A Multigene Molecular Phylogenetic Assessment of True Morels (Morchella) in Turkey

Home , Fischerula, Morchella deliciosa, Morchella elata, Morchella semilibera

Fungal Genetics and Biology 47 (2010) 672–682

Contents lists available at ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier.com/locate/yfgbi

A multigene molecular phylogenetic assessment of true morels (Morchella) in Turkey

Hatıra Tasßkın a, Saadet Büyükalaca a, Hasan Hüseyin Dog˘an b, Stephen A. Rehner c, Kerry O’Donnell d,* a Faculty of Agriculture, Department of Horticulture, University of Çukurova, 01330 Adana, Turkey b Faculty of Science, Department of Biology, University of Selçuk, 42079 Konya, Turkey c Systematic Mycology and Microbiology Laboratory, Agricultural Research Service, United States Department of Agriculture, Beltsville, MD 20705, USA d Bacterial Foodborne Pathogens and Mycology Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, United States Department of Agriculture, Peoria, IL 61604, USA article info abstract

Article history: A collection of 247 true morels (Morchella spp.) primarily from the Mediterranean and Aegean Regions of Received 30 September 2009 Southern Turkey, were analyzed for species diversity using partial RNA polymerase I (RPB1) and nuclear Accepted 9 May 2010 ribosomal large subunit (LSU) rDNA gene sequences. Based on the result of this initial screen, 62 collec- Available online 24 May 2010 tions representing the full range of genetic diversity sampled were subjected to multigene phylogenetic species recognition based on genealogical concordance (GCPSR). The 62-taxon dataset consisted of partial Keywords: sequences from three nuclear protein-coding genes, RNA polymerase I (RPB1), RNA polymerase II (RPB2), Conservation translation elongation factor (EF1-a), and partial LSU rDNA gene sequences. Phylogenetic analyses of the EF-1a individual and combined datasets, using maximum parsimony (MP) and maximum likelihood (ML), GCPSR ITS rDNA yielded nearly fully resolved phylogenies that were highly concordant topologically. GCPSR analysis of LSU rDNA the 62-taxon dataset resolved 15 putative phylogenetically distinct species. The early diverging Elata RPB1 (black morels) and Esculenta Clades (yellow morels) were represented, respectively, by 13 and two spe- RPB2 cies. Because a Latin binomial can be applied with conﬁdence to only one of the 15 species (Morchella Species limits semilibera), species were identiﬁed by clade (Mel for Elata and Mes for Esculenta) followed by a unique Arabic number for each species within these two clades. Eight of the species within the Elata Clade appear to be novel, including all seven species within the Mel-20-to-31 subclade and its sister designated Mel-25. Results of the present study provide essential data for ensuring the sustainability of morel harvests through the formulation of sound conservation policies. Published by Elsevier Inc.

1. Introduction Hemisphere (Pilz et al., 2007). As a result, it is possible to purchase dried morels in local supermarkets in numerous countries Species of true morels (Morchella spp.) are one of the most throughout the year. In addition, commercial cultivation of morels highly prized and easily identified epigeous macrofungi collected has made it possible to enjoy fresh morels year round as well by mycophiles during the Spring in temperate regions of the (Ower et al., 1986). Northern hemisphere (Weber, 1995; Kuo, 2005). Factors that con- Synapomorphies that united Morchella, together with two other tribute to their economic importance include their extraordinary epigeous genera, Verpa and Discioitis, within the Morchellaceae in- demand among gourmets and foodies alike, coupled with their cluded multinucleate, eguttulate ascospores with a crown of epi- scarcity due to a sporadic and short fruiting season restricted to plasmic polar granules (Berthet, 1964). Molecular phylogenetic a few weeks each spring. With their ever-increasing popularity, analyses using nearly complete SSU rDNA and partial LSU rDNA se- harvest of wild morels has become a commercially successful cot- quences confirmed the monophyly of this family (O’Donnell et al., tage industry in morel-rich regions of countries such as China, In- 1997) and expanded its circumscription to include two hypogeous dia, Mexico, Turkey and the United States in the Northern genera, Fischerula and Leucangium (Hansen and Pfister, 2006). Although these studies provided a robust hypothesis of evolutionary relationships within the Morchellaceae, and identified the Dis- * Corresponding author. Address: Bacterial Foodborne Pathogens and Mycology cinaceae as its sister, surprisingly few studies have focused on Research Unit, National Center for Agricultural Utilization Research, Agricultural elucidating species limits within Morchella, and none has used Research Service, United States Department of Agriculture, 1815 North University multilocus phylogenetic species recognition based on genealogical Street, Peoria, IL 61604-3999, USA. Fax: +1 (309) 681 6672. E-mail address: [email protected] (K. O’Donnell). concordance (GCPSR; Taylor et al., 2000). To date, species-level

1087-1845/$ - see front matter Published by Elsevier Inc. doi:10.1016/j.fgb.2010.05.004 H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682 673 molecular systematic markers employed within this genus have provinces (Fig. 1; Supplemental Table 1) and then air-dried for sub- been limited to isozymes (Gessner et al., 1987; Royse and May, sequent analysis. After the specimens were typed molecularly 1990; Wipf et al., 1996), restriction fragment polymorphisms of using partial RPB1 and LSU rDNA gene sequence data, a subset of the LSU rDNA (Bunyard et al., 1994, 1995) and internal transcribed 62 collections (Table 1), chosen to represent the full range of phy- spacer (ITS) region of the nuclear rDNA (Buscot et al., 1996), and logenetic diversity sampled, were analyzed phylogenetically using phylogenetic analyses of the ITS rDNA sequence data (Wipf et al., a four-locus dataset comprising portions of the RPB1, RPB2, EF-1a 1999; Kellner et al., 2005). However, due to its length variability, genes and domains D1 and D2 of the nuclear large subunit (LSU) ITS rDNA sequences cannot be aligned among members of the rDNA. In addition, sequence of the nuclear ribosomal ITS rDNA re- black (Elata Clade) or yellow (Esculenta Clade) morels unless gion was obtained for members of the Mel-20-to-31 subclade. Phy- extensive regions are excluded from the analyses (Kellner et al., logenetic species identity, geographic origin including GPS 2005). coordinates and dominant vegetation type were recorded for each Although export of fresh morels from Turkey quadrupled over collection (Table 1; Supplemental Table 1). Twenty-seven cultures the past 5 years where in 2008, 238,106 kg averaging $18 US dol- representing 13 of the 15 species sampled in this study were made lars per kilogram were exported primarily to France and Germany, to preserve this novel fungal genetic diversity to insure that it knowledge of Turkish morels is limited to a single morphological would be available to the scientiﬁc and biotechnological communi- survey of macrofungi (Solak et al., 2007). Understanding their spe- ties (see Supplemental Table 1; Hawksworth, 2004). Pure cultures cies diversity, however, is critical to elucidating their ecology and obtained from germinated ascospores were typed using a partial systematics, and for formulating sound conservation policies to en- RPB2 gene sequence to insure their authenticity, prior to being sure sustainability of morel harvests (Pilz et al., 2007). Towards stored in the ARS Culture Collection (NRRL) at 175 °C in a cryogen this end, 247 specimens of Morchella, collected in the spring of consisting of 10% skim milk and 1% DMSO. 2007 and 2008 primarily in Mediterranean and Aegean provi- To assess whether ascospore and ascus dimensions could be dences of Southern Turkey, were analyzed phylogenetically using used for morphological species recognition, detailed measure- multilocus DNA sequence data. The primary objectives of the pres- ments were made of ascospore length and width (N = 50) and ascus ent study were threefold: (1) compare the utility of partial LSU length and width (N = 25) from two independent collection of rDNA, RPB1, RPB2 and EF-1a gene sequences for resolving species 11/15 Morchella species detected in Turkey; measurements of limits of Turkish morels using GCPSR (Taylor et al., 2000); (2) as- 4/15 species (Mel-9, Mel-26, Mel-30 and Mes-8) were based on sess the utility of ITS rDNA sequences for species-level phylogenet- single collections (Supplemental Table S2). ics within the Elata Mel-20-to-31 subclade, and (3) use the phylogenetic data to better understand the geographic distribution 2.2. Molecular biology of Morchella spp. within Turkey. Total genomic DNA was extracted following a CTAB (hexadecyl- 2. Methods trimethyl-ammonium bromide (Sigma Chemical Co., St. Louis, MO) protocol (O’Donnell et al., 1997) from approximately 50–100 mg of 2.1. Material studied each dried specimen, which had been pulverized with a pipette tip in a 1.5 ml eppendorf tube. Once the mycelium was resuspended in The 247 Morchella specimens included in the present study 700 ll of the CTAB extraction buffer (100 mM Tris–Cl pH 8.4, 1.4 M were collected in the spring of 2007 and 2008 in 10 Turkish NaCl, 25 mM EDTA pH 8.0, 2% CTAB), it was incubated at 60 °C for

Fig. 1. The 10 provinces and ﬁve regions (in parentheses) where morels were collected. 674 H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682

Table 1 Species subjected to multilocus phylogenetic analyses.

Speciesa HT no.b Provincec Region GPS coordinated Dominant vegetatione Herbarium numberf Mel-2 176 Adana (F) Mediterranean 37°5205100N–035°4801800E-1373 m Pine (Pb, Pn), Cedar, Fir ANK Taskin 39 Mel-2 179 Adana (F) Mediterranean 37°5205100N–035°4801800E-1373 m Pine (Pb, Pn), Cedar, Fir ANK Taskin 40 Mel-2 130 Kahramanmarasß (G) Mediterranean Unknown Pine (Pb, Pn), Cedar, Fir ANK Taskin 49 Mel-2 144 Kahramanmarasß (G) Mediterranean Unknown Pine (Pb, Pn), Cedar, Fir ANK Taskin 50 Mel-2 147 Kahramanmarasß (G) Mediterranean Unknown Pine (Pb, Pn), Cedar, Fir ANK Taskin 51 Mel-2 197 Mug˘la (B) Agean 36°5003800N–029°0701400E-1048 m Pine (Pb), Oak ANK Taskin 28 Mel-2 199 Mug˘la (B) Agean 36°5105400N–029°1002800E-1413 m Pine (Pb), Oak ANK Taskin 29 Mel-2 200 Mug˘la (B) Agean 36°5105400N–029°1002800E-1413 m Pine (Pb), Oak ANK Taskin 30 Mel-3 213 Antalya (D) Mediterranean 37°0504600N–031°3601400E-999 m Chestnut ANK Taskin 10 Mel-3 215 Antalya (D) Mediterranean 37°0504600N–031°3601400E-999 m Chestnut ANK Taskin 11 Mel-3 216 Antalya (D) Mediterranean 37°0504600N–031°3601400E-999 m Chestnut ANK Taskin 12 Mel-7 235 Antalya (D) Mediterranean 36°1902100N–029°4502100E-180 m Pine (Pb), Oak (Burned area) ANK Taskin 16 Mel-7 239 Antalya (D) Mediterranean 36°1902100N–029°4502100E-180 m Pine (Pb), Oak (Burned area) ANK Taskin 22 Mel-7 240 Antalya (D) Mediterranean 36°1902100N–029°4502100E-180 m Pine (Pb), Oak (Burned area) ANK Taskin 17 Mel-7 242 Antalya (D) Mediterranean 36°1902100N–029°4502100E-180 m Pine (Pb), Oak (Burned area) ANK Taskin 19 Mel-7 244 Antalya (D) Mediterranean 36°1902100N–029°4502100E-180 m Pine (Pb), Oak (Burned area) ANK Taskin 20 Mel-7 245 Antalya (D) Mediterranean 36°1902100N–029°4502100E-180 m Pine (Pb), Oak (Burned area) ANK Taskin 21 Mel-7 93 Unknown Unknown Unknown ANK Taskin 08 Mel-9 166 Denizli (C) Agean Unknown Pine (Pb, Pn) ANK Taskin 33 Mel-10 114 Kastamonu (J) Black Sea Unknown Unknown ANK Taskin 54 Mel-10 85 Mersin (E) Mediterranean 36°1802000N–033°2505700E-780 m Pine (Pb) ANK Taskin 15 Mel-10 238 Antalya (D) Mediterranean 36°1902100N–029°4502100E-180 m Pine (Pb), Oak (Burned area) ANK Taskin 18 Mel-20 123 Kastamonu (J) Black Sea Unknown Unknown ANK Taskin 58 Mel-20 260 Sivas (I) Central Anatolian 40°2100500N–037°5405600E-1963 m Pine (Pb, Pn), Fir ANK Taskin 63 Mel-20 42 Adana (F) Mediterranean 37°5105600N–035°4800500E-1325 m Pine (Pb, Pn), Fir ANK Taskin 02 Mel-20 46 Adana (F) Mediterranean 37°5105600N–035°4800500E-1325 m Pine (Pb, Pn), Fir ANK Taskin 60 Mel-20 165 Denizli (C) Agean Unknown Pine (Pb, Pn) ANK Taskin 32 Mel-20 168 Denizli (C) Agean Unknown Pine (Pb, Pn) ANK Taskin 34 Mel-20 181 Adana (F) Mediterranean 37°5205100N–035°4801800E-1373 m Pine (Pb, Pn), Cedar, Fir ANK Taskin 41 Mel-20 182 Adana (F) Mediterranean 37°5205100N–035°4801800E-1373 m Pine (Pb, Pn), Cedar, Fir ANK Taskin 42 Mel-20 183 Adana (F) Mediterranean 37°5205100N–035°4801800E-1373 m Pine (Pb, Pn), Cedar, Fir ANK Taskin 43 Mel-20 184 Adana (F) Mediterranean 37°5205100N–035°4801800E-1373 m Pine (Pb, Pn), Cedar, Fir ANK Taskin 44 Mel-20 187 Mug˘la (B) Agean 36°5003800N–029°0701400E-1048 m Pine (Pb), Oak ANK Taskin 01 Mel-20 191 Mug˘la (B) Agean 36°5003800N–029°0701400E-1048 m Pine (Pb), Oak ANK Taskin 24 Mel-20 195 Mug˘la (B) Agean 36°5003800N–029°0701400E-1048 m Pine (Pb), Oak ANK Taskin 26 Mel-20 92 Unknown Unknown Unknown ANK Taskin 07 Mel-25 157 Aydın (A) Agean 37°3701300N–028°1901500E-819 m Pine (Pb, Pn) ANK Taskin 36 Mel-25 65 Mug˘la (B) Agean 36°5003800N–029°0701400E-1048 m Pine (Pb), Oak ANK Taskin 31 Mel-25 188 Mug˘la (B) Agean 36°5003800N–029°0701400E-1048 m Pine (Pb), Oak ANK Taskin 27 Mel-26 156 Aydın (A) Agean 37°3701300N–028°1901500E-819 m Pine (Pb, Pn) ANK Taskin 35 Mel-26 120 Kastamonu (J) Black Sea Unknown Unknown ANK Taskin 56 Mel-26 122 Kastamonu (J) Black Sea Unknown Unknown ANK Taskin 57 Mel-26 124 Kastamonu (J) Black Sea Unknown Unknown ANK Taskin 59 Mel-27 107 Kastamonu (J) Black Sea Unknown Unknown ANK Taskin 53 Mel-27 118 Kastamonu (J) Black Sea Unknown Unknown ANK Taskin 55 Mel-27 25 Mersin (E) Mediterranean 36°4200700N–033°5905600E-1335 m Pine (Pb), Juniper, Spruce ANK Taskin 47 Mel-27 207 Kahramanmarasß (G) Mediterranean 38°0800000N–036°3500400E-1685 m Cedar, Fir, Juniper ANK Taskin 37, ANK Taskin 38 Mel-28 251 Sivas (I) Central Anatolian 40°2100500N–037°5405600E-1963 m Pine (Pb, Pn), Fir ANK Taskin 62 Mel-28 50 Adana (F) Mediterranean 37°5105600N–035°4800500E-1325 m Pine (Pb, Pn), Fir ANK Taskin 03 Mel-28 201 Kahramanmarasß (G) Mediterranean 38°0801500N–036°3402000E-1630 m Cedar, Fir, Juniper ANK Taskin 45 Mel-29 155 Aydın (A) Agean 37°3701300N–028°1901500E-819 m Pine (Pb, Pn) ANK Taskin 04 Mel-29 45 Adana (F) Mediterranean 37°5105600N–035°4800500E-1325 m Pine (Pb), Cedar, Fir ANK Taskin 23 Mel-29 82 Mersin (E) Mediterranean 36°1802000N–033°2505700E-780 m Pine (Pb) ANK Taskin 05 Mel-30 193 Mug˘la (B) Agean 36°5003800N–029°0701400E-1048 m Pine (Pb), Oak ANK Taskin 25 Mel-31 106 Kastamonu (J) Black Sea Unknown Unknown ANK Taskin 52 Mel-31 202 Kahramanmarasß (G) Mediterranean 38°0801500N–036°3402000E-1630 m Cedar, Fir, Juniper ANK Taskin 46 Mel-31 203 Kahramanmarasß (G) Mediterranean 38°0801500N–036°3402000E-1630 m Cedar, Fir, Juniper ANK Taskin 61 Mel-31 212 Kahramanmarasß (G) Mediterranean 38°0705800N–036°3500500E-1706 m Cedar, Fir, Juniper ANK Taskin 48 Mes-8 218 Antalya (D) Mediterranean 37°0402600N–031°3804800E-730 m Pine (Pb) ANK Taskin 13 Mes-17 225 Antalya (D) Mediterranean 37°0503800N–031°4002300E-470 m Pine (Pb) ANK Taskin 14 Mes-17 98 Diyarbakır (H) Southeastern Anatolian Unknown Unknown ANK Taskin 06 Mes-17 95 Unknown Unknown Unknown ANK Taskin 09

a Fifteen putatively phylogenetically distinct species were resolved employing GCPSR (Fig. 3; Taylor et al., 2000). b Ht no., Hatira Tasßkin’s collection number. c The letter in parentheses identiﬁes each of the 10 provinces where morels were collected in Fig. 1. d GPC coordinates for 18 of the collections are unknown because they were purchased from collectors. e Pine, Pb = Pinus brutia Tenore, Pn = Pinus nigra J.F. Arnold; Cedar, Cedrus libani A. Rich.; Fir, Abies cilicica (Ant. & Kotschy)Carr.; Oak, Quercus coccifera L.; Chestnut, Castanea sativa Mill.; Juniper, Juniperus sp.; Spruce, Picea orientalis (L.)Link. f ANK, Ankara University Herbarium, Ankara, Turkey.

1–24 h. Afterwards 700 ll of chloroform was added to each tube, of the upper phase was carefully removed to a new 1.5 ml eppen- samples were vortexed brieﬂy and then spun for 10 min at dorf tube to which an equal volume of 20 °C isopropanol was 12,300g in a microcentrifuge (Savant, Holbrook, NY). Next 350 ll added to precipitate the DNA. After the DNA was pelleted at H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682 675

12,300g for 5 min, the supernatant was discarded and the DNA pel- Comparisons based on maximum parsimony bootstrap values let was gently washed with 70% ethanol and resuspended in 200 ll P70% indicated that they were topologically congruent. Therefore ddH2O by heating at 65 °C for 1–2 h. Once the DNA pellet was com- the individual partitions were analyzed phylogenetically as a com- pletely dissolved, 8 ll of the genomic DNA prep was added to bined dataset, using MP in PAUP* (Swofford, 2002) and by maxi-

192 ll of sterile double-distilled H2O in a 96-well plate and used mum likelihood (ML) in GARLI ver. 0.951 (Zwickl, 2006). The as a template for amplification by the polymerase chain reaction hierarchical likelihood ratio tests in MrModeltest ver. 2.2 (Posada (PCR) (O’Donnell et al., 1998). DNA extraction from pure cultures and Crandall, 1998), using PAUP*, identified the general-time- grown in yeast–malt broth (O’Donnell et al., 1997) followed the reversible model with a proportion of invariant sites and gamma protocol outlined above, with the exception that mycelium was distributed rate heterogeneity (GTR + I + C) as the best-fit model freeze-dried before the CTAB extraction step. of nucleotide substitution for the combined dataset. MP searches All PCR and sequencing primers are listed in Table 2. Platinum for the shortest trees employed tree-bisection and reconnection Taq DNA polymerase (Invitrogen Life Technologies, Carlsbad, CA) branch swapping (TBR), and 1000 random sequence addition rep- was employed in all PCR amplifications. Amplifications were con- licates. Nonparametric bootstrapping, employing 1000 pseudo- ducted using an Applied Biosystems (ABI) 9700 thermocycler replicates of the data, 10 random addition sequences per replicate, (Emeryville, CA) using the following program: 1 cycle of 90 s at and TBR branch swapping was used to assessed MP clade support. 94 °C; 40 cycles of 30 s at 94 °C, 90 s at 55 °C, and 3 min at 68 °C; Nonparametric bootstrap analyses of the 62- and 36-taxon data- followed by 1 cycle of 5 min at 68 °C and a 4 °C soak. Gel electro- sets were conducted in GARLI (Zwickl, 2006) using the 5000 gener- phoresis in 1.5% agarose gels (Invitrogen) run in TAE buffer (Sam- ations without improving the topology parameter and 500 ML brook et al., 1989) was used to size-fractionate amplicons. pseudo-replicates of the data. DNA sequences generated in this Subsequently gels were stained with ethidium bromide and visual- study have been deposited in GenBank as accessions HM056248- ized over a UV trans-illuminator. Montage96 filter plates (Millipore HM056530. Corp., Billerica, MA) were used to purify amplicons prior to cycle sequencing. All sequencing reactions were conducted in a 10-ll volume containing 2–4 pmol of a sequencing primer, 2 ll of ABI 3. Results BigDye version 3.1-terminator reaction mix, and approximately 50 ng of amplicon as described previously (O’Donnell et al., Although the 247 morels studied were obtained from 10 prov- 1998). DNA sequencing reactions were purified with ABI Big-Dye inces in five regions (Fig. 1) during the spring of 2007 and 2008, XTerminator and then run on an ABI 3730 48 capillary automated 81% of the specimens were collected in three Aegean (N = 48) sequencer. and four Mediterranean (N = 152) provinces (Supplemental Table 1). The remaining collections were made in the provinces of Kasta- 2.3. Molecular phylogenetics monu (N = 22; Black Sea region), Sivas (N = 18; Central Anatolia region), Diyarbakır (N = 1; Southeastern Anatolia region) or the Raw ABI sequence chromatograms were edited and aligned province and region were not documented because the collections with Sequencher ver. 4.1.2 (Gene Codes, Ann Arbor, MI, USA), prior were purchased from exporters (N = 6). GPS coordinates were re- to manual improvement of the alignments using TextPad ver. 5.1.0 corded for all collections except for 57 purchased from regional for windows (http://www.textpad.com/). Sequences from the indi- or local collectors. In addition, the dominant vegetation type was vidual partitions were concatenated in a single nexus file and then recorded, except for 30 collections purchased from exporters or assessed for combinability using PAUP* 4.0b10 (Swofford, 2002). collectors (Supplemental Table 1). An initial assessment of Morch-

Table 2 PCR and sequencing primers.

Locus Primer References Sequence (50–30)a PCR Sequencing RPB1 RPB-1A Matheny et al. (2002) GARTGYCCDGGDCAYTTYGG X RPB-1C Matheny et al. (2002) CCNGCDATNTCRTTRTCCATRTA X RPB-C2 This study GMAGAACMGTAATCACCATCC X RPB-A2 This study GTTAGATGAAGTGAGACACAC X RPB2 RPB2-7cf Liu et al. (1999) ATGGGYAARCAAGCYATGGG X RPB2-3053r Reeb et al. (2004) TGRATYTTRTCRTCSACCATRTG X RPB2-9f This study CAAATGGGCRATTGTCATACG X RPB2-3r This study GCATYGGTATGCAGGTTGTGG X EF-1a (50 fragment) EF-526F Rehner and Buckley (2005) GTCGTYGTYATYGGHCAYGT X EF-1567R Rehner and Buckley (2005) ACHGTRCCRATACCACCRATCTT X EF-3AR This study GAAACGRTCCTCRGACCAC X EF-1a (30 fragment) EF-2F Rehner and Buckley (2005) AACATGATSACTGGTACYTCC X X EF-2218R Rehner and Buckley (2005) ATGACACCRACRGCRACRGTYTG X EF-4AF This study TCAAGTCCGTCGARATGCACC X EF-5AR This study CCAGCAACRTTACCACGACG X rDNA ITS4 White et al. (1990) TCCTCCGCTTATTGATATGC X ITS5 White et al. (1990) GGAAGTAAAAGTCGTAACAAGG X X NL1 O’Donnell et al. (1997) GCATATCAATAAGCGGAGG X NL4 O’Donnell et al. (1997) GGTCCGTGTTTCAAGACGG X X

a IUPCA degenerate nucleotides: D, AGT; H, ACT; M, AC; N, ACGT; R, AG; S, CG; Y, CT. 676 H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682 ella genetic diversity in Turkey was obtained from maximum par- Turkey given that they phylogenetically match species that appear simony (MP) phylogenetic analyses of aligned partial RPB1 to be endemic to the Pacific Northwest of North America (O’Don- (852 bp) and LSU rDNA (535 bp) gene sequences obtained from nell et al., in review). Of the four introduced species, Mel-2 was the 247 collections (Supplemental Table 1; Fig. 2). Based on this the most common (N = 59) and widespread with collections from preliminary genetic screen, 62 collections were selected for further three regions and seven provinces (Table 5), followed by Mel-10 study to represent the full range of phylogenetic diversity within represented by 17 collections from two regions and three prov- the 247-taxon collection (Table 1). For this 62-taxon matrix, por- inces. Phylogenetic species Mel-7 and Mel-9 represented by 11 tions of two additional nuclear genes were sequenced, and they in- and 1 collection were restricted, respectively, to the Mediterranean cluded RPB2 (956 bp) and EF1-a (1299 bp). The 956 bp region of province of Antalya and the Aegean province of Denizli (Supple- RPB2 sequenced does not contain any introns. The A–C region of mental Table 1). The dominant vegetation for Aegean collections RPB1 sequenced (852 bp alignment) was interrupted by two small of Mel-2 included Pinus brutia (Turkish pine), Pinus nigra (Austrian introns representing 133 bp of aligned sequence in the 62-taxon pine) and Quercus coccifera (Kermes oak), whereas it consisted of dataset. Collectively, the RPB1 introns contributed only 44 parsi- P. brutia, P. nigra together with Abies cilicica (Cicilian fir) and Cedrus mony-informative characters (PIC) compared with 134 from the libani (Lebanon cedar) from specimens collected from the Mediter- exons. By contrast, the EF-1a alignment (1299 bp) for the 62-taxon ranean region. By way of contrast, Mel-7 and Mel-10 were collected dataset contained four introns whose aligned length totaled on burn sites dominated by P. brutia and Q. coccifera primarily in 274 bp. These contributed 110 parsimony-informative characters the Mediterranean province of Antalya. With the exception of (PIC), the same number as the four exons whose length totaled P. nigra, which was introduced to and is widely grown within the 1025 bp. United States, the dominant tree species at the sites where the MP bootstrap (BS) analyses of the four individual partitions re- introduced morel species were collected are not planted widely vealed strong gene-gene concordance. Topological discord involv- within the US. ing nodes receiving P70% bootstrap support was not detected. In addition to Mes-17 from Anatalya and Diyarbakır, seven of Relative to the LSU rDNA, which provided little phylogenetic signal the eight terminal-most Elata Clade species resolved as phyloge- (5.98% PIC) and nodal support (Tables 3 and 4), the RPB1, RPB2 and netically distinct in the present study have only been collected in EF1-a protein-coding genes possessed between 16.9% and 21.8% Turkey (Fig. 3; Mel-20 is found in Europe), based on more inclusive parsimony-informative characters and these three partitions indi- analyses (O’Donnell et al., in review). Six of these species (i.e., Mel- vidually provided bootstrap support for the monophyly of 9-to-10 26 through Mel-31) are members of the Mel-20-to-31 subclade, an of the 12 species represented by two or more collections (Table 4). informally named lineage representing a relatively recent species Strong support for the monophyly of all 12 species (i.e., P92% BS), radiation within the Elata Clade. The sister species of the Mel-20- however, was only obtained by analyses of the combined dataset. to-31 subclade, Mel-25, was collected widely in the Aegean and Based on the results of a conditional combination approach Mediterranean regions at sites dominated by P. brutia and Q. coccif- employing P70% bootstrap values as the threshold for topological era. Mel-25 was highly divergent from the Elata Clade Mel-20-to-31 concordance, sequence data from the four individual loci were subclade based on analyses of the four individual and combined combined and analyzed using MP in PAUP* (Swofford, 2002) and dataset. Because it was resolved as a sister to this subclade in all ML in GARLI (Zwickl, 2006). The 62 sequences in the combined of the analyses, we felt justified in treating it as an outgroup. dataset totaled 3642 bp of aligned sequence of which 17.4% were Mel-27 (N = 44) and Mel-20 (N = 55), next to Mel-2, comprised parsimony-informative (Table 3). Unweighted MP analysis of the the second and third most widespread species in the present study, combined dataset identified 384 most-parsimonious trees (MPTs) being sampled respectively from three regions and five provinces 1029 steps in length with a CI of 0.751 and RI of 0.971. ML boot- and four regions and seven provinces from the Black to the Medi- strap analysis using the GTR + I + G model of DNA substitution in terranean Sea (Table 5; Supplemental Table 1). Excluding the three GARLI recovered clade support nearly identical to MP bootstrap- species represented by a single collection (Mel-9, Mel-30 and Mes- ping with the exception that one weakly supported node in the 8), 10 of the 12 species were collected in two or more regions MP analysis (71% BS) received less than 50% BS in the ML analysis (Table 5). Only Mel-3 (N = 5) from sites dominated primarily by (Fig. 3). Sequences of the two Esculenta Clade (yellow morels) spe- Castanea sativa (Chestnut) and Mel-7 (N = 11) from P. brutia and cies, Mes-17 and Mes-8, were used to root the trees based on the Q. coccifera post-fire sites were restricted to a single region, the results of more inclusive analyses. Of the 15 phylogenetically dis- Mediterranean (Table 5). tinct species resolved by MP and ML analyses of the combined To improve phylogenetic resolution within the Mel-20-to-31 dataset (Figs. 2 and 3), a Latin binomial can be confidently applied subclade, 542 bp of aligned sequence from the ITS rDNA region only to Mel-3, Morchella semilibera. Twelve of the species in our col- was added to the four-locus dataset. This 36-taxon dataset com- lection from Turkey, based on a more inclusive sampling world- prised 4163 bp of aligned DNA sequence of which 5.9% was parsi- wide (O’Donnell et al., in review), do not appear to have been mony-informative (Table 6). Alignment of the ITS rDNA partition described formally. The remaining two species (Mel-20 and Mes- required the insertion of one 1-bp indel within the ITS1 and three 8) very likely have names, because they are common in Europe, 1-to-2-bp indels within the ITS2. Analyses of the 36-taxon dataset but we do not know what names to apply because there are many revealed that the ITS and LSU rDNA partitions possessed the most validly published names for black and yellow morels in Europe. and least phylogenetic signal, respectively, with 7.56% and 0.19% Even when type species exist, most are too old to yield useful parsimony-informative characters. Addition of the ITS rDNA parti- molecular systematic data. In the absence of Latin binomials for tion to the four-locus dataset, however, did not improve phyloge- 14 of the 15 terminals, species were identified by clade (Mes for netic resolution within this subclade (Fig. 4). Consistent with the Esculenta and Mel for Elata) followed by an Arabic number to dis- results obtained with the 62-taxon dataset, support for the mono- tinguish species. phyly of the most species was obtained using partial sequences from Except for Mel-9 and Mel-10, which formed an unresolved poly- the three protein-coding genes (Table 7). Of these, RPB2 performed tomy in the bootstrap analyses, evolutionary relationships among the best by providing support for six of the seven species; however, the 13 other putatively phylogenetically distinct species were strong support (i.e., P97% BS) for the monophyly of all seven species nearly fully resolved. Four of the five basal-most species within was only obtained through analyses of the combined dataset. the Elata Clade (i.e., Mel-2, Mel-7, Mel-9 and Mel-10), representing We conducted an a posteriori morphological analysis to assess 35.6% of the collection (88/247), appear to have been introduced to whether ascospore and ascus dimensions could be used for mor- H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682 677

Fig. 2. Morphological diversity of Morchella Elata Clade ascocarps: (A) Mel-2, (B) Mel-7, (C) Mel-9, (D) Mel-10, (E) Mel-20, (F) Mel-25, (G) Mel-26, (H) Mel-27, (I) Mel-28, (J) Mel- 29, (K) Mel-30, and (L) Mel-31. Note that Mel-26 through Mel-31 are members of the Mel-20-to-31 subclade. 678 H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682

Table 3 62-Taxon tree statistics and summary sequence (see Fig. 3).

Locus # Characters # MPTsa MPT length CIb RIc PIC/bpd (%) LSU rDNA 535 894 44 0.818 0.962 5.98 RPB1 852 108 263 0.806 0.967 20.77 RPB2 956 8 329 0.745 0.953 21.77 EF-1a 1299 511 376 0.745 0.954 16.94 Combined 3642 384 1029 0.751 0.971 17.43

a MPTs, most-parsimonious trees. b CI, consistency index. c RI, retention index. d PIC/bp, parsimony-informative characters/base pair.

Table 4 Bootstrap support for individual and combined 62-taxon dataset. 2005), and Mucorales (O’Donnell et al., 2001). A forward primer designed by Liu et al. (1999) and a reverse primer from Reeb et al. a Species LSU rDNA RPB1 RPB2 EF-1a Combined (2004) successfully amplified an approximately 1 kb fragment Mel-2 83 100 100 100 100 spanning the 7–11 region of RPB2 from all 247 collections (Table Mel-3 83 100 100 100 100 3). For the partial EF1-a gene sequence, two pairs of PCR primers Mel-8 61 97 100 100 100 Mel-9 NA NA NA NA NA designed by Rehner and Buckley (2005) for Beauveria were used Mel-10 93 100 100 100 100 to amplify this region as two overlapping fragments. Using the Mel-20 – – 73 90 98 same strategy for sequencing the RPB1 amplicon, we designed Mel-25 86 100 100 100 100 internal primers for sequencing the RPB2 and EF1-a amplicons, Mel-26 – 61 96 77 100 thereby greatly increasing the quality of sequence data from these Mel-27 – 100 96 97 100 Mel-28 – 88 92 57 100 two genes. EF1-a PCR primer EF-2F worked well as an internal Mel-29 – 83 – 64 94 sequencing primer as did EF-4AF and EF-5AR. These three primers Mel-30 NA NA NA NA NA generated approximately 1.3 kb of contiguous sequence for the 62- Mel-31 – – 62 96 92 taxon dataset. In contrast to the three single-copy protein-coding Mes-8 NA NA NA NA NA Mes-17 96 98 100 100 100 genes, the rDNA PCR primers generally worked well for DNA sequencing (White et al., 1990; O’Donnell, 1996). Consistent with a Of the 13 species within the Elata Clade (Mel) and two species within Esculenta the results of several multilocus phylogenetic analyses of diverse Clade (Mes), Latin binomial can be applied with confidence to only Mel-3 (Morchella semilibera). As indicated by NA, bootstrap support could not be obtained for Mel-9, fungal groups (O’Donnell et al., 1998; Frøslev et al., 2005; Hofstet- Mel-30 and Mes-8 because they were each represented by a single collection. ter et al., 2007; Matheny, 2005), partial sequence data from the LSU rDNA contributed relatively little phylogenetic signal and nodal support relative to the RPB1, RPB2 and EF1-a protein-coding genes phological species recognition (Supplemental Table S2). Because sampled (Tables 3 and 6). Given the small number of parsimony- variability of ranges was large, ascospore and ascus length and informative characters within the partial LSU rDNA sequence, it width cannot be used for species differentiation. is not surprising that phylogenetic inferences within the Morchell- aceae based on RFLP analyses of this region failed to resolve the monophyly of Morchella (Bunyard et al., 1994, 1995). In addition, 4. Discussion these analyses were also unable to distinguish it from Gyromitra in its sister family, the Discinaceae (Hansen and Pfister, 2006; The primary objective of the present study was to investigate O’Donnell et al., 1997). To date, published DNA sequenced-based species limits and evolutionary relationships among 247 true mor- phylogenetic analyses of Morchella have been limited to sequences els (Morchella) collected in 10 different provinces from five regions from the nuclear ITS rDNA region (Kellner et al., 2005; Wipf et al., within Turkey during 2007 and 2008. Towards this end, partial 1999). However, because sequences from this locus cannot be RPB1 and LSU rDNA sequence data were collected and analyzed aligned to include all of the taxa within the Elata or Esculenta phylogenetically to obtain an initial estimate of Morchella species Clades, we limited its use in the current study to phylogenetic diversity in Turkey. All of the sequence data was obtained using to- analysis of the Mel-20-to-31 subclade, where the insertion of only tal genomic DNA extracted directly from dried specimens as a tem- three 1–2 bp indels were required to establish positional homology plate for PCR amplifications. The RPB1 primers designed by at this low taxonomic level. Matheny et al. (2002) for Inocybe (Agaricales) were used to amplify Results of the present study add to a growing number of GCPSR- the 0.9 kb A–C region from all 247 collections. We attribute the based studies that have employed concordance among multigene successful amplification of this single-copy gene in part because genealogies to investigate species limits within agriculturally the specimens were only three to 15 months old at the time DNA (Geiser et al., 1998; O’Donnell et al., 2000; Rehner and Buckley, was extracted and because they had been dried as soon as possible 2005) and medically important fungi (Koufapanou et al., 1997; after they had been collected. By designing Morchella-specific Pringle et al., 2005), including model system fungi (Dettman internal sequencing primers, we were able to increase the quality et al., 2003a,b). Phylogenetic species were delimited herein based of RPB1 sequence data substantially compared to that using the on the following two criteria, after excluding the LSU rDNA parti- PCR primers. tion because it was nearly devoid of phylogenetic signal: (1) strong To further elucidate species boundaries using GCPSR, portions monophyly bootstrap support from a majority of the individual of two additional protein-coding genes, RPB2 and EF1-a, were cho- and combined partitions and (2) none of the genes contradicted a sen to increase phylogenetic resolution based on several recent re- species genealogical exclusivity (i.e., there was no conflict between ports documenting their utility at low taxonomic levels in diverse what species lineages were supported by bootstrap analyses of the fungal groups such as the Ascomycota (Hansen et al., 2005; Hof- four single-gene partitions; Dettman et al., 2003a,b). As almost stetter et al., 2007), Basidiomycota (Frøslev et al., 2005; Matheny, universally noted in multigene phylogenetic studies, bootstrap H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682 679

28S rDNA, RPB1 106 92 202 RPB2 EF-1α Mel-31 (4) , 91 100 203 3642 bp 212 635 PIC 193 Mel-30 (1) 74 155 1 of 384 MPTs 98 94 45 Mel-29 (5) 1029 steps 82 CI = 0.751 201 RI = 0.954 100 251 Mel-28 (5) 50 123 100 182 25 42 steps 46 Mel 181 183 20-to-31 95 184 Mel-20 (55) Subclade 260 168 98 100 165 82 195 92 88 187 191 107 118 100 Mel-27 (44) 100 79 207 25 Elata 91 120 Clade 122 100 Mel-26 (5) 124 156 157 100 100 188 Mel-25 (30) 65 114 100 238 Mel-10 (17) 85 166 Mel-9 (1) 235 71 100 244 <50 93 239 Mel-7 (11) 100 240 242 245 213 100 100 216 Mel-3 (5) 215 130 179 144 147 Mel-2 (59) 100 197 199 200 176 218 Mes-8 (1) Esculenta 225 100 Clade 95 Mes-17 (4) 98 (outgroup)

Fig. 3. One of 384 most-parsiminous trees inferred from MP analysis of the combined four-locus dataset for 62 specimens of Morchella collected primarily from the Aegean and Mediterranean regions of Turkey. Collections are identified by Hatira Tasßkin’s collection numbers. The 15 phylogenetically distinct species are identified by three Roman letters, identifying clade affiliation (i.e., Mel for Elata and Mes for Esculenta), followed by an Arabic number. Mel-3 = M. semilibera is the only species for which a Latin binomial can be applied confidently. Four species highlighted in gray (Mel-2, Mel-7, Mel-9 and Mel-10) appear to have been introduced into Turkey from the Pacific Northwest of North America. Numbers above internodes indicate MP bootstrap values based on 1000 pseudo-replicates of the data. ML bootstrap values based on 500 pseudo-replicates of the data are indicated below internodes only when they differed by P5% of the MP value. 680 H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682

Table 5 Geographic distribution of 247 Morchella collections.

Speciesa # Collectionsb # Regions/# provincesc Regions (# collections)d Mel-2 59 3/7 Agean (12), Black Sea (1), Mediterranean (43), ? (3) Mel-3 5 1/2 Mediterranean (5) Mel-7 11 1/1 Mediterranean (11) Mel-9 1 1/1 Agean (1) Mel-10 17 2/3 Black Sea (3), Mediterranean (14) Mel-20 55 4/7 Agean (7), Black Sea (8), Central Anatolian (16), Mediterranean (23), ? (1) Mel-25 30 2/5 Agean (22), Mediterranean (8) Mel-26 5 2/2 Agean (1), Black Sea (4) Mel-27 44 3/5 Agean (2), Black Sea (5), Mediterranean (37) Mel-28 5 2/3 Central Anatolian (2), Mediterranean (3) Mel-29 5 2/5 Agean (2), Mediterranean (3) Mel-30 1 1/1 Agean (1) Mel-31 4 2/2 Black Sea (1), Mediterranean (3) Mes-8 1 1/1 Mediterranean (1) Mes-17 4 2/2 Mediterranean (2), SE Anatolian (1), ? (1)

a Fifteen putatively phylogenetically distinct species resolved by GCPSR (Taylor et al., 2000). b See Supplemental Table 1 for data on all 247 collections. c Collections were obtained from ﬁve regions and 10 provinces (Fig. 1). d Species distribution by region. ? Indicates the region is unknown because it was purchased from a collector.

Table 6 36-taxon tree statistics and summary sequence (see Fig. 4).

Locus # Characters # MPTsa MPT length CIb RIc PIC/bpd (%) ITS rDNA 542 16 51 0.9804 0.992 7.56 LSU rDNA 534 1 9 1 1 0.19 RPB1 848 61 61 0.983 0.994 6.6 RPB2 956 4 62 0.984 0.994 5.96 EF-1a 1283 8 103 0.884 0.965 6.55 Combined 4163 88 295 0.919 0.971 5.91

a MPTs, most-parsimonious trees. b CI, consistency index. c RI, retention index. d PIC/bp, parsimony-informative characters/base pair. analyses of the combined dataset provided stronger nodal support cies included in our study. Nevertheless, a posteriori morphological than the individual partitions (Hofstetter et al., 2007; Matheny, analyses of a broader sampling of Esculenta and Elata Clade species 2005; O’Donnell et al., 2000; Reeb et al., 2004). may reveal morphological apomorphies that can be used to distin- The most important finding to emerge from the present study guish some of the species. was the discovery of 15 putatively phylogenetically distinct but One of the surprising results of the present study was that only morphologically cryptic Morchella species (Fig. 2), based on our two Esculenta Clade species represented by five specimens were survey conducted during two consecutive years within five regions among the 247 collections, suggesting that members of this clade of Turkey. This finding contrasts with regional field guides that list may be better adapted to northern temperate environments. Con- between three and seven species in North America (Miller, 1972; versely, the putatively high endemicity of members of the Mel-20- Arora, 1979; Weber, 1995), eight species in Japan (Imazeki et al., to-31 subclade and its sister Mel-25 in Turkey, suggests that these 1988), and between four (Breitanbach and Kränzlin, 1984) and eight species may have evolved novel adaptations associated with 30 species in Europe (Jacquetant, 1984). The latter study, however, speciation within the Mediterranean region. In a related study, stands in sharp contrast to a molecular phylogenetic assessment of multilocus typing of fusaria in Sardinian soils also revealed surpris- Morchella in Europe where only eight species were detected ingly high levels of endemics in this Mediterranean island noted (O’Donnell et al., in review). Although Solak et al. (2007) recorded for its high biodiversity (Balmas et al., 2010). Our preliminary re- 21 Morchella species in Turkey, all of the names used in this check- sults also suggest that the majority of Morchella species we sam- list were ones proposed for species from Europe and all of the iden- pled may not exhibit provincialism within Turkey, given that 10 tifications were conducted using morphological data. Furthermore, of the 12 species represented by two or more collections were it is impossible to determine to what extent our sampling overlaps found in two or more regions. However, this hypothesis needs to with that of Solak et al. (2007) because the latter represents a sim- be tested by sampling in regions not included in the present study. ple checklist without specimens or morphological data. Consistent Another surprising result was the scarcity of Mel-3 (=M. semilibera), with the preliminary findings of Breitanbach and Kränzlin (1984), the only species for which a Latin binomial could be applied with conducted on a small number of Esculenta and Elata Clade species confidence. Although this species has been treated within the sep- from Switzerland, our analyses show that ascus and ascospore arate genus Mitrophora by some authors (Breitanbach and Kränz- length and width are too conserved to distinguish any of the spe- lin, 1984; Wipf et al., 1999), our results show that it is deeply cies within Morchella included in our study (Supplemental Table nested within the Elata Clade of Morchella. We are confident that 2). Macromorphological data was not collected in the present our Turkish collections represent M. semilibera because they match study because our phylogenetic results identified a number of mor- collections of this species made in Europe, which is where this spe- phologically cryptic species (see Fig. 2), suggesting that ascocarp cies was initially described (O’Donnell et al., in review). Because M. morphology is too homoplastic for distinguishing many of the spe- semilibera is the only half-free morel found in Europe thus far, we H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682 681

106 sis for evaluating traditional morphology-based classification ITS + 28S rDNA 97 202 Mel schemes and species diversity within this economically important RPB1, RPB2, EF-1α 100 -31 90 203 genus, as well as providing a foundation for formulating sound 4163 bp 212 conservation policies to help ensure sustainable morel harvests 246 PIC 193 Mel-30 155 for this rapidly expanding cottage industry. In the near absence 1 of 88 MPTs 98 45 Mel-29 of morphological apomorphies, advancements in the ecology and 295 steps 98 82 systematics of Morchella will necessarily be heavily reliant on the CI = 0.919 201 results of multigene molecular phylogenetics using GCPSR to iden- 99 Mel RI = 0.971 251 -28 tify species limits (Taylor et al., 2000). The ability to discern indi- 50 vidual species makes it possible for the first time to identify 123 which morel species if any might have biotrophic or facultatively 25 100 42 mycorrhizal associations with vascular plant hosts (Buscot, 1994; steps 182 46 Hobbie et al., 2002). In addition, knowledge of their species bound- 181 aries is a prerequisite for ascertaining which species are post-fire 183 morels and whether they are obligatorily so. In this regard, our pre- 95 184 Mel-20 liminary results suggest that Mel-10 may not be an obligate pyro- 260 168 phile given that three of the 14 collections were made on non- 99 100 165 burned sites dominated by P. brutia (Supplemental Table 1). Clearly 76 195 much needs to be learned about the ecological roles played by 92 post- and non-post-fire morels with regard to their saprobic and/ 69 187 or mycorrhizal-like associations (Fujimura et al., 2005). 191 107 Perhaps the most interesting result of the present study was the 207 discovery that four putatively western North American endemics 100 Mel-27 25 comprised one-third of the Turkish collections. We hypothesize 84 118 that these species were introduced inadvertently in soil or were 120 associated with the root tips of exotic forestry species such as 100 122 Mel-26 Pseudotsuga menziesii (Douglas fir) or Pinus species for use in Turk- 124 156 ish forestry (Vellinga et al., 2009). However, whether and how these morels might have been introduced remains a mystery for 157 Mel-25 188 two reasons. First, no exotic tree species were observed at the sites (outgroup) 65 where Mel-2, Mel-7, Mel-9 and Mel-10 were collected. Secondly, based on our preliminary data, Mel-2 and Mel-7 appear to be sim- Fig. 4. Phylogenetic relationships among seven members of the Elata Mel-20-to-31 ilarly diverse in western North America and Turkey. This result subclade inferred from MP analysis of the combined five-locus dataset for 36 terminals, using sequences of Mel-25 to root the phylogeny. Collections are stands in sharp contrast to Amanita phalloides, which is consider- identified by Hatira Tasßkin’s collection numbers. This dataset differs from the one ably more genetically diverse in its native range of Europe, com- analyzed for Fig. 3 by the inclusion of ITS rDNA sequence data (see Table 3). MP pared to its introduced North American population (Pringle et al., bootstrap values based on 1000 pseudo-replicates of the data are indicated above 2009). Our working hypothesis is that the four exotic Morchella internodes; ML bootstrap values from 500 pseudo-replicates of the data are indicated below internodes only when they differed by P5% of the MP value. species were introduced into Turkey multiple times from forestry plantations with a connection to western North America. Interest- ingly, of the four exotic morels, Mel-8 and Mel-10 and Mel-2 and Table 7 Mel-9 were recovered, respectively, from post- and non-post-fire Bootstrap support for individual and combined 36-taxon Elata Clade Mel-20-to-31 sites in Turkey and western North America, suggesting that their subclade dataset. reproductive strategies and ecological roles may be similar in both Speciesa ITS rDNA LSU rDNA RPB1 RPB2 EF-1a Combined countries. Another area for future study is what impact the exotic Mel-20 – 68 – 76 78 99 morels might have on native species. Given their successful estab- Mel-25 100 98 100 100 100 100 lishment and apparent ability to spread to regions dominated by Mel-26 79 64 62 97 81 100 native tree species, studies are needed to assess whether they are Mel-27 96 – 100 97 95 100 displacing the native Morchella species. Lastly, the present study Mel-28 – – 86 95 66 99 Mel-29 64 – 81 82 63 98 adds to the field of mushroom conservation genetics pioneered Mel-30 NA NA NA NA NA NA by Hibbett and Donoghue’s (1996) studies of Lentinula edodes.As Mel-31 69 – – 60 98 97 promoted by these authors for shiitake, we strongly advocate using

a Mel, Morchella elata clade. As indicated by NA, bootstrap support could not be a phylogenetic species concept based on genealogical exclusivity to obtained for Mel-30 because it was represented by a single collection. identify the full range of Morchella biodiversity. Such a concept is essential to help insure sustainable harvests of these economically important and charismatic macrofungi by developing robust man- can make this connection without trying to obtain DNA data from agement practices and conservation policies within Turkey and the type specimen, which would probably be unproductive be- elsewhere (Pilz et al., 2007). cause the type is 195 years old. Twelve of the species in our collection from Turkey, based on available sampling, do not appear to Acknowledgments have been described formally. The remaining two species (Mel-20 Elata Clade and Mes-8 Esculenta Clade) very likely have names, be- Special thanks are due the Scientific and Technological Research cause they are common in Europe, but we do not know what Council of Turkey (TUBITAK) and the Çukurova University, Scien- names to apply because there are many validly published names tific Research Projects Coordinating Office (ÇÜ-BAP-ZF2009D41) for black and yellow morels in Europe. for supporting the studies of HT at NCAUR, Stacy Sink for excellent The nearly fully resolved multigene phylogeny inferred for technical assistance, Deb Palmquist for assistance with the statisti- Turkish collections of Morchella provides the first robust hypothe- cal analyses, Don Fraser for preparation of the publication figures, 682 H. Tasßkın et al. / Fungal Genetics and Biology 47 (2010) 672–682 and Nathane Orwig for running the DNA sequences in the NCAUR Liu, Y.J., Whelen, S., Hall, B.D., 1999. Phylogenetic relationships among ascomycetes: DNA core facility. The mention of trade products or firm names evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 16, 1799–1808. Matheny, P.B., 2005. Improving phylogenetic inference of mushrooms with RPB1 does not imply that the US Department of Agriculture recommends and RPB2 nucleotide sequences (Inocybe; Agaricales). Mol. Phylogenet. Evol. 35, them over similar products or other firms not mentioned. 1–20. Matheny, P.B., Liu, Y.J., Ammirati, J.F., Hall, B.D., 2002. Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). Am. J. Appendix A. Supplementary material Bot. 89, 688–698. Miller, O.K., 1972. Mushrooms of North America. E.P. Dutton and Co., Inc., New York. Supplementary data associated with this article can be found, in O’Donnell, K., 1996. Progress towards a phylogenetic classification of Fusarium. Sydowia 48, 57–70. the online version, at doi:10.1016/j.fgb.2010.05.004. O’Donnell, K., Cigelnik, E., Weber, N.S., Trappe, J.M., 1997. Phylogenetic relationships among ascomycetous truffles and the true and false morels inferred from 18S References and 28S ribosomal DNA sequence analysis. Mycologia 89, 48–65. O’Donnell, K., Cigelnik, E., Nirenberg, H., 1998. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90, Arora, D., 1979. Mushrooms Demystified. Ten Speed Press, Berkeley. 465–493. Balmas, V., Migheli, Q., Scherm, B., Garau, P., O’Donnell, K., Ceccherelli, G., Geiser, O’Donnell, K., Kistler, H.C., Tacke, B.K., Casper, H.H., 2000. Gene genealogies reveal D.M., 2010. Multilocus molecular phylogenetics indicates high levels of global phylogeographic structure and reproductive isolation among lineages of endemic fusaria inhabit Sardinian soils (Tyrrhenian Islands). Mycologia. Fusarium graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci. USA doi:10.3852/09-201. 97, 7905–7910. Berthet, P., 1964. Essai biotaxinomique sur les Discomycètes. Ph.D. Dissertation. O’Donnell, K., Lutzoni, F.M., Ward, T.J., Benny, G.L., 2001. Evolutionary relationships Université de Lyon at Lyon. among mucoralean fungi (Zygomycota): evidence for family polyphyly on a Breitanbach, J., Kränzlin, F., 1984. Fungi of Switzerland. Ascomycetes, vol. 1. large scale. Mycologia 93, 286–296. Mykologia, Luzern. O’Donnell, K., Rooney, A.P., Mills, G.L., Kuo, M., Weber, N.S., Rehner, A.S., in review. Bunyard, B.A., Nicholson, M.S., Royse, D.J., 1994. A systematic assessment of Phylogeny and historical biogeography of morel mushrooms (Morchella) reveals Morchella using RFLP analysis of the 28S ribosomal RNA gene. Mycologia 86, an early Cretaceous origin and high continental endemism and provincialism in 762–772. the Holarctic. Bunyard, B.A., Nicholson, M.S., Royse, D.J., 1995. Phylogenetic resolution of Ower, R., Mills, G.L., Malachowski, J.A., 1986. Cultivation of Morchella. US Patent Morchella, Verpa, and Disciotis [Pezizales: Morchellaceae] based on restriction 4594,809. enzyme analysis of the 28S ribosomal RNA gene. Mycol. Res. 19, 223–233. Pilz, D., McLain, R., Alexander, S., Villarreal-Ruiz, L., Berch, S., Wurtz, T.L., Parks, C.G., Buscot, F., 1994. Ectomycorrhizal types and endobacteria associated with McFarlane, E., Baker, B., Molina, R., Smith, J.E., 2007. Ecology and Management ectomycorrhizas of Morchella elata (Fr.) Boudier with Picea abies (L.) Karst. of Morels Harvested from the Forests of Western North America. General Mycorrhiza 4, 223–232. Technical Report PNW-GTR-710. Portland: US Department of Agriculture, Forest Buscot, F., Wipf, D., Di Battista, C., Munch, J.C., Botton, B., Martin, F., 1996. DNA Service, Pacific Northwest Research Station, 161 pp. polymorphisms in morels I: PCR/RFLP analysis of the ribosomal DNA spacers Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of DNA substitution. and microsatellite-primed PCR. Mycol. Res. 100, 63–71. Bioinformatics 14, 817–818. Dettman, J.R., Jacobson, D.J., Taylor, J.W., 2003a. A multilocus genealogical approach Pringle, A., Baker, D.M., Platt, J.L., Wares, J.P., Latge´, J.P., Taylor, J.W., 2005. Cryptic to phylogenetic species recognition in the model eukaryote Neurospora. speciation in the cosmopolitian and clonal human pathogenic fungus, Evolution 57, 2703–2720. Aspergillus fumigatus. Evolution 59, 1886–1899. Dettman, J.R., Jacobson, D.J., Turner, E., Pringle, A., Taylor, J.W., 2003b. Reproductive Pringle, A., Adams, R.I., Cross, H.B., Bruns, T.D., 2009. The ectomycorrhizal fungus isolation and phylogenetic divergence in Neurospora: comparing methods of Amanita phalloides was introduced and is expanding its range on the west coast species recognition in a model eukaryote. Evolution 57, 2721–2741. of North America. Mol. Ecol. 18, 817–833. Frøslev, T.G., Matheny, P.B., Hibbett, D.S., 2005. Lower level relationships in the Reeb, V., Lutzoni, F., Roux, C., 2004. Contribution of RPB2 to multilocus phylogenetic mushroom genus Cortinarius (Basidiomycota, Agaricales): a comparison of studies of the euascomycetes (Pezizomycotina, Fungi) with species emphasis on RPB1, RPB2 and ITS phylogenies. Mol. Phylogenet. Evolut. 37, 602–618. the lichen-forming Acarosporaceae and evolution of polyspory. Mol. Fujimura, K.E., Smith, J.E., Horton, T.R., Weber, N.S., Spatafora, J.W., 2005. Pezizalean Phylogenet. Evol. 32, 1036–1060. mycorrhizas and sporocarps in ponderosa pine (Pinus ponderosa) after Rehner, S.A., Buckley, E., 2005. A Beauveria phylogeny inferred from nuclear ITS and prescribed fires in eastern Oregon, USA. Mycorrhiza 15, 79–86. EF1-a sequences: evidence for cryptic diversification and links to Cordyceps Geiser, D.M., Pitt, J.I., Taylor, J.W., 1998. Cryptic speciation and recombination in the teleomorphs. Mycologia 97, 84–98. aflatoxin-producing fungus Aspergillus flavus. Proc. Natl. Acad. Sci. USA 95, 388–393. Royse, D.J., May, B., 1990. Interspecific allozyme variation among Morchella spp. and Gessner, R.V., Romano, M.A., Schultz, R.W., 1987. Allelic variation and segregation in its inferences for systematics within the genus. Biochem. Syst. Ecol. 18, 475–479. Morchella deliciosa and M. Esculenta. Mycologia 79, 683–687. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Hansen, K., Pfister, D.H., 2006. Systematics of the Pezizomycetes – the operculate Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. discomycetes. Mycologia 98, 1029–1040. Solak, M.H., Isßilog˘lu, M., Kalmısß, E., Alli, H., 2007. Macrofungi of Turkey Checklist, Hansen, K., LoBuglio, K.F., Pfister, D.H., 2005. Evolutionary relationships of the cup- vol. 1. Üniversiteliler Ofset, Izmir._ fungus genus Peziza and Pezizaceae inferred from multiple nuclear genes: RPB2, Swofford, D.L., 2002. PAUP*. Phylogenetic analysis using parsimony (*and other b-tubulin, and LSU rDNA. Mol. Phylogenet. Evol. 36, 1–23. methods). Version 4.0b10. Sinauer Associates, Sunderland. Hawksworth, D.L., 2004. Fungal diversity and its implications for genetic resource Taylor, J.W., Jacobson, D.J., Kroken, S., Kasuga, T., Geiser, D.M., Hibbett, D.S., Fisher, collections. Stud. Mycology 50, 9–18. M.C., 2000. Phylogenetic species recognition and species concepts in fungi. Hibbett, D.S., Donoghue, M.J., 1996. Implications of phylogenetic studies for Fungal Genet. Biol. 31, 21–32. conservation of genetic diversity in shiitake mushrooms. Conserv. Biol. 10, Vellinga, E.C., Wolfe, B.E., Pringle, A., 2009. Global patterns of ectomycorrhizal 1321–1327. introductions. New Phytol. 181, 960–973. Hobbie, E.A., Weber, N.S., Trappe, J.M., van Klinken, G.J., 2002. Using radiocarbon to Weber, N.S., 1995. A Morel Hunter’s Companion: A Guide to the True and False determine the mycorrhizal status of fungi. New Phytol. 156, 129–136. Morels of Michigan. Thunder Bay Press, Lansing. Hofstetter, V., Miadlikowska, J., Kauff, F., Lutzoni, F., 2007. Phylogenetic comparison White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of of protein-coding versus ribosomal RNA-coding sequence data: a case study of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, H.H., the Lecanoromycetes (Ascomycota). Mol. Phylogenet. Evol. 44, 412–426. Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: A Guide to Methods and Imazeki, R., Otani, Y., Hongo, T., 1988. Fungi of Japan. Yama-Kei Publishers Co., Ltd., Applications. Academic Press, San Diego, pp. 315–322. Tokyo (in Japanese). Wipf, D., Bedell, J.P., Munch, J.C., Botton, B., Buscot, F., 1996. Polymorphisms in Jacquetant, E., 1984. Les Morilles. Plantanida, Lausanne. morels: isozyme electrophoretic analysis. Can. J. Microbiol. 42, 819–827. Kellner, H., Renker, C., Buscot, F., 2005. Species diversity within the Morchella Wipf, D., Fribourg, A., Munch, J.C., Botton, B., Buscot, F., 1999. Diversity of the esculenta group (Ascomycota: Morchellaceae) in Germany and France. Organ., internal transcribed spacer of rDNA in morels. Can. J. Microbiol. 45, 769–778. Divers. Evol. 5, 101–107. Zwickl, D.J., 2006. Genetic algorithm approaches for the phylogenetic analysis of Koufapanou, V., Burt, A., Taylor, J.W., 1997. Concordance of gene genealogies reveals large biological sequence datasets under the maximum likelihood criterion. reproductive isolation in the pathogenic fungus Coccidioides immitis. Proc. Natl. Ph.D. Dissertation, The University of Texas at Austin. Acad. Sci. USA 94, 5478–5482. Kuo, M., 2005. Morels. University of Michigan Press, Ann Arbor.