Generation and Characterization of Mafa-Kusabira Orange Mice

Endocrine Journal 2015, 62 (1), 37-51

Original Generation and characterization of MafA-Kusabira Orange mice

Wataru Nishimura1), Hisashi Oishi2), Nobuaki Funahashi1), Toshiyoshi Fujiwara3), Satoru Takahashi2) and Kazuki Yasuda1)

1) Department of Metabolic Disorders, Diabetes Research Center, Research Institute, National Center for Global Health and Medicine, Tokyo 162-8655, Japan 2) Department of Anatomy and Embryology, Faculty of Medicine, University of Tsukuba, Tsukuba 305-8575, Japan 3) Department of Gastroenterological Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama 700-8558, Japan

Abstract. MafA and MafB are basic leucine zipper transcription factors expressed in mature pancreatic β- and α-cells, respectively. MafA is not only an insulin gene transcription factor but is also critical for the maturation and maintenance of β-cell function, whereas MafB is expressed in immature β-cells during development and in compromised β-cells in diabetes. In this study, we developed a mouse model to easily trace the promoter activity of MafA in β-cells as a tool for studying β-cell differentiation, maturation, regeneration and function using the expression of the fluorescent protein Kusabira Orange (KOr) driven by the BAC-mafA promoter. The expression of KOr was highly restricted to β-cells in the transgenic pancreas. By crossing MafA-KOr mice with MafBGFP/+ reporter mice, simultaneous monitoring of MafA and MafB expressions in the isolated islets was successfully performed. This system can be a useful tool for examining dynamic changes in the differentiation and function of pancreatic islets by visualizing the expressions of MafA and MafB.

Key words: MafA, MafB, Kusabira Orange, Reporter, β-cells

IMAGING the dynamics of particular cell types Mature and functional populations of β-cells are marked by cell-type- or stage-specific gene expression marked by v-maf musculoaponeurotic fibrosarcoma in vivo allows us to analyze the associated temporal oncogene family, protein A (MafA), an insulin gene and spatial changes. Dynamic imaging of pancreatic transcription factor [10]. The expression of MafA is β-cells contributes to a better understanding of diabetes reduced in immature or compromised β-cells [11], pathology and developmental biology [1]. Previously, often accompanied by an increase in the expression of the visualization of murine β-cells was based on posi- MafB, another large Maf factor usually expressed in tron emission tomography [2], luciferase activity [3, 4] adult α-cells [10, 12, 13]. In the present study, we gen- and fluorescent proteins [5]. The mouse insulin 1 pro- erated and characterized transgenic mice expressing the moter-green fluorescent protein transgenic (MIP-GFP) fluorescent protein Kusabira Orange (KOr) [14] driven mouse strain is one of the most widely used tools for by the bacterial artificial chromosome (BAC)-mafA investigating various aspects of β-cell biology, includ- promoter to precisely mimic the endogenous expres- ing embryonic development [6] and stem cell differ- sion of MafA. These mice were subsequently crossed entiation [7-9]. However, it is difficult to visualize in with the reporter mice of MafB [10], which enabled us detail the maturation and dysfunction of β-cells using to investigate mature and compromised populations of currently available tools. β-cells by imaging the expressions of MafA and MafB Submitted Jun. 25, 2014; Accepted Sep. 11, 2014 as EJ14-0296 in this fluorescence-based system. Released online in J-STAGE as advance publication Oct. 1, 2014 Correspondence to: Wataru Nishimura and Kazuki Yasuda, Materials and Methods Department of Metabolic Disorders, Diabetes Research Center, Research Institute, National Center for Global Health and Medicine,1-21-1 Toyama, Shinjuku-ku, Tokyo 162-8655, Japan. Mice E-mail: [email protected] and [email protected] The Animal Care and Use Committee of the National ©The Japan Endocrine Society 38 Nishimura et al.

Center for Global Health and Medicine approved all of after the overnight incubation and were cultured with the animal experiments. MafBGFP/+ mice, in which 2.5 mM glucose for 8 hours, followed by culturing the coding sequence of mafB was replaced with green with 5 mM or 10 mM glucose. The cultured islets were fluorescent protein (GFP) [15], were maintained in observed at the indicated time period. For observa- a C57BL/6J background. MIP-GFP mice [5] (JAX tion by confocal microscopy, the islets were placed in 006864) were maintained in a C57BL/6J background. poly-L-lysine-coated glass bottom dishes with Krebs- The fluorescent protein Kusabira-Orange (KOr) gene Ringer solution. [14] was inserted into the chromosomal mafA locus of the BAC clone RP23-94I16 to generate MafA-KOr Quantitative and conventional RT-PCR analyses of reporter mice using a Red/ET recombination system isolated islets and various organs (Gene Bridges, Heidelberg, Germany). The trans- Total RNA was extracted from MafA-KOr islets genic vector was linearized and microinjected into the or from various organs dissected from the MafA-KOr pronuclei of fertilized C57BL/6J eggs using standard mice and wild-type littermates using the QIAshredder procedures. A total of four lines, D, F, G and H, were and RNeasy Micro Kit (Qiagen, Valencia, CA, USA) established. The genotyping of the mice described according to the manufacturer’s instructions, includ- above with the primers listed in Supplemental Table ing DNase treatment. The concentration of purified 1 was performed using NaOH extraction methods [4]. RNA was measured using the NanoDrop ND 1000 To generate diabetic mice, a low dose (50 mg/kg body Spectrophotometer (Thermo Scientific, Rockford, IL, weight) of streptozotocin (STZ) (Sigma, St. Louis, USA). Reverse transcription of purified RNA was MO, USA) was intraperitoneally injected for five con- performed using the High Capacity cDNA Reverse secutive days. Twenty days after the injection, mice Transcription Kit (Applied Biosystems, Foster City, with blood glucose over 200 mg/dl were analyzed as CA, USA). Quantitative PCR amplification was mice with diabetes. Male mice or islets from male performed using TaqMan Fast Advanced Master mice were analyzed in this study. Mix (Applied Biosystems), with the probes listed in Blood glucose values were measured in blood from Supplemental Table 2, and was analyzed using an ABI tail snips using a Glutest Ace-R and a Glutest Sensor Prism 7900 (Applied Biosystems). mRNA was quan- (Sanwa Kagaku Kenkyusho, Aichi, Japan). To per- tified by normalization to β-actin expression using form glucose tolerance testing, 2 g/kg body weight the 2-ΔΔCt method, and the data were presented as the glucose was intraperitoneally injected after food depri- mean ± S.E.M. values. Statistical significance of -ΔCt2 vation for 14 to 16 hours. Plasma samples were col- values was determined using a two-tailed unpaired lected by centrifugation and were assayed for insulin Student’s t-test. Conventional PCR amplification was using ELISA (Shibayagi, Gunma, Japan). The meta- performed using MafA-KOr primer (Supplemental bolic data were presented as the mean ± S.E.M. val- Table 1) and analyzed using MultiNA (Shimadzu, ues, and statistical significance was determined using Kyoto, Japan). a two-tailed unpaired Student’s t-test. Immunofluorescence Isolation, culture and observation of pancreatic islets Immunostaining analyses were performed in paraf- The islets were isolated from MafA-KOr mice, fin-embedded sections as previously described [10]. MafA-KOr;MafBGFP/+ mice, MIP-GFP mice or wild- The primary antibodies used in this study are listed type mice using collagenase digestion as previously in Supplemental Table 3. For amplification, bioti- described [4]. After isolation, the islets were hand- nylated anti-mouse or anti-rabbit antibodies (Jackson picked and cultured overnight in RPMI-1640 (Sigma, ImmunoResearch, West Grove, PA, USA) were used St. Louis, MO, USA), supplemented with 11.1 mM at 1:400 dilution, followed by incubation with strep- glucose, 10% FBS, 1 mM sodium pyruvate, 10 mM tavidin-conjugated Texas Red or Alexa Fluor 488 Hepes, 100 U/ml penicillin and 100 mg/ml streptomy- (1:400) (Life Technologies). The secondary antibod- cin (Life Technologies, Carlsbad, CA, USA). Islets ies were AMCA-, FITC- or DyLight 594-conjugated of similar size were subsequently handpicked and anti-guinea pig IgG, DyLight 594-conjugated anti- observed using fluorescent microscopy. For the time- mouse IgG or Texas Red-conjugated anti-rabbit IgG course observation, MafA-KOr islets were washed (Jackson ImmunoResearch). DAPI mounting medium MafA-Kusabira Orange mice 39

(Vector, Burlingame, CA, USA) was used to label the nuclei. Immunofluorescent images were obtained using an Olympus FV-1000 (Olympus, Tokyo, Japan) in confocal mode, and the acquired images were identically processed using Adobe Photoshop CS5.1.

Observation of fluorescence or immunofluorescence on frozen sections of pancreas Frozen sections of transgenic or wild-type pancreas were immunostained for MafA with biotinylated anti- rabbit antibody (Jackson ImmunoResearch) and strep- tavidin-conjugated Alexa Fluor 488 (Life Technologies) for amplification as previously described [4]. DAPI mounting medium (Vector, Burlingame, CA, USA) was used to label the nuclei. The images of fluorescence of KOr and immunofluorescence of MafA were obtained using an Olympus FV-1000 (Olympus) in confocal mode and identically processed using Adobe Photoshop CS5.1.

Explant culture of embryonic pancreas The day of vaginal-plug discovery was designated as E (embryonic day) 0.5. Embryonic pancreases at E12.5 were excised and kept on ice-cold PBS, followed by the explant culture with phenol-red free Fig. 1 Generation of MafA-KOr mice Matrigel (BD Bioscience, Franklin Lakes, NJ, USA). (A) BAC clone RP23-94I16 containing the mafA gene On day 5, fluorescence of embryonic pancreas was in the vector pBACe3.6, together with the targeting observed every 20 minutes using confocal microscopy cassette composed of Kusabira Orange (KOr) with 5’ and 3’ homology arms; (B) the modified BAC clone after FV-1200 with FV12-HSD system equipped with CO2 incubator (Olympus), and the 3D data obtained were recombination of the mafA gene with KOr and PGK-gb2 neo in Escherichia coli; (C) transgene after removal of processed using FV10-ASW software (Olympus) and the PGK-gb2 neo cassette for microinjection; and (D) the AlphaBlend method. results of genotyping showing 215 bp products in the transgenic genome encoding Kusabira-Orange. Results

Generation of MafA-Kusabira Orange mice various organs was analyzed using quantitative and To visualize the expression of MafA, the 217 kb conventional RT-PCR. The expression of KOr in pan- mouse BAC clone RP23-94I16 containing mafA gene creatic islets was significantly higher than that in the was utilized. The fluorescent protein Kusabira Orange pancreas without islets, stomach, duodenum, liver, (KOr) gene was inserted at the mafA locus, and trans- colon and kidney (p<0.05, respectively), suggesting genic mice carrying BAC-MafA-Kusabira Orange were that KOr in MafA-KOr mice was exclusively expressed generated (Fig. 1A-C). Nine founders were identified in the pancreatic islets, similar to the expression pattern using PCR amplification (Fig. 1D), and four indepen- of MafA (Fig. 2). Fluorescent microscopy revealed dent transgenic lines, D, F, G and H, were established the clusters of cells expressing orange fluorescence in by genotyping. These MafA-KOr transgenic animals the transgenic pancreas but not in wild-type pancreas were born at the expected frequency, survived through (Fig. 3A and B, Supplemental Fig. 1A-C), which are adulthood and were outwardly indistinguishable from similar to the clusters of cells expressing green fluo- the control littermates. To examine the expression of rescence in the MIP-GFP pancreases (Supplemental KOr in the transgenic mice, the mRNA expression in Fig. 2A and B). Immunofluorescent analysis of the 40 Nishimura et al.

Fig. 2 Expression of KOr in various organs of MafA-KOr mice mRNA was extracted from various tissues isolated from the MafA-KOr and wild-type mice. The quantitative PCR analyses revealed that Kusabira Orange in the MafA-KOr mice was exclusively expressed in pancreatic islets. The results of the conventional PCR analyses from three transgenic mice are similarly shown. n=3 for MafA-KOr and wild-type mice. The mean ± S.E.M. values are shown.

MafA-KOr and wild-type pancreases revealed that all lated insulin secretion were not significantly differ- of the mice lines exhibited β-cell specific expression ent between MafA-KOr mice and wild-type mice (Fig. of KOr (Fig. 3C, Supplemental Fig. 1D-F) except the 4E, F). wild-type pancreas (Fig. 3D, Supplemental Fig. 1G). The expression of KOr was not observed in α-cells, Real-time monitoring of MafA expression in embry- δ-cells or PP-cells (Fig. 3E, F). In this study, only one onic pancreas line (line D) was analyzed. The fluorescence of KOr The maturation of β-cells is accompanied by the in the frozen section of MafA-KOr pancreases also expression of MafA [10]. Time-lapse confocal obser- revealed colocalization of MafA immunofluorescence. vation of the MafA-KOr embryonic pancreas in the The quantification of these results revealed that 95.7% explant culture clearly revealed the expression of KOr of MafA-expressing cells (n=443) exhibited KOr flu- (Fig. 5A and B). New KOr+ cells were produced dur- orescence, suggesting successful induction of KOr ing the observation (Fig. 5C-F). The dynamic expres- expression driven by the BAC-mafA promoter (Fig. 3G sion of KOr in the embryonic pancreas revealed that and H). the majority of the cells expressing KOr did not Body weights as well as fed and fasting blood glu- migrate (Fig. 5C-F). This system may be useful for cose levels were not significantly different between examining whether MafA is expressed after the migra- MafA-KOr mice and their wild-type littermates at 8 tion of insulin-expressing cells and whether the matu- weeks of age (Fig. 4A-D). At 14 weeks of age, the ration of β-cells requires the formation of islets. fasting blood glucose level of MafA-KOr mice was significantly higher than that of wild-type mice (Fig. Visualization of MafA and MafB in the isolated islets 4E), although glucose tolerance and glucose-stimu- To examine the dynamic changes in MafA expres- MafA-Kusabira Orange mice 41

Fig. 3 Expression of MafA-KOr in the transgenic pancreas (A, B) Fluorescent microscopy of pancreas dissected from MafA-KOr line D and wild-type mice, showing the clusters of cells with KOr fluorescence in the MafA-KOr (A) but not in the wild-type pancreas (B). Each picture is derived from the pancreas of different mice. n=3. Bar, 500 µm. (C, D) The islets in the pancreatic paraffin sections of MafA-KOr mice line D (C) and wild-type (D) stained for KOr (green), insulin (red) and DAPI (blue). KOr driven by the BAC-mafA promoter is colocalized with insulin. n=7 for MafA-KOr and wild-type mice. Bar, 20 µm. (E, F) MafA-KOr (E) and wild-type (F) islets of the pancreatic paraffin sections stained with anti-KOr antibody (green), a cocktail of anti-glucagon, anti-somatostatin and anti-pancreatic polypeptide antibodies (red) and DAPI (blue). n=3 for MafA-KOr and wild-type mice. Bar, 20 µm. (G, H) MafA-KOr islets in the frozen sections of pancreas stained for MafA (green), which revealed fluorescence of KOr (orange) and immunofluorescence of MafA (green). n=3. Bar, 20 µm. 42 Nishimura et al.

Fig. 4 Metabolic parameters of MafA-KOr mice (A-D) Body weight (A), fed blood glucose (B), fasting blood glucose (C) and intraperitoneal glucose tolerance testing (D) of MafA-KOr and wild-type mice at 8 weeks of age, which were not significantly different (n=5 for MafA-KOr; n=6 for wild- type). (E, F) Blood glucose (E) and plasma insulin (F) of MafA-KOr and wild-type mice at 14 weeks of age before and after the intraperitoneal glucose injection (n=5 for MafA-KOr mice, n=3 for wild-type mice). The MafA-KOr mice were not diabetic or glucose-intolerant. The mean ± S.E.M. values are shown and the asterisks represent p<0.05. MafA-Kusabira Orange mice 43

Fig. 5 Visualization of β-cell maturation in explant culture of embryonic pancreas (A, B) Time-lapse confocal observation of MafA-KOr embryonic pancreas, excised at E12.5 and in explant cultured for 5 days. After 23 hours, KOr+ cells increased. (C-F) Still images from the movie demonstrating dynamic expression of KOr in the embryonic pancreas. The arrows indicate cells converting from KOr- to KOr+. n=3. The images were taken every 20 minutes, and total elapsed time is shown as hours:minutes. Bar, 50 µm. sion, the islets were isolated from the MafA-KOr pan- The immunofluorescence of MafA-KOr;MafBGFP/+ creas. Fluorescent microscopy revealed KOr expres- pancreas revealed mutually exclusive expressions of sion in the MafA-KOr islets but not in the wild-type KOr and GFP, driven by the promoter of mafA and islets (Supplemental Fig. 3A-D). The observation of mafB, respectively (Fig. 6E-G). Triple staining of KOr the MafA-KOr islets in a time-course manner demon- and GFP with insulin or glucagon revealed coexpres- strated the stable fluorescence of KOr for one week sions of KOr with insulin and of GFP with glucagon in culture, although several islets showed a down-reg- (Fig. 6H-O). The observation of MafA-KOr;MafBGFP/+ ulated expression of KOr in the center of the islets, islets directly using confocal microscopy revealed flu- which was likely caused by central necrosis due to orescence of KOr and GFP at a single cell level and hypoxia or dedifferentiation of β-cells (Supplemental showed rare KOr+GFP+ cells (Fig. 7A-F). Although Fig. 3E and F) [16, 17]. Meanwhile, the down-reg- the observation by bright field and dithizone stain- ulation of KOr expression using immunofluores- ing showed normal findings of the islets isolated from cence (Supplemental Fig. 4) and KOr fluorescence MafA-KOr;MafBGFP/+ mice (Fig. 7G, H), fluorescent (Supplemental Fig. 5) was observed in the entire islets microscopy revealed very few islets that had decreased in the pancreases of aged and diabetic model mice. In expression of KOr three days after the islet isolation. adult mice pancreas, MafA is localized in the β-cells, These islets reciprocally expressed GFP driven by the whereas MafB is expressed in the α-cells [10, 18, 19]. endogenous mafB promoter (Fig. 7I-K, arrows). Both For real-time imaging of MafA and MafB expres- of these KOr+GFP- and KOr-GFP+ islets were dithi- sions in the same islets, MafA-KOr;MafBGFP/+ double zone-positive (Fig. 7H). The fluorescence of KOr and reporter mice were generated by crossing MafA-KOr GFP in these GFP-dominant islets detected using con- mice with MafBGFP/+ mice [14]. Fluorescent micros- focal microscopy was still mutually exclusive three copy revealed the expressions of KOr and GFP in the days after isolation (Fig. 7L-N). These results sug- center and peripheral areas of the islets, respectively, gested a likely usefulness of this reporter system in which was consistent with the endogenous localization studying the dynamic expressions of MafA and MafB of MafA and MafB in β-cells and α-cells (Fig. 6A-D). and, thus, the maturation and function of β-cells that 44 Nishimura et al.

Fig. 6 Characterization of the islets isolated from MafA-KOr;MafB GFP/+ double-reporter mice (A, C) Fluorescent microscopy of the islets isolated from MafA-KOr;MafBGFP/+ and wild-type mice revealed KOr (orange) and GFP (green) fluorescence in the center and peripheral areas of islets, respectively, which was consistent with the endogenous localization of MafA in β-cells and MafB in α-cells. (B, D) Bright field images of the islets shown in (A) and (C). n=3. (E- G) Immunofluorescence of KOr (green), GFP (red) and DAPI (blue) in the paraffin section of MafA-KOr;MafBGFP/+ pancreas. n=2. Bar, 20 µm. (H-O) Immunofluorescence of KOr (H, I, L, M; green), GFP (H, K, L, O; red) and insulin (H, J; blue) or glucagon (L, N; blue) in the paraffin sections of MafA-KOr;MafBGFP/+ pancreas. n=2. Bar, 20 µm. MafA-Kusabira Orange mice 45

Fig. 7 Real-time monitoring of MafA and MafB expressions in the islets using MafA-KOr;MafBGFP/+ double-reporter mice (A-F) Fluorescence of KOr (red) or GFP (green) in the isolated islets of wild-type (A) or MafA-KOr;MafBGFP/+ (B-F) observed using confocal microscopy. The arrows indicate rare KOr+GFP+ cells. (G-K) Fluorescent microscopy of the MafA- KOr;MafBGFP/+ islets (G, I-K) followed by dithizone staining (H). The arrows indicate the islets with decreased fluorescence of KOr and increased fluorescence of GFP. n=3. (L-N) Fluorescence of KOr (red) or GFP (green) in the MafA-KOr;MafBGFP/+ islets cultured for 3 days. The number of GFP+ cells increased. 46 Nishimura et al. cannot be recognized using other methods. expression of KOr and increased expression of GFP (Fig. 7I-K). Discussion Finally, this system will be suitable for screening small molecules that can activate the MafA promoter. In this study, we generated and characterized MafA It may also be interesting to screen for chemicals that reporter mice, MafA-KOr. MafA is a basic leucine induce KOr expression in primary cultured hepato- zipper transcription factor that regulates the expres- cytes or fibroblasts. Additionally, using Pdx1-reporter sion of insulin in β-cells [17, 20-22]. MafA is also mice that we generated earlier [4], it may be possible a marker for mature β-cells. The fluorescent protein to screen for chemicals that activate both mafA and/or Kusabira Orange driven by the BAC-mafA promoter pdx1 promoters in a single platform, which may help is accurately expressed in pancreatic β-cells. We suc- to induce the direct reprogramming of somatic cells cessfully visualized the promoter activity of MafA in into insulin-expressing cells [28, 29]. β-cells in embryonic and adult pancreases and in iso- In summary, the MafA-KOr reporter may be a useful lated islets. fluorescence-based system for the study of dynamic For the characterization of MafA-KOr mice, var- changes in the function, differentiation and regener- ious methods are used, including observation of (1) ation of β-cells through the identification of mature KOr fluorescence detected by fluorescent microscopy populations of β-cells marked by MafA. at low magnification in the pancreas (Fig. 3A and B, Supplemental Fig. 1A-C) and the islets (Fig. 6A and Acknowledgments C, Supplemental Fig. 3), (2) KOr fluorescence in the islets using confocal microscopy at high magnifica- W.N. contributed to the design of this study and the tion (Fig. 5, 7C-F and 7L-N), (3) KOr fluorescence in acquisition, analysis and interpretation of data; W.N., the frozen section (Fig. 3G and H, Supplemental Fig. H.O. and K.Y. contributed to drafting the article; and 5A-F) and (4) immunofluorescence in the paraffin sec- N.F., T.F., S.T. and K.Y. contributed to critically revis- tion (Fig. 3C-F, 6E-O, Supplemental Fig. 1D-G, and ing the manuscript for important intellectual content. Supplemental Fig. 4). KOr fluorescence of (2) and (3) We thank Dr. Miwa Tamura-Nakano at the NCGM was detected in the nucleus, suggesting nuclear local- EM support unit for tissue processing and imaging, ization of the native KOr. Meanwhile, the immunoflu- and Mr. Keisuke Manji and Ms. Miyuki Koumura orescence of KOr in the paraffin section could often (Olympus) for assisting with the confocal time-lapse be observed in the cytoplasm. This observation may imaging of the embryonic pancreas. We also thank result from the difference in the preservation of the Ms. Naoko Ishibashi, Dr. Takao Nammo, Dr. Miho antigenicity of KOr in the paraffin sections. Kawaguchi, Dr. Haruhide Udagawa, Mr. Dai Suzuki We also showed β- and α-cells expressing KOr and and Ms. Kazuko Nagase (National Center for Global GFP, respectively, in the islets of MafA-KOr;MafBGFP/+ Health and Medicine) for their invaluable assistance. mice, simultaneously visualizing the promoter activity This study was supported, in part, by JSPS KAKENHI, of MafA and MafB. Previously, our group and oth- grants from the National Center for Global Health and ers have shown that the maturation of β-cells during Medicine, the Takeda Science Foundation, and Japan the development of the pancreas is accompanied by Diabetes Foundation (to W.N.), JSPS KAKENHI, the increased expression of MafA and the decreased grants from the National Center for Global Health and expression of MafB [10, 18, 23]. Recent studies have Medicine and the Japan Human Sciences Foundation demonstrated the dedifferentiation of β-cells with the (to K.Y.). increased expression of MafB in diabetes mice [12, 13]. It has also been shown that MafA is reduced in Disclosure the majority of β-cells in diabetes [11, 24-27]. Thus, MafA-KOr;MafBGFP/+ double reporter mice may be None of the authors have any potential conflicts of useful for analyzing the relationship between plasticity interest associated with this research. and dysfunction of β-cells using islets with decreased MafA-Kusabira Orange mice 47

Supplemental Fig. 1 Kusabira Orange is expressed in β-cells of MafA-KOr mice (A-C) Fluorescence microscopy of pancreas dissected from MafA-KOr mice lines F, G and H. The KOr fluorescence is expressed in each line of MafA-KOr transgenic pancreas. (D-G) Islets in MafA-KOr (D-F) and wild-type (G) pancreatic paraffin sections stained for KOr (red), insulin (green) and DAPI (blue). KOr driven by the BAC-mafA promoter is colocalized with insulin. Bar, 20 µm.

Supplemental Fig. 2 Fluorescent microscopy of pancreas dissected from MIP-GFP and wild-type mice (A, B) Fluorescent microscopy of MIP-GFP and wild-type pancreas show the clusters of cells expressing GFP fluorescence in the MIP-GFP (A) but not in wild-type pancreas (B). Each picture is derived from the pancreas of different mice. n=3. Bar, 500 µm. 48 Nishimura et al.

Supplemental Fig. 3 Real-time monitoring of MafA expression in the cultured islets (A, B) Fluorescent microscopy of the isolated islets revealed KOr fluorescence in MafA-KOr islets (A, B) but not in wild-type islets (C, D). n=3. (E, F) MafA-KOr islets were isolated and cultured with 11.1 mM glucose overnight. The islets were subsequently washed and cultured with 2.5 mM glucose for 8 hours, followed by culturing in medium containing 10 mM (A) or 5 mM (B) glucose. The cultured islets were observed at the indicated time points. MafA-Kusabira Orange mice 49

Supplemental Fig. 4 KOr expression in the pancreas of aged mice Transgenic pancreas from different individuals of MafA-KOr mice at 71 weeks of age (A, B, C) and 15 weeks of age (D, E, F) in the paraffin sections, stained for Kusabira-Orange (green). The down-regulation in the expression of KOr was observed in the aged pancreas, which was not specific to the center of islets, such as those cultured with 10 mM glucose (see Supplemental Fig. 3).

Supplemental Fig. 5 KOr fluorescence and MafA expression in the pancreas of diabetic MafA-KOr mice MafA-KOr mice received a low dose (50 mg/kg body weight) of streptozotocin (STZ) or buffer intraperitoneally for five consecutive days. Pancreases were dissected from these mice 20 days after the injection and frozen sections of these pancreases were stained for MafA. The observation of these pancreases revealed that both fluorescence of KOr (orange) and expression of MafA (green) were impaired in diabetic MafA-KOr (D-F) but not in control pancreas (A-C). The arrows indicate remaining MafA-expressing cells. Body weight on day 20 (G) and blood glucose at the indicated time points (H) after low-dose STZ injection are shown. The mean ± S.E.M. values are shown. n=3. Bar, 20 µm. 50 Nishimura et al.

Supplemental Table 1 Primers used for genotyping Mice Primers Product size Forward TCATGGCCGACAAGCAGAAGAACG MafBGFP/+ 228 bp Reverse CGGCGGCGGTCACGAACTC Forward GCTTGAGAGGCAACACCTTC MafA-Kusabira Orange 215 bp Reverse GGCCTTGTAGGTGGTCTTGA Forward CACCGGCCGCCCCTACGA MafA-Kusabira Orange-8 424 bp Reverse GTTGCCGCCGCCCTCCAG Forward TGAGCCACGTGTTCTGCTAC MafA-Kusabira Orange-14 173 bp Reverse GAAGGTGTTGCCTCTCAAGC

Supplemental Table 2 TaqMan probes used in this study Gene symbols Gene ID Species MafA v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A Mm00845209_s1 Mus musculus Kusabira Orange Kusabira Orange All1MW5 Fungia concinna Actb Beta-actin Mm00607939_s1 Mus musculus

Supplemental Table 3 Antibodies used in this study Antigen Species Maker Catalogue number Dilution Kusabira Orange Mouse MBL M104-3 1:50 Kusabira Orange Rabbit MBL PM051M 1:50 Insulin Guinea pig Millipore AB3440 1:300 Glucagon Rabbit Millipore AB932 1:300 Somatostatin Rabbit Chemicon International AB5494 1:300 Pancreatic polypeptide Rabbit Linco AB939 1:300 EGFP Mouse Clontech 632569 1:100 MafA Rabbit Bethyl IHC-00352 1:100

References

1. Andralojc K, Srinivas M, Brom M, Joosten L, de Vries 5. Hara M, Wang X, Kawamura T, Bindokas VP, Dizon IJ, et al. (2012) Obstacles on the way to the clinical visu- RF, et al. (2003) Transgenic mice with green fluores- alisation of beta cells: looking for the Aeneas of molec- cent protein-labeled pancreatic beta-cells. Am J Physiol ular imaging to navigate between Scylla and Charybdis. Endocrinol Metab 284: E177-E183. Diabetologia 55: 1247-1257. 6. Puri S, Hebrok M (2007) Dynamics of embryonic pan- 2. McGirr R, Hu S, Yee SP, Kovacs MS, Lee TY, et al. creas development using real-time imaging. Dev Biol (2011) Towards PET imaging of intact pancreatic beta 306: 82-93. cell mass: a transgenic strategy. Mol Imaging Biol 13: 7. Kikugawa R, Katsuta H, Akashi T, Yatoh S, Weir GC, et 962-972. al. (2009) Differentiation of COPAS-sorted non-endo- 3. Virostko J, Radhika A, Poffenberger G, Chen Z, crine pancreatic cells into insulin-positive cells in the Brissova M, et al. (2010) Bioluminescence imaging mouse. Diabetologia 52: 645-652. in mouse models quantifies beta cell mass in the pan- 8. Milewski WM, Temple KA, Wesselschmidt RL, Hara M creas and after islet transplantation. Mol Imaging Biol (2009) Generation of embryonic stem cells from mouse 12: 42-53. insulin I promoter-green fluorescent protein transgenic 4. Nishimura W, Eto K, Miki A, Goto M, Kawaguchi M, mice and characterization in a teratoma model. In Vitro et al. (2013) Quantitative assessment of Pdx1 promoter Cell Dev Biol Anim 45: 1-5. activity in vivo using a secreted luciferase reporter sys- 9. Katsuta H, Akashi T, Katsuta R, Nagaya M, Kim D, et tem. Endocrinology 154: 4388-4395. al. (2010) Single pancreatic beta cells co-express multi- MafA-Kusabira Orange mice 51

ple islet hormone genes in mice. Diabetologia 53: 128- Identification of beta-cell-specific insulin gene tran- 138. scription factor RIPE3b1 as mammalian MafA. Proc 10. Nishimura W, Kondo T, Salameh T, El Khattabi I, Natl Acad Sci USA 99: 6737-6742. Dodge R, et al. (2006) A switch from MafB to MafA 21. Kataoka K, Han SI, Shioda S, Hirai M, Nishizawa M, expression accompanies differentiation to pancreatic et al. (2002) MafA is a glucose-regulated and pancreatic beta-cells. Dev Biol 293: 526-539. beta-cell-specific transcriptional activator for the insulin 11. Guo S, Dai C, Guo M, Taylor B, Harmon JS, et al. gene. J Biol Chem 277: 49903-49910. (2013) Inactivation of specific β cell transcription fac- 22. Kajihara M, Sone H, Amemiya M, Katoh Y, Isogai M, et tors in type 2 diabetes. J Clin Invest 123: 3305-3316. al. (2003) Mouse MafA, homologue of zebrafish somite 12. Talchai C, Xuan S, Lin HV, Sussel L, Accili D (2012) Maf 1, contributes to the specific transcriptional activ- Pancreatic β cell dedifferentiation as a mechanism of ity through the insulin promoter. Biochem Biophys Res diabetic β cell failure. Cell 150: 1223-1234. Commun 312: 831-842. 13. Gao T, McKenna B, Li C, Reichert M, Nguyen J, et al. 23. Aguayo-Mazzucato C, Koh A, El Khattabi I, Li WC, (2014) Pdx1 maintains β cell identity and function by Toschi E, et al. (2011) Mafa expression enhances glu- repressing an α cell program. Cell Metab 19: 259-271. cose-responsive insulin secretion in neonatal rat beta 14. Karasawa S, Araki T, Nagai T, Mizuno H, Miyawaki A cells. Diabetologia 54: 583-593. (2004) Cyan-emitting and orange-emitting fluorescent 24. Kitamura YI, Kitamura T, Kruse JP, Raum JC, Stein proteins as a donor/acceptor pair for fluorescence reso- R, et al. (2005) FoxO1 protects against pancreatic beta nance energy transfer. Biochem J 381: 307-312. cell failure through NeuroD and MafA induction. Cell 15. Moriguchi T, Hamada M, Morito N, Terunuma T, Metab 2: 153-163. Hasegawa K, et al. (2006) MafB is essential for renal 25. Ueki K, Okada T, Hu J, Liew CW, Assmann A, et al. development and F4/80 expression in macrophages. (2006) Total insulin and IGF-I resistance in pancreatic Mol Cell Biol 26: 5715-5727. beta cells causes overt diabetes. Nat Genet 38: 583-588. 16. Weinberg N, Ouziel-Yahalom L, Knoller S, Efrat S, Dor 26. Butler AE, Robertson RP, Hernandez R, Matveyenko Y (2007) Lineage tracing evidence for in vitro dedif- AV, Gurlo T, et al. (2012) Beta cell nuclear muscu- ferentiation but rare proliferation of mouse pancreatic loaponeurotic fibrosarcoma oncogene family A (MafA) beta-cells. Diabetes 56: 1299-1304. is deficient in type 2 diabetes. Diabetologia 55: 2985- 17. Russ HA, Bar Y, Ravassard P, Efrat S (2008) In vitro 2988. proliferation of cells derived from adult human beta- 27. Matsuoka TA, Kaneto H, Miyatsuka T, Yamamoto T, cells revealed by cell-lineage tracing. Diabetes 57: Yamamoto K, et al. (2010) Regulation of MafA expres- 1575-1583. sion in pancreatic beta-cells in db/db mice with diabe- 18. Matsuoka TA, Zhao L, Artner I, Jarrett HW, Friedman tes. Diabetes 59: 1709-1720. D, et al. (2003) Members of the large Maf transcription 28. Kaneto H, Matsuoka TA, Nakatani Y, Miyatsuka T, family regulate insulin gene transcription in islet beta Matsuhisa M, et al. (2005) A crucial role of MafA as a cells. Mol Cell Biol 23: 6049-6062. novel therapeutic target for diabetes. J Biol Chem 280: 19. Artner I, Hang Y, Mazur M, Yamamoto T, Guo M, et al. 15047-15052. (2010) MafA and MafB regulate genes critical to beta- 29. Zhou Q, Brown J, Kanarek A, Rajagopal J, Melton DA cells in a unique temporal manner. Diabetes 59: 2530- (2008) In vivo reprogramming of adult pancreatic exo- 2539. crine cells to beta-cells. Nature 455: 627-632. 20. Olbrot M, Rud J, Moss LG, Sharma A (2002)