DOCSLIB.ORG

Databases Genomes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Databases Genomes 25‐Mar‐15 Biology is Big Data science Databases genomes sequenced # Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Moore's Law: computer Utrecht University, March 26th 2015 power doubles every ~2 years. History How would you figure out the function of a protein? Activity assay X‐ray structure IBM 7090 computer • First protein sequence: bovine insulin (51 amino acids, 1956) • Atlas of Protein Sequence and Structure (1965) – Margaret Oakley Dayhoff • Protein DataBank (10 proteins, 1972) – X‐ray crystallographic protein structures Knock‐out mouse • SWISSPROT (1987) – Protein sequence database • Genbank (1982) – Nucleotide and protein sequences BLAST search Fasta files Fasta file extensions • Biological sequences are stored in Fasta files • The file extension of a Fasta file is .fa or .fasta • Fasta files are plain text files (open e.g. in ) • The preferred extension for protein Fasta files is .faa – Fasta Amino Acid Every new sequence entry starts with a “>” sign at the start of a line >protein_sequence_A MTQSSHAVAA FDLGAALRQE GLTETDYSEI QRDPNRAELG TFGV Each sequence has an identifier >protein_sequence_B that has to be unique in the file MLTETDYSEI QRRLGRDPNR AELGMFGVMN RAELGMFGY >protein_sequence_A >protein_sequence_C MTQQQQSSHAVAA FDLGAALRQE GLTETDYSEI QRDPNRAELG TFGV MHAVAAFDLG AALRQEGLTE TDYSEIQRRL GRAMFGVMWS EHCCYRNDDA >protein_sequence_B RPLLRPIKSP FGAWVVIV MLTETDYSEI QRRLGRDPNR AELGMFGVMN RAELGMFGY >protein_sequence_C • The preferred extension for DNA Fasta files is .fna MHAVAAFDLG AALRQEGLTE TDYSEIQRRL GRAMFGVMWS EHCCYRNDDA RPLLRPIKSP FGAWVVIV – Fasta Nucleic Acid >DNA_sequence_X GAGGAATTCA TAGCTGACGA GTCGAGTGAA AACCGTGTCG TAAAAGA >DNA_sequence_Y The sequence can be on one or more lines Spaces and newlines just make CTGACGAGTC GCCCCCCCCC ATAGAGTGGT TTCCGTTTCC GGAAGGGTCG until the next “>” at the start of a new line sequences easier to read/count, >DNA_sequence_Z they do not have any meaning GAAGCTGACC CGTTTCCGGA AGAGGGAGG 1 25‐Mar‐15 DNA sequencing Bad quality sequencing read • DNA sequencing depends on A/C/G/T signal being “read” – Differently colored fluorophore signals – Signal is not always unambiguous • DNA sequencing machines estimate the quality of a sequenced nucleotide Good quality sequencing read DNA sequencing quality scores • DNA sequencing quality is measured in Phred scores – Phred 10: 10‐1 chance that the base is wrong • 90% accuracy; 10% error rate – Phred 20: 10‐2 chance that the base is wrong • 99% accuracy ; 1% error rate – Phred 30: 10‐3 chance that the base is wrong • 99.9% accuracy ; 0.1% error rate – Etcetera • Phred scores in Fastq files are stored as ASCII characters – Phred score + 33, converted to ASCII text Fastq Genbank format • Sequencing output and quality are stored in Fastq format • Used by the Genbank – Based on Fasta format database – Used in sequence similarity – Contains information about quality of each nucleotide searches (more about this – Quality score is estimated by sequencing machine later) >sequence_identifier_1@sequence_identifier_1 GGAAATGGAGTACGGATCGATTTTGTTTGGAACCGAAAGGGTC >se+seqq_uence identifier _ 21 AAGCATCCGAATGACGAGCTAGGAGAGATCTGAGCCTTTCAAAhhhhhhhhhhhhhhhh7F@71,'";C?,B;?6B;:EA1EA1E% • Four lines per sequence: – Identifier line starting with @ – DNA sequence on one line • Contains the sequence and all related information – Second identifier line starting with + • Click on “FASTA” to get Fasta – String of quality scores on one line, encoded in ASCII characters format 2 25‐Mar‐15 Central paradigm of Bioinformatics International Nucleotide Sequence Database Collaboration • Central dogma of (molecular) biology • INSDC is a collaboration between: – DNA Data Bank of Japan (DDBJ) – National Center for Biotechnology Information (NCBI) – European Molecular Biology Laboratory / European Bioinformatics • Biological sequences encode a lot of information Institute (EMBL‐EBI) • One of the most important applications of Bioinformatic Data Analysis is to extract this information Protein families • Pfam database • SEED database • EGGnog database Ribosomal RNA genes Protein structures • Small subunit ribosomal RNA (SSU rRNA) is a universal marker gene that indicates the taxonomic group of an organism, and was used to discover the three domains in the Tree of Life (ToL) – 16S rRNA (Bacteria and Archaea) – 18S rRNA (Eukaryotes) 3 25‐Mar‐15 Transcription factor binding sites (TFBS) Metabolic pathways (etc.) Scientific literature Protein interactions Using databases reproducibly in science • Databases are not static, but are constantly updated • Thus, every entry (sequence, protein, structure, function, etc.) in a database has a unique identifier – Sometimes identifiers are changed in new versions of the database • Entries can be retrieved from the database – Search possibilities depend on the database – Often the complete database can be downloaded for large‐scale analyses – When you access a database, note the version of the database or the date of accessing the database for reproducible science! 4.
Load more

Recommended publications
  • Lie Therory and Hermite Polynomials
    International Journal For Research In Advanced Computer Science And Engineering ISSN: 2208-2107 A Computational Method for Sequence analyzing Rekardo Fosalli, Teriso Joloobi School of Computer Science, University of De Cyprus, Cyprus Abstract: To study how normal cellular activities are altered in different disease states, the biological data must be combined to form a comprehensive picture of these activities. Therefore, the field of bioinformatics has evolved such that the most pressing task now involves the analysis and interpretation of various types of data. This includes nucleotide and amino acid sequences, protein domains, and protein structures. Common uses of bioinformatics include the identification of candidate genes and nucleotides (SNPs). Often, such identification is made with the aim of better understanding the genetic basis of disease, unique adaptations, desirable properties (esp. in agricultural species), or differences between populations. In a less formal way, bioinformatics also tries to understand the organisational principles within nucleic acid and protein sequences. Keywords: Clustering, RNA sequences, RNA-Seq, Data Mining, Bioinformatics, Graph Mining. 1. INTRODUCTION Bioinformatics has become an important part of many areas of biology. In experimental molecular biology, bioinformatics techniques such as image and signal processing allow extraction of useful results from large amounts of raw data. In the field of genetics and genomics, it aids in sequencing and annotating genomes and their observed mutations. It plays a role in the text mining of biological literature and the development of biological and gene ontologies to organize and query biological data. It also plays a role in the analysis of gene and protein expression and regulation.
    [Show full text]
  • Sophie Dumont
    Sophie Dumont University of California, San Francisco 513 Parnassus Ave, HSW-613, San Francisco, CA 94143-0512, USA Office: (415) 502-1229 / Cell: (510) 229-9846 [email protected] ; http://dumontlab.ucsf.edu/ EDUCATION 9/2000-12/2005 Ph.D., Biophysics, University of California, Berkeley, CA 10/1999-8/2000 Candidate for D.Phil., Theoretical Physics, University of Oxford, UK 9/1995-6/1999 B.A., Physics, magna cum laude, Princeton University, Princeton, NJ RESEARCH POSITIONS & TRAINING 7/2012-present Assistant Professor, University of California, San Francisco Dept of Cell & Tissue Biology and Dept of Cellular & Molecular Pharmacology Member, QB3 California Institute for Quantitative Biosciences Member, NSF Center for Cellular Construction Affiliate Member, UCSF Cancer Center Graduate program member: Bioengineering, Biomedical Sciences, Biophysics, Tetrad 7/2006-5/2012 Postdoctoral Fellow, Harvard Medical School Mentor: Prof. Timothy Mitchison (Systems Biology) 7/2006-6/2009 Junior Fellow, Harvard Society of Fellows 9/2000-12/2005 Graduate Student, University of California, Berkeley Advisor: Prof. Carlos Bustamante (Physics and Molecular & Cell Biology) 10/1999-8/2000 Graduate Student, University of Oxford Advisor: Prof. Douglas Abraham (Theoretical Physics) 6/1997-5/1999 Undergraduate Student, Princeton University Advisor: Prof. Stanislas Leibler (Physics) AWARDS 2016-2021 NSF CAREER Award 2016 Margaret Oakley Dayhoff Award of the Biophysical Society 2015-2020 NIH New Innovator Award (DP2) 2013-2018 Rita Allen Foundation and Milton
    [Show full text]
  • Sophie Dumont
    Sophie Dumont University of California, San Francisco 513 Parnassus Ave, HSW-613, San Francisco, CA 94143-0512, USA Office: (415) 502-1229 / Cell: (510) 229-9846 [email protected] ; http://dumontlab.ucsf.edu/ EDUCATION 9/2000-12/2005 Ph.D., Biophysics, University of California, Berkeley, CA 10/1999-8/2000 Candidate for D.Phil., Theoretical Physics, University of Oxford, UK 9/1995-6/1999 B.A., Physics, magna cum laude, Princeton University, Princeton, NJ RESEARCH POSITIONS & TRAINING 7/2012-present Assistant Professor, University of California, San Francisco Dept of Cell & Tissue Biology Dept of Cellular & Molecular Pharmacology Member, NSF Center for Cellular Construction Member, QB3 California Institute for Quantitative Biosciences Associate Member, UCSF Cancer Center Graduate program member: Biomedical Sciences Biophysics Bioengineering Tetrad 7/2006-5/2012 Postdoctoral Fellow, Harvard Medical School 7/2006-6/2009 Junior Fellow, Harvard Society of Fellows Mentor: Prof. Timothy Mitchison (Systems Biology) Collaborator: Prof. Edward Salmon (UNC Chapel Hill) Topic: Mechanochemistry of cell division 9/2000-12/2005 Graduate Student, University of California, Berkeley Advisor: Prof. Carlos Bustamante (Physics and Molecular & Cell Biology) Collaborators: Prof. Ignacio Tinoco & Prof. Jan Liphardt (UC Berkeley) Prof. Anna Marie Pyle (Yale University) Thesis: Force and helicase-catalyzed mechanical unfolding of single RNA molecules 10/1999-8/2000 Graduate Student, University of Oxford Advisor: Prof. Douglas Abraham (Theoretical Physics) Topic: Statistical mechanics of neural networks 6/1997-5/1999 Undergraduate Student, Princeton University Advisor: Prof. Stanislas Leibler (Physics) Thesis: Thermal sensing network of E. coli Page 1 of 5 AWARDS 2016-2021 NSF CAREER Award 2016 Margaret Oakley Dayhoff Award of the Biophysical Society 2015-2020 NIH New Innovator Award (DP2) 2013-2018 Rita Allen Foundation and Milton E.
    [Show full text]
  • The Origins of Bioinformatics.Pdf
    PERSPECTIVES d’éthique en désaccord avec la directive européenne. Le Medicine in the 21st Century, December 4–5, 1998, 2nd nomic environment that includes various Monde 15 June (2000). edn 47–53 (AACC, Washington DC, 1998). social values, research practices and business 7. Kolata, G. Special Report: Who owns your genes? New 26. Caulfield, T. & Gold, E. R. Genetic testing, ethical York Times 15 May (2000). concerns, and the role of patent law. Clin. Genet. 57, pressures. We are mindful that, in some situa- 8. Ramirez, A. School given patent to clone humans. 370–375 (2000). tions, modifying patent law may reduce one National Post 16 May (2000). 27. Bruzzone, L. The research exemption: a proposal. Am. 9. Sagar, A., Daemmrich, A. & Ashiya, M. The tragedy of Intell. Prop. Law Assoc. QL 21, 52 (1993). problem (such as permitting more competi- commoners: biotechnology and its publics. Nature 28. Parker, D. Patent infringement exemptions for life science tion), while magnifying others (such as Biotechnol. 18, 2–4 (2000). research. Houston J. Intl Law 16, 615 (1994). 10. Angell, M. Is academic medicine for sale? N. Engl. J. 29. Gold, E. R. in Commercialization of Genetic Research: reducing incentives to conduct research and Med. 20, 1516–1518 (2000). Ethical, Legal and Policy Issues (eds Caulfield, T. & development). Nevertheless, although care 11. Pottagem, A. The inscription of life in law: gene, patents, Williams–Jones, B.) 63–78 (Plenum, New York, 1999). and bio-politics. The Modern Law Review 61, 740–765 30. Schissel, A., Merz, J. F. & Cho, M. K. Survey confirms must be taken, this debate needs to progress (1998).
    [Show full text]
  • History and Epistemology of M Olecular Biology and Beyond
    M A X - P L A N C K - I N S T I T U T F Ü R W I S S E N S C H A F T S G E S C H I C H T E M ax Pl anc k Ins t i tut e for the His tory of Sc i enc e 2 0 0 6 P R E P R I N T 3 1 0 W o r k s h o p H i s t o r y and Ep i s t e m o logy of M o lecu la r B i o logy and Beyond : P r ob le m s and Pe r spec t i ves Collecting and Experimenting: The Moral Economies of Biological Research, 1960s-1980s. Bruno J. Strasser I. Introduction Experimentation is often singled out as the most distinctive feature of modern science. Our very idea of modern science, that we trace back to the Scientific Revolution, gives a central place to this particular way of producing knowledge. The current epistemic, social and cultural authority of science rests largely on the possibility of experimentation in the laboratory. The history of the sciences over the last four centuries reminds us that experimentation has only been one out of many ways in which scientific knowledge has been produced. However, by most accounts, experimentation has progressively come to dominate all the others, in most fields of science, from high energy physics to molecular biology. In the life sciences, the rise of experimentalism has been cast against the natural history tradition, leading to its progressive demise.
    [Show full text]
  • Coding Sequences: a History of Sequence Comparison Algorithms As a Scientiªc Instrument
    Coding Sequences: A History of Sequence Comparison Algorithms as a Scientiªc Instrument Hallam Stevens Harvard University Sequence comparison algorithms are sophisticated pieces of software that com- pare and match identical or similar regions of DNA, RNA, or protein se- quence. This paper examines the origins and development of these algorithms from the 1960s to the 1990s. By treating this software as a kind of scien- tiªc instrument used to examine sets of biological objects, the paper shows how algorithms have been used as different sorts of tools and appropriated for dif- ferent sorts of uses according to the disciplinary context in which they were deployed. These particular uses have made sequences themselves into different kinds of objects. Introduction Historians of molecular biology have paid signiªcant attention to the role of scientiªc instruments and their relationship to the production of bio- logical knowledge. For instance, Lily Kay has examined the history of electrophoresis, Boelie Elzen has analyzed the development of the ultra- centrifuge as an enabling technology for molecular biology, and Nicolas Rasmussen has examined how molecular biology was transformed by the introduction of the electron microscope (Kay 1998, 1993; Elzen 1986; Rasmussen 1997).1 Collectively, these historians have demonstrated how instruments and other elements of the material culture of the labora- tory have played a decisive role in determining the kind and quantity of knowledge that is produced by biologists. During the 1960s, a versatile new kind of instrument began to be deployed in biology: the electronic computer (Ceruzzi 2001; Lenoir 1999). Despite the signiªcant role that 1. One could also point to Robert Kohler’s (1994) work on the fruit ºy, Jean-Paul Gaudillière (2001) on laboratory mice, and Hannah Landecker (2007) on the technologies of tissue culture.
    [Show full text]
  • Functional Proteins from Short Peptides: Dayhoff S Hypothesis
    Angewandte Essays Chemie International Edition:DOI:10.1002/anie.201609977 Origin of Proteins German Edition:DOI:10.1002/ange.201609977 Functional Proteins from Short Peptides:Dayhoffs Hypothesis Turns 50 M. Luisa Romero Romero,Avigayel Rabin, and Dan S. Tawfik* Margaret O. Dayhoff ·peptides ·proteins · protein evolution ·origin of life 1. Introduction to adifferent fold.[6] But how would relatively short peptides give rise to folded, globular,and functional proteins?Fifty Proteins are unlikely to have emerged as the large, years ago,Margaret O. Dayhoff pioneered the key hypothesis complex globular forms we know today.First, the primordial regarding the evolution of the first protein forms from short, protein synthesis machinery would inevitably have been simple peptides. inefficient, and the earliest step in protein evolution may even have been the abiotic emergence of short peptides.Second, the de novo emergence of functional proteins through 2. Margaret Oakley Dayhoff random condensation of amino acids demands an improbably extensive exploration of sequence space.Wemay assume Born in Philadelphia on 11 March 1925, Dayhoff grew up aminimal set of primordial, abiotic amino acids,[1] even in New York City (Figure 1). Already in her early academic a“binary” system of polar/charged or hydrophobic[2] plus life,she stood out as an exceptional student, and was awarded glycine for connecting loops.Nonetheless,the probability of ascholarship to New York University.In1945, she graduated the emergence of atypical protein domain that can carry out magna cum laude in mathematics and three years later she enzymatic functions (ca. 100 amino acids) seems dauntingly obtained aPh.D.inquantum chemistry at Columbia Uni- 100 47 low (1/3 10À ).
    [Show full text]
  • Evolution by Substitution: Amino Acid Changes Over Time
    BioMath Evolution By Substitution: Amino Acid Changes Over Time Student Edition Funded by the National Science Foundation, Proposal No. ESI-06-28091 This material was prepared with the support of the National Science Foundation. However, any opinions, findings, conclusions, and/or recommendations herein are those of the authors and do not necessarily reflect the views of the NSF. At the time of publishing, all included URLs were checked and active. We make every effort to make sure all links stay active, but we cannot make any guaranties that they will remain so. If you find a URL that is inactive, please inform us at [email protected]. DIMACS Published by COMAP, Inc. in conjunction with DIMACS, Rutgers University. ©2015 COMAP, Inc. Printed in the U.S.A. COMAP, Inc. 175 Middlesex Turnpike, Suite 3B Bedford, MA 01730 www.comap.com ISBN: 1 933223 75 8 Front Cover Photograph: EPA GULF BREEZE LABORATORY, PATHO-BIOLOGY LAB. LINDA SHARP ASSISTANT This work is in the public domain in the United States because it is a work prepared by an officer or employee of the United States Government as part of that person’s official duties. Evolution By Substitution: Amino Acid Changes Over Time DNA, or deoxyribonucleic acid, carries the code for life and that code directs the making of proteins that will carry out the organism’s functions. Proteins are made from twenty different amino acids and the number and order of those amino acids will determine the properties and function of the protein. Any alterations in the sequence of amino acids may have an effect on the function of the protein.
    [Show full text]
  • Classifying Peroxiredoxin Subgroups and Identifying
    CLASSIFYING PEROXIREDOXIN SUBGROUPS AND IDENTIFYING DISCRIMINATING MOTIFS VIA MACHINE LEARNING BY JIAJIE XIAO A Thesis Submitted to the Graduate Faculty of WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES in Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIENCE Computer Science May, 2018 Winston-Salem, North Carolina Approved By: William Turkett, Jr., Ph.D., Advisor David John, Ph.D., Chair Grey Ballard, Ph.D. James Pease, Ph.D. Dedication This work is dedicated to my parents, Mingfu Xiao and Lizhu Xu, my sister, Wanling Xiao. Because of their hard work, I get to be exactly who I want to be. ii Acknowledgments First, I would like to show my gratitude towards the Center for Molecular Communication and Signaling for supporting me as a Research Fellow for the fall semester in 2017-2018 academic year. The extra time and focus has helped me expand my research project in directions I would not have been able to explore otherwise. I would also like to thank the Department of Computer Science at Wake Forest University. I appreciate all of the resources and support that the department has provided me with in order to complete my thesis. I would also like to thank the professors who have been very helpful and welcoming during coursework, seminars, and hallway passings. I want to thank Dr. John, Dr. Ballard, and Dr. Pease for being on my committee. I appreciate your input and the time you are taking to help me complete my thesis. I want to thank Dr. Poole for the interactions in the Prx subgroup classification project.
    [Show full text]
  • Fully Transferred to Cotton, Maize and Potatoes
    IOSR Journal of Computer Engineering (IOSR-JCE) e-ISSN: 2278-0661,p-ISSN: 2278-8727 PP 20-26 www.iosrjournals.org Exploring the Applications and Potential of Bioinformatics Mrs. Kanchan Gawande1, Mr. Dhiraj Rane2 1([email protected], AP, Dept. of CS, SRPCE, Nagpur, India) 2([email protected], Dept. of CS, GHRIIT, Nagpur, India) Abstract: This paper has discussed basic working of Bioinformatics and its association with computation. It also summarizes the application domains of Bioinformatics. The use of computer science is also discussed with the bioinformatics. This paper has explored the potential domain of the bioinformatics in the computer science development. It has also given the technical tools discussion for the various practical implantation and conducting experiments. Keywords- Bioinformatics, Bioweka, Genes, DNA I. INTRODUCTION Bioinformatics is an interdisciplinary field that develops methods and software tools for understanding biological data. As an interdisciplinary field of science, bioinformatics combines computer science, statistics, mathematics, and engineering to analyze and interpret biological data. Bioinformatics has been used for in silico analyses of biological queries using mathematical and statistical techniques. Bioinformatics is both an umbrella term for the body of biological studies that use computer programming as part of their methodology, as well as a reference to specific analysis "pipelines" that are repeatedly used, particularly in the field of genomics. Common uses of bioinformatics include the identification of candidate genes and nucleotides (SNPs). Often, such identification is made with the aim of better understanding the genetic basis of disease, unique adaptations, desirable properties (esp. in agricultural species), or differences between populations. In a less formal way, bioinformatics also tries to understand the organisational principles within nucleic acid and protein sequences.
    [Show full text]
  • PDF Hosted at the Radboud Repository of the Radboud University Nijmegen
    PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/100866 Please be advised that this information was generated on 2017-12-06 and may be subject to change. Project HOPE: Providing the last piece of the puzzle Proefschrift ter verkrijging van de graad van doctor aan de Radboud Universiteit Nijmegen op gezag van de rector magnificus prof. mr. S.C.J.J. Kortmann, volgens besluit van het college van decanen in het openbaar te verdedigen op donderdag 29 november 2012 om 12:30 uur precies door Hanka Venselaar Geboren op 27 oktober 1982 te Tilburg Promotor Prof. dr. G. Vriend Manuscriptcommissie Prof. dr. H.G. Brunner Prof. dr. J.A.M. Smeitink Prof. dr. M.G. Netea Project HOPE: Providing the last piece of the puzzle Hanka Venselaar ISBN: 978-90-9026835-4 Contents Chapter 1 5-20 Introduction Chapter 2 21-38 Homology Modeling Chapter 3 39-57 Homology Modeling and Spectroscopy, a never-ending lovestory Chapter 4 59-72 Protein structure analysis of mutations causing inheritable diseases. An e-Science approach with life scientist friendly interfaces Chapter 5 73-138 Applications of Homology Modeling Chapter 6 139-149 Automated protein structure annotation of human disease variants Chapter 6a 150-154 Appendix Chapter 7 155-162 Summary / Samenvatting Dankwoord 165-166 Curriculum Vitae 167 Publications 168-171 3 “We sift over our fingers the first grains of this great outpouring of information and say to ourselves that the world be helped by it.“ (Margaret Oakley Dayhoff in 1968 about the first Atlas of Protein Sequence and Structure) 4 Introduction 1 Previous page: Model of human Dectin – A receptor that specifically recognizes cell wall constituents from pathogenic bacteria and fungi.
    [Show full text]
  • Amino Acids, Peptides, and Proteins
    c03AminoAcidsPeptidesAndProteins.indd Page 75 11/08/12 12:47 PM user-F408 /Users/user-F408/Desktop 3 Amino Acids, Peptides, and Proteins 3.1 Amino Acids 76 these amino acids has a side chain with distinctive chemical properties, this group of 20 precursor mole- 3.2 Peptides and Proteins 85 cules may be regarded as the alphabet in which the 3.3 Working with Proteins 89 language of protein structure is written. To generate a particular protein, amino acids are 3.4 The Structure of Proteins: Primary Structure 96 covalently linked in a characteristic linear sequence. What is most remarkable is that cells can produce proteins with roteins mediate virtually every process that takes strikingly different properties and activities by joining the place in a cell, exhibiting an almost endless diversity same 20 amino acids in many different combinations and Pof functions. To explore the molecular mechanism sequences. From these building blocks different organ- of a biological process, a biochemist almost inevitably isms can make such widely diverse products as enzymes, studies one or more proteins. Proteins are the most hormones, antibodies, transporters, muscle fibers, the abundant biological macromolecules, occurring in all lens protein of the eye, feathers, spider webs, rhinoceros cells and all parts of cells. Proteins also occur in great horn, milk proteins, antibiotics, mushroom poisons, and variety; thousands of different kinds may be found in a myriad other substances having distinct biological activi- single cell. As the arbiters of molecular function, pro- ties (Fig. 3–1). Among these protein products, the teins are the most important final products of the infor- enzymes are the most varied and specialized.
    [Show full text]