic, human papillomavirus (HPV). The expression of which causes acute or chronic disease to the liver. p16INK4a, a protein associated with tumor suppression, Many epidemiologic, viral and genetic factors bias the can be used as a marker for the presence of high risk HPV susceptibility and persistency of the HBV infection. The DNA. The upregulation of this protein is understood to chemokine 5 receptor (CCR5) is a gene located in the p21.3 be an attempt to stop uncontrolled cellular proliferation region from chromosome 3, altogether with its ligand, in response to HPV infection. The goal of this study was CCR5 has an important role in the immune response to to estimate the prevalence of HPV DNA and evaluate the viral infections, among them, the Hepatitis B. Chemokine expression and correlation of p16INK4a with HPV DNA receptors are proteins found on cell’s surface. There by, in patients with PC in Goias, Brazil. This retrospective the existence of a mutant allele of the CCR5 gene, which cohort study involved 93 patients with PC treated in the presents a deletion of 32 base pars (CCR5delta32), leads UroOncology service of Hospital Araujo Jorge (HAJ), a to receptor expression decrease and dysfunction. HBV unit of the Association Against Cancer in Goias (ACCG), chronically infected patients are incapable of clearing the from January 2003 to November 2015. This study was viral infection from hepatocytes, and probably, a down approved by the Research Ethics Committee of HAJ. regulated CCR5 leads to low immune cells recruitment to the infected hepatocytes. This study’s objective was fragments were subjected to extraction of viral DNA investigate the presence of the CCR5delta32 mutation in usingThe paraffin a commercial blocks kit containing (Promega the Corporation, cancerous tissueUSA), infected patients and health controls in Roraima State and subsequently subjected to polymerase chain reaction stablish its possible correlation with HBV infection. This testing with short PCR fragment (SPF PCR) primers to project was approved by the COEP (protocol 1.134.36). A detect HPV DNA. The marking of the p16INK4a protein was hundred twentytwo HBV chronic carriers and 79 health performed with polymerbased immunohistochemistry, controls were tested. DNA was extracted and analyzed using a commercial kit (Mach 4 Universal HRPPolymer according to Farias et al. (2012). Fenotype and allelic Detection System – Biocare Medical, CA, USA). The slides frequencies were calculated and evaluated by Hardy were evaluated independently by two pathologists. Of Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

92 Human Virology: HV

Weinberg Equilibrium. Comparison among proportions for IgM. In relation to the disease stage, 10 were in the and differences among groups were determinate given acute stage, 04 in the subacute stage and 12 in chronic by Fisher’s Exact Test. Our results show the following stage. Correlated serology results to symptoms, it was genotype frequency between patients and controls observed that all volunteers had fever in the acute stage,

in the subacute stage was more frequent arthralgia, respectively: CCR5/CCR5 (95.04% e 94.94%), CCR5/ 90% headache, 70% arthralgia and 60% edema. While groupsCCR5delta32 (p=0.6076), (4.96% as well e 5.06%), as mutant CCR5delta32/ allele (CCR5delta32) delta32 frequency(0%, in both), in patients there are and no control significant group, difference respectively, among 2.4 headache (100%), myalgia and edema. (75%), and in negativechronic stageserology, were n = edema54, the (100%),more presented arthralgia symptoms (92%) wereand myalgia exanthema (75%). (n =When 39) headache, compared fever participants (n = 35) with and % and 2.5%, (p=0.6480). No relation was found between arthralgia (n = 31). Conclusion: The study focused showthe mutation association and betweenHBV risk polymorphism(OR = 0.97, IC95%0.26 CCR5delta323.58; andp=0.76). HBV Ininfection, conclusion, we observed we did notthat findamong evidences all analyzed that common symptom in the three stages was arthralgia, samples no homozygosis to the polymorphism was followedon people by with edema clinical and myalgia, findings fever for was FCHIK. frequent The most only found, which could probably be explained because of in the acute stage. All participants were negative by Roraima’s mixed population. Real Time PCR, because the virus has a short duration in the body, and this methodology is very limited by the HV121 - CLINICAL AND LABORATORY ASPECTS IN INDIVIDUALS WITH CHIKUNGUNYA FEVER OF TWO for IgG serology. Individuals who did not show IgM or STATES: AMAPA AND GOIAS IgGstart despite time symptoms.having articular However, pain, 32.5%they presented were positive rash, Koga, R.C.R.; Maia, A.P.V.M.; Barletto, J.S.; Fonseca, headache and fever, symptoms that may be correlated S.G.; Pfrimer, I.A.H. with other arbovirus as Zika virus. 1. PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS 2. UNIVERSIDADE FEDERAL DE GOIÁS HV127 - INFLAMMATORY PROFILE OF INDIVIDUALS INFECTED BY ZIKA VIRUS IN ACUTE AND CONVALESCENT STAGES Chikungunya virus (CHIKV), transmitted by mosquitoes arthropods,Introduction: has Manyspread researchersglobally and originated confirm outbreaks that the Pfrimer, I.A.H.; Barletto, J.S.; Maia, A.P.V.M.; Silva, P.A.N.; Koga, R.C.R.; Paiva, P.L.; Dias Neto, O.S.; Ribeiro, challenge to public health. The aim of this study was to L.L.S.; Fonseca, S.G.; evaluatein sites hostingclinical vectorand laboratory species, becomingaspects of a individuals significant 1. PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS 2. UNIVERSIDADE FEDERAL DE GOIÁS the states of Amapa and Goias. Methodology: The study Introduction: The Zika virus (ZIKV) is an arbovirus waswith conductedclinical findings in Immunologic of Chikungunya Center fever, of Studiesresidents and in responsible for asymptomatic and symptomatic Research of the Catholic University of Goias in Goiania, and infections in human. The disease was considered in Health Care Units of Macapa and OiapoqueAP cities. A benign until 2007, but from that period on there were total of 80 volunteers who agreed to participate signed a complications such as microcephaly and GuillainBarre consent form (TCLE) and answered a questionnaire with syndrome . Despite the numerous articles published clinical and sociodemographic data. It was performed the extraction of the RNA viral in samples, followed by response to ZIKV. The aim of this study was to evaluate quantitative detection of RNA CHIKV by Real Time PCR. recently, little is known about the inflammatory It was also performed an immunoassay for IgM and IgG (CRP) and ferritin in individuals positive to ZIKV in acute for CHIKV. The symptoms of the subjects were correlated andmarkers convalescent of the inflammatory stages. Methodology: response, C reactive Samples protein of 27 with the results of serology. Results: No sample showed individuals were positive for ZIKV and negative for the quantitative detection of viral RNA by RTPCR. However, chikungunya and dengue virus by Real Time PCR. A new blood sample was collected from six of these patients.

Virus26 samples Reviews (32.5%)& Research were Vol 20 positive (2), August-December for IgG and 20163 of -those Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

93 Human Virology: HV

The control group consisted of 21 samples from Goiana 1 whose ART consisted of two Reverse Transcriptase Central of Serology and Immunohematology, which were Inhibitors Nucleoside (T1) and individuals infected with subjected to the same analysis of the study subjects. HIV1 whose ART consisted of two Reverse Transcriptase Nucleoside Inhibitors associated with one Reverse method. The participants signed a consent form and Transcriptase not Nucleoside Inhibitor (T2 ). Monocyte answeredInflammatory a questionnaire proteins were withquantified signs byand turbidimetric symptoms and sociodemographic data. Statistical analysis was statistical analyzes performed with the GraphPad Prism performed by GraphPad Prism by nonparametric test of 6.subsets Results: were the determined CD14highCD16 by flow subset cytometry presented and low the Mann Whitney (PCR and ferritin in patients with Zika x percentage in T1 and T2. In CD14lowCD16+ subset, controls, and CRP and ferritin levels in acute patients x as well as reduced in the mentioned groups, there was also a reduction in the patients who did not use ART. In (CRP and ferritin x amount of clinical manifestations). CD14highCD16 monocytes, we see a low percentage of convalescent) and parametric by r coefficient of Pearson the control group. Conclusion: Our studies have shown in controls p <0.0001, while ferritin levels were not that monocytes are reservoirs of HIV and spread the Results: CRP levels were significantly higher than virus in the body. Furthermore, they are important levels in acute and convalescent stages, the results were p targets for ART. <0.0087significantly and p different <0.8182 p for <0.7552. PCR and When ferritin, comparing respectively. the The levels of CRP and ferritin and the number of clinical HV129 - MOLECULAR EPIDEMIOLOGY OF NOROVIRUS IN CHILDREN HOSPITALIZED DURING A RANDOMIZED clinical manifestations presented by patients were rash CLINICAL TRIAL IN BELÉM, NORTHERN BRAZIL manifestations was not significant, p> 0.05. The main Sousa, E.S.A.; Siqueira, J.A.M.; Bandeira, R.S.; Santos, L.F.P.; Linhares, A.C.; Gabbay, Y.B. in(88.8%), the acute headache stage of (59.2%),infection, arthralgiaand return (55.5%)to normality and 1. INICIAÇÃO CIENTÍFICA/FUNDAÇÃO AMAZÔNIA DE inmyalgia convalescent (55.5%). stage. Conclusion: There was CRP no association levels are increased between AMPARO A ESTUDOS E PESQUISAS abnormal levels of CRP and the number of clinical 2. PROGRAMA DE PÓSGRADUAÇÃO EM VIROLOGIA/ INSTITUTO EVANDRO CHAGAS manifestations. No changes were observed in the levels 3. INSTITUTO EVANDRO CHAGAS of ferritin, both in the acute stages and convalescence in patients with Zika virus. of gastroenteritis (GE) outbreaks globally. This virus HV128 - MONOCYTE SUBSETS IN HIV-1 POSITIVE affectsNorovirus all age (NoV) groups, have butbeen the identified illness can as thebe moremajor severe cause PATIENTS USING OR NOT ANTIRETROVIRALS Pfrimer, I.A.H.; Carvalho, A.E.S.; Morais, C.O.B.; purpose of this study was to detect and genotype NoV in specific groups such as children and the elderly. The Castro, F.O.F.; Borges, A.F.; Barletto, J.S.; Souza, L.C.S.; in fecal samples collected of hospitalized children in Fonseca, S.G. BelémPará from January 2004 to August 2005, during a 1. PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS randomized clinical trial. All feces were initially tested for 2. UNIVERSIDADE FEDERAL DE GOIÁS rotavirus. Later, 200 samples with negative results were 3. HOSPITAL DAS CLÍNICAS UFG screened by an enzymelinked immunosorbent assay Introduction: Monocytes may be divided into subsets (EIA) for NoV antigen detection. Samples that presented based on the levels of CD14 and CD16 expression: classical positive results were subjected to a seminested RT PCR (CD14highCD16), intermediate (CD14highCD16+) and nonclassical (CD14lowCD16+). Objective: to evaluate of Polymerase gene (RdRp) and the ones with positive for amplification and genotyping targeting the A region the monocyte subsets in patients infected with HIV1 in use or not of Antiretroviral Therapy (ART). Methods: gene. Analysis from P2 region was held to a more accurate results were characterized by C/D regions of the VP1 we analyzed four study groups, made up of: individuals

regionclassification analysis of wasGII.4 performed.variants. In Thesamples overall that positivity showed not infected with HIV 1; individuals infected with HIV1 possible recombinant events, the ORF1/2 junction Viruswithout Reviews the &use Research of ART; Vol 20individuals (2), August-December infected 2016with - Abstracts/PostersHIV - Human Virology: HV to NoV was 26% (52/200), being 69.2% (36/52) of XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

94 Human Virology: HV

each child (total of 400 samples), who presented AGE them positive samples amplified, which 27 (75%) were (fecal and nasopharyngeal swabs) were submitted the characterized by the A region as: GII.P13 [n=1], GII.P21 DNAand/or extraction respiratory by a symptoms. commercial The kit clinical (Qiagen samplesHilden, Hunter_2004[n=1], GII.P7 [n=2]by this and region GII.P4 observing[n=23]. About its position the 23 GII. in Alemanha), and screened by RTqPCR (TaqMan) assay, theP4 samples,tree. The inVP1 9 analyzes it was clearly held in possible the 27 characterized classified as region of HAdV genome. To determine the viral load ofwith the specific samples primers a standard and curve probe using targeting serial the dilutions hexon samples showed 66.7% (18/27) of amplification, of a recombinant plasmid was constructed. The global classified as GII.4 [n=9], GII.6 [n=1], GII.3 [n=1], GII.17 as[n=1] variants, by C region being and6 as GII.4Asia_2003 [n=6] andby D 1 region. as Hunter_2004 Of the 10 bysamples the P2 classified region. Thus,as GII.P4/GII.4, considering 7 werethe results characterized of both frequency of HAdVs was 21% (42/200). Positivity in regions (A and P2) the replacement of variant Asia_2003 amongnasopharyngeal children upswabs to 24 was months 9.5% old, (19/200), when compared and in fecal to by Hunter_2004 was clearly observed in May 2005 in thesamples positivity 16% (32/200). in older Achildren. higher positivity Regarding was symptoms, observed

Belém city. Discrepancies were identified in 3 samples population64.5% (129/200) was asymptomatic. of the children Amonghad at leastthe onechildren AGE recombinantafter comparison strains of by the the analyzed junction regions:region. The GII.P6/GII7 monthly or respiratory symptom, and 35.5% (71/200) of the distribution[n=2] e GII.P13/GII.17 analysis showed [n=1] which a higher were prevalence confirmed asof that had at least one of the respiratory symptoms, 54% showed a high positivity of NoV, demonstrating wide (108/200) were positive for HAdV in fecal samples and geneticNoV infection diversity, in Augustwith the 2004 presence (53.8% of7/13). two variants This study and symptoms,9.2% (10/108) were were positive positive for HAdVs in nasopharyngeal in fecal samples, swab recombinant strains. These results will contribute to a samples. Also, 20.9% (22/105) of the children with AGE greater understanding of NoV, providing a perspective (fecal and nasopharyngeal swab). Mean viral loads in on how was its molecular epidemiology at that period. and 4.5% (9/200) were positive in both clinical samples

HV130 - ADENOVIRUS IN FECAL AND HAdVfecal and positivity swab samplesrate in fecal were samples, 1.57E+ 13when copies/g compared and NASOPHARYNGEAL SWAB SAMPLES FROM CHILDREN to8.79E+ positivity 11 copies/mL, in nasopharyngeal respectively. swabs. Data High reveals viral higher loads ATTENDED AT HOSPITAL IN GOIANIA GOIAS were observed in both fecal and nasopharyngeal swab da Paz, T.C.; Dábilla, N.A.S.; Souza, K.M.C.; Fiaccadori, samples from symptomatic and asymptomatic children. F.S.; Cardoso, D.D.P.; Sousa, T.T.; Almeida, T.N.V.; After sequencing the positive samples, we hope to be Oliveira, A.C.R.; Souza, M. able to establish associations between HAdV positivity UNIVERSIDADE FEDERAL DE GOIÁS and loads, and type of HAdV with the age and symptoms Human adenoviruses (HAdVs) may cause several clinical presented by the children. syndromes, and are a major cause of respiratory and acute gastroenteritis (AGE), especially among children. However, data on viral load, in more than one clinical sample obtained from the same child, are still scarce. The aims of the present study were to evaluate the frequency of the HAdV, to determine the load viral in clinical samples, and to proceed molecular characterization of

For this, 200 children attended at Hospital Materno positive samples from children up to five years of age. July 2015, were included in the study. One fecal and oneInfantil nasopharyngeal in Goiânia, Goiás;swab sample between was March obtained 2014 from and

95 Human Virology: HV

HV132 - ANALYSIS OF NUCLEOTIDE CHANGES two samples rest have to be tested again. Because the IN HUMAN PAPILLOMAVIRUS 6 E6 REGION IN CONDYLOMA ACUMINATUM SAMPLES the protein, it is believed that there are differences in the changes in E6 sequence can influence the expression of Dias, M.C.; Stuqui, B.; Provazzi, P.J.S.; Candido, N.M.; lesions progression in patients with differents variants Bonfim, C.M.; Rahal, P.; Melli, P.P.S.; Quintana, S.M.; of human papillomavirus. Calmon, M.F. HV134 - THE HUMAN PLATELET ANTIGENS (HPA) 1, 3 1. INSTITUTO DE BIOCIÊNCIAS, LETRAS E CIÊNCIAS AND 5 POLYMORPHISMS IN HIV INFECTED PATIENTS EXATAS UNIVERSIDADE ESTADUAL PAULISTA "JÚLIO DE MESQUITA FILHO" Grotto, R.M.T.; Freitas, G.M.; Cantão, N.M.; Hebeler 2. HOSPITAL DAS CLÍNICAS DA FACULDADE DE - Barbosa, F.; Alho, M.J.O.; Dias Barreto, S.F.; Assis, MEDICINA DE RIBEIRÃO PRETO R.C.F.P.; Souza, L.R.; Pardini, M.I.M.C. 3. FACULDADE DE MEDICINA DE RIBEIRÃO PRETO – UNIVERSIDADE ESTADUAL PAULISTA UNIVERSIDADE DE SÃO PAULO Introduction: Although HIV host cells express CD4 Condyloma acuminatum (CA) or genital warts are molecule, major receptor associated with virus entry benign proliferative lesions founded in the skin or mucosa, that are mostly related to types 6 and 11 of the HIV presence has already been described in cells human papillomavirus (HPV). Papillomaviruses infect withoutin your targetCD4 cellular cells assurface macrophages marker, including and lymphocytes; platelets. epithelia of vertebrates and may cause diseases or Platelets do not express CD4, then others molecules on remain asymptomatic. These viruses contain the genes the platelet surface could be candidates to HIVplatelets E6 and E7, which are responsible for the host epithelium ligation. Besides that cellular adhesion molecules have transformation, and can lead to the development of already been associated with the entry of the other carcinomas. Due the importance of the E6 protein in the virus in yours target cells as adenovirus, rhinovirus and process of carcinogenesis related to HPV, the aim of this echovirus. The integrins can be a example of cellular study was identify variants and nucleotide alterations adhesion molecule that has a role of the receptor or presents in E6 of HPV6 detected in condyloma coreceptor for several virus. In particular, the Human acuminatum samples. We tested 31 condyloma Platelet Antigens (HPA) 1, 3 and 5 polymorphisms, samples positive to HPV6, that were submitted to the which resides in integrins of the platelets surface, have been associated with viral infections and progression oligonucleotide to the E6 region and the products were Polymerase Chain Reaction (PCR) using a pair of specific of the viral infection. These associations have already products to the E6 region were submitted to cloning using submitted to electrophoresis on agarose gel 1%. Positive Hepatitis C and Dengue. The purpose of this study was todemonstrated evaluate a possible to HCV, association fibrosis progression of the HPA in1, Chronic3 and 5 polymorphism with HIV presence using samples from usingthe pJET1.2 the BigDye® vector. Terminator These products v3.1 Cycle were Sequencing purified andKit. sequenced by the dideoxy fluorescentterminal method HIV infected patients. Materials and methods: Genomic DNA isolated from 100 HIV infected patients (whole blood) was used to genotyped HPA 1 and 3 by PCR sequencesThe computer quality program analysis Phred/Phap/consed and the electropherograms available SSP, and HPA5 by PCR RFLP. A control group previously wereon website analyzed http://www.biomol.unb.br/ using BioEdit software. wasThe used prototype to the described, from blood donors (without HIV), from same and samples sequences alignment in both directions region of this study, was used to data analysis. Results: were performed in CLUSTAL W program. A total of 24 samples were positive to the E6 region. In this way, thanThe results control showed group that(without the HPA HIV).1a/ 1bIn andaddition, 1b/1b therewere analyzed, while the HPV6a variant was founded in other weresignificantly deviation (p=0,004) in Hardy–Weinberg more frequent equilibrium in HIV to infected HPA1 11the patients. HPV6vc Allvariant the HPV6a was identified samples inshowed 11 of athe nucleotide samples higher than control group (without HIV) (p=0,0021). one of this samples showed one more alteration in the system. The HPA 1b allele frequency was, significantly, alteration of G>A on position 474 of the genome, and Conclusions: The results here obtained showed, for the

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV 369 position, ocurring the nucleotide change T>G. The XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

96 Human Virology: HV

presence and, suggest that the integrin beta3 present in to amplify the 110bp DNAfragment from the human GPIIbfirst time, IIIa glycoproteican association complex, of the HPA which 1b resides allele and on plateletthe HIV ?PCRglobin usinggene. the Results: PC03/PC04 Among set the primers 61 analyzed which aresamples able membrane can be involved in HIVPlatelet ligation in infected patients. 48 (79%) showed positive amplification for the human HV135 - HPV PCR DETECTION AND GENOTYPING IN cancer?globin samplesgene. The positive HPVDNA for detection HPV 16, was6 cervical verified tissues in 35 PARAFFINEMBEDDED TISSUES (PETS) OBTAINED (58%) out of the 61 analyzed samples, with 21 (35%) FROM WOMEN WITH INVASIVE CERVICAL CARCINOMA demonstrated(10%) positive a relatively for HPV high 18 and prevalence 5 cervical of HPV samples DNA Sousa, V.B.P.; Peixoto, L.R.; Duarte, W.H.; Aguiar, infection(8.5%) positive among forthe analyzed HPV 31. cervical Conclusion: cancer Our biopsies. results M.F.G.; Silva, K.A.; Tafuri, A.; Pascoal Xavier, M.A.; Additionally, a higher prevalence for HPV 16, followed by Fernandes, P.A.; Vago, A.R. HPV 18 and HPV 31 could be observed among the studied 1. PONTIFÍCIA UNIVERSIDADE CATÓLICA DE MINAS samples. However the observed prevalence of HPVDNA GERAIS and the HR types may be possibly underestimated, since 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS the DNA integrity isolated from PETs might be damaged Introduction: Cervical cancer, the third most common neoplasia among women worldwide is a severe samples. by a deficient DNA conservation of these archival tissue problem, especially in development countries. Human HV137 - DNA PREVALENCE OF THE HIGHRISK (HR) papillomavirusdisease that constitutes (HPV) is considered a significant the main public etiologic health HPV58 IN CERVICAL SAMPLES OBTAINED FROM agent for the development of cervical cancer and its CERVICAL SAMPLES OBTAINED FROM WOMEN WITH precursor intraepithelial lesions. Highrisk (HR) HPV CYTOPHATOLOGY ABNORMALITIES genotypes, namely HPV 16 and, to a lesser extent, types Peixoto, L.R.; Sousa, V.B.P.; Aguiar, M.F.G.; Duarte, 18,45,56,31,33,35,51,52 and 58 are most frequently W.H.; Lopes, L.V.A.; Fonseca, L.P.; Toppa, N.H.; Vago, found in premalignant and malignant anogenital A.R. 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. PONTIFÍCIA UNIVERSIDADE CATÓLICA DE MINAS (PETs)lesions, representwhilst low riskan unlimited (LR) HPV sourcetypes are of withmaterial benign/ for GERAIS 3. LABORATÓRIO DE ANÁLISES E DIAGNÓSTICO analysiscondylomatous in relevant lesions. retrospective Paraffin embeddedstudies. Aims: tissues This HISTOPATOLÓGICO study aimed to investigate the prevalence of HPV infection and of the oncogenic HPV16, 18 and 31 types Introduction: Cervical cancer is one of the most common in 61 cervical PET biopsies obtained from women with causes of cancerrelated death in women worldwide. invasive cervical cancer from Belo Horizonte city, Minas Persistent infections with highrisk (HR) types of Gerais state, Brazil. Methodology: Five tissue sections of human papillomavirus (HPV) consist the main risk 57 ?M obtained in microtome were submitted to the DNA factor for the cervical cancer (SCC) and pre neoplastic extraction step. HPVDNA search was performed by using cytopathology criterions as lowgrade (LSIL) or high gradelesions (HSIL) development, squamous which intraepithelial are classified lesions by means (SILs). of amplifya sensible a 450bp Nested andPCR a protocol150bp DNA with fragments MY09/MY11 from andthe According to phylogenetic and molecularepidemiology GP5/GP6+ primers sets, which are able to respectively studies, the HR HPVs types 16,18,45,56,31,33,35,39,4 nested PCR protocol was employed for searching DNA 5,51,52,56 and 58 are closely associated with SCC and fragmentsconserved fromL1 gene the from 16, 18 HPV and genome. 31 HRHPVs An efficient and detecting Hemi SILs progression. Very recently, a novel 9valent HPV L1 HPVDNA fragments of 149bp, 177bp and 249bp Viruslike Particle (VLP) vaccine (Merck) was developed, integrity of DNA extracted from tissues was assessed by (lowrisk), 16,18,31,33,35,45,52 and 58. Despite the amplified from these HPVs genomes, respectively. The epidemiologicalwhich is directed association against the L1to VLPs cervical from cancer types 6/11and Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

97 Human Virology: HV precursor lesions worldwide, there is a scarcity of data performed in HIV monoinfected patients but there are concerning the HPV58 prevalence among the worldwide no studies concerning GPG association in HIV coinfected women, including the Brazilian ones. Therefore, the patients with Hepatitis C (HCV) and B Virus (HBV). Here, purpose of this work was to investigate the HRHPV58 it was evaluated if the HIV B’ variant presents the same prevalence among women from Belo Horizonte city, MG "protector effect" in HIV coinfected patients with HBV state, Brazil. Methodology: The prevalence of HPV58DNA was evaluated by using a conventional PCR protocol and infected patients was used to HIV subtyping, to infer theand/or tip of HCV. V3 Plasmaloop and viral the RNAHIV syncytium isolated frominducing 649 HIV(SI) ability. The progression of HIV infection was assessed by genome.the E7CR3/585F DNA samples set primers were whichisolated are from able to187 amplify liquid a clinical evaluation (aids presence and HIV risk factors) based375bp DNAcytology fragment (LBC) from cervical the E6/E7 samples genes obtained from the from HPV and laboratorial data (CD4 count, plasma viral load, patients from Belo Horizonte city and exhibiting cervical alterations. According to the cytological diagnosis, obtained from the patient´s medical records. The results patients were diagnosed as presenting ASCUS (70), LSIL time of infection by HIV, HCV and/or HBV presence) B’ variant and CD4 count and time of HIV infection investigate the HPV58 type prevalence among women inshowed HIV monoinfected. a significant statistic Although association no difference between among HIV from(111) Minas and HSIL Gerais (6). state. Results: HPV58 ThisDNA study was is observed the first toin this variables were founded in coinfected groups. This data can suggests that the B’ variant does not induces the protector effect due in HCV or HBV presence. The 25 (13.4%) out of the 187 analyzed samples, with the mechanism involving in this process is unknown. follow prevalence verified among the lesion groups: cases.10% (7/70)Conclusions: from theOur ASCresultsUS cases,pointed 15.3% out a (17/111)relatively HV146 - HPA 1A/1B COULD BE CONSIDERED highfrom incidencethe LSIL samples of HPV58 and infection 16.6% (1/6)among from the analyzedthe HSIL MOLECULAR PREDICTOR OF POORLY PROGNOSTIC women, who were mainly diagnosed as exhibiting low IN CHRONIC HEPATITIS C grade (ASCUS and LSIL) cervical lesions. By considering Santos, F.M.; Picelli, N.; Silva, G.F.; Ferrasi, A.C. ; that most of women submitted to the cytology cervical Sarnighausen, V.C.R.; Pardini, M.I.M.C.; Grotto, R.M.T. screening were diagnosed as LSIL, our data emphasize UNIVERSIDADE ESTADUAL PAULISTA the relevance of the HPV58 type inclusion in newly Hepatocellular carcinoma (HCC) can be developed in designed vaccines to effectively prevent this HR type patients with Chronic Hepatitis C. Although previous dissemination among the sexually active women. studies have already demonstrated that HCC developing HV138 - THE ABSENCE OF THE PROTECTOR EFFECT age, sex and alcohol abuse, host genetic polymorphisms FROM HIV GWG VARIANT IN HIV/HBV AND HIV/HCV havein patients been withassociated chronic with Hepatitis HCC presence. C is influenced Previous by COINFECTED PATIENTS studies already demonstrated that the levels of the Watanabe, T.; Massolini, V.M.; Barbosa, F.H.; Silva, some integrins can be altered in HCC. The Human G.F.; Barbosa, A.N.; Simões, R.P.; Ferrasi, A.C.; Pardini, Platelet Antigen (HPA) polymorphism that resides in M.I.M.C.; Grotto, R.M.T. integrins has already associated with HCV presence and, UNIVERSIDADE ESTADUAL PAULISTA progression in Chronic Hepatitis C. It is unknown if is the most frequent virus in Brazil and it has a variant, therespecifically, are association the HPA1 between system wasHPA 1related polymorphism with fibrosis and calledThe subtype B’. This B variant of Human has Immunodeficiency been described in theVirus country (HIV) HCC presence. The goal of this study was to evaluate and it codes the amino acid sequence GWG instead of GPG the association between the HPA1 polymorphism and HCC presence in patients with chronic Hepatitis C. motif among variants of subtype B. The GWG variant has HPA genotyping was performed from 76 HCV infected beenon the associated tip of gp120 to a slowerV3 loop; progression GPG is the of most HIV infection,common patients by PCRSSP. There were no association between giving a better prognosis. However, these studies were

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posterspatients - Human with andVirology: without HV HCC. There was significant XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

98 Human Virology: HV difference (p<0.05) in HPA 1 genotypic frequency distribution between patients with HCC and with lower patientsin G1 96.1% presented of patients undetectable presented viral undetectable load in the plasma end of viral load in the end of the treatment. In G2 75.0% of (F1/F2) fibrosis degree but not with advanced fibrosis information about viral load in the end of the treatment. marker(F3/F4). of The the resultspoorly prognosissuggest, for in thechronic first Hepatitistime, that C. the the treatment. In G2, 8.3% of patients did not present the polymorphism HPA 1a/1b can be constitute a molecular Load undetectable 12 weeks after end of the treatment HV147 - THERAPEUTIC RESPONSE TO SECOND In relation to SVR, 34% of patients presented Plasma Viral GENERATION DIRECT ANTIVIRALS FROM PATIENTS SVR. The results here presented showed that the HCV WITH CHRONIC HEPATITIS C. EXPERIENCE OF THE new(SVR). therapies On the other with hand, second in G2generation 75% of patients DAAs are achieved highly GASTROENTEROLOGY DIVISION OF THE BOTUCATU effective in controlling viral replication. CLINICAL HOSPITAL, UNESP Santos, F.M.; Barreto, S.F.D.; Alho, M.J.O.; Assis, R.C.F.P.; HV149 - MOLECULAR EPIDEMIOLOGY OF Silva, C.N.; Poli, G.B.; Nunes, C.; Santos, F.M.; Silva, G.F.; RESPIRATORY SYNCYTIAL VIRUS STRAINS ISOLATED Grotto, R.M.T.; Pardini, M.I.M.C. IN NORTHERN BRAZIL UNIVERSIDADE ESTADUAL PAULISTA Ferreira, J.A.; Santos, V.M.; Barbagelata, L.S.; Santos, M.C.; Sousa E.M.A.; Gonçalves, M.S.; Souza Junior, E.C.; The Hepatitis C affects 185 million people in the world. In Medeiros, R.; Mello, W.A. Brazil, there are, approximately, 1.4 to 1.7 million of the persons infected by Hepatitis C Virus (HCV). The Hepatitis 1. SECTION OF VIROLOGY, EVANDRO CHAGAS INSTITUTE, SECRETARY OF SURVEILLANCE IN C course involve, in most f cases, a subclinical evolution, HEALTH, MH 2. NUCLEUS OF TROPICAL MEDICINE UFPA infection. This chronic infection can lead to cirrhosis and 3. SECTION OF VIROLOGY, EVANDRO CHAGAS hepatocellularwith about 80% carcinoma. of the patientsThe therapeutic with asymptomatic success in INSTITUTE, SECRETARY OF SURVEILLANCE IN Chronic Hepatitis C is the achievement of the Sustained HEALTH, MH Introduction: Respiratory infections are common causes of morbidity and mortality worldwide, representing a Nowadays,Virologic Response the Brazilian (SVR), Ministry defined of as Healthy undetectable provides viral the major public health problem due to its high incidence secondload after generation 12 or 24 of weeks the Direct afterActing finished Antiviral the therapy. Drugs and easy dissemination in the community. Human (DAAs) to Chronic Hepatitis C treatment: Sofosbuvir, a Respiratory Syncytial Virus (HRSV) is an important pathogen associated with these infections, contributing and Daclatasvir, NS5B inhibitor. The therapeutic success polymerase inhibitor; Simeprevir, a protease inhibitor belongsapproximately to Mononegavirales to 50% of the order, cases Pneumovirus of pneumonia family and SVRshould involves be performed to performed using the the Plasma HCV RNA Viral quantification Load before and90% Orthopneumovirus of cases of bronchiolitis gender. inBased infancy. on the The genetic HRSV (Viral Load) in plasma. The Brazilian protocol to confirm using qPCR assay. The goal of this study was evaluate into two groups, HRSVA and HRSVB, which have 24 and thetreatment, SVR and 12 andrelapsed 24 weeks (patients after finishedwith undetectable the therapy 20diversity genotypes, of the respectively. F and G proteins, In this this context, virus studies is classified have HCV RNA at the end of treatment but again detectable been conducted worldwide aiming to analyze the genetic within the following 6 months) in patients assisted diversity of HRSV and its circulation factors. Objective: in Gastroenterology Division of the Botucatu Clinical Characterize genetically HRSV strains isolated in the Hospital. Samples from 38 patients with Chronic Hepatitis Northern Brazil, between January 2015 and January 2016, and to determine the most frequent HRSV subgroup, DAAs were included in this study. These patients were identify current genotypes and describe the period of separatedC that finished in two the groups: treatment G1 (26 with patients second treated generation with greatest circulation HRSV in this population. Material sofosbuvir and daclatasvir) and G2 (12 patients treated and Methods: 57 HRSV strains, isolated in cell cultures, with sofosbuvir and simeprevir).The results showed that were analyzed to the molecular characterization of the

99 Human Virology: HV

G protein gene, in four main steps: a) extraction of viral of patients. For this, 21 patients undergoing AloHSCT were monitored (from pretransplant period 5 days prior d) phylogenetic analysis. Results: The distribution of the to transplantation until one year after transplantation). 57RNA; HRSV b) Gpositive gene amplification cases by age byshowed RTPCR; that c) the sequencing majority For HCMV detection three methodologies were used: AGM, nestedPCR and qPCR, and for molecular detection years of age. The State of Amazonas had the highest a comparison was made between detection of HCMV in of patients, 38 cases (67%) had between zero and four DNA extracted from peripheral blood leukocytes (PBL) and sera, in a paired manner. The results showed that betweennumber ofthe positive months cases,of March 23 and (40.4%). July, climate The circulation transition the active HCMV infection was detected by at least one of periodof HRSV in focus the study in the area. first Viralmonths subgroup of the year,was presentespecially in

period,three methodologies having been observed in 95.2% good (20/21) agreement of patients between and HRSV45 (79%) infections specimens, occurred of these, predominantly 40 were in thein childrenHVRS B the45% results (9/20) of of AGM these and were qPCR positive (kappa in pre = 0.65).transplantation Of the 20 agedsubgroup zero to and four five years to HRSVold. It Awas subgroup. the HRSV Conclusion: circulation in all the studied States, with the exception of the states of Roraima and Amapá. The circulation of HRSV was werepatients positive positive for forAGM active and qPCR,HCMV andinfection, negative 85% by (17/20) nested related to the climate transition. Both HRSVB subgroups PCR.were positiveRegarding for the threetype methodsof clinical and sample, only 15% molecular (3/20) and HRSVA circulated in the period studied, with the techniques showed higher sensitivity to the PBL over the Buenos Aires HRSVB genotype being the most common sera. The main alteration of patients was pancytopenia in the North of Brazil. The detection of ON1genotype and the main complication was graft versushost disease. Six patients died during the study period, however, it movement or circulation of this genotype in Brazil. the HRSVA in this study configured in the first report of directly associated with the cause of death. The obtained HV150 - HUMAN CYTOMEGALOVIRUS IN PATIENTS datawas notreveal possible a high to positivityconfirm if HCMVindex andactive the infection occurrence was UNDERGOING ALLOGENEIC HEMATOPOIETIC STEM of HCMV syndrome in patients submitted to aloHSCT. CELL TRANSPLANTATION We hope that the results may assist in the therapeutical Abreu, M.N.; Borges, F.P.S.; Abreu, M.N.; Souza, K.M.C.; measures, as well as in the methodology of choice and Arantes, A.M.; Fiaccadori, F.C.; Cardoso, D.D.P.; Souza, the type of clinical sample for detection of active HCMV M.B.L.D. infection, in order to contribute for the inclusion of 1. INSTITUTO DE PATOLOGIA E TROPICAL E SAÚDE HCMV monitoring is included in the routine testing of PÚBLICA patients. 2. HOSPITAL ARAÚJO JORGE/ ASSOCIAÇÃO DE COMBATE AO CÂNCER The Human Cytomegalovirus (HCMV) is an important cause of morbimortality in recipients of allogeneic hematopoietic stem cell transplantation (AloHSCT). However, there is not a consensus on which protocol to use for monitoring the infection by HCMV and, data on the frequency and clinical manifestations of the infection in this group population are quite variable among the distinct transplant centers in the world. Thus, the main objective of the present study was to proceed the monitoring of active HCMV infection in patients undergoing AloHSCT by three different methodologies: antigenemia (AGM), nestedPCR and realtime PCR (qPCR) and determine viral load, correlating active infection with the clinical manifestations and prognosis Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

100 Human Virology: HV

HV153 - GENETIC DIVERSITY OF THE INFLUENZA (190 helix) in Yamagata lineage strains. Regarding the VIRUS B STRAINS CIRCULATING IN THE AMAZON NA, the E105K substitution was detected in Victoria and REGION D197N lineage and P139S in Yamagata lineage, both Santos, M.C.; Silva, A.M.; Sousa Júnior, E.C.; Ferreira, related resistance to neuraminidase inhibitors. The J.A.; Barbagelata, L.S.; Chagas Júnior, W.D.; Gomes, R.A.; Sousa, E.M.A.; Bedran, R.L.S.; Santos, V.M.; detection of influenza B virus was more evident in the Medeiros, R.; Mello, W.A. with the rainy season. There was disagreement first half of the year in the Amazon Region, consistent 1. INSTITUTO EVANDRO CHAGAS circulating strain against vaccine strain in the years 2013 2. FACULDADE METROPOLITANA DA AMAZÔNIA and 2014. Mutations were observed, which resulted in 3. INSTITUTO EVANDRO CHAGAS E NÚCLEO DE aminoacidic substitutions in antigenic sites of HA. There MEDICINA TROPICAL DA UFPA were aminoacidic substitutions in NA associated with 4. INSTITUTO EVANDRO CHAGAS E UNIVERSIDADE FEDERAL DO PARÁ resistanceHV159 - PDGF to antiviralA OVEREXPRESSION used to treat influenza. IN PLATELETS IS ASSOCIATED WITH ADVANCED HEPATIC FIBROSIS IN ItThe has Influenza two antigenic B virus andis one genetically of the etiological distinct agentslineages, of CHRONIC HEPATITIS C knownflu, is associated as Yamagata with and epidemics Victoria. throughout Constituting the the world. viral Nunes, C.; Tanikawa, A.A.; Grotto, R.M.T.; Silva, G.F.; particle are two surface glycoproteins, hemagglutinin Ferrasi, A.C.; Sarnighausen, V.C.R.; Pardini, M.I.M.C. (HA) and neuraminidase (NA), and the genes encoding UNIVERSIDADE ESTADUAL PAULISTA these proteins are those which are most selective Activation of hepatic stellate cells (HSCs) is the primary pressure which induces occurring mutations that may cause strains capable of escaping the immune system and resistance to antiviral drugs. Thus, the genetic diversity PDGFevent thatthe mostleads potent to fibrosis mitogen, in chronic so both hepatitis have essential C. TGF ?1 is the most profibrogenic cytokine for HSCs and possible treatment failure. In order to assess the genetic of influenza B virus impacts the vaccine formulation and mRNAroles during in hepatic fibrogenesis. tissue and The platelets aim of from this HCVstudy carriers. was to Amazon Region, from january 2013 to december 2015, Fortyevaluatethree the patients expression were profile evaluated of TGF accordingB1 and PDGFtwo wasdiversity carried of circulatingout the genetic influenza characterization B virus strains of the in theHA and NA genes. The methodology involved extraction and F2) and G2 (n=24, F3 and F4). mRNA expression of viral nucleic acid followed by RTPCR (polymerase ofgroups those depending growth factors on the in fibrosis hepatic degree: tissue G1and (n=19, platelets F1 chain reaction preceded by reverse transcription) was evaluated by qPCR. Expression of PDGFA mRNA sequencing. The analysis of the circulation pattern for amplification of the HA and NA genes and their PDGFin platelets A mRNA was was significantly more expressed higher in in platelets G2. Although when comparingwe did not with find hepatic a significant tissue, association,differently from TGFB PDGF1 andB showed that the peak activity of influenza B virus was that was more expressed in hepatic tissue. These results concentrated in the first half of the years studied, except in the second half. The circulation of both Victoria and suggest that an alternative pathway for the development for the year 2013 in which a second peak was identified in 2013 and 2014, and the Victoria was more prevalent, PDGFA in megakaryocytes (platelets precursors), could thusYamagata being lineages at odds withof influenza the vaccine B strains strain were that belongeddetected of fibrosis mediated by over expression of TGFB1 and to Yamagata lineage, since in 2015 only Yamagata lineage it was detected, supporting the vaccine strain. be involved in fibrosis developing, contributing to the The analysis of aminoacidic changes in the HA changes HSCs activation and, to the process of fibrogenesis. were observed in both Victoria and Yamagata lineages. Among the replacements were found N141D and N144D (150 loop) in Victoria lineage strains and P123A, K131N, Q137K (120 loop) I165S (160 loop), T197K and T197A Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

101 Human Virology: HV

HV160 - INFLUENCE OF SNP 764C> G INTERFERON patients type 3 in Brazil. However, it is important to GAMMA GENE IN PATIENT RESPONSE TO TREATMENT highlight that the number of samples was low, which OF THE HEPATITIS C GENOTYPE 3 Lima, M.L.D.L.; Carneiro, B.M.; Provazzi, P.J.S.; Batista, such certainty and therefore more studies are needed. may interfere with the final result, cannot infer it with M.N.; Andrade, S.T.Q.; Rahal, P. HV161 - EVALUATION OF THE HLA CLASS I KILLER 1. UNIVERSIDADE ESTADUAL PAULISTA "JÚLIO DE IMMUNOGLOBULINLIKE RECEPTORS (KIR) LIGANDS MESQUITA FILHO" INSTITUTO DE BIOCIÊNCIAS, IN HIV/HCV COINFECTED PACIENTS LETRAS E CIÊNCIAS EXATAS 2. UNIVERSIDADE FEDERAL DO MATO Nunes, C.; Massolini, V.M.; Barbosa, F.H.; Barbosa, Infection by hepatitis C virus (HCV) is a major cause of A.N.; Silva, G.F.; Pardini, M.I.M.C.; Grotto, R.M.T. cirrhosis and hepatocellular carcinoma, which induces UNIVERSIDADE ESTADUAL PAULISTA the need for liver transplantation. In recent years, new factors are related to predicting success of HCV treatment, response, which natural killers cells have a fundamental among them are the single nucleotide polymorphisms role.The first These immune cells defense present against in their pathogens surface is thereceptors innate (SNPs) in many genes, particularly those related to the named KILLERIMMUNOGLOBULINLIKE RECEPTORS innate immune response of the patient. Interferon (KIR). These receptors (KIR) interact with HLA class I gamma (IFNgamma) is involved in the host response to molecules presenting inhibitory or stimulatory effects. The HIV infection progression is dependent on viral and host factors. Polymorphisms in the KIR genes and times,HCV infection. improving It has the been host\'s reported response that to764C> treatment G variant for ligands HLA class I (A, B and C), have been associated increased the efficiency of this gene promoter up to three in patients infected with HCV 3 and in a country with combination with HIV progression has already been well mixedHCV. There ethnicity is little like information Brazil. The the objective influence this of this project SNP describedwith HIV progression.in literature, Althoughthere are theno reports specifics about KIR HLAthis the IFNgamma gene in patients chronically infected with HCVwas verifynonresponders the presence to treatment of the polymorphism with IFN and 764C> ribavirin. G of HLAin patients polymorphisms with coinfection in the HIV HIV/HCV. infection The progression goal of this in For this, were used 52 samples from patients positive study was evaluated the influence of the ligands KIR for HCV, from these 31 positive for viral RNA (group I). from 251 patients and used as source to genotype KIR genesHIV/HCV by PCRcoinfectedSSP and patients. HLA class Genomic I genes DNA by wassequencing. isolated The patients included in this study were attended in The polymorphism site sequence was amplified using Botucatu Medical School. The patients were separated sequenceda high fidelity by DNA the polymerase,Sanger method. using specificThe generated primers. in Group 1: HIV monoinfected (n=100), Group 2: HCV After amplification, the fragments were purified and The information about HIV infection progression was html).sequences Statistical were evaluatedanalysis was by PHREDmade using software the BioEstat/ phrap obtainedcoinfected, from Group patients 3: HIV/HCV medical reports. coinfected The patients. results / CONSED (http://www.bioinformatica.ucb.br/electro. showed that ligands KIRHLA class I were more frequent in two samples of group I, as well as two of the group software version 5.3. The variant 764C> G was found in group 1, 2 and 3, where KIR2DL3C1/X (77%, 33%, II, being the frequency of this polymorphism 6.45% in of47%) the , KIR3DL1ligands BW/XKIRHLA (53%, with 47%, ligand 60%), non KIR2DS1 alele). C2/X The thegroup presence I and 9.52% of the in variant group II.in Theeach comparative group (p = 0.1594).analysis (50%, 63%, 67%) respectively. (/X is the heterozygosis Theof the analysis groups, is by not x2, consistent showed no with significant the literature, difference which for KIRstatisticalHLA class analyzes I ligands. showed Then, the no HCV significant presence difference did not cure for HCV genotype 1 patients. Therefore, the (p> 0.05) among the groups (G1, G2, G3) according to showed correlation of SNP 764C> G with spontaneous I KIR genes in HIV infection progression. Others genetic used as predictive factor of response for viral genotype seem to affect the influence on combination in HLA class polymorphism 764C> G of the IFNgamma gene cannot be Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

102 Human Virology: HV polymorphisms can be evaluated to infer about the HIV or in some cases in infants with microcephaly, which is drawing the attentionof the public health community. Because of that, there is an urge need for better diagnosis infectionHV162 - progressionDETECTION in AND HIV/HCV EPIDEMIOLOGIC patients. PROFILE OF HUMAN ADENOVIRUS IN PEDIATRIC PATIENTS most valuable clinical samples for diagnosis. Objective: WITH ACUTE RESPIRATORY INFECTION Ourtools aim for healthwas to providers compare asdifferent well the clinical identification samples of and the Mesquita, F.S.; Oliveira, D.B.L.; Durigon, E.L. verify which one is more feasible for ZIKV diagnostic UNIVERSIDADE DE SÃO PAULO by RT PCR. Methodology: Samples of saliva, urine, Human Adenovirus (HAdV) belongs to the Adenoviridae semen, and serum of patiente which showed DENVlike family, genus Mastadenovirus, and has a genome of symptoms, GuillanBarr or microcephaly, were extracted doublestranded DNA. HAdV is an important etiologic on the NUCLISENS® easyMag® platform (BioMerieux). agent responsible for various diseases in adults and The RTPCR reaction was carried out for ZIKV, DENV and children, particularly respiratory tract infections, eye CHIKV with RNA from each sample with a set of primers infections, gastroenteritis and hemorrhagic cystitis. and probes with FAM as dye reporter for the probe, as Currently there are 68 known types of HAdV divided into seven species (HAdVA to HAdVG). In the case of et al., 2004 and LU et al., 2012, respectively. Patients previously described by Lanciotti et al., 2008; Wagner acute respiratory infections, they are associated with positive for ZIKV, were followed for 60 days. Results. We HAdV B, C and E species. Acute respiratory infection analyzed samples of 38 patients, which showed DENVlike in the lower tract is the fourth leading cause of death symptoms, 1 patient with Guillan Barr and 5 newborn worldwide. In children under two years of age, Human

ofwith the microcephaly. tested specimens. Of these, Of the13.63% 6 patients (6/44) positive were ZIKV for positive and 6.81% (3/44) were DENV for at least one respiratoryAdenovirus infections,is responsible which for shows5 to 15% the ofimportance viruses that of ZIKV, 1 collected only serum and 5 colleted urine, Saliva surveillancecause acute and respiratory monitoring infection of HAdV. and In 1 tothis 5% context, of all 1129 nasopharyngeal aspirate samples from children total patients, 3 had ZIKV detected in the serum and withand Seruma maximum and 2 of of 8 these days afterfive collectedthe onset semen. of symptoms, Of the framework were collected in the University of São Paulo’s 5 had ZIKV in the urine with detection time 30 days, 2 Universitaryunder five who Hospital presented (HUUSP), acute in respiratory2015. Samples infection were patients were positive in salive for 30 days and 2 were extracted by automated method and analyzed by real positive in the semem for at leat 60 days after the onset. time polymerase chain reaction for detection of HAdV. A baby with microcephaly persisted until 56 days after the birth in urine e 64 in the serum. Conclusion: Data samples tested positive for the virus. demonstrated that samples of semen and urine presents Preliminary results showed approximately 20% of the ZIKV for longer time, what make them the best option HV165 - COMPARISON OF DIFFERENT CLINICAL for ZIKV diagnosis, when possible. SAMPLES FOR DETECTION OF ZIKA VÍRUS IN SYMPTOMATIC PATIENTS BY REALTIME PCR Silveira, V.B.; Mesquita, F.S.; Thomazelli, L.M.; Mendes, E.A.; MELO, S.R.; Durigon, E.L.; Oliveira, D.B.L. LABORATÓRIO DE VIROLOGIA CLÍNICA E MOLECULAR, DEPARTAMENTO MICROBIOLOGIA, INSTITUTO DE CIÊNCIAS BIOMÉDICAS, UNIVERSIDADE DE SÃO PAULO Introduction: Zika virus (ZIKV) has been described recently causing problems for humans as a disease able to result in complications such as skin rash, arthralgia, myalgia and conjuntivitis. In addition, if a pregnant woman is infected with ZIKV may result in a natidead

103 Human Virology: HV

HV173 - ANALYSIS OF EPIDEMIOLOGICAL PROFILE, importance as a cause of gastroenteritis requiring SEASONAL AND MOLECULAR OF CHILDREN INFECTED WITH ADENOVIRUS HOSPITALIZED AFTER THE after the introduction of rotavirus vaccine in Brazil. INTRODUCTION OF THE ROTAVIRUS VACCINE IN hospitalization in children under 3 years; especially BELÉM, PARÁ HV176 - PRESENCE AND GENOTYPING OF HUMAN PAPILLOMAVIRUS IN CONDYLOMA ACUMINATA Muller, E.C.A.; Soares, L.S.; Resque, R.L.; Linhares, LESIONS A.C.; Sousa, M.S. Badial, R.M.; Provazzi, P.J.S.; Badial, R.M.; Dias, M.C.; 1. INSTITUTO EVANDRO CHAGAS 2. UNIFAP Cândido, N.M.; Stuqui, B.; Matos, R.P.A.; Bonfim, C.M.; 3. UFPA Melli, P.P.S.; Quintana, S.M.; Calmon, M.F.; Rahal, P. 1. INSTITUTO DE BIOCIÊNCIAS, LETRAS E CIÊNCIAS Gastroenteritis are the third cause of infant morbidity EXATAS UNESP SÃO JOSÉ DO RIO PRETO and mortality worldwide, especially among children 2. HOSPITAL DAS CLÍNICAS DA FACULDADE DE under 5 years old. Adenoviruses (HAdV) are icosahedral MEDICINA DE RIBEIRÃO PRETO, DEPARTAMENTO DE GINECOLOGIA E OBSTETRÍCIA and doublestranded DNA. They belong to Adenovidae 3. FACULDADE DE MEDICINA DE RIBEIRÃO PRETO family,nonenveloped Mastadenovirus virus, has 240genre, proteins are \"hexon\"distributed specific in 7 UNIVERSIDADE DE SÃO PAULO species (A to G) and 57 serotypes. Epidemiological Genital human papillomavirus (HPV) infection is the most common sexually transmitted disease. The HPV diarrhea in hospitals and clinical ambulatories. The main infection produces a wide range of disease presentations, studies found AdV in 214% of cases of acute childhood from asymptomatic infection to benign genital warts to invasive cancer. It is extremely common and affects inpourpose stool samples of this study from was 842 to children detect the under presence, three defineyears ofthe age, epidemiological hospitalized with profile gastroenteritis and types of and adenoviruses vaccinated worldwide. Human papillomaviruses are members of the Papovaviridaebetween 2% family and 43%of epitheliotropic of the female double populationstranded case control\" and conducted by Instituto Evandro DNA viruses and are considered tumor viruses because Chagas,against rotavirus;from May 2009participants to April of 2011 the studyin Belém, \"Rotavirus PA, CEP of their ability to immortalize normal cells. Currently n. 0013.0.72.00011. ELISA and immunochromatography characterized as “lowrisk” types which are associated sequencing nucleotides for typing and molecular withmore genital than 130warts types and ofrespiratory HPV have papillomatosis, been identified; or techniques were used for screening; and PCR and as “highrisk” which are associated with invasive cancer. the tested sample, with the enteric adenoviruses (ADE) Condylomata acuminata, are the most common virally identification. The AdV were found in 7.2% (61/842) of transmitted STD, affecting 1.9 million Brazilians each year. It is most associated with the low risk HPV types being 50.8% (31/61) of the positive cases. The analysis Positivityon the gender by age of of the the infected patients children analyzed, showed detected 7.7% a highrisk HPV co infection is common. Therefore, the higher(28/362) prevalence being female among and those 6.8% over (33/480) 24 months were of male. age, objective6 (70% of of cases) this workand 11was (20% to improve of cases) the although, knowledge the about the pathogenesis of the condylomata acuminata Regarding Ads temporal distribution, the month of and thus establish more appropriate therapies for HPV corresponding to 8.9% (16/178) of all positive cases. infection and injury caused. On this basis we investigated total cases. The sequencing reaction characterized the the presence of HPV as well as their genotype in 44 speciesJune was F theas moremost prevalent,prevalent inwith our 11.4% region, (8/70) accounting of the genital lesions from 44 patients from Ribeirão Preto

Ribeirão Preto Medical School. For this purpose we used for 64.5% (29/45) of the sequenced samples, with the city and region; collected at the Clinical Hospital of type 41 detected in 69% (20/29) of positive cases for polymerase chain reaction (PCR) to detect the virus and thesethis species viruses and in 31%the city (9/29) of Belém, was characterized demonstrating as theirtype sequencingthe oligonucleotides reaction PGMY09/11according to andthe GP5+/6+Sanger method in the 40. The results of this study confirm the presence of Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

104 Human Virology: HV for HPV genotyping. As a result it was observed the virus (RSVA and B). The second Multiplex NestedPCR samples were successfully genotyped. The lowrisks were presence of HPV in 43 samples (95.5%), where all these viruseswas performed (PIV14), usingthe S gene specific for setcoronavirus of primers (HCoV) targeting and the hemagglutininneuraminidase gene for parainfluenza predominant between the HPV types detected (97.7%) and enterovirus (EV). The third Multiplex NestedPCR was alsospecifically, analyzed the and most showed frequent the types presence were of HPV6 HPV6 (63.6%)vc and performedthe 5’NCRVP4/VP2 using primers genome targeting region for the rhinovirus hexon gene (HRV) for HPV6afollowing in a by half HPV11 samples. (20.4%). The results The HPV6 are in variants agreement was with the literature that shows the presence of HPV in for bocavirus (HBoV) and the matrix gene for human condylomata acuminata lesions as well as the prevalence metapneumovirusadenovirus (HAdV), (hMPV). the NP 1/VP1/VP2It was observed genome a regionglobal infection is the most common STD and is responsible forof low a widerisk rangeHPV types of conditions (60%), mostly from benign HPV6. warts Genital to HPVanal prevalent.detection rateSimilar of detection 35.9% (90/251), rate was beingobserved rhinovirus among cancer. The obtained results can contribute to a better (31%) and respiratory syncytial virus (27,4%) the most understand about HPV infection and management and treatment of condylomata acuminata lesions. the groups symptomatic (37%) and asymptomatic (34,5%). It was observed codetection rate of 6,4% HV183 - HIGH FREQUENCY OF RESPIRATORY VIRUSES of(16/251), respiratory mostly viruses in samples in children of symptomatic and contribute patients to IN ASYMPTOMATIC AND SYMPTOMATIC CHILDREN further(13/16) understanding(p<0,05). The resultsof the reinforce epidemiological the importance factors ATTENDED IN PEDIATRIC HOSPITAL, GOIÂNIAGOIÁS associated with different pathogens in our region. Thus, Sousa, J.P.G.; Oliveira, A.C.R.; Sousa, T.T.; Castro, I.A.; they open the way to new studies in the state of Goiás, Silva, N.D.A.; Nogueira, T.R.; Souza, K.M.C.; Souza, M.; also providing information to assist in the construction Cardoso, D.D.P.; Fiaccadori, F.S. of control measures and more effective prevention of UNIVERSIDADE FEDERAL DE GOIÁS these infections. The acute respiratory infections (ARIs) are an important HV184 - VALIDATION OF A MOLECULAR PANEL FOR cause of morbidity and mortality worldwide. They are HSV AND ENTEROVIRUS IN CEREBROSPINAL FLUID responsible for more than four million of deaths annually, FOR CLINICAL USE IN A PRIVATE HOSPITAL IN SAO affecting mainly children and elderly people. Children PAULO, BRAZIL Castro, V.F.D.; Santana, R.A.F.; Petroni, R.C.; Dastoli, and this is a common cause of hospitalization, mainly in G.T.F.; Moreira, D.H.; Pinho, J.R.R. developingfewer than fivecountries. years have With about regard four toto sixetiologic ARIs per agents year associated with respiratory infections, viruses have a HOSPITAL ISRAELITA ALBERT EINSTEIN prominent role. In Brazil, particularly in the WestCentral Viruses are common etiological agents of central nervous region, studies that evaluate the circulation of respiratory system (CNS) infections. A rapid molecular diagnosis is viruses in the pediatric population are scarce. Thus, this recommended to improve patient management. Clart study aimed to investigate the occurrence of respiratory Entherpex kit allows the simultaneous detection of these viruses in the pediatric population, from GoiâniaGoiás. herpesviruses: Herpes Simplex Virus types 1 and 2 (HSV 1 and HSV2), Varicella Zoster Virus (VZV), EpsteinBarr swabs were collected from children between zero and Virus (EBV), Human Cytomegalovirus (CMV), Human sixBetween years May/2014of age presenting and May/2015, or not respiratory 251 samples symptoms, of nasal Herpes Virus 6, 7, 8 (HHV6, HHV7 and HHV8), as well attended at the reference children’s hospital in Goiânia. as the most clinical relevant Enteroviruses (Poliovirus, For the molecular screening, three Multiplex Nested Echovirus, Coxsackievirus), including enterovirus 71 (EV71). For the diagnosis of these virus infections in the CNS, we validated a laboratory test based on this kit for PCR protocols were performed. The first Multiplex (FLUA,Nested PCRB and was C) performedand the F gene using for specific respiratory set of syncytial primers targeting the nucleoprotein gene for influenza virus their detection in the cerebrospinal fluid (CSF). METHODS: Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/PostersNucleic - acidsHuman fromVirology: cerebrospinal HV fluid (CSF) samples XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

105 Human Virology: HV were extracted using automated EasyMag system and populated areas. They are proven sources of infection and submitted to a multiplex reverse transcription PCR DNA transmission of various fungal and bacterial diseases but microarray test (CLART® ENTHERPEX kit) for human little is known about its potential for the spread of viruses. Herpesvirus and Enterovirus detection. Validation was conducted according to CAP guidelines. We evaluated zoonotic potencial in asymptomatic pigeons of the Tietê accuracy, reproducibility and sensitivity. Accuracy EcologicalThis study Park, shows São Paulo the identification SP, Brazil, using of metagenomic viruses with was tested comparing obtained results with previous with next generation sequencing analysis and Nested assays for the detection of single agents carried out in PCR for validation. This analysis was performed using our laboratory or in references laboratories. Sensitivity oropharyngeal and cloacal swabs from 10 Columbia livia was evaluated by dilutions of a commercial control domestica pigeon specimens collected in 2011. Samples with known concentration. RESULTS: For accuracy, we Proteinase K reaction) and the RNA extraction was correlation. Reproducibility was performed using two conductedwere submitted through for prea QIAamptreatment Viral (filtration RNA Mini and Kit. DNAse/ From negativecompared samples the results and of two 35 samplespositive andsamples obtained (HSV 97,2%2 and an equimolar pool, an RNA library was prepared and enterovirus), tested in three different days by different was submitted for RNASeq in HiSeq 2500 Sequencing persons. All the results were concordant. The test was System (Illumina), pairedend (2x 100bp). The genome assembly was made with Metavelvet, and the annotation with UniProt. 83,944,578 reads were obtained, from 6.able CONCLUSION: to detect viral The loadresults of of 200 validation copies/reaction demonstrated with that100% the confidence kit is a valuable for HSV2 molecular and 90% confidence diagnostic for tool HHV for assemblies matched Human Herpesvirus 6A (HHV6A) virus infections and the implementation of this technique (Q69566_U88).which 80,67% hadThe Q>30samples score. were Ten further of 39,971 investigated scaffold allows the detection of different Herpesviruses and by conventional PCR assays for validation using the Enteroviruses in CSF samples. This method has been Van Der Hanter (1996) protocol, which resulted in one incorporated into the routine of our laboratory allowing positive cloacal swab for Herpesvirus. Herpesviridae the etiological diagnosis and establishment of more is a large family of DNA viruses that cause diseases in effective medical treatment for each patient. animals and in humans. Whilst the initial objective was the RNA virus detection, was also possible the detection HV190 - CITY PIGEONS AS CARRIERS OF HERPESVIRUS of dsDNA viruses as Herpesvirus. The conclusion can Caserta, L.C.; Simas, P.V.M.; Barnabé, A.C.S.; Caserta, be made that metagenomic and NGS analysis followed L.C.; Martini, M.C.; Durães Carvalho, R.; Felippe, P.A.N.; Lima Neto, D.F.; Beck, R.M.; Nascimento, G.M.; method for virus detection and can be used as a strategy Jacomassa, F.A.F.; Moraes, A.P.; Barbosa, C.M.; Miller, forby PCRepidemiological for validation studies. is a sensitive,HHV6A has fast been and described efficient M.E.; Oliveira, D.B.L.; Durigon, E.L.; Arns, C.W. to be more neurovirulent, and as such is more frequently 1. UNIVERSIDADE ESTADUAL DE CAMPINAS 2. UNIVERSIDADE DE SOROCABA such as multiple sclerosis. Sequencing and phylogenetic 3. UNIVERSIDADE FEDERAL DO PAMPA analysisfound in are patients still to be with performed. neuroinflammatory However, these diseases results 4. DEPARTAMENTO DE PROTEÇÃO E BEM ESTAR already indicate that city pigeons may serve as reservoirs ANIMAL PREFEITURA MUNICIPAL DE CAMPINAS for Herpesviruses and may lead to viral transmission to 5. UNIVERSIDADE DE SÃO PAULO humans. Although they may seem inoffensive, city pigeons may be a public health problem and are of importance to veterinary and epidemiological surveillance. Columbia livia domestica is the pigeon specie most widely distributed in urban areas in Brazil. As in most urbanized areas around the world, they have had uncontrolled proliferations and now cohabits with humans in public places, open food courts and many other highly Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

106 Human Virology: HV

HV191 - DETECTION, GENOTYPING AND VIRAL HV193 - AN APPROACH ON ZIKA VIRUS LOAD QUANTIFICATION OF CHIKUNGUNYA VIRUS IN Ferraz, L.F. CANCER PATIENTS UNIVERSIDADE FEDERAL DO TOCANTINS Macedo, D.F.R.; Gama, B.E.; Emmel, V.E.; Vera Lozada, Introduction: Zika virus is belonging to the genus M.G.; Martins, I.S.; Hassan, R. 1. UNIVERSIDADE FEDERAL FLUMINENSE consists of singlestranded ribonucleic acid with a 2. INSTITUTO NACIONAL DE CÂNCER positiveflavivirus, sense. family It Flaviviridae,is capable of itsinfecting genetic arthropod material Chikungunya virus (CHIKV) is a +(ss)RNA arbovirus that Aedes aegypti and Aedes albopictus, very common in belongs to the Alphavirus genus of Togaviridae family. countries with tropical climates, are also associated with the transmission of dengue and chikungunya. The in Rio de Janeiro State, and by April 2016, an outbreak virus can cause symptoms ranging from people, usually wasIn 2015, declared. the first Little autochthonous is known about cases CHIKV were infection diagnosed in include hemorrhagic fever, headache, malaise and other cancer patients and whether there was a difference in symptoms also related to dengue with duration close viral load in the different compartments (serum, plasma to one week. One of the severe conditions of disease and urine) at the time of diagnosis. The aim of this study include impairment of the central nervous system and was to evaluate the performance of a RTqPCR method microcephaly. The relationship between microcephaly in newborns and contagion virus was observed in mid describe the circulating strain of CHIKV in patients with cancerfor diagnosis (immunocompromised) and viral load quantification, and immunocompetent as well as to the end of 2015. Materials and Methods: For diagnostic patients. We herein report on results of 22 CHIKV+ saliva2014 in and Brazil blood and confirmedsamples are by thecollected Ministry from of Health people at individuals, 14 cancer patients (INCA, Rio de Janeiro), in risk areas or showing any symptoms of infection. and 8 immunocompetent patients, which were studied Reverse transcription is performed by polymerase chain reaction (RTPCR) capable of producing multiple copies of the genetic material. The number of bands is observed extraction37 days after of viral the appearanceRNA was carried of the firstout symptoms.using the in agarose gel and compared with data from recent QIAampSample Viral consisted RNA Mini of serum, Kit (QIAGEN). plasma Quantitation and urine; was the studies on the virus genome. The amount of antibodies performed by RTqPCR with CDC recommended primers that have the individual is also an important factor for and probes (TaqMan), and a standard curve. In cancer isolated in 1947 in Africa. About twenty years later it wasdiagnosis. observed Results: in other Zika regions virus wasof Africa observed and andAsia firstand urine,patients, and 13/14 in one exhibited case, CHIKV a positive was detected result in only serum, in urine. and into Oceania and later in Brazil. Much of the infected zika Therefore,12/14 in plasma. in cancer Of patients, note, 9/14 the hadchoice a positive sample isresult serum, in virus may have the mild form of the disease. However, being the urine an important diagnostic complement. A the virus appears to have acquired the ability to infect positive correlation was observed between serum and plasma (R2 = 0.886, p <0.001) and between plasma and many of their genes are compatible with the human body,humans facilitating efficiently the since transfer it was of the discovered. virus by the Currently, vectors to humans. Conclusions: The contamination zika virus is urine viral loads (R2 = 0.685; p = 0.029). Viral loads fairly frequent in tropical countries that behave Aedes betweenwere higher cancer in serumcases and controls. plasma vs A urinesegment (~7x10^4 of the mosquitoes. The main concern include the relationship CHIKVtimes) (pE1 <0.01).glycoprotein No significant gene was differences sequenced were in 11 found viral between infection and syndromes such as microcephaly isolates, genotyping and phylogenetic reconstruction and GuillainBarré syndrome, but more studies are needed to prove this relationship. In Brazil, more efforts are needed to complete elimination of mosquito breeding analyses allowed to determine a 9899% similarity of sites in addition to clinical tests for rapid diagnosis. ofRio the de CHIKVJaneiro viral circulating characteristics virus with in thethe East state / ofCentral Rio de / Janeiro,Southern pre AfricaOlympics (ECSA) games. genotype. This is the first report

107 Human Virology: HV

HV194 - ANALYSIS OF MUTATIONAL PROFILES OF amino acid in this domain. Therefore, it is necessary to HIV1 NEF IN PATIENTS SAMPLES WITH DIFFERENT test if these changes could alter the protein structure HAART RESISTANCE PROFILES and if they can affect the function of the viral PR or even Correa, I.A.; Costa, L.J. the sensitivity to the protease inhibitors. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO HV204 - OUTBRED GENETICALLY SELECTED MICE FOR HIGH OR LOW ANTIBODY RESPONSE AS A MODEL AIDS epidemic, the disease still is an important public TO STUDY THE IMMUNE RESPONSE TO HEPATITIS B healthEven after issue. 30 The years introduction since the of beginning antiretroviral of the therapy HIV / ANTIGENS (HAART) positively affected the course of the disease, Oliveira, D.C.A.; Trezena, A.G.; Tino De Franco, M.; increasing the survival of infected individuals. However, Utescher, C.L.A.; Tenório, E.C.N.; Botosso, V.F. in the absence of a cure for the disease, the treatment INSTITUTO BUTANTAN must be adopted for a long period of time and with the course of treatment, selection of viruses harboring The ability to produce antibody in response to drug resistance mutations is a limiting factor for the immunization with hepatitis b surface antigen (s treatment continuity. We have previously characterized antigen) is controlled by autosomal dominantly that the viral protein Nef regulates the activity of the expressed hla class ii molecules. as a consequence viral Protease, and its absence decreases the sensibility marked variation in antibody production to hepatitis b of Protease to currently used Protease inhibitors. Given vaccines was found after immunization with this antigen this, the study of the interactions of HIV1 proteins during alone. aiming circumvent the non-responsiveness a new its replicative cycle remains important to characterize and s proteins have been developed. since 1998 instituto generation vaccines containing epitopes of pre-s1/s2 replication. As well as, will provide data on the impact butantan has been producing the recombinant hepatitis ofnew these specific mutations targets occurring for drug in intervention genomic regions during outside viral b vaccine containing only the s antigen. in order to study the target genes for the current therapy. Therefore, this different hepatitis b antigens a new yeast expressing study aims to analyze the nef gene from samples of the modification in the immunogenicity promoted by patients under HAART regimen and presenting different the s protein and other surface components, pre-s1 and pre-s2, was produced and tested in genetically selected genes. Analyses of nucleotide sequences from different murine model. the two mice lines used were obtained groupsprofiles (high of drug number resistance of resistance mutations mutations in the RT in andRT and PR by bidirectional selection according to the high (hiii) or PR versus no resistance mutations in these genes), we low (liii) antibody responsiveness against salmonella

the different patterns of immune response to rabies rate is higher than 1 in both groups, indicating that Nef flagelar antigens and showed to be useful to investigate issaw under that negative the synonymous/non selection. By observingsynonymous the amino mutation acid sequence from these samples, we found that there was virus and mouse hepatitis virus 3. samples of purified a conservation of functional protein domains. However, pre-s1s and pre-s1-s2/s and pre-s2 mabs.antigens hiii were and liii evaluation mice groups by sds-page received we noted the presence of polymorphisms and some and by western blot, using anti-s specific serum and aluminum hydroxide by the subcutaneous route with in the group presenting high number of resistance two doses of the s or pre-s1-s2/s antigens adsorbed in mutationsspecific amino in RT acid and modifications PR. In the region that occur of ? helixspecifically we’ve 30 day-interval. individual serum was periodically

titration. in addition, after an intraperitoneal antigen all of this insertions, the occurrence of Proline which collected and tested by elisa for specific antibodies cannoticed be insertionsrelated to in stringencin 67% of the thisstudy region. samples We and also in injection spleen cells were isolated and incubated for 3 noticed changes in the diacidic domain in samples with followed by stained with anti-mouse apc-cy7-cd4 and mutations in the protease region compared to samples days at 37oc in 5% co2 with s or pre-s1-s2/s antigens who didn’t present mutations in the protease where, apc-cd8 antibodies and analyzed on facs. the liii mice for this samples, there was an insertion of another acid Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersimmunized - Human with Virology: s antigen HV presented higher specific igg XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

108 Human Virology: HV titles at 15 (p=0,02) and 30 (p=0,03) days than the hiii. Endolimax nana. Some metabolic disorders were detected in HTLV infected patients, as increased levels lower than the response to s antigen in liii (p= 0,04 and 0,01)the antibodies in all times response but equal to pre-s1-s2/sin the hiii line. antigens initial weredata cholesterol levels were higher in women HTLV positive (p=0.02).of triglyceride As the (>150mg/dL) nervous system (p=0.047). has a Inhigh addition, percentage total response after immunization with s antigen but not with of lipids in their composition, dyslipidemia can be indicated that hiii e liii mice have differences in cd4/cd8 related to viral pathogenesis, and the higher levels of that both antigens elicited different levels of antibody cholesterol in infected women can be associated to the responsepre-s1-s2/s and antigens. also indicate these preliminarythat hiii and results liii mice showed can preponderance of HTLV infection in this group. Evidence be used as a model for studies of hepatitis b antigens for an association between metabolic disorders and response. HTLV1 infection has been suggested, but this question

HV211 - IS THE HTLV1 INFECTION RELATED TO METABOLIC DISORDERS? remainsHV216 -unclear MAMMARENAVIRUSES and need to be clarified. IN WILD RODENTS Gadelha, R.S.; Marin, J.L.; Azevedo, M.M.M.S.; (CRICETIDAE:SIGMODONTINAE) DETECTED BY Azevedo, J.N.; Carréra, A.F.K.; Júnior, J.F.; Bezerra, METAGENOMIC TOOLS D.H.; Carvalho, L.D. Sabino Santos Jr, G.; Maia, F.G.M.; Souza, W.M.; 1. UNIVERSIDADE ESTADUAL DE SANTA CRUZ Fumagalli, M.J.; Romeiro, M.F.; Jonsson, C.B.; Goodin, 2. CENTRO DE REFERÊNCIA EM PREVENÇÃO, D.G.; Murcia, P.R.; Salazar Bravo, J.; Figueiredo, L.T.M. ASSISTÊNCIA E TRATAMENTO 1. CENTRE FOR VIROLOGY RESEARCH, SCHOOL OF HTLV1 causes a persistent and highly dynamic infection MEDICINE IN RIBEIRAO PRETO, UNIVERSITY OF and it has associated with neoplasic disorders as well as SAO PAULO, BRAZIL 2. NATIONAL INSTITUTE FOR MATHEMATICAL AND BIOLOGICAL SYNTHESIS, DEPARTMENT OF why some people infected with HTLV develop diseases MICROBIOLOGY, KNOXVILLE, TENNESSEE, US anddegenerative other not. inflammatory Early biomarkers diseases. have So been far it studied. is unclear In 3. REMOTE SENSING RESEARCH LABORATORY, order to know epidemiological and clinical laboratory DEPARTMENT OF GEOGRAPHY, KANSAS STATE aspects of this infection in the Southern region, HTLV UNIVERSITY, MANHATTAN, KANSAS, US positive individuals attended at Centro de Referência 4. CENTRE FOR VIRUS RESEARCH, UNIVERSITY OF GLASGOW, GLASGOW, SCOTLAND, UK em Prevenção, Assistência e Tratamento CEPART in 5. DEPARTMENT OF BIOLOGICAL SCIENCES, TEXAS Itabuna have been monitored. The study was approved TECH UNIVERSITY, LUBBOCK, TEXAS, US by CEP (CAAE 22727114700005526). After signing the A complex mixture of predisposing factors has TCLE, it was applied a structured questionnaire. Blood created new opportunities in our modern world for and feces were collected with vacuum blood tube and the emergence of infectious diseases of animals and sterile pot, respectively, for hematogical, biochemical, humans. This is largely related to globalization and immunological and parasitological analyses and co environmental degradation, which increases contacts infections research. Blood samples were collected between animals and humans. Viruses that have their origin in animal world are the most abundant biological entities on the planet. Small mammals such as wild andfrom 116 all patientsnoninfected. (100%) Individuals while feces infected samples were onlymostly in 44.23%. It was analyzed 55 HTLV 1 infected individuals rodents are important reservoirs of viruses. During June 2008 to July 2009 we collected 560 wild sigmodontine levels. Epidemiological data suggest patterns of gender, rodents in the northeastern region of São Paulo State. incomewomen and (82.70%), education with similar low to income other regions. and education Among In a previous study, we have found mammarenaviruses antibodies in the wild rodents. Thus, we show here a viral to other serological marker (mainly total antiHBc), the infected, 17.30% presented at least one reactivity metagenomic aiming to detect and characterize viral genomes in sigmodontine from the study region. From individuals were parasitized. The main parasite was presented a higher number of basophils, and 23 (44.44%) Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersall viruses - Human (22%), Virology: 13% HV belonged to Arenaviridae family. XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

109 Human Virology: HV

We have found Latino and Oliveros mammarenaviruses 22 came from symptomatic children (presence of three in Akodon montensis, and Latino, Oliveros and Pinhal or more diarrhea episodes in 24 hours) and 110 from mammarenaviruses in Calomys tener. This is an asymptomatic ones (without diarrhea at least 72 hours ongoing study and we intend to further understand before collection). The positivity for NoV and AdV was mammarenavirus ecology, the dynamics of infections in nature in order to predict future threats to animal and The AdV circulated during the period analyzed with human health. 13.3% (18/135) and 62.8% (66/105) respectively. the monthly distribution was more restricted probably HV225 - MOLECULAR DETECTION OF NOROVIRUS duefluctuations to low numberin the frequencies of symptomatic along the cases. months, Among for NoV the AND ADENOVIRUS IN CHILDREN’S DAY CARE IN NoV positive samples sequenced, three were genotyped ANANINDEUAPA as GII.P4, GII.P7 and GII.P12. For AdV the genotypes Teixeira, D.M.; Costa, K.R.S.; Rodrigues, E.A.M.; Bandeira, R.S.; Lucena, M.S.S.; Gusmão, R.H.P.; Araújo, enteric genotypes. The results demonstrated that NoV E.C.; Silva, M.M.; Rocha, D.C.; Mascarenhas, J.D.P.; anddetected AdV are involved circulating the entericamong children 40/41 asattending well as in non day Soares, L.S.; Gabbay, Y.B.; Silva, L.D. care centers. These viruses circulated asymptomatically 1. SEÇAO DE VIROLOGIA, INSTITUTO EVANDRO and with wide genetic diversity, during the period CHAGAS, SECRETARIA DE VIGILANCIA EM SAUDE, analyzed, enlightening a relevant aspect, indicating that MINISTERIO DA SAUDE this event is frequent. These data are important because 2. PIBIC/CNPQ/INSTITUTO EVANDRO CHAGAS, SVS/ they demonstrate the molecular epidemiology of these MS viruses, which need further investigation. Acute gastroenteritis (AGE) is a worldwide impact problem in terms of health being considered a major HV228 - PAN DIAGNOSTICS OF HUMAN VIRAL cause of morbidity and mortality among children PATHOGENS THROUGH MULTIPLEX PCR AND MASSIVE PARALLEL SEQUENCING adenovirus (AdVE) are important cause of outbreaks of de Souza Luna, L.K.; Rodrigues, A.C.; Lima, C.P.; under five years. Norovirus (NoV) and enteric gastroenteritis in children’s day care, hospitals, nursing Poerner, F.; Kalb, L.C.; Krieger, M.A.; Marchini, F.K. homes, ships, hotel and restaurant settings. This study 1. INSTITUTO DE BIOLOGIA MOLECULAR DO PARANÁ aimed the detection and molecular characterization 2. INSTITUTO CARLOS CHAGAS of NoV and AdVE in children attending two public The spectrum of diseases that affect humans is children’s day care localized in Ananindeua, Para. The responsible for considerable morbidity and mortality. study involved fecal samples collected from children Most of these diseases are caused by a wide variety of less than six years old that attending two children’s viruses, in the majority causing respiratory and enteric day care. The NoV detection was realized by enzymatic infections. The development of molecular diagnostic immunoassay (EIA) and for AdVE by the polymerase methods and new generation sequencing has enabled the chain reaction (PCR). The nucleic acid was extracted by silica method. The NoV genotyping was performed by agents. Similarly, the spread of these viruses has been increasedrapid and withprecise air detection travel growth and identification along with the of theselarge the analyze of the regions A (JV13I/JV12Y and JV12Y/ agglomeration of individuals from different countries, NoroIIR) and B (Mon 431/432/433/434). For AdV, we especially in major international events. In this scenario, this work aims to develop a universal diagnostic method, 2001.used the The nested sequencing PCR with was primersperformed Hex using 1Deg/Hex the Big 2Deg Dye Kit®and Hex in ABI 3Deg/Hex Prism 4Deg3130xL as describedDNA Sequencer by Allard (Applied et al., of all known human viral pathogens, to be used as an Biosystems, USA). The sequences was aligned by the epidemiologicalor pan diagnostics, surveillance for detection tool and and last identification diagnostic Bio Edit program (v.7.1.3.0) and compared with others approach. These pan viral diagnostics is part of a major registered in GenBank and Norovirus Genotyping Tool pan diagnostic method that comprises the detection of all know human pathogens, including eukaryotes and version 1.0. During the study period (August/2014 to Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV April/2015) 135 samples were analyzed, among them XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

110 Human Virology: HV

in a single tube, and parallel massive sequencing of PCR technique, whereas in the NestedPCR the number prokaryotes. The method is based on PCR amplification, now, 12 (23.1%) showed positive results when using the present in different types of biological samples such as from patient coded as PTR001, 6 from PTR004, 5 from blood,specific respiratory sequences secretions, for each humansaliva, bronchoalveolar viral pathogen PTRof positive005, 6 from samples PTR increased008, 4 from to PTR 35 009, (67.3%), 4 from being PTR 6 032, 2 from PTR054 and 2 from PTR055. Interestingly, primers were designed for the detection of 402 viruses, some patients had AdV positivity in consecutive months comprisinglavage, cerebrospinal all known humanfluid, urine viral and pathogens, stool. So in far, addition 2034 of collection, suggesting a prolonged virus shedding to the design of synthetic genes to be used as control (e.g. PTR005), while others showed positive samples in targets in this diagnostic methodology. To initially alternate months, suggesting reinfection (e.g. PTR032). establish the methodology a subset of synthetic genes Another interesting data is that from the 35 positive and primers targeting respiratory viruses will be tested. The development of this project will allow the creation reported by the patients. The other 23 positive samples of an analytical center of high technology and biosafety camesamples, from 12 patients (34.3%) hadthat nohad gastroenteritis at least one symptomssymptom to be used in the diagnosis of human pathogens. In Brazil, there are few studies on the incidence of these HV230 - ADENOVIRUS DETECTION IN PATIENTS virusesreported in (14/40%) cases of gastroenteritis or had no data in available patients undergoing(9/25.7%). UNDERGOING KIDNEY TRANSPLANT IN BELÉM PA kidney transplant. In this research, it was demonstrated Resque, H.R.; Silva, V.P.; Brasi Costa, I.; Migone, S.R.C.; the AdV circulation in this group of patients.These data Silva, A.B.; Viana, C.A.; Teixeira, D.M.; Lima, I.C.G.; will certainly help in a better understanding of the Gabbay, Y.B. epidemiology of these viruses in gastroenteritis cases in 1. INSTITUTO EVANDRO CHAGAS a post kidney transplant scenario. 2. HOSPITAL OPHIR LOYOLA HV232 - COINFECTION BETWEEN ZIKV AND DENV Adenovirus (AdV) is nowadays considered to be one DURING DENGUE OUTBREAK IN SÃO JOSÉ DO RIO of the main causes of gastroenteritis outbreaks and PRETO, SP sporadic cases of diarrhea, leading the infected person to both ambulatory and hospital cares, presenting Terzian, A.C.B.; Zini, N.; Estofolete, C.F.; da Silva, R.A.; symptoms such as diarrhea, vomiting and fever. It Greque, G.V.; Colombo, T.E.; Rahal, P.; Nogueira, M.L. is understood that gastroenteritis is also one of the 1. SÃO JOSÉ DO RIO PRETO SCHOOL OF MEDICINE most common complications observed in individuals 2. SÃO JOSÉ DO RIO PRETO REGIONAL SCHOOL OF MEDICINE FOUNDATION undergoing kidney transplant, and its cause is often 3. INSTITUTE OF BIOSCIENCES, LETTERS, AND EXACT unknown. Therefore, this study aims to detect AdV in SCIENCES – SÃO PAULO STATE UNIVERSITY without diarrhea, hospitalized, treated and followed up stool samples from kidney recipient patients, with/ in Uganda in 1947 during the course of a yellow fever at the Ophir Loyola Hospital in BelémPA. As a cohort Zika virus (ZIKV) is a reemerging flavivirus, first isolated study, 8 patients were included and followedup each Brazil have been documented in Bahia, Rio Grande do month for a period of one year posttransplant. Fecal virus serosurvey. The first cases of ZIKV infections in samples were collected during their monthly visit to the cases were reported in the country based on clinical– hospital or when presenting a diarrheic episode. The DNA epidemiologicalNorte and São Paulo. or laboratory Until April data. 2016, We 39,993 report confirmed two cases of coinfection of ZIKV and different DENV serotypes in a DNA Mini Kit, according to manufacturer\'s instructions. city located in the northwest region of São Paulo State. In Forextraction molecular was detection performed of using AdV both the PureLink PCR and NestedViral RNA/PCR 2016 April, two patients were attended at the emergency unit of the reference hospital in São José do Rio Preto presenting acute febrile illness. Dengue was suspected secondwere performed, steps, respectively. using the pairsOf the of primers52 stool Hex1deg/ samples based on clinical–epidemiological data. Blood samples collectedHex2deg from and NeHex3deg/NeHex4degthe 8 patients included in in the the study first until and were collected one day after the onset of symptoms Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

111 Human Virology: HV

HV247 - “TYPIFICATION OF HUMAN PAPILLOMAVIRUS AND PRESENCE OF RISK COFACTORS FOR CERVICAL toand determine the patients the werediagnosis screened of DENV for DENV14, ZIKV by orNS1 CHIKV. and/ AND ANAL LESION DEVELOPMENT IN FEMALE SEX Bothor IgM patientsIgG. PCR/qPCR were positive assays to were ZIKV, applied while patient to the 1RNAs was WORKERS, DURING 20122013” also positive to DENV 1, and patient 2 to DENV 2. Both Valenzuela, A.; Picconi, M.A.; Mongelós, P.; Rodríguez were negative to CHIKV. Patient 1 was a 41years old M.I.; Medina, G.; Gimenez, G.; Castro, A.; Cardozo, male, without comorbidity, presented with complaints P.; Castro, W.; Páez, M.; Kasamatsu, E.; Gonzalez, J.; of myalgia, headache, arthralgia, chills, initiated one Basiletti, J.; Aguilar, G.; Suarez, Z.; Valdez, R. day prior to examination. No fever or bleeding was 1. DEPARTAMENTO DE SALUD PÚBLICA, INSTITUTO reported. The NS1 test was negative and the hemogram DE INVESTIGACIONES EN CIENCIAS DE LA SALUD, was normal. Patient 2 was a 36years old female, without UNIVERSIDAD NACIONAL DE ASUNCION comorbidity, presented with complaints of myalgia 2. SERVICIO DE VIRUS ONCOGÉNICO, INSTITUTO and headache, one day prior to examination, with no NACIONAL DE ENFERMEDADES INFECCIOSAS, report of fever, nausea, vomiting, abdominal pain, or “DR. MALBRÁN” ADMINISTRACIÓN NACIONAL DE LABORATORIOS E INSTITUTO DE SALUD bleeding. The blood count showed mild leukopenia. 3. HOSPITAL DE CLÍNICAS, FACULTAD DE CIENCIAS The tourniquet test was positive and dengue NS1 test MÉDICAS, UNIVERSIDAD NACIONAL DE ASUNCIÓN, was negative. An IgM antidengue ELISA was positive. PARAGUAY. Both patients were discharged after support therapy. 4. SERVICIO DE VIRUS ONCOGÉNICO, INSTITUTO São José do Rio Preto is hyperendemic for dengue and NACIONAL DE ENFERMEDADES INFECCIOSAS, is located within the yellow fever transmission region “DR. MALBRÁN” ADMINISTRACIÓN NACIONAL DE LABORATORIOS E INSTITUTO DE SALUD 5. PROGRAMA NACIONAL DE CONTROL DEL SIDA, is facing a dengue epidemic by DENV1 and 2, with few MINISTERIO DE SALUD PÚBLICA Y BIENESTAR detectionswith confirmed of DENV cases4. In of previous ZIKV, SLEV outbreaks, and CHIKV. coinfections The city SOCIAL The human papillomavirus high oncogenic risk (HR believed that coinfections occur only during outbreaks of among DENV2/3 and DENV3/SLEV were reported. It is HPV) is the major etiological agent of cervical and anal multiple serotype and where there is a high prevalence cancer. Female sex workers (FSW) constitute a risk of the urban vectors. The sexual transmission may be group to be infected with HPV. This descriptive study considered as a possible in the cases of coinfection, of transverse cut was aimed to detect HPV types and together with the natural infection through vector bite. determine the presence of cofactors of risk associated With the recent introduction of ZIKV and CHIKV in the with the development of lesions in the cervix and anus Americas and the resultant cocirculation, situations like this will become more frequent. trachomatis (CT) and Herpes simplex virus (HSV) were detectedof 144 FSW by periodPCR and 2012/2013. genital lesions HPV types,by cytology. Chlamydia The

frequency of HPV and HRHPV detected was 50% and both42.4% locations, in cervical in HPVand positive56% and women 36.1% bearing in anus. cervical 43.1% infectionand 24.3% more of women often of had anus HPV infection infection (p?0,0001). and HRHPV HPV in

abnormal cervical and anus cytology. It was also noted that16 was HR theHPV most positive common. women 1.4% had and a8.3% higher of women frequency had of infections with Chlamydia trachomatis (p = 0.004), and HSV (p = 0.002) in the cervix. These results suggest that HRHPV positive FSW should be controlled at both areas frequently to identify persistent viral infection and prevent the development of genital lesions. They also

112 Human Virology: HV suggest the need to strengthen surveillance of infections reactivation, or by a low sensitivity in the EBV research by Chlamydia trachomatis and HSV in women HRHPV positive, considering that studies have found that they observed may indicate that there is a subtle viral load are at higher risk of developing cancer precursor injuries in acellular blood samples. The low quantification and cancer. methodology. Further studies are needed taking into considerationfluctuation that the may type or may of biological not be detected sample by used,the qPCR the HV263 - DETECTION AND QUANTIFICATION OF immune suppression scheme and the increase of the EPSTEINBARR VIRUS IN PLASMA FROM PRE AND number of patients involved. POST KIDNEY TRANSPLANT PATIENTS Brasil Costa, I.; Silva, M.J.M.; Barros, I.C.; Oliveira, HV267 - HIGH RISK HUMAN PAPILLOMAVIRUS B.S.J.; Mendes, W.R.B.; Resque, H.R.; Monteiro, T.A.F.; DETECTION IN CERVICAL SAMPLES FROM WOMEN Viana, C.A.; Silva, A.B.; Migone, S.R.C. OF THE DISTRICT OF ITAUGUÁ, PARAGUAY, 2014 1. INSTITUTO EVANDRO CHAGAS 2015. PRELIMINARY RESULTS 2. HOSPITAL OPHIR LOYOLA Caballero, S.V.; Kasamatsu, E.; Rodriguez, M.I.; Soilán, A.; Ortega, M.; Mongelós, P.E.; Páez, G.M.; Cristaldo, of the world population and is effectively controlled C.; Castro, A.M.; Basiletti, J.; González, J.; Picconi, M.A.; byEpstein the immuneBarr Virus system. (EBV) latentlyHowever, infects patients more undergoing than 90% Hernández, M.; Almonte, M.; Herrero, R.; Mendoza, L. kidney transplant require immunosuppressive therapy 1. INSTITUTO DE INVESTIGACIONES EN CIENCIAS DE as a measure to prevent graft rejection. The immune LA SALUD 2. HOSPITAL DE SAN LORENZO depletion, caused by the use of such drugs, enables an 3. HOSPITAL NACIONAL DE ITAUGUA increase in the virus reactivation potential. The present 4. INSTITUTO NACIONAL DE ENFERMEDADES study aims to investigate the EBV presence and viral INFECCIOSAS load in plasma samples from patients undergoing kidney 5. INTERNATIONAL AGENCY FOR RESEARCH ON transplant at the Ophir Loyola Hospital, reference in CANCER kidney transplant in northern Brazil. An analytical and Paraguay has the seventh highest incidence of cervical longitudinal study was conducted using 132 plasma cancer in Latin America. Human papillomavirus high samples obtained from 66 kidney transplant patients, oncogenic risk (HRHPV) is a necessary factor for cervical being a sample collected immediately before transplant, cancer. In Paraguay there are not studies on HPV types and another one 30 days after surgery. For viral detection circulating in the general population. The aim of this crosssectional study was to determine HRHPV types kit (Nanogen) was used and, as endogenous control, present in cervical samples of women aged 30 to 64 and quantification a qPCR test whit EBV qPCR Alert years of the district of Itauguá, Paraguay, period 2014 evaluated, previously added in the extraction step. For 2015. In total 822 women were surveyed and then they statisticalthe amplification analysis, of it thewas humanused the beta statisticalglobin gene package was were invited to the health post where cervical samples BioEstat 5.3. Among the pretransplant samples, tested for convencional cytology and detection of HRHPV by Hybrid Capture 2 were obtained from those women who had agreed to participate. Positive samples for HRHPV for the presence of the EBV viral genome, 4.5% (3/66) were positive. Only one sample (1.5%) was positive after (PGMYCHUV validated by WHO LabNet HPV). A samplestransplant. PTR33, It was PTR38 observed and a PTR50, quantification respectively. of 106.32, Post were typified by PCR followed by reverse hybridization transplant46.88 and 32.48sample copies/ml (PTR69) of plasmashowed for extremely pretransplant low wasprevalence observed. of Furthermore 13,7% of HR 78HPV of (113/822113 samples samples), of HR difference when comparing the pre and posttransplant as and of 3,8% of abnormal cytology (31/822 samples) thequantification results (p = (0.05 0.625 copies/ml). McNemar There test). wasThe nopositivity significant for EBV in the plasma of pre and posttransplant patients was HPV positive women were typified and among these in observed75.6% of women multiple (59/78 infections. samples) The were most observed common simple viral infections and in 24.3% of women (19/78 samples) were Viruslow, whichReviews can & Research be explained Vol 20 (2), by August-December the low virus 2016infection/ - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

113 Human Virology: HV type was HPV16 followed by HPV 31. This study showed infection and as coinfections with mucosotropic HPV, a high prevalence of HRHPV, which partly explains the however more studies are needed to understand their high incidence of cancer in Paraguay. In addition, these role in anal canal. results may be useful as baseline prevaccination data for a future virological surveillance. Finally, this study HV272 - TOXICITY TEST AND ANTIVIRAL ACTIVITY suggests that HPV testing could be implementing as a OF THE CHONDRACANTHUS CHAMISSOI EXTRACT primary screening method in Paraguay. AGAINST YELLOW FEVER VIRUS Mayta, E.H.; Mamani, E.Z.; Mariano, M.A.; Sevilla , L.D.; HV268 - DIVERSITY OF HUMAN PAPILLOMAVIRUS Vásquez, K.V.; Quintana, A.B.; Sulca, J.H.; Gonzalez, IN THE ANAL CANAL OF PARAGUAYAN FEMALE SEX M.R.; Oliveira, D.B.; Durigon, E.L. WORKERS, PERIOD 20122014 1. UNIVERSITY NATIONAL MAYOR DE SAN MARCOS Riveros, J.F.; Valenzuela, A.B.; Correa, R.M.; Mongelós, 2. ICB-II-UNIVERSITY P.E.; Giménez, G.; Rodriguez, M.I.; Medina, G.; Castro, Yellow fever virus (YFV) affects annually around 200,000 A.M.; Kasamatsu, E.; Páez, G.M.; Basiletti, J.; González, people in tropical regions of South America and Africa. J.; Picconi, M.A.; Mendoza, L.P. Although an effective vaccine (17D strain) is available, 1. INSTITUTO DE INVESTIGACIONES EN CIENCIAS DE its use is not helpful as it is incomplete in many areas. LA SALUD 2. INSTITUTO NACIONAL DE ENFERMEDADES Yellow fever (YF). Seaweeds full of bioactive compounds INFECCIOSASANLIS “DR MALBRAN” whichThere couldis no specifichelp to develop antiviral antiviral therapy drugs. for a Intreatment this work of , A great diversity of human papillomavirus (HPV) we describe in vitro antiviral activity of Chondracanthus types is detected in different anatomical locations. chamissoi extracts against (YFV). The C. chamissoi HPV infections are associated with the development of were collect in Perú. The ethanolic extraction phase anogenital lesions in women. Knowledge about anal HPV gametophytic these seaweeds were used for obtaining infection among women is limited. This crosssectional sulfated carbohydrates and carrageenan were tested for study analyzed the frequency of cutaneous and mucosal antiviral properties against YFV in cells. The Seaweeds HPV infections in 107 anal canal samples of Paraguayan has antiviral properties, and the activity against YFV female sex workers and also described the characteristics needs to be tested. The toxicity test was evaluated that favor HPV infection, period 20122014. Detection by inoculating different dilution (101 to 106) of the and typing of HPV was performed by two generic PCRs combined with their respective reverse hybridization facecarbohydrate and diluted extracts in maintenance (625 mg/ml) media and the(MM). carrageenan Then the were positive for mucosotropic HPV, being HPV 16 the (10 mg/ml) which is produced in the gametophyte assay (PCRRLB). In total, 63/107 (59%) anal samples most frequently type detected. Furthermore, positive monolayer using 24well plates, and incubated at 37oC. Thedilutions morphology were inoculated of cells was in aevaluated VERO76 for cells 9 days. confluent The plates were stained. For evaluation of antiviral activity cases of cutaneous HPV were detected in 31/107 samples against YFV the carbohydrate extracts and carrageenan (29%), being HPV 9 the most frequently type observed. coinfection between mucosotropic and cutaneotropic (diluted 1:10) were mixed (1:1) with YFV (17D vaccine Furthermore, in 21/107 samples (20%) were observed HPV. Among the factors predisposing to HPV infection strain), diluted from 104 to108 for the antiviral activity. After an hour of incubation at 37oC, the mix extract virus was inoculated in 96 well plates of VERO76 cells it was observed that 54/107of women (50%) had ?12 and incubated at 37oC for 5 days. Then the plates sexual partners per week, 36/107 of women (34%) used were stained. Both extracts had not toxicity in the condoms only with some sexual partners, 54/107 (50%) were smokers. In conclusion, this study showed a high concentrations tested (carbohydrate extracts (31.25 frequencyof women of had mucosotropic anal sex, and HPV, 46/107 such (43%) as HPV of 16 women that could cause anal lesions. This data suggest the need for periodic monitoring of this population risk. Finally, the ismg/ml) necessary and to the continue carrageenan the evaluation (0.5 mg/ml)) of the andantiviral they presence of cutaneotropic HPV were detected as simple had antiviral activity against YFV (103.5 TCID50/ml). It Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

114 Human Virology: HV activity by using plate assay to know the percent of HV275 - PHYLOGENETIC CHARACTERIZATION OF A POSSIBLE NEW HIV-1 RECOMBINANT FORM Seaweed extract. CIRCULATING IN SOUTHERN BRAZIL reduction produced with a specific concentration of the Coltro, V.P.; Pinto, A.R.; Graf, T. HV273 - DETERMINATION OF CYTOLOGICAL STATUS OF CERVICAL SAMPLES FROM WOMEN INFECTED HIV-1 genome is composed by two linear copies of single WITH HIGH RISK HUMAN PAPILLOMAVIRUS stranded RNA, combined with enzymes required for Hermosilla, J.; Iwasaki, R.; Mamani, E.; Mayta, E.; replication. One of these enzymes, reverse transcriptase Hernández, V.; Arias-Stella, J. (RT) has the ability to change substrate during 1. LABORATORIO DE VIROLOGÍA CLÍNICA Y transcription, being able to generate a recombinant MOLECULAR - FACULTAD DE CIENCIAS BIOLÓGICAS genome among two or more strains. This feature 2. INSTITUTO DE PATOLOGÍA Y BIOLOGÍA contributes for the appearance of a wide variety of MOLECULAR ARIAS STELLA circulating recombinant forms (CRFs). In southern The cervical cancer is one of the types of cancer with the highest incidence (third worldwide) and mortality national scenario. In the states of Rio Grande do Sul (RS) (fourth worldwide). The cervical cancer´s development andBrazil Santa epidemic Catarina of HIV/AIDS(SC) there hasis a aprevalence distinct character of subtype of is gradual and it can be diagnosed in preinvasive on this region approximately for 40 years. Despite this, a high rate of falsenegative results. The presence toC (arounddate, only 56%) one and CRF B had (around been 22%)described that inco-circulate southern ofphases Human through Papillomavirus, the Pap test; especially however, thisthe testHigh shows Risk Human Papillomavirus or HRHPV, is strongly related therefore masking the real scenery of the circulating with precancerous cervical lesions and cancer, for that viralBrazil forms (CRF31_BC), at the reflectingregion of the Brazil. absence Previous of studies studies and reason, many studies suggest the molecular diagnosis of HRHPV as a complementary test. The aim of this work was determinate the cytological status of cervical fromhave founda BLAST in for Joinville/SC each of these a group three of sequences, three sequences other samples from women infected with HRHPV. For that, we with an uncommon phylogenetic classification. Starting tested 241 cervical samples (positives for HRHPV) with eight sequences isolated from Brazilians HIV positive the Pap test, following the liquidbased cytology method. individualsfive were retrievedcollected frombetween public 1992 databases, and 2013. totalizing The The results were expressed following The Bethesda recombinat analyses were performed on RDP3 software using the MaxChi, 3seq, Chimaera, BootScanning and of the samples didn’t show neoplastic or dysplastic cells RDP methods. Bayesian phylogenetic analyses were System for Reporting Cervical Cytology. 29.5% (n=71) performed using a relaxed molecular clock model, GTR+G4+I nucleotide substitution model and Bayesian (Negative for the test), while 70.5% of samples showed SkyLine coalescent model as implemented in BEAST Lowcellular Grade abnormalities Squamous Intraepithelialclassified in: Atypical Lesion orSquamous LSIL (n software. Recombination analyses showed that eight =Cells 126), of UndeterminedHigh Grade Squamous Significance Intraepithelial or ASCUS (n Lesion= 30), sequences exhibit the same recombinant form. This or HSIL (n = 14).The obtained results showed that a recombinant is composed by a central fragment with high rate of women infected withHRHPV didn’t show approximately 373 bp correspondent to the subtype B cellular abnormalities. Taking into account that many authors have reported that women infected with HR analyses performed for each fragment indicated HPV(either with precancerous lesions or not)show a thatflanked both by twoparental fragments are ofBrazilian. subtype C.Besides, The phylogenetic fragment high rate of malignant progression, is important to take corresponding to subtype B grouped with a sequence the molecular diagnosis of HRHPV (cotesting) in order from RS, showing the south region as the most likely to improve the screening of patients with high risk to place of emergence. Additionally, phylogenetic analysis develop cancer. showed that this recombination event occurred in Brazil

of co-circulation between subtypes B and C in southern in 1982 (95% HPD: 1979-1987), consistent with the time Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

115 Human Virology: HV

Brazil. Although the strong evidences of the occurrence of recombination presented in this study, further studies involving the full genome of these samples are necessary in order to determine such a new CRF between HIV-1 subtypes B and C. Financial support: CNPq and FAPESC.

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Human Virology: HV IMMUNOBIOLOGICALS IN VIROLOGY - IV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

117 Immunobiologicals in Virology: IV

IV63 - DEVELOPMENT AND IMMUNOGENICITY OF average size 339 nm and zeta potential of 19.9 mV and A NEW INACTIVATE VACCINE FORMULATED WITH A BRAZILIAN VARIANT OF AVIAN INFECTIOUS only with IBVCSON and previously vaccinated with BRONCHITIS VIRUS (IBV) ENCAPSULATED IN attenuatedencapsulation vaccine efficiency followed of IBV. by Thea booster chicks vaccination vaccinated CHITOSAN NANOPARTICLES with IBVCSON or IBV OIM showed complete protection to Lopes, P.D.; Okino, C.H.; Fernando, F.S.; Casagrande, challenge with the homologous strain, as demonstrated V.M.; Pavani, C.; Dalmolin, L.F.; Tamanini, M.L.F.; by the maintenance the integrity of tracheal ciliary Montassier, M.F.S.; Lopez, R.F.V.; Montassier, H.J. movement and the presence of low viral loads, while the chicks vaccinated only with IBVOIM showed partial 1. FACULDADE DE CIÊNCIAS AGRÁRIAS E protection against homologous challenge. The IBVCSON VETERINÁRIAS, UNIVERSIDADE ESTADUAL PAULISTA – CAMPUS JABOTICABAL vaccine alone or combined with live attenuated vaccine 2. EMPRESA BRASILEIRA DE PESQUISA conferred to immunized chicks an effective protection AGROPECUÁRIA against challenge with a BRvariant homologous strain. 3. FACULDADE DE CIÊNCIAS FARMACÊUTICAS, In conclusion, this type of vaccine is a new generation UNIVERSIDADE DE SÃO PAULO, CAMPUS of immunogen with a great potential to induce effective RIBEIRÃO PRETO protection at mucosal sites of chickens.

Infectious Bronchitis (IB) is an acute viral disease IV139 - STANDARDIZATION OF THE CONSTRUCTION caused by IBV. IB is distributed worldwide and in Brazil A RECOMBINANT ANTIBODY LIBRARY ANTI HCV remains as one of major infectious diseases that affects FROM PATIENTS DIFFERENT DEGREEES OF WITH poultry farms due to the emergence of Brazilian (BR) FIBROSIS Watanabe, T.; Silva, C.N.; Hebeler Barbosa, F.; Moraes, by the commercial vaccines. The objective of this study L.N.; Ferrasi, A.C.; Pardini, L.M.C.; Pardini, M.I.M.C.; wasvariant to developstrains and and insufficient evaluate the cross protectionimmunity conferred induced Grotto, R.M.T. by an inactivated vaccine formulated with a BR variant strain of IBV encapsulated in chitosan nanoparticles UNIVERSIDADE ESTADUAL PAULISTA and administered by oculonasal route (IBVCSON) in The phage display technique for generating recombinant SPF chicks. Ionic gelation technique was used for the antibodies is an alternative to hybridoma technology. formulation of nanoparticles. The size and zeta potential The phage display allows the generation of recombinant of the nanoparticles were measured (ZetaSizer) and the antibodies from mRNA obtained of the patients with HCV, protein by the Bradford technique and detection of the The standardization of the construction technique of viralencapsulation genomic RNA efficiency by RT PCR. was The assessed degree by of measuringprotection aliver library fibrosis for confirmedphage display by biopsy is necessary and naive to ensuretreatment. the induced by the vaccine was compared with other antiIBV variability of antibodies. To standardize the library were inactivated vaccine incorporated into an oil adjuvant, separated two groups of patients with chronic hepatitis administered by intramuscular route (IBVOIM). Four groups of chicks were vaccinated with different vaccine protocols, associating or not a prior immunization wholeC with blood. different The degreesreverse oftranscription fibrosis according performed Metavir with with attenuated H120 vaccine and four weeks later, the score: F1/F2 and F3/F4. The mRNA was extracted from chicks were challenged with the homologous virulent strain. Two other groups were kept as positive control random primer and specific primers (for IgG and IgM). (infected chicks) and negative control (uninfected The obtained cDNA was purified and PCRs reactions and unimmunized chicks). At 5 days postinfection, the usingwere performedPCRs involve using the specifichigh and protocol light antibody described chain by chicks were euthanized to collect tracheal samples Barbas (2001). To amplification the antibody genes antibody (heavy chain: Vh + Ch and light chain: V k + load by RTqPCR techniques. The best formulation of Ck)amplification were joined separately. by overlap Products PCR. A ofsecond each reaction chain of was the for evaluation of ciliostasis and quantification of viral an overlap PCR to join the two strands (VhCh+VkCk) nanoparticlesVirus Reviews & Researchresulted Vol in 20 88% (2), August-December encapsulation 2016efficiency, - Abstracts/Posters - Immunobiologicals in Virology: IV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

118 Immunobiologicals in Virology: IV forming a single product (Fab). The results showed that a polyclonal porcine antiPCV2 serum and viral antigen DNA contamination during RNA extraction is a problem consisted of swine testicle (ST) cell supernatant persistently infected with PCV2. To perform the LFB extracted RNA was incubated with DNAse improving for amplification antibody specific genes. Then the injected intramuscularly, with 50 µl of 5 x 104.86 DICT50 the techniques limitations were resolved using pure ofELISA, commercial ten to vaccine nineweek againstold female PCV2. An BALB/c identical mice booster were the amplification process. During amplification phase immunization was performed 21 days later. The animals of the retrotranscription product demonstrated better were challenged with PCV2 twice at 50 and 52 days after RNA, analyzed by fluorescence method. The purification the intraperitoneal route. Serum samples were collected results during amplification phase. Other differential atthe 36, first 64 vaccine and 84 dose, days with after 100 immunization µl of 5 x 105.19 and TCID50 used byin productsprocedure using was freeze the usesqueeze of the with higher an in specificityhouse protocol and LFBELISA test. The microplate was coated with trapping sensibility PCR enzymes. The purification of the PCR antibody, after incubation, the reaction microplate was performed in original protocols showed concentration blocked. Liquid phase (antigen and serum test) was andimproved pattern all ofamplifications bands consistent reactions. with Thethe modificationsexpected size transferred to the reaction microplate, and detector of the fragment. The product obtained was subjected to antibody, peroxidaseconjugated rabbit antiswine IgG, library. The standardization of the construction of antibodiescloning and libraries sequencing enables for confirmation a good assay ofreproducibility the antibody reactionand H2O2/TMB was stopped were (2M added. HCl) and The the plate results was reported washed without lost the variability of antibodies, allowing the asafter percentage each step, inhibition except for (PI). the H2O2/TMBA commercial solution. ELISA The kit creation of a library with great potential for application was used for comparison with the LFBELISA, and it was in the detection and monitoring of the development performed according to the manufacturer’s instructions, potential therapeutic. detect a high amount of antiPCV2 antibodies in the of fibrosis and the discovery of new antibodies with analysedbut with samples some modifications. presenting good Both correlation, tests were showing able to IV180 - DEVELOPMENT OF A LIQUID PHASE BLOCKING seroconversion after the challenge with PCV2. Thus, ELISA (ENZYMELINKED IMMUNOSORBENT ASSAY) LFBELISA was a method simple to perform, rapid, FOR PORCINE CIRCOVIRUS TYPE 2 ANTIBODY DETECTION against PCV2 in studies of experimental infection, and in Araujo Jr., J.P.; Cruz, T.F.; Vaz, M.R.; Portela, L.M.F. thespecific development and convenient of vaccines for theagainst detection PCV2 inof mice antibodies due to UNIVERSIDADE ESTADUAL PAULISTA PCV2 (Porcine circovirus type 2) is causative agent of highIV181 analytical - EVALUATION specificity. OF SEROCONVERSION several syndromes named porcine circovirusassociated INDUCED BY LIVE VACCINE OF NEWCASTLE DISEASE SUBMITTED OF BRAZILIAN OFFICIAL QUALITY for serological monitoring in swine herds, in association CONTROL DURING MARCH/2015 TO MAY/2016 withdisease protection (PCVAD). Antibodyagainst PCV2, quantification and in is serological important Orsi, M.A.; Benites, C.I.; Silva, L.A.; Rodrigues, R.L.; surveys, in the assessing the effectiveness of vaccines in Lima, T.S.; Leal, F.S.; Pereira, G.A,F.; Reischak, D. development. The aim of this work was to standardize a liquid phase blocking ELISA (LFBELISA) for PCV2 LABORATÓRIO NACIONAL AGROPECUÁRIO Newcastle disease virus (NDV, Paramyxoviridae family, used in research of experimental infection or vaccine Avulavirus genus) is the agent that causes one of the development.antibodies quantification The optimal in concentration mice sera, which of anti mayPCV2 be most important diseases in birds and represents a threat to industrial aviculture, leading to sanitary barriers. mL. The optimum dilution of test serum (1:25), detector Prophylaxis of many avian diseases is based primarily on antibodyrabbit IgG (1:800) used as andtrapping antigen antibody (1:2) werewas defined established as 5 µg/ by active immunization through live vaccines. Serological chessboard titration. It was used as detector antibody tests may be used to verify the vaccination effectiveness

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Immunobiologicals in Virology: IV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

119 Immunobiologicals in Virology: IV

IV182 - VALIDATION OF THE SEROCONVERSION quality control processes. This test allows to estimate METHOD FOR DETECTION OF ANTIBODIES INDUCED in field animals and indirectly as vaccine efficacy a in a BY A NEWCASTLE DISEASE VACCINES commercial avian vaccines in Brazil are submitted to Orsi, M.A.; Fortunato, E.C.; Ashimine, R.; Catharino, the quantity of antibodies to a specific viral antigen. The A.M.R.; Nascimento, M.L.J.; Zaroni, M.M.H.; Benites, is one of the main assays, which checks the production C.I.; Lima, T.S.; Leal, F.S.; Reischak, D. official quality control. In this control, seroconversion LABORATÓRIO NACIONAL AGROPECUÁRIO study aimed the evaluation of the seroconversion resultsof specific obtained virus by antibodies monovalent after and immunization. combined vaccine This The method of seroconversion (serology) are commonly used in Avian vaccine quality control to evaluate live months. For each seroconversion, two vaccine bottles vaccine, such as Newcastle disease (ND), which is weresubmitted diluted to in thePBS and official 10 birds quality were control inoculated during in BSL 15 caused by a virus from the family Paramyxoviridae, 3 isolator (age and method according to manufacturer). genus Avulavirus. This method is used to evaluate After 21 days, the animals were anesthetized and the production of specific antibodies against the NDV. Free birds (SPF) unvaccinated were used as negative Currently, validation and verification of analytical control.blood collected The sera by werecardiac analyzed puncture. for Specific the detection Pathogen of from the Brazilian Government as a mean to increase methods are usually required by official laboratories antiNDV antibodies by indirect ELISA (commercial the quality of these tests, besides being criteria kit). 27 batches of monovalent vaccines were tested (6 checked in international and national auditing. In this companies strains: B1, LaSota, VGGA, C2, PHYLMV42, way, the objective of this work was the validation of the seroconversion using the ELISA test to detection companies strains: Clone 30, B1, LaSota and VH). The of antibodies against Newcastle disease virus after monovalentVH and CL/79) vaccines and 7 showed batches ELISA of combined values ranging vaccines from (4 immunization with vaccines used in Brazil. The following parameters were evaluated in the data obtained by ELISA: (3,579 to 7,017). 5 batches resulted negative ELISA test: 4614 PHY toLMV42 7,017, strains the CL/79 and 1 strain C2 strain. showed In these higher samples values accuracy and Kappa index. Three groups of birds were testedrepeatability, in three analytical independent sensitivity, rounds, analytical using the specificity, SPF birds results from 1:20 to 1:456, being considered approved with one dayold which were vaccinated in the eye using forHI/NDV this technique, was performed which with is considered LaSota antigen as Gold presenting Standard. antigens of NDVLANAGRO SP (origin by National Service The NDV fractions of combined vaccines showed ELISA Veterinary Laboratory, NSVL). The birds were kept in results ranging from 1,606 to 3,275 therefore approved. BSL3, the seroconversion was detected in 21 days p.i. The The results of monovalent vaccine for PHYLMV42 and C2 indirect ELISA (ELISAi) method using the commercial kit strains indicate that it should preferably be submitted to of NDV was used for the detection of antiNDV antibodies. the HI test. As ELISA is used for screening in vaccinated In ELISA test, there were differences between positive birds, further studies should be conducted to immune and negative sera for NDV. In addition, when was compared the results of 27 sera from vaccinated birds that all 34 lots tested had minimum values required by Brazilianresponse law. of these specific strains. It is emphasized and 25 sera from unvaccinated birds, by ELISAi IgG/ IgM sera it was showed the accuracy (98%), sensitivity (96%), specificity (100%), repeatability (96,3%). This Thisstrong means coincidence that the was vaccinated measured birds by Kappa showed index positive (96%) resultswith the in proportion the ELISA of test. false Our positive+ results false indicate negative that (4%). this method were very effective to measure the production of protective antibodies in vaccinate birds for NDV, via a single inoculation.

120 Immunobiologicals in Virology: IV

IV242 - SEARCHING FOR A MURINE MODEL OF positive for RTPCR only in the brain, and among them, INFECTION BY OROPOUCHE VIRUS TO EVALUATE THE IMMUNE PROTECTION CONFERRED BY ITS Al(OH) stimulated humoral and cellular responses NUCLEOCAPSID PROTEIN withone also high positive levels ofin theIgG1 liver. and Vaccination IG2a. However, with whenNrOROV/ the Zapana, P.R.R.M.; Lauretti, F.; Barbosa, N. da S.; de mice model was intracerebrally challenged, it did not Oliveira, A.S.; de Souza, W.M.; Fumagali, M.J.; Badra, show a protective immunity despite the development S.J.; Figueiredo, L.T.M. of neutralizing antibodies. Lymphocyte proliferation assays and cytokine levels will be measured in the sera UNIVERSIDADE DE SAO PAULO of vaccinated animals to evaluate the ce. The Oropouche virus (OROV) is an arbovirus, which infection usually occurs in the Amazon region causing acute febrile disease outbreaks that occasionally may be associated with meningoencephalitis. It is assumed that it has infected at least 500,000 people in Brazil, making it the second arbovirus in the number of cases, just behind dengue virus. Thus, despite the importance of OROV, there is no vaccine available against it. Therefore, this project proposes the usage of the recombinant nucleocapsid protein of OROV (NrOROV) as immunogen to induce humoral immune response, which may protects mice against infection. The presence of antibodies to NrOROV in the experimental model was evaluated by and Western blot. Moreover, the organs of the animals wereELISA, assessed neutralization by RT PCR (PRNT), to amplify immunofluorescence, the S segment of OROV. In this study, we used the animal model of Swiss mice of 6 weeks old and these were inoculated intracerebrally with 50LD50 of OROV, all of these daysdeveloped of life encephalitisand challenged (100% with mortality).OROV 14 days The after animals the lastwere immunization. immunized with Blood NrOROV/Al(OH) samples were atcollected 21, 28, andbefore 35 and after the challenge, and the organs were collected after it. High titers of IgG antibodies in the animals were a humoral immunity mediated by Th2 and also the observed, being them IgG1 NrOROVspecific, suggesting by Th1. Post vaccinated sera (PVS) were evaluated for the presence ofof IgG2aantibodies NrOROV capablespecific, of anrecognizing immune mediated infected intensityHeLa cells in bymost immunofluorescence. of the cells membrane, After indicating 24 hours the of infection with OROV, it was observed high fluorescence

NrOROVpresence and NrOROV infected on lysed it. The HeLa specificity cells. The of neutralizing the PVS to capacityOROV was was confirmed determined by by western PRNT50, blot showing using purified a 1:20 titer. All vaccinated animals after the challenge were Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Immunobiologicals in Virology: IV PLANT AND INVERTEBRATE VIROLOGY - PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

122 Plant and Invertebrate Virology: PIV

PIV16 - CHARACTERIZATION OF TWO GENOMOVIRUS a potential stemloop sequence. Infectivity tests are being ASSOCIATED WITH NONCULTIVATED PLANTS IN performed in E. heterophylla, M. charantia and Nicotiana BRAZIL benthamiana plants. de Rezende, R.R.; Mar, T.B.; Paes, L.M.; Xavier, C.A.D.; PIV18 - VIRAL DETECTION OF TREE SPECIES FROM A Castilho, J.N.; Zerbini, F.M.; Zerbini, P.A. NURSERY IN THE FEDERAL DISTRICT 1. UNIVERSIDADE FEDERAL DE VIÇOSA Batista, J.G.; Batista, J.G.; Santos, F.M.B.; Lima, M.F.; 2. UNIVERSIDAD DE MÁLAGACONSEJO Pereira Carvalho, R.C. SUPERIOR DE INVESTIGACIONES CIENTÍFICAS 1. EMBRAPA HORTALIÇAS 2. UNIVERSIDADE DE BRASILIA In recent years, new groups of circular replication associated protein encoding singlestranded (CRESS) DNA Tree species are of great economic, social and viruses have been described infecting animals (including environmental importance. However, these kinds of humans), plants and fungi. One of these groups are the plants can also be affected by several pathogens, including gemycircularviruses, which have been detected in insects, viruses, in which information is scarce and incipient. in the faecal matter of various animals, and in fungi This work was conducted to prospect viruses in plants infected cassava leaves. It has not yet been unequivocally of eight botanical species by serological and biological demonstrated that gemycircularviruses can infect tests. Samples were collected from symptomatic and plants, as the virus isolated from cassava is more related asymptomatic plants. Firstly, samples were mechanically to mycoviruses and infectivity tests were not carried out. inoculated onto eight indicator species. Symptoms were Here, we describe gemycircularviruses associated with evaluated at 7, 14, 21, 28, 35 and 60 days after inoculation two noncultivated hosts which are important invasive (dai). Moreover, serologic evaluation was performed in the 28thdai, using polyclonal antibodies for detection (two samples showing yellow mosaic, leaf curling, of Cucumovirus (Cucumber mosaic virus CMV), andspecies stunting in field collected crops in in Brazil: Rio Grande Euphorbia do Sul heterophylla state) and Momordica charantia (samples collected in Minas Gerais PapayaPotyvirus ringspot (Potato virus virus strain Y – PVY; watermelon Watermelon – PRSV mosaicW virus – WMV; Pepper yellow mosaic virus – PepYMV; RCA, cloned and sequenced. Samples of E. heterophylla and Zucchini yellow mosaic virus – ZYMV). According werestate). also Viral infected genomes by (aprox. Euphorbia 2,100 nt)yellow were mosaic amplified virus, by to serological test results, seven out of eight botanical but begomoviruses were not detected in M. charantia. species curupita (Couroupita guianensis), copaibeira A Bayesianinferred tree based on fulllength sequences (Guibourtia hymenifolia), eucalypt (Eucalyptus spp.), ipê clustered Euphorbia heterophylla associated circular rosa (Handroanthus impetiginosus), ipê verde (Cybistax virus (EHasCV) and Momordia charantiaassociated antisyphilitica), jatobá da mata (Hymenaea courbaril) circular virus (MCasCV) in a well supported clade with and pau santo (Kielmeyera coriacea) were negative for Sclerotinia sclerotiorum hypovirulence (SsHADV), all the antibodies tested. Only pau Brazil (Caesalpinia Hypericum japonicum (HJasCV), Cassava (CasCV) and echinata) was positive for CMV, WMV, ZYMV, PepYMV and, PVY, while no reaction was observed against EHasCV more closely related to DfaCV and MCasCV to PRSVW antibodies. On the other hand, in the host range HJasCV.Dragonfly Comparing (DfaCV) the associated genome organization circular viruses, of EHasCV with assay, mosaic symptoms were observed on Gomphrena globosa and Nicotiana tabacum cv. TNN, when rub inoculated with sap from ipê verde, jatobá da mata and twowith domains that of SsHADV of a putative we identified replication a putativeassociated coat protein eucalypt. In the serology assayof indicator plants, it was probably(298 amino expressed acids, 37% from identity spliced with transcripts the SsHADV (126 CP),aa, observed that G. globosa inoculated with sap of ipê verde were positive for ZYMV and WMV. When it was used pau Brazilas inoculum, it was possible to detect PepYMV and63% the identity nanonucleotide with the helicase TAATATTAT domain, (the and genome 205 aa,of and WMV in TNN, while G. globosa reacted positively to MCasCV64% identity contains with a TAATGTTAT the catalytic nonanucleotide) domain SsHADV within Rep), ZYMV. These results demonstrate the potential of tree

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

123 Plant and Invertebrate Virology: PIV species to serve as reservoirs of viruses belonging to to the ToYSV population, and the DNAB being more Potyvirus genus. permissible to variation than the DNAA for both viruses. Phylogenetic analysis and population subdivision tests PIV23 - GENETIC STRUCTURE AND VARIABILITY indicated geographical structuring. A higher number OF SIDA MICRANTHA MOSAIC VIRUS (SIMMV) of recombination events were detected in both SiMMV AND TOMATO YELLOW SPOT VIRUS (TOYSV) components compared with ToYSV, and for both viruses POPULATIONS INFECTING NONCULTIVATED HOSTS the DNAB was most prone to recombination than the Ferro, C.G.; Xavier, C.A.D.; Silva, J.P.; Pereira, H.M.B.; DNAA. Although recombination partly explains the Godinho, M.T.; Lima, A.T.M.; Lau, D.; Zerbini, F.M. high genetic variability found for these two viruses, 1. UNIVERSIDADE FEDERAL DE UBERLÂNDIA mutational dynamics was the primary factor in the 2. EMBRAPA TRIGO 3. UNIVERSIDADE FEDERAL DE VIÇOSA diversificationPIV24 - REVEALING of both viral populations. THE COMPOSITION OF Begomoviruses are responsible for serious diseases in BEGOMOVIRUS POPULATIONS IN CULTIVATED AND several crops of great economic importance, especially NONCULTIVATED HOSTS WITH NEXTGENERATION in tropical and subtropical regions. Noncultivated plants SEQUENCING act as begomovirus reservoirs, enabling the occurrence of mixed infections where recombination can occur. A Ferro, C.G.; Godinho, M.T.; Xavier, C.A.D.; Pinto, V.B.; high species diversity of begomoviruses in noncultivated Silva, J.P.; Silva, J.C.F.; Zerbini, F.M. plants, especially in Macroptilium and Sida spp., has been UNIVERSIDADE FEDERAL DE VIÇOSA observed in studies conducted in several countries in the Americas. Many of the viral species found in these hosts DNA plant viruses) are among the most damaging also infect cultivated plants, reinforcing the importance pathogensBegomoviruses causing (whitefly epidemicstransmitted, in economically single importantstranded of characterizing begomovirus populations infecting crops worldwide. Tomatoinfecting begomoviruses these noncultivated hosts. Understanding the dynamics emerged in Brazil in the mid1990\’s following the and genetic variability of viral populations is important introduction of Bemisia tabaci Middle EastAsia Minor to assist on the prediction and consequent prevention 1 (MEAM1, previously known as biotype B). Several of new virus diseases in cultivated plants. In this work, lines of evidence indicate that these viruses evolved fulllength begomovirus DNAA and DNAB components of from indigenous viruses infecting noncultivated hosts. Sida micrantha mosaic virus (SiMMV) and Tomato yellow However, tomatoinfecting viruses are only rarely found spot virus (ToYSV) were sequenced from samples of the in noncultivated hosts, and viceversa. It is possible that noncultivated hosts Sida spp. (Malvaceae) and Leonurus viral populations in a given host are composed primarily sibiricus (Lamiaceae), respectively, collected in the of viruses which are better adapted to this host, but states of Rio Grande do Sul, Paraná and Mato Grosso do also include a very small proportion of viruses which Sul between 2009 and 2011. Total DNA was extracted are poorly adapted. Then, after transfer to a different from pressdried samples and fulllength genomes were population changes rapidly, with the viruses which are genomes were excised with restriction enzymes, ligated betterhost by adapted the whitefly to the vector, new hostthe composition predominating. of the To viral test intoenriched plasmid by vectors rolling and circle completely amplification. sequenced. Unit Pairwise length this hypothesis, we collected tomato and Sida sp. plants sequence comparisons were performed with SDT v.1.2 using the MUSCLE alignment option. Phylogenetic trees locations (Coimbra and Florestal, both in Minas Gerais were constructed using Bayesian inference performed growing next to each other, as well as whiteflies, at two with MrBayes v. 3.0b4. Recombination analysis was performed with RDP v.4.5.1 using default settings. We fromstate, one Brazil). tomato Viral and infection one Sida was sp. confirmed sample from by rolling each found a high genetic variability for both begomovirus circle amplification and digestion with MspI. Total DNA populations, with the SiMMV population showing greater was sequenced in the Illumina HiSeq 2000 platform. genetic variability for both DNA components compared Followinglocation, and a highly from pools stringent of whiteflies set of criteria, from each reads location, were

124 Plant and Invertebrate Virology: PIV mapped to a data set including all DNAA and DNAB of for G. globosa. To detect ToCV in natural conditions, New World begomoviruses. For each read, the three 120 symptomatic or asymptomatic weed samples were with reads mapping to (i) Tomato severe rugose virus The following species were found naturally infected (ToSRV),best hits (ii)were Sida recorded micrantha and mosaicthree files virus were (SiMMV) prepared, and bycollected ToCV: closeAmaranthus to tomato hybridus, fields, andN. physaloides tested by RTandPCR. S. (iii) any other begomovirus. The results indicate that of the ornamental plant C. coronarium to ToCV. It was shownamericanum. that Thisweeds is therepresent first report potential of the susceptibility sources of >98% of the reads from Sida sp. mapped to SiMMV, but ToCV virus to tomato crops, particularly the species A. mapping0.01% of theto SiMMV.reads mapped These resultsto ToSRV. are Conversely, consistent >99% with hybridus, S. americanum, N. physaloides and P. angulata, theof the hypothesis reads from that tomato the composition mapped to ToSRV,of viral with populations 0.001% shifts after transfer to a different host. ToCV disease management strategy should include the plants frequently found in tomato fields. Therefore, a PIV36 - IDENTIFICATION OF SUSCEPTIBLE HOSTS TO TOMATO CHLOROSIS VIRUS INFECTION IN BRAZIL controlPIV45 of - FIRSTinfected REPORT weeds close OF to AN tomato AMALGAVIRUS fields. IN Souza, T.A.; Inoue Nagata, A.K. BRAZIL 1. UNIVERSIDADE DE BRASÍLIA Martins, T.P.; Nakasu, E.Y.T.; Fernandes, F.R.; Inoue 2. EMBRAPA HORTALIÇAS Nagata, A.K. The tomato (Solanum lycopersicum) is one of the 1. UNIVERSIDADE DE BRASILIA most important vegetables grown in Brazil due to the 2. EMBRAPA HORTALIÇAS extensive cultivated area and the great socioeconomic 3. EMBRAPA QUARENTENA VEGETAL importance. However, the tomato crop cultivation is Tomato fruits are famous for their antioxidant and severely hampered by the attack of a wide range of insect anticancer compounds, being extensively used in salads, pests and diseases, including those of viral etiology. sauces and sophisticated dishes. Brazil is the eighth Recently, a crinivirus has emerged as one of the most largest producer, with approximately four million tons frequent virus occurring in tomatoes. Tomato chlorosis produced in 2013. However, this crop is the target virus (ToCV) is the only crinivirus reported in Brazil. It of several pathogens that can limit its production. was reported in 2008 in the state of São Paulo (Brazil), Viruses cause some of the most important diseases and soon became widely spread in the major producing in tomatoes, due to their high incidence, prevalence, states of the country. Little is known about its biological characteristics involving aspects of the host range. using a nextgeneration sequencingbased analysis in Thus, this study aimed to identify cultivated and non tomatoand difficulty samples to control.collected A invirus two survey regions, was Campinas performedSP cultivated plants that are susceptible to ToCV infection in (libraries Ahol, Toca1, Toca2) and BrazlândiaDF (library experimental and natural conditions. A total of 50 plant species was evaluated by inoculations performed with was extracted using RNeasy® kit (Qiagen) according toBraz). manufacturer\’s Viral particles recommendations. were semipurified Samples and total were RNA B (MEAM1) that had acquired ToCV (isolate ToCVBR) sequenced on an Illumina platform HiSeq2000, at 50 viruliferous adult whiteflies Bemisia tabaci biotype Macrogen Company (Seoul, South Korea). Obtained sequences were trimmed with Trimmomatic 0.35 and backin infected inoculated tomato to plants.tomato Toplants. confirm Out infection,of the 50 plantsplant contigs were assembled using the Velvet algorithm specieswere tested tested, by nineRTPCR were using susceptible ToCV specific to ToCV primers, infection, and (word size 29 Kmer). The generated contigs were Gomphrena globosa, Chrysanthemum coronarium, transferred to the Geneious software 9.0.5 (Biomatters) Datura stramonium, Nicotiana benthamiana, N. tabacum and submitted to BLAST analysis. Sequences sharing cv. TNN, Nicandra physaloides, Physalis angulata, P. high identity with an amalgavirus were detected in all pubescens and Solanum americanum. Back infection to four libraries. Two contigs of 1.120 nt and 441 nt from tomato plants was successful in all plant species, except

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/PostersBrazlândia - Plant and and Invertebrate Campinas, Virology: respectively, PIV shared 100% XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

125 Plant and Invertebrate Virology: PIV identity with an amalgavirus sequence (accession using the software Geneious 9.0. From all plants tested, targeting the partial overlapping region between coat producing 39 sequenced clones. The phylogenetic proteinNC_011591, and RNA E value=0.0). polymerase A genes pair was of specificsynthesized primers and analysesthe JGMV CPdemonstrated gene fragment that of 924pbBrazilian’s was amplified,isolates used for RTPCR detection tests in the original samples, in comprise a monophyletic group in wich we observed that viral clones derived from the same plant were often dispersed in the phylogenetic tree, suggesting that virus Thisnew randomlyamalgavirus field wascollected detected samples in the fromoriginal Brazlândia samples, coinfections with distinct JGMV genotypes are common. Ahol,DF, and Toca1, in tomato Toca2 seedlings and Braz, germinated and the resulting on filter 440 paper. bp These results suggest that JGMV is indeed an important pathogen of forage crops, the variation at the sequence amalgaviruses isolated in the United States, Bangladesh, of the CP protein could be responsible for the previously amplicons shared ca. 95% nucleotide identity with described host range variation, cross protection, and samples collected in BrazlândiaDF (total=54) and in virulence among JGMV isolates. In addition to the CP China and Mexico. The virus was detected in 98% of the currently being performed to be used as an additional suggestingseedlings of seed three transmission out of the five ability. commercial These varietiesresults comparativegene, the amplification tool to determine and sequencing the diversity of the CIof geneJGMV are in stronglyevaluated, suggest with an the incidence presence rangingof an amalgavirus from four in to Brazil, 36%, Brazil.

PIV55 - EVALUATION OF DAMAGE CAUSED BY toand the the Ministry final cloning of Agriculture. and sequencing tests are currently TOMATO CHLOROSIS VIRUS (TOCV) AND TOMATO being carried out before officially notifying its presence SEVERE RUGOSE VIRUS (TORSV) IN SIMPLE AND PIV53 - MOLECULAR DETECTION OF JOHNSONGRASS MIXED INFECTION IN SWEET PEPPER MOSAIC VIRUS IN FORAGE CROPS IN BRAZIL Moura, M.F.; Vallado, N.A.; Ruschel, R.G.; Guimarães, Schuch, H.C.; Silva, K.N.; Melo, F.L.; Silva, M.S.; L.R.P.; Pavan, M.A.; Krause Sakate, R. Fernandes, C.D.; de Souza, J.M.; Orílio, A.F.; Resende, UNIVERSIDADE ESTADUAL PAULISTA “JÚLIO R.O. DE MESQUITA FILHO” FACULDADE DE CIÊNCIAS 1. EMBRAPA AGRONÔMICAS 2. UNIVERSIDADE DE BRASILIA Sweet pepper is cultivated in all regions of Brazil but the Considering that pasture grasses are the basis of cattle Southeast and Midwest States are the largest producers. feeding in Brazil, the study of its phytopathogenic agents Tomato severe rugose virus (ToSRVGenus Begomovirus) is crucial for the development of resistant and more and Tomato chlorosis virus (ToCVGenus Crinivirus) are of productive grasses cultivars. Plants showing virus great agricultural importance and can be found infecting like symptoms have been frequently found in forage this culture. To assess the damage caused by these species as Brachiaria sp. and Panicum sp., representing pathogens in sweet pepper, cultivars MagaliR and RubiaR a potential risk for its cultivation. Since there is a lack of were inoculated with these viruses by the vector Bemisia information about the occurrence and damages caused tabaci MEAM1cryptic species (biotype B), in single and by viral infections in forage plants, our aims here were mixed infections. Adults of B. tabaci were maintained to detect and characterize Johnsongrass mosaic virus during 24 hours in cages containing sweet pepper plants (JGMV) in Panicum and Brachiaria plants collected infected by ToCV, ToSRV and ToCV+ToSRV to acquire the at the forage germplasm bank of EMBRAPA National plants placed in cages during 1 week for the inoculation designed from the sequences previously obtained by viruses. Fifty whiteflies were then transferred to healthy nextCentergeneration for Beef sequencing Cattle Research. and used Specific to amplify primers the were coat protein (CP) and cylindrical inclusion (CI) genes. The inaccess sweet period. pepper, As the Nested inoculatedRT PCR (Primersplants were pairs used HS11/ as HS12 and ToC 5/ToC6) is not efficient to detect ToCV vector (Promega), sequenced by Sanger and analyzed to healthy tomato cv.“Mariana”, well know as susceptible amplified PCR products were cloned in pGEM®T Easy inoculum source for the virus transmission by whiteflies Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

126 Plant and Invertebrate Virology: PIV to ToSRV and ToCV, to comprove that the primary Arsenophonus, Hamiltonella and Rickettsia were inoculation of the sweet pepper plants was succeeded. Total RNA and DNA was extracted from tomato and a analysis for MED from São Paulo and Paraná in 2015, differingdetected byfrom PCR MED and detected confirmed in byRio sequencing Grande do and Sul FISH that PCR, as previously described, were performed to detect harbored Hamiltonella and Cardinium, and from the ToSRVPCR (Primers and ToCV, pair respectively.PAL1v1978/PAR1c496) The number, and weight a Nested and MED collected in 2016, whose sets were composed by diameter of the fruits and plant height were analyzed with Arsenophonus, Hamiltonella, Rickettsia and Wolbachia. ASSISTAT software using ScottKnott test, and P = 0.05 A pure colony of MED was reared and transmission tests with Tomato severe rugose virus and Tomato chlorosis The fruits diameter and plant height were not directly virus were performed and demonstrated that MED is of significance limit was used for the statistical analysis. concern for Brazilian agriculture. theinfluenced number by and ToCV weight and ToSRVof the infections,fruits, respectively. however, Thethe an efficient vector of these viruses, representing a new resultsinfected demonstrate plants showed that a althoughreduction the of 25symptoms % and 14% can bein PIV57 - VIRUS TRANSMISSION BY BRAZILIAN NATIVE tenuous in sweet pepper fruits, the infected plants had a AND INVASIVE SPECIES OF BEMISIA TABACI reduction in the productivity. Krause-Sakate, R.; de Marchi, B.R.; Bello, V.H.; Watanabe, L.M.; Moraes, L.A.; Marubayashi, J.M.; PIV56 - POPULATIONAL DYNAMICS OF BEMISIA Yuki, V.A.; Pavan, M.A. TABACI MEDITERRANEAN SPECIES (BIOTYPE Q) IN 1. FACULDADE DE CIENCIAS AGRONOMICAS BRAZIL AND VIRUS TRANSMISSION BOTUCATU, UNIVERSIDADE ESTADUAL Cruciol, G.C.D.; Moraes, L.A.; Marubayashi, J.M.; Yuki, PAULISTA V.A.; Bello, V.H.; Takada, H.M.; Krause Sakate, R.; 2. HORTEC TECNOLOGIA DE SEMENTES Pavan, M.A. 3. INSTITUTO AGRONOMICO DE CAMPINAS 1. FACULDADE DE CIENCIAS AGRONOMICAS 2. INSTITUTO AGRONOMICO DE CAMPINAS occurred in the 1990s by ornamentals plants in São Paulo 3. APTA VALE DO PARAIBA stateIn Brazil, when the Middle first major East–Asia invasion Minor event 1 speciesof Bemisia (MEAM1, tabaci Bemisia tabaci (Hemiptera: Aleyrodidae) is a highly polyphagous insect and considered a supervector later, the presence of the Mediterranean invasive species of viruses that alone transmits over 300 species, (MED,biotype biotype B) was Q) first was detected. reported More in Rio than Grande two decadesdo Sul, representing 5 genera, including DNA and RNA viruses suggesting that these insects were introduced probably of several shapes. More than three decades after the from Uruguai. More recently MED was also detected in B. tabaci Middle EastAsia Minor 1 species (MEAM1, São Paulo and Paraná States associated to ornamental biotype B) invasion in Brazil, the presence of the B. plants, indicating different invasions. Besides invasive tabaci Mediterranean species (MED, biotype Q) was species, there are also two indigenous species, New World 1 (NW1) and New World 2 (NW2), formerly known as biotype A, which have not been completely Paulofirst reported State revealed in Rio thatGrande MED do species Sul, and was recently present in only São displaced by MEAM1. The ability of the native species inPaulo commercial and Paraná ornamentals States. In 2015, greenhouses a first survey and notin São in NW2 and the recently introduced MED species to transmit viruses was investigated. Our work provided prevailed ever since. In 2016, however, a second and evidence that the native NW2 species is an especially moreopen fieldextensive neither survey in vegetable performed cultures, in Sãowhere Paulo MEAM1 and good vector of Bean golden mosaic virus (BGMV) and Paraná showed that MED has spread through several Euphorbia yellow mosaic virus (EuYMV) but can also important vegetable cultures, like tomato, cucumber transmit the carlavirus Cowpea mild mottle virus (CpMMV) that infects beans and soyabeans, as well as the located near where MED was detected in ornamental crinivirus Tomato chlorosis virus and the begomovirus plants.and sweet The pepper, endosymbiont either in greenhousessets are different and open as fieldswell. Tomato severe rugose virus (ToSRV). Begomoviruses

127 Plant and Invertebrate Virology: PIV associated to weeds were also detected directly from transferred to Agrobacterium tumefaciens GV3101. Leaf discs of N. benthamiana were inoculated and NW2 might be important to maintain dispersion of cultured under kanamycin selection. Six plants tested begomovirusNW2 specimens that collected infect weeds in the in field, Brazil. indicating Concerning that positive for the transgene by PCR. T1 seeds of one of MED species, a pure colony was reared on cotton plants. the transformation events (3.2) were germinated in This population contains Hamiltonella and Richettsia plantlets with welldeveloped roots were transferred to soil.MS mediumFourteen containing transgenic kanamycinplants were (100 inoculated mg/ml) with and as secondary endosymbionts, with a frequency of 14% ToCMoV by biolistics, using as control, seven wild type plantsand 29%, and respectively.CpMMV+BGMV These to beans. specimens Other were tests able are toin (WT) N. benthamiana plants. Preliminary results showed progressefficiently and transmit will help ToCV to better and clarify ToSRV+ToCV the importance to tomato of that N. benthamiana plants overexpressing Ring E3 gene the recently introduced MED in Brazil. were smaller and showed stronger ToCMoV symptoms than WT plants. Assays to determine virus presence PIV66 - UBIQUITIN-RELATED RING E3 OVEREXPRESSION ON NICOTIANA BENTHAMIANA: EFFECT ON TOMATO CHLOROTIC MOTTLE VIRUS INFECTIVITY helpand quantification,to elucidate how as Ringwell E3as theoverexpression Ring E3 expression interferes in Lacerda, A.L.M.; Fontenele, R.S.; Lacorte, C.; Brasileiro, withthe transgenic viral accumulation plants, are and underway. its involvement These findings in ToCMoV will A.C.M.; Boiteux, L.S.; Ribeiro, S.G. susceptibility and resistance mechanisms in plants. 1. EMBRAPA RECURSOS GENÉTICOS E BIOTECNOLOGIA PIV67 - GENE SILENCING IN WHITEFLY (BEMISIA 2. EMBRAPA HORTALIÇAS TABACI) BY ORAL ROUTE USING VIRUSINDUCED GENE SILENCING (VIGS) Ubiquination is involved in the regulation of many signaling pathways, through the control of cellular Lacerda A.L.M.; Santana, A.S.; Lacorte C.; Campos proteins degradation. This process involves an enzymatic M.A.; Ribeiro S.G. cascade that tags the substrate by the attachment 1. EMBRAPA RECURSOS GENÉTICOS E of ubiquitin molecules with the participation of E1 BIOTECNOLOGIA ubiquitin activating enzyme, E2 ubiquitin conjugation 2. UNIVERSIDADE FEDERAL DE CAMPINA enzyme, and E3 ubiquitin ligase. Several plant viruses GRANDE show the ability to disturb the ubiquitination pathway Virusinduced gene silencing (VIGS) is widely used in by inducing, inhibiting or modifying these enzymes, plants to downregulate the expression of a target gene. In a similar approach, VIGS can be adapted for gene substrate. To study Tomato chlorotic mottle virus silencing in sucking insects and other plant parasites (ToCMoV)particularly infection E3 ligase in tomato that confers (Solanum specificity lycopersicum) to the and its resistance mechanism shown by ‘LAM 157’ line, an important insect pest causing damage to many cDNA libraries from inoculated plants were sequenced cropssuch asaround nematodes. the world, The including whitefly (Bemisiamany plants tabaci) of the is by RNAseq and compared with the near isogenic line, the susceptible variety ‘Santa Clara’. In silico analysis responsible for transmitting important plant viruses suchSolanaceae as begomovirus and Fabaceae and families.crinivirus, Whiteflies which motivates are also complex as differentially expressed in inoculated plants. numerous studies aiming alternative strategies for identified two RING finger proteins related to E3 ligases their control. The objective of this work is to test the of Ring E3 transcripts in ‘LAM 157’ plants nine days afterqRTPCR ToCMoV analysis inoculation. confirmed Therefore, the high to expression study the levelseffect by the oral route. The target genes are the vATPase of Ring E3 on ToCMV infection, transgenic plants of subuniteffectiveness A and of Ribosomal VIGS for geneProtein silencing L9 (RPL9), in whitefly both Nicotiana benthamiana were evaluated. For that, Ring essential for the insect and known to cause a high mortality rate in B. tabaci when silenced. Total RNA vector, recombined to the binary vector pK2GW7,0 and E3 cDNA was PCRamplified, cloned into pENTR/DTOPO Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posterswas isolated - Plant from and Invertebrate whiteflies Virology: and cDNA PIV was synthesized. XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

128 Plant and Invertebrate Virology: PIV

Sequencing’ (NGS) strategy was applied to unravel the genome sequence of an isolate of MYaV. Melon samples AfterFragments sequencing, of about the 200 fragments nucleotides were weretransferred amplified by used in this study were collected from Jaguaribe LRand recombination cloned in vector to pCR8/GW/TOPO®the viral vector PotatoVirus (Invitrogen). X (PVX). This vector was transferred transformation to Agrobacterium tumefaciens \’GV3101\’, and inoculated virusAçu agriculturalincidence is center frequently (CE/RN), high. which Plants produces exhibiting ca. in plants. PVX empty vector (pGR107) and PVXGFP yellowing81% of the symptoms total national were production, subjected andto viral where semi the was used as controls and to analyze suitable host plant for the virus infection. Six plants species were initially tested: Nicotiana tabacum, Datura stramonium, Solanum purification according to Cali Moyer (1991) protocol, melongena, Abelmoschus esculentus, Capsicum annum (Invitrogen),with modifications. and dried Total using RNA wasRNAstable extracted (Biomatrica). from semi and Brassica oleracea. In Nicotiana tabacum cv. TNN Thepurified ribosomal virus preparationsRNA molecules with were Trizol removed LS Reagent from and Datura stramonium the virus was detected by RT the extract and the remaining RNA was sequenced at PCR, 28 days after inoculation, in noninoculated leaves, Macrogen, Inc. (South Korea) by Illumina 2000 Hiseq with 100 bp pairedend. Mapping and assembly of viral tabacum cv. TNN and D. stramonium are known hosts for quasicomplete genome sequence were done with the confirming the systemic infection in the plants. N. Software Geneious 8.1. The genome, lacking its 5’ and 3’ PVX and therefore, were chosen for further experiments. ends, was approximately 9 kblong, in a typical carlaviral Studiesthe whitefly of v andATPase were and shown RPL9 to genebe also silencing good hosts in thefor genomic organization with six ORFs. Pairwise nucleotide

this virus belongs to the genus Carlavirus. Based on the whiteflyPIV82 using - THE PVX COMPLETEmediated VIGS GENOME are in progress. SEQUENCE speciescomparison demarcation and phylogenetic criteria of this analysis genus, confirmedviruses sharing that OF MELON YELLOWINGASSOCIATED VIRUS nucleotide (nt) sequence identity of CP or polymerase DETERMINED BY NEXTGENERATION SEQUENCING Costa, T.M.; Costa Junior, A.C.; Moriya, N.M.N.; Aragão, F.A.S.; Lima, M.F.; Inoue Nagata, A.K.; Blawid, R.; genes lower than 72% or amino acid sequence identity Nagata, T. withlower the than MYaV 80% areCP classifiedgene available as distinct in GenBank species. Theand 1. UNIVERSIDADE DE BRASÍLIA nt sequence of the CP of this study shared 97% identity 2. UNIVERSIDADE FEDERAL RURAL DE potato yellow mottle virus (SPYMV), the closest member PERNAMBUCO amongisolated the in 2010 carlaviruses. (ID: AB510477), The nt sequenceand 57.9% of with the SweetRdRp 3. UNIVERSIDADE DE BRASÍLIA 4. EMPRESA BRASILEIRA DE PESQUISA SPYMV. In conclusion, the complete genome sequence of AGROPECUÁRIA, CENTRO NACIONAL DE MYaVgene (ORF1) showed shared a typical the carlaviral highest identity genomic of organization, 57.2% with PESQUISA DE AGROINDÚSTRIA TROPICAL as well as its genome nt identity with other viruses low 5. EMPRESA BRASILEIRA DE PESQUISA enough to be considered as a distinct viral species in the AGROPECUÁRIA HORTALIÇAS genus Carlavirus. The Northeast region of Brazil is the major melon producing zone in the country, being responsible for disease has been reported in melon plants since 1999. It95% is known of the as total “yellowing national of production. melon plants” A devastating(Amarelão do meloeiro), which is associated to a viral agent, Melon yellowing associated virus (MYaV). This virus belongs to by a linear ssRNA (+) genome of ca. 9 kb. The genome containsgenus Carlavirus six ORFs. in Thethe completefamily Betaflexiviridae, genome sequence formed of MYaV is still not available, thus the ‘Next Generation Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

129 Plant and Invertebrate Virology: PIV

PIV100 - MOLECULAR CHARACTERIZATION AND makes tobaccoinfecting ToBMV an excellent candidate COMPLETE GENOME SEQUENCE OF A TOBACCO for virusinduced gene silencing (VIGS) vector for tomato INFECTING TOMATO BLISTERING MOSAIC VIRUS functional genomics studies. Alves Freitas, D.M.T.; Melo, F.L.; Lacorte. C.; Ribeiro, PIV106 - FIRST REPORT OF SIDA MICRANTHA S.G. MOSAIC VIRUS IN OXALIS SPP 1. EMBRAPA RECURSOS GENÉTICOS E Lamas, N.S.; Fontenele, R.F.; Ribeiro, G.; Lacorte, C.; BIOTECNOLOGIA Ribeiro, S.G. 2. UNIVERSIDADE DE BRASÍLIA 1. EMBRAPA RECURSOS GENÉTICOS E Tomato blistering mosaic virus (ToBMV) is a monopartite BIOTECNOLOGIA singlestranded positive sense RNA virus member of the 2. UNIVERSIDADE DE BRASILIA Tymovirus genus (family Tymoviridae). This virus has solanaceous plants as natural hosts and was reported Begomoviruses are singlestranded DNA viruses causing severe symptoms of leaf mosaic and blistering genomes are either monopartite or bipartite and in tomato plants. In a previous work, a tobaccoinfecting transmitted by the whitefly Bemisia tabaci. Their ToBMV was near completely sequenced using Illumina® known as DNAA and DNAB. Sida micrantha mosaic sequencing technology (GenBank KJ940970). In this virus (SiMMV) is a bipartite begomovirus of the new study, we determined the 5\’ and 3\’terminal sequences world that has already been described infecting tomato, of this virus isolate completing its entire genome. Total soybean, common bean, okra, cotton, and Sida spp. RNA was extracted from tobaccoinfected plants using Plants in Brazil. In this report, we characterized SiMMV Trizol® reagent. The 3’ RACE was done by adding a isolates from Oxalis sp. Four Oxalis spp. plants were poly(A) tail to the viral RNA genome and synthesized collected in urban areas of Brasília, Distrito Federal, and Londrina (Paraná State). The collected samples displayed transcriptase (Invitrogen) and Oligo(dT)50 anchor symptoms of yellow mosaic and leaf distortion, typical primer.the first RTstrand PCR and cDNA nested using PCR Superscript were conducted III reverse using of begomovirus infection. Total DNA was extracted from the samples using CTAB method, and begomovirus forward primers designed based on the contig from LongAmp Taq DNA polymerase (NEB) and specific pAL1v1978 e pAR1c496. Total DNA of each sample was the Illumina sequence. To determine the 5’terminal infection was confirmed using the degenerate primers Phi29 DNA polymerase for viral DNA enrichment. RCA submitted to rolling circle amplification (RCA) using tailsequence, was then the added firststrand to the cDNA cDNA. was RT synthesizedPCR and nested using products were digested with the enzymes ClaI, EcorV, PCRSuperscript were done III andusing specific LongAmp reverse Taq primer.DNA polymerase A poly(G) SacI, EcoRI and HindIII, cloned into pBluescript SK+ and completely sequenced. BLASTN comparison and a poly(G) anchor forward primer. The resulting 3’ and Species Demarcation Tool (SDT) (v.1.0) analysis were 5’(NEB) terminal and specificfragments ToBMV weretobacco cloned reverse and sequenced. primers andWe done to identify the virus species infecting the plants. were able to identify 18 nucleotides at the 5’terminal Complete DNAA and DNAB clones were obtained from the Oxalis sp. samples with genomic organization of Primers were designed to amplify the complete ToBMV typical bipartite begomovirus. DNAA clones shared tobaccoand five genome additional and the nucleotides GibsonAssembly® at the 3’ approachterminal. Demarcation Tool (SDT) analysis resulted in identities was used to construct a fulllength clone. ToBMVtobacco 93% nucleotide identity amongst them and Species sequence comprises a total of 6,280 nucleotides and

sp.ranging plants from were 82% infected to 96% with with SiMMV. the 19 DNA SiMMVB clones full DNA wereA isolates in Genebank. These results confirm that Oxalis ToBMVshares 88%Solanum identity violaefolium with the isolate ToBMV SPtomato01 (GenBank isolate SC50 (GenBank KC840043) and 78% identity with the with all 16 SiMMV DNAB isolates present in Genebank. KT834406). The ToBMV isolate from tobacco does not 90% identical, and identities ranging from 75% to 93% display systemic symptoms in tomato plants, neither in which broadens the host range of this begomovirus. cultivated varieties or wild relatives. This characteristic This is the first report of SiMMV infecting Oxalis sp. Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

130 Plant and Invertebrate Virology: PIV

PIV109 - IDENTIFICATION OF A NEW VITIVIRUS IN PIV123 - THE HIGHLY DIVERGENT JOHNSONGRASS ARRACACIA XANTHORRHIZA BY NEXT GENERATION MOSAIC VIRUS ISOLATE FROM PENNISETUM SEQUENCING PURPUREUM REPRESENTS A POTENTIAL THREAT Oliveira, L.M.; Orílio, A.F.; Nagata, T.; Blawid, R. TO CORN CROPS IN BRAZIL UNIVERSIDADE DE BRASÍLIA de Souza, J.M.; Silva, K.N.; Nicolini, C.; Melo, F.L.; Silva, M.S.; Fernandes, C.D.; Nagata, T.; Fragoso, R.R.; Orílio, A.F.; Resende, R.O. possess a positivesense single stranded RNA genome of aboutVitiviruses 7.37.6 belong kb. The to genomic the Betaflexiviridae RNA of vitiviruses family has and a 1. UNIVERSIDADE DE BRASÍLIA 5´ cap, a 3´ poly(A) tail and are known to be organized 2. EMBRAPA RECURSOS GENÉTICOS E BIOTECNOLOGIA 3. EMBRAPA GADO DE CORTE belonging to the Vitivirus genus has a restricted host 4. EMBRAPA CERRADOS rangeinto five and overlapping are natural opentransmitted reading by frames. pseudococcid Viruses mealybugs, soft scale insects and aphids, either by In the last years, plants showing viruslike symptoms mechanical inoculation or by grafting. NextGeneration have been observed in the main pasture grass growing Sequencing (NGS) technology is a very powerful tool areas. Plants of Pennisetum purpureum line CNPGL for detecting and discovering novel viral genomic 00211 showing mosaic symptoms on leaves and sequences without having prior knowledge. Here we growth reduction were collected in Minas Gerais State, describe a putative new member of the Vitivirus genus Brazil. Flexuous elongated potyviruslike particles that was discovered by NGS from arracacha (Arracacia were observed in the leafdip preparation of diseased xanthorrhiza) plants. The complete genome sequence plants by electron microscopy. The complete genome sequence (9865 nucleotides) of this highly divergent sequence information obtained by our NGS approach, Johnsongrass mosaic virus isolate (JGMVCNPGL) was was confirmed through Sanger sequencing. Based on the determined using Illumina sequencing. The virus regions of the new virus genome. To this aim, total JGMVCNPGL was mechanically inoculated into 14 RNAprimers was were extracted designed from to Arracacia amplify specific xanthorrhiza overlapping using putative host plants to determine its host range and TRIzol reagent (Invitrogen). RTPCR was performed the characterization of symptoms expression. These using the SuperScript™ IV Reverse Transcriptase kit plants were kept in greenhouse for 30 days and the polymerase (NEB). In order to determine both genomic symptoms appeared at 13 days after inoculation (dpi) symptoms monitored during this period. The first termini,(Thermo 3´RACE Fisher and Scientific) 5’ RACE andprotocols Long were Amp performed, Taq DNA determining the whole Vitiviral genomic sequence. JG9413and theR infection TTAGCCCCACGGTATGAATG). was confirmed by RTPCR Only using 10 specific hosts designed primers (JG8352F CAAAGCCCCATACTTGTCGG; Healthcare Life Sciences kit and send for sequencing were susceptible to the JGMVCNPGL isolate presenting (Macrogen,The amplified Korea). fragments The genomic were gel organizationpurified with resembles the GE mainly two types of symptoms: chlorotic veins observed closely that of grapevine viruses D and A. After amino in Zea mays 2B587, Zea mays 3646H1 and Millet ADR500 and mosaic symptoms in Brachiaria brizantha cv. Arapoty, Brachiaria brizantha cv. Xaraés, Panicum grapevineacid sequence vitiviruses. analysis, According the putative to the CP vitivirus showed species 47% maximum cv. Mombaça, Panicum maximum cv. Massai, demarcationto 50% of identity criteria, with viruses the coat from proteins different encoded species by Panicum maximum lineage C12, BRS Capileto and Sorghum bicolor BRS332. The JGMVCNPGL isolate was unable to infect Wheat BRS264, Hordeum vulgare L. should have less than 80% of identity at amino acid VCUCPAC, Crotalaria juncea and Glycine max under newlylevel or discovered less than 72%virus ofinfecting nucleotide arracacha identity is consideredof the coat the tested conditions. Comparatively, JGMVCNPGL host aprotein new species or polymerase of the Vitivirus gene. genus. Giving these findings the range was similar to those reported for JGMVN and JGMV MDO. A comparative analysis of the complete

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersgenome - Plantshowed and Invertebratea nucleotide Virology: identity PIV of 80% nt (86% XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

131 Plant and Invertebrate Virology: PIV aa) with Johnsongrass mosaic virus Australia. However, stablished genders and 130 unsigned viruses widely distributed in nature from vertebrates, invertebrates and aa, respectively), close to the species demarcation and plants. The objective of this study was the screening values.the CP identitiesCrucially, wereJGMV CNPGLslightly isolateabove 78%was ableand to82% infect (nt maize genotypes, suggesting that this virus represent collected from 2012 to 2015 in several areas of Rio de a potential threat to this important crop. Brazil is the through familyspecific RTPCR of 16.163 mosquitoes world’s third largest maize producer, planting, yearly, species and sex. RNA were extracted and analyzed in the over 15.8 million ha, which represents 80 million ton of formJaneiro of a State. mixture. The From vectors all weresamples separated two were by positive, genus/ maize grains productions. The biological implication of one collected in 2012 and the other in 2015. The this striking difference among JGMV isolates worldwide genome sequences obtained for both samples presented and its evolutionary history remains to be elucidated homologies with rhabdovirus detected in America.

PIV125 - GENOME CHARACTERIZATION OF PIV126 - TEMPLATEBASED MODELING AND RHABDOVIRUS DETECTED IN MOSQUITOES MOLECULAR DYNAMICS OF THE TOSPOVIRUS TRAPPED AT RIO DE JANEIRO STATE GROUNDNUT RINGSPOT VIRUS NUCLEOPROTEIN: Campos, R.M.; Santos, L.L.R.; Cadar, D.; Ribeiro, M.S.; INTRAMOLECULAR INTERACTIONS AND RNA Cirne Santos, C.C.; Yamamoto, K.A.; Meira, G.L.S.; de ENCAPSIDATION Meneses, M.D.F.; Schmidt Chanasit, J.; Ferreira, D.F.; Lima, R.A.; Faheem, M.; Barbosa, J.A.R.G.; Polêto, Campos, R.M. M.D.; Verli, H.; Melo, F.L.; Resende, R.O. 1. DEPARTAMENTO DE VIROLOGIA, 1. UNIVERSIDADE DE BRASÍLIA INSTITUTO DE MICROBIOLOGIA PAULO DE 2. UNIVERSIDADE FEDERAL DO RIO GRANDE GÓES DO SUL 2. WHO COLLABORATING CENTRE FOR The understanding of protein folding mechanisms and the ARBOVIRUS AND HAEMORRHAGIC FEVER REFERENCE AND RESEARCH, BERNHARD to modeling and predict three dimensional structures NOCHT INSTITUTE FOR TROPICAL ofadvances plant virus in the proteins. bioinformatics The nucleoprotein field have provided (NP) crystal tools MEDICINE 3. SECRETARIA ESTADUAL DE SAÚDE structures of related RNA virus families were elucidated and despite having different sizes and distinct NPfolding structures, these proteins share common features diseases, ranging from mild febrile illness to encephalitis and architectural principles when forming NPNP Many arboviruses are responsible for significant human and death. During the last decade the world has been multimers and NP–RNA complexes. Due to their genetic facing the burden of introduction and re introduction relationship, the La Crosse virus (LACV) crystal structure of arboviruses such as zika virus, dengue virus, in complex with ssRNA was selected as template for chikungunya virus, japanese encephalitis virus, west nile a templatebased modeling approach and molecular virus and yellow fever. Most of the characterized virus dynamics simulations to predict a three dimensional species related to human diseases belong to 3 families: model for the NP of the tospovirus Groundnut ringspot Togaviridae, Flaviviridae, and Bunyaviridae. However, virus (GRSV). The GRSV NP monomer was predicted to possess thirteen helical segments and two small beta among 3 other families: Reoviridae, Rhabdoviridae, and sheets organized in a globular core domain (26223 aa) a significant number of viruses is also distributed Orthomyxoviridae. Besides the species related to human containing a deep positively charged groove with the diseases, a huge diversity of insectonly viruses exist. two terminal chains forming a Nterminus arm (125 aa) Very little is known about the diversity, transmission, and a Cterminus arm (224258 aa). Both N and Carms physiologic effects in host and the impact of insect extend outwards from the globular core domain and they ecology or even their impact in human populations interact with the globular core domain of neighboring in this whole scenario. The continuous search for new monomers to mediate the multimerization, supporting the “headtotail” model. The RNA is primarily bound at family Rhabdoviridae is very diverse consisting of 6 well Virusspecies Reviews is first & Research step Vol to 20 improve (2), August-December this knowledge. 2016 - Abstracts/Posters The - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

132 Plant and Invertebrate Virology: PIV the central RNAbinding groove and the key residues manufacturer’s instructions. The RNA samples were for this interaction are mainly located in this groove. pooled and sequenced at Macrogen INc. (Korea) using RNA is strongly bent at each NP–NP interface and is Illumina HiSeq 2000 technology. Based on the results largely solventinaccessible in the tetramer structure. from the consensus NGS, primers were designed for The dimensions of the groove allow accommodation of ssRNA and further analysis showed that the majority of residuenucleotide interactions occur with the ribose whole genome and these viruses were confirmed in the and the phosphate moiety, suggesting a non sequence infected samples by RTPCR. The 3’ ends were confirmed theby using SMART oligodT PCR and primers RACE. with The specificcomplete forward genomes to wereeach the globular core domain did not reveal any loss of determinedvirus. The 5’ endsto comprise were confirmed of 9213 with nucleotides the techniques for Poty of secondaryspecific ssRNA structure, interaction. increase During of radius the simulation of gyration time, or 1, 9197 nucleotides for Poty 2 and 9425 nucleotides persistent increments on RMSD values, which supports for Poty 3 (excluding the polyA tails). The complete the model quality. The RMSF calculations indicate the virus genomes and CP sequences were compared with sequences available in GenBank. The highest nucleotide residues are conserved among all tospoviruses. Copies ofNterminal the NP armform as oligomers a very flexible that interactregion. Most with of the the viral key compared to other potyviruses, respectively. The RNAs to build ribonucleoprotein complexes (RNPs) that genomesidentities were of 43%, deduced 39% to andencode 56% a single were open determined reading are proposed to be transported via plasmodesmata and frame (polyprotein) on the plus strand. Phylogenetic are templates for RNA replication and transcription. The analysis based on the whole genome sequences and proposed model may shed light on the mechanisms of coat protein amino acid sequences showed that the new viruses found are most closely related to the Blackberry amino acid residues as potential targets for tospovirus virus Y (Poty 1 and Poty 2) and the Rose yellow mosaic controlRNP shaping strategies. and allow the identification of essential virus (Poty 3). The biological features of these new potyviruses are currently being investigated. PIV145 - NGS STRATEGY REVEALED THREE PUTATIVE MEMBERS OF A NEW GENUS IN THE POTYVIRIDAE PIV151 - HIGH INCIDENCE OF MIXED DNA AND RNA FAMILY NATURALLY INFECTING STYLOSANTHES VIRUS INFECTIONS IN COMMON BEAN IN CENTRAL de Souza, J.M.; Silva, K.N.; Melo, F.L.; Fernandes, C.D.; BRAZIL Nagata, T.; Orílio, A. F.; Silva, M.S.; Resende, R.O. Lima, B.P.; Alves Freitas, D.M.T.; Godinho, M.T.; Faria, 1. EMBRAPA GADO DE CORTE J.C.; Lacorte, C.; Ribeiro, S.G. 2. UNIVERSIDADE DE BRASÍLIA 1. UNIVERSIDADE DE BRASÍLIA 3. EMBRAPA CENARGEM 2. EMBRAPA RECURSOS GENÉTICOS E Nextgeneration sequencing (NGS) is quickly emerging BIOTECNOLOGIA as the goto tool for plant virologists when sequencing 3. EMBRAPA ARROZ E FEIJÃO whole virus genomes and undertaking plant Common bean is one of the most important protein food metagenomic studies for new virus discoveries. Two source consumed worldwide, mainly in Africa, South and Stylosanthes sp. samples were shipped to sequencing Central Americas. In Brazil, there are several diseases through the use of NGS and three novel potyviruses, preliminrly named as Poty 1, Poty 2 and Poty 3, were the Bean golden mosaic virus (BGMV), responsible discovered naturally infecting Stylosanthes plants. affecting bean fields, including viral diseases, such as crop season in 2016 a very high incidence of viruslike Embrapa Beef Cattle in Mato Grosso do Sul, showing symptomsfor losses of that mosaic, can reachleaf curling 100%. and During deformation, the winter and typicalThese samples leaf mosaic were symptons. collected To in obtainexperimental a viral enrichedfields of fraction, the leaves were ground in phosphate buffer, of Brazil. Bean plants were collected in commercial farmsplant dwarfing in Luziânia, was reportedCristalina by and farmers experimental in central areasplots RNA was extracted using RNeasy Mini Kit following the in Goiânia and Brasília. Total DNA was extracted using filtred and centrifuged through a sucrose cushion. Viral Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

133 Plant and Invertebrate Virology: PIV

CTAB method. Total RNA was obtained using Trizol® interest epitopes. Therefore, we are assessing the reagent. Samples were tested for the presence of DNA assembly of tymoviruslike particles (tVLPs) using BEVS. and RNA viruses that are commonly found infecting In this work, the potential use of tVLPs for displaying beans in Brazil. Begomoviruses BGMV, Macroptilium biopharmacological epitopes with medical interest and yellow spot virus (MaYSV), and Macroptilium yellow one epitope of Chikungunya virus (CHIKV) envelope protein 2 (E2) was selected. CHIKV is a mosquitoborne primers. Detection of the RNA viruses Cowpea mild viral disease that causes headache, fever and severe mottlenet virus virus (MaYNV) (CPMMV were Carlavirus), detected by Bean PCR rugose using specificmosaic joint pain. Since 2004, this virus is affecting thousands virus (BRMV Comovirus) and a new, yet not fully of people around the world. Importantly, there is no characterized rhabdovirus (Bean associated rhabdovirus available serological kit for CHIKV detection produced in BAR), recently found by our group was performed by Brazil. Therefore, we will use the tVLPs displaying the CHIKV E2 epitope to generate diagnostic kits for human thus far, a high incidence of mixed infection, usually with serum. For this purpose, we are analyzing the deletion threeRTPCR viruses with specificwas detected primers. in all For sampled the samples areas. BGMV tested deletion will interfere with the correct assembly of the tVLPs.construct If not,of the we first will 23 replace a.a. of theseToBMV 23 CP a.a. whether by CHIKV this theand regionCPMMV where were thepresent samples in 100% were ofcollect. the plants BRMV while was detectedBAR had inan a incidence few samples of 60while100%, MaYSV varying and MaYNVaccording were to was cloned to pFastBac1 vector. The constructs were sequencedepitope. At andfirst, the the DH10Bacdeletion mutant strain ofgene Escherichia of ToBMV coli CP of mixed infection is causing extensive yield losses in that contains Bacmed was transformed with selected thenot bean identified crop and in any will of likely the samples.impact on This availability widespread and clones to generate recombinant baculoviruses by prokaryotic transposition and viral DNA transfection into insect cell. The protein expression of this construct influencePIV155 - A market PLANT prices. VIRUS COAT PROTEIN AS A CARRIER PROTEIN FOR MEDICAL INTEREST EPITOPES IN antiCP antibody. BACULOVIRUS/INSECT CELL SYSTEM is now on evaluation by immunoblotting using specific Vasques, R.M.; Ardisson Araujo, D.M.; Blawid, R.; PIV164 - A NEW PUTATIVE GEMYCIRCULARVIRUS Duarte, M.A.; Ribeiro, B.M.; Correa, R.F.T.; Nagata, T. DETECTED IN COMMON BEAN IN BRAZIL 1. UNIVERSIDADE FEDERAL DE SANTA MARIA Lamas, N.S.; Fontenele, R.S.; Melo, F.L.; Costa, A.F.; 2. UNIVERSIDADE DE BRASÍLIA Lacorte, C.; Varsani, A.; Ribeiro, S.G. The baculovirus expression vector system (BEVS) 1. EMBRAPA RECURSOS GENÉTICOS E has been widely used to produce a large number of BIOTECNOLOGIA recombinant proteins and is becoming one of the most 2. UNIVERSIDADE DE BRASILIA 3. INSTITUTO AGRONOMICO DE powerful, robust, and costeffective system for the PERNAMBUCO production of proteins. The success of the system is duet 4. UNIVERSITY OF ARIZONA to the intrinsic security and the high yields of protein expression. BEVS can be used for the production of virus Genomoviridae is a recently created family of like particles (VLPs). The VLPs can be obtained basically circular, singlestranded DNA viruses. The family is the by expression of recombinant capsid proteins in composed of one genus, Gemycircularvirus with a sole a variety of heterologous systems, that promote the recognized species, Sclerotinia gemycircularvirus 1. selfassembly of proteins into structures similar virus The representative isolate, Sclerotinia sclerotiorum particles. VLPs have antigenicity similar to that of the hypovirulence associated DNA virus 1, (SsADV1) was native virus, but they lack genetic material, thus are not discovered in 2010, infecting the fungus S. sclerotiorum. infectious. Tomato blistering mosaic virus (ToBMV) is a There are more than one hundred SsADV1 like putative plant virus infecting plants from the genus Solanum and, viruses described in different hosts and environmental in this work, candidate as a carrier protein for medical samples, including water from rivers, treated and

134 Plant and Invertebrate Virology: PIV untreated sewage, animals, humans and plants. In this study, we report a putative gemycircularvirus (GemyCV) associated to common bean plants. A single 123nt read begomovirus was confirmed by PCR using the universal GO).primers Interesting, PAL1v1978/PAR1c496. no sample from A PR total was of PCR137 positive,samples in a 454pyrosequencing NGS library prepared from bean butwas infected PCR positive by a (27/57crinivirus from (family RJ and Closteroviridae). 110/216 from DNA,with similaritiesisolated from with samples GemyCV showing sequences virus was symptoms identified These 137 infected plants were analyzed using RCA collected in Arcoverde, Pernambuco, Brazil. Backtoback RFLP with MspI restriction enzyme and the pattern of primers were designed to recover full viral genomes fragments obtained was compared with those known from individual samples using inverse PCR. We were for the main species of begomovirus infecting tomato in able to recover amplicons of about 2200 pb from three Brazil. Representative RCA products were chosen and of the bean samples. The fragments were cloned into PCRIITOPOTA vector and sequenced. The sequences species in single or mixed infection: Tomato mottle leaf were assembled into fullgenomes using Geneious® curldirectly virus sequenced. (ToMoLCV), It confirmed Tomato common the presence mosaic of threevirus program. The virus genomes are 2220nt long bearing three ORFs: a putative capsid protein, a Rep and RepA protein, characteristic of GemyCVs. We propose the infection(ToCmMV) with and ToSRV, ToSRV. but In the RJ, 15%begomovirus of the plants present were in name Common beanassociated gemycircularvirus infected by ToCmMV and ToSRV, 41% showed single of the plants were mixed infected with ToMoLCV and 44% of the samples is still not determined. In GO, 4.5% gemycircularvirus(CBaGmV). CBaGmV from isolates Tonga. share To 80.4further80.7% investigate identity infection with ToSRV. The presence of ToSRV in all these thewith biology two isolates of CBaGmV, from Pacific infectivity flying tests fox fecesare currently associated in ToSRV, while the remaining (95.5%) showed a single progress. primers. This preliminary result indicates that even after manysamples years was of confirmedthe last systematic by PCR study with specieson the specificgenetic PIV169 - OCCURRENCE OF BEGOMOVIRUSES ON diversity and prevalence of begomovirus species in the TOMATOES IN THREE BRAZILIAN STATES country, ToSRV remains the most important species, Oliveira, T.M.R.; Carneiro, T.M.; Pontes, N.C.; Nakasu, although the incidence of other species as ToCmMV E.Y.T.; Macedo, M.A.; Inoue Nagata, A.K.; Albuquerque, and ToMoLCV are increasing in some regions in the last L.C. 1. INSTITUTO FEDERAL GOIANO CAMPUS MORRINHOS completeyears. For sequencing a precise taxonomicof each isolate. classification, including 2. EMBRAPA HORTALIÇAS the unidentified isolates, clones are being obtained for PIV172 - IDENTIFICATION OF A NEW POLEROVIRUS Begomoviruses (Family Geminiviridae) are the most INFECTING COTTON IN MATO GROSSO THAT INDUCES important viruses infecting tomatoes (Solanum APICAL NECROSIS lycopersicum) in Brazil. These viruses are transmitted Santana, A.O.; Santana, A.O.; Santos, R.O.; Rondon, Asia Minor 1). Many species are reported infecting M.N.; Moura, M.O.; Fausto, A.K.S.; Vaslin, M.F.S. tomatoesby the whitefly in Brazil, Bemisia with tabaciprevalence MEAM of 1Tomato (Middle severe East 1. UNIVERSIDADE FEDERAL DO RIO DE rugose virus (ToSRV). Based on the geographic distance JANEIRO and distinct cultivation conditions of tomatoes in the 2. TROPICAL MELHORAMENTO E GENÉTICA country, an irregular distribution of begomovirus Cotton plants from Mato Grosso showing drastic species is expected. To test this hypothesis, 313 symptoms associated to apical necrosis were saw in samples of tomato plants exhibiting typical symptoms distinct cotton crops from Rondonópolis and Serra da of begomovirus infection (such as interveinal chlorosis, Petrolina, Pedra Preta, at Mato Grosso state. Symptoms mosaic, leaf distortion, and stunting) were collected in were observed in adult plants that died after disease Goiás (GO), Paraná (PR) and Rio de Janeiro (RJ) states manifestation. The middle portion of the diseased plants in 2015. Total DNA was isolated and the presence of shows cotton blue diseaselike symptoms, as leaf rolling

135 Plant and Invertebrate Virology: PIV and reddening. These symptoms are very similar to the (Pirizal) in the rainy, intermediate and dry seasons observed in cotton plants infected by CLRDVbreaking during 20142015. Adult females (n=1.729) captured resistance virus isolates. However, plants infected with Cotton leafroll dwarf virus (CLRDV – causal agent of cotton blue disease) never present necrosis symptoms. keyswith Nasciand their aspirators salivary and gland CDC waslight dissected. traps were Specimens identified Our group has already studied at least four distinct ofalive 36 at speciesa dormant from state 8 accordinggenera (Aedes, to specific Coquillettidia, dichotomy genotypes of CLRDV and none of these isolates are Culex, Haemagogus, Mansonia, Psorophora, Uranotaenia able to induce apical necrosis. Four samples of plants and Wyeomyia) comprised 40 pools. Viral RNA was showing this putative new disease were collect from extracted from the minced salivary glands, converted to distinct districts of Mato Grosso state. Total RNA from cDNA, subjected to cDNA secondstrand synthesis and these samples were extracted and were submitted to CLRDV like polerovirus Nested PCR diagnosis. A TruSeqPCR amplification RNA Sample with Prep viral and randomic after sequencedprimers (Random in the IlluminaKS). Library HiSeq was 2.500 prepared plataform. with the Preliminary purified DNA analysis using fragment corresponding to the capsid region (P3/ORF3) of the sequences obtained from 25 pools containing inand the another four samples.corresponding New primersto replicase were (P2/ORF2) then used were for species of Aedes, Coquillettidia, Culex, Haemagogus, amplified, showing that a CLRDVlike virus is present Mansonia, Psorophora and Wyeomyia using viral order to analyze that ORF that is the most variable ORF RefSeq data available at NCBI generated hits by tblastx aroundamplify the silencingCLRDVlike suppressor polerovirus protein as well (P0/ORF0) observed in with viruses belonging to Flaviviridae, Bunyaviridae, also for other polerovirus genotypes closed related Togaviridae, Reoviridae, Rhabdoviridae and Iridoviridae families, including also some possible plant and insect Sanger sequencing and analyzing the sequences of these threeby themselves. ORFs we expect The amplified to identify fragments more deeply were this sent new for polerovirus infecting cotton. suggestingspecific viruses. the Nucleotidepresence of identity new viral among species the obtained within thecontigs salivary and glands reference of the sequences mosquitoes vary included among in 30 these60%, PIV185 - VIRAL BIODIVERSITY IN THE SALIVARY pools. Financial Support: CAPES, Rede PróCentro Oeste GLAND OF CULICINAE MOSQUITOES CAPTURED IN CNPq. SYLVATIC AREAS OF CHAPADA DOS GUIMARÃES AND PANTANAL OF MATO GROSSO, BRAZIL PIV189 - VIRAL BIODIVERSITY IN THE SALIVARY de Lara Pinto, A.Z.; Carvalho, M.S.; Melo, F.L.; GLANDS OF TICKS CAPTURED IN CHAPADA DOS Pinheiro, A.; Serra, O.P.; Bezerra, M.C.F.; Ribeiro, GUIMARÃES AND NORTH PANTANAL, MATO GROSSO, A.L.M.; Dezengrini Slhessarenko, R. BRAZIL 1. UNIVERSIDADE FEDERAL DE MATO GROSSO Carvalho, M.S.; de Lara Pinto, A.Z.; Pinheiro, A.; Melo, 2. UNIVERSIDADE DE BRASÍLIA F.L.; Aguiar, D.M.; Dezengrini Slhessarenko, R. Arboviruses represent a main public health problem in 1. UNIVERSIDADE FEDERAL DE BRASÍLIA tropical areas. Mato Grosso presents sylvatic ecosystems 2. UNIVERSIDADE FEDERAL DE MATO GROSSO harboring a great diversity of vector and host species, Ticks are involved in the transmission cycle of several intense ecotourism activity in close proximity to populated urban centers, factors contributing to viruses associated to ticks is scarce in Brazil. The aim arbovirus emergence. The subfamily Culicinae is the ofarboviruses this study worldwide.is to investigate However, the presence the identification of viruses in of major taxon inside the family Culicidae. Estimates ticks captured in two RAPELD systems present in sylvatic areas of the Chapada dos Guimarães National Park may circulate in Brazil. This study aimed at identifying (PNCG) and in North Pantanal (Pirizal), State of Mato theindicate viral thatdiversity 371 in species sylvatic classified culicinae in captured this subfamily in two Grosso. To achieve that, ticks were captured in the rainy, RAPELD systems present in the National Park of Chapada intermediate and dry season (20142015) in those areas, dos Guimarães (Rio Claro) and in North Pantanal

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersidentified - Plant alive and according Invertebrate to Virology: specific PIV dichotomy keys and XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

136 Plant and Invertebrate Virology: PIV the salivary glands were dissected from adult specimens. found in potatoes (Solanum tuberosum), tomatoes (S. 265 specimens (182 adults of Amblyomma sculptum lycopersicum) and sweet pepper (C. annuum). Tospovirus and 83 ninfs of Amblyomma sp.) were allocated in eight species are notorious for inducing substantial losses on pools. After viral RNA extraction (High Pure Viral RNA vegetable production around the world. The real diversity kit), reverse transcription (GoScript, Promega), second of plant viruses has been overlooked for a long period strand cDNA synthesis (DNA polimerase I large Klenow of time. Only plants with economical importance and presenting compromising symptoms have mostly been fragment) and PCR amplification with randomic primers With the accessibility of highthroughput sequencing dsDNA)for viruses and (random sequenced KS), throughthe DNA Illuminaproduct wasHiSeq purified 2500 (NGS)surveyed tools, for thisidentification scenario has of diseasechanged causative and viruses agents. not plataformwith 20% after PEG the 8000, synthesis quantified of the (QuantiFluor® library (Illumina ONE causing apparent disease symptoms have been found TruSeq DNA nano). Partial analysis of the sequences in large scales. Here, sequences covering virusderived obtained from the eight pools indicate the presence genomes were retrieved from RNA sequencing data of of viruses belonging to the families Togaviridae, symptomatic vegetables collected in DR. RNA genomes Flaviviridae, Bunyaviridae, Reoviridae, Arenaviridae, of three plant virus genera were obtained apart from Orthomyxoviridae and Rhabdoviridae and also of some the complete genome of TCSV and partial sequences of TSWV. A partial sequence of a Tobacco veinclearing virus pools of ninfs presented hits with RefSeq sequences (TVCV) isolate was traced back only in potato plants ofsequences Phlebovirus, of plant Nairovirus, and insect specificOrbivirus, viruses. Vesiculovirus The two by RTPCR. A Bell pepper endornavirus (BPEV) isolate, and Tospovirus genus. The six pools formed by adult within family Endornaviridae, was found and traced back ticks showed mostly hits with sequences of Coltivirus, in sweet pepper. The cryptovirus (family Partitiviridae) Asfavirus, Pegivirus, Vesiculovirus and Alphavirus genus. Identity between the contigs and reference sequences in chili pepper. Finally, a Southern tomato virus (STV) (genusPepper Amalgavirus, cryptic virus family 2 (PCV Amalgaviridae)2) isolate was isolate identified was viral species in the salivary glands of ticks. found infecting tomato. Apart from the viruses above were below 70%, which suggests the presence of new mentioned, we could assemble the complete genome PIV198 - VIRUSDERIVED GENOMES FROM of a TCSV isolate. The consensus of the three genomic CULTIVATED VEGETABLES IN DOMINICAN REPUBLIC. segments were deposited under accession numbers A NEW ENVIRONMENT FOR VIRUS EMERGENCE KX463272 (L RNA), KX463273 (M RNA), and KX463274 Almeida, M.M.S.; Oliveira, A.S.; Melo, F.L.; Rodriguez, (S RNA). Whole transcriptome shotgun sequencing of a R.; Martínez, T.R.; Resende, R.O. RNA pool was performed using an Illumina Hi Seq 2000 1. UNIVERSIDADE DE BRASILIA platform, which ended up in the production of about 2. MINISTERIO DE AGRICULTURA 53 million reads. The reads were assembled using CLC 3. INSTITUTO DOMINICANO DE genomic Workbench. Contigs covering virusderived INVESTIGACIONES AGROPECUARIAS Y genomes were built by BLASTn and BLASTx searches FORESTALES against the virus reference database available in the Dominican Republic (DR) contains large areas for National Center for Biotechnology Information (NCBI). of this country economy. Chili pepper (Capsicum frutescens)vegetable production and other whichpepper bases species, a significant for example, portion are amongst the top ten commodities exported in quantity and value by DR. Recently, this vegetable production has been threatened by tospovirus infections. While Tomato chlorotic spot virus (TCSV) caused typical tospovirus symptoms in long beans (Vigna unguiculata) and chili pepper, Tomato spotted wilt virus (TSWV) was

137 Plant and Invertebrate Virology: PIV

PIV199 - ABSENCE OF BEGOMOVIRUS TRANSMISSION BY SEED IN SIDA SPP respectively, however they are not transmitted by seeds the flower tissues of Sida rhombifolia and Sida acuta, Amaral, J.G.; Zerbini, F.M. in these hosts. UNIVERSIDADE FEDERAL DE VIÇOSA PIV200 - ANCESTRY STUDY AND FITNESS ANALYZING The genus Begomovirus (family Geminiviridae) includes OF THE VERY CLOSE RELATED TOSPOVIRUSES a number of plant viruses of economical importance GROUNDNUT RINGSPOT VIRUS (GRSV) AND TOMATO CHLOROTIC SPOT VIRUS (TCSV) Begomovirus have one or two genomic components and Almeida, M.M.S.; Melo, F.L.; Blawid, R.; Oliveira, A.S.; for Brazilian agriculture. Viruses classified in the genus Kormelink, R.J.M.; Resende, R.O. dicot plants. Begomoviruses naturally infect several non 1. WAGENINGEN UNIVERSITY AND RESEARCH are transmitted in nature by the whitefly Bemisia tabaci to cultivated hosts, such as Sida spp. and Macroptilium spp. CENTRE These noncultivated hosts may harbor viral populations 2. UNIVERSIDADE DE BRASÍLIA with a high degree of genetic diversity. Nevertheless, Tomato chlorotic spot virus (TCSV) and Groundnut ringspot virus (GRSV) (Tospovirus genus, Bunyaviridae species of noncultivated plants. Based on the observation some viral populations seem to be confined to certain family) are single strand RNA viruses. Their virions are compound by three RNA segments (S RNA, M RNA and already showing symtpoms of begomovirus infection L RNA) inside an icosahedral enveloped particle. TCSV apparentlyof noncultivated in the plantsabsence newly of the emerged insect vector, in the and field on and GRSV are closely related phylogenetically and the recent reports of seed transmission of begomoviruses both were reported infecting tomatoes in 1990’s year in sweet potato, bean and tomato, the objective of this in Brazil. At the beginning, these viruses were limited to study was to analyze the presence of begomoviruses few counties. Nowadays, GRSV incidence has grown and in seeds of Sida acuta and Sida rhombifolia, as well as raised it as the main tospovirus species in Brazil. Over the transmission of these viruses by seed. A total of 39 the last four years, severe tospoviruses infections have plants of these two species, displaying typical symptoms spread through Caribbean islands and TCSV became of infection by begomoviruses, were collected in Viçosa, one of the main disease agents in important vegetable’s MG on December 2013 and transferred to a greenhouse. in the South and Southwest of the United States as well, crops. The TCSV has been reported damaging crops fields Viral infection was confirmed in 38 of these plants where GRSV has been stated more than ten years ago. by rollingcircle amplification (RCA) of complete viral The interaction between GRSV and TCSV was proposed Sidagenomes. yellow Amplification mosaic virus (SiYMV) products and were of S. acuta cloned by Sida and the S and L GRSVsegments and the M TCSVsegment yellowsequenced, leaf curl confirming virus (SiYLCV). infection Approximately of S. rhombifolia 320,000 by (denotedto born the SGRSV first MTCSV hybrid LGRSV). tospovirus In attempt isolate, to which study hasthe seeds were collected from the 38 infected plants. The competition of GRSV and TCSV in a mixed infection, the seeds were surfacesterilized with sodium hypochloride or sulphuric acid, and were ground in groups of 20, 30 or 200 seeds. Total DNA extracted from approximately thefitness origin of both of this viruses segment. was measuredNicotiana benthamianaby qPCR. The M plants RNA 80,000 seeds was used for viral detection by RCA, with wereancestry infected of GRSV with and the TCSV ancient was GRSV verified and toTCSV understand isolates, negative results. Total DNA was also extracted from SA05 and Br03, respectively. After few days, the total stamens, styles and ovaries) from infected plants and the RTPCR. The serological test ELISA was performed to usedwhole for flowers viral anddetection, from flowerwith positive tissues (sepals,results petals,in all calculateRNA was the purified virus concentration and tested with on the specific N. benthamiana primers in cases. Seeds from infected plants were treated with leafs. These leafs were used to prepare three different sulphuric acid, germinated and 269 plantlets from these inoculum concentrations, which were rubbed on healthy seeds were evaluated for the presence of virus by RCA N. benthamiana plants. After few days, the viral titer and PCR, with negative results. Together, these results indicate that SiYMV and SiYLCV are capable of infecting Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posterswas measured - Plant and with Invertebrate specific Virology: primers PIV on qPCR. The old XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

138 Plant and Invertebrate Virology: PIV

GRSV and TCSV isolates were completely sequenced by was selected and used for complete genome sequence Ilumina Hiseq 2000. The sequence reads obtained were through Sanger sequencing. To determine the 5’ and assembled by CLC Genomic Workbench program and the 3’ terminals the RACE approach was successfully used. The complete genome of this closterovirus encodes 9 Extensive phylogenetic analysis made by the software potential open reading frames and shows the typical PhyMLfinal contigs showed were that analysed the genetic by the GenBank®variability database.between organization of closteroviruses. The putative heat shock GRSV and TCSV M RNA is less than in Tomato spotted protein 70 homolog (HSP70h), RNAdependent RNA wilt virus (TSWV) species, the virus type in the genus. polymerase, and coat protein genes showed 3744, 2633, The M RNA phylogeny does not separate GRSV and TCSV segments in different groups, signaling that probably closteroviruses genome, respectively. A phylogenetic they share the same M RNA. As result, the qPCR analysis treeand 18based35% on amino HSP70h acid gene sequence showed identities that Beet with yellows other virus and Grapevine leafrollassociated virus 2 are their when mixed with a higher amount of GRSV. closest relative to this virus. In conclusion, this study showed that TCSV was more efficient in replication, even shows evidence of the presence of a putative new PIV208 - A NEW CLOSTEROVIRUS FOUND IN species in genus Closterovirus in Arracacia xanthorrhiza ARRACACIA XANTHORRHIZA BY NEXT GENERATION of Brazil. Considering that the sequence similarities of SEQUENCING all taxonomically relevant proteins between this new Costa, G.A.; Gomes, S.S.V.S.F.; Blawid, R.; Nagata, T.; Arracacia virus and recognized closteroviruses are far Inoue Nagata, A.K.; Resende, R.O.; Orílio, A.F. below the species demarcation threshold proposed by 1. EMBRAPA HORTALIÇAS the Closteroviridae Study Group, we propose this virus 2. UNIVERSIDADE DE BRASÍLIA to be representative of a new species in the genus, for Arracacia xanthorrhiza, known as mandioquinhasalsa which we propose the name ‘‘Arracacha virus 1’’. (MS) in Brazil, is a root vegetable originally from the PIV210 - IDENTIFICATION BRUGMANSIA SUAVEOLENS Andes and belonging to family Apiaceae. It is a vegetatively MOTTLE VIRUS IN BRUGMANSIA SP propagated plant and viral infection symptoms are Souza, T.A.; Inoue Nagata, A.K.; Calegario, R.F.; frequently observed. Nextgeneration sequencing (NGS) Kitajima, E.W. analysis, without the need of previous viral genome 1. UNIVERSIDADE DE BRASÍLIA has proven to be an efficient tool for viral metagenomic 2. EMBRAPA HORTALIÇAS genome analysis of a novel closterovirus found in 3. UNIVERSIDADE FEDERAL DO PARANÁ 4. ESALQ A.knowledge. xanthorrhiza Here by we NGS. describe RNA thefrom identification viral enriched and preparation after differential centrifugation of plant Plants of the genus Brugmansia (Solanaceae) are bushy extracts were sequenced by Illumina HiSeq 2000 like trees that can reach up to 4.6 metres high. In Brazil, platform. Reads were analyzed, assembled, and plants of this genus are popularly known as ‘trombeteira’ submitted to blastx analysis against the RefSeq Viral (trumpet) or ‘saia branca’ (white skirt). They are used as database. The contig of 15.756 bp with coverage of ornamental plants, because of their beautiful, large and 4464 reads share a high identity to closteroviruses, and similar genomic organization. The genus Closterovirus with mosaic and vein clearing symptoms was collected (family Closteroviridae) comprises species with intubular 2015,shape in Curitiba flowers. – PRA leaf (Parque sample do ofPapa, Brugmansia S 25º24’40” sp. monopartite positive singlestrand RNA genome whose W 49º16’13”). There is a report of the infection of the size varies from 14.5 to 19.3kb. Based on the sequence potyvirus Brugmansia suaveolens mottle virus (BsMoV) in a B. suaveolens plant, observed in CampinasSP primers that amplify overlapping regions of all genome (isolate BsCampinas). As the symptoms observed in this wereinformation designed. obtained Initially, by metagenomic the presence analysis, of this specific new ‘trombeteira’ plant was distinct from the one collected in Campinas, it was supposed that a different virus total plants based on RTPCR. Then, one sample (MS#6) could be causing the viruslike symptom in this plant. closterovirus was confirmed in 21 MS plants from 47 Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

139 Plant and Invertebrate Virology: PIV

Initially, transmission electron microscopy analysis sequence of the Ag2D (genebank) was used as a reference. The results showed that the major discrepancy between and cytoplasmic inclusions, typical of potyvirus. the Ag01 and Ag16 and the genome of reference Ag2D Then,indicated biological the presence characterization of long and was flexuous performed particles, by occurred in the pe38 gene. This gene is involved in viral mechanical inoculations in twelve indicator plants and DNA replication, and transactivation of viral early genes symptoms were recorded. The test plants inoculated transcription. In the Ag2D isolate, the p38 gene presents with the BsCuritiba isolate showed symptoms similar itself divided in two ORFs while in the Ag01 and Ag16 to those induced by the isolate BsCampinas. The test clones only one ORF was found. Similarly, the he65 gene plants Nicotiana benthamiana, N. tabacum cv. TNN and (unknown function) also have a single ORF arrangement N. rustica reacted with symptoms of necrotic spots and compared to the Ag2D genome, in which the gene is split necrosis in the veins. The virus produced strong necrosis into two ORFs. Interestingly, in the broa (ORF6) and bro on Physalis pubescens, Datura metel and Nicandra b (ORF7) genes of the Ag16 clone, the major difference physaloides, resulting in plant death. The molecular was a deletion of about 700 bps, resulting in a fusion of both genes into a single ORF. This was not observed of a potyvirus using a potyvirusuniversal primer pair. neither in the Ag2D nor in the Ag01 clone. These clones Totalidentification RNA was of extracted the BsCuritiba and subjected was initiated to RT byPCR a search using have polymorphism in genomic regions which have not primers that amplify a 1.7kb fragment in the 3’end of been described in the literature yet. The comparative the genome. The amplicon was cloned and the insert genomic analysis is an approach that can bring relevant sequence determined. The sequence share a nucleotide information on virus diversity and the mechanisms used by the virus to adapt to a new environment. AB551370). It was concluded that Brugmansia suaveolensidentity of 98% mottle with virus the isBs alsoCampinas present isolate in ‘trombeteira’ (Accession PIV218 - DETECTION OF CULEX QUINQUEFASCIATUS plants in Curitiba. NATURALLY INFECTED BY INSECTSPECIFIC VIRUSES IN CUIABÁ, MATO GROSSO, BRAZIL PIV217 - COMPARATIVE GENOMIC ANALYSIS OF TWO de Lara Pinto, A.Z.; Serra, O.P.; Cardoso, B.F.; Carvalho, ANTICARSIA GEMMATALIS CLONES OBTAINED FROM M.S.; Anjos, T.P.; Burlamaqui, T.C.T.; Oliveira, L.F.; A NATURAL ISOLATE FOUND IN THE FIELD Oliveira, R.S.; Vasconcelos, J.M.; Lemos, P.S.; Nunes, Silva, A.M.R.; Melo, F.L.; Ferreira, B.C.; Ribeiro, B.M. M.R.T.; Dezengrini Slhessarenko, R. UNIVERSIDADE DE BRASILIA 1. UNIVERSIDADE FEDERAL DE MATO GROSSO Baculoviruses are pathogenic to insects and have been 2. INSTITUTO EVANDRO CHAGAS effective in controlling agricultural and forest insect pests. In Brazil, the baculovirus Anticarsia gemmatalis capable of replicating only in invertebrate cells. Culex multiple nucleopolyhedrovirus (AgMNPV) has been Insectspecific viruses comprise a new group of viruses used as a biological insecticide since the early 80’s to genus isolated from Culex spp in several countries. This control the soybean caterpillar, Anticarsia gemmatalis, a studyflavivirus aimed is anto insectinvestigatespecific the virus frequency of the of Flavivirus natural major pest of this crop. In this study, we sequenced the infection of adult mosquitoes by viruses in Cuiabá city, entire genome of two clones (Ag01 and Ag16) derived Mato Grosso, Brazil. To achieve that, Culicidae females from a natural population of AgMNPV occurring in the (n=4,556) belonging to 14 species sampled in 200 urban census tracts pooled according to collection by either using the plaque assay technique (Ag16) or by site, species and gender were subjected to RTPCR for serialfield (Ag dilution79). The (Ag Ag01)01 of and the Ag Ag1679. clones These were isolates obtained were a NS5 region, nucleotide sequencing, viral isolation in selected for genomic analysis because they showed differences in the virulence pattern in the bioassay. DNA from both clones was extracted and sequenced using the Cx.C6/36 quinquefasciatus, cells and IonTorrent the most plataform. abundant Culex species. Flavivirus The pyrosequencing technique, and the data was analyzed nucleotide(CxFV) was sequences detected inpresented 16/403 (MIR=4.6)a high similarity pools of using the Geneious software R6. The entire genome with CxFV sequences from México, Uganda and Brazil.

140 Plant and Invertebrate Virology: PIV

Phylogenetic analysis showed that the Cuiabá isolates genotype (genotype II) based on envelope protein. This to(third third instar). instar In C. the includens second, semilarvae.purified The virusmortality particles was are closely related to Africa/Caribbean/Latin American were incorporated to the artificial diet and offered Brazil. Studies suggest that Cx. pipiens are the main LC50 and LC99 were calculated using Probit analysis. hostis the of first genotype report ofI strains CxFV in and central Cx. westernquinquefasciatus region of Toverified select at a 10 good and candidate15 d.p.i. and for the in lethalvitro multiplicationconcentration of genotype II strains of the virus. One pool of Cx. of the virus, analysis was performed with six different quinquefasciatus females presented also the genome lepidopteran cell lines: Bombyx mori (BM5), Lymantria sequence of a Negevirus, similar to species Bustos and dispar (IPLBLD625Y), two Trichoplusia ni (BTITn5B14 Dezidougou viruses (MIR=0,3). Negeviruses is a novel and TN368), and two Spodoptera frugiperda cells (IPLB SF21AE and Sf9).The cells were seeded at a density nine species capable of infecting several hematophagous of 1x106 per 60mm2 dish. The virus was obtained group of insect specific viruses composed by at least from infected larvae hemolymph at 4 d.p.i., treated geographical distribution. The pathogenicity of CxFV and allowed to be adsorbed by cells during 1 hour. andinsects, negeviruses as mosquitoes for humans and sand and flies,their presenting interference a widewith Then, the cells were kept in TNMFH complete medium arbovirus replication in competent vectors is largely and incubated at 270C. Morphological analysis was unknown, however, recent studies suggest that the an Olympus CK2 optical microscope. The best results in of the mosquitoes for some arboviruses resulting in monitored by light microscopy during five days, using superinfectioninsectspecific viruses exclusion could or alterby alteration the vector of competencethe vector’s immune response. the bioassays were obtained with the semipurified virus. The LC50 obtained was 10,918 polyhedra/ ml artificial PIV219 - IN VIVO AND IN VITRO VIRULENCE ANALYSIS diet (pol/ml) and the LC99 was 247,710 pol/ml, at10 OF A BACULOVIRUS ISOLATED FROM CHRYSODEIXIS analysisd.p.i. Furthermore, of the cell at 15lines d.p.i incubated the LC50 waswith 6,709 this pol/mlisolate (=PSEUDOPLUSIA) INCLUDENS, A SOYBEAN PEST IN showedand LC99 typical was 146,880 cytopathic pol/ml. effects In addition, as cell preliminary rounding, THE BRAZILIAN CERRADO nuclear hypertrophy and the presence of polyhedra de Souza, M.L.; Sanches, M.M.; Sihler, W.; Sosa Gomes, inTn5B14 cells at 4 d.p.i. The bioassays showed potential D.R. to use this virus isolate as a biopesticide. Moreover, the 1. EMBRAPA RECURSOS GENÉTICOS E Tn5B14 cell line demonstrated to be prospective for BIOTECNOLOGIA further in vitro studies. 2. EMBRAPA SOJA PIV220 - COMPARISON OF THE INFECTIVITY OF TWO Baculovirus are important biological control agents of SPODOPTERA FRUGIPERDA CELL LINES TO SFMNPV Lepidoptera. In February 2014, larvae with symptoms of viral infection were observed in populations of de Souza, M.L.; Sihler, W.; Sanches, M.M.; Barros, Chrysodeixis (=Pseudoplusia) includens infesting A.M.R.; Valicente, F.H. 1. EMBRAPA RECURSOS GENÉTICOS E Observations of larval tissue under optical microscope BIOTECNOLOGIA showedsoybean the field presence at Buritis ofMG typical (S15o22.2´ virus W46o50.7´).particles of 2. UNIVERSIDADE PAULISTA 3. EMBRAPA MILHO E SORGO as Pseudoplusia includens single nucleopolyhedrovirus The fall armyworm, Spodoptera frugiperda, is a severe (PsinSNPV)Nucleopolyhedrovirus by transmission (NPV). electron The virus microscopy. was identified The pest in South America causing damage to different present work was carried out in order to investigate crops, especially in maize. The Spodoptera frugiperda the potential of this viral isolate to control this insect Multiple Nucleopolyhedrovirus (SfMNPV), a baculovirus highly pathogenic to this pest, has been largely used as infected with virus were macerated and incorporated to a biocontrol agent. So far the baculovirus production pest. Two bioassays were performed. In the first, larvae has been done by multiplication of the virus in its insect theVirus artificial Reviews & diet Research and Voloffered 20 (2), toAugust-December 432 C. inludens 2016 larvae - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

141 Plant and Invertebrate Virology: PIV

and cannibalism behavior. Therefore, optimization tabaci. Tomato sereve rugose virus (ToSRV) is the most ofhost baculovirus in despite in of vitro difficulties production as intense is essential cuticle as lyses an importantThese viruses begomovirus are transmitted reported by thein the whitefly country. Bemisia The alternative technology. In the present work, the SfMNPV production in IPLBSF 21AE and Sf9 cell lines were the use of resistant cultivars and the chemical control compared. The polyhedra yield was determined as well as ofcontrol insect of vectors. these viruses There is adifficult, lack of andinformation usually relyon theon the kinetics of viral protein synthesis. In addition, larval cultural practices that could be implemented to reduce mortality was determined by virulence assays with 3th to 4th instar larvae. Cells seeded at a density of 2X106 in transplantsthe incidence age of tomatoes the begomovirus on the begomovirus in the field. infection The for 1h adsorption time and kept in TNMFH complete rateobjective and symptomof this study expression. was to evaluate The susceptible the influence cultivar of mediuma T25 flasks at 270C.were incubated At 5 dpi withthe cells the SfMNPVwere collected I19 isolate by centrifugation at 3000rpm for 5 min. The cell pellet of 20, 30, 40, 50 and 60 days after seeding (DAS) were distributedH9553 was usedin three with blockswhitefly (completely inoculation. randomized) Transplants 270C. Polyhedra was placed in a Neubauer chamber and with 10 plants for each treatment. Inoculation was countedwas disrupted under an by optical treatment microscope. with 1% For SDS, kinetics for 1h,of the at performed by B. tabaci biotype B viruliferous to ToSRV. protein synthesis both cell lines were seeded at a density Negative controls consisted of plants inoculated with of 1X106 per 60mm2 dish and incubated with the virus. After that, pulse labelling was carried out by addition andaviruliferous by detection whiteflies tests based and plants on PCR without and hybridization. the presence and 72h pi. Analyses of the labelled proteins was done Thereof whiteflies. was a clear The difference evaluation in wasthe rate performed of infection visually and byof 50SDS–PAGE uCi of [35S] followed methionine by autoradiography. per dish at 0h, Comparison 24h, 48h severity of the symptoms observed in plants inoculated of the two cell lines infected with the virus showed that at distinct ages. The treatment with plants of 20 DAS polyhedra production was similar in both cells ranging by plants with 30, 50, 60 and 40 DAS. Plants inoculated of radiolabed proteins showed that the cell protein had the highest incidence of infection (50%), followed synthesisfrom 200 400was polyhedra/cell.shut off while an As intense expected, band the of kinectsaprox. For symptom severity, plants inoculated at 40 DAS 30 kD (polyhedrin) was synthesized in SF21 and Sf9 showed40 DAS showedthe least the severe lowest symptoms, rate with followed 20% of byinfection. plants cells. Assays with Spodoptera frugiperda larvae showed inoculated at 60 DAS. The results suggest that the age of that the virus produced in cell culture was pathogenic to its host. The present data indicates that cell culture of a disease caused by a begomovirus. Further studies is a viable system for baculovirus in vitro production the transplants influence the incidence rate and severity and reinforces the need to optimize strategies for large production in bioreactors. arePIV223 in progress - IMMUNOSTAINING to confirm this result. OF ROOT TISSUE OF NICOTIANA BENTHAMIANA INFECTED WITH PEPPER PIV221 - INFLUENCE OF THE AGE OF TOMATO RISNGPOT VIRUS TRANSPLANTS ON THE RATE OF INFECTION AND Tavares, M.L.; Blawid, R.; Nagata, T.; Inoue Nagata, SYMPTOM SEVERITY CAUSED BY THE BEGOMOVIRUS A.K. TOMATO SEVERE RUGOSE VIRUS 1. UNIVERSIDADE DE BRASILIA Rodrigues, C.S.; Macedo, M.A.; Rêgo, C.M.; Michereff 2. CENTRO NACIONAL DE PESQUISA EM Filho, M.; Inoue Nagata, A.K. HORTALIÇAS 1. UNIVERSIDADE DE BRASÍLIA The genus Tobravirus is formed by three species: Tobacco 2. EMBRAPA HORTALIÇAS rattle virus (TRV, type species), Pea early browning High incidence of viral diseases is reported in tomato virus (PEBV) and Pepper ringspot virus (PepRSV). The plants, particularly those caused by begomoviruses genome of a tobravirus is formed by two segments of (Fam. Geminiviridae, gen. Begomovirus) in Brazil. single stranded RNA molecules. Because of their ability

142 Plant and Invertebrate Virology: PIV to be transmitted by nematodes of genera Trichodorus viruses, overcoming previously technical barriers. and Paratrichodorus they are thought to be present in Therefore, through next generation sequencing (NGS) high titers in the root tissues. The objective of this study and metagenomics analysis a novel plant virus related was to immunolocalize the PepRSV capsid protein (CP) to Rhabdoviridae family was found infecting arracacha in the root tissue of Nicotiana benthamiana. Plants of plants. Here we describe the molecular characterization N. benthamiana were inoculated with the CAM isolate of this putative new rhabdovirus genome. To this extent, based on NGS sequence information, primers were designed to amplify the full viral genome containing withof PepRSV. the polyclonal After 14 days,antibody the rootsagainst were the collected, CP of PepRSV, fixed overlapping regions. Initially, the presence of this new produced(3% paraformaldehyde, in the Laboratory 0.1% of glutaraldehyde),Virology of the ´Centro treated Nacional de Pesquisa em Hortaliças´, and later treated in 36 arracacha plants out of 47 analyzed. One plant with antirabbit conjugated with alkaline phosphatase wasputative selected plant and rhabdovirus total RNA extracted was confirmed aiming byto amplify RTPCR (AP). Chromogenic substrates, 5bromo4chloro3 indolyl phosphate (BCIP) and nitro blue tetrazolium fragments were sequenced by Sanger sequencing. The chloride (NBT), were used for immunodetecting AP RACEfive overlapping technology regionswas used of to the determine genome. both All amplified5’ and 3’ activity. BCIP is hydrolized by AP and intermediates terminals. The genomic organization resembles those undergo dimerization with the help of NBT. At the end of plant rhabdoviruses. Six open reading frames (ORFs) of the reaction an insoluble darkblue precipitate is formed consisting of NBTdiformazan and 5,5`dibromo negativesense, singlestranded viral RNA, in the following 4,4` dichloro indigo. The immunostained tissue was orderwere identified3\’NP4bM in GL the5\’. Amino antigenomic acid sequence orientation analysis of the of microscope (Leica Microsystems, Wetzlar, Germany). with N proteins encoded by other plant rhabdovirus Stronganalyzed chromogenic with the Leica signals TCS/SP5 were confocal observed laserscanning in the genomes.the putative Phylogenetic nucleoprotein analysis (N) of showed the N and 941% polymerase identity phloem cells of the root tissue in PepRSV infected N. (L) amino acid sequence indicated that this arracacha infecting rhabdovirus is related to viruses belonging to translocate to root tissues. No positive signal was Cytorhabdovirus genus, and are closely related to Alfalfa observedbenthamina in plantsnoninoculated suggesting plants that theof N.virus benthamiana efficiently dwarf virus. According to Rhabdoviridae Taxonomy (negative control). We concluded that the CAM isolate of PepRSV translocates via vascular system (phloem) to the root tissue, similar to the other two tobraviruses, TRV Group (ICTV), genus classification based on sequence and PEBV. thediversity novel has virus thus foundfar correlated infecting 100% arracacha with classification should be consideredby intracellular as avirus new maturation.species of Givingthe Cytorhabdovirus these findings PIV226 - A NOVEL CYTHORHABDOVIRUS IN genus. ARRACACHA (ARRACACIA XANTHORRHIZA) Gomes, S.S.V.S.F.; Blawid, R.; Costa, G.A.; Nagata, T.; PIV231 - DISCOVERY OF A NOVEL DICISTROVIRUS Madeira, N.R.; Inoue Nagata, A.K.; Resende, R.O.; ISOLATE IN TOMATO LEAF SAMPLES Orílio, A.F. Nakasu, E.Y.T.; Rêgo, C.M.; Ardisson Araújo, D.M.P.; 1. EMBRAPA HORTALIÇAS Ribeiro, B.M.; Inoue Nagata, A.K. 2. UNIVERSIDADE DE BRASÍLIA 1. EMBRAPA HORTALIÇAS Arracacha (Arracacia xanthorrhiza) is one of the most 2. UNIVERSIDADE DE BRASÍLIA important cultivated Andean roots, belongs to the 3. UNIVERSIDADE FEDERAL DE SANTA MARIA family Apiaceae, which includes carrot, celery and The family Dicistroviridae is composed of viruses that parsley. It is vegetatively propagated, and therefore it infect invertebrates, including insects such as honeybees accumulates high amounts of degenerative pathogens and hemipterans. Therefore, these viruses might provide such as viruses. The viral metagenome sequencing practical applications for controlling agricultural brings many possibilities of identifying unknown arthropod pests. Our group is currently making efforts

143 Plant and Invertebrate Virology: PIV

PIV233 - SEQUENCE VARIABILITY AND EVOLUTION biological control agents in integrated pest management OF TOMATO CHLOROSIS VIRUS IN BRAZIL to identify whiteflyinfecting viruses that can be used as programmes. The surveys are carried out directly in Coelho, L.M.; Souza, T.A.; Macedo, M.A.; Nakasu, E.Y.T.; Pontes, N.C.; Inoue Nagata, A.K.; Albuquerque, L.C. 1. INSTITUTO FEDERAL GOIANO generationwhiteflies and sequencing also in whitefly (NGS) approach.infested plants. Tomato Here, leaves we report the identification of a dicistrovirus using a next 2. EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA 3. INSTITUTO FEDERAL GOIANO bywere differential collected incentrifugation, São Paulo state total in 2013 RNA and was kept extracted at 80 °C Tomato chlorosis virus (ToCV, genus Crinivirus, family anduntil subjectedprocessing. to After NGS semi sequencingpurification at of Macrogen, virus particles Inc. Reads were trimmed with an automatic Phred score on with a bipartite RNA genome (RNA1 and RNA2). The Trimommatic before contigs were assembled using the RNA1Closteroviridae) encodes proteins is a whiteflyinvolvedtransmitted in replication crinivirus of viral Velvet algorithm (91kmer) and analysed for their shared RNA and suppression of gene silencing, while RNA2 identities with other viruses in a RefSeq database using encodes proteins likely involved in viral movement MegaBLAST on Geneious software. Forty contigs ranging and encapsidation. In the last years, this virus is from 190 to 1,228 nt shared high percentage identity emerging as a serious threat to tomato crops in Brazil. During 2015, surveys were done on tomato (Solanum virus (ALPV). These contigs were used as reference for lycopersicum) virus diseases in three states of Brazil: sequence(>80%) with extension the dicistrovirus using the Geneious Aphid mapper. lethal paralysisBy using Goiás (GO), Paraná (PR) and Rio de Janeiro (RJ). Samples this strategy, a 9,936 ntlong sequence was generated exhibiting interveinal chlorosis on the basal leaves, typical symptoms of ToCV, were collected. Total RNA from 278,669 reads. The sequence presented 86% was extracted from 64 samples and the presence of fromoverall nt identity 592 to 6699with ALPVand coding (acc. JQ320375,for a putative 97% protein query cover, Evalue=0.0) and two major ORFs, the first ranging fragmentToCV infection of approximately confirmed by463 reverse pb. A total transcription of 55 samplesPCR Evalue=0.0) and the second ranging from nt 6896 to (RTPCR) using the specific primers, which amplifies a similar to ALPV nonstructural polyprotein (92% identity, identity, Evalue=0.0). As this virus presumably infects evolutionwere PCR of positive ToCV species (14/14 infecting from GO, tomatoes 23/23 from in Brazil, RJ and 10 insects,9301, coding pathogenicity for an tests ALPV werelike capsidinitiated protein in insect (92% cell isolates18/27 from from PR).each InBrazilian order tostate study were the selected. variability Primers and were designed to amplify three genomic regions coding three genes, p22 (RNA1), HSP70h and CP (RNA2), which lepidopteranlines. The extract cell containingline UFLAg. semi Cytopathicpurified effects particles such used as amplify fragments of 720, 936 and 917 pb, respectively. vacuolizationfor NGS sequencing and cell wasrounding filtered were and evident inoculated following into PCR products were cloned and sequenced. Preliminary ten days postinoculation. Furthermore, reinoculation of results based on p22 protein from a population of PR the cell media into healthy cells consistently produced state indicate nucleotide diversity ranged between 0.1 cytopathic effects. These results demonstrate the feasibility of using NGS methods for discovery of new virus isolates. nonand synonymous 0.3% and interpopulation rates indicate betweenthat this 0.1population and 3.2%. is underVirus positive evolution selection predictions suggesting based adaptation on synonymous/ to a new ecological niche. Interesting, in phylogenetic analyses, these isolates grouped in a regular manner suggesting a geographicalbased evolution pattern. However, only one location has been completely analyzed, data from other regions (RJ e GO) will be useful to determine the true diversity of Brazilian isolates.

144 Plant and Invertebrate Virology: PIV

PIV235 - DETECTION OF LEISHMANIAVIRUS IN PIV237 - AN SYBR GREENBASED REALTIME RTPCR LEISHMANIA PARASITES FROM AMAZON REGION OF ASSAY TO DISTINGUISH GROUNDNUT RINGSPOT BRAZIL VIRUS AND TOMATO CHLOROTIC SPOT VIRUS Oliveira, R.R.; Barata, R.R.; Bularmaqui, T.C.T.; Costa, G.A.; Orílio, A.F.; Blawid, R.; Resende, R.O. Vasconcelos, J.M.; Oliveira, L.F.; Silva, D.E.A.; Lemos, UNIVERSIDADE DE BRASÍLIA P.S.; Franco Filho, L.C.; Costa, K.S.; Cardoso, J.F.; Groundnut ringspot virus (GRSV) and Tomato chlorotic Silveira, F.T.; Vianez Jr, J.L.S.G.; Nunes, M.R.T. spot virus (TCSV) belong to the genus Tospovirus 1. UNIVERSIDADE FEDERAL DO OESTE DO (Bunyaviridae family) and have a similar host range, PARÁ causing high economic losses in several vegetable crops 2. INSTITUTO EVANDRO CHAGAS/ in Brazil. Their genomes consist of three segmented LABORATÓRIO DE LEISHMANIOSES RNAs: L, M and S, in which they share biological and 3. INSTITUTO EVANDRO CHAGAS/CENTRO DE INVOVAÇÕES TECNOLÓGICAS distinguish these viruses in single or mixed infections. The Leishmaniavirus (LRV) genus is part of Totiviridae Inserological this study, properties, we developed making a highly it difficult sensitive to accuratelyand rapid family and includes endogenous doublestranded RNA detection method for GRSV and TCSV by Sybr Green virus of Leishmania sp., where a virushost relationship is unclear. Thus, this study aimed to investigate the designed to amplify a fragment of approximately 150pb presence of LRV at Leishmania sp. strains isolated in inbased the same Real Timeregion RT ofPCR. the segments Firstly, specific L and S primers of each virus were the Amazon region. The detection of Leishmaniavirus based on alignment of complete genome. An isolate was conducted in 40 Leishmania strains belonging to of GRSV (Tom#47) and TCSV (Tom#59) from tomato the collection of the Leishmaniasis Laboratory at the plants were mechanically inoculated separately in healthy Datura stramonium and Nicotiana rustica plants, step was precipitation of the total doublestranded RNA and after the appearance of symptoms, leaves were Evandro Chagas Institute (Pará State/ Brazil). The first of Leishmania sp. strains, followed by sequencing using collected for total RNA extraction using TRIzol reagent Ion Torrent PGM ™ plataform and mapping the generated (Invitrogen), following the manufacturer\\\’s protocol. readings against the reference genome (Leishmania RNA cDNA synthesis was performed using MMLV reverse virus 1 and Leishmania RNA virus 2) available at GenBank transcriptase (Invitrogen) with random primers. Real (NCBI). For positive samples, genome was assembled by Time PCR was performed using Power Up SYBR Green De novo approach. Among readings generated, only eight Master Mix (ThermoFisher) following manufacturer\\\’s samples had nucleotide sequences related to the virus, instructions and the RotorGene equipment (Qiagen). comprising the following species of protozoa: Leishmania Melting temperature analysis generated a segment (V.) shawi, Leishmania (V.) guyanensis, Leishmania (V.) Lindemberg, Leishmania (V.) lansoni and Leishmania for GRSVL, GRSVS, TCSVL and TCSVS, respectively. The (V.) braziliensis. All viral readings were related to analysisspecific ampliconindicated atno 79,2°C, primer 76,2°C,dimers 75,8°Cin the and assay. 78,2°C No crossreaction was observed with GRSV, TCSV and also occurrence of this species is related to protozoa strains to Tomato spotted wilt virus. Therefore, the SYBR green Leishmania RNA virus 1. Thus, it is confirmed that the of the \”New World”. The occurrence of Leishmaniavirus based real time RTPCR assay could provide a rapid, was also detected in Leishmania strains (V.) guyanensis lower costs for high throughput screening of suspected further reported. Furthermore, genome assembly tospovirussensitive, specificinfected and samples reliable with alternative the most approach prevalent with isolated from Bradypus sp. and this finding was not analysis revealed possibility of the presence of more species in BrazilIn addition, the developed method can than one viral strain within the same host. Thus, the use be used to monitore virus epidemiology, to study virus of new generation sequencing becomes extremely useful for detection and characterization of viral strains, such as Leishmaniavirus. resistance and virus synergism under field conditions.

145 Plant and Invertebrate Virology: PIV

PIV239 - IDENTIFICATION OF A POTATOINFECTING PIV240 - VIRAL BIODIVERSITY IN PLEBOTOMINAE BEGOMOVIRUS IN THE CENTRAL REGION OF BRAZIL CAPTURED IN PANTANAL AND CHAPADA DOS Lima, M.F.; Ribeiro, S.G.; Inoue Nagata, A.K.; Nakasu, GUIMARÃES OF MATO GROSSO, BRAZIL E.Y.T. Carvalho, M.S.; de Lara Pinto, A.Z.; Rodrigues, J.S.V.; 1. EMBRAPA RECURSOS GENÉTICOS Ribeiro, A.L.M.; Melo, F.L.; Dezengrini Slhessarenko, 2. EMBRAPA HORTALIÇAS R. Potato is one of the most important vegetable crops 1. UNIVERSIDADE FEDERAL DE MATO GROSSO in Brazil. Production is concentrated mainly in three 2. SECRETARIA DE SAÚDE DE MATO GROSSO regions, South, Southeast, and CentralWest. Cristalina 3. UNIVERSIDADE FEDERAL DE BRASILIA county, located in the state of Goiás, is considered as one Arboviruses transmitted by phlebotominae present of the major region for potato production in the country. considerable medical importance, since many were In 2012, the production of potato reached 300,000 isolated from these arthropods and humans in the Brazilian Amazon. This study was conducted to in Cristalina. Monitoring potato plants exhibiting investigate the viral biodiversity in phlebotominae begomovirustons (10% oflike national symptoms share) inhas 6,000 been hectares performed planted in captured with CDC traps in two sylvatic areas of Cerrado potatogrowing areas since 2011.The incidence of of Mato Grosso containing RAPELD systems: the Chapada dos Guimarães National Park (PNCG, Rio Claro) and 20132014 growing seasons. The objective of this work North Pantanal (Pirizal) during the rainy, intermediate wassymptoms to identify in potato begomovirus fields was species generally infecting low duringpotato plants in the central region of Brazil. Leaf samples were collected from 20 plants showing yellow mosaic and leaf and dry seasons of 20142015. After identification with a specific dichotomy key, 105 specimens (90 belonging to days after planting, at Cristalina in 2014. Total DNA was weregenus allocated Lutzomyia 11 [L. pools. witmani, These L. pools evandroi, were L.minced carmelina and, extracteddeformation from symptoms samples inand potato testedgrowing by polymerase fields, 50 chainto 60 subjectedand L. sherloki to viral wilsoni], RNA extraction, and 15 to reversegenus Brumptomyia) transcription, reaction (PCR) using degenerate begomovirusgroup synthesis of the second strand of cDNA and PCR

1.1 kbp of the A component. Ten begomoviruspositive specific primers, which amplify a DNA fragment of ca. sequencedamplification by withillumina viral HiSeq randomic 2500 primers platform. (random Partial (RCA) using Phi 29 DNA polymerase. RCA products were KS). The purified and quantitated DNA product was digestedsamples werewith selectedrestriction to enzymes Rolling Circle and Hind Amplification III was sp. revealed hits with sequences of vesiculovirus, selected for cloning the genome. RCAdigested products analysis of contigs obtained from five pools of Lutzomyia tospovirus. Since the whole arthropod was used in the experiment,pegivirus, flavivirus,is possible phlebovirus,that some of these nairovirus sequences and pBluescriptwere electrophoresed vector. Out on of 1.2% the agarose20 samples, gel and 15 a were DNA originated from their gastrointestinal contents or either positivefragment by of PCR,ca. 2.6 showing kb was agel ca.purified, 1.1 kb andDNA cloned amplicon. into from their exterior parts in contact with plants and Initial sequences of 750 bp, from DNAA of all ten selected animals. with Tomato severe rugose virus (ToSRV), a pathogen thatsamples, primarily share infects from tomato. 94% to It 98% is concluded nucleotide that identity ToSRV is likely to be the predominant begomovirus in potatoes in the Cristalina region.

146 Plant and Invertebrate Virology: PIV

PIV241 - PRODUCTION OF INFECTIOUS CLONES PIV248 - RECOMBINATION EVENTS IN FULL GENOME OF WEEDINFECTING BEGOMOVIRUSES FOR SEQUENCES OF APPLE STEM GROOVING VIRUS PATHOGENICITY STUDIES Souza, E.B.; Nickel, O.; Nagata, T.; Silva, J.M.F.; Fajardo, Mansilla Córdova, P.J.; Barreto, S.S.; Inoue Nagata, T.V.M.; Barros, D.R. A.K. 1. EMBRAPA UVA E VINHO EMBRAPA HORTALIÇAS 2. UNIVERSIDADE DE BRASÍLIA 3. UNIVERSIDADE FEDERAL DE PELOTAS The genus Begomovirus has the highest number of known viral species. Some of them are responsible for Apple stem grooving virus (ASGV), type species of the large agricultural losses such as Tomato severe rugose genus Capillovirus, is disseminated worldwide. No vector virus (ToSRV) in Brazil. Euphorbia heterophylla and Sida is known and the virus is transmitted only by grafting, spp. are weeds frequently found in tomato production usually causing a latent infection in most commercial cultivars of apple trees. However, infected scions grafted species. The aim of this work was to obtain infectious onto sensitive material display reduction of yield, loss clonesfields and of actweed as hostsinfecting of ToSRV begomoviruses, and other begomovirus Euphorbia of fruit quality and tree decline. Currently twenty three yellow mosaic virus (EuYMV) and Sida micrantha complete nucleotide sequences of this virus species are mosaic virus (SiMMV), for studies of characterization, available in the GenBank. Here we report recombination interaction between viruses and pathogenicity in tomato events along the complete genome sequences of ASGV plants. EuYMV and SiMMV isolates were obtained from using two Brazilian isolates (M2193 and M220) and E. heterophylla and S. santaremnensis plants naturally values for the recombination events were evaluated by sevensequences programs available built in the in GenBankthe RDP4 database. software Confidence package: infected in the field. Total DNA was extracted and RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan (RCA)the begomovirus technique followed species by identified digestion by with PCR. restriction Circular and 3Seq. Events detected by RDP with a pvalue under 1 endonucleasesDNA was amplified and dimeric by the rollingmolecules circle (4.8 amplification to 5.4 Kb) were recovered after electrophoresis. The inserts were length genome analysis, six potencial recombinants, not cloned in the pCAMBIA0380 vector. Two clones were previouslyx 106 were reported,considered were significant detected. in Fourthis study. recombinants In a full obtained for each viral component. The EuYMV DNA apple isolates, NC_001749 (Japan), JQ308181 (China), KJ579253 (China) and M2193 (Brazil) showed as major parents, apple isolate M220 (Brazil), lily isolate A clones shared 97 to 99% to EuYMV DNAA accession D16681 (Japan), apple isolate M2193 (Brazil) and lily JF56676; the EuYMV DNAB clones 98% to EuYMV DNAB isolate AB004063 (Japan), respectively. JQ308181, accession JF756678; the SiMMV DNAA clones 99 to 100% M2193 and KJ579253 shared the same minor parent, plasmidsto SiMMV DNAwereA accessiontransformed JX415194; into and Agrobacterium SiMMV DNAB M220. NC001749 showed as minor parent, JQ308181. tumefaciensclones 96% to and SiMMV inoculated DNAB AJ557452. in test plants. The recombinant Inoculated One recombinant pear isolate (JN701424 from China) plants are under analysis. These clones will be useful for showed citrus isolate LC143387 (Japan) as major parent studies on pathogenicity and virusvirus interaction in and apple isolate KF434636 (China) as minor while the weeds and tomato plants. recombinant LC143387 was originated from JN701424 (major parent) and pear isolate AY596172 (Korea). Among recombinants shown we have observed recombination between isolates from different countries and different hosts species. Recombinant events were likely a result from exchange of propagation materials and vegetative propagation and could play a role in virus evolution, emergence and epidemiology. It likely contributes to virus survival, adaptability to environmental factors and new hosts, increase in virulence and genetic diversity.

147 Plant and Invertebrate Virology: PIV

PIV249 - PEPPER RINGSPOT VIRUS ISOLATE in the plant after symptom disappearing. Only the CHARACTERIZATION AND PRODUCTION OF A local symptomatic leaves of Chenopodium spp and N. POLYCLONAL ANTIBODY physaloides, but not upper leaves, became positive in Tavares, M.L.; Nagata, T.; Inoue Nagata, A.K. serological detection. No signal was observed in healthy plants. It is concluded that the polyclonal antibody 1. UNIVERSIDADE DE BRASILIA 2. CENTRO NACIONAL DE PESQUISA EM HORTALIÇAS rapid serological detection of the virus. reacted specifically with PepRSV and can be used for a The genus Tobravirus is formed by three species: Tobacco PIV250 - STRANDSPECIFIC REALTIME RTPCR rattle virus (TRV, type species), Pea early browning virus ASSAYS FOR QUANTIFICATION OF GENOMIC AND (PEBV) and Pepper ringspot virus (PepRSV). PepRSV is ANTIGENOMIC RNAS OF TOMATO SPOTTED WILT the only tobravirus that occurs in Brazil and has been VIRUS Orílio, A.F.; Costa, G.A.; Blawid, R.; Resende, R.O. crops. The objective of this study was to produce a UNIVERSIDADE DE BRASÍLIA polyclonaldetected in antiserum the field ofagainst tomato, PepRSV pepper to and be artichokeused in diagnosis. The CAM isolate of PepRSV was propagated in Bunyaviridae) (TSWV), infects over 1000 plant species Tomato spotted wilt virus (genus Tospovirus; family according to the protocol of Nixon & Harrison (1959). Nicotiana benthamiana, and the particles were purified agronomic and horticultural crops. Their genome are threeand causessingle stranded, significant negative economicsense damage RNAs tothat many are withPurified Freund\’s particles complete were used (1st) for threeand incompleteimmunizations (2nd, in individually encapsidated, they differ in size and are 3rd)rabbits adjuvant. at intervals Bleeding of three started weeks one after week emulsification after the last called large (L), middle (M) and small (S). For viruses having a singlestranded, negativesense RNA genome, standard qRTPCR assays do not distinguish between presenceimmunization. of tubular The andpurified rigid virus particles preparation with two observed different the genomic (negativesense genome) and antigenomic lengths.in transmission This preparation electron microscopycontained a confirmedprotein of theca. RNA (positivesense). Thus, these methods are unable 30 kDa observed in a polyacrylamide gel. This protein to determine viral genome copy numbers. To better reacted positively with the produced polyclonal antibody understand TSWV replication and transcription cycle, in a Western blotting test. Then, indicator plants were quantitative detection methods for distinguishing TSWV inoculated with PepRSV and tested by DotELISA. The genomic RNA (gRNA) and antigenomic RNA (agRNA) virus caused local lesions in Chenopodium quinoa, C. in TSWVinfected plants are indispensible. Therefore, amaranticolor, C. murale, Nicandra physaloides, but no systemic infections were observed in these plants. The was developed to quantify independently the two types in this study, a strandspecific realtime RTPCR method systemic necrotic lesions were observed in Gomphrena of TSWV viral RNA (gRNA and agRNA) of the three globosa, Nicotiana rustica, N. tabacum cv. Samsun and segments. This method is based on reverse transcription cv. TNN. The chlorotic rings and line patterns were using tagged primers added of a \’tag\’ sequence at the observed in Capsicum annuum cv. Casca Dura Ikeda, 5\’ end. Realtime PCR using the \’tag\’ portion as the Solanum lycopersicum cv. Santa Clara. N. benthamiana showed crumpling symptom. In general, the symtoms forward primer and a segmentspecific reverse primer in S. lycopersicum and C. annuum and N. benthamiana RNA. Validation of this strategy has been performed ensured the specificity for quantifying both types of plants were disappearing with time. Serological tests with synthetic RNA transcripts obtained from full length TSWV segment clones by T7 RNA polymerase reactions observed only in inoculated plants. ELISA tests and demonstrated that assays could discriminate the wereconfirmed done theevery specificity week up of to the six antibody weeks post with inoculation. the positive The virus could be detected in the indicator plants with After validation, this method will be applied to evaluate correct RNA strand with greater than 1000fold fidelity. systemic infection in all time points, although symptom the gRNA and agRNA levels of L, M and S segments in was not clear,suggesting that the virus remained present tomato plants infected with TSWV at different times

148 Plant and Invertebrate Virology: PIV postinfection. In conclusion, a realtime RTPCR for PIV264 - FIRST REPORT OF TOMATO SEVERE RUGOSE VIRUS IN COMMON BEANS IN BRAZIL Inoue Nagata, A.K.; Macedo, M.A.; Barreto, S.S.; Costa, absolute quantitation of specific viral RNA fragments in The development of this assay will be helpful for further T.M.; Maliano, M.R.; Rojas, M.R.; Gilbertson, R.L. studiesTSWVinfected on the plantspathogenesis was developed and control for the strategies first time. of 1. EMBRAPA HORTALIÇAS TSWV, understanding the tospovirus virus life cycle, 2. UNIVERSIDADE DE BRASILIA including transcription and replication. 3. UNIVERSIDADE DA CALIFORNIA PIV252 - VIROME OF SWEET POTATO GENOTYPES In Brazil, diseases caused by begomoviruses may lead to Souza, C.A.; Pires, A.R.F.; Naito, F.Y.B.; Orílio, A.F.; severe losses in common beans and tomatoes. In beans, Melo, F.L.; Pereira Carvalho, R.C. the disease is primarily caused by Bean golden mosaic virus and in tomatoes, Tomato severe rugose virus UNIVERSIDADE DE BRASÍLIA (ToSRV) is currently the predominant begomovirus The sweet potato (Ipomoea batatas L.) is a vegetable of found in the country. During epidemiological studies great global importance and is currently the sixth most conducted in 20132015 in tomato production areas, consumed food crop in the world. In Brazil, the sweet 479 bean plants cv. Carioca were collected from around potato is grown in all regions with the main importance to the Northeast where it is greatly appreciated by part of Brazil. DNA was extracted and used in a PCR test population.The sweet potato production can be affected tomato fields located in five municipalities in the central by the action of various pathogens such as viruses PAL1v1978 and a total of 204 samples were positive. that reduce the productivity due to viral accumulation Thewith 204 the degenerateDNA extracts begomovirus of these begomovirus primers PAR1c496/positive caused by vegetative propagation, the main method of propagation of the culture. Thus, the aim of this primers, and 14 samples, all from symptomless plants, study was to apply metagenomic analysis by Illumina weresamples positive. were used Then, in anotherdirect sequencing PCR with ToSRV of thespecific RCA sequencing to verify the viral diversity in sweet potato products of the 14 ToSRVpositive bean samples was samples from different regions of Brazil. For this, 100 performed with the begomovirus degenerate primer samples of sweet potato were used to a virus enrichment PARc496, which generated sequence of the 5’ end of the process by differential centrifugation where each plant capsid protein and the intergenic region. The sequences was weighed to 1g to form a composite sample. After this, RNA extraction was performed using the TRIzol reagent (Invitrogen) according to the manufacturer\’s plantsshared were 9698% infected identity with with ToSRV. the One sequence of these of samples ToSRV instructions and send to Illumina HiSeq sequencing. was(accession selected FJ824808), and the full confirminglength DNA A that component these beanwas The reads obtained were assembled using the CLC cloned and sequenced (GenBank accession number Genomics Workbench 8.5 software, generating 2.698 contigs. The contigs were analyzed using the BLASTX identical identity with a ToSRV isolate from tomato program (GenBank) against viral RefSeq database. The KX458238). The sequence of this clone was 99% genome analysis was performed using Geneious 9.0 common beans to ToSRV, bean plants (cv. Topcrop) were program, and as a result, four viral sequences related to: agroinoculated(accession JX415196). with infectious To confirm ToSRV the DNA susceptibilityA and DNA ofB Potyvirus genus (Potyviridae), one sequences related to dimeric clones ToSRV1164 of a tomatoinfecting isolate of ToSRV. Controls were bean plants agroinoculated with genus (Closteroviridae) were found. Thus for the future the BGMV DNAA and DNAB clones BGMVBRCAM and Carlavirus genus (Betaflexiviridae) and one to Crinivirus an empty pCAMBIA vector, and tomatoes (cv. Glamour) be designed and synthesized for detection of virus in agroinoculated with ToSRV. By twenty one days after studies, used specific primers, for each viral species, will each plant separately. Financial support: CNPq. agroinoculation, common beans agroinoculated with ToSRV did not show obvious symptoms, but all plants

infected based on detection of the virus by PCR. Common (18/18, results of three independent experiments) were Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

149 Plant and Invertebrate Virology: PIV bean and tomato plants agroinoculated with BGMV PIV269 - FIRST REPORT OF TOMATO SEVERE RUGOSE and ToSRV, respectively, developed typical symptoms. VIRUS IN SOYBEAN IN BRAZIL The bean plants agroinoculated with empty pCAMBIA Inoue Nagata, A.K.; Macedo, M.A.; Barreto, S.S.; Costa, remained healthy and were negative for begomovirus T.M.; Gilbertson, R.L. infection. These results indicate that ToSRV induces a 1. EMBRAPA HORTALIÇAS symptomless infection in common beans, and suggest 2. UNIVERSIDADE DA CALIFORNIA that infected beans could serve as reservoirs of ToSRV for the tomato crop. Three begomoviruses have now been reported in soybean plants in Brazil, occurring in a low incidence. PIV266 - REACTION OF LETTUCE GENOTYPES TO However, soybeans have the potential to act as inoculum LETTUCE MOSAIC VIRUS AND CHARACTERIZATION sources for crops such as beans and tomatoes. In OF THE EIF4E ALLELE addition, because soybean is frequently cultivated in Moura, M.F.; da Silva, N.; Hoffmann, M.I.M.; Pavan, M.A.; Krause Sakate, R. can transmit begomoviruses among these crops. The close proximity to beans and tomato in Brazil, whiteflies UNESP FACULDADE DE CIÊNCIAS begomovirus Tomato severe rugose virus (ToSRV) is the AGRONÔMICAS predominant species in tomatoes and can cause yield losses. During epidemiological studies on begomoviruses Lettuce mosaic virus is one of the major virus occurring infecting tomato plants, 295 soybean plants were on lettuce (Lactuca sativa L.). LMVMost are able to overcome the resistance of the recessive genes mo11 extracted and PCR with degenerate begomovirus and mo12 found in lettuce and so far as we know there primersrandomly was collected performed, around and 17 tomato positive fields. samples DNA were was are no resistant or tolerant varieties for these isolates. obtained. The DNA from these positive samples was These recessive genes encode the eukaryotic translation factor eIF4E, also related to the recessive potyvirus resistance in other plant species. In this work lettuce (RCA)used in and another RFLP PCR analysis with ToSRVwith Mspspecific I enzyme primers, were and performedfour samples with were these positive. ToSRV Rollingpositive circle samples. amplification The RFLP Botucatu were evaluated for reaction to isolate AF199 genotypes belonging to a collection of FCA / UNESP patterns of the soybean samples were identical to the (LMVMost) and the presence of possible variations in ToSRVinfected tomato sample. Two of these samples the eIF4E gene were evaluated. Varieties Calona and were selected and the DNAA component was cloned Salinas88, previously reported with the tolerant genes mo11 and mo12, respectively, were used as control for the eIF4E sequence pattern. The sequence for the others ofand soybeans sequenced. to ToSRV,These sequencessoybean plants were 98were99% inoculated identical genotypes analyzed was highly conserved and typical byto ToSRVbiolistics (JX415196.1). using an RCA To preparation confirm the from susceptibility one of the for eIF4E0 (mol0), related to the susceptible genotype. soybean samples positive to ToSRV by PCR. By 21 days Interestingly, some of these genotypes showed delay in after inoculation, soybeans inoculated with the RCA symptoms appearing and attenuated symptoms for LMV from a ToSRV positive soybean did not show any obvious AF199. These phenotypes could not be correlated with variability’s in the eIF4E sequence, indicating that other detection of the virus by PCR. Soybean plants inoculated regions of the lettuce genome could be implicating in the withsymptoms, RCA product but all plantsof BGMV (12/12)infected were soybeans, infected as based positive on symptomatology reaction to LMV isolates. controls, developed mosaic and mottling symptoms, whereas those inoculated with the RCA product from a healthy plant were not infected. A transmission

was performed. Soybean infected with ToSRV was used as experiment with whiteflies (Bemisia tabaci biotype B) were provided a 48 h inoculation access period (IAP) on healthyan acquision soybeans. host (48The h soybean acquisition) plants and given these the whiteflies 48 h IAP Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

150 Plant and Invertebrate Virology: PIV

DH10B cells. Colonies were selected by PCR to check for infected soybeans did not develop symptoms, but six of the presence of the KLM cassette. Restriction enzyme tenwith plants whiteflies (results having from acquired two independent the virus experiments) from ToSRV digestion (HindIII) was also performed resulting in not were infected based on PCR detection. These results indicate that ToSRV induces a symptomless infection in We hypothesized that the virus might be able to express soybean, and suggest that it may serve as a reservoir of cytotoxicexpected digestionproducts profile,after bacterial when compared transformation, with AgMNPV. killing ToSRV for the tomato crop. the E. coli host. On the other hand, virus lacking this cytotoxic portion would be positively selected during PIV270 - CONSTRUCTION OF A NEW EXPRESSION bacterial transformation which explains the second VECTOR BASED ON THE BACULOVIRUS ANTICARSIA result. Therefore, both restriction enzyme digestion and GEMMATALIS MULTIPLE NUCLEOPOLYHEDROVIRUS complete genome sequencing of possible recombinant (AGMNPV) viruses are needed in order to reevaluate the integrity of Silva, L.A.; Ardisson Araújo, D.M.; VAN OERS. M.M.; Ribeiro, B.M. PIV271 - POTATOINFECTING VIRUSES IN BRAZIL: A 1. CELL BIOLOGY DEPARTMENT, UNIVERSITY the genomes and to confirm for the recombinant viruses. OF BRASÍLIA SURVEY 20102015 2. FEDERAL UNIVERSITY OF SANTA MARIA Lima, M.F.; Mirtes, M.F.; Santos, D.I.S. 3. LABORATORY OF VIROLOGY, WAGENINGEN 1. EMBRAPA HORTALIÇAS UNIVERSITY 2. FACULDADE ANHANGUERA Baculoviruses are insectinfecting viruses used as Potato is affected by many viral diseases that can cause expression vectors of heterologous proteins. The most severe losses, resulting in low yields and tubers of poor common method for the construction of recombinant baculovirus is the BactoBac System (Invitrogen). This quality. Potato virus Y (PVY; genus Potyvirus; family: expression cassette (KLM, that contains a kanamycin agentsPotyviridae) infecting and potato Potato in leafroll Brazil, viruswhile (PLRV;Potato genusvirus resistantstrategy is basedgene, ona theLacZa sitespecificbased transpositioncomplementation of an Polerovirus; family Luteoviridae) were the main viral baculovirus genome (bacmid) maintained in E. coli. This X (PVX; genus Potexvirus; family Alphaflexiviridae), workgene, aimed and a for MiniF the construction replication origin) of a similar into aexpression modified and Potato virus S (PVS; genus Carlavirus; family vector system using the baculovirus genomes of andBetaflexviridae) crinivirus) have were been less frequently detected causing detected. diseases In the last in Anticarsia gemmatalis multiple nucleopolyhedrovirus potatoyears, whiteflyin producingtransmitted areas around viruses the (e.g. country, begomoviruses especially (AgMNPV). Several strategies were performed including after the introduction of Bemisia tabaci biotype B. The homologous recombination of KLM into insect cells and objective of this work was to perform a survey of viruses infecting potato in the central region of Brazil during a cotransfection experiments having the recombinant 20102015. A total of 200 samples showing mosaic, direct cloning. For the first strategy, supernatant from virus likely recombined with the KLM cassette were mottling, interveinal chlorosis and stunting were used in 96well end point dilution assays to isolate the recombinant vAgKLM. After six passages, viral DNA was collected from 10 potatoproducing fields (Cristalina and that resulted positive for the construction. Restriction samplesLuziânia GO;were Unaí testedMG). for Whitefly PVY, PLRV, and PVS aphid and, PVX populations by DAS purified PCRchecked using specific oligonucleotides enzyme digestion (HindIII) was also performed resulting ELISAwere presentusing polyclonal on fields antibodies. sampled. Total Extracts DNA was from tested leaf for begomovirus infection, by PCR, using degenerate AgMNPV wildtype. When this viral DNA was transformed in the expected digestion profile, when compared with by electroporation into E. coli cells, no colony forming of DNAA component. Total RNA was tested for crinivirus unit was observed. In the direct cloning strategy, the genusspecific primers that amplify a fragment of 1.1 kbp ligation was transformed by electroporation into E. coli chlorosis virus – ToCV). Eighty samples positive for PVY by RTPCR using a pair of specific primers (e. g. Tomato Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

151 Plant and Invertebrate Virology: PIV by serology were investigated by host reaction after rub inoculation on Nicotiana tabacum cv. TNN plants, and 3primer RT PCR tests to determine PVY strains (e.g. protein, coat protein, and nuclear inclusion body and 3’UTR.PVYo; PVYN; Serological PVYNTN), and molecular by amplifying test results fragments indicated of P1 the presence of all the viruses infecting potatoes singly or in combination. More than 58% of the samples were PVYvirus isinfected. still the PVY most was important the most frequently and, ToCV found incidence (40%), is followed by crinivirus (ToCV; 14%), indicating that plants.increasing. PVY PVS strains and inducedPVX were vein encountered clearing and in 10%chlorotic and pearl3%, respectively. spots (PVYo) Geminivirus and vein necrosis occurred on inleaves 10% of of TNN the wellplants as (PVYN; the diversity PVYNTN). of viruses PVYNTN infecting was the potatomost frequent crop in centralPVYstrain region (54%). of Brazil. These data reaffirm the importance as

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Plant and Invertebrate Virology: PIV VETERINARY VIROLOGY - VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

153 Veterinary Virology: VV

VV1 - GAMMACORONAVIRUS AND DELTACORONAVIRUS VV4 - NATURAL INFECTION WITH BOVINE DETECTED IN WILD BIRDS FROM SOUTH AND PAPILLOMAVIRUS TYPE 2 IS NOT SUFFICIENT TO SOUTHEAST BRAZIL CAUSE ENZOOTIC HEMATURIA IN CATTLE Barbosa, C.M.; Durigon, E.L.; Góes, L.G.B.; Ometto, T.; Tibúrcio Júnior, E.; Carrazzoni, P.G.; Pontes, N.E.; Thomazelli, L.M.; de Azevedo, R.M.; Nardi, M.S.; de Andrade, M.A.S.; Pessoa Junior, M.E.; Freitas, A.C. Aguiar, M.; Pinho, J.B.; Petry, M.V., Neto, I.S.; Serafini, UNIVERSIDADE FEDERAL DE PERNAMBUCO P.; Rodrigues, R.V.; Jr. Azevedo, S.M.; de Araújo, A. Papillomaviruses are DNA doublestrand viruses that 1. UNIVERSIDADE FEDERAL DE SÃO PAULO infect squamous epithelium of the skin and mucosa in 2. DEPARTAMENTO DE PARQUES E ÁREAS various mammalian species. Bovine papillomatosis is VERDES a disease caused by Bovine Papillomavirus (BPV). The 3. UNIVERSIDADE FEDERAL DE MATO GROSSO virus is described as epitheliotropic, but studies have 4. UNIVERSIDADE DO VALE DO RIO DOS SINOS 5. INSTITUTO CHICO MENDES DE CONSERVAÇÃO DA BIODIVERSIDADE semen. The BPV2 is associated with the development of shown the viral presence in body fluids such as blood and 6. CENTRO NACIONAL DE PESQUISA E bladder cancer and enzootic hematuria (EH) in animals CONSERVAÇÃO DE AVES SILVESTRES fed with fern shoots. One experimental infection study 7. UNIVERSIDADE FEDERAL DA PARAÍBA showed that the BPV2 alone can lead to the development 8. UNIVERSIDADE FEDERAL RURAL DE of characteristic clinical signs of EH, suggesting that the PERNAMBUCO natural infection itself could lead to the development of Coronaviruses (CoVs) have a unique replication the disease. This study aimed to assess whether animals mechanism, resulting in a high frequency of naturally infected with BPV2 but that do not feed on recombination and high mutations rates, which may fern shoots can develop EH. In order to do this, it was allow them to adapt to new hosts and ecological niches. isolated in the Agronomic Institute of Pernambuco (IPA) urine and blood samples of two groups consisting and the largest number of endangered species in the world,Even though studies Brazil about has the 18% presence of the birdof CoVs species in wild diversity birds of infected animals with BPV2 and the second with of 15 animals each. The first group was composed are scarce. This study performed a retrospective analysis animals not affected by BPV2. These animals underwent periodic clinical examinations by veterinarians. The samples from wild birds collected in different regions DNA extraction was performed from samples collected of theBrazil presence between of CoVs2004 in and 754 2015. orotracheal/cloacal Viral screening swab was using the PhenolChloroform extraction kit, the DNA was performed using conventional RTPCR and nested PCR. Positive samples were characterized by partial quantified and then was performed Polymerase Chain sequencing of the RNAdependent RNA polymerase AYC CWT ATT3’ and Rev 5’ CCW ATA TCW VHC CAT ITC Reaction (PCR) of FAP 59/64 (Fw 5’ TAA CWG TIG GIC (RdRp) gene and phylogenetic analysis was performed to ICC ATC3) for general detection of Papillomaviruses investigate the association between virus epidemiology, and then was evaluated for the presence of BPV2 using bird migration routes, and the proximity of urban and poultry regions. Six samples were positive for CoVs Papillomavirus in all studied samples, while BPV2 is specific primers. The results show the detection of by RTPCR, three of which were gammacoronaviruses and three were deltacoronaviruses. This study showed no signal of EH was observed. The results obtained so shown in more than 90% of the total samples. However, the presence of avian gamma and deltacoronaviruses far suggest that the natural infection with BPV2 is not circulating in different regions of the country, close to urban areas and poultry regions, indicating that wild needed to better understand the disease, to know what sufficient for the development of EH. More studies are birds may transport CoVs to different migratory sites is the real role of the virus in the development of bladder and represent a risk to poultry farms and public health cancer and hematuria, how does the interaction between in Brazil. the virus and the fern shoots occur, and if the presence of the virus in the blood and urine plays a role in the disease development. Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

154 Veterinary Virology: VV

VV5 - PRESENCE OF MIXED INFECTION OF data support other studies that show that BPV, although DIFFERENT TYPES OF BOVINE PAPILLOMAVIRUS IN characterized as epitheliotropic, can be found in other BOVINE PERIPHERAL BLOOD IN CATTLE AFGECTED tissues, as in this case, the blood tissue. BY PAPILLOMATOSIS VV22 - PHYLOGENETIC ANALYSIS OF PORCINE Tibúrcio Júnior, E.; Carrazzoni, P.G.; Pontes, N.E.; GROUP A ROTAVIRUS WITH ZOONOTIC POTENTIAL Andrade, M.A.S.; Pessoa Junior, M.E.; Freitas, A.C. IN BELÉM, BRAZIL UNIVERSIDADE FEDERAL DE PERNAMBUCO Mascarenhas, J.D.P.; Neves, M.A.O.; Marinho, A.N.R.; The bovine papillomatosis is a disease that affects Lobo, P.S.; Soares, L.S. cattle causing warts along its epithelium that has as INSTITUTO EVANDRO CHAGAS etiological agent the Bovine Papillomavirus (BPV). Rotavirus A (RVA) is member of the Reoviridae family, Papillomaviruses are circular doublestranded DNA Rotavirus genus and they are a common cause of severe viruses, it has icosahedral symmetry, nonenveloped, that gastroenteritis in humans and animals. RVA genome infect the squamous epithelium of the skin and mucous comprises 11 segments of doublestranded RNA, encoding causing generally asymptomatic infections and various six structural viral proteins (VP1–4, VP6 and VP7) and benign lesions that may progress to malignant lesions in various mammalian species. Currently there are 14 RVA genome facilitates reassortment between strains, types of BPV described in the literature, with the type happeningsix nonstructural both intra proteins and inter (NSP1–5/6).genogroup The reassortment segmented 14 described in 2015. In Brazil, the disease has been that allowing the transmission zoonotic. This study aims reported in several areas causing serious economic to molecular characterization RVA in porcine samples losses to cattle keepers, some even give up this activity. in Belém, Brazil. From April 2008 to May 2009, 17 This study aimed to evaluate the presence of Bovine Papillomavirus types 1 to 13 in bovine blood samples. pig farms located in midsized metropolitan middle The 36 blood samples were obtained from the Agronomic regionsamples of porcineBelém, Pará. RVA Viral positives genome from was five extracted commercial and Institute of Pernambuco IPA, Experimental Station of subjected to ReverseTranscription Polymerase Chain Itambé. The quality of the extracted DNA was evaluated Reaction (RTPCR) targeting VP7, VP1, NSP4 and NSP5 by primers that attach to the bovine genome (beta genes. Subsequently, these samples were sequenced globin). The viral DNA detection was performed by PCR and subjected to phylogenetic analysis. All porcine samples were subjected to partial sequencing and the the BPV types 1 to 13. The presence of at least one type (Polymerase Chain Reaction) using specific primers for phylogenetic analysis of VP7, VP1, NSP4 and NSP5 genes of viral DNA was found in 100% of the 36 samples, and and H1 genotype, respectively. Phylogenetic analysis all It was possible to identify up to 5 viral types in the same demonstrated that samples possessed G3/G5, R1, E1 the mixed infection was detected in 97.2% (35 samples). genes analysed, demonstrated a high nucleotide identity with strains porcine and human origins detected in sample, being 43% of the samples positive for two types Brazil, Argentina e Paraguay. This study indicates that of BPV, 40% for three types, 14.2% for four types and porcine samples have different evolutionary origins, with 2.8% for five types. The BPV13 was not identified in transmission interspecies from different regions of Brazil and zoonotic transmission within Brazil and between frequentany of the in studied the blood samples. samples, Briefly, and thethen BPV the12 BPV (97,2%),6 with BPV11 (70%) and BPV2 (58,3%) types were the most neighboring countries (Argentina and Paraguay) that import porcine. In conclusion, these data are important for epidemiological surveillance mainly because Brazil types22,2%. 1, The 4, 5, BPVs 8 and that 13 werepresented not detected lower frequency in the samples were is an exporter of porcines that can transmit viral strains studied.the BPV 3 The with results 5,6% andpresented BPV10 here with 2,8%.show Thethe BPVswide that infect humans or emergence of new recombinant dissemination of the types of BPVs in the evaluated herd strains with zoonotic potential. of cattle. Furthermore, it reinforces that the presence of mixed infection for the virus approached has become common in molecular analysis performed by PCR. These Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

155 Veterinary Virology: VV

VV27 - EVIDENCE FOR A NOVEL AVIAN PARAMYXOVIRUS (APMV14) DETECTED IN MIGRATORY BIRD FROM LAGOA DO PEIXE, RS and APMV13 (67.4 %), APMV2 and APMV10 (67.4 %), and APMV1 and APMV9 (66.5 %). The higher divergence Thomazelli, L.M.; Araujo, J.; Ometto, T.; Barbosa, between APMVs was 87.4% (APMV4 and APMV 12), the C.M.; Petry, M.V.; Walker, D.; Fabrizio, T.; Webby, R.; APMV4. We consider that the large genetically distance higher divergence of isolate RS1177 was 79.3% with Durigon, E.L. showed by isolate RS1177 in the present study, indicate 1. INSTITUTO DE CIENCIAS BIOMEDICAS USP to be considered the prototype strain of a new APMV 2. UNIVERSIDADE DO VALE DO RIO DOS SINOS that it is sufficiently different from the other APMVs 3. ST JUDE HOSPITAL Avian paramyxovirus (APMV) belongs to the genus group, APMV14, with the full name APMV 14/calidris_ Avulavirus in the Paramyxovirinae subfamily of fuscicollis/Brazil/RSVV29 - COMPETENCE1177/2012. IN ANIMAL RABIES DIAGNOSIS the family Paramyxoviridae. Members of family Romijn, P.C.; Rouge, L.M.S.; Kimura, L.M.S.; Costa, Paramyxoviridae are characterized by pleomorphic C.H.C.; Pinto, A.M.V.; Gonçalves, W.M.; Valle, S.C.P. enveloped particles that contain a singlestranded, 1. UNIVERSIDADE FEDERAL FLUMINENSE 2. EMPRESA DE PESQUISA AGROPECUARIA DO twelve distinct serotypes (APMV1 to 12) by ICTV Virus ESTADO DO RIO DE JANEIRO Taxonomynegative sense 2016. RNA Only genome. recently, APMV in 2016, is classifiedthree APMVs into 3. INSTITUTO NACIONAL DE METROLOGIA isolated from the rockhopper penguin in the Falkland Islands, the common snipe in France, the Eurasian essential that diagnostic and research laboratories wigeon in Italy were considered new serotypes of attendIn the to field the quite of Preventive restricted Veterinarybiological competence Medicine, itand is safety standards required for differential diagnosis of avulavirus isolated from the wild geese in Japan have encefalophathies. Targeting the global livestock business APMV, APMV10, 11 and 12, respectively. An unclassified been proposed to be serotype APMV13. Here, we and aiming to conduct diagnostic research about encephalopathies in mammals within internationally considering that many authors have demonstrated that recognized competence concepts, the Virology Area propose a new serotype APMV14 based in genetic finds phylogenetic analysis are suitable to separate the groups of “Centro Estadual de Pesquisa em Sanidade Animal in accordance with the serological tests. Since 2005 the Geraldo Manhães Carneiro” of PESAGRORIO developed Laboratory of Virology of Institute of Biomedical Science technical competence for systemic acting and quality USP has a surveillance programme aimed at detecting requirements for rabies diagnosis, resulting in accreditation recognition. We developed the quality of viruses in wild birds and assessing the risk of such diagnostic research of diseases that affect the central the presence of avian influenza and Newcastle disease viruses spreading to poultry. As part of this programme, nervous system of animals, with primary focus on cloacal swabs were taken from a Calidris fuscicollis rabies, and were able to monitor the health of herds in (Charadriiforme) captured in April 2012 in the Lagoa do the State of Rio de Janeiro. The activities resulted in the Peixe, RS from which an APMV virus was isolated. The development of a Competence System, called “Sistema partial sequence (2000 bp) of the L gene of this isolate de Competencia da Área de Virologia do CEPGM”, SCAV, (RS1177) were aligned with representative viruses of culminating in accreditation by CGCRE INMETRO in the diagnosis of rabies, under the number of CRL 1007. We Avulavirus available in GenBank. For the construction the Paramyxoviridae family including all unclassified of the phylogenetic trees, the evolutionary history was proposed by Ordinance 116, of August 28, 2008, including inferred using the maximumlikelihood method and theattended conduction the requirements of the complete of ISO protocol / IEC of17025 all processes and the the substitution model chosen from a model test done and tests carried out in the involved laboratories. To suit the conditions of management and techniques for rabies virus diagnosis in mammals, within the 17025 using MEGA 5. Isolate RS1177 had 67.4 % identity to APMV2. These are comparable to, or even lower than, and MAPA requirements, we prepared 01 Manual (MV), the identities closest APMV seen8 between and second the closest 67.3 % groups identity APMV to the12

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

156 Veterinary Virology: VV

13 management procedures (PGV) and 08 technical procedures (PTV), 02 Preparation Instructions ( IPV), 13 Work Instructions (ITV), 06 Remark books (LOV), samples 7.5% (9/120) were positive by RVA for one 53 Forms (FV), 49 Development Models (MDV) and 08 canine,step (RT twoPCR), swines distributed and one 5% feline. (6/120) The inpositive Santa samplesBarbara Informatives (IV). It is concluded that the development wereand 2.5%sequenced (3/120) and in after Viseu, phylogenetic being six isolatedanalysis, fromthey of SCAV, with its Manual and several technical and were grouped in to genotype I2 of human origin. The management procedures, will support the adaptation to results show the circulate of RVA in animals belonging situations arising from the international imposition of to the areas analyzed and pointed out the requirement sanitary barriers, in order to keep the constant threat of for further investigation of domestic animals as RVA virus severity in animals, and its spread, under control reservoirs and zoonotic transmission. in the country, as well as those that can be introduced VV32 - EVALUATION OF ROTAVIRUS A, B, C AND at any time, and automatically implies in the design and H BY RTPCR MULTIPLEX IN WILD ANIMAL FROM implementation of appropriate and effective preventive MESOREGIONS OF BELÉM AND NORTHEAST OF PARÁ measures by the government and the productive sector. STATE, BRAZIL VV31 - DETECTION OF ROTAVIRUS A IN DOMESTIC Barros, B.C.V.; Duarte Júnior, J.W.B.; Ribeiro, L.G.; da ANIMALS IN AREAS OF ANTHROPOGENIC Silva Junio, E.T.da P.; Mascarenhas, J.D.A.P.; Marinho, ALTERATIONS FROM MESOREGIONS METROPOLITAN A.N. do R. OF BELEM AND NORTHEAST OF PARÁ STATE INSTITUTO EVANDRO CHAGAS Barros, B.C.V.; Ribeiro, L.G.da S.; Duarte Júnior, J.W.B.; Acute gastroenteritis is an important cause of morbidity Chagas, E.H.N.; Marinho, A.N. do R.; Mascarenhas, and mortality both in humans and in animals. Infection J.D.A.P. by rotavirus (RV) have shown zoonotic character, INSTITUTO EVANDRO CHAGAS because its diversity and possibility of rearrangements, Viral gastroenteritis is a condition infectous subject to certain factors of transmission and maintenance of into nine groups or species designed from A to I, whereas the agents in animal population and the environment. theaffecting Group a Awide RV (RVA)variety infections of species. are The widely RV are distributed, classified Studies have shown that domesticated animals of several especially in young animals. The RV belong to the family species have been affected by rotavirus infections (RV), Reoviridae, genus Rotavirus, have segmented genome symptomatic or asymptomatically. The RV offers a with 11 double RNA segments (dsRNA). The present study aims to evaluate the circulation of rotavirus or species designated from A to I, whereas the group Awide rotavirus range of(RVA) hosts are and widely are classified distributed, into especiallynine groups in young animals. The RV belong to the Reoviridae family, changesA, B, C andin Hthe in Metropolitan wild mammals, mesoregions flying mammals of Belém and genus Rotavirus, and their segmented genome consist andnon flyingNortheast mammals of Pará, in theBrazil. areas Faecal of environmentalsamples were of 11 segments of double stranded RNA (dsRNA). Fecal specimens were collected from asymptomatic domestic animals from areas of anthropogenic changes located in collected from flying mammals (bats n=50) and non Belém metropolitan mesoregions and Northeast Pará flying mammals (rodents n=50) from Santa Bárbara and State. Were selected 120 fecal specimens from different ImmunochromatographicViseu cities, Pará, in the periodtest, RIDAQUICKR from September/2014 Rotavirus. animal species with different ages and races belonging to Batsto December/2015. Feecal specimens The were samples extracted were in NB screened3 laboratory by the Santa Bárbara and Viseu cities. The specimens were using Guanidine isothiocyanate, and submitted to subrequerently subjected to immunochromatography, Polymerase Chain Reaction preceded by Reverse ELISA, polyacrylamide Gel Electrophoresis and one Transcription Multiplex (RTPCR Multiplex) for RVA, step (RTPCR) to gene VP6. All samples studied were RVB, RVC and RVH, and positive and negative controls. negative for polyacrylamide gel electrophoresis, ELISA The amplicons were subjected to electrophoresis in and Immunochromatographic test. However, of the 120

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Postersagarose - Veterinary gel 1.5%, Virology: and VV photodocumented. The Chi XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

157 Veterinary Virology: VV square test, BioEstat 5 Program, with ? = 0.05 was polyethylene glycol (PEG) centrifugation as previously applied to compare the positivity among the population described and the supernatant treated with DNAse and studied (bats and rodents). All samples were negative RNAse (Ambion) for host contaminant debris removing. by Immunochromatographic test, although has been Treated samples were futher used for RNA extraction and for fulllength genome sequencing. The genome was populations investigated for RVA to Multiplex RT obtained employing a de novo hybrid assembly strategy observed 4% (4/100) of positive samples for two using GS FLX 454 and Ion reads simultaneously in the software Mira 4.0. Visual inspection was performed PCR. When analyzed separately were confirmed in 8% using the software Genious v.6.1.4. The cytopathic effect populations(4/50) of positivity studied in was bats, 0.041 and noto positive0.05 ?. Sequencingsamples in was detected 4 days post infection and characterized rodents population. The positivity significance among by membrane fusion and formation of syncytia and vacuoles. Negative staining of supernadants of demonstrated one sample genotype G1 (99%) and one I2 cultures showed coated viral particles with diameter of(99%) RVA closely in Chiroptera related to in human the Amazon samples. region. The results Further are of approximately 200nm. Ultrathin sections showed studiespioneers to and determine recorded the for RVA the circulationfirst time the are occurrence needed to enveloped virus particles in the cytoplasm with different evaluate the potential of these animals as reservoirs and stages of maturation. The total genome recovered was zoonotic transmission of rotavirus. 162,700nt in length with a mean coverage of 297x fold. VV33 - GENOME SEQUENCING AND INFECTION IN for Be An 58058 virus strain isolated in northern Brazil. ANIMAL PRIMARY NERVOUS CELL CULTURE OF BEAN This is the first report of the complete genome sequence 58058 VIRUS ISOLATED FROM ORYZOMIS RODENTES VV39 - SENECAVIRUS A IN SUCKLING PIGS FROM IN NORTHERN BRAZIL (PARÁ) SWINE HERDS, SANTA CATARINA, BRAZIL Wanzeller, A.L.M.; Souza, A.L.P.; Martins, L.C.; Demoliner, M.; Girardi, V.; Pressi, G.F.; Henzel, A.; Azevedo, R.S.S.; Casseb, L.M.N.; Pinto, E.V.; Júnior, E.C.; Lorenzett, M.P.; Driemeier, D.; Spilki, F.R. Araújo, S.C.; Franco, F.T.C.; Júnior, J.A.P.D.; Filho, L.C.F.; 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO Oliveira, R.S.; Lemos, P.S.; Júnior, J.V.; Vasconcelos, SUL P.F.C. 2. UNIVERSIDADE FEEVALE INSTITUTO EAVNDRO CHAGAS Senecavirus A (SVA), also known as Seneca Valley Virus The poxviruses are enveloped viruses with mean (SVV) has been detected in swine, and is characterized by diameter of 200nm and the replication occurs in the vesicular skin lesions, which are sometimes accompanied cytoplasm. The genome is a doublestranded DNA which in by systemic disease. This includes digestive, respiratory, size from 130300kb. In northern Brazil few information reproductive and nervous system disorders. Clinical is available on BeAn 58058 virus, Cotialike virus, thus signs resemble Footand mouth disease, swine vesicular we propose to study the genome it using the GS FLX disease and vesicular stomatitis. SVA is the only member of the genus Senecavirus within the family Picornaviridae. parallel an experimental infection in primary neuronal SVA is a singlestranded, positivesense, nonenveloped cells454 (Roche,of suckling Life Science) Swiss andmice Ion wasTorrent performed platforms; and in RNA virus with a genome size of approximately 7.2 Kb. transmission electron microscopy was used to examine In May of 2016, a pig herd located in Santa Catarina sites of replication of strain BeAn 58058 onto infected State, Southern Brazil, presented diarrhea, vesicle in the Vero and primary cells. For this, we sequenced the nearly skin and lesions in hoof and snout of suckling piglets, 20 complete genome, and infected primary animal culture days after the arrival of male and three female adult pigs. The clinical evolution was of one week approximately, infected with BeAn 58058 virus onto the monolayer. and samples from snout, vesicles, livers and hoof were Theand Veronegative cells withstaining a clarified and ultrathin 1:10 brain sections homogenate were submitted for viral detection. After RNA extraction examined in a transmission electron microscopy (Zeiss and cDNA synthesis, polymerase chain reaction was EM 900). The virus particles were precipitated using the performed with primers targeting the genomic 5’

158 Veterinary Virology: VV untranslated region (UTR), namely SenecaV5UTR F herd as well as in other animal species discloses the 5’TTAGTAAGGGAACCGAGAGG3’ and SenecaV5UTR R 5’ epidemiological complexity of the disease. The results of CTGTAGCTCGCTATGCTAGG3’. Amplicons from positive all HEV studies conducted in Brazil so far should serve as a warning to the local public health system, but they also for further genotype characterization. Twelve out 14 reveal that the disease needs to be better investigated. samples analyzed were purified were positive and submitted for SV genotype to sequencing A (SVA) VV47 - DETECTION OF BLUETONGUE VIRUS ANTIBODIES virus. Detection of RNA SAV in suckling pigs allowed IN CATTLE OF PORTO NACIONAL CITY, TOCANTINS, us to conclude that this virus may be responsible for BRAZIL this outbreak. Due the epidemiological investigation conducted, it seems that the adult pigs served as case Negri Filho, L.C.; Silva, L.C.; Marcasso, R.A.; Nogueira, controls for the introduction of SVA in the farm, thus A.H.C.; Okuda, L.H.; Stefano, E.; Pereira, C.E.S.; reinforcing the need of stricter biosafety measures. Veronez, J.V.; Vieira, M.V.; Rodrigues, S.M.C.; Furlan, Many outbreaks have been reported in Southern region D.; Pereira, G.R.; Gomes, M.G.T.; Koetz Junior, C.; of Brazil, and SVA might be included as a differential Pituco, E.M.; Okano, W. diagnosis for swine vesicular diseases. 1. INSTITUTO BIOLÓGICO DE SÃO PAULO 2. UNIVERSIDADE NORTE DO PARANÁ VV40 - ZOONOTIC HEPATITIS E IN BRAZIL: A 3. UNIVERSIDADE FEDERAL DO RIO GRANDE DO NEGLECTED DISEASE? SUL Rigueira, L.L.; Vilanova, L.F.L.S.; Rigueira, L.L.; 4. UNIVERSIDADE FEDERAL DO TOCANTINS Perecmanis, S. The Bluetongue is an infectious disease that affects all UNIVERSIDADE DE BRASÍLIA ruminants. It is caused by Bluetongue Virus (BTV), Hepatitis E is a zoonotic disease that circulates all over with 27 serotypes distributed worldwide. This virus the world. In addition to affecting humans, the Hepatitis is primarily transmitted by vectors of the Culicoides E virus (HEV) is also found in pigs, wild boar and other genus. BTV occurs endemically in temperate and animals. The zoonotic transmission mainly occurs tropical climate zones that provide suitable conditions through the direct exposure, by drinking contaminated for high proliferation of Culicoides. In countries where water (fecaloral route) or by the consumption of raw or Bluetongue is endemic there may be restrictions on international trade in animals. In cattle the infection is disease but it is not routinely investigated, even in cases usually unapparent and it is detected by the presence ofundercooked unexplained meat. elevated In Brazil, liver enzymes Hepatitis or E acute is a notifiablehepatitis. of antibodies produced around 10 days after infection. Furthermore, only a few laboratories perform diagnostic Cattle are considered to be an incubator of the disease tests for the virus. It is known that humans and swine due to the long viremia duration. Different studies in share genotypes 3 of HEV, which circulate in many Brazil showed high prevalence of BTV in cattle and sheep countries such as Brazil. It is also known that humans with occupational exposure to pigs are at increased risk However, there are no data on the BTV in the state of and they are identified as serotypes 3, 4, 12, 14 and 18. of HEV zoonotic transmission. Both human and swine Tocantins. Therefore, the aim of this work was to check HEV antibodies have already been detected in Brazil. the occurrence of antibodies antiBTV in bovines of the Tocantins State. For this study blood serum and semen country. Swine HEV seems to also be spread all over the were collected from 25 Braford cattle, of which were 14 country.Human cases However, have despite been detected all the evidence in all five demonstrating regions of the females and 11 males without clinical manifestation of this, the lack of a national epidemiological study about the disease. All animals were older than two years of age the disease hinders the awareness of its real situation in and were raised in the municipality of Porto Nacional, the country. Even Brazil’s Ministry of Health recognizes state of Tocantins, Brazil. Samples were collected in that many human cases may not have been registered in October of 2015. The analyzes were performed at the country, therefore generating high underreporting. the UNOPAR Veterinary Medical Diagnostic Center In addition, the HEV circulation in the national swine in Arapongas, state of Paraná, following the standard protocol for the Bluetongue Virus Antibody Test Kit, Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

159 Veterinary Virology: VV

VMRD Inc. It was performed a screening of samples by AGID technique, which detects antibodies of all BTV Antibodies against BVDv can be detected on serum serotypes. After that, the samples were sent to the Bovine withinthe virus 21 or days by theafter demonstration the infection and of specific remain antibodies. detectable Virus Laboratory, at the Biological Institute of São Paulo. for at least three years. However, the antibody titers Serum samples were subjected to virus neutralization resulting from an old infection will decline with time. tests against BTV4 serotype, where the titers were The aim of this work was to check the occurrence of determined by Reed and Muench method and expressed antibodies antiBVDv in bovines of the Tocantins State. in log10. Samples with titers greater than 0.3 log10 of For this study blood serum and semen were collected virus neutralization were considered reagents. Semen from 25 Braford cattle, of which were 14 females and 11 males without vaccination for BVDv. All animals were in reproductive age and were raised in the municipality samples were subjected to RTPCR for BTV. In AGID, 76% of Porto Nacional, state of Tocantins, Brazil. Samples positive(19/25) for of BTV serum4, with samples titers were ranging positive, from 1.0 whereas to 2.2 in were collected in October of 2015. All analyzes were logarithmicvirus neutralization basis. No 100% semen (25/25) samples of thewere samples positive were for performed at the Biological Institute of São Paulo. Serum RTPCR. The high percentage of animals with antibodies samples were subjected to virus neutralization(VN) tests, shows that in the region studied the BTV4 is endemic, were titers were determined by Reed and Muench and expressed in log10. Samples with titer greater than 1.0 proliferation of vectors. log10 of VN were considered reagents. Semen samples which is justified by the tropical climate favorable to the were subjected to Polymerase Chain Reaction(PCR) VV48 - DETERMINATION OF ANTIBODY TO BOVINE for BVDv. The presence of antibodies to BVDv was VIRAL DIARRHEA IN CATTLE UNIMMUNIZED AT PORTO NACIONAL COUNTY, TOCANTINS, BRAZIL titers ranging from 1.0 log10 and 3.1 log10. The results Negri Filho, L.C.; Silva, L.C.; Marcasso, R.A.; Nogueira, demonstratedetected in 100%(25/25) that in this property of the there serum are samples, animals with A.H.C.; Okuda, L.H.; Stefano, E.; Pereira, C.E.S.; high and low antibodies titers, which represents that Veronez, J.V.; Vieira, M.V.; Rodrigues, S.M.C.; Furlan, were newly infected and others that are already declining D.; Pereira, G.R.; Gomes, M.G.T.; Koetz Junior, C.; Pituco, E.M.; Okano, W. was negative for BVDv. Since none of these animals 1. UNIVERSIDADE NORTE DO PARANÁ havetitration. been Through vaccinated the PCR,against 100% BVDv of theand analyzed all showed semen the 2. INSTITUTO BIOLÓGICO DE SÃO PAULO presence of antibodies, the results indicate that there 3. UNIVERSIDADE FEDERAL DO RIO GRANDE DO has been exposure to the virus, and that studies should SUL be conducted on the property to identify PI animals. 4. UNIVERSIDADE FEDERAL DO TOCANTINS 59 - ANTIBODY RESPONSE EVALUATION OF DOGS The virus of Bovine viral diarrhea (BVDv) is a RNA virus VACCINATED AGAINST CANINE DISTEMPER from Flaviviridae family. The virus has a worldwide ASSOCIATED WITH ACUNPUNCTURE STIMULATION distribution, with cytopathic and noncytopathic biotypes. The bovine viral diarrhea is a disease with Portela, V.A.B.; Lima, T.M.; Souza, H.C.V.; Guerrera, severe or unapparent clinical signs and it is responsible M.U.; Batista Filho, A.F.B.; Uchoa, J.M.W.M.C.; Sá, F.B.; for high mortality rates and reproductive problems. Maia, R.C.C. The seropositivity for this agent in a herd indicates the UNIVERSIDADE FEDERAL RURAL DE presence of carriers of the virus that could potentially PERNAMBUCO serve as a source of infection for susceptible animals. Acupuncture is one of the oldest methods in Traditional The presence of persistently infected (PI) animals is Chinese Medicine consisting in the use of needles for the main form of transmission and maintenance of the cutaneous stimulation in determined points called virus in a herd. Hence, the prophylaxis and control of acupoints, in order to prevent or treat diseases. It has been shown that they can immuno modulate the defenses, and removal of PI animals out of the properties. The increasing population and activity of many immune BVDv infectiondiagnosis consistis performed essentially through on the the identification detection of Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

160 Veterinary Virology: VV cells. Canine distemper virus (CDV) causes one of the VV68 - EPIDEMIOLOGICAL AND CLINICOPATHOLOGICAL most important infectious diseases of dogs worldwide, FEATURES OF CANINE PARVOVIRUS 2C INFECTION IN a highly contagious illness that leads to neurologic DOGS FROM RIO GRANDE DO SUL STATE, BRAZIL disorders and death. The most susceptible dogs are Flores, E.F.; Oliveira, P.S.B.; Cargnelutti, J.F.; Masuda, those unvaccinated, but it is necessary to revaccinate the E.K.; Fighera, R.A.; Kommers, G.D.; Weiblen, R. animals in order to maintain the level of protection. The 1. AXYS ANÁLISES present study was carried out at the Veterinary Hospital 2. UNIVERSIDADE FEDERAL DE SANTA MARIA from the Department of Veterinary Medicine, where 18 dogs from various ages were randomly distributed Canine parvovirus type 2c (CPV2c) emerged in Europe in the early 2000’s and rapidly spread out worldwide. GII – 1mL of the vaccine and were stimulated with Clinical and molecular data demonstrated the in 5 groups: GI –1mL of the CDV vaccine (3 animals); widespread distribution of CPV2c among Brazilian dogs. However, detailed clinical and pathological descriptions ofacupuncture vaccine and (2 animals);were stimulated GIII – 1mL with of acupuncture NaCl and were (4 of cases are still scarce. This research describes the stimulated with acupuncture (4 animals); GIV – 0,2mL epidemiological and clinicopathological features of 23 were applied subcutaneously in the right hypochondria, cases of CPV2c associated disease in dogs from Rio Grande andanimals); the acupuncture GV – 0,2mL stimulation of vaccine were(5 animals). performed All indoses the do Sul state (20142016). Fecal samples or intestine day (D0) and twelve days (D12) later, using the acupoints IG4(Hegu), VG14(Dahzui) e E36(Zusanli), known for signs compatible with parvovirosis were obtained segments of 23 dogs with clinical and/or pathological immunological stimulation. The parameters evaluated from veterinary clinics and pathology laboratories. The using the immunochromatographic method to detect PCR for a 583bp of the VP2 gene of the CPV2 genome, samples were submitted to virus isolation and/or to a IgG,were performed hematologic on profileD0 and and D12. antibody The results titer obtained antiCDV following by nucleotide sequencing of the amplicons. showed that acupuncture stimulation increased the Virus isolation and PCR detection were achieved in all samples. Nucleotide sequencing of the amplicons experimental groups that received the acupuncture revealed a high amino acid identity among them and specific antibody titer of 90% of the animals in all acupuncture stimulation and showed no increase in importantly, all sequences harbored the mutation at with CPV2c standard sequences (99.4 to 100%). Most antibodystimulation production (9/10). The was only a 10 animalyearold that from received Group theIV, amino acid residue 426 in VP2 sequence (asparagine most likely due to agerelated immunesuppression. to glutamic acid), which is a signature of CPV 2c. Most Interestingly, animals from the negative control group affected dogs presented typical clinicopathological signs (GIII) with initial low levels of antiCDV antibodies of parvovirosis such as diarrhea, vomiting, hyperemia and hemorrhage of the serous membrane of the small intestine. Also a diffuse segmental granulation, atrophy parametrichad an increase Mann Whitney in specific U test antibody showed production that the results due of the mucosa, necrosis and fusion of crypts, villous to acupuncture stimulation alone (4/4). The non atrophy, squamous metaplasia and epithelial syncytia in crypts was observed in most of the cases. Nonetheless, acupunctureare significantly stimulation different fromof immune D0 to D12 responses. (p<0.5). These This some affected animals presented clinical, pathological workresults showed corroborate that manyacupuncture literature immune findings stimulationconcerning may become an interesting partner in increasing vaccine classical cases. These differences included a wide and/or epidemiological features divergent from the protection against Canine Distemper in dogs. variation in the color of diarrheic feces. The colour ranged from yellowish, lightbrownish, greenish, orangebrown

and brownish (13/23); the number of adult (3/23) and lesions,vaccinated such affected as pulmonary dogs (11/23); edema the wideand extensionconvulsion of the lesions in small intestine (10/20) and extraintestinal

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - (9/20). TheseVeterinary findings Virology: confirm VV the importance of CPV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

161 Veterinary Virology: VV

2c infection among Brazilian dogs and reinforce the VV70 - NEUTRALIZING ANTIBODIES TO BOVINE need for its inclusion in the list of differential diagnosis ENTEROVIRUS IN CATTLE, HERD FROM DO RIO of many diseases, especially for its potential atypical GRANDE DO SUL, BRAZIL clinicopathological presentations. Gras, C.K.; Demoliner, M.; Eisen, A.K.A.; Henzel, A.; VV69 - DETECTION AND IDENTIFICATION OF Spilki, F.R. PESTIVIRUSES IN COMMERCIAL FETAL BOVINE UNIVERSIDADE FEEVALE SERUM Bovine enterovirus (BEV) a singlestrand RNA and Flores, E.F.; Monteiro, F.L.; Cargnelutti, J.F.; Braunig, nonenveloped virus, belonging to Enterovirus genus P.; Weiblen, R.; Flores, E.F. from Picornaviridae family is endemic in cattle herds UNIVERSIDADE FEDERAL DE SANTA MARIA worldwide and the infection is normally subclinical. Clinical signs may be sporadically reported being Bovine viral diarrhea virus (BVDV) belongs to the associated to gastroenteritis, respiratory disorders family Flaviviridae and genus Pestivirus. Based on and infertility. BEV is detected in high load in bovine feces and may be transmitted to susceptible bovine by contaminated water. Fecaloral route is the main Additionally,genetic and antigenic a new pestivirus relationships, species, field named BVDV HoBi isolateslike, are classified into two species, BVDV1 and BVDV2. transmission mechanism and BEV particles can be viable for long periods under environmental conditions. serum (FBS) from Brazil and, subsequently, isolated The goal of the present study was to survey the presence fromwas identifiedFBS and clinical in commercial cases of BVD batches in several of fetal countries. bovine of BEV neutralizing antibodies in cattle herds from Rio The objective of this study was to detect and identify Grande do Sul State, Brazil. Sera came from 49 different pestiviruses contaminating commercial FBS produced municipalities from central, north and northwest of in Brazil between 2005 and 2015. Seventy six batches of RS, from female beef and milk herds with reproductive FBS were submitted to RNA extraction, cDNA synthesis losses. Samples were kindly provided by Setor de Virologia from Universidade Federal de Santa Maria. One for 5’UTR, followed by nucleotide sequencing and hundred three n=180 serum samples were submitted to phylogeneticand PCR amplification analysis. In addition, using panpestivirus FBS were submitted primers virus neutralization (VN) assay. Sera were diluted from to virus isolation in MDBK cells and virus neutralizing (VN) assays against BVDV1 and BVDV2. Forty two FBS mL of a prototype BEV2 virus strain. Nearly all samples 1:5 to 1:640 and assayed against 100 – 200 TCID50/ samples (55.3%) were PCR positive for pestiviruses, testes showed anti BEV antibodies: 98.3% (177/180). being 37 (88.1%) BVDV1 (BVDV1a: 25; b: 8 and d: 4). The antibody titers of ranged from 1:10 in 3.8% (7/180) Seven samples contained BVDV2 (16.7%) and 4 HoBi circulating among southern Brazilian cattle herds. contained more than one genotype (4 had BVDV1 and to 1:80 in 23.3% (42/180). These results showed BEV is like (9.5%). From the positive samples, six (14.3%) VV73 MULTIPLEX RTPCR EVALUATION OF ROTAVIRUS like). The nucleotide identity among the BVDV1a ranged A, D, F AND G FROM BIRDS ON PARÁ STATE, BRAZIL BVDV2; one had BVDV1 and one had BVDV2 and HoBi Chagas, E.H.N.; Bezerra, L.W.V.; Cherpinski, H.F.M.; Duarte Júnior, J.W.B.; Barros, B.C.V.; Mascarenhas, from 90.8 to 98.7%; BVDV1b, 93.9 to 96.7%; BVDV1d, J.D.A.P.; Marinho, A.N.R. 96.2 to 97.6%. The identity among HoBilike viruses INSTITUTO EVANDRO CHAGAS hadvaried antibodies from 96.6 to toBVDV 98.7%.2, with In VN titers assay, ranging 12 samples of 5 to 160. had Theseantibodies results to BVDV showed1 with a high titers level of 5 of to FBS 40; andcontamination 12 samples Studies demonstrate different birds’ species have with pestivirus RNA and call attention for continuous been affected by Rotaviruses (RV), symptomatic or and systematic monitoring to avoid contamination of asymptomatic, specially by RVA and RVC, which are biological products. important zoonotic agents, in addiction they represent an economy impact, due these animals decreased productivity. The RV offers a wide range of hosts and

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV are classified into nine groups or species designated XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

162 Veterinary Virology: VV from A to I, although in birds the infections have been (days 0, 30 and 390) of orfv-rabvgg-1 or orfv-rabvgg-2 characterizing by groups A, D, F and G and widely distributed. The RV belong to the Reoviridae family, genus days 0 (vaccination day), 30 (second dose day), 60 (30 Rotavirus have segmented genome with 11 double post-revaccination),containing 10^7.9 tcid50/dose. 180, 390 (third serum dose was day) collected and 420 at stranded RNA (dsRNA). This study aimed to detect RV by multiplex RTPCR in fecal birds specimens collected from dose - immunization) and tested for rabv neutralizing different locations from State of Pará. Nine two fecal (30 days post-revaccination after one year of the first specimens have been selected randomly, of different bird’s species, from the samples animals Bank been of rabvantibodies 30 post-vaccination. by rapid fluorescent heifers immunized focus inhibition with orfv- test Rotaviruses Laboratory of the Instituto Evandro Chagas rabvgg-1(rffit). all immunizeddeveloped titers animals of 80 developed to 1280 (gmtvn antibodies = 211) and to IEC. There specimens have subjected to Polyacrylamide heifers immunized with orfv-rabvgg-2 developed titers Gel Electrophoresis and Multiplex (RTPCR). All samples of 320 to 2560 (gmt = 735). the antibody titers at 180 from this study were negative by Polyacrylamide gel and 360 after vaccination demonstrated the duration of humoral response. after a booster vaccination after at day 390, animals of group orfv-rabvgg-1 developed Electrophoresis, however showed positivity in 10.9% titers of 40 to 2560 (gmt = 177) and heifers immunized (10/92) by Multiplex (RTPCR), which 6.9% (2/29) with orfv-rabvgg-2 developed titers of 80 to 1280 (gmt G.represented Subsequently the all Group positive A, samples 13.8% have (4/29) sequenced Group to D, = 422). we are currently investigating the impact of characterization10.3% (3/29) Group of groups. F and The 3.4% results (1/29) presented to the record Group vaccination with the recombinants in cellular responses simultaneously detection about RVA, RVD, RVF and RVG to rabv glycoprotein. these results demonstrate that from fecal birds specimens in the State of Pará, and orfv-rabvgg-1 and orfv-rabvgg-2 may be a new option for rabies vaccine cattle and suitability of orfv as a vaccine test, noticing the largest necessity investigation of delivery vector for this species. theseshow animals to the multiplex like RV reservoirs RTPCR efficiency and possible as diagnosticchance of VV78 - MOLECULAR CHARACTERIZATION OF zoonotic transmission. GLYCOPROTEIN G OF RABIES VIRUS FROM CATTLE IN VV76 - IMMUNOGENICITY OF PARAPOXVIRUS OVIS THE CENTRAL RIO GRANDE DO SUL STATE, BRAZIL RECOMBINANTS EXPRESSING THE RABIES VIRUS Martins, M.; Cargnelutti, J.F.; Quadros, J.M.; Batista, GLYCOPROTEIN AS A CANDIDATE VECTORIAL H.B.C.R.; Weiblen, R.; Flores, E.F. VACCINE FOR CATTLE 1. INSTITUTO PASTER Martins, M.; Cargnelutti, J.F.; Joshi, L.R.; Diel, D.G.; 2. UNIVERSIDADE FEDERAL DE SANTA MARIA Flores, E.F.; Weiblen, R. Rabies is a worldwide, generally fatal, zoonosis of 1. UNIVERSIDADE FEDERAL DE SANTA MARIA mammals, caused by the rhabdovirus rabies virus 2. SOUTH DAKOTA STATE UNIVERSITY (RabV). Rabies is endemic in Southern Brazil, especially The parapoxvirus orf virus (orfv) has several unique in Rio Grande do Sul (RS), Brazil where thousands of properties that make the virus an excellent candidate for bovine cases have been reported every year. Molecular vaccine delivery in livestock. to assess the suitability of orfv and epidemiological investigations of RabV infection as a multi-species vaccine delivery vector, we constructed have been performed, mainly to identify the virus orfv recombinants expressing the rabies virus (rabv) variants involved in the disease and their geographic glycoprotein g (gg). expression of gg by recombinants distribution. In the present study we performed a molecular characterization of the glycoprotein G (gG) of and their replication properties were assessed in bovine cellorfv-rabvgg-1 cultures. then, and orfv-rabvgg-2the immunogenicity was confirmed of orfv-rabvgg-1 in vitro bovine in RS between 2012 and 2016. Glycoprotein G is and orfv-rabvgg-2 recombinants was assessed in heifers. an78 importantRabV identified RabV inprotein clinical involved specimens in virulence obtained and from it thirty animals were allocated in two groups (15 heifers the interactions with the immune system. The gG gene each) and immunized intramuscularly with tree doses

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posterswas amplified - Veterinary by Virology: RT PCR; VV nucleotide and amino acid XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

163 Veterinary Virology: VV

acid sequences were obtained of 22 RabV obtained from November 2014, SVA has also been frequently reported cattlesequences from were central analyzed. RS. The To amino date, total acid nucleotide/amino analyzed showed insignificant swine in increaseBrazil. However, in the incidence the factors of that infection. contributed Since the high conservation of gG from all samples (97.6 to for the emergence of SVA remain unknown. The overall goal of our study was to characterize contemporary SVA sites (I, IIa and IIb, III, IV, G5 and G1). For phylogeny, isolates to determine the genetic diversity of the strains all100% samples of amino clustered acid identity), together mainly with inherbivorous all six antigenic and circulating in the US and Brazil. The complete genome vampire bat RabV obtained from Genbank and apart of sequences of seventeen SVA isolates obtained in the US dog, cat, wild animals and human RabV sequences. Three and four SVA isolates obtained in Brazil were compared sublineages were detected, clustering two samples from to other SVA sequences available on GenBank. Sequence comparisons revealed that the US contemporary isolates

JaguariPinhal Grande counties county obtained (sublineage in 2015 and1), identified 2016 (sublineage in 2012 identity with the prototype US SVA strain SVV001 and and 2016; three samples of Ivorá, Pinhal Grande and ancharacterized isolate obtained here in share Canada 91 93%in 2007 of (SVA nucleotide1155910 (nt)3), county (sublineage 3) in 2014, indicating divergent virus2); and circulating two samples in central obtained region from of SãoRS. PedroSome doamino Sul 9899% nt identity with other contemporary isolates two sublineages were determined by some mutations: withrecently a recent obtained Chinese in isolate the US, (CH 95197%2015). nt Comparison identity with of lineageacid mutations 2, at amino were acid identified position in gG375 sequences, (aspartic acid and thecontemporary amino acid Brazilian(aa) sequences isolates of andSVA 94polyprotein96% nt identity (2181 aa) revealed that the US contemporary isolates here share 376 (glycine to arginine). The results showed the high conservationto asparagine); of gG and among lineage the 3, analyzed at amino samples, acid position mainly based on a 541 nt region of the VP1 gene revealed a in the antigenic sites. On the other hand, our data similar9799% geneticaa identity heterogeneity with other betweenSVA strains. these Comparisons isolates. A demonstrate that different RabV variants are circulating among herbivorous of central RS. was observed when the contemporary SVA isolates were comparegreater genetic to historical divergence US isolates (8688% obtained nt identity), prior however, to 2002. VV81 - GENETIC CHARACTERIZATION AND Sequence comparisons between the isolates obtained PHYLOGENETIC ANALYSIS OF SENECAVIRUS A here and other contemporary or historical strains CIRCULATING IN THE US AND IN BRAZIL available on GenBank revealed a high degree of sequence Gava, D.; Joshi, L.R.; Mohr, K.A.; Haach, V.; Caron, L.; homology between contemporary isolates. Additionally, Schaefer, R.; Diel, D.G. both US and Brazilian SVA isolates share a high degree 1. EMPRESA BRASILEIRA DE PESQUISA of homology with a recent SVA strain obtained in China. AGROPECUÁRIA Phylogenetic analysis using complete genome sequences 2. DEPARTMENT OF VETERINARY AND of contemporary SVA isolates and a limited number of BIOMEDICAL SCIENCES, SOUTH DAKOTA historical sequences suggest a constant evolution of STATE UNIVERSITY SVA. Results here provide important information on the 3. UNIVERSIDADE DO OESTE DE SANTA genetic diversity of contemporary SVA isolates that have CATARINA been recently associated with outbreaks of vesicular 4. EMPRESA BRASILEIRA DE PESQUISA disease in swine. AGROPECUÁRIA Senecavirus A (SVA) has been associated with sporadic outbreaks of vesicular disease in pigs in the US since the late 1980’s. Recently, however, an increased number of reports have described the association of SVA with vesicular disease and neonatal mortality in swine. Notably, the number of SVA cases have jumped from two in 2014 to over 100 in 2015, which represents a Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

164 Veterinary Virology: VV

VV101 - NEUTRALIZING ANTIBODIES TO BOVINE VV110 - ANTIBLUETONGUE ANTIBODIES IN DAIRY ADENOVIRUS TYPE 3 IN CATTLE, RIO GRANDE DO CATTLE FROM THE STATE OF PERNAMBUCO, BRAZIL SUL, BRAZIL Maia, R.C.C.; Aragão, B.B.; Silva, B.P.; Oliveira, J.M.B.; Eisen, A.K.A.; Gras, C.K.; Demoliner, M.; Henzel, A.; Florentino, G.C.; Guedes, M.I.M.C.; Lobato, Z.I.P.; Maia, Spilki, F.R. R.C.C.; Pinheiro Júnior, J.W. UNIVERSIDADE FEEVALE 1. UNIVERSIDADE FEDERAL RURAL DE Adenovirus infections are mostly characterized by PERNAMBUCO 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS ubiquitous nature in many host species, thus being expected that seroprevalence to bovine adenovirus Bluetongue is a noncontagious infectious disease, (BAV3) may be high in cattle herds worldwide. However, caused by an Orbivirus from the Reoviridae family, there is no information regarding the presence of BAV3 called Bluetongue virus (BTV). This BTV transmission is carried out by hematophagous vector from the with respiratory disorders, conjunctivitis, and Culicoides sp. genera, being all domestic and wild pneumonia,specific antibodies and also in Brazilian with enteritis, cattle. BAVlymphadenopathy3 is associated ruminants susceptible to BTV infection, especially sheep. and polyarthritis disease, comprising the so called “weak calf syndrome”. Transmission mainly occurs by the fecal oral route, but can also occur by aerolized droplets. The casesBluetongue of this is disease a disease results with incompulsory great economic notification impacts to objective of the present study was to survey the presence duethe Worldto the direct Organization and indirect for Animal production Health. losses, Confirmed as well of neutralizing antibodies to BAV3 in cattle herds as sanitary restriction measures by importer countries. from Rio Grande do Sul State, Brazil. One hundred and The lack of data of this infection in the Northeast region seven (n=107) serum samples were analyzed by Virus of Brazil in the literature prompted the investigation on Neutralization (VN) assay. Serum samples were provided the present work. Therefore, the aim of this study was by Setor de Virologia da Universidade Federal de Santa to investigate the presence of antiBTV antibodies in Maria and came from central, north and northwest the dairy cattle of the state of Pernambuco, Brazil. The region of State, both from beef and milk cattle herd and mesoregion Ipanema Valley, in the state of Pernambuco from female gender. The serum samples were diluted comprises six counties (Águas Belas, Buíque, Itaíba, from 1:2 until 1:256 in microplates assayed against 100 Pedra, Tupanatinga and Venturosa) and its main economic activity is dairy production. During October of 2015 and February of 2016, 358 samples were collected antibodies.– 200 TCID50/mL One percent of a prototypeof serum of BAV these3 strain. animals Nearly had from female dairy cattle in reproductive age, from 18 all samples, 91% (97/107) were positive for antiBAV randomly selected farms. The sampling was designed to determine the occurrence of positive properties indeed1:4 of titers;BAV3 however,is circulating 60% among of serum southern samples Brazilian showed and seropositive animals per county. Subsequently, the cattletiters >herds 1:256. and From further these attention results, wehave can to conclude be taken that for samples were processed using the Immune diffusion the presence of typical clinical signs in calves. agar gel technique to detect the presence of antibodies. The results showed the presence of antiBTV antibodies

in 23.2% (83 / 358) animals. Interestingly, all properties The(100%) detection had at leastof infected one positive animals animal is important among their to establishherds, with prophylactic frequency varyingmeasures between in order 1.7 andto 84.6%.reduce the exposure of uninfected members of the herd. The results obtained in this initial work showed circulation of BTV in the mesoregion studied and that prevention and control measures need to be implemented to reduce the dissemination of the agent. Moreover, it indicates

165 Veterinary Virology: VV that new studies are necessary in order to identify the circulating serotypes in this region. (68,96%) samples from Aix galericulata, 8 (27.59%) of VV115 - DETECTION OF AVIAN METAPNEUMOVIRUS RRTDendrocygnaPCR assays viduata, for subtypes and 1 (3.45%)A and B. sampleThe data from shows Aix IN CAPTIVE ANATIDAE BIRDS thatsponsa. there None is aof circulationtested samples of a wasaMPV detected between by specificcaptive Ferreira, H.L.; Rizotto, L.S.; Simão, R.M.; Benassi, J.C.; birds that belong to the Anatidae family, corroborating Durigon, E.L. previous studies that also found aMPV subtypes A, and 1. DEPARTMENT OF VETERINARY MEDICINE B in Dendrocygma viduata, Anas bahamensis, Neochen FZEA, USP jubata samples, and subtype C in Cairina moschata, Anas 2. PÓSGRADUAÇÃO EM EPIDEMIOLOGIA discors, Branta canadensis and wild goose samples. EXPERIMENTAL APLICADA ÀS ZOONOSES Samples will be molecularly characterized by DNA 3. DEPARTMENT OF VETERINARY MEDICINE FZEA, USP subtype that has been found. 4. INSTITUTE OF BIOMEDICAL SCIENCES, sequencing to confirm the viral circulation and aMPV CLINICAL VIROLOGY AND MOLECULAR VV122 - PREVALENCE OF HEPATITIS E VIRUS (HEV) LABORATORY UNIVERSITY OF SÃO PAULO ANTIBODIES IN DOMESTIC SWINE IN PERNAMBUCO Wild birds from Anseriforme order, specially Anatidae Oliveira Filho, E.F.; Lopes, K.G.S.; Brandespim, D.F.; family, are considered reservoirs of many pathogens Pinheiro Junio, J.W.; Gil, L.H.V.G. that threats poultry industry. Among these pathogens 1. CENTRO DE PESQUISA AGGEU MAGALHÃES are the avian metapneumovirus (aMPV), one of the FIOCRUZ members of the genus Metapneumovirus, the family 2. UNIVERSIDADE FEDERAL RURAL DE Paramyxoviridae. The aim of this study was detect the PERNAMBUCO presence of aMPV in captive birds samples. To do so, Hepatitis E is a zoonotic emerging disease worldwide distributed. The causative agent, Hepatitis E virus (HEV) RTPCR targeting the N gene with expected fragment of is present in domestic pigs, wild boar, deer and rabbit, RNA purification was performed and a conventional 115bp and a real time RTPCR (RRTPCR) targeting the while other member of the Hepeviridae family are present in camel, moose, rat, ferret, bats, chicken and cutthroat of subtypes A and B were carried out. All assays were trout. In Brazil, few reports have shown the presence of G gene using primers and probes specific for detection validated using aMPV vaccines (subtype A and B) as HEV in humans, swine and in the environment samples. However, due to the lack of reported human cases it still by using a vaccinal Newcastle disease virus (strain La disputable whether Hepatitis E is a public health issue controls, RTPCR and RRTPCR specificity was assayed Sota). Regarding samples 329 oropharyngeal (OP) and or a neglected disease in the country. For instance, the cloacal swabs from captive birds of Anatidae family presence of HEV the Northeast regions has not been collected in 4 different locations from São Paulo state, yet reported in animals. In addition, environmental, following the guidelines and with the permission of the social and economic differences might play a role in the responsible agency (CEUAUSP and SISBIO), were tested. Hepatitis E transmission chain, concerning the disease Samples combining up 5 swabs types in one vial from severity and even genotype difference. In this study we birds of same sex, specie and cage. In total, 157 samples investigate the HEV seroprevalence in domestic pigs from were tested individually or pooled, comprising 78 OP the state of Pernambuco, northeast Brazil. A total of 229 and 79 cloacal swabs from 3 ducks, 2 swans, 2 drakes swine sera samples were collected from 16 farms using and 1 goose species. Additional samples were also intensive and semiintensive pig production systems. tested, those samples were pooled mixing OP and cloacal The presence of antiHEV IgG antibodies was investigate swabs, 2 each, totaling 172 samples from 2 drakes and 1 using the PrioCHECK HEV antibody ELISA kit (Thermo duck species. aMPV viruses were successfully detected

studyFisher), was specific performed for porcine in order (sensibility to examine of the 90.96% risk factor and detectedby all assays; by conventional whereas NDV RT wasPCR, not corresponding detected by tothose 20 specificity of 94.04%). In addition, an epidemiological tests. Of the 329 tested samples, 29 (8.81%) were Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

166 Veterinary Virology: VV

of NDV and IBV, respectively, were performed for DNA sequencing. One positive sample was selected for a deep negatives.associated All with farms the presencewere positive of HEV. with 82.10% the prevalence (188) of sequencing using Nextera XT kit (Illumina).18 samples the sera tested were positive and 17.90% (41) were (14 OP and 4 cloacal swabs) and 56 samples (42 OP and high positive rates among the pig farms in Pernambuco. 14 cloacal swabs of tested samples were detected by Therate presenceranging from of HEV 40 in to domestic 100%. The swine results poses shown a great very risk of infection to the human population. On another hand, those, eighteen samples (14 OP and 4 cloacal swabs) as most of the animals were in poor sanitary conditions, fromRRTPCR Aix specificsponsa andfor NDVAix galericulataand IBV, respectively. birds of Anatidae Among it cannot be discarded the possibility that pigs are getting family, were detected for both viruses. A sample from infected from human excrements (e.g. contact with Aix galericulata was selected for deep sequencing. sewage), which would suggest that the HEV might be Phylogenetic analysis from OP swab of Aix galericulata disseminated through both human and swine population in the state. We are currently identifying the risk factors genotype II of NDV vaccinal strains. Sequencing of S1 gene andbased analysis on 527 ofnt obtainedof F gene readsshowed from 93% deep of identity sequencing with studies should be carried out in order to investigate the are ongoing to characterize the detected viruses. Our presenceassociated of withHEV in the humans HEV infection/exposition. and other animal species Future as results indicate a high prevalence of IBV and NDV among tested samples,mainly in OP swabs, in agreement with previous studies, since inhibitory substances present in wellVV124 as to find - COtheINFECTIONS genotype and subtype WITH involved. INFECTIOUS BROCHITIS VIRUS AND NEWCASTLE DISEASE VIRUS Coinfections with IBV and NDV in ducks detected are in IN SAMPLES FROM CAPTIVE BIRDS agreementfecal samples with may a previous reduce orstudy. block Future RNA studies amplification. should Ferreira, H.L.; Simão, R.M.; Rizotto, L.S.; Benassi, J.C.; be done to elucidate how those interactions can affect Scagion, G.P.; Barnabé, A.C.S.; Caserta, L.C.; Arns, C.W.; Ferreira, H.L. VV141 - POOLED BATS’ SAMPLES SHOWED PRESENCE 1. UNIVERSIDADE DE SÃO PAULO viral fitness. 2. UNIVERSIDADE DE CAMPINAS OF CORONAVIRUS IN THREE DIFFERENT SPECIES Afonso, S.N.; Pedrozo - Pavini, D.F.; Carvalho, C.; Racca, Wild birds can be reservoir of many pathogens, G.N.; Barnabé, A.C.S.; Nascimento, G.M.; Beck, R.M.; including infectious bronchitis virus (IBV) (family Miller, M.E.; Moraes, A.P.; Lima Neto, D.F.; Jacomassa, Coronaviridae) and Newcastle disease virus (NDV) F.A.F.; Caserta, L.C.; Felippe, P.A.N.; Martini, M.C.; Arns, (family Paramyxoviridae). Coinfections with one or C.W.; Simas, P.V.M. virus were observed but they are rare. The aim of this 1. UNIVERSIDADE ESTADUAL DE CAMPINAS studymore viruseswas investigate including NDV,the presence IBV and/or of aviancoinfection influenza by 2. UNIVERSIDADE DE SOROCABA IBV and NDV in wild birds. One hundred and forty 3. UNIVERSIDADE FEDERAL DO PAMPA 4. BOSQUE DOS JEQUITIBÁS eight samples (cloacal and oropharyngeal OP swabs) pooled in up to 5 samples from captive birds allocated The Coronaviridae family has been associated with many in the same cage were tested. Samples were collected zoonotic diseases in humans. To date, many bat species, in Pirassununga city, Sao Paulo state according to the asymptomatic reservoirs for Coronaviruses. The aim of the QIAmp viral RNA kit (Qiagen) and realtime RT thisthe onlystudy truly was flying to identify mammals, Coronaviruses have been circulating identified asin PCRauthorities’ (RRTPCR) guidelines. reactions Viral targeting RNA purificationUTR gene of using IBV different bat species in the cities of Campinas and Rio and M gene of NDV, previously described, were carried Claro in the Sao Paulo State – Brazil, in areas of different chicken embryo eggs to attempt virus isolation and DNA older, later and most recently reforested areas and urban sequencingout. Samples was detected done using by both harvested tests were allantoid amplified liquid. in nativedegrees forest). of environmental Between 2011 conservation and 2015, (native 429 samplesforests; Conventional RTPCR reactions targeting F and S1 genes were collected, from which 256 oral and 173 anal swabs

167 Veterinary Virology: VV from the Phyllostomidae (8 species), Molossidae (5 diseases of the cats. The symptoms are mostly related species) and Vespertilionidae (1 specie) bat families. To perform a rapid and most effective screening, the tumours and hematological abnormalities are also samples were organized into pools according to origin of common.to immunodeficiency All cats should and be tested secondary for these infections, viruses, but as the swab (oral or anal) and bat specie. Thirtythree pools the most important way to prevent the spread of infection of 140µL each, composed by 20µL of seven samples, is the detection of cases. Many rapid immunoassay tests were submitted for RNA extraction through a QIAamp are available for the diagnosis of infection in veterinary Viral RNA Mini Kit. Another twenty pools were obtained practice. Two tests are commercially available in Brazil: a from RNA of other samples and were composed by 1µL of each sample (10 samples per pool). All pools were submitted to reverse transcription with High Bothlateral tests flow enzymeare rapidlinked immunoassays immunosorbent for assaysimultaneous (ELISA) Capacity cDNA Archive Kit, according manufacturing detectionkit and a lateralof antibodies flow immunochromatography against FIV proteins and(LFI) FeLV kit. intructions, and NestedPCR reactions for RdRp gene antigen in serum, plasma, or whole blood. The LFI assay of panCoronavirus according with the protocol of Chu was recently introduced in Brazil. The aim of this study et al. (2011). The positive pools were subbmited to new analysis in which were conducted new reactions hundred and twenty six plasma or serum samples from of individually samples. Twentyeight (28) anal swabs healthywas to compare and diseased LFI kit cats with were lateral tested flow using ELISA both kit. tests. One from three (3) bat species (Anoura caudifer, Carollia Real time Polymerase Chain Reaction (qPCR) was chosen perspicillata and Sturnira lilium) and ten (10) anal swabs between the kits. The results showed good agreement were positive for Coronaviruses. Seven (7) oral swabs betweenfor verification the tests. of However, samples three with plasma discordant samples results with (Carolliafrom the Vespertiolionidaeperspicillata) had familya positive (unclassified result. From species) the weak positive result for FIV in the LFI kit were negative in positive samples, ten (10) were collected in the Jequitibás the ELISA kit. These samples were also negative in qPCR. Woods, an urban park in the city of Campinas, and all Only one sample showed discordant results for FeLV. other were from two newly reforested areas surrounding In this case, the result was positive in the LFI kit using serum sample and negative in the ELISA kit. When the submitted for sequencing (results unavailable). These test was performed using the plasma sample, the result primarythe city of results Rio Claro. indicate The PCR that products different were Brazilian purified andbat was negative in both tests. This sample was negative species living in close proximity with both human and in qPCR. The LFI assay had a good performance when domestic animal populations may serve as reservoirs compared to the ELISA assay. However, plasma samples for Coronaviruses and demonstrate the importance of generated better accurate results and should be the new studies to understand the relationship between matrix of choice. Finally, although agreement between bat viruses associated with both human and nonhuman emerging diseases. tests results by qPCR is recommended. the two assays was good, confirmation of positive rapid VV154 - COMPARISON OF COMMERCIAL TESTS FOR VV163 - METAGENOMIC ANALYSIS FOR CORONAVIRUS THE DETECTION OF FELINE IMMUNODEFICIENCY DETECTION IN BATS ANAL AND TRACHEAL SWAB VIRUS AND FELINE LEUKEMIA VIRUS INFECTION SAMPLES Medeiros, S.O.M.; Silva, B.J.A.; Bittencourt, S.L.; Andrade, A.A.S. Ferreira, O.C.; Tanuri, A. INSTITUTO EVANDRO CHAGAS 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO Coronavíruses (CoVs) constitute a large viral family 2. CENTRO DE APOIO E DIAGNÓSTICO associated with respiratory infections. Many CoVs VETERINÁRIO species, which demonstrates a strong association. Leukemia Virus (FeLV) are members of the Retroviridae Also,described these inanimals the last can decade play an were important identified role from in virus bat Family,Feline and Immunodeficiency they are responsible Virus for the (FIV) most and important Feline dispersion. Contrasting the big diversity of bats in

168 Veterinary Virology: VV our region, there is a small number of research being as sentinel the species L. chrysomelas. Material and conducted on CoVs biodiversity in bats from Brazil, and Methods: Fecal samples were collected individually no research at all on Amazon bats. In order to detect from groups of primates living in four Atlantic Forest quickly all CoVs types from a sample, a PCR technique fragments. The animals were captured by tomahawk was established using a primer designed by aligning a traps, anesthetized for clinical evaluation and most of polymerase region that is conserved in the whole viral fecal samples were collected straight from the rectum. The feaces were storaged at 20ºC and shipped in dry is expected. The pancoronavirus PCR is a useful tool to ice to the Rotavirus Lab at Evandro Chagas Institute, screenfamily. positive The amplification samples and of to a 251detect base all paircoronaviruses fragment Brazil. Following the Public Health Service, screening types. Objectives: To identify coronaviruses in Carollia tests were performed by immunochromatography perspicillata individuals captured in the city of Canaã dos Carajás, state of Pará. Materials and methods: We 3 Lab. RNA viral extraction was proceeded using a mix used anal and tracheal swab samples from 32 individuals ofspecific fecal tosuspensions RVA inside ofprepared the Biosecurity in Tris Ca++Standards 0,01M Level pH totaling 64 samples. RNA was extracted from the 64 7,2. A Polyacrylamide Gel Electrophoresis (PAGE) to swab samples but only 12 of those samples, chosen determine the electropherotypes of RVA and RVC was randomly, continued to PCR using the pancoronavirus performed. And a quantitative real time Polymerase primer. 10 out of 12 samples followed for sequencing. Chain Reaction (qPCR) were made looking for the VP6

negative for RV. Despite of the negative results, this theResults: samples, 100% but positivity sequencing for results PCR testedweren’t samples. satisfying The as studygene amplification.was able to perform Results: a Allmolecular the fifty methodology samples were to theyPCR presented amplification low characterized quality values the and viral further presence analyses in investigate RVA and RVC in wild primates. Conclusion: were impossible. Conclusion: The present study was the This research indicates the absence of RV circulation in these groups of L. chrysomelas. However, future studies individuals from the State of Pará, although it wasn’t should be conducted to improve the understanding of first to detect coronaviruses in the Carollia perspicillata the RV epidemiology into the wild adding habitats and and to make the phylogenetic analysis since the obtained other environmental variables that could be affect the sequencespossible to showed make the quality identification below the of expected. the viral species virus infection in NHP populations. VV167 - SURVEILLANCE OF ROTAVIRUS IN WILD 178 ZIKA VIRUS IN PERIDOMESTIC NEOTROPICAL NEOTROPICAL PRIMATES PRIMATES FROM AN EPIDEMIC REGION IN BRAZIL Mascarenhas, J.D.P.; Silva, J.R.; Marinho, A.N.R.; Favoretto, S.R.; Araujo, D.B.; Oliveira, D.L.; Duarte, Barros, B.C.V.; Catenacci, L.S.; Junior, E.T.P.; de N.F.; Mesquita, F.; Crus, N.G.; Zanotto, P.; Durigon, E.L. Vleeschouwer, K.M.; Oliveira, L.C. 1. INSTITUTO PASTEUR/UNIVERSIDADE DE SÃO 1. INSTITUTO EVANDRO CHAGAS PAULO 2. CENTRE FOR RESEARCH AND CONSERVATION 2. INSTITUTO DE CIÊNCIAS BIOMÉDICAS/ – ROYAL ZOOLOGICAL SOCIETY OF ANTWERP UNIVERSIDADE DE SÃO PAULO 3. BICHO DO MATO INSTITUTO DE PESQUISAS Zika virus (ZIKV) is a viral disease recently associated Introduction: Acute diarrhea is one of the most causes with microcephaly and other central nervous system of morbidity and mortality among human and animals, including non human primates (NHP). However, few monkeys in Uganda and later in humans (Zika fever). In studies have investigated the occurrence of viral agents – CNS symptomatology. It was identified in Rhesus that could cause acute gastroenteritis in free living CNS alterations and rapid spread. Considering that the and threatened wildlife, as the goldenheaded lion virus2015 can ZIKV infect was African notified monkeys, in Northeast the aim Brazil of this related study to tamarins (Leontopithecus chrysomelas). The goal of was to research ZIKV in neotropical primates. Here we this study was investigate the occurrence of rotavirus show a ZIKV detection in neotropical primates captured (RV) in the Southern Bahia Atlantic Forest, Brazil, using in Ceara State, Northeast region and an epidemic area

169 Veterinary Virology: VV

VV186 - HEMORRHAGIC DISEASE IN BROCKET DEER (MAZAMA NANA) CAUSED BY DIFFERENT fromfor ZIKV. Ceara The State animals with were reports captured of microcephaly from July/2015 related to BLUETONGUE VIRUS SEROTYPES, BRAZIL March/2016, during the epidemic period and in areas to ZIKV. Samples of sera and oral swabs from 25 white Matos, A.C.D.; Rosa, J.C.C.; Baldini, M.H.M.; Cubas, Z.S.; tufted marmosets (Callithrix jacchus) and 17 capuchin Guedes, M.I.M.C.; Moraes, W.; Oliveira, M.; Felippi, D.; monkeys (Sapajus libidinosus) were tested for ZIKV Moraes, A.N.; Lobato, Z.I.P. using real time RTPCR assay as previously described. 1. UNIVERSIDADE DO ESTADO DE SANTA CATARINA showed high similarity with the ZIKV isolates circulating 2. ITAIPU BINACIONAL inSeven the (7/41)Northeast samples region were of Brazil.positive All and positive the sequencing primates were captured in several regions of the State, including Brazil has a great diversity of deer species with eight coastal (1 capuchin monkey), semiarid – “caatinga” biome species currently recognized. Deer breeding in Brazil, for (2 marmosets and 1 capuchin monkey) and a mountain conservation or commercial purposes, has been poorly range with rainforest remnants (2 marmosets – a female and its cub and 1 capuchin monkey), marmosets were animals in captivity. Despite the reproductive success, developed due to difficulties in maintenance of these free ranging and the capuchins were pets. All animals the mortality rate is still high, due to different diseases. were apparently healthy at the moment of their capture, Adenovirus Hemorrhagic Disease (AHD), Epizootic during the procedures and when released. The samples Hemorrhagic Disease (EHD) and Bluetongue (BT) are were collected during the viral epidemics in Ceara State, the diseases generally associated with hemorrhagic from animals living in proximity to humans and as disease in deer. AHD is a contagious disease caused by these mammals were constantly exposed to A. aegypti, Adenovirus hemorrhagic disease virus (AHDV), not yet it is likely that the ZIKV detected in the primates was recognized as a new species by ICTV. Bluetongue virus of human origin. There is no current information (BTV) and Epizootic hemorrhagic disease virus (EHDV) regarding the susceptibility of neotropical primates to are arboviruses transmitted by Culicoides sp midges and ZIKV, however, the yellow fever virus (YFV), another their distribution corresponds to the vector distribution, which is widespread in tropical and subtropical zones. Bela Vista Biological Sanctuary (CASIB) is a protected ZIKVvector detectionborne flavivirus, among has neotropical an established primates, sylvatic further cycle area in Itaipu Binational, located in the border of informationin Africa and is in required the America. to determine This is ifthe the first infection report was on Brazil and Paraguay. There, reproduction of Mazama incidental, as a result of the intense virus circulation and nana (brocket deer) happens continuously. However, outbreaks of hemorrhagic disease have led to death possibility that primates could act as reservoirs, with of a considerable number of animals along the years, ZIKV will“jumping” not establish from humans a sylvatic to cycle;neotropical or if there primates, is the compromising conservation efforts. In 2015, blood similar to the sylvatic cycle of YFV described in the New samples of the herd were collected for a serologic survey World. revealing high susceptibility of the animals to BTV infection.for BTV. From From 32 March deer, only to June one of (3.12%) 2015, four was seropositive,M. nana died with clinical signs and macroscopic lesions compatible with hemorrhagic disease. In April 2016, another three M. nana died with the same clinical signs. Fragments of tissues were collected and submitted for molecular diagnosis and virus isolation. Real time RT PCR results combined with differential diagnosis for AHDV and EHDV and virus isolation revealed that BTV was the etiological

inagent three of samplesthe outbreaks. from 2015 BTV (BTV3,was identified BTV14, andBTV18) isolated and in all samples. Different BTV serotypes were identified Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

170 Veterinary Virology: VV another two samples from 2016 (BTV19, BTV22). The neutralizing antibodies were detected in 17 and seven samples,amplification respectively. was performed Nine samplesin blood samples.were positive Total andfor ofidentification BTV3, BTV14, of occurringBTV18, BTV19 serotypes and BTV22 is essential detection for A56R gene. Seven samples were sequenced, and they disease epidemiological studies. This is the first report affecting wild ungulates in South America. Molecular and buffaloes in Brazil are susceptible to VACV infection, serologicalin Brazil, and studies the first integrated confirmed with case vectors of BTV distribution isolation corroboratingshowed 100% with similarity. previous These studies. results Furthermore, confirmed more that should be conducted in order to implement programs evidence was shown about VACV circulation among for conservation of endangered deer species. buffalo herds in different Brazilian regions. So far, buffaloes did not showed clinical signs compatible with VV187 - DETECTION OF VACCINIA VIRUS IN BUFFALO VACV infection in Brazil, which could suggest that they HERDS IN MARANHÃO STATE, BRAZIL might act as possible VACV reservoirs. It is well known Guedes, M.I.M.C.; Rehfeld, I.S.; Matos, A.C.D.; Freitas, that VACV is spread among cattle herds in the country, E.J.P.; Costa, E.A.; Lage, A.P.; Heinemann, M.B.; Lobato, Z.I.P. in buffalo´s herds as well. However, more studies are 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS necessaryand these findingsto determine suggests the thatimportance VACV may of bebuffaloes prevalent in 2. UNIVERSIDADE DE SÃO PAULO the epidemiology of VACV infection in Brazil. The production and consumption of buffalo milk and VV188 - METAVIROME OF DOMESTIC PIGEON IN THE meat has experienced great expansion in Brazil in the STATE OF SÃO PAULO, BRAZIL last years. The Brazilian herd is estimated in 1.15 million Caserta, L.C.; Simas, P.V.M.; Barnabé, A.C.S.; buffaloes, with herds present in all Brazilian regions. Nascimento, G.M.; Beck, R.M.; Miller, M.E.; Moraes, Among the pathogens that infect buffaloes, Buffalopox A.P.; Lima Neto, D.F.; Felippe, P.A.N.; Arns, C.W. virus (BPXV), considered a Vaccinia virus (VACV) variant, has been circulating among buffaloes, cows 1. UNIVERSIDADE DE SOROCABA and humans in Asia, mainly in India, since the 1960´s. 2. UNIVERSIDADE ESTADUAL DE CAMPINAS The disease caused by BPXV, which has economic and 3. UNIVERSIDADE DE SÃO PAULO DEPARTAMENTO DE PROTEÇÃO E BEM ESTAR public health impacts, is characterized by exanthematic ANIMAL PREFEITURA DE CAMPINAS lesions, similarly as it is observed in cases of bovine vaccinia (BV), caused by VACV, in Brazil. So far, no VACV The domestic pigeon (Columba livia domestica) is one outbreaks in buffaloes have been reported in Brazil. of the main sinantropic birds in Brazil. The gathering However, antibodies antiOrthopoxvirus (OPXV) have of this specie represents a public health problem been detected in asymptomatic buffalo herds in Minas specially due to the carriage of pathogenic agents. The Gerais and Pará (Marajó Island) states, in the Southeast present study was aimed at identifying viral agents and North Brazilian regions, respectively. Furthermore, in domestic pigeons by the use of metagenomics. VACV DNA genome was detected in serum samples from Twenty samples were collected in the Tietê Ecological asymptomatic buffaloes from Marajó Island. Therefore, Park, São Paulo SP, Brazil. Samples were grouped in 2 it is important to study VACV circulation in buffalo’s pools: 10 oropharyngeal swabs and 10 cloacal swabs. A herds from other Brazilian regions. Total blood and pretreatment was carried out with DNAse and Proteinase serum samples were collected from 33 asymptomatic K, followed by RNA extraction. Libraries were prepared buffaloes belonging to herds from Maranhão state, and sent for sequencing in the HiSeq 2500 Sequencing Northeast region, which has the fourth largest buffalo System – Illumina platform at the Central Laboratory herd in Brazil. Serum samples were submitted to of High Performance Technologies LaCTAD (Unicamp). immunoperoxidase cell monolayer cell assay (IPMA) A pairedend 2x100pb run in 1 lane yielded 83.944.578 and plaque reduction neutralization test (PRNT) to detect total and neutralizing antibodies antiOPXV, reads, among which 80,67% presented a quality index respectively. Conventional PCR for the VACV A56R gene using a viral genome database. Between analyzed >= Q30. Similarity analyses were performed by Metavir

Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV contigs, 91% grouped with dsDNA viruses, with no XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

171 Veterinary Virology: VV

10 anal swabs and 10 oral swabs were collected from of the sequences in this group whereas the families 10 bats belonging to a Tadarida brasiliensis colony RNA stage. Caudovirales are represented by 45% in the Jequitibas Woods, Campinas, São Paulo, Brazil. Samples were sent for sequencing in the HiSeq 2500 Mimiviridae and Phycodnaviridae accounted for 17% Sequencing System – Illumina platform at the Central distributedand 14%, respectively. among several Within phages, the Caudovirales being the groupmost Laboratory of High Performance Technologies LaCTAD representativethe Myoviridae the family Haemophilus grouped 55% phage of theAaphi23 sequences, and (Unicamp). A pairedend 2x100pb run in 1 lane yielded detection of representatives of the Caudovirales orderthe Bacilus with phageover 40000305phi8 scaffolds36. There clustered, was a thesignificant family annotation,345.409.110 MetaVelvet reads, among and Metavir which 76,47% 2 were used. presented Nearly a Myoviridae had 2200 scaffolds associated followed by quality index >= Q30. For the assembly of contings and the family Siphoviridae and Podoviridae (1800 and 500 belonging to the subfamily Orthoretrovirinae. Viruses scaffolds respectively). Within the Myoviridae family that4% of cause sequences immunosupression presented similarity in birds withans simians retroviruses were it was noteworthy the subfamily Tenevirinae with detected within this family, like viruses of the family of 500 associations, more than all the other subfamilies reticuloendotheliosis (6181 scaffolds), including Avian spleen necrosis virus (2564 scaffolds), and Simian associated with Myoviridae. The Siphoviridae family was retrovírus. In addition, retroviruses that cause tumours subdividedcombined butin the less genus than Lambdalikevirus sequences unclassified (54 scaffolds), but in murines, like murine osteosarcoma virus and mouse Barnyadilikevirus (24 scaffolds) and Andromedalikevirus mammary tumor vírus were detected. Therefore, it is (22 scaffolds). A similarity was also found with viruses possible to conclude that the metagenomic approach important for human health, such as HHV6 (9 scaffolds) using next generation sequencing represents a useful methodology in epidemiological studies and a powerful that bacteria serve as natural hosts for some of these tool in researches involving the zoonotic potential of and RSV (2 scaffolds). Regarding this findings it is known bats, not only as reservoirs for retroviruses but also in the samples. This study provides a description of the for other important diseases in human and veterinary basalviruses, virome which of maydomestic reflect pigeons, the presence prior to of the such study hosts of health. symptomatic birds’s virome. VV245 - CORONAVIRUS IN A THRAUPIDAE BIRD VV196 - CITY BATS AS CARRIERS OF RETROVIRUS LIVING IN THE URBAN AREA OF CAMPINAS do Nascimento, G.M.; Simas, P.V.M.; Barnabé, A.C.S.; do Nascimento, G.M.; Beck, R.M.; Caserta, L.C.; Caserta, L.C.; Martini, M.C.; Durães Carvalho, R.; Barnabé, A.C.S.; Miller, M.E.; Moraes, A.P.; Simas, Felippe, P.A.N.; Ferreira Neto, D.L.; Beck, R.M.; P.V.M.; Martini, M.C.; Durães Carvalho, R.; Fellippe, Jacomassa, F.A.F.; Moraes, A.P.; Barbosa, C.M.; Miller, P.A.N.; Ferreira Neto, D.L.; Jacomassa, F.A.F.; Barbosa, M.E.; Oliveira, D.B.L.; Durigon, E.L.; Arns, C.W. C.M.; Oliveira, D.B.L.; Durigon, E.L.; Arns, C.W. 1. UNIVERSITY OF CAMPINAS 1. UNIVERSITY OF SOROCABA 2. UNIVERSITY OF SOROCABA 2. FEDERAL UNIVERSITY OF PAMPAS 3. FEDERAL UNIVERSITY OF PAMPAS 3. OSWALDO CRUZ FOUNDATION 4. OSWALDO CRUZ FOUNDATION 4. JEQUITIBÁS WOODS 5. JEQUITIBÁS WOODS 5. UNIVERSITY OF SAO PAULO 6. UNIVERSITY OF SAO PAULO 6. UNIVERSITY OF CAMPINAS Bats have been receiving growing attention for serving as The recent advances in molecular sequencing techniques reservoirs for many emerging infectious diseases. Ahigh number of zoonotic viruses in humans and animals have novel viruses in avian species. Between January, 2012 andare leadingSeptember, to the 2014, identification at least and73 discoveryviruses belonging of many anthropogenic pressure on wildlife habitats facilitates been associated to this reservoir. The intensification of published in indexed journals. Among RNA viruses, bats and humans and domestic animals. For this study, thoseto more belonging than 17 to families Coronaviridae were identified family were in birds the most and the interespecific transmission of pathogens between Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

172 Veterinary Virology: VV numerous and gammacoronavirus the main genus Brazil. Whole blood samples were collected (0.5 to 1.0 detected in birds. The main representative within this ml) from 151 cats, centrifuged, and obtained sera were genus is the infectious bronchitis virus (IBV), responsible tested by ImmunoComb® FCoV kit (FIP) ® (Biogal Galed for large economical losses in the poultry industry. In the Labs. Abs. Ltd.) for detection FCoV antiIgG antibodies last years, CoVs were isolated from many avian orders, following manufacturer\’s recommendations. A including Passeriformes. It leads to the idea that wild birds are essential as reservoirs and carriers of CoVs. In May, 2016, twenty three birds belonging to the Tersina forseroprevalence animals that of live 65% in werepopulated observed environments in 98 of 151 such tested as viridis specie, Thraupidae family, were found dead in sera. It is estimated a FCoV seropositivity of 80% to 90% the urban area of Campinas, State of São Paulo, Brazil. in the home environment. The present study found that The postmortem examination found that the cause of theshelters FCoV and infection catteries, is andwidespread 25% to 40% in the for populationpet cats living of death was traumatism due to a frontal collision against domiciled domestic cats from Botucatu. a window, meaning that the sampling was most likely VV257 - DETECTION OF HEPATITIS E VIRUS IN composed by healthy wild birds. In order to investigate SAMPLES OF SWINE FECES FROM THE STATE OF SAO the presence of viruses in these birds, tracheal and PAULO BY RTPCR cloacal swabs were collected. After the RNA extraction and cDNA synthesis, a nested PCR was carried out Cortez, A.; Metorima, C.S.; Sousa, A.O.; Miuagi, targeting the RdRp gene of coronaviruses, using genus S.A.T.; Castro, A.M.M.G.; Brandão, P.E.; Pinto, M.A.; wide universal primers. Samples from 8 different birds Heinemann, M.B.; Megid, J. were considered suspect after the electrophoresis gel 1. CURSO DE MEDICINA VETERINÁRIA analysis. Five samples were chosen between these UNIVERSIDADE DE SANTO AMARO 2. FACULDADE DE MEDICINA VETERINÁRIA E to verify the presence of the virus. One sample retrieved a ZOOTECNIA UNIVERSIDADE DE SÃO PAULO 158suspect bp sequence and after showingDNA purification, similarity they with were human, sequenced canine, 3. CURSO DE MEDICINA VETERINÁRIA FACULDADES METROPOLITANAS UNIDAS bat and ferret coronavirus. Probably due to the short range and quality of the sequence, it was not possible Hepatitis E virus (HEV) is a member of the genus to perform a more precise phylogenetic analysis of this Orthohepevirus in the Hepeviridae family. HEV is a virus. For this reason, other samples will be sequenced nonenveloped, singlestranded, positivesense RNA virus as a next step, to provide a better characterization about containing about 7.2 kb in its genome that contains what CoVs this specie and order of birds is able to carry. 3 open reading frames (ORFs) ORF1, ORF2 and ORF3 encoding respectively a nonstructural protein, the VV251 - SEROPREVALENCE STUDY OF FELINE capsid protein, and a small protein involved in virus CORONAVIRUS (FCOV) INFECTION IN DOMICILED egress. HEV genotypes 3 and 4 have been isolated from DOMESTICS CATS FROM BOTUCATU CITY, SÃO PAULO, both humans and animals such as deer, wild boars BRAZIL and pigs and are recognized as zoonotic pathogens. In Almeida, A.C.; Araújo Jr., J.P. Brazil, HEV has also been detected in pigs from Rio de UNIVERSIDADE ESTADUAL PAULISTA Janeiro, Paraná, Pará, Mato Grosso and Sao Paulo states. The feline Coronavirus (FCoV) is responsible for causing In addition to swine, HEV infections have been detected on of the most important infectious diseases that affect domestic and wild cats, the feline infectious peritonitis report of a human autochthonous case was documented in other domestic and wild animal species and the first (FIP), which is an immunemediated, systemic, in 2010 in Rio de Janeiro. With the aim to evaluate the progressive and fatal disease. The FCoV is highly occurrence of pigs with HEV infection in Campinas contagious and the infection is common in populations Region of the São Paulo State, 89 stool samples were of domestic cats worldwide. This study aimed to collected between 2008 and 2009 and screened by determine the seroprevalence of FCoV infection in nested RTPCR using primers targeting ORF1. The domiciled domestic cats from Botucatu city, São Paulo, viral RNA was extracted with Trizol® according to the manufacturer’s instructions, from faecal suspensions in Virus Reviews & Research Vol 20 (2), August-December 2016 - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

173 Veterinary Virology: VV

by readthrough alternative splicing, and its product conducted using MMLV® (Invitrogen). The positive was also shown to restrict feline retroviruses. in other samplesPBS (10 20% were w/v) sequenced and RNA in the reverse automated transcription sequencer was mammals, a3h singlenucleotide polymorphisms (snps) ABI 3500 (Applied Biosystems®). Electropherogram was shown to alter the stability and cellular localization quality analysis and the consensus sequence were localization and reducing its anti viral effect. thus, it might beof thepossible encoded that protein, a3h variants thus influencing would confer its subcellular different searchesperformed were using conducted Phred andagainst CAP3 sequences software deposited (http:// asparagin.cenargen.embrapa.br/phph/). Similarity little is known on the genetic variability of a3 genes in domesticdegrees of cats. susceptibility the aim of tothis fiv study infections was the in cats. investigation however, neighborin GenBankjoining using method the BLASTn with the(http: Kimura //www.ncbi. 2parameter nlm. modelnih.gov/BLAST/). using the MegaPhylogenetic 6.0 software. trees were Bootstrap generated values by for phylogenetic trees were determined using 1000 usedof the as variability template of to a3h amplify in naturally a region fiv infectedof a3h thatcats. wasdna previouslyobtained from shown whole to displayblood of polymorphisms 27 fiv positive incats the were cat positive for the ORF1 fragments. The sequences replicates. Of the 89 samples tested, 7 (7.56%) were ii,population. iii and iv. followingtwenty one the samples sequencing showed of the a65s amplified snp, stoolconfirmed samples that of all swine of the feces samples by RT identifiedPCR shows in the that present there ofregion, these the 18 samples were heterozygous were classified and in 3 thehomozygous haplotypes for i, maystudy be were a direct classified or indirect as genotype human 3.exposure Detection to ofthe HEV agent in this polymorphism. this snp was previously associated and suggests that there may be an endemic circulation of with susceptibility to the infection. our results indicate HEV in pig farms. that, as previously shown in other mammals, there is variability in a3h genes among the population of VV260 - ANALYSIS OF SINGLENUCLEOTIDE domestic cats, which could contribute to susceptibility POLYMORPHISMS IN THE APOBEC3Z3 GENE IN NATURALLY FELINE IMMUNODEFICIENCY VIRUS INFECTED DOMESTIC CATS andof domestic in vitro experiments.cats to retroviral infections; however, these Franco, A.C.; Cano, L.; Costa, C.; Duda, N.C.B.; Firpo, results should be confirmed by more extensive analysis R.M.; Nunes, R.; Finoketti, F.; Correa, R.; Roehe, P.; VV261 - COMPLETE GENOME SEQUENCE OF AN Amorim, F. EQUINE INFECTIOUS ANEMIA VIRUS FROM BRAZIL UNIVERSIDADE FEDERAL DO RIO GRANDE DO Araujo Jr., J.P.; Malossi, C.D.; Fioratti, E.G.; Lima, SUL M.F.N.T.; Aguiar, D.M.; Ullmann, L.S. 1. EMPRESA BRASILEIRA DE PESQUISA distributed retrovirus that infects domestic cats (felis AGROPECUÁRIA Feline immunodeficiency virus (fiv) is a widely 2. UNIVERSIDADE FEDERAL DO MATO GROSSO 3. UNIVERSIDADE ESTADUAL PAULISTA are counteracted by different immune mechanisms, includingcatus) and the other restriction members factors, of the felidae.which fivare infections proteins Equine infectious anemia virus (EIAV) is a persistent that have the ability to hamper retroviruses’ replication lentivirus that causes equine infectious anemia (EIA). and are part of the conserved mechanisms of anti viral All of the complete genomic sequences published from immunity of mammals. the apobec3 or a3 proteins are the most studied class of restriction factors. such proteins and only proviral genomic sequences are available. are cytidine deaminases that generate hypermutations Infield Brazil, virus areEIAV from is endemicNorth America, in Pantanal Asian andregion Europe, and in provirus dna during reverse transcription, thus euthanasia is not mandatory in these areas. Only the gag causing hypermutations in the viral genome, hampering sequence is currently available from the Brazilian virus. virus replication. the feline genome contains four a3h This study aimed to sequence EIAV’s genomic RNA for genes named a3z2aa3z2c and a3z3. in addition to infected horse from Mato Grosso State was collected. the first time in naturally infected horses. Plasma of an Virusthese, Reviews a fifth & transcript, Research Vol designated 20 (2), August-December a3z2z3, is 2016expressed - Abstracts/Posters - Veterinary Virology: VV XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

174 Veterinary Virology: VV

Total RNA was extracted and used to prepare the dsDNA Brazilian strain, we designed a quantitative PCR based on EIAV sequences from Mato Grosso Brazil obtained in our lab to detect the current circulating virus. The library with the kit Strand Specific RNA Library Prep designed qPCR primers amplify a 71 bp product from and(Agilent sequenced Technologies). with the NextSeq The library System was (Illumina quantified Inc.). by the 5’ LTR region. GoTaq® qPCR Master Mix (Promega) GeneiousIllumina LibraryR6 was Quantificationused to analyze kit the (Kapa sequences, Biosystems) using was used in the reaction plus 5 pmol of each primer, 4 the map to reference tool with complete EIAV genome uL of gDNA sample (about 100 ng) and nuclease free from isolate DV103(accession no. HM141910). Then, water to 20 uL. The thermocycling program set up in primers were designed to cover the gaps of the consensus a 7500 Fast qPCR (Applied Biosystems) was 1 cycle at sequence, and these PCR products were sequenced by 95ºC for 10 min, 40 cycles at 95ºC for 15 sec and 60 ºC Sanger protocol in a 3500 platform (Applied Biosystems). for 1 min, followed by the standart melting curve. Eighty A new alignment with all the sequences (12 sequences eight equine sera samples were tested in AGID or ELISA obtained by Sanger and 9,185,813 reads obtained by and their gDNA extracted from whole blood was tested Illumina) generated a consensus sequence of 7,591 bp with the SemiNestedPCR and qPCR. Equine GAPDH was

Thirty horses were positive in AGID or ELISA, and in length, presenting 94% of coverage. This isolate has althoughused in the 16 samples were positive as a control both ingene the and SemiNested all amplified.PCR (AF033820),just 82% of nucleotide and Ireland sequence isolates identity(JX480631 withJX480634). the main Furthermore,field strains, like phylogenetic EIAV Liaoning studies (AF327878), using EIAV Wyomingsequence against known viral strains of EIAV strongly suggests Aand test in performed the qPCR, withnot the a serially same samples diluted positiveamplified. sample This this isolate comprise a separate monophyletic group. indicatesresult shows the that same the reactionssensibility have in differentboth reactions. specificity. A With these results it is possible to better characterize the qPCR using cDNA of some positive samples had a good virus circulating in Brazil and to cope with the challenges of the EIAV diagnosis in Brazil. thatamplification the two reactionstoo, and a cannext be step used is usein a this set reaction to a better for VV262 - DETECTION OF THE CURRENT CIRCULATING detectiona viral quantification. of the virus circulatingWith these in results Brazil weand concluded maybe to EQUINE INFECTIOUS ANEMIA VIRUS IN BRAZIL BY help to classify animals in viremia. QUANTITATIVE PCR Araujo Jr., J.P.; Malossi, C.D.; Lima, M.F.N.T.; Aguiar, D.M.; Ullmann, L.S.; 1. UNIVERSIDADE ESTADUAL PAULISTA 2. EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA 3. UNIVERSIDADE FEDERAL DO MATO GROSSO Equine infectious anemia virus (EIAV) is a lentivirus that causes equine infectious anaemia (EIA), a persistent viral infection. The recommended diagnosis method is either agar gel immunodiffusion (AGID) or enzyme linked immunosorbent assay (ELISA). The PCR described by OIE to detect EIAV does not amplify the virus currently circulating in Brazil due to the higher genetic variation.

Asian EIAV is used in some Brazilian labs, but some serologicallyA modification positive in the NestedsamplesPCR testprotocol negative to detect in thean

SemiNestedPCR modified. In order to find a more sensitive Virusand more Reviews specific & Research molecular Vol 20 (2), technique August-December to detect 2016 the - viralAbstracts/Posters - Veterinary Virology: VV INDEX XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

176 Index

A Aragão, F.A.S. 128–151 155–174, 171–174 Abdalla, L.F. 8, 13, 34–47 Aragon, D.C. 14, 46–47 Barbosa, F.H. 97–115, 101–115 Abjaude, W.S. 64 ARAGON, D.C. 10 Barbosa, J.A.R.G. 131–151 Abreu, M.N. 99–115 Aranha, D.P. 68 Barbosa, N. da S. 120 Acosta, P.O.A. 91–115 Arantes, A.M. 99–115 Barbosa, N.S. 7, 9, 12, 14, 28–47, 41–47 Acrani, G.O. 9, 14, 41–47 Araujo, C.L. 7, 12, 25–47 Barbosa, V.G. 62 Afonso, S.N. 166 Araujo, D.B. 168 Barletto, J.S. 92–115, 93 Aguiar, D.M. 135–151, 173–174, 174 Araújo, D.B. 55 Barnabé, A.C.S. 24–47, 105–115, 166, Aguiar, M.F.G. 96–115 Araújo, E.C. 109–115 166–174, 170–174, 171–174 Aguiar, R.S. 8, 13, 32–47, 83 Araujo, E.D. 86 Barnabé;, A.C.S. 7, 12 Aguilar, G. 111–115 Araújo, E.D. 52, 90 Barreto, D.M. 52, 86, 90 Aguilar, J. 10, 14, 46–47 Araujo, J. 155–174 Barreto, S.F.D. 98–115 Akamine, R.N. 9, 13, 35–47 Araujo Jr., J.P. 118–120, 173–174, 174 Barreto, S.S. 146–151, 148–151, 149–151 Albino, S. 76 Araújo Jr., J.P. 172–174 Barros, A.M.R. 140–151 Albino, S.M. 67, 68, 69 Araújo, L.A. 91 Barros, B.C.V. 156–174, 161–174, Albrieu-Llinás, G. 10, 14, 46–47 Araujo, N.M. 10, 14, 45–47 168–174 Albuquerque, L.C. 134–151, 143–151 Araújo, S.C. 157–174 Barros, C.S. 54, 62 Alencar, R.C.G. 91 Ardisson Araujo, D.M. 133–151 Barros, D.R. 146–151 Alfenas-Zerbini, P. 9, 9–14, 14, 42–47, 49 Ardisson Araújo, D.M. 150–151 Barros, G.S. 52, 86, 90 Alho, M.J.O. 95–115, 98–115 Ardisson Araújo, D.M.P. 142–151 Barros, I.C. 80, 80–115, 112–115 Almeida, A.C. 172–174 Ardisson-Araújo, D.M.P. 7, 13, 31–47 Bartholomeu, D.C. 8, 13, 33–47 Almeida, J.C.F. 49 Arias-Stella, J. 114 Basiletti, J. 111–115, 112–115, 113–115 Almeida, M.M.S. 136–151, 137–151 Arns, C.W. 7, 12, 24–47, 105–115, 166, Batista Filho, A.F.B. 159–174 Almeida, M.R. 6, 12, 21–47 166–174, 170–174, 171–174 Batista, H.B.C.R. 162–174 Almeida, P.N. 9, 13, 37–47 Arruda, E. 6, 6–14, 7, 7–14, 7–14, 9, 9–14, Batista, J.G. 122–151 Almeida, R. 6, 12, 19–47 9–14, 9–14, 10, 10–14, 12, 12–14, Batista, L.F. 9, 13, 38–47 Almeida, S.E.M. 72, 73, 74, 75, 76 12–14, 12–14, 14, 20–47, 27–47, Batista, M.N. 101–115 Almeida, T.N.V. 10, 10–14, 14, 45–47, 86, 28–47, 40–47, 41–47, 46–47, 63 Batista, M.V.A. 51, 52, 86, 90 86–115, 94–115 Arruda, L.B. 8, 9, 13, 14, 32–47, 39–47, 59 Beck, R.M. 7, 12, 24–47, 105–115, 166, Almeida, T.P.A. 8, 13, 34–47 Ashimine, R. 119–120 170–174, 171–174 Almonte, M. 112–115 Assis, A.S.F. 71 Bedran, R.L.S. 100–115 Al Rwahnih, M. 7, 13, 28–47 Assis, M.R.S. 9, 13, 37–47 Beguelini, M.R. 53 Alvarenga, C.F. 60 Assis, R.C.F.P. 95–115, 98–115 Bello, G. 11, 16–17, 85 Alves, A.D.R. 84 Azevedo, J.N. 108–115 Bello, V.H. 126–149, 126–151 Alves, A.S. 70 Azevedo, M.M.M.S. 108–115 Benassi, J.C. 165–174, 166–174 Alves Freitas, D.M.T. 129–151, 132–151 Azevedo, R.M. 60 Benites, C.I. 118–120, 119–120 Alves-Freitas, D.M.T. 9, 9–14, 14, 43–47 Azevedo, R.S.S. 157–174 Berlanda, R.L.A. 57 Alves, J.C.S. 70, 72, 88 B Bezerra, D.A.M. 82 Amado Leon, L.A. 84 Badial, R.M. 88, 88–115, 103–115 Bezerra, D.H. 108–115 Amaral, J.G. 137–151 Badra, S.J. 120 Bezerra, L.W.V. 161–174 Ambar, G. 60 Badr, K.R. 86 Bezerra, M.C.F. 135–151 Amorim, F. 173–174 Baggio, M.L. 11, 17, 81 Bianchi, E. 75 Amorim, M.M.R. 8, 13, 32–47 Balbino, V.Q. 52 Biasoli, B. 10, 14, 46–47 Andrade, A.A. 10, 10–14, 14, 45–47 Baldini, M.H.M. 169–174 Bicalho, K.M. 9, 13, 35–47 Andrade, A.A.S. 167–174 Bandeira, R. da S. 11, 16–17 Bittar, C. 53 Andrade, A.S. 62 Bandeira, R.S. 62, 72, 82, 82–115, 93–115, Bittencourt, S.L. 167–174 Andrade, M.A.S. 153–174, 154–174 109–115 Blawid, R. 7, 9, 13, 28–47, 30–47, 31–47, Andrade, P.O. 49 Barardi, C.R.M. 9, 13, 36–47, 38–47 38–47, 128–151, 130–151, 133– Andrade, R. 9, 9–14, 14, 43–47 Barata, R.R. 78, 144–151 151, 137–151, 138–151, 141–151, Andrade, S.T.Q. 101–115 Barbagelata, L.S. 97–112, 98–115, 142–151, 144–151, 147–151 Andriguetti, N.B. 75, 76 100–115 Blissard, G.W. 6, 12, 20–47 Anjos, T.P. 139–151 Barbosa, A.N. 6, 12, 19–47, 97–115, Boccardo, E. 64 Anselmo-Lima, W.T. 6, 12, 20–47 101–115 Boiteux, L.S. 127 Aragão, B.B. 164–174 Barbosa, C.M. 105–115, 153–174, Bonfim, C.M. 88, 88–115, 95–115,

Virus Reviews & Research Vol 20 (2), August-December 2016 - Index XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

177 Index

103–115 Carmona, R.C.C. 10, 10–14, 14, 44–47, 80 Costa, A.G. 7, 12, 25–47 Borges, A.F. 93 Carneiro, B.M. 101–115 Costa, C. 173–174 Borges, F.P.S. 99–115 Carneiro, M.A.S. 91 Costa, C.H.C. 155–174 Born, P.S. 6, 11, 12, 16–17, 22–47 Carneiro, T.M. 134–151 Costa, E.A. 170–174 Botosso, V.F. 55, 107 Caron, L. 7, 12, 24–47, 163–174 Costa, G.A. 138–151, 142–151, 144–151, Braconi, C.T. 55 Carrazzoni, P.G. 153–174, 154–174 147–151 Brandão, P.E. 172–174 Carréra, A.F.K. 108–115 Costa, I.C.T.A. 49 Brandespim, D.F. 165–174 Carvalho, A.E.S. 93 Costa, J.C.C.S. 60 Brant, P.M. 9, 9–14, 14, 42–47 Carvalho, A.N. 9, 14, 40–47 Costa, J.D.D. 50–65 Brasi Costa, I. 110–115 Carvalho, C. 60, 166 Costa Junior, A.C. 128–151 Brasil Costa, I. 80, 80–115, 81, 81–115, Carvalho, L.D. 51, 108–115 Costa-Junior, A.O. 7, 12, 26–47 112–115 Carvalho, L.V. 6, 12, 19–47 Costa, K.R.S. 109–115 Brasileiro, A.C.M. 127 Carvalho, M.S. 135–151, 139–151, Costa, K.S. 144–151 Braunig, P. 161–174 145–151 Costa, L.J. 9, 14, 40–47, 58, 107–115 Bressan, G.C. 6, 12, 21–47 Casagrande, V.M. 6, 12, 22–47, 117–120 Costa, T.M. 128–151, 148–151, 149–151 Brown, D. 6, 12, 22–47 Cascardo, R.S. 49 Coutinho, C.R.M. 87, 88 Bruckner, F.P. 9, 9–14, 14, 42–47 Caserta, L.C 166–174, 170–174, 171–174 Criado, M. 7, 9, 12, 14, 28–47, 40–47 Bularmaqui, T.C.T. 144–151 Caserta, L.C. 7, 12, 24–47, 105–115, 166, Criado, M.F. 7, 9, 12, 14, 27–47, 41–47 Burbano, R.M.R. 6, 12, 19–47 166–174, 170–174, 171–174 Cristaldo, C. 112–115 Burbano, R.R. 80 Casseb, L.M.N. 157–174 Cruciol, G.C.D. 126–151 Burlamaqui, T.C.T. 139–151 Castilho, J.N. 122–151 Crus, N.G. 168 C Castro, A. 111–115 Cruz, A.A. 6, 12, 19–47 Caballero, S.V. 112–115 Castro, A.M. 112–115, 113–115 Cruz Neto, A.P. 60 Cadar, D. 131–151 Castro, A.M.M.G. 172–174 Cruz, T.F. 118–120 Caetano, B.C. 6, 12, 22–47 Castro, F.O.F. 93 Cubas, Z.S. 169–174 Caixeta, G.N. 91 Castro, I.A. 6, 12, 20–47, 63, 104–115 Curty, G. 83 Calegario, R.F. 138–151 Castro, V.F.D. 104–115 D Calmon, M.F. 88, 88–115, 95–115, Castro, W. 111–115 Dábilla, N.A.S. 10, 10–14, 14, 45–47, 103–115 Catenacci, L.S. 168–174 94–115 Campbell, C.M.P. 11, 17 Catharino, A.M.R. 119–120 da Fonseca, F.G. 8, 13, 33–47 Campestrini, J. 7, 12, 26–47 Cavalcante, M.S.B. 54 da Franca, T.S. 7, 7–14, 7–14, 9, 9–14, 13, Campo, A.J. 6, 12, 21–47 Ceole, L.F. 56 13–14, 13–14, 14, 29–47, 43–47 Campos, A.C.A. 60 Chagas, E.H.N. 156–174, 161–174 Dalmolin, L.F. 117–120 Campos M.A. 127–151 Chagas Júnior, W.D. 100–115 Damaso, C. 55, 56, 65 Campos, R.M. 54, 131–151 Chaves, L.C.S. 6, 12, 20–47 Dantas, A.N.G. 51 Candeias, J.M.G. 59 Cherpinski, H.F.M. 161–174 da Paz, T.C. 94–115 Candido, N.M. 95–115 Ciacci-Zanella, J.R. 7, 12, 23–47 da Silva Junio, E.T.da P. 156–174 Cândido, N.M. 103–115 Cilli, A. 10, 10–14, 14, 44–47, 80 da Silva, L.L.P. 7, 9, 12, 14 Cano, L. 173–174 Cirne Santos, C.C. 54, 131–151 Dasilva, L.L.P. 28–47 Cantão, M.E. 7, 12, 23–47 Coelho, L.M. 143–151 da Silva, N. 149–151 Cantão, N.M. 6, 12, 19–47, 95–115 Coelho, S.V.A. 8, 13, 32–47 da Silva, R.A. 110–115 Cardoso, B.F. 139–151 Colombo, T.E. 110–115 da Silva, R.C. 91 Cardoso, C.A.L. 57 Coltro, V.P. 114–115 Dastoli, G.T.F. 104–115 Cardoso, C.C. 8, 13, 32–47, 83 Comelis, M.T. 53 de Aguiar, M. 153–174 Cardoso, D.D.P. 10, 10–14, 14, 45–47, 86, Contigiani, M.S. 10, 14, 46–47 de Araújo, A. 153–174 86–115, 94–115, 99–115, 104–115 Corado, A.L.G. 8, 13, 34–47, 85, 85–115, de Azevedo, R.M. 153–174 Cardoso, J.F. 6, 12, 19–47, 78, 144–151 91–115 Debur, M.C. 6, 12, 22–47 Cardoso, R.S. 7, 9, 12, 14, 27–47, 40–47, Cornacini, F.H. 53 de Ferreira, S. 11, 17 41–47, 63 Correa, I.A. 107–115 de Lara Pinto, A.Z. 135–151, 139–151, Cardozo, F.M. 10, 10–14, 14, 46–47 Correa, R. 173–174 145–151 Cardozo, P. 111–115 Correa, R.F.T. 133–151 Del Rios, N.H.A. 91 Carenzi, L.R. 6, 9, 12, 14, 20–47, 41–47 Correa, R.M. 113–115 de Marchi, B.R. 126 Cargnelutti, J.F. 160–174, 161–174, 162, Cortez, A. 172–174 de Meneses, M.D.F. 131–151 162–174 Costa, A.F. 133–151 Demoliner, M. 9, 13, 36–47, 67, 68, 69, 70,

178 Index

71, 77, 157–174, 161–174, 164–174 Faria, J.C. 9, 9–14, 14, 43–47, 132–151 Flores, E.F. 160–174, 161–174, 162, de Oliveira, A.S. 120 Faria, N.R. 11, 16–17 162–174 de Oliveira, F.C. 73 Fausto, A.K.S. 7, 7–14, 7–14, 9, 9–14, 13, Fogaça, L. 6, 12, 19–47 de Paula, A.A.P. 91 13–14, 13–14, 14, 29–47, 43–47, Fongaro, G. 9, 13, 36–47 de Paula, H.S.C.P. 91 134–151 Fonseca, L.P. 96–115 de Paula, S.O. 9, 13, 35–47, 49 Favoretto, S.R. 55, 168 Fonseca, S.G. 92–115, 93 de Paula, V.S. 49, 68, 85 Fecury, P.C.M.S. 82 Fonseca, V.W.P. 9, 14, 40–47 de Rezende, R.R. 122–151 Felippe, P.A.N. 105–115, 166, 170–174, Fontenele, R.F. 129–151 de Siqueira, M.K. 56 171–174 Fontenele, R.S. 127, 133–151 de Souza, J.M. 125–151, 130–151, Felippi, D. 169–174 Fortunato, E.C. 119–120 132–151 Fellippe, P.A.N. 7, 12, 24–47, 171–174 Fragoso, R.R. 130–151 de Souza Luna, L.K. 109–115 Fernandes, A.M. 10, 10–14, 14, 44–47 França, J.P. 51 de Souza, M.L. 140–151 Fernandes, C.D. 125–151, 130–151, França, L.P. 51 de Souza, W.M. 120 132–151 Franco, A.C. 173–174 Deus, D.R. 70, 72 Fernandes, F.R. 124–151 Franco Filho, L.C. 78, 144–151 de Vleeschouwer, K.M. 168–174 Fernandes, P.A. 96–115 Franco, F.T.C. 157–174 Dezengrini Slhessarenko, R. 135–151, Fernando, F.S. 6, 12, 22–47, 117–120 Franco, G.M. 51 139–151, 145–151 Ferrasi, A.C. 97–115, 100–115, 117–120 Franco, O.L. 57 Dias, A.S. 7, 12, 25–47 Ferraz, A.G. 50 Freitas, A.C. 153–174, 154–174 Dias Barreto, S.F. 95–115 Ferraz, L.F. 106–115 Freitas, E.J.P. 170–174 Dias, M.C. 88, 88–115, 95–115, 103–115 Ferreira, B.C. 139–151 Freitas, G.M. 95–115 Dias Neto, O.S. 92–115 Ferreira, C.L. 9, 13, 37–47 Freitas, N.R. 10, 10–14, 14, 45–47 Dias, R.S. 9, 13, 35–47, 49 Ferreira, C.S. 9, 13, 37–47 Freitas, P.S.L. 64 Dias, T.D. 7, 12, 26–47 Ferreira, D.F. 54, 131–151 Fumagali, M.J. 120 Diaz, L.A. 10, 14, 46–47 Ferreira, H.L. 165–174, 166–174 Fumagalli, M.J. 108–115 Diel, D.G. 7, 12, 24–47, 162–174, 163–174 Ferreira, J.A. 97–112, 98–115, 100–115 Fumian, T.M. 9, 13, 37–47, 71 Diniz, J.A.P. 54, 64 Ferreira, J.M.S. 50 Furlan, D. 158–174, 159–174 Domigues, A.L.S. 71 Ferreira, M.S.R. 77 G Driemeier, D. 7, 12, 24–47, 157–174 Ferreira Neto, D.L. 171–174 Gabbay, Y.B. 11, 16–17, 61, 62, 70, 72, 81, Drumond, B.P. 71 Ferreira-Neto, D.L. 7, 12, 24–47 81–115, 88, 88–115, 89, 89–115, Duarte dos Santos, C.N. 56 Ferreira, O.C. 167–174 93–115, 109–115, 110–115 Duarte, E.C.B. 91 Ferreira, P.C.P. 87 Gadelha, R.S. 108–115 Duarte Júnior, J.W.B. 156–174, 161–174 Ferreira, P.G. 50 Gagliardi, T.B. 9, 14, 41–47 Duarte, M.A. 133–151 Ferreira, S. 81 Galan, L. 11, 17, 81 Duarte, N.F. 168 Ferreira, T.A. 8, 13, 32–47 Gallinari, G.C.F. 7, 12, 25–47 Duarte, W.H. 96–115 Ferro, C.G. 123–151 Gama, B.E. 106–115 Duda, N.C.B. 173–174 Fiaccadori, F.C. 99–115 García-González, M.C. 9, 36–47 Durães Carvalho, R. 105–115, 171–174 Fiaccadori, F.S. 10, 10–14, 14, 45–47, 86, García-González, M.C. 13 Durães-Carvalho, R. 24–47 86–115, 94–115, 104–115 Garcia, R.C.N.C. 84 Durigon, E.L. 55, 60, 102–115, 105–115, Fietto, J.L.R. 6, 12, 21–47 Garrido, V. 62 113, 153–174, 155–174, 165–174, Fighera, R.A. 160–174 Gaspar, D.M. 58 168, 171–174 Figueiredo, A.C.C. 87 Gava, D. 7, 12, 23–47, 24–47, 163–174 Durões Carvalho, R. 7 Figueiredo, J.E. 50 Gheit, T. 11, 17, 81 Durões-Carvalho, R. 12 Figueiredo, J.F. 6, 12, 21–47 Giband, M. 9, 9–14, 14, 43–47 Dutra, J.M.M. 72, 73, 74 Figueiredo, L.T.M. 108–115, 120 Gilbertson, R.L. 148–151, 149–151 E Filho, L.C.F. 157–174 Gil, L.H.V.G. 165–174 Eisen, A.K.A. 161–174, 164–174 Finoketti, F. 173–174 Gimenez, G. 111–115 Eléouët, J.F. 7, 12, 25–47, 26–47 Fioratti, E.G. 173–174 Giménez, G. 113–115 Emmel, V.E. 106–115 Fioretti, J.M. 9, 13, 37–47, 77 Girardi, V. 67, 68, 69, 77, 157–174 Estofolete, C.F. 9, 13, 35–47, 110–115 Firpo, R.M. 173–174 Giuliano, A.R. 11, 17, 81 F Fiuza, M.K.C. 89 Godinho, M.T. 123–151, 132–151 Fabrizio, T. 155–174 Fleck, J. 69 Góes, L.G.B. 60, 153–174 Faheem, M. 131–151 Fleck, J.D. 68, 71 Gomes, E.R. 90 Fajardo, T.V.M. 7, 13, 28–47, 146–151 Florentino, G.C. 164–174 Gomes, G.R. 62

179 Index

Gomes, M.G.T. 158–174, 159–174 147–151, 148–151, 149–151 Leal, F.S. 118–120, 119–120 Gomes, M.W.L. 62 Inoue-Nagata, A.K. 7, 13, 30–47, 31–47 Leal, J.I. 8, 13, 32–47 Gomes, R.A. 100–115 Iwasaki, R. 114 Leão, R.A.C. 85 Gomes, R.P.S. 62 J Leite, R.A. 10, 10–14, 14, 45–47 Gomes, S.S.V.S.F. 138–151, 142–151 Jacomassa, F.A.F. 7, 12, 24–47, 105–115, Lemos, P.L. 78 Gonçalves, C.R. 80 166, 171–174 Lemos, P.S. 139–151, 144–151, 157–174 Gonçalves, M.S. 97–112, 98–115 Jardim, A.C.G. 53 Lima, A.T.M. 123–151 Gonçalves, W.M. 155–174 Jesus, B.L. 9, 14, 41–47 Lima, B.P. 132–151 Gonzalez, J. 111–115 Jesus, B.L.S. 6, 7, 9, 12, 14, 20–47, 27–47, Lima, C.P. 109–115 González, J. 112–115, 113–115 40–47 Lima, I.C.G. 89, 89–115, 110–115 Gonzalez, M.R. 113 Jesus, L.F. 74, 75 Lima Jr., W.P. 91–115 Goodin, D.G. 108–115 Jesus, M.G. 57 Lima, L.M.P. 57 Graf, T. 114–115 Jonsson, C.B. 108–115 Lima, M.F. 122–151, 128–151, 145–151, Granja, F. 85, 85–115, 91–115 Joshi, L.R. 7, 12, 24–47, 162–174, 163–174 150–151 Gras, C.K. 67, 69, 161–174, 164–174 Jr. Azevedo, S.M. 153–174 Lima, M.F.N.T. 173–174, 174 Gregorio, D.S. 10, 10–14, 14, 44–47 Júnior, E.C. 157–174 Lima, M.L.D.L. 101–115 Greque, G.V. 110–115 Júnior, E.C.S. 61 Lima, M.O. 68 Grotto, R.M.T. 6, 12, 19–47, 95–115, Junior, E.T.P. 82, 168–174 Lima Neto, D.F. 105–115, 166, 170–174 97–115, 98–115, 100–115, 101–115, Júnior, J.A.P.D. 157–174 Lima, R.A. 131–151 117–120 Júnior, J.F. 108–115 Lima, T.M. 159–174 Guedes, M.I.M.C. 7, 12, 25–47, 164–174, Júnior, J.V. 157–174 Lima, T.S. 118–120, 119–120 169–174, 170–174 Junior, W.D.C. 90 Lima, W. 9, 10, 14, 41–47, 46–47 Guerra, S.F.S. 82 Justino, M.C.A. 11, 16–17, 89 Linhares, A.C. 61, 62, 82, 82–115, 87, 87– Guerrera, M.U. 159–174 K 115, 89, 89–115, 93–115, 103–115 Guillén, Y. 10, 14, 46–47 Kalb, L.C. 109–115 Linhares, A. da C. 11, 16–17 Guimarães, L.R.P. 125–151 Kanazawa, T. 9, 13, 35–47 Lino, V. 64 Gularte, J.S. 9, 13, 36–47, 67, 75 Kasamatsu, E. 111–115, 112–115, Lobato, Z.I.P. 7, 12, 25–47, 164–174, Gusmão, R.H.P. 109–115 113–115 169–174, 170–174 H Kassar, T. 51 Lobo, P.S. 82, 154–174 Haach, V. 7, 12, 23–47, 24–47, 163–174 Kataoka, A.P.G. 60 Lopes, A.O. 85 Hamerski, F. 71 Kimura, L.M.S. 155–174 Lopes, C.A. 49 Hassan, R. 106–115 Kitajima, E.W. 138–151 Lopes, C.L.R. 10, 10–14, 14, 45–47 Hebeler - Barbosa, F. 95–115 Koetz Junior, C. 158–174, 159–174 Lopes, K.G.S. 165–174 Hebeler Barbosa, F. 117–120 Koga, R.C.R. 92–115 Lopes, L.V.A. 96–115 Heck, T.M.S. 9, 13, 36–47, 72, 73, 74, 75, Kommers, G.D. 160–174 Lopes, P.D. 6, 12, 22–47, 117–120 76, 77 Konigheim, B. 10, 10–14, 14, 46–47 Lopez, R.F.V. 6, 12, 22–47, 117–120 Heinemann, M.B. 170–174, 172–174 Kormelink, R.J.M. 137–151 Lorenzett, M.P. 7, 12, 24–47, 157–174 Heinzelmann, L.S. 75 Krause Sakate, R. 125–151, 126–151, Lucena, M.S.S. 109–115 Heldt, F.H. 9, 13, 36–47 149–151 Lucena, S.S. 81 Henzel, A. 9, 13, 36–47, 67, 70, 157–174, Krause-Sakate, R. 126 Luchs, A. 10, 10–14, 14, 44–47, 80 161–174, 164–174 Krieger, M.A. 109–115 Luz, R.B. 75 Herbster, S. 64 Kunz, A. 9, 13, 36–47 M Herebia, L. 10, 14, 46–47 L Macedo, D.F.R. 106–115 Hermosilla, J. 114 Lacerda A.L.M. 127–151 Macedo, M.A. 134–151, 141–151, Hernández, M. 9, 13, 36–47, 112–115 Lacerda, A.L.M. 127 143–151, 148–151, 149–151 Hernández, V. 114 Lacorte C. 127–151 Machado, E.S. 83 Herrero, R. 112–115 Lacorte, C. 127, 129–151, 132–151, Machado, R.R.G. 53 Hochmann, J. 9, 14, 39–47 133–151 Machado, R.S. 87, 88 Hoffmann, M.I.M. 149–151 Lacorte. C. 129–151 Madalosso, G. 80 I Lage, A.P. 170–174 Madeira, N.R. 7, 13, 30–47, 142–151 I.E.P. 49 Laliberté, J.F. 9, 9–14, 14, 42–47 Magalhães, C.L.B. 50 Inoue Nagata, A.K. 124–151, 128–151, Lamas, N.S. 129–151, 133–151 Magalhães, J.C. 50 134–151, 138–151, 141–151, 142– Lau, D. 123–151 Magri, M.E. 9, 13, 38–47 151, 143–151, 145–151, 146–151, Lauretti, F. 120 Maia, A.P.V.M. 92–115 Lazcano-Ponce, E. 81 Virus Reviews & Research Vol 20 (2), August-December 2016 - Index XXVII Brazilian Congress of Virology & XI Mercosur Meeting of Virology September, 18 - 21, 2016, Pousada dos Pireneus Resort, Pirenópolis, Goiás, Brazil

180 Index

Maia, F.G.M. 108–115 Mejía, M.C.C. 8, 13, 34–47 Moraes, W. 169–174 Maia, R.C.C. 159–174, 164–174 Melchiades, V.A. 62 Morais, C.O.B. 93 Maliano, M.R. 148–151 Melgaço, J.G. 84 Morais, L.L.C.S. 68, 70, 72 Malossi, C.D. 173–174, 174 Melli, P.P.S. 88, 88–115, 95–115, 103–115 Morale, M.V. 64 Mamani, E. 114 Mello, W.A. 97–112, 98–115, 100–115 Moreira, D.H. 104–115 Mamani, E.Z. 113 Melo, A.S. 8, 13, 32–47 Moreira-Nunes, C.A. 6, 12, 19–47 Manfro, I. 69 Melo, F.L. 7, 7–14, 9, 9–14, 13, 13–14, 14, Moresco, V. 9, 13, 38–47 Manfro, I.D. 71 31–47, 43–47, 125–151, 129–151, Morés, M.A.Z. 7, 12, 24–47 Mansilla Córdova, P.J. 146–151 130–151, 131–151, 132–151, 133– Morés, N. 7, 12, 24–47 Marcasso, R.A. 158–174, 159–174 151, 135–151, 136–151, 137–151, Morillo, S.G. 10, 10–14, 14, 44–47, 80 Marchini, F.K. 109–115 139–151, 145–151, 148–151 Moriya, N.M.N. 9, 13, 38–47, 128–151 Mariano, M.A. 113 Melo, F.O. 8, 13, 32–47 Mosimann, A.L.P. 56 Marinho, A.N. do R. 156–174 Melo S.R. 55 Motta, F.C. 6, 11, 12, 16–17, 22–47 Marinho, A.N.R. 154–174, 161–174, MELO, S.R. 102–115 Moura, M.F. 125–151, 149–151 168–174 Melo, S.R.G. 51 Moura, M.O. 7, 13, 29–47, 134–151 Marin, J.L. 108–115 Mendes, E.A. 55, 102–115 Moussatché, N. 56 Marin, L.J. 51 Mendes, G.S. 57 Muller, E.C.A. 9, 13, 37–47, 103–115 Marques J.R.E.T.A. 8, 32–47 Mendes, T.A.O. 8, 13, 33–47 Murcia, P.R. 108–115 Marques, J.R.E.T.A. 13 Mendes, W.R.B. 112–115 N Mar, T.B. 122–151 Mendonca, L.L.R. 7, 12, 28–47 Nagata, T. 7, 7–14, 7–14, 7–14, 9, 9–14, Martínez, T.R. 136–151 Mendoza, L. 112–115 9–14, 13, 13–14, 13–14, 13–14, Martini, M.C. 7, 12, 24–47, 105–115, 166, Mendoza, L.P. 10, 14, 46–47, 113–115 13–14, 14, 28–47, 30–47, 31–47, 171–174 Menegatti, R. 9, 14, 40–47 38–47, 42–47, 128–151, 130–151, Martins, C.P.S. 51 Mesquita, F. 168 132–151, 133–151, 138–151, 141– Martins, I.S. 106–115 Mesquita, F.S. 55, 102–115 151, 142–151, 146–151, 147–151 Martins Junior, R.B. 6, 9, 10, 12, 14, Metorima, C.S. 172–174 Naito, F.Y.B. 148–151 20–47, 41–47, 46–47 Meuren, L.M. 59 Nakasu, E.Y.T. 7, 13, 31–47, 124–151, Martins, L.C. 157–174 Meyrelles, Â.R. 83 134–151, 142–151, 143–151, Martins, M. 162, 162–174 Miagostovich, M.P. 9, 13, 37–47, 77 145–151 Martins, R.M.B. 10, 14, 45–47 Miagostovich, M.P.P. 71 Namiyama, G.M. 80 Martins, R.P.G. 68 Michereff Filho, M. 141–151 Nardi, M.S. 60, 153–174 Martins, S.R. 80 Migone, S.R.C. 81, 81–115, 110–115, Nascimento, C.A. 74, 75 Martins, T.P. 124–151 112–115 Nascimento, G.M. 7, 12, 24–47, 105–115, Martorelli, L.F. 60 Milani, E.R. 9, 14, 40–47 166, 170–174, 171–174 Marubayashi, J.M. 126–149, 126–151 Miller, M.E. 7, 12, 24–47, 105–115, 166, Nascimento, M.L.J. 119–120 Mascarenhas, J.D.A.P. 156–174, 161–174 170–174, 171–174 Nascimento, V.A. 8, 13, 34–47 Mascarenhas, J.D.P. 70, 82, 82–115, Mirtes, M.F. 150–151 Naveca, F.G. 8, 13, 34–47, 85, 85–115, 89, 89–115, 109–115, 154–174, Miuagi, S.A.T. 172–174 91–115 168–174 Mohr, K.A. 7, 12, 24–47, 163–174 Negri Filho, L.C. 158–174, 159–174 Massolini, V.M. 97–115, 101–115 Mongelós, P. 111–115 Nelson, M.I. 7, 12, 23–47 Masuda, E.K. 160–174 Mongelós, P.E. 112–115, 113–115 Neto, I.S. 153–174 Matos, A.C.D. 169–174, 170–174 Montassier, H.J. 6, 12, 22–47, 117–120 Neves, M.A.O. 154–174 Matos, A.R. 6, 12, 22–47 Montassier, M.F.S. 6, 12, 22–47, 117–120 Nickel, O. 146–151 Matos, A.S. 51 Monteiro, D.C.S. 8, 13, 34–47 Nicolini, C. 130–151 Matos, M.A.D. 10, 10–14, 14, 45–47, 91 Monteiro, F.L. 161–174 Nixon, D.F. 8, 13, 32–47 Matos, R.P.A. 103–115 Monteiro, J.C. 70, 87 Nogueira, A.H.C. 158–174, 159–174 Mayta, E. 114 Monteiro, T.A.F. 80, 80–115, 112–115 Nogueira, C.C.R. 54 Mayta, E.H. 113 Montenegro, A. 64 Nogueira, M.L. 8, 9, 13, 33–47, 35–47, 53, Medaglia, M.L.G. 56 Moraes, A.N. 169–174 110–115 Medeiros, R. 97–112, 98–115, 100–115 Moraes, A. P. 12 Nogueira, T.R. 104–115 Medeiros, S.O.M. 167–174 Moraes, A.P. 7, 24–47, 105–115, 166, Nunes, C. 98–115, 100–115, 101–115 Medina, G. 111–115, 113–115 170–174, 171–174 Nunes, E.M. 11, 17, 81 Megid, J. 172–174 Moraes, L.A. 126–149, 126–151 Nunes, L.M. 57 Meira, G.L.S. 131–151 Moraes, L.N. 117–120 Nunes, M.R.T. 6, 12, 19–47, 78, 139–151,

181 Index

144–151 Páez, M. 10, 14, 46–47, 111–115 Pontelli, M.C. 6, 12, 20–47, 63 Nunes, R. 173–174 Pagliari, C. 6, 12, 19–47 Pontes, N.C. 134–151, 143–151 O Paiva Júnior, S.S.L. 52 Pontes, N.E. 153–174, 154–174 Ogawa, J.K. 7, 12, 26–47 Paiva, P.L. 92–115 Portal, T.M. 89 Okano, W. 158–174, 159–174 Paixão, I.C.P. 54 Portela, L.M.F. 118–120 Okino, C.H. 6, 12, 22–47, 117–120 Paixão, I.C.P.N. 62 Portela, V.A.B. 159–174 Okuda, L.H. 158–174, 159–174 Paixão, L.C.F. 80 Posser, K. 69 Oliva, C.B. 53 Papa, M.P. 9, 14, 39–47, 59 Posser, K.C. 69, 76 Oliveira, A.C.R. 94–115, 104–115 Pardini, L.M.C. 117–120 Prado, F.O. 51 Oliveira, A.P. 7, 12, 26–47 Pardini, M.I.M.C. 6, 12, 19–47, 95–115, Prates, M. 9, 14, 40–47 Oliveira, A.S. 7, 12, 27–47, 136–151, 97–115, 98–115, 100–115, 101–115, Prates, M.C. 6, 12, 20–47 137–151 117–120 Prates, M.C.M. 7, 10, 12, 14, 27–47, 46–47 Oliveira, B.S.J. 112–115 Pascoal Xavier, M.A. 96–115 Prati, B. 64 Oliveira, D.B. 113 Pavani, C. 6, 12, 22–47, 117–120 Pressi, G. 67, 68, 69, 70, 76 Oliveira, D.B.L. 55, 102–115, 105–115, Pavan, M.A. 125–151, 126–149, 126–151, Pressi, G.F. 67, 71, 157–174 171–174 149–151 Primo, E.G. 70 Oliveira, D.C. 60 Pedrozo - Pavini, D.F. 166 Provazzi, P.J.S. 88, 88–115, 95–115, Oliveira, D.C.A. 107 Peixoto, L.R. 96–115 101–115, 103–115 Oliveira, D.L. 168 Pellizoni, T.A. 51 Q Oliveira, D.N. 60 Perecmanis, S. 158–174 Quadros, J.M. 162–174 Oliveira, D.S. 70 Pereira Carvalho, R.C. 122–151, 148–151 Queiroz, L.H. 60 Oliveira, F.C. 72, 74, 75, 76 Pereira-Carvalho, R.C. 9, 9–14, 14, 42–47 Quinderé Neto, G.A. 89 Oliveira Filho, E.F. 165–174 Pereira, C.E.S. 158–174, 159–174 Quintana, A.B. 113 Oliveira, J.G. 87 Pereira, C.G. 6, 12, 21–47 Quintana, S.M. 88, 88–115, 95–115, Oliveira, J.M.B. 164–174 Pereira, C.M. 53 103–115 Oliveira, L.C. 168–174 Pereira, G.A,F. 118–120 R Oliveira, L.F. 6, 12, 19–47, 139–151, Pereira, G.R. 158–174, 159–174 Racca, G.N. 166 144–151 Pereira, H.M.B. 123–151 Rahal, P. 53, 88, 88–115, 95–115, 101– Oliveira, L.M. 130–151 Pereira, T.C. 49 115, 103–115, 110–115 Oliveira, M. 169–174 Pessoa Junior, M.E. 153–174, 154–174 Ramos, J.E.P. 91 Oliveira, M.C. 62 Petroni, R.C. 104–115 Raposo, J.V. 49, 85 Oliveira, M.D. 9, 13, 35–47, 49 Petry, M.V. 153–174, 155–174 Recalde, M.L. 10, 14, 46–47 Oliveira, M.P. 10, 10–14, 14, 45–47 Pezzuto, P. 8, 13, 32–47 Regasini, L.O. 53 Oliveira, P.S.B. 160–174 Pfrimer, I.A.H. 92–115, 93 Rêgo, C.M. 7, 13, 31–47, 141–151, Oliveira, R.R. 78, 144–151 Picconi, M.A. 111–115, 112–115, 113–115 142–151 Oliveira, R.S. 78, 139–151, 157–174 Picelli, N. 97–115 Rehfeld, I.S. 7, 12, 25–47, 170–174 Oliveira-Szejnfeld, P.S. 8, 13, 32–47 Pierce Campbell, C.M. 81 Reischak, D. 118–120, 119–120 Oliveira, T.M.R. 134–151 Pinheiro, A. 135–151 Reis, J.K.P. 51 Oliveria, L.S. 55 Pinheiro Junio, J.W. 165–174 Resende, B.C. 55 Ometto, T. 153–174, 155–174 Pinheiro Júnior, J.W. 164–174 Resende, C.F. 51 Orílio, A. F. 132–151 Pinho, J.B. 153–174 Resende, P.C. 6, 11, 12, 16–17, 22–47 Orílio, A.F. 7, 13, 30–47, 125–151, 130– Pinho, J.R.R. 104–115 Resende, R.O. 7, 13, 30–47, 125–151, 151, 138–151, 142–151, 144–151, Pinto, A.M.V. 155–174 130–151, 131–151, 132–151, 136– 147–151, 148–151 Pinto, A.R. 7, 12, 26–47, 114–115 151, 137–151, 138–151, 142–151, Ornelas, A.M.M. 8, 13, 32–47, 83 Pinto, E.V. 157–174 144–151, 147–151 Orsi, M.A. 118–120, 119–120 Pinto, M.A. 49, 84, 85, 172–174 Resque, H.R. 81, 81–115, 89, 89–115, Ortega, M. 112–115 Pinto, V.B. 123–151 110–115, 112–115 Otenio, M.H. 71 Pinto, W.V.M. 68 Resque, R.L. 9, 13, 37–47, 103–115 P Pires, A.R.F. 148–151 Reymão, T.K.A. 89 Pacoal Xavier, M.A. 87 Pituco, E.M. 158–174, 159–174 Ribeiro, A.L.M. 135–151, 145–151 Paesi, S. 67 Poerner, F. 109–115 Ribeiro, B.M. 6, 7, 12, 13, 20–47, 31–47, Paes, J.F. 91 Polêto, M.D. 131–151 133–151, 139–151, 142–151, Paes, L.M. 122–151 Poli, G.B. 98–115 150–151 Páez, G.M. 112–115, 113–115 Ponce, E.L. 11, 17 Ribeiro, G. 129–151

182 Index

Ribeiro, L.G. 156–174 Santana, A.S. 127–151 Silva, G.C.D. 9, 13, 35–47 Ribeiro, L.G.da S. 156–174 Santana, E.B.R. 10, 10–14, 14, 45–47 Silva, G.F. 6, 12, 19–47, 97–115, 98–115, Ribeiro, L.L.S. 92–115 Santana, R.A.F. 104–115 100–115, 101–115 Ribeiro, M.S. 131–151 Santos, D.I.S. 150–151 Silva, I.E.P. 49 Ribeiro S.G. 127–151 Santos, D.S. 54 Silva, J.C.F. 123–151 Ribeiro, S.G. 9, 9–14, 14, 43–47, 127, 129– Santos, D.S.A.S. 72 Silva, J.D. 9, 13, 35–47 151, 132–151, 133–151, 145–151 Santos, E.J.M. 6, 12, 19–47 Silva, J.M.F. 7, 9, 13, 28–47, 38–47, Riediger, I. 6, 12, 22–47 Santos, F.L.S.G. 52, 86, 90 146–151 Rigotto, C. 67, 68, 69, 70, 71, 74, 76 Santos, F.M. 49, 97–115, 98–115 Silva, J.P. 123–151 Rigueira, L.L. 158–174 Santos, F.M.B. 122–151 Silva, J.R. 168–174 Ritzel, R.G.F. 9, 13, 36–47, 72, 73, 74, 75, Santos, I.P.F. 56 Silva, J.R.M. 91 76, 77 Santos. J.H.A. 8, 13, 34–47 Silva Júnior, A. 6, 12, 21–47 Rivarola, M.E. 10, 14, 46–47 Santos, L.F.P. 62, 80, 80–115, 88, 88–115, Silva, K.A. 96–115 Riveros, J.F. 113–115 93–115 Silva, K.N. 125–151, 130–151, 132–151 Rizotto, L.S. 165–174, 166–174 Santos, L.L.R. 131–151 Silva, L.A. 118–120, 150–151 Rocha, C.M. 75 Santos, M.B. 53 Silva, L.C. 158–174, 159–174 Rocha, D.C. 109–115 Santos, M.C. 97–112, 98–115, 100–115 Silva, L.D. 89, 89–115, 109–115 Rocha, L. 62 Santos, R.O. 9, 9–14, 14, 43–47, 134–151 Silva, L.G.A. 72, 73, 74 Rocha, L.P. 10, 14, 46–47 Santos Silva, A.H. 87 Silva, L.L.P. 9, 14, 40–47, 41–47 Rocha, M.S. 9, 13, 37–47 Santos, V.M. 98–115, 100–115 Silva, L.V.M. 68 Rocha, P.A.S. 51 Santos, V.V.C.M. 9, 13, 35–47 Silva, M.J.M. 112–115 Rodrigues, A.C. 109–115 Sa-Oliveira, J.C. 13, 37–47 Silva, M.L. 6, 9, 10, 12, 14, 20–47, 41–47, Rodrigues, C.S. 141–151 Sa-Oliveira, J.C.; 9 46–47 Rodrigues, E.A.M. 109–115 Saraiva, G.L. 6, 12, 21–47 Silva, M.M. 109–115 Rodrigues, J.S.V. 145–151 Sarnighausen, V.C.R. 97–115, 100–115 Silva, M.S. 8, 13, 125–151, 130–151, Rodrigues, R.L. 118–120 Scagion, G.P. 166–174 132–151 Rodrigues, R.V. 153–174 Schaefer, R. 7, 12, 23–47, 24–47, 163–174 Silva, N.D.A. 104–115 Rodrigues, S.M.C. 158–174, 159–174 Scharfstein, J. 8, 13, 32–47 Silva, P.A. 57 Rodríguez-Lázaro, D. 9, 13, 36–47 Schmidt Chanasit, J. 131–151 Silva, P.A.N. 92–115 Rodriguez, M.I. 112–115, 113–115 Schneider, T. 72, 73, 74 Silva, R.A. 9, 13, 35–47 Rodríguez M.I. 111–115 Schneider, V.E. 67 Silva, R.C. 11, 17, 81 Rodriguez, R. 136–151 Schnellrath, L.C. 65 Silva, T.N. 10, 10–14, 14, 45–47 Roehe, P. 173–174 Schuch, H.C. 125–151 Silva, V.P. 81, 81–115, 110–115 Röhnelt, N.M.S. 74, 75, 77 Seglia, M. 77 Silveira, E. 70, 88 Rojas, A. 10, 14, 46–47 Serafini, P. 153–174 Silveira, F.T. 144–151 Rojas, M.R. 148–151 Serra, A.C.S. 82 Silveira, P.P. 8, 13, 32–47 Romanel, E. 7, 13, 29–47 Serra, O.P. 135–151, 139–151 Silveira, T.S. 6, 12, 19–47 Romeiro, M.F. 108–115 Sevilla , L.D. 113 Silveira, V.B. 55, 102–115 Romijn, P.C. 155–174 Sezerino, P.H. 9, 13, 38–47 Simão, R.M. 165–174, 166–174 Rondon, M.N. 134–151 Sichero, L. 9, 11, 14, 17, 39–47, 81 Simas, P.V.M. 7, 12, 24–47, 105–115, 166, Rosa e Silva, M.L. 71 Sihler, W. 140–151 170–174, 171–174 Rosa, J.C.C. 169–174 Silva, A.B. 81, 81–115, 110–115, 112–115 Simões, R.P. 97–115 Rosales, R. 9, 14, 40–47 Silva, A.M. 98–112, 100–115 Siqueira, J.A.M. 11, 16–17, 61, 62, 70, 72, Rouge, L.M.S. 155–174 Silva, A.M.C. 10, 10–14, 14, 45–47 88, 88–115, 89, 89–115, 93–115 Ruckert, A. 60 Silva, A.M.R. 139–151 Siqueira, J.D. 83 Ruschel, R.G. 125–151 Silva, A.S. 49 Siqueira, M.M. 6, 11, 12, 16–17, 22–47 Ruskowski, L. 68 Silva, B.J.A. 167–174 Slongo, J. 9, 14, 39–47 S Silva, B.P. 164–174 Smith, V.C. 70, 72 Sabino Santos Jr, G. 108–115 Silva, C.C. 9, 13, 35–47 Soares, L.S. 70, 82, 82–115, 103–115, Saddi, V.A. 91 Silva, C.N. 98–115, 117–120 109–115, 154–174 Sá, F.B. 159–174 Silva, C.R.S. 91–115 Soares, M.A. 83 Salazar Bravo, J. 108–115 Silva, D.E.A. 144–151 Sobrinho, J.S. 9, 14, 39–47 Sanches, M.M. 140–151 Silva, E.D. 9, 13, 35–47 Soilán, A. 112–115 Santana, A.O. 134–151 Silva, E.S. 9, 13, 37–47 Sosa Gomes, D.R. 140–151

183 Index

Sosa-Gómez, D.R. 7, 13, 31–47 Tanikawa, A.A. 100–115 Verli, H. 131–151 Sousa, A.O. 172–174 Tanuri, A. 8, 13, 32–47, 167–174 Veronez, J.V. 158–174, 159–174 Sousa, D.D. 91–115 Taranto, A.G. 50 Versiani, A.F. 8, 13, 33–47 Sousa E.M.A. 98–115 Tavares, F.N. 70, 87, 88 Versute, E.M. 53 Sousa, E.M.A. 98–112, 100–115 Tavares, M.L. 141–151, 147–151 Viana, C.A. 81, 81–115, 110–115, Sousa, E.S.A. 93–115 Teixeira, D.M. 70, 72, 89, 89–115, 112–115 Sousa, J.P.G. 104–115 109–115, 110–115 Viana, R.M.M. 9, 14, 40–47 Sousa Junior, E.C. 82, 89, 90 Teixeira, L.C.G.C.L. 57 Vianez, J.L.G. 6, 12, 19–47 Sousa Júnior, E.C. 100–115 Teixeira, V.L. 54, 62 Vianez Jr, J.L.S.G. 144–151 Sousa, M.P. 9, 13, 35–47 Telles, A.L. 6, 12, 19–47 Vianez Junior, J.L.S.G. 50 Sousa, M.S. 103–115 Tenório, E.C.N. 107 Vidigal, P.M.P. 6, 21–47 Sousa, T.T. 10, 10–14, 14, 45–47, 86, Terzian, A.C.B. 9, 13, 35–47, 110–115 Vidigal, P.M.P.; 12 86–115, 94–115, 104–115 Thomazelli, L.M. 55, 102–115, 153–174, Vieira, C.B. 9, 13, 37–47 Sousa, V.B.P. 96–115 155–174 Vieira, H.R. 10, 10–14, 14, 44–47 Souza, A.L.P. 157–174 Tibúrcio Júnior, E. 153–174, 154–174 Vieira, M.V. 158–174, 159–174 Souza, C.A. 148–151 Timenetsky, M.C.S.T. 10, 10–14, 14, Vilanova, L.F.L.S. 158–174 Souza, C.O. 80 44–47, 80 Vilas Boas, L.C.P. 57 Souza, E.B. 146–151 Tino De Franco, M. 107 Villa, L. 11, 17 Souza, F.G. 69, 70, 71 Todorov, S.D. 57 Villa, L.L. 9, 14, 39–47, 81 Souza, G.O.S. 51 Tommasino, M. 11, 17, 81 W Souza, H.C.V. 159–174 Toppa, N.H. 96–115 Walker, D. 155–174 Souza, J.P. 63 Trezena, A.G. 107 Wanzeller, A.L.M. 70, 87, 88, 157–174 Souza Junior, E.C. 98–115 U Watanabe, A.S.A. 9, 13, 35–47 Souza, K.A.F. 10, 10–14, 14, 44–47, 80 Uchoa, J.M.W.M.C. 159–174 Watanabe, L.M. 126 Souza, K.M.C. 94–115, 99–115, 104–115 Ullmann, L.S. 173–174, 174 Watanabe, T. 97–115, 117–120 Souza, L.C.S. 93 Utescher, C.L.A. 107 Webby, R. 155–174 Souza, L.R. 95–115 V Weiblen, R. 160–174, 161–174, 162, Souza, M. 10, 10–14, 14, 45–47, 86, Vago, A.R. 96–115 162–174 86–115, 94–115, 104–115 Valdez, R. 111–115 Wolf, I. 6, 12, 19–47 Souza, M.B.L.D. 99–115 Vale, E.R. 68 X Souza, M.C.P. 60 Valente, G.T. 6, 12, 19–47 Xavier, A.S. 49 Souza, M.M. 7, 12, 27–47 Valenzuela, A. 111–115 Xavier, C.A.D. 122–151, 123–151 Souza, M.R.M. 58 Valenzuela, A.B. 113–115 Xavier, M.V.A. 91–115 Souza, T.A. 124–151, 138–151, 143–151 Valera, F. 9, 10, 14, 41–47, 46–47 Y Souza, V.C. 8, 13, 34–47 Valicente, F.H. 140–151 Yamamoto, K.A. 131–151 Souza, W.M. 108–115 Vallado, N.A. 125–151 Yuki, V.A. 126–149, 126–151 Z Spilki, F. 69, 70 Vallejos, M.A. 10, 14, 46–47 Spilki, F.R. 9, 13, 36–47, 67, 68, 71, 74, 75, Valle, S.C.P. 155–174 Zago, G. 59 76, 77, 157–174, 161–174, 164–174 VAN OERS. M.M. 150–151 Zanotto, P. 168 Spitz, N. 10, 14, 45–47 Varsani, A. 133–151 Zanotto, P.M.A. 55 Staggemeier, R. 9, 13, 36–47, 67, 72, 73, Vasconcelos, J.M. 6, 12, 19–47, 78, Zapana, P.R.R.M. 120 74, 75, 76, 77 139–151, 144–151 Zaroni, M.M.H. 119–120 Stefano, E. 158–174, 159–174 Vasconcelos, P.F.C. 54, 64, 157–174 Zerbini, F.M. 122–151, 123–151, 137–151 Stuqui, B. 88, 88–115, 95–115, 103–115 Vaslin, M.F.S. 7, 7–14, 7–14, 9, 9–14, 13, Zerbini, P.A. 122–151 Suarez, Z. 111–115 13–14, 13–14, 14, 29–47, 43–47, Zini, N. 9, 13, 35–47, 110–115 Sudenga, S.L. 11, 17, 81 134–151 Sulca, J.H. 113 Vasques, R.M. 133–151 Summa, J.L. 60 Vásquez, K.V. 113 T Vaz, M.R. 118–120 Tafuri, A. 96–115 Vellasco, L. 8, 13, 32–47 Takada, H.M. 126–151 Venker, C.A. 77 Tamanini, M.L.F. 6, 12, 22–47, 117–120 Ventura, A.M. 7, 9, 12, 14, 25–47, 26–47, Tamashiro, E. 6, 9, 10, 12, 14, 20–47, 27–47, 40–47 41–47, 46–47 Vera Lozada, M.G. 106–115

Virus Reviews & Research Vol 20 (2), August-December 2016 - Index