1 Phylogeny of water birds inferred from mitochondrial DNA sequences of 2 nine protein coding genes 3
4 Tsendsesmee Lkhagvajav Treutlein, Javier Gonzalez, Michael Wink
5
6 Institute of Pharmacy and Molecular Biotechnology (IPMB), Heidelberg University, Im
7 Neuenheimer Feld 364, Germany
8 s t 9 M. Wink ( ) n i r 10 Institute of Pharmacy and Molecular Biotechnology (IPMB) P e r 11 Heidelberg University P 12 Im Neuenheimer Feld 364
13 69120 Heidelberg, Germany
14 phone: +496221 544881
15 e mail: wink@uni hd.de
16
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
1 16 Abstract
17 Background: The phylogeny of birds which are adapted to aquatic environments is
18 controversial because of convergent evolution.
19 Methods: To understand water bird evolution in more detail, we sequenced the majority of
20 mitochondrial protein coding genes (6699 nucleotides in length) of 14 water birds, and
21 reconstructed their phylogeny in the context of other taxa across the whole class of birds for
22 which complete mitochondrial DNA (mtDNA) sequences were available.
23 Results: The water bird clade, as defined by Hackett et al. (2008) based on nuclear DNA s t
n 24 (ncDNA) sequences, was also found in our study by Bayesian Inference (BI) and Maximum i r
P 25 Likelihood (ML) analyses. In both reconstruction methods, genera belonging to the same e r 26 family generally clustered together with moderate to high statistical support. Above the P 27 family level, we identified three monophyletic groups: one clade consisting of Procellariidae,
28 Hydrobatidae and Diomedeidae, and a second clade consisting of Sulidae, Anhingidae and
29 Phalacrocoracidae, and a third clade consisting of Ardeidae and Threskiornithidae.
30 Discussion: Based on our mtDNA sequence data, we recovered a robust direct sister
31 relationship between Ardeidae and Threskiornithidae for the first time for mtDNA.
32 Our comprehensive phylogenetic reconstructions contribute to the knowledge of higher level
33 relationships within the water birds and provide evolutionary hypotheses for further studies.
34
35 Keywords: Phylogeny, mitochondrial DNA, mitogenomics, water birds, Threskiornithidae,
36 Ardeidae
37
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
2 37 Introduction
38 For decades, the phylogenetic placement and interrelationship of birds which are adapted to
39 aquatic environments have been controversially discussed (Cracraft, 1981; Sibley & Ahlquist,
40 1990; Mindell, 1997; van Tuinen et al., 2001; Braun & Kimball, 2002; Cracraft et al., 2004;
41 Slack et al., 2006; Watanabe et al., 2006; Ericson et al., 2006; Hackett et al., 2008; Pratt et al.,
42 2009; Smith, 2010; Pacheco et al., 2011; Wink, 2011; Jetz et al., 2012; McCormack et al.,
43 2013; Gibb et al., 2013). Diverse ecological and morphological specializations exist in water
44 birds which are mainly related to feeding style, e.g. wading (storks, flamingos, and herons), s t
n 45 foot propelled diving (loons, grebes, cormorants) and webbed feet (pelicaniform birds). The i r
P 46 occurrence of these traits likely involved convergent character evolution, which makes it e r 47 difficult to resolve the phylogenetic relationships at the level of morphology alone (van P 48 Tuinen et al., 2001). A large scale phylogenomic study of birds (Hackett et al., 2008), which
49 analysed ~32 kb of nuclear DNA (ncDNA) revealed that the adaptation to aquatic
50 environments constitutes a remarkably stable evolutionary trait: the water birds (intermixed
51 with semiaquatic species) constitute a monophyletic group (see ‘group H’ in Hackett et al.,
52 2008) which is found by maximum likelihood method with relative high bootstrap support
53 (89%). For this “water bird assemblage” the term Aequornithes has recently been introduced
54 by Mayr (2011). However, other groups of water birds, such as flamingos, grebes, geese,
55 ducks, swans, tropic birds, terns and gulls cluster in other independent clades (Hackett et al.,
56 2008; Mayr, 2011). Considering phylogenetic analyses based on complete mitochondrial
57 DNA (mtDNA), the most recent studies (Pacheco et al., 2011; Gibb et al., 2013) included
58 only a limited number of water bird species. To analyse water bird evolution in more detail at
59 higher taxonomic level than previously reported, we sequenced 6699 nucleotides of the
60 majority of mitochondrial protein coding genes (i.e., COX1, COX2, ATP8, ATP6, COX3,
61 ND3, ND4L, ND4 and CYTB ) of 14 species, to increase taxon number of water birds to 52 in
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
3 62 total. We reconstructed the phylogeny of these species in the context of a large number of
63 additional taxa covering the whole bird class for which complete mtDNA data were available,
64 using comprehensive phylogenetic reconstruction methods Bayesian Inference (BI) and
65 Maximum Likelihood (ML).
66
67 Materials & Methods
68 Taxon sampling
69 We increased taxon density by sequencing the majority (nine) of the mitochondrial protein s t
n 70 coding genes of further 14 water bird taxa. Sample information is given in table 1 and i r
P 71 GenBank accession numbers are provided in table 2. Our analysed dataset comprised 100 e r 72 avian taxa from which 52 were water birds. For accession numbers of the additional taxa P 73 which were retrieved from the GenBank, see Supplemental table S1. We did not handle any
74 live vertebrate animals during this study. All animals sequenced here were sequenced from
75 blood and feather samples provided by the Institute of Pharmacy and Molecular
76 Biotechnology (IPMB), Heidelberg University, Germany, thus animal care approval was not
77 required for this specific study.
78
79 DNA extraction
80 Collected sample material was stored following Arctander (1988). DNA was isolated from
81 blood, pieces of muscle or ends of feather by incubation in lysis buffer [10 mM Tris (pH 7.5),
82 25 mM EDTA, 75 mM NaCl, 20% SDS, 20 mg /ml Proteinase K], followed by removal of
83 proteins using a standard phenol/chloroform extraction (Sambrook et al., 1989).
84
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
4 85 PCR amplification and sequencing
86 PCR reaction mixtures contained: 100 ng DNA, 5 µL 10 × buffer [500 mM KCl, 100 mM
87 Tris HCl (pH 9.0 at 25°C), 1% Triton X 100 ], 5 µL 15 mM MgCl 2, 5 pmol primer, 2 µL
88 dNTPs (1.5 mM), 0.75 U Taq or 1 U Red Taq Polymerase (Amersham Biosciences) and
89 ddH 2O added up to a volume of 50 µL. Thermal cycling conditions consisted of an initial
90 denaturation for 4 min at 94°C followed by 31 cycles of 45 s at 94°C, 50 s at 50–60°C and
91 150 s at 72°C and a final elongation of 10 min at 72°C. PCR primer sequences are
92 documented in table 3. PCR products were sequenced directly (Cycle Sequencing Ready s t n i 93 Reactions version 1.1 and version 3.1, Applied Biosystems). Cycle sequencing products were r
P 94 run on an Applied Biosystems 310 sequencer. Source and sequence of sequencing primers are e r 95 shown in table 4. We obtained a total of 6699 nucleotides for the following genes: COX1, P
96 COX2, ATP8, ATP6, COX3, ND3, ND4L, ND4 and CYTB.
97
98 Phylogenetic reconstruction
99 The sequences were aligned by BioEdit version 7.1.3.0 (Hall, 1999). We explored the model
100 of sequence evolution which fits the data best with jModelTest version 2.1.4 (Guindon &
101 Gascuel, 2003; Darriba et al., 2012). Bayesian inference (BI) analyses were conducted in
102 MrBayes MPI version 3.1.2. (Ronquist & Huelsenbeck, 2003; Altekar et al., 2004). Two
103 independent runs of 16,000,000 generations were performed along with four Markov chains
104 and the evolutionary model GTR + Γ + I. Trees were sampled every 2000 generations and the
105 first 800 samples were discarded as “burn in”. The “burn in” was determined in Tracer
106 version 1.6 (Rambaut & Drummond, 2007). Maximum likelihood (ML) tree was
107 reconstructed using the rapid hill climbing algorithm implemented in RaxML HPC version
108 7.7.8 (Stamatakis, 2006) with the random starting tree option and the GTRGAMMA model of
109 sequence evolution. The robustness of nodes in ML analyses was assessed by 1000 bootstrap
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
5 110 replicates. The both ML and BI trees were rooted with three paleognaths (Hackett et al.,
111 2008): Apteryx haasti , Dromaius novaehollandiae and Pterocnemia pennata . We made use of
112 the resources available from the CIPRES Science Gateway in order to perform our
113 phylogenetic analyses (Miller et al., 2010).
114
115 Results and Discussion
116 To select for robust monophyletic clades, we run comprehensive BI and ML analyses using
117 parallelized applications. 16,000,000 generations resulted in two chains that converged with a s t
n 118 standard deviation of split frequencies equal to 0.006. Phylogenetic reconstructions for the i r
P 119 dataset using BI and ML are shown in Fig. 1 and Fig. 2, respectively. The deepest bifurcation e r 120 within the Neognathae constituted the split between Galloanserae (BI posterior probability P 121 [PP]: 1.0; ML bootstrap support [BS]: 100%) versus the Neoaves (PP: 1.0; BS: 93%).
122 Passeriformes were monophyletic (PP: 1.0; BS: 100%). In BI, the water bird group as defined
123 by ‘clade H’ of Hackett et al. (2008) consisting of Pelecaniformes (with Sulidae, Anhingidae,
124 Phalacrocoracidae , Pelecanidae), Ciconiiformes (with Ardeidae, Threskiornithidae,
125 Ciconiidae), Procellariiformes (with Procellariidae, Hydrobatidae, Diomedeidae)
126 Sphenisciformes and Gaviiformes received a PP value of 0.78. ML also weakly suggests
127 genetic coherence of these taxa (BS: 25%, in addition to Gruiformes). In both BI and ML
128 reconstructions the species belonging to the same family generally clustered together with
129 moderate to high statistical support. Above the family level, relationships were less
130 congruent, presumably because of relative saturation of the fast evolving mtDNA at deep
131 avian divergences. The same topologies identified across BI and ML were for a clade
132 consisting of Procellariidae, Hydrobatidae and Diomedeidae (PP: 1.0; BS: 97%), in which the
133 sister taxa Calonectris and Puffinus (PP: 1.0; BS: 100%) formed a monophyletic group with
134 Procellaria (PP: 1.0; BS: 100%), which in turn clustered with Pterodromia (PP: 1.0; BS:
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
6 135 100%). This cluster is sister group to Hydrobates (PP: 0.98; BS: 59%). The clade consisting
136 of Calonectris , Puffinus , Procellaria , Pterodroma and Hydrobates shows sister relationship to
137 the monophylum Pelagodroma , Diomedea and Thallasarche (PP: 1.0; BS: 97%), the latter
138 two genera are very closely related (PP: 1.0; BS: 100%). A further monophyletic group
139 constitutes a clade consisting of Sulidae (genera Morus and Sula ), Anhingidae (genus
140 Anhinga ), Phalacrocoracidae (genus Phalacrocorax ) (PP: 1.0; BS: 100%), which is the sister
141 group to Pelecanidae (PP: 0.99; BS: 50%). The last monophyletic assemblage consists of
142 Ardeidae (genera Egretta , Ardea , Nycticorax and Ixobrychus ) and Threskiornithidae (genera s t
n 143 Platalea , Threskiornis and Nipponia ) (PP: 1.0; BS: 71%). i r
P 144 Despite strong efforts in the past to identify statistically robust clades from complete mtDNA e r 145 data sets, many of the interrelationships above the family level in birds are still ambiguous in P 146 some studies. One complicating factor for bird phylogenetic reconstruction is that groupings
147 with high metabolic rates tend to show increased substitution rates (Gillooly , McCoy &
148 Allen, 2007), e.g. passerines. As the waterbird assemblage comprises taxa which are of
149 comparatively uniform size and physiology, statistically robust resolution can be expected
150 within this group. Despite this benefit, resolution of the relationships in this group from DNA
151 data is hampered by the occurrence of short internodes at this taxonomic level from analyses
152 of ncDNA (Hackett et al., 2008), which are also among the shortest within the mtDNA
153 topologies. The use of morphology for phylogenetic reconstruction of the Aequornithes clade
154 is restricted by the limited number of informative characters (Livezey & Zusi, 2007; Mayr,
155 2011). Despite this limitation, our analyses of a large protein coding mtDNA dataset
156 identified three robust groupings, which delineate monophyletic entities of specialized
157 morphological and ecological adaptations.
158 The first of these groupings covers three families of the traditional order Procellariiformes
159 (Nunn & Stanley, 1998; Penhallurick & Wink, 2004), which share the characteristic of a
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
7 160 tubular nasal passage (Lequette et al.,1998) and an almost exclusively pelagic feeding life
161 style. In congruence with the topology from the cytochrome b gene reported by Nunn &
162 Stanley (1998), the genera Calonectris , Puffinus , Procellaria and Pterodroma are sister taxa.
163 Compared to the eight tubenose birds of the present study, previous studies included less
164 number of two (Slack et al., 2006), two (Pacheco et al., 2011), five (Gibb et al., 2013), five
165 (Hackett et al., 2008) and six (Ericsson et al., 2006) taxa of this group in their analyses.
166 Consistently over BI and ML reconstructions, we observed a placement of Pelagodroma as
167 the closest related taxon to Diomedea and Thallasarche , which differed from that found by s t
n 168 Nunn & Stanley (1998); they placed Pelagodroma basal to a monophylum containing i r
P 169 Diomedea , Procellaria , Puffinus and Calonectris . We further observed a different placement e r 170 of Hydrobates , which is placed basal to all above mentioned genera of Procellariiformes in P 171 Nunn & Stanley (1998), but in Penhallurick & Wink (2004) Hydrobates is closely related to
172 Pelagodroma . In our mtDNA reconstructions in contrast, we found Hydrobates well
173 supported as a sister taxon to the monophylum containing Calonectris , Puffinus , Procellaria
174 and Pterodroma. Limited support of our placement of the latter two taxa is given in the
175 mitogenomic analysis of Gibb et al. (2013) which detected a direct sister relationship between
176 Procellaria and Pterodroma ; however, only the expanded taxa number of tubenose birds in
177 the present study, which generated the additional sequences of Calonectris and Puffinus, led
178 to an yet unprecedented resolution of the internal structure of this clade.
179 The second monophyletic group shares a gular sac and four webbed toes as common
180 morphological characters, i.e., Pelecanidae, Sulidae, Anhingidae and Phalacrocoracidae.
181 Affinities of the latter three families had earlier been suggested by DNA DNA hybridization
182 analysis (Sibley & Ahlquist, 1990), cladistic analysis of a large number of morphological
183 characters (Mayr, 2005; Livezey & Zusi, 2007) and by topologies from ncDNA (Ericsson et
184 al., 2006; Hackett et al., 2008) and mtDNA sequence data (Gibb et al., 2013) and from
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
8 185 analyses of morphological and genetic data combined (Cracraft et al., 2004). The third
186 grouping concerns the families Threskiornithidae and Ardeidae; their affinity was previously
187 identified by ncDNA analyses (Ericson et al., 2006, Hackett et al., 2008). To our knowledge,
188 the present study for the first time indicates a robust direct sister relationship of
189 Threskiornithidae and Ardeidae based on almost complete mtDNA data, with inclusion of
190 ibises and spoonbills of the genera Nipponia , Platelea , and Threskiornis in a common family
191 Threskiornithidae and of herons, egrets and bitterns of the genera Ixobrychus , Ardea , Egretta ,
192 and Nycticorax in a common family Ardeidae. In contrast, formerly published mitogenomic s t
n 193 topologies found Threskiornithidae and Ardeidae clustered together either with the i r
P 194 Pelecanidae (Pacheco et al., 2011), or with the Ciconiidae (Gibb et al., 2013). Therefore, a e r 195 consensus topology from ncDNA data of Hackett et al. (2008) and mtDNA data from Gibb et P 196 al. (2013) showed herons and ibises related but ungrouped, placed in a polytomy of a cluster
197 containing additional pelecaniform and ciconiiform birds (Gibb et al., 2013).
198 The sister relationship of flamingos and grebes (Cracraft et al., 2004; Ericsson et al., 2006;
199 Hackett et al., 2008; Pacheco et al., 2011; Gibb et al., 2013; McCormack et al., 2013) which
200 clustered outside the Aequornithes clade, was also evident in our analysis. The data clearly
201 show that the superficial ressemblance of grebes and loons, which led to the affinity in
202 traditional considerations of relationships between these two taxa (van Tuinen et al., 2001), is
203 due to convergent evolution. The position of Gruiformes including cranes and rails is outside
204 the Aequornithes clade in the BI which is consistent with their placement in the ncDNA
205 topologies of Ericson et al. (2006) and Hackett et al. (2008). Therefore, the inclusion of the
206 Gruiformes within the Aequornithes clade in the ML tree is very likely erroneous, as this
207 position furthermore is not supported by high bootstrap values.
208
209
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
9 210 Conclusions
211 Our analyses, based on an enlarged dataset of 52 water bird taxa in total and complementary
212 phylogenetic reconstruction methods, have identified three monophyletic clades of the aquatic
213 birds above the family level and provide a robust hypothesis for further evolutionary and
214 ecological studies.
215
216 Acknowledgements
217 The authors thank various colleagues, mentioned in table 1, for the provision of samples for s t
n 218 this study. i r
P 219 e r 220 P 221
222
223
224
225
226
227
228
229
230
231
232
233
234
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
10 235 References
236 Altekar G, Dwarkadas S, Huelsenbeck JP, Ronquist F. 2004. Parallel metropolis coupled
237 Markov chain Monte Carlo for Bayesian phylogenetic inference. Bioinformatics
238 20:407–415.
239 Arctander P. 1988. Comparative studies of avian DNA by restriction fragment length
240 polymorphism analysis: convenient procedures based on blood samples from live
241 birds. Journal of Ornithology 129:205–216.
242 Braun EL & Kimball RT. 2002. Examining basal avian divergences with mitochondrial s t
n 243 sequences: model complexity, taxon sampling, and sequence length. Systematic i r
P 244 Biology 51:614–625. e r 245 Cracraft J. 1981. Towards a phylogenetic classification of the recent birds of the world (class: P 246 Aves). Auk 98:681–714.
247 Cracraft J, Barker FK, Braun M, Harshman J, Dyke GJ, Feinstein J, Stanley S, Cibois A,
248 Schikler P, Beresford P, Garcia Moreno J, Sorenson MD, Yuri T, Mindell DP. 2004.
249 Phylogenetic relationships among modern birds (Neornithes). Toward an Avian Tree
250 of Life. In: Cracraft J & Donoghue MJ, ed. Assembling the tree of life . New York:
251 Oxford University Press, 468 489.
252 Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: more models, new
253 heuristics and parallel computing. Nature Methods 9:772.
254 Ericson PGP, Anderson CL, Britton T, Elzanowski A, Johansson US, llersjo MK, Ohlson JI,
255 Parsons TJ, Zuccon D, Mayr G. 2006. Diversification of Neoaves: integration of
256 molecular sequence data and fossils. Biology Letters 2:543–547.
257 Gibb GC, Kennedy M & Penny D. 2013. Beyond phylogeny: pelecaniform and ciconiiform
258 birds, and long term niche stability. Molecular Phylogenetic Evolution 68:229 –238.
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
11 259 Gillooly JF, McCoy MW & Allen AP. 2007. Effects of metabolic rate on protein evolution.
260 Biology Letters 3:655 659.
261 Guindon S & Gascuel O. 2003. A simple, fast and accurate method to estimate large
262 phylogenies by maximum likelihood. Systematic Biology 52:696–704.
263 Hackett SJ, Kimball RT, Reddy S, Bowie RC, Braun EL, Braun MJ, Chojnowski JL, Cox
264 WA, Han KL, Harshman J, Huddleston CJ, Marks BD, Miglia KJ, Moore WS,
265 Sheldon FH, Steadman DW, Witt CC, Yuri T. 2008. A phylogenomic study of birds
266 reveals their evolutionary history. Science 320:1763–1768. s t
n 267 Hall TA. 1999. BioEdit: a user friendly biological sequence alignment editor and analysis i r
P 268 program for Windows 95/98/NT. Nucleic Acids Symposium Series 41:95–98. e r 269 Haring E, Kruckenhauser L, Gamauf A, Riesing MJ, Pinsker W. 2001. The complete P 270 sequence of the mitochondrial genome of Buteo buteo (Aves, Accipitridae) indicates
271 an early split in the phylogeny of raptors. Molecular Biological Evolution 18:1892–
272 904.
273 Jetz W, Thomas GH, Joy JB, Hartmann K, Mooers AO. 2012. The global diversity of birds in
274 space and time. Nature 491:444–448.
275 Lequette B, Verheyden C & Jowentin P. 1989. Olfaction in subantarctic seabirds: its
276 phylogenetic and ecological significance. Condor 91:732–735.
277 Livezey BC & Zusi RL. 2007. Higher order phylogeny of modern birds (Theropoda, Aves:
278 Neornithes) based on comparative anatomy. II. Analysis and discussion. Zoological
279 Journal of Linnean Society 149:1–95.
280 Mayr G. 2005. Tertiary plotopterids (Aves, Plotopteridae) and a novel hypothesis on the
281 phylogenetic relationships of penguins (Spheniscidae). Journal of Zoological
282 Systematics and Evolutionary Research 43:61–71.
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
12 283 Mayr G. 2011. Metaves, Mirandornithes, Strisores and other novelties – a critical review of
284 the higher level phylogeny of neornithine birds. Journal of Zoological Systematics and
285 Evolutionary Research 49:58–76.
286 Miller MA, Pfeiffer W & Schwartz T. 2010. Creating the CIPRES Science Gateway for
287 inference of large phylogenetic trees. Proceedings of the Gateway Computing
288 Environments Workshop (GCE) , 14 Nov. 2010, New Orleans, LA pp 1–8.
289 Mindell DP, Sorenson MD, Huddleston CJ, Miranda HC, Knoght A, Sawchuk SJ, Yuri T.
290 1997. Phylogenetic relationships among and within select avian orders based on s t
n 291 mitochondrial DNA. In: Mindell DP, ed. Avian molecular evolution and systematics . i r
P 292 San Diego: Academic Press, 213 247. e r 293 McCormack JE, Harvey MG, Faircloth BC, Crawford NG, Glenn TC, Brumfield RT. 2013. A P 294 phylogeny of birds based on over 1,500 loci collected by target enrichment and high
295 throughput sequencing. PLoS ONE 8(1):e54848.
296 Nunn GB & Stanley SE. 1998. Body size effects and rates of cytochrome b evolution in tube
297 nosed seabirds. Molecular Biology and Evolution 15:1360 1371.
298 Pacheco MA, Battistuzzi FU, Lentino M, Aguilar RF, Kumar S, Escalante AA. 2011.
299 Evolution of modern birds revealed by mitogenomics: timing the radiation and origin
300 of major orders. Molecular Biology and Evolution 28:1927–42.
301 Penhallurick J & Wink M. 2004. Analysis of the taxonomy and nomenclature of the
302 Procellariiformes based on complete nucleotide sequences of the mitochondrial
303 cytochrome b. Emu 104:124–147.
304 Pratt RC, Gibb GC, Morgan Richards M, Phillips MJ, Hendy MD, Penny D. 2009. Toward
305 resolving deep Neoaves phylogeny: data, signal enhancement, and priors. Molecular
306 Biology and Evolution 26:313–326.
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
13 307 Rambaut A & Drummond AJ. 2007. Tracer v1.4. Available at http://beast.bio.ed.ac.uk/Tracer
308 (accessed 20 November 2013).
309 Ronquist F & Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under
310 mixed models. Bioinformatics 19:1572–1574.
311 Sambrook J, Fritsch EF & Maniatis T. 1989. Molecular cloning: a laboratory manual . New
312 York: Cold Spring Harbor Laboratory Press.
313 Sibley CG & Ahlquist JE. 1990. Phylogeny and classification of birds . New Haven &
314 London: Yale University Press. s t
n 315 Slack KE, Jones CM, Ando T, Harrison GL, Fordyce RE, Arnason U, Penny D. 2006. Early i r
P 316 penguin fossils, plus mitochondrial genomes, calibrate avian evolution. Molecular e r 317 Biology and Evolution 23:1144–1155. P 318 Smith ND. 2010. Phylogenetic analysis of Pelecaniformes (Aves) based on osteological data:
319 implications for waterbird phylogeny and fossil calibration studies. PLoS ONE 5(10):
320 e13354.
321 Sorenson MD, Ast JC, Dimcheff DE, Yuri T, Mindell D. 1999. Primers for a PCR based
322 approach to mitochondrial genome sequencing in birds and other vertebrates.
323 Molecular Phylogenetics and Evolution 12:105–114.
324 Stamatakis A. 2006. RAxML VI HPC: maximum likelihood based phylogenetic analyses
325 with thousands of taxa and mixed models. Bioinformatics 22:2688–2690.
326 van Tuinen M, Butvill DB, Kirsch JAW, Hedges SB. 2001. Convergence and divergence in
327 the evolution of aquatic birds. Proceedings of the Royal Society of London B
328 268:1345–1350.
329 Watanabe M, Nikaido M, Tsuda TT, Kobayashi T, Mindell D, Cao Y, Okada N, Hasegawa
330 M. 2006. New candidate species most closely related to penguins. Gene 378:65 73.
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
14 331 Wink M. 1995. Phylogeny of old and new world vultures (Aves: Accipitridae and
332 Cathartidae) inferred from nucleotide sequences of the mitochondrial cytochrome b
333 gene. Zeitschrift für Naturforschung 50c:868–882.
334 Wink M. 2011. Evolution und Phylogenie der Vögel Taxonomische Konsequenzen.
335 Vogelwarte 49:17–24.
336
337
338 s t
n 339 i r
P 340 e r 341 P 342
343
344
345
346
347
348
349
350
351
352
353
354
355
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
15 356 Legends of the tables
357 Table 1 Origin, collector information and voucher numbers of samples analyzed in this study
358 Table 2 GenBank accession numbers of taxa sequenced in the present study
359 Table 3 Primers used for PCR amplifications
360 Table 4 Primers used for sequencing
361
362 Legends of the figures
363 Fig. 1 Bayesian inference tree of waterbirds in relation to other bird orders based on 6699 s t
n 364 nucleotides of protein coding mtDNA genes, reconstructed under the GTR + Γ + I nucleotide i r
P 365 substitution model and 16,000,000 generations. Posterior probabiliy values are indicated for e r 366 each node. P 367
368 Fig. 2 Maximum likelihood tree reconstructed under the GTRGAMMA nucleotide
369 substitution model (ln L = –207933.05). Bootstrap support (1000 replicates) is indicated for
370 each node.
371
372
373
374
375
376
377
378
379
380
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
16 381 Table 1
Taxon Voucher number a Sample origin, collector
Aechmophorus occidentalis 3768 Mexico, H. Witt Gavia immer 3770 Mexico, H. Witt Gavia pacifica 3774 Mexico, H. Witt Spheniscus humboldti 477 Zoo Leipzig, Germany, G. Ehlers Spheniscus demersus 8128 Zoo Leipzig, Germany, G. Ehlers Puffinus yelkouan 3163 Naxos, Greece, D. Ristow Calonectris diomedea 15872 Crete, Greece, D. Ristow
s Hydrobates pelagicus 4073 Malta, Italy, J. Borg t
n Morus bassanus 3288 Saltees, Ireland, M. Wink i r Pelecanus occidentalis 3747 Mexico, H. Witt P e Phoenicopterus ruber 6927 Namibia, J. Osborne r
P Ardea cinerea 2822 Bünder Natur Museum, Switzerland Ciconia ciconia 468 Zoo Leipzig, Germany, G. Ehlers Ciconia nigra 3848 Spain, U. Höfle 382
383 a Voucher numbers of the Institute of Pharmacy and Molecular Biotechnology (IPMB),
384 University Heidelberg, Germany
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
17 385 Table 2
Taxon COX1 COX2 ATP8 ATP6 COX3 ND3 ND4L ND4 CYTB Aechmophorus AY567891 AY567905 AY567863 AY567849 AY567877 AY567933 AY567961 AY567947 AY567919 occidentalis Gavia immer AY567890 AY567904 AY567862 AY567848 AY567876 AY567932 AY567960 AY567946 AY567918 s
Gavia pacifica AY567889t AY567903 AY567861 AY567847 AY567875 AY567931 AY567959 AY567945 AY567917 n i
Spheniscus humboldti AY567888r AY567902 AY567860 AY567846 AY567874 AY567930 AY567958 AY567944 AY567916 P
Spheniscus demersus AY567887e AY567901 AY567859 AY567845 AY567873 AY567929 AY567957 AY567943 AY567915 r
Puffinus yelkouan AY567884P AY567898 AY567856 AY567842 AY567870 AY567926 AY567954 AY567940 AY567912 Calonectris diomedea AY567883 AY567897 AY567855 AY567841 AY567869 AY567925 AY567953 AY567939 AY567911 Hydrobates pelagicus AY567885 AY567899 AY567857 AY567843 AY567871 AY567927 AY567955 AY567941 AY567913 Morus bassanus AY567893 AY567907 AY567865 AY567851 AY567879 AY567935 AY567963 AY567949 AY567921 Pelecanus occidentalis AY567892 AY567906 AY567864 AY567850 AY567878 AY567934 AY567962 AY567948 AY567920 Phoenicopterus ruber AY567894 AY567908 AY567866 AY567852 AY567880 AY567936 AY567964 AY567950 AY567922 Ardea cinerea AY567886 AY567900 AY567858 AY567844 AY567872 AY567928 AY567956 AY567942 AY567914 Ciconia ciconia AY567881 AY567895 AY567853 AY567839 AY567867 AY567923 AY567951 AY567937 AY567909 Ciconia nigra AY567882 AY567896 AY567854 AY567840 AY567868 AY567924 AY567952 AY567938 AY567910 386
387
388
18
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014 389 Table 3
Gene Primer pair Sequence (5´ to 3´) Reference
CYTB L14995 CTCCCAGCCCCATCCAACATCTCAGCATGATGAAACTTCG Wink (1995)
H16065 CTAAGAAGGGTGGAGTCTTCAGTTTTTGGTTTACAAGAC s
COX1 L6615 t CCTCTGTAAAAAGGACTACAGCC Sorenson et al. (1999) n i COX2 H9233 r AAGAAGCTTAGGTTCATGGTCAGG P e ATP8 r P
ATP6 L9034 CAGCACTAGCCTTTTAAGCTA Sorenson et al. (1999)
COX3 H12976 CAGATGCAGGAATTAGCAGTTCTTG
ND3 nd4 3+ ACCAACTACGAGCGGACACACAG Haring et al. (2001)
ND4L nd5 2 ATGATTCCCACTCCTTCTCAGCC
ND4 L9034 CAGCACTAGCCTTTTAAGCTA Sorenson et al. (1999)
nd4 4 GCTTTCTAGGCATAGTAGGGC Haring et al. (2001)
390
391
392
19
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014 393 Table 4
Gene Nucleotides Primer Sequence (5´ to 3´) Reference COX1 1530 L6615 CCTCTGTAAAAAGGACTACAGCC Sorenson et al. (1999) COX2 675 L6615+1 GC(CT)A(CT)(CT)AACATAAAACCCCCAGCC Present study ATP8 150 L6615 1N CAAC(CT)GC(CT)ATCAACATAAA Present study L6615+2 ATAGA(CT)GTAGA(CT)AC(CT)CGAGC Present study L6615+3 GACGATACTCCGACTA(CT)CCAGA Present study s
t L6615+4N TCTCCTATCATAGAAGA Present study n i L6615 4 TCCCC(CT)AT(CT)ATAGAAGA Present study r H9233 AAGAAGCTTAGGTTCATGGTCAGG Sorenson et al. (1999) P
ATP6 666 e L9034 CAGCACTAGCCTTTTAAGCTA Sorenson et al. (1999) r
COX3 780 P L9034 1 CAACTATC(AGC)AT(AG)AACAT Present study ND3 342 L9034 1n CTAGGCCTACTACCATACACAT Present study ND4L 285 L9034+1N CAA(CT)TATCAATAAACATA Present study ND4 1359 L9034+2 CAATGATGACGAGACAT(CT)GTACG Present study L9034+2N CAATGATGACGTGATATTGTACG Present study L9034+3 TTCCA(CT)GGACT(GCT)CACGTAAT Present study L9034+3N GTATA(CT)GGCTCAACCTTCTT Present study L9034+4 TTCCTCAGTAGCAAT(CT)(CT)TATTCCT Present study L9034+5 ACTCATACT(ACT)ACATTCTC Present study L9034+5D CCAAACAACAACATTCACT Present study L9034+5N5 ATCGAAAACCAAGCAGCA Present study L9034+6 AGCTCCCTACC(CT)TTACT Present study L9034+6N TACCTACTATTCTA(CT)ACCCT Present study Nnd4 3+ ACAAACTA(CT)GAACG(AC)ACACACAG Present study nd4 3+ ACCAACTACGAGCGGACACACAG Haring et al. (2001) CYTB 912 mt A(L14995) CTCCCAGCCCCATCCAACATCTCAGCATGAT Wink (1995) GAAACTTCG mt C (L15320) TA(CT)GTCCTACCATGAGGACAAATATCATT Wink (1995) CTGAGG 394
20
PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014 395 Figure 1 Calonectris diomedea 1 1 Puffinus yelkouan 1 Procellaria cinerea Procellariidae 396 0.98 Pterodroma brevirostris Hydrobatidae Hydrobates pelagicus 1 1 Diomedea chrysostoma Diomedeidae 0.68 Thalassarche melanophrys 397 Pelagodroma marina Eudyptes chrysocome 0.73 0.51 Eudyptula minor 1 1 Spheniscus demersus Sphenisciformes 1 Spheniscus humboldti 398 Pygoscelis adeliae 0.82 0.86 Ciconia boyciana 1 1 Ciconia ciconia Ciconiidae Ciconia nigra 399 1 Gavia arctica 1 Gavia pacifica 1 Gavia immer Gaviiformes Gavia stellata Egretta eulophotes 400 1 Egretta novaehollandiae 0.78 1 Ardea cinerea Ardeidae 1 Nycticorax nycticorax 401 Ixobrychus cinnamomeus 1 1 Platalea leucorodia 0.99 Platalea minor 1 Threskiornis aethiopicus Threskiornithidae 402 Nipponia nippon 1 Morus bassanus s 1 Morus serrator t 0.99 1 Sula dactylatra Sulidae/Anhingidae/ 1 Anhinga rufa Phalacrocoracidae n 403 1 i 0.99 Phalacrocorax chalconotus
r Pelecanus conspicillatus 1 Pelecanus occidentalis Pelecanidae Coturnicops exquisitus P 404 1 0.99 Rallina eurizonoides sepiaria Porphyrio hochstetteri e 1 1 Gallinula chloropus r Gallirallus okinawae Gruiformes 405 1 1 Balearica pavonina
P Balearica regulorum 1 Grus canadensis 1 0.61 Grus leucogeranus 406 Geotrygon violacea 0.85 1 Zenaida auriculata Leptotila verreauxi 1 Columbiformes Columba livia 1 407 1 Ectopistes migratorius Hemiphaga novaeseelandiae Aechmophorus occidentalis 1 1 Podiceps cristatu s Podicipediformes 408 Tachybaptus novaehollandiae 1 Phoenicopterus roseus 1 Phoenicopteriformes Phoenicopterus ruber Aratinga pertinax 1 409 1 Brotogeris cyanoptera 0.56 1 Melopsittacus undulatus Psittaciformes 1 Nymphicus hollandicus Strigops habroptilus 1 Aceros waldeni 410 1 Penelopides panini 1 Bucerotiformes 1 Bycanistes brevis Bucorvus leadbeateri 0.72 Larus dominicanus 411 1 Saundersilarus saundersi 1 Charadriiformes 1 Synthliboramphus antiquus Arenaria interpres Accipiter gentilis 1 412 Buteo buteo 1 Nisaetus alboniger 1 Accipitridae 1 Nisaetus nipalensis 413 1 Spilornis cheela 1 Pandion haliaetus Cyanoptila cyanomelana 1 Passeriformes 1 Pseudopodoces humilis 414 1 Sturnus cineraceus 1 Carduelis spinus Sylvia crassirostris 1 1 Tachycineta albiventer Corvus frugilegus 1 1 415 Cyanopica cyanus 0.81 Menura novaehollandiae 1 Falco peregrinus 1 Falconidae Falco tinnunculus Anas platyrhynchos 416 0.8
GALLOANSERAE 1 Aythya americana Cairina moschata 1 Anser anser 1 Branta canadensis 417 1 1 Cygnus atratus Anseranas semipalmata 1 Gallus gallus 1 418 1 Phasianus versicolor Numida meleagris 1 Alectura lathami Apteryx haasti 1 419 1 Dromaius novaehollandiae PALAEOGNATHAE Pterocnemia pennata
0.2 PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
21 420 Figure 2
Nycticorax nycticorax 421 5 Ardea cinerea 10 9 Egretta 0 100 Ardeidae 10 novaehollandiaeEgretta eulophotes 0 Ixobrychus cinnamomeus 422 7 Platalea 1 10 leucorodia 99 0 Platalea minor Threskiornithidae 100 Threskiornis aethiopicus Nipponia nippon 423 42 Morus serrator 100 100 Morus bassanus Sulidae/Anhingidae/ 100 Sula dactylatra Anhing a Phalacrocoracidae 92 424 50 Phalacrocoraxrufa chalconotus Pelecanus conspicillatus 10 5 Pelecanidae 0 Pelecanus occidentalis Rallina eurizonoides sepiaria 9 425 7 5 Coturnicops exquisitus 1 Porphyrio hochstetteri 10 73 Gallinula chloropus 0 Gallirallus okinawae Gruiformes 72 Grus canadensis 100 426 Grus leucogeranus 100 Balearica 10 pavonina 0 Balearica regulorum Calonectris diomedea 10 427 Puffinus 25 10 0 s 10 0 yelkouan Procellaria cinerea Procellariidae t 59 0 Pterodroma brevirostris Hydrobatidae Hydrobates pelagicus 97 n 428 10 Diomedea chrysostoma Diomedeidae i 0 3 Thalassarche melanophrys r 3 Pelagodroma marina 14 100 Gavia arctica
P Gavia pacifica 429 100 Gaviiformes 100 Gavia immer
e Gavia stellata 1 Ciconia boyciana r 8 10 430 10 26 10 0 Ciconia ciconia Ciconiidae 0 Ciconia nigra
P 100 Spheniscus demersus 75 Spheniscus humboldti 100 Eudyptula Sphenisciformes 431 10 Eudyptesminor chrysocome 0 Pygoscelis adeliae Geotrygon violacea 39 84 Zenaida Leptotilaauriculata verreauxi 432 10 11 Ectopistes migratorius Columbiformes 0 100 100 Columba livia Hemiphaga novaeseelandiae 14 Podiceps cristatus 433 10 100 0 Aechmophorus occidentalis Podicipediformes 8 Tachybaptus novaehollandiae Phoenicopterus ruber 0 10 Phoenicopterus roseus Phoenicopteriformes 434 1 0 Larus dominicanus 6 10 Saunde rsilarus saundersi 100 0 Charadriiformes 10 Synthliboramphus antiquus 0 Arenaria interpres 435 Nisaetus alboniger 100 5 Nisaetus nipalensis 10 0 Spilornis cheela Accipitridae 25 Accipiter g entilis 0 97 436 100 Buteo buteo Pandion haliaetus Brotogeris cyanoptera 100 96 Aratinga pertinax 437 99 Melopsittacus undulatus Psittaciformes 10 Nymphicus hollandicus 0 Strigops habroptilus 70 Aceros waldeni 10 Penelopides panini 438 100 0 Bucerotiformes 9 10 Bycanistes brevis 3 0 Bucorvus leadbeateri Cyanoptila cyanomelana 10 Passeriformes 100 0 Pseudopodoces humil is 439 77 Sturnus cineraceus 95 Carduelis spinus Sylvia crassirostris 9 9 5 Tachycine ta albiventer 440 9 Corvus frugilegus 100 10
Cyanopica cyanus 0 100 6 Menura novaehollandiae 5 Falco 100 Falconidae 441 Falcotinnunculus peregrinus Anser anser
99 GALLOANSERAE 10 Branta canadensis 0 Cygnus atratus 100 Aythya americana 442 87 Cairina moschata 89 100 Anas platyrhynchos Anseranas semipalmata 100 Phasianus versicolor 443 100 10 Gallus gallus Numida meleagris 10 0 0 Alectura Apteryx lathami 10 Dromaiushaasti novaehollandiae 100 0 PALAEOGNATHAE Pterocnemia pennata
0.06 PeerJ PrePrints | http://dx.doi.org/10.7287/peerj.preprints.272v1 | CC-BY 4.0 Open Access | received: 5 Mar 2014, published: 5 Mar 2014
22