Supporting Information

Seki et al. 10.1073/pnas.0907601107 SI Methods and mouse TIF1β (S824A), sense, 5′-GTGCTGGCCTAAGTG- Cell Culture. Mouse ES cells, D3 and E14, were purchased from CTCAGGAGCTCTC-3′;antisense,5′-GAGAGCTCCTGAGC- American Type Culture Collection. ZHBTc4 cell line was kind ACTTAGGCCAGCAC-3′. For the retroviral expression plas- gift from Hitoshi Niwa (Kobe, Japan) (1). Mouse GS cells (mGS- mids, mouse TIF1β (S824D and S824A) were constructed by DBA1) were obtained from the RIKEN cell bank (2). All these subcloning the EcoRI/NotI fragments of pCAGIP-Flag-TIF1β cells were maintained on mitomycin-C–treated MEF feeder layer mutants into a retroviral vector, pMYs (7), digested by the same in ES medium [DMEM with high glucose Wako)], 2 mM L- enzymes. The pMYs was kindly provided by T. Kitamura (Tokyo, glutamine, 0.1 mM nonessential amino acids (Gibco), 0.1 mM 2- Japan). The retroviral vectors pSINsi-DK-TIF1β, pSINsi-DK- mercaptoethanol, 15% ES cell–qualified FBS (Gibco), 1,000 IU/ TIF1α, pSINsi-DK-ATM, pSINsi-DK-Oct3/4, pSINsi-DK-Nanog, mL ESGRO (Chemicon), and penicillin/streptomycin (Sigma). pSINsi-DK-Sox2, and the negative control vectors were con- MEFs were prepared as described previously (3), and main- structed by inserting the following sense-loop-antisense DNA se- tained in MEF medium [DMEM with low glucose (Gibco), quences into the pSINsi-DK-I vector (Takara): TIF1β,sense,5′- 2 mM L-glutamine, 12.5% FBS (Gibco), and penicillin/strep- GATCCGGAACCAACGTAAACTCTTTAGTGCTCCTGGT- tomycin]. For spontaneous differentiation of mouse ES cells, TGAAGAGTTTACGTTGGTTCCTTTTTTAT-3′; antisense, 5′- ES cells were cultured in the absence of LIF (1 IU/mL ESGRO) CGATAAAAAAGGAACCAACGTAAACTCTTCAACCAGG- on a gelatin-coated dish without a feeder layer. Mouse ES AGCACTAAAGAGTTTACGTTGGTTCCG-3′; TIF1α, sense, cells stably expressing TIF1β were cultured on a gelatin-coated 5′-CTAGAGTAATCGAGGATAAAGAGACACAGGGAAG- dish in ES medium supplemented with 0.5 μg/mL of puromycin CGAGTCTGTCTCTTTATCCTCGATTACTTTTTTCCTGC- (Sigma). Mouse EC cells, F9, and P19CL6 were obtained from A-3′;antisense,5′-GGAAAAAAGTAATCGAGGATAAAG- the RIKEN cell bank. These cells were maintained in DMEM AGACAGACTCGCTTCCCTGTGTCTCTTTATCCTCGAT- with high glucose (Wako), 2 mM L-glutamine, 10% ES cell– TACT-3′;ATM,sense,5′- CTAGAGCATACTACTCAAAG- qualified FBS (Gibco), and penicillin/streptomycin (Sigma) ACATTGTGTGCTGTCCAATGTCTTTGAGTAGTATGCT- without feeder cells. NIH 3T3 cells were maintained in DMEM TTTTTCCTGCA -3′;antisense,5′- GGAAAAAAGCATACT- with high glucose, 10% FBS, and penicillin/streptomycin ACTCAAAGACATTGGACAGCACACAATGTCTTTGAG- (Sigma). HaCaT cells were cultured in DMEM with low glu- TAGTATGCT-3′ (8, 9); Oct3/4, sense, 5′-GATCCCCGAAG- cose, 10% FBS, and penicillin/streptomycin (Sigma). GATGTGGTTCGAGTATTCAAGAGATACTCGAACCACA- For retrovirus propagation, Plat-E cells (4) were maintained in TCCTTCTTTTTAT-3′, antisense, 5′-CGATAAAAAGAAGGA- DMEM with low glucose, 10% FBS, 10 μg/mL Blasticidin (In- TGTGGTTCGAGTATCTCTTGAATACTCGAACCACATC- vitrogen), 1 μg/mL puromycin, and penicillin/streptomycin (Sigma). CTTCGGG-3′; Nanog, sense, 5′-GATCCGAGACAGTGAGG- For some experiments, JAK inhibitor I (cat. no. 420099; Calbio- TGCATATTAGTGCTCCTGGTTGATATGCACCTCACTGT- chem) was used to test the LIF dependency of TIF1β-expressing CTCTTTTTTAT-3′; antisense, 5′-CGATAAAAAAGAGACA- cells. Plat-E cells were kindly provided by T. Kitamura (Tokyo, GTGAGGTGCATATCAACCAGGAGCACTAATATGCACC- Japan). Neural differentiation of mouse ES cells was performed as TCACTGTCTCG-3′; Sox2, sense, 5′-GATCCCCGAAGGAG- described previously (5). All cells were maintained in a humidified CACCCGGATTATTTCAAGAGAATAATCCGGGTGCTCC- ′ ′ incubator at 37 °C under 5% CO2 atmosphere. TTCTTTTTAT-3 ; antisense, 5 -CGATAAAAAGAAGGAGC- ACCCGGATTATTCTCTTGAAATAATCCGGGTGCTCCTT- Plasmid Construction. For the construction of the expression vector CGGG-3′; negative control-1, sense, 5′-GATCCGTCTTAATC- pCAG-IP-Flag-TIF1β, oligonucleotides encoding the Flag pep- GCGTATAAGGCTAGTGCTCCTGGTTGGCCTTATACGCG- tide (sense, 5′-AATTGACCGCCATGGACTACAAGGACG- ATTAAGACTTTTTTAT-3′;antisense,5′-CGATAAAAAAGT- ATGATGACAAGGGCG-3′; antisense, 5′-AATTCGCCCTTG- CTTAATCGCGTATAAGGCCAACCAGGAGCACTAGCC- TCATCATCGTCCTTGTAGTCCATGGCGGTC-3′) were an- TTATACGCGATTAAGACG-3′; and neg control-2, sense, 5′- nealed and ligated into the EcoRI site of the pCAG-IP vector CTAGAGTCTTAATCGCGTATAAGGCCACAGGGAAGCG- (6). The plasmid pCAG-IP was provided by H. Koide (Kana- AGTCTGGCCTTATACGCGATTAAGACTTTTTTCCTGCA- zawa, Japan). The TIF1β cDNA was amplified by RT-PCR with 3′; antisense, 5′-GGAAAAAAGTCTTAATCGCGTATAAGG- a high-fidelity DNA polymerase, KOD-Plus (Toyobo), using CCAGACTCGCTTCCCTGTGGCCTTATACGCGATTAAGA- total RNAs prepared from mouse ES D3 cells with the following CT-3′. For some experiments, ATM shRNA expression cassette primers: mouse TIF1β,5′-GGAATTCATGGCGGCCTCGGC- was amplified by PCR with the following primers: 5′-CCGT- GGCAGC-3′; mouse TIF1β-3′,5′-CGATATCTCAGGGGCC- CGACGTTTCGAGC-3′ and 5′-GCTGACTAATTGAGATG- ATCACCAGG-3′. The PCR products were then digested with CATGCTTTGC-3′, and used for transient expression in ES EcoRI and EcoRV, and subcloned into the EcoRI and EcoRV cells with Lipofectamine 2000. For knockdown experiments with sites of the aforementioned vector. The deletion mutants of TIF1β siRNAs, the following RNA oligos were annealed and TIF1β, TIF1β-N (aa 1–509), and TIF1β-C (aa 510–835) were used for transient transfection with Lipofectamine 2000: TIF1β-1 generated by PCR-based amplification and subcloned into sense, 5′-ggaaccaacguaaacucuuTT-3′;TIF1β-1 antisense, 5′- aaga- EcoRI and EcoRV sites of the pCAG-IP-Flag vector. The mu- guuuacguugguuccTT-3′;TIF1β-2 sense, 5′-agcgaacagucuacuguaaT- tated versions of TIF1β that mimic the phosphorylated or non- T-3′;TIF1β-2 antisense, 5′-uuacaguagacuguucgcuTT; negative con- phosphorylated state of TIF1β were generated by mutagenesis trol sense, 5′- ucuuaaucgcguauaaggcTT-3′; negative control anti- of pCAG-IP-Flag-TIF1β using the QuikChange site-directed sense, 5′- gccuuauacgcgauuaagaTT-3′. mutagenesis kit (Stratagene). Mutagenesis was performed ac- cording to the manufacturer’s instructions, and the following RT-PCR and Real-Time qRT-PCR. Total RNA was extracted with primers were used: mouse TIF1β (S824D), sense, 5′-CAGTG- Isogen (Nippon Gene) following the manufacturer’s recom- CTGGCCTAAGTGATCAGGAGCTCTCTGGC-3′; antisense, mendations, and cDNAs were synthesized using Super Script II 5′-GCCAGAGAGCTCCTGATCACTTAGGCCAGCACTG-3′; reverse transcriptase (Invitrogen). Primers used for the PCR

Seki et al. www.pnas.org/cgi/content/short/0907601107 1of9 were as follows: Nanog, forward, 5′-CTGTGTTCTCTCAGG- Tween-20 and incubated with antibodies against ES cell–specific CC-3′; reverse, 5′-GGGATACTCCACTGGTG-3′; Oct3/4, for- marker proteins. After incubation with horseradish-conjugated ward, 5′-TGCGGAGGGATGGCATAC-3′; reverse, 5′-CTCC- secondary antibody, the blots were incubated with an enhanced AACTTCACGGCATTG-3′; Oct3/4 (endogeneous); forward, 5′- chemiluminescent assay reagent, SuperSignal West Femto (Pierce) TCTTTCCACCAGGCCCCCGGCTC-3′; reverse, 5′-TGCGG- for 5 min at room temperature, and the protein bands were visu- GCGGACATGGGGAGATCC-3′; Sox2, forward, 5′-CCAGCG- alized using an LAS 1000 Pro Image Analyzer or LAS1500 Ana- CCCGCATGTATAAC-3′; reverse, 5′-CGGGCTGTTCTTCT- lyzer (Fuji Film). For quantitative analysis, the protein bands were GGTTGC-3′; c-Myc, forward, 5′-TGACCTAACTCGAGGAG- further analyzed using Image Gauge software (Fuji Film). GAGCTGGAATC-3′; reverse 5′-AAGTTTGAGGCAGTTAA- Immunoprecipitation was performed using cell lysate prepared AATTATGGCTGAAGC-3′; Klf4, forward, 5′-CACCGTCCA- as described earlier. After centrifugation the cell lysate was pre- GCTCGCAGTTC-3′; reverse, 5′-CTGCACGCTCTTGGACT- cleared with IgG-Sepharose (GE Healthcare) for 30 min at 4 °C on CAG-3′; E-Ras, forward, 5′-ACTGCCCCTCATCAGACTGC- a rotating wheel. The supernatant was collected and further in- TACT-3′; reverse, 5′-CACTGCCTTGTACTCGGGTAGCTG- cubated with Flag-agarose beads (Sigma) for 2 h at 4 °C on a rotating 3′; Cripto, forward, 5′-ATGGACGCAACTGTGAACATGATG- wheel. The beads were extensively washed with the lysis buffer. The CTCGCA-3′; reverse, 5′-CTTTGAGGTCCTGGTCCATCACGT- bound proteins were eluted by boiling in SDS sample buffer, re- GACCAT-3′; Fgf4, forward, 5′-CGTGGTGAGCATCTTCGGAG- solved on a 12% SDS/PAGE gel, and transferred to PVDF mem- TGG-3′,reverse,5′-CCTTCTTGGTCCGCCCGTTCTTA-3′; Dax1, branes as described earlier. Immunoprecipitated proteins were forward, 5′-GCCTGCAGTGCGTGAAATAC-3′; reverse, 5′-GAA- detected with specific antibodies as described as follows. TCTCAGCAGGAAAAGGG-3′; Esg1,forward,5′-CCCTGAAG- For immunoprecipitation of endogenous proteins, nuclear ex- TCTGGTTCCTTG-3′; reverse, 5′-CAGATATTTCAGCACCAG- tract was prepared. Mouse ES cells were washed once with PBS CG-3′; Gdf3, forward, 5′-CCTTCACCTCACAGGTTCCA-3′;re- solution and lysed in a hypotonic buffer (10 mM Hepes buffer, pH verse, 5′-GTCTGGGAGAAGCTGAAGCA-3′; Zfp296, forward, 7.9, containing 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 0.1 mM 5′-CCATTAGGGGCCATCATCGC-3′; reverse, 5′-GCAACTTC- EGTA, 0.5 mM DTT, and Complete). After 15 min on ice, the cells CAAGGACTAGTG-3′; Eomes,forward,5′-GTGACAGAGACG- were homogenized in a glass Dounce homogenizer and centrifuged GTGTGGAGG-3′,reverse,5′-AGAGGAGGCCGTTGGTCTG- at 15,000 rpm for 5 min at 4 °C. The nuclear pellet was resuspended TGG-3′; Fgf5, forward, 5′-CTGTATGGACCCACAGGGAGTA- in a nuclear extraction buffer (20 mM Hepes buffer, pH 7.9, con- AC-3′; reverse, 5′-ATTAAGCTCCTGGGTCGCAAG-3′;and taining 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2,0.2mM Gapdh, forward, 5′-ACCCAGAAGACTGTGGATGG-3′;reverse, EDTA, 0.5 mM DTT, 25 mM NaF, 25 mM β-glycerophosphate, 5′-CACATTGGGGGTAGGAACAC-3′. 1mMNa3VO4, and complete) and was rotated 4 °C for 30 min. The Real-time RT-PCR was performed with an ABI PRISM 7700 suspension was centrifuged at 15,000 × g for 10 min at 4 °C. The (Applied Biosystems) sequence detection system using SYBR supernatant was then diluted to 150 mM NaCl with the nuclear Green PCR Master Mix (Qiagen) according to the manu- extraction buffer lacking NaCl and centrifuged at 15,000 rpm for facturer’s instructions. Experiments were done in duplicate or 10 min at 4 °C. The resulted supernatant was used for immuno- triplicate, and the data were normalized to expression of the precipitation. To detect sumoylated proteins, a coimmunoprecipi- Gapdh mRNA. Primers used for the quantitative real-time PCR tation assay was performed as described previously (10). were as follows: Nanog, forward, 5′-CTGTGTTCTCTCAGGC- Immunofluorescent staining was performed as described pre- C-3′;reverse,5′-GGGATACTCCACTGGTG-3′; Sox2, forward, viously (11). For immunostaining of mouse embryos, the embryos 5′-CCAGCGCCCGCATGTATAAC-3′;reverse,5′-CGGGCTG- were isolated from pregnant female mice (ICR) according to TTCTTCTGGTTGC-3′; Gdf3, forward, 5′-CCTTCACCTCAC- standard procedures (3). For immunofluorescent staining of em- AGGTTCCA-3′;reverse,5′-GTCTGGGAGAAGCTGAAGCA- bryos, a mouse-piece equipped with a pulled glass capillary was 3′; Zfp296, forward, 5′-CCATTAGGGGCCATCATCGC-3′; re- used to transfer embryos from one buffer to another (12). The verse, 5′-GCAACTTCCAAGGACTAGTG-3; Cripto,forward,5′- confocal images of the embryos were obtained using an Olympus GGAGGTATATTCCTCCGAAG-3′; reverse, 5′-ATGCCAAAT- IX81 FV1000 laser scanning confocal microscope equipped with GAGAGAGGCCC-3′; E-Ras,forward,5′-TCCAGAGGAAAG- a ×40 UPlanSApo 0.95 objective lens. To obtain confocal images TCACGAGG-3′; reverse, 5′-GTCTTTCACGAAGCATTGG- of immunofluorescent staining using modified histone antibodies, 3′; c-Myc, forward, 5′-AAGGAAGGACTATCCAGCTG-3′; re- a ×60 UPlanSApo 1.35 oil immersion objective lens was used with verse, 5′-TCCAAGACGTTGTGTGTCCG-3′; Oct3/4, forward, the same confocal system. For the detection of apoptosis of MEFs 5′- TGCGGAGGGATGGCATAC-3′; reverse, 5′-CTCCAACT- after retrovirus infection, a Sulforhodamine Multi-Caspase Ac- TCACGGCATTG-3′; Esg1, forward, 5′-CCCTGAAGTCTGG- tivity Kit for apoptosis detection (Biomol) was used according to TTCCTTG-3′; reverse, 5′-CAGATATTTCAGCACCAGCG-3′; the manufacturer’sinstruction. Dax1, forward, 5′-GCCTGCAGTGCGTGAAATAC-3′; reverse, The antibodies used in this study were follows: rabbit polyclonal 5′-GAATCTCAGCAGGAAAAGGG-3′; Klf4, forward, 5′-CA- antibodies against phosphorylated TIF1β (Cell Signaling 4127, CCGTCCAGCTCGCAGTTC-3′; reverse, 5′-CTGCACGCTCTT- Bethyl Laboratories A300-815A), TIF1β (Santa Cruz sc-33186), GGACTCAG-3′;andGapdh, forward, 5′-ACCCAGAAGACTG- Oct3/4 (Santa Cruz sc-9081, Abcam ab19857), Nanog (Reprocell TGGATGG-3′; reverse, 5′-CACATTGGGGGTAGGAACAC-3′. RCAB0001P), β-tubulin (Neo Markers RB-9249-P1), TIF1α (Bethyl Laboratories BL2794), NF200 (SigmaN4142), Brg-1 (Santa Immunoblotting, Immunoprecipitation, and Immunofluorescence. For Cruz sc-10768), BAF155 (Santa Cruz sc-10756), SETDB1 (Abcam the preparation of cell extracts, mouse ES cells were lysed in lysis ab12317), CHD3/Mi2 (Santa Cruz sc-11317), H3K9me3 (Abcam buffer (20 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM EDTA, ab8898), and N-CoR (Affynity Bioreagents PA1-844A); mouse 1% Nonidet P-40, 1 mM Na3VO4, 25 mM NaF, and 25 mM β- monoclonal antibodies against TIF1β (Affinity Bioreagents MA1- glycerophosphate) supplemented with a protein inhibitor mix- 2023), Oct3/4 (BD O84720), SSEA1 (Kyowa TM13), Flag M2 ture (Complete; Roche), and rotated at 4 °C for 30 min. After (Sigma F3165), α-tubulin (Sigma T9026), histone H3K4me3 (Wako centrifugation at 13,200 rpm for 10 min at 4 °C, the supernatant MABI0304), H3K9me3 (Wako MABI0308), H3K9Ac (Wako was collected and the protein concentration was determined with MABI0305), HP1α (Upstate 05–689), CBP (Santa Cruz sc-7300), a Protein Assay Kit (Bio-Rad). Thirty micrograms of sample TuJ1 (Convance MMS-435P), Smarcad1 (BD B11020-050), Actin were boiled in SDS sample buffer, resolved using SDS/PAGE, (Thermo Scientific MS-1295-P0), and SUMO-1 (Zymed 33–2400); and transferred to PVDF membranes. The membranes were and goat polyclonal antibody against Sox2 (Santa Cruz sc-17320). blocked with 5% skim milk in Tris-buffered saline solution with Secondary antibodies for the immunofluorescent study were anti-

Seki et al. www.pnas.org/cgi/content/short/0907601107 2of9 mouse and rabbit IgG-conjugated Alexa 488 or Alexa 594 (Mo- ChIP. ChIP assay was performed with a ChIP Assay Kit (Upstate lecular Probes). All the immunofluorescent images other than Biotechnology) according to the manufacturer’s protocol. Instead confocal images were obtained using an Olympus IX70 microscope of protein G agarose beads, magnetic protein G beads (Dyna- equipped with CoolSNAP HQ2 (Photometrics) and processed using beads Protein G; Invitrogen) were used for this study. Primer MetaMorph software (Molecular Devices). sequences used for this assay were as follows: mouse Nanog proximal promoter, forward, 5′-GAGGTAAAGCCTCTTTT- fi fi Combined Bisul te Restriction Analysis and Bisul te Sequencing. TGG-3′; and reverse, 5′-GTGAATTCACAGTTAATCCCACC- Genomic DNA was digested with HindIII. Digested DNA (3 μg) 3′; +1 kb forward, 5′-TGGAGACAGTAGTAGTATGGTGGC- was denatured with 0.3 N NaOH. Sodium metabisulfite (pH 5.0) fi 3′; reverse, 5′-CCTGGCTGTCCTGGGACTTG-3′; and −1kb and hydroquinone were added to a nal concentration of 2.0 M ′ ′ and 0.5 mM, respectively. The reaction mixture was incubated in forward, 5 -CGGTGATACGTTGGCCTTCTAGTC-3 ; reverse, ′ ′ the dark at 55 °C for 16 h. DNA was purified using the Wizard 5 -CCCTGCTACTGAAGACACCACTC-3 . DNA Clean-up System (Promega), treated with 0.3 M NaOH at 37 °C for 15 min, and precipitated with ethanol. It was then dis- Induction of iPS Cells from MEFs by Retrovirus Gene Transfer. For solved in 20 μL of TE buffer (pH 8.0) and used in a concentration retrovirus production, Plat-E cells seeded on a P60 dish were range of 1/40 to 1/20 for PCR analysis with Immolase Taq DNA transfected with each retroviral plasmid using Lipofectamine 2000. polymerase (Bioline). PCR was performed under the following The next day, the medium was renewed. At 48 h after transfection, conditions: denaturation at 95 °C for 10 min and 43 cycles, each the virus-containing supernatant was collected by centrifugation at cycle comprising 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min. 1,000 rpm for 5 min at room temperature, filtered through a 0.45-μm The primers used were as follows: Oct3/4, forward, 5′- GAG- membrane, and the aliquots were immediately used for infection or AGGGTGTAGTGTTAATAGGTTTTGT -3′; reverse, 5′-AA- stored at –80 °C. One hundred microliters of each supernatant TCTAAAACCAAATATCCAACCATAAA-3′; Zfp42, forward, supplemented with 4 μg/mL Polybrene was added to MEFs seeded 5′-AATGGTTTTAGATAGAGAAAAGGGTTT-3′; reverse, 5′- on a 12-well plate and cultured in MEF medium. The medium was ′ ′ CTTTTATCCTAAATTCCCTACAACCA-3 ; Jag1, forward, 5 - renewed every other day. On d 5, the infected MEFs were trypsinized AATTTAAAGGTTGGTTGAAGTTTTTG-3′; reverse, 5′-AA- ′ ′ and seeded on MMC-treated MEFs (six-well plate). After d 6, cells CTTTCTCAACCCCATCAAATAATA-3 ; Sgk1, forward, 5 -T- were cultured in ES medium, renewed every other day. The mor- GTTGGGTTAAAAGTGTGGGTTAT-3′; reverse, 5′-AAACC- phology of the cells was monitored under a microscope every day. CTACCCACAAATAACAAAA-3′. During the bisulfite reaction, unmethylated CpGs are converted to TpGs, whereas methylated DNA Microarray. Total RNA was prepared from TIF1β-SD- and CpGs remain intact. For restriction mapping, 25% of the PCR TIF1β-SA–expressing ES cells cultured in the absence of LIF for product was digested with HpyCH4IV at 37 °C for 3 h and elec- 8 d using Isogen (Nippon Gene). An Agilent low RNA input trophoresed with the undigested product (control) on a microchip fluorescent linear amplification kit (Agilent) was used to syn- electrophoresis apparatus (MCE-202 MultiNA; Shimadzu). The fl CpG methylation status within the HpyCH4IV restriction sites was thesize uorescently labeled cRNA targets for microarray anal- assessed according to the proportion of cleaved fragments. For ysis. Labeled cRNA targets were hybridized to a whole mouse bisulfite sequencing, 50% of the PCR product was gel-extracted genome (4 × 44K; Agilent) according to the manufacturer’spro- and subcloned into the pGEM-T easy vector (Promega). A mini- tocol. Arrays were scanned with a G2565BA Microarray Scanner mum of 10 clones was sequenced, and the methylation status of System (Agilent). Data were analyzed using GeneSpring GX individual CpGs was determined. software (Agilent).

1. Niwa H, Masui S, Chambers I, Smith AG, Miyazaki J (2002) Phenotypic complementation 7. Kitamura T, et al. (2003) Retrovirus-mediated gene transfer and expression cloning: establishes requirements for specific POU domain and generic transactivation function Powerful tools in functional genomics. Exp Hematol 31:1007–1014. of Oct-3/4 in embryonic stem cells. Mol Cell Biol 22:1526–1536. 8. Zhou N, Xiao H, Li TK, Nur-E-Kamal A, Liu LF (2003) DNA damage-mediated apoptosis 2. Kanatsu-Shinohara M, et al. (2004) Generation of pluripotent stem cells from induced by selenium compounds. J Biol Chem 278:29532–29537. neonatal mouse testis. Cell 119:1001–1012. 9. Ouyang Y, et al. (2005) Inhibition of Atm and/or Atr disrupts gene silencing on the 3. Hogan B, Beddington R, Costantini F, Lacy E, eds. (1994) Manipulating the Mouse inactive X chromosome. Biochem Biophys Res Commun 337:875–880. Embryo: A Laboratory Manual (Cold Spring Harbor Lab Press, Cold Spring Harbor, NY), 10. Ivanov AV, et al. (2007) PHD domain-mediated E3 ligase activity directs intramolecular 2nd ed. sumoylation of an adjacent bromodomain required for gene silencing. Mol Cell 28: 4. Morita S, Kojima T, Kitamura T (2000) Plat-E: An efficient and stable system for 823–837. transient packaging of retroviruses. Gene Ther 7:1063–1066. 11. Kurisaki A, et al. (2006) The mechanism of nuclear export of Smad3 involves exportin 5. Watanabe K, et al. (2005) Directed differentiation of telencephalic precursors from 4 and Ran. Mol Cell Biol 26:1318–1332. embryonic stem cells. Nat Neurosci 8:288–296. 12. Nagy A, Gertsenstein M, Vintersten K, Behringer R (2002) Manipulating the Mouse 6. Yoshida-Koide U, et al. (2004) Involvement of Ras in extraembryonic endoderm Embryo: A Laboratory Manual (Cold Spring Harbor Lab Press, Cold Spring Harbor, differentiation of embryonic stem cells. Biochem Biophys Res Commun 313:475–481. NY), 3rd ed.

Seki et al. www.pnas.org/cgi/content/short/0907601107 3of9 Fig. S1. Overexpression of TIF1β promotes the pluripotency of mouse ES cells. (A) Alkaline phosphatase activity of mouse ES cells stably expressing TIF1β. Mouse ES D3 cells constitutively expressing TIF1β, Nanog, or an empty vector (Ctrl) were cultured without LIF for 2 weeks on a feeder-free gelatin-coated dish, fixed with 3.7% formaldehyde in PBS solution, and incubated with alkaline phosphatase substrate. Blue color indicates alkaline phosphatase activity.(B) Expression of Oct3/4 in TIF1β stably expressing cells. RT-PCR analysis of the Oct3/4 gene was performed with ES cells cultured with or without LIF for 2 weeks. Immunoblotting analysis of Oct3/4 protein was also performed with the same samples. (C) Immunofluorescent analysis of Oct3/4 and SSEA1 in mouse ES cells stably expressing TIF1β. ES cells cultured with or without LIF for 2 weeks were stained with Oct3/4 (red) or SSEA1 (green) antibodies. Nuclei were stained with DAPI (blue).

Fig. S2. TIF1β is indispensable for the maintenance of pluripotency of mouse ES cells. (A) Immunofluorescent analysis of TIF1β and TIF1α in knockdown ES cells. Mouse ES D3 cells stably expressing the indicated shRNA were stained with TIF1β or TIF1α antibody (green). Nuclei were stained with DAPI (blue). (B) Typical morphology of TIF1β knockdown ES cells cultured in the presence of LIF (1,000 IU/mL). Mouse ES cells were infected with TIF1β, TIF1α, or a control shRNA expression retrovirus, and G418-resistant stably expressing cells were obtained. (C) Immunofluorescent analysis of SSEA-1 and Nanog in TIF1β- and TIF1α- knockdown cells. ES cells cultured with LIF were stained with SSEA-1 (green) or Nanog (red) antibody. (D) Reduced cell growth of TIF1β knockdown ES cells. ES cells stably expressing TIF1β, TIF1α, or control shRNA were seeded in a 12-well plate (1 × 105 cells/well), and the number of cells was counted after a 48-h culture. (E and F) Semiquantitative analyses of SSEA1- and Nanog-immunopositive cells. The numbers of SSEA1-positive cells (E) and Nanog-positive cells (F) were counted in five independent eye fields. (G) Immunoblotting analyses of Nanog expression in TIF1β- and TIF1α-knockdown ES cells. Cell extracts prepared from shRNA stably expressing cells were analyzed by immunoblotting with a Nanog antibody. Immunoblotting of α-tubulin was used as a loading control. (H) qRT-PCR analysis of TIF1β knockdown ES cells cultured in the presence of LIF. Total RNA was prepared from the TIF1β shRNA-expressing cells and control shRNA- expressing cells. Relative expression of the indicated marker mRNA was shown. The experiment was done in duplicate.

Seki et al. www.pnas.org/cgi/content/short/0907601107 4of9 Fig. S3. Phosphorylation of TIF1β in various stem cells. (A) Immunofluorescence staining of mouse ES cells, GS cells, and EC cells. The cells were immunostained with antibodies against TIF1β (red) and TIF1β-P (green). The nuclei were stained with DAPI (blue). (B) Immunofluorescence staining of mouse ES cells cultured in the absence of LIF for 1 week. (C) Expression of endogenous TIF1β protein in early embryos. Mouse embryos (embryonic day 3.5) were collected from pregnant female mice and immunofluorescent analysis was performed with TIF1β- or phosphorylated TIF1β (S824)–specific antibodies.

Fig. S4. TIF1β regulates the expression of pluripotency-specific genes, but not cancer-related genes, in mouse ES cells in a phosphorylation-dependent manner. (A) qRT-PCR analysis of pluripotency-specific ES cell marker genes. Total RNA extracted from ES D3 cells cultured without LIF for 8 d was used for the analysis. All experiments were performed in duplicate. (B) qRT-PCR analysis of cancer-related genes. The experiments were conducted as described in A.(C) qRT-PCR analysis of pluripotency-specific ES cell marker genes. Total RNA extracted from ES cells cultured in the presence of LIF for 8 d. (D) TIF1β-SD- or TIF1β- SA–expressing retrovirus does not induce apoptosis. MEFs seeded in a 24-well plate were infected with the retroviruses, and the caspase-activated cells were counted 7 d after infection. The nuclei were counter stained with DAPI. The caspase-activated MEFs were counted from five different microscopic fields. (E) TIF1β-SD- or TIF1β-SA–expressing retrovirus does not induce growth inhibition of MEFs. DAPI-positive cells in D were counted.

Seki et al. www.pnas.org/cgi/content/short/0907601107 5of9 Fig. S5. Phosphorylation of TIF1β negatively regulates H3K9me3 and HP1α foci formation in pluripotent mouse ES cells. (A) Expression of pluripotency-specific marker and differentiation markers after knockdown of TIF1β in ES D3 cells. Expression of Nanog, Fgf5, and Eomes mRNAs were analyzed by qRT-PCR. (i)ES cells transiently transfected with TIF1β siRNA or negative control siRNA on day 1 and day 5 were cultured in the presence of LIF and lysed on day 6 to analyze gene expressions. (ii) ES cells infected with TIF1β shRNA-expressing retrovirus was cultured in the presence of LIF and 0.4mg/mL of G418 for 14 days to select TIF1β shRNA stably expressing cell population. (iii) Nontransfected control ES cells were cultured with or without LIF for 6 days. (B) Immunofluorescent staining of H3K4me3, H3K9me3, and HP1α in the TIF1β siRNA transfected cells. ES cells transiently transfected with TIF1β siRNA or negative control siRNA were subjected to immunostaining 4 days after transfection. The arrow heads indicate TIF1β-knockdown cells. (C) Quantification of HP1α foci in TIF1β-knockdown cell nuclei. The number of immunopositive HP1α foci in (B) was counted.

Fig. S6. (A) The effect of a JAK kinase inhibitor on the phosphorylation of TIF1β in ES cells. ES D3 cells cultured in the presence of LIF were treated with the JAK kinase inhibitor for 48 h and the cell extracts were subjected to immunoblotting with TIF1β-P antibody. (B) The effect of the JAK kinase inhibitor on the maintenance of the pluripotency of TIF1β-expressing ES cells. Flag-TIF1β-SD- or TIF1β-SA–expressing ES cells were cultured in the absence of LIF for 5 d with or without the JAK kinase inhibitor, and immunostained with the Oct3/4 antibody.

Fig. S7. Interaction of TIF1β with Oct3/4, MSH2, and Smarcad1. (A)The internal domain of Oct3/4 interacts with TIF1β. HEK 293T cells transiently transfected with the deletion mutant of Oct3/4 and Flag-TIF1β S824D were used for the coimmunoprecipitation assay. The lysate was coimmunoprecipitated with Flag M2 antibody and immunoblotted with a mixture of Oct3/4 antibodies (Abcam ab19857 1/333, Santa Cruz sc-9081 1/1000). ΔN and ΔC indicate N-terminal and C- terminal deletion Oct3/4 mutants, respectively. The asterisk indicates a nonspecific band. (B) TIF1β forms a stable complex with Smarcad1 and MSH2. TIF1β was immunoprecipitated with Flag M2 antibody from mouse ES cells stably expressing TIF1β proteins or empty vector–transfected cells. The proteins were detected by immunoblotting with the indicated antibodies.

Seki et al. www.pnas.org/cgi/content/short/0907601107 6of9 Fig. S8. Specificity of TIF1β on the maintenance of pluripotency in ES cells. (A) Overexpression of TIF1β fragments does not show positive effect on the main- tenance of ES cell pluripotency. ES D3 cells stably expressing N-terminal or C-terminal half of TIF1β were cultured in the presence or absence of LIF for 1 week, and immunostained with Oct3/4 antibody. These stably expressing cells gradually change their morphology and tend to lose Oct3/4 expression even in the presence of LIF. Oct3/4 (red), DAPI (blue). (B) Overexpression of TIF1β cannot maintain the pluripotency of mouse ES cells in the absence of Oct3/4, Nanog, or Sox2. Mouse ES cells stably expressing Flag-TIF1β (S824D) or Flag-TIF1β (S824A) were infected with retrovirus for Oct3/4 shRNA, Nanog, shRNA or Sox2 shRNA, and the cells were selected in the presence of 400 μg/mL ofG418 and 0.5 ng/mL of puromycin. The cells were fixed with 3.7% formaldehyde/PBS solution for 5 min at room tem- perature and an alkaline phosphatase assay was performed as described in Methods in the main text. (C) TIF1β knockdown ES cells loses the pluripotency even in the culture with 3i medium. Mouse ES cells infected with retrovirus for TIF1β shRNA was cultured in the ES medium as described in Methods in the main text or 3i medium. TIF1β knockdown ES cells were selected with 0.4 mg/mL of G418. The cells were fixed with 3.7% formaldehyde/PBS solution for 5 min at room temperature and alkaline phosphatase assay was performed as described in Methods in the main text.

Seki et al. www.pnas.org/cgi/content/short/0907601107 7of9 Table S1. Oct3/4-responsive genes regulated by TIF1β in a phosphorylation-dependent manner >2.0 fold 1.5–2.0 fold

Gene name Ratio (SD/SA) Gene name Ratio (SD/SA)

Upp1/Upp 8.46 Zfml 1.93 Zfp42 6.57 Ube2o 1.92 Otx2 6.12 Elovl6 1.91 Jag1 5.32 Trh 1.85 Tmem131 5.09 D230012E17Rik 1.82 Ndufs4 4.74 Bmp7 1.82 Nanog 4.67 Ccnh 1.81 Ranbp17 4.41 Phip 1.81 Asb4 4.33 Igfbp3 1.80 Suz12 4.31 Adss 1.80 Sox2 4.28 Cnot10 1.79 Nfib 4.24 Pml 1.76 Arid5b 4.05 Tle4 1.74 Esrrb 4.03 B630005N14Rik 1.73 Runx1t1 4.00 Slc25a36 1.71 ptch1 3.91 1110059E24Rik 1.69 Rif1 3.69 Skil 1.69 Plekha5 3.65 Wapal 1.69 1700019D03Rik 3.60 Dcp1a 1.69 Pitpnc1 3.55 Lrba 1.68 prkcb1 3.54 Aebp2 1.68 Nmnat2 3.51 Zbtb10 1.65 LOC195531 3.45 Fblim1 1.60 Tdh 3.40 Ttc14 1.58 Top1 3.31 Rest 1.57 Socs2 3.29 Slc7a3 1.57 Inhbb 3.14 Tdgf1 1.57 4921513D23Rik 3.09 Brms1l 1.56 Trp53 3.06 C80913 1.54 Jarid2 3.05 2010204K13Rik 1.54 Fbxl17 3.03 Fbxo15 1.54 Enah 2.92 D930015E06Rik 1.52 Wdr44 2.89 Acot9 1.51 Tcfcp2l1 2.81 Pa2g4 1.51 Chd9 2.75 Gas8 0.65 4933426K21Rik 2.63 Ches1 0.65 Esco1 2.58 Snai1 0.62 Etv5 2.57 Igsf3 0.61 Phc1 2.55 Rai17 0.61 Jmjd1c 2.54 Arhgef18 0.58 Mtf2 2.48 Cdf/Ctnna2 0.56 Trim24 2.45 Klf6 0.56 X99384 2.43 Ldlr 0.56 Smarcad1 2.39 Kremen1 0.55 Rara 2.36 Sars 0.55 Tiam1 2.34 Fgfr1 0.54 Pcaf 2.27 Pdgfa 0.54 Dido1 2.26 Pdlim5 0.54 Spp1/Opn 2.25 Pdgfc 0.53 Oct3/4 2.23 Gata6 0.53 ppp2r5c 2.23 Hexb 0.52 Eif2c1 2.17 Gata4 0.52 Uhrf2 2.16 Akap2 0.52 Odz4 2.15 Bad 0.50 Msi2 2.14 Ppargc1a 2.13 Lifr 2.11 Mkrn1 2.09 D11Bwg0280e 2.07 Jmjd1a 2.06 Sgk 2.02

Seki et al. www.pnas.org/cgi/content/short/0907601107 8of9 Table S1. Cont. >2.0 fold 1.5–2.0 fold

Gene name Ratio (SD/SA) Gene name Ratio (SD/SA)

Dysf 0.48 Flt1 0.48 Iqgap1 0.47 Ldlrap1 0.45 BC022623 0.44 Hdgf 0.42 Afp 0.40 D10Ucla1 0.35 Ckb 0.32 3110004L20Rik 0.24 Cldn4 0.17 Ptges 0.13

Microarray analysis of TIF1β-SD- and TIF1β-SA-expressing ES cells cultured in the absence of LIF for 8 d was performed as described in Methods.

Seki et al. www.pnas.org/cgi/content/short/0907601107 9of9