QSAR and Its Role in Target-Ligand Interaction
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Pharmacophore Modeling and Applications in Drug Discovery
REVIEWS Drug Discovery Today Volume 15, Numbers 11/12 June 2010 Reviews Pharmacophore modeling and INFORMATICS applications in drug discovery: challenges and recent advances Sheng-Yong Yang State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, West China Medical School, Sichuan University, Chengdu, Sichuan 610041, China Pharmacophore approaches have become one of the major tools in drug discovery after the past century’s development. Various ligand-based and structure-based methods have been developed for improved pharmacophore modeling and have been successfully and extensively applied in virtual screening, de novo design and lead optimization. Despite these successes, pharmacophore approaches have not reached their expected full capacity, particularly in facing the demand for reducing the current expensive overall cost associated with drug discovery and development. Here, the challenges of pharmacophore modeling and applications in drug discovery are discussed and recent advances and latest developments are described, which provide useful clues to the further development and application of pharmacophore approaches. Introduction lead optimization and multitarget drug design (Fig. 1). A variety of The concept of pharmacophore was first introduced in 1909 by automated tools for pharmacophore modeling and applications Ehrlich [1], who defined the pharmacophore as ‘a molecular appeared constantly after the advances in computational chem- framework that carries (phoros) the essential features responsible istry in the past 20 years; these pharmacophore modeling tools, for a drug’s (pharmacon) biological activity’. After a century’s together with their inventor(s) and typical characteristics, are development, the basic pharmacophore concept still remains summarized in Supplementary Table S1. Many successful stories unchanged, but its intentional meaning and application range of pharmacophore approaches in facilitating drug discovery have have been expanded considerably. -
Ligand Based 3D-QSAR Pharmacophore, Molecular Docking and ADME to Identify Potential Broblast Growth Factor Receptor 1 Inhibitor
Ligand based 3D-QSAR pharmacophore, molecular docking and ADME to identify potential broblast growth factor receptor 1 inhibitors Zizhong Tang Sichuan Agricultural University Lu Huang Sichuan Agricultural University Xiaoli Fu Sichuan Agricultural University Haoxiang Wang Sichuan Agricultural University Biao Tang Sichuan Agricultural University Yirong Xiao Sichuan Agricultural University Hospital Caixia Zhou Sichuan Agricultural University Zhiqiao Zhao Sichuan Agricultural University Yujun Wan Sichuan food feimentation industry research and design institute Hui Chen ( [email protected] ) Sichuan Agricultural University Huipeng Yao Sichuan Agricultural University Zhi Shan Sichuan Agricultural University Tongliang Bu Sichuan Agricultural University Xulong Wu Chengdu Agricultural College Research Page 1/27 Keywords: FGFR1, Inhibitor, molecular docking, pharmacophore, ADME Posted Date: September 1st, 2020 DOI: https://doi.org/10.21203/rs.3.rs-64361/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 2/27 Abstract Background The FGF/FGFR system may affect tumor cells and stromal microenvironment through autocrine and paracrine stimulation, thereby signicantly promoting oncogene transformation and tumor growth. Abnormal expression of FGFR1 in cells is considered to be the main cause of tumorigenesis and a potential target for the treatment of cancer. Methods The known inhibitors were collected to construct 3D-QSAR pharmacophore model, which was veried by cost analysis, test set validation and Fischer test. Virtual screening of zinc database based on pharmacophore was carried out. FGFR1 crystal complex was downloaded from the protein database to dock with the compound. Finally, the absorption, distribution, metabolism and excretion (ADME) characteristics and toxicity of a series of potential inhibitors were studied. -
Semantic Web Integration of Cheminformatics Resources with the SADI Framework Leonid L Chepelev1* and Michel Dumontier1,2,3
Chepelev and Dumontier Journal of Cheminformatics 2011, 3:16 http://www.jcheminf.com/content/3/1/16 METHODOLOGY Open Access Semantic Web integration of Cheminformatics resources with the SADI framework Leonid L Chepelev1* and Michel Dumontier1,2,3 Abstract Background: The diversity and the largely independent nature of chemical research efforts over the past half century are, most likely, the major contributors to the current poor state of chemical computational resource and database interoperability. While open software for chemical format interconversion and database entry cross-linking have partially addressed database interoperability, computational resource integration is hindered by the great diversity of software interfaces, languages, access methods, and platforms, among others. This has, in turn, translated into limited reproducibility of computational experiments and the need for application-specific computational workflow construction and semi-automated enactment by human experts, especially where emerging interdisciplinary fields, such as systems chemistry, are pursued. Fortunately, the advent of the Semantic Web, and the very recent introduction of RESTful Semantic Web Services (SWS) may present an opportunity to integrate all of the existing computational and database resources in chemistry into a machine-understandable, unified system that draws on the entirety of the Semantic Web. Results: We have created a prototype framework of Semantic Automated Discovery and Integration (SADI) framework SWS that exposes the QSAR descriptor functionality of the Chemistry Development Kit. Since each of these services has formal ontology-defined input and output classes, and each service consumes and produces RDF graphs, clients can automatically reason about the services and available reference information necessary to complete a given overall computational task specified through a simple SPARQL query. -
Natural Products As Leads to Potential Drugs: an Old Process Or the New Hope for Drug Discovery?
J. Med. Chem. 2008, 51, 2589–2599 2589 Natural Products as Leads to Potential Drugs: An Old Process or the New Hope for Drug Discovery? David J. Newman† Natural Products Branch, DeVelopmental Therapeutics Program, DCTD, National Cancer InstitutesFrederick, P.O. Box B, Frederick, Maryland 21702 ReceiVed April 5, 2007 I. Introduction From approximately the early 1980s, the “influence of natural products” upon drug discovery in all therapeutic areas apparently has been on the wane because of the advent of combinatorial chemistry technology and the “associated expectation” that these techniques would be the future source of massive numbers of novel skeletons and drug leads/new chemical entities (NCEa) where the intellectual property aspects would be very simple. As a result, natural product work in the pharmaceutical industry, except for less than a handful of large pharmaceutical compa- nies, effectively ceased from the end of the 1980s. Figure 1. Source of small molecule drugs, 1981–2006: major What has now transpired (cf. evidence shown in Newman categories, N ) 983 (in percentages). Codes are as in ref 1. Major and Cragg, 20071 and Figures 1 and 2 below showing the categories are as follows: “N”, natural product; “ND”, derived from a natural product and usually a semisynthetic modification; “S”, totally continued influence of natural products as leads to or sources synthetic drug often found by random screening/modification of an of drugs over the past 26 years (1981–2006)) is that, to date, existing agent; “S*”, made by total synthesis, but the pharmacophore there has only been one de novo combinatorial NCE approved is/was from a natural product. -
Downloading Only Compounds with the Properties “Drug-Like”, “Purchasable”
bioRxiv preprint doi: https://doi.org/10.1101/2021.03.02.433618; this version posted June 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A Pharmacophore Model for SARS-CoV-2 3CLpro Small Molecule Inhibitors and in Vitro Experimental Validation of Computationally Screened Inhibitors Enrico Glaab*†1, Ganesh Babu Manoharan2, Daniel Abankwa*2 1Luxembourg Centre for Systems Biomedicine (LCSB), University of Luxembourg, 7 avenue des Hauts Fourneaux, L-4362 Esch-sur-Alzette, Luxembourg 2Department of Life Sciences and Medicine, University of Luxembourg, 7 avenue des Hauts Fourneaux, L-4362 Esch-sur-Alzette, Luxembourg *EG and DA are joint senior autHors †Contact: [email protected] Abstract Among the biomedical efforts in response to the current coronavirus (COVID-19) pandemic, pharmacological strategies to reduce viral load in patients with severe forms of the disease are being studied intensively. One of the main drug target proteins proposed so far is the SARS- CoV-2 viral protease 3CLpro (also called Mpro), an essential component for viral replication. Ongoing ligand- and receptor-based computational screening efforts would be facilitated by an improved understanding of the electrostatic, hydrophobic and steric features that characterize small molecule inhibitors binding stably to 3CLpro, as well as by an extended collection of known binders. Here, we present combined virtual screening, molecular dynamics simulation, machine learning and in vitro experimental validation analyses which have led to the identification of small molecule inhibitors of 3CLpro with micromolar activity, and to a pharmacophore model that describes functional chemical groups associated with the molecular recognition of ligands by the 3CLpro binding pocket. -
Structure Based Pharmacophore Modeling, Virtual Screening
www.nature.com/scientificreports OPEN Structure based pharmacophore modeling, virtual screening, molecular docking and ADMET approaches for identifcation of natural anti‑cancer agents targeting XIAP protein Firoz A. Dain Md Opo1,2, Mohammed M. Rahman3*, Foysal Ahammad4, Istiak Ahmed5, Mohiuddin Ahmed Bhuiyan2 & Abdullah M. Asiri3 X‑linked inhibitor of apoptosis protein (XIAP) is a member of inhibitor of apoptosis protein (IAP) family responsible for neutralizing the caspases‑3, caspases‑7, and caspases‑9. Overexpression of the protein decreased the apoptosis process in the cell and resulting development of cancer. Diferent types of XIAP antagonists are generally used to repair the defective apoptosis process that can eliminate carcinoma from living bodies. The chemically synthesis compounds discovered till now as XIAP inhibitors exhibiting side efects, which is making difculties during the treatment of chemotherapy. So, the study has design to identifying new natural compounds that are able to induce apoptosis by freeing up caspases and will be low toxic. To identify natural compound, a structure‑ based pharmacophore model to the protein active site cavity was generated following by virtual screening, molecular docking and molecular dynamics (MD) simulation. Initially, seven hit compounds were retrieved and based on molecular docking approach four compounds has chosen for further evaluation. To confrm stability of the selected drug candidate to the target protein the MD simulation approach were employed, which confrmed stability of the three compounds. Based on the fnding, three newly obtained compounds namely Caucasicoside A (ZINC77257307), Polygalaxanthone III (ZINC247950187), and MCULE‑9896837409 (ZINC107434573) may serve as lead compounds to fght against the treatment of XIAP related cancer, although further evaluation through wet lab is necessary to measure the efcacy of the compounds. -
Joelib Tutorial
JOELib Tutorial A Java based cheminformatics/computational chemistry package Dipl. Chem. Jörg K. Wegner JOELib Tutorial: A Java based cheminformatics/computational chemistry package by Dipl. Chem. Jörg K. Wegner Published $Date: 2004/03/16 09:16:14 $ Copyright © 2002, 2003, 2004 Dept. Computer Architecture, University of Tübingen, GermanyJörg K. Wegner Updated $Date: 2004/03/16 09:16:14 $ License This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation version 2 of the License. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. Documents PS (JOELibTutorial.ps), PDF (JOELibTutorial.pdf), RTF (JOELibTutorial.rtf) versions of this tutorial are available. Plucker E-Book (http://www.plkr.org) versions: HiRes-color (JOELib-HiRes-color.pdb), HiRes-grayscale (JOELib-HiRes-grayscale.pdb) (recommended), HiRes-black/white (JOELib-HiRes-bw.pdb), color (JOELib-color.pdb), grayscale (JOELib-grayscale.pdb), black/white (JOELib-bw.pdb) Revision History Revision $Revision: 1.5 $ $Date: 2004/03/16 09:16:14 $ $Id: JOELibTutorial.sgml,v 1.5 2004/03/16 09:16:14 wegner Exp $ Table of Contents Preface ........................................................................................................................................................i 1. Installing JOELib -
Cheminformatics and Chemical Information
Cheminformatics and Chemical Information Matt Sundling Advisor: Prof. Curt Breneman Department of Chemistry and Chemical Biology/Center for Biotechnology and Interdisciplinary Studies Rensselaer Polytechnic Institute Rensselaer Exploratory Center for Cheminformatics Research http://reccr.chem.rpi.edu/ Many thanks to Theresa Hepburn! Upcoming lecture plug: Prof. Curt Breneman DSES Department November 15th Advances in Cheminformatics: Applications in Biotechnology, Drug Design and Bioseparations Cheminformatics is about collecting, storing, and analyzing [usually large amounts of] chemical data. •Pharmaceutical research •Materials design •Computational/Automated techniques for analysis •Virtual high-throughput screening (VHTS) QSAR - quantitative structure-activity relationship Molecular Model Activity Structures O N N Cl AAACCTCATAGGAAGCA TACCAGGAATTACATCA … Molecular Model Activity Structures O N N Cl AAACCTCATAGGAAGCATACCA GGAATTACATCA… Structural Descriptors Physiochemical Descriptors Topological Descriptors Geometrical Descriptors Molecular Descriptors Model Activity Structures Acitivty: bioactivity, ADME/Tox evaluation, hERG channel effects, p-456 isozyme inhibition, anti- malarial efficacy, etc… Structural Descriptors Physiochemical Descriptors Topological Descriptors Molecule D1 D2 … Activity (IC50) molecule #1 21 0.1 Geometrical Descriptors = molecule #2 33 2.1 molecule #3 10 0.9 + … Activity Molecular Descriptors Model Activity Structures Goal: Minimize the error: ∑((yi −f xi)) f1(x) f2(x) Regression Models: linear, multi-linear, -
Committee on Publications and Cheminformatics Data Standards (CPCDS)
Committee on Publications and Cheminformatics Data Standards (CPCDS) Report to the Bureau, April 2020 Leah McEwen, Committee Chair I. Executive Summary The IUPAC Committee on Publications and Cheminformatics Data Standards (CPCDS) advises on issues related to dissemination of information, primarily of IUPAC outputs. The portfolio is expanding and diversifying, in types of content, modes of publication and potential readership. Publication of IUPAC recommendations, technical reports and other information resources remains at the core of IUPAC dissemination activity and that of CPCDS. Increasingly the committee also focuses on the development and dissemination of chemical data and information standards to facilitate robust communication in the digital environment. Further details on these two priority areas are provided in Appendix A (Subcommittee on Publications: Report to CPCDS) and Appendix B (CPCDS Chair’s Statement: Towards a “Digital IUPAC”). The 2018-2019 biennium brought stability to key systems and workflows including those supporting IUPAC’s flagship journal Pure and Applied Chemistry (PAC) and online access to the Compendium of Chemical Terminology (a.k.a., the “Gold Book”). A number of collaborative symposia and workshops with strategic partners including CODATA and the GO FAIR Chemistry Implementation Network (ChIN) surfaced use cases and infrastructure needs for digital science among diverse community stakeholders. These activities lay the groundwork for developing a robust and systematic program for Digital IUPAC and “the creation of a consistent and interoperable global framework for human and machine-readable chemical information,” as articulated in the CPCDS Terms of Reference. This vision will be a critical component of success for IUPAC’s contribution towards the United Nations Sustainable Development Goals. -
A Fully Integrated Pharmacophore Modeling and Structure Optimization Toolkit D Vlachakis, P Fakourelis, V Megalooikonomou, C Makris, S Kossida
DrugOn: a fully integrated pharmacophore modeling and structure optimization toolkit D Vlachakis, P Fakourelis, V Megalooikonomou, C Makris, S Kossida To cite this version: D Vlachakis, P Fakourelis, V Megalooikonomou, C Makris, S Kossida. DrugOn: a fully inte- grated pharmacophore modeling and structure optimization toolkit. PeerJ, PeerJ, 2015, 3, pp.e725. 10.7717/peerj.725. hal-01163636 HAL Id: hal-01163636 https://hal.archives-ouvertes.fr/hal-01163636 Submitted on 8 Jun 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License DrugOn: a fully integrated pharmacophore modeling and structure optimization toolkit Dimitrios Vlachakis1,2,4 , Paraskevas Fakourelis1,2,4 , Vasileios Megalooikonomou2, Christos Makris2 and Sophia Kossida1,3 1 Bioinformatics & Medical Informatics Team, Biomedical Research Foundation, Academy of Athens, Athens, Greece 2 Computer Engineering and Informatics Department, University of Patras, Patras, Greece 3 IMGT, Laboratoire d’ImmunoGen´ etique´ Moleculaire,´ Institut de Gen´ etique´ Humaine, Montpellier, France 4 These authors contributed equally to this work. ABSTRACT During the past few years, pharmacophore modeling has become one of the key com- ponents in computer-aided drug design and in modern drug discovery. -
Scalable Analysis of Large Datasets in Life Sciences
Scalable Analysis of Large Datasets in Life Sciences LAEEQ AHMED Doctoral Thesis in Computer Science Stockholm, Sweden 2019 Division of Computational Science and Technology School of Electrical Engineerning and Computer Science KTH Royal Institute of Technology TRITA-EECS-AVL-2019:69 SE-100 44 Stockholm ISBN: 978-91-7873-309-5 SWEDEN Akademisk avhandling som med tillstånd av Kungl Tekniska högskolan framlägges till offentlig granskning för avläggande av teknologie doktorsexamen i elektrotek- nik och datavetenskap tisdag den 3:e Dec 2019, klockan 10.00 i sal Kollegiesalen, Brinellvägen 8, KTH-huset, Kungliga Tekniska Högskolan. © Laeeq Ahmed, 2019 Tryck: Universitetsservice US AB To my respected parents, my beloved wife and my lovely brother and sister Abstract We are experiencing a deluge of data in all fields of scientific and business research, particularly in the life sciences, due to the development of better instrumentation and the rapid advancements that have occurred in informa- tion technology in recent times. There are major challenges when it comes to handling such large amounts of data. These range from the practicalities of managing these large volumes of data, to understanding the meaning and practical implications of the data. In this thesis, I present parallel methods to efficiently manage, process, analyse and visualize large sets of data from several life sciences fields at a rapid rate, while building and utilizing various machine learning techniques in a novel way. Most of the work is centred on applying the latest Big Data Analytics frameworks for creating efficient virtual screening strategies while working with large datasets. Virtual screening is a method in cheminformatics used for Drug discovery by searching large libraries of molecule structures. -
Cheminformatics for Genome-Scale Metabolic Reconstructions
CHEMINFORMATICS FOR GENOME-SCALE METABOLIC RECONSTRUCTIONS John W. May European Molecular Biology Laboratory European Bioinformatics Institute University of Cambridge Homerton College A thesis submitted for the degree of Doctor of Philosophy June 2014 Declaration This thesis is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. This dissertation has been typeset using LATEX in 11 pt Palatino, one and half spaced, according to the specifications defined by the Board of Graduate Studies and the Biology Degree Committee. June 2014 John W. May to Róisín Acknowledgements This work was carried out in the Cheminformatics and Metabolism Group at the European Bioinformatics Institute (EMBL-EBI). The project was fund- ed by Unilever, the Biotechnology and Biological Sciences Research Coun- cil [BB/I532153/1], and the European Molecular Biology Laboratory. I would like to thank my supervisor, Christoph Steinbeck for his guidance and providing intellectual freedom. I am also thankful to each member of my thesis advisory committee: Gordon James, Julio Saez-Rodriguez, Kiran Patil, and Gos Micklem who gave their time, advice, and guidance. I am thankful to all members of the Cheminformatics and Metabolism Group.