DOCSLIB.ORG

Supporting Information

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information Supporting Information Zhang et al. 10.1073/pnas.1309725110 SI Methods selection (day 6 postinfection), the cells were differentiated into Cell Culture and Neural Differentiation. The human embryonic stem NPCs using noggin induction (150 ng/mL) for 10 d then the cells cell (hESC) lines H1 (WA01) and H9 (WA09), both from WiCell, were gently propagated using Accutase and grown further on poly-L- 2 were maintained in an undifferentiated state by culturing on ornithine (20 μg/mL)/fibronectin (1.7 μg/cm )-coated plates in NPC Matrigel-coated plates (Becton & Dickinson) in feeder-free and medium with basic FGF (10 ng/mL) for 2 wk more before harvesting serum-free, component-defined conditions. H1 was cultured in the samples for RNA extraction or immunostaining (see below); (ii) DMEM/F12 medium with supplement components described for each shRNA a simultaneous cell culture was also maintained in previously (1); H9 was cultured in mTeSR medium (Stem Cell hESC medium to maintain pluripotency. The pluirpotent cells were Technologies). The neuronal induction, propagation and char- cultured for 24 d with medium change every 2 d. At the end of the acterization of neuronal progenitor cells (NPCs) were carried experiment cell lysates were collected in TRIzol reagent (In- out as we and others previously described (1, 2). vitrogen) and kept at −80 °C for RNA extraction. Viral Infection of hESCs. Pooled shRNA library screening. Colonies of FACS Sorting. Live neural cell surface antigen staining using anti- hESC maintained on Matrigel (BD Biosciences) were pretreated polysialylated neural cell adhesion molecule (anti–PSA-NCAM) for 1 h with 10 μM Y27632 compound (Calbiochem), dissociated antibody was performed as described by Pruszak et al. (3) with with Accutase (Millipore) and single-cell suspension of un- minor modifications. In preliminary experiments the concentra- differentiated hESCs were infected with pools of the pLKO.1- tion of primary and secondary antibodies were titrated for based lentiviral short hairpin RNA (shRNA) library targeting the specificity using isotype-specific antibody controls along with entire human genome [MISSION library, Sigma-Aldrich, origi- hESCs and their derived NPCs. Briefly, for large-scale, pre- nally from The RNA1 Consortium (TRC)/Broad Institute]. For parative FACS all of the infected NPCs cultured under puro- one viral pool (1/10th of the human genome, ∼8,600 distinct mycin selection for 4 wk were quickly digested at 37 °C using shRNAs with four to five different shRNAs targeting the same Accutase (Millipore) and collected in sterile tubes containing gene) we infected 1 × 108 undifferentiated hESCs prepared as FACS buffer [2% (vol/vol) BSA (Invitrogen) in HBSS (Gibco- a single-cell suspension, such that that at least 300 cells are in- Invitrogen)]. Following centrifugation at 100 × g for 4 min at fected with the same single species of viral particle when using a +4 °C, the pellets were resuspended in FACS buffer, triturated multiplicity of infection of 0.3. Forty-eight hours later the cells were with a glass pipet, and filtered using a 40-μm sterile strainer (BD split and an aliquot (∼5 × 107 cells) was collected for a time 0 (T0) Biosciences). A total of 2.5 × 107 cells were resuspended in 2.5 input reference; the rest of the cells cultured further in plurip- mL FACS buffer. After removing aliquots for unstained control otent condition. Because the pLKO.1 backbone harbors the and unsorted cells, the cell suspensions were incubated with puromycin resistance gene, the uninfected cells were eliminated anti–PSA-NCAM IgM monocolonal antibody (Millipore; 1:250 by adding this chemical (1 μg/mL) at 72 h after the infection. The dilution) for 30 min at 4 °C using gentle rotation. Following rest of the cell population was expanded for an additional 3 d as a wash with washing buffer [0.1% (vol/vol) BSA in HBSS], the pluripotent cells then divided into two experimental arms: (i) cells were incubated with Alexa-488 secondary antibody (1:500 propagated in a condition that maintains undifferentiated state dilution) for 20 min at +4 °C in the dark. The cell suspensions and (ii) differentiated into neuronal precursors/progenitors using were washed twice using washing buffer containing 0.1% BSA, a monolayer approach (1, 2). Puromycin selection was main- then sorted into three populations, PSA-NCAM–negative, tained throughout the entire experiment. The pluripotent arm of weakly positive, and PSA-NCAM strongly positive cells by pre- the experiment performed in parallel served as additional con- parative FACS sorting using a VantageSE sorter. trol to obtain a time course of for self-renewal and overall cel- lular survival. The undifferentiated cells were maintained in DNA Extraction, PCR Amplification Adapted for Deep Sequencing. To pluripotent ES medium, and ∼5 × 107 cells were collected every extract genomic DNA, lysis buffer (50 mM Tris, pH 7.5, 50 mM 5–6 d for genomic DNA extraction, over a total of 4 wk. For EDTA, pH 8.0, 100 mM NaCl, 5 mM DTT, 0.5 mM Spermidine- neuronal differentiation, cells were cultured in NPC medium HCl, 1% SDS) was added to the various cell samples. The cell [DMEM/F12 (Gibco-Invitrogen) containing 2% (vol/vol) B27 lysates were de-proteinized by incubation with 100 μL proteinase supplement and 1% (vol/vol) from a 10,000 units/mL penicillin K (10 mg/mL) overnight at 55 °C followed by RNase A (0.1 mg/ and 10,000 μg/mL streptomycin stock solution] in the presence of mL) treatment at 37 °C for half an hour. Finally, phenol-chloro- noggin (R&D Systems; 100 ng/mL) for 14 d before the cells were form and ethanol precipitation was used to extract genomic DNA. split and transferred to poly-L-ornithine (20 μg/mL)/fibronectin (3 A total of 3.0 μg gDNA for each experimental group was μg/cm2) -coated flasks, and maintained in NPC medium with a low PCR-amplified to recover shRNA inserts for deep sequencing. concentration of recombinant human basic FGF (Millipore) (10 The PCR was performed in multiple tubes, each with 50–100 ng ng/mL) but without noggin for another 33 d before live-cell FACS gDNA, 200 nM dNTPs, 200 nM forward (5′ AATGATACGG- sorting. The experimental schedule is illustrated by Fig. 1B. CGACCACCGATTCTTGGGTAGTTTGC) and reverse primers Individual viral shRNA infection. We infected undifferentiated H1 or (5′ CAAGCAGAAGACGGCATACGACTGCCATTTGTCTCG) H9 hESCs as single cell suspensions plated in multiwell plates containing Illumina Genome Analyzer II adapter sequences, 0.6 μL with viral lysates of individual pLKO.1-based shRNAs with DMSO, and 0.6 U Phusion Polymerase (New England Biosciences). a multiplicity of infection of 2. Two to three shRNA species The PCR program setting was 98 °C for 2 min, 26 cycles of 98 °C for targeting different regions of the same gene were used. As done at 30 s, 60 °C for 15 s, and 72 °C for 15 s, and then 72 °C for 5 min. The the primary screen with the pooled library, 72 h after transduction PCR products were pooled together and purified using MinElute puromycin (1 μg/mL) was added to each well, and this selection columns (Qiagen) before running onto a 2% (wt/vol) E-gel (In- was maintained throughout the rest of the experiment. To test vitrogen) and the PCR products were cut out and purified using a the effects of individual shRNAs, two parallel experiments were MinElute gel purification kit (Qiagen). The PCR products were performed: (i) after recovery from the infection and puromycin then sequenced using Illumina GAII with a customer designed Zhang et al. www.pnas.org/cgi/content/short/1309725110 1of13 sequencing primer (5′ TCTTGTGGAAAGGACGAAACACC- protein (TARDBP) immunostaining the cells were permeabilized GG) to capture the sequences of shRNA inserts (single-end, with 0.2% Triton X-100 and washed first before blocking; the 36-bp sequencing). PSA-NCAM immunostaining was performed without any de- tergent present. The following primary antibodies and dilutions RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR. For were used: PSA-NCAM (mouse mAb IgM, Chemicon; 1:175), cells cultured in pluripotent condition, total RNA was extracted NESTIN (mouse mAb, Millipore; 1:200), SOX1 (goat pAb, R&D with the TRIzol reagent (Invitrogen), then treated with DNase I Systems; 1:20), TARDBP (rabbit pAb, Proteintech; 1:100). Pri- fi and puri ed using an RNeasy mini kit (Qiagen). Differentiated mary antibodies were incubated overnight at + 4 °C and after – NPCs had a limited number of cells (20 5,000 per well), thus our washing the cells were incubated with the respective fluorescence- fi modi ed RNA extraction protocol was used using reagents of labeled secondary antibodies for 1 h at room temperature. After the RNeasy Plus Micro kit (Qiagen) (4). In brief, for samples washing and mounting Zeiss Apotome fluorescent microscope μ with less than 200 cells, 200 L of RLT Plus Lysis Buffer with providing optical sectioning was used for image acquisition. 2-mercaptoethanol (Qiagen) was added, the cells were re- suspended and vortexed at speed 8 on an SP vortex mixer Statistical Analyses. The statistical approach RIGER was de- – (Boxter) for 30 times, each for 1 s. For samples with 200 1,000 veloped at the Broad Institute specifically for pooled library μ cells and 350 L of RLT Plus Lysis Buffer with 2-mercaptoe- screening strategy using the TRC/Sigma library (5). It is a non- thanol were added and pipetted up and down 10 times, followed parametric approach, ultimately based on gene-enrichment fi by vortexing for 1 min. Afterward puri cation steps followed the analysis methodology with a consideration of the entire list of protocol of RNeasy Plus Micro kit, with 20 ng carrier RNA shRNAs and several hairpin shRNA features.
Load more

Recommended publications
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Further Delineation of Chromosomal Consensus Regions in Primary
    Leukemia (2007) 21, 2463–2469 & 2007 Nature Publishing Group All rights reserved 0887-6924/07 $30.00 www.nature.com/leu ORIGINAL ARTICLE Further delineation of chromosomal consensus regions in primary mediastinal B-cell lymphomas: an analysis of 37 tumor samples using high-resolution genomic profiling (array-CGH) S Wessendorf1,6, TFE Barth2,6, A Viardot1, A Mueller3, HA Kestler3, H Kohlhammer1, P Lichter4, M Bentz5,HDo¨hner1,PMo¨ller2 and C Schwaenen1 1Klinik fu¨r Innere Medizin III, Zentrum fu¨r Innere Medizin der Universita¨t Ulm, Ulm, Germany; 2Institut fu¨r Pathologie, Universita¨t Ulm, Ulm, Germany; 3Forschungsdozentur Bioinformatik, Universita¨t Ulm, Ulm, Germany; 4Abt. Molekulare Genetik, Deutsches Krebsforschungszentrum, Heidelberg, Germany and 5Sta¨dtisches Klinikum Karlsruhe, Karlsruhe, Germany Primary mediastinal B-cell lymphoma (PMBL) is an aggressive the expression of BSAP, BOB1, OCT2, PAX5 and PU1 was extranodal B-cell non-Hodgkin’s lymphoma with specific clin- added to the spectrum typical of PMBL features.9 ical, histopathological and genomic features. To characterize Genetically, a pattern of highly recurrent karyotype alterations further the genotype of PMBL, we analyzed 37 tumor samples and PMBL cell lines Med-B1 and Karpas1106P using array- with the hallmark of chromosomal gains of the subtelomeric based comparative genomic hybridization (matrix- or array- region of chromosome 9 supported the concept of a unique CGH) to a 2.8k genomic microarray. Due to a higher genomic disease entity that distinguishes PMBL from other B-cell non- resolution, we identified altered chromosomal regions in much Hodgkin’s lymphomas.10,11 Together with less specific gains on higher frequencies compared with standard CGH: for example, 2p15 and frequent mutations of the SOCS1 gene, a notable þ 9p24 (68%), þ 2p15 (51%), þ 7q22 (32%), þ 9q34 (32%), genomic similarity to classical Hodgkin’s lymphoma was þ 11q23 (18%), þ 12q (30%) and þ 18q21 (24%).
    [Show full text]
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Interconversion Between Active and Inactive TATA-Binding Protein
    1446–1459 Nucleic Acids Research, 2012, Vol. 40, No. 4 Published online 19 October 2011 doi:10.1093/nar/gkr802 Interconversion between active and inactive TATA-binding protein transcription complexes in the mouse genome Mohamed-Amin Choukrallah, Dominique Kobi1, Igor Martianov1, W. W. M. Pim Pijnappel2,4, Nikolai Mischerikow2,3, Tao Ye1, Albert J. R. Heck3,4,5, H. Th. Marc Timmers2,4 and Irwin Davidson1,* 1Institut de Ge´ ne´ tique et de Biologie Mole´ culaire et Cellulaire, CNRS/INSERM/ULP, 1 Rue Laurent Fries, 67404 Illkirch Ce´ dex, France, 2Molecular Cancer Research, University Medical Center Utrecht, Universiteitsweg 100, 3Biomolecular Mass Spectrometry and Proteomics Group, Bijvoet Centre for Biomolecular Research and Utrecht Institute for Pharmaceutical Sciences, Utrecht University, 4Netherlands Proteomics Centre and 5Centre for Biomedical Genetics, Padualaan 8, 3584 CH Utrecht, The Netherlands Received June 10, 2011; Revised September 12, 2011; Accepted September 13, 2011 ABSTRACT preinitiation complex comprising B-TFIID that primes the promoter for productive preinitiation The TATA binding protein (TBP) plays a pivotal role complex formation in mammalian cells. in RNA polymerase II (Pol II) transcription through incorporation into the TFIID and B-TFIID complexes. The role of mammalian B-TFIID composed of TBP INTRODUCTION and B-TAF1 is poorly understood. Using a com- Accurate initiation of transcription by RNA polymerase plementation system in genetically modified mouse II (Pol II) requires the assembly of the multiprotein cells where endogenous TBP can be condi- preinitiation complex (PIC) on the core promoter around tionally inactivated and replaced by exogenous the mRNA start site (1–3). Amongst the basal transcrip- mutant TBP coupled to tandem affinity purification tion factors in this process is the TFIID complex com- and mass spectrometry, we identify two TBP prising the TATA binding protein (TBP) and a set of 13–14 TBP-associated factors (TAFs) (4–7).
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Original Article Diagnostic and Prognostic Values of Forkhead Box D4 Gene in Colonic Adenocarcinoma
    Int J Clin Exp Pathol 2020;13(10):2615-2627 www.ijcep.com /ISSN:1936-2625/IJCEP0117403 Original Article Diagnostic and prognostic values of forkhead box D4 gene in colonic adenocarcinoma Qiu-Xia Li1, Ning-Qin Li2, Jin-Yuan Liao2 1Department of Health Management and Division of Physical Examination, The First Affiliated Hospital of Guangxi Medical University, Nanning 530021, Guangxi Zhuang Autonomous Region, People’s Republic of China; 2Department of Radiology, The First Affiliated Hospital of Guangxi Medical University, Nanning 530021, Guangxi Zhuang Autonomous Region, People’s Republic of China Received July 2, 2020; Accepted August 31, 2020; Epub October 1, 2020; Published October 15, 2020 Abstract: Previous studies found that Forkhead box D4 (FOXD4) overexpressed in human colorectal cancer had the worst prognosis. However, the diagnostic value and further mechanism have not been fully researched. Statistical examinations for FOXD4 expression colon adenocarcinoma (COAD) patients were obtained from The Cancer Genome Atlas (TCGA). Survival analysis was used to assess its prognostic value. Nomogram model was used for visual pre- diction of patient survival rate. The online functional enrichment analysis tool was used to evaluate the biological functions and pathways of FOXD4 and its co-expressed genes. Receiver operating characteristic curve analysis suggested that FOXD4 might be a diagnostic biomarker for COAD (P<0.001, area under the curve [AUC]=0.728, 95% confidence interval [CI]=0.669-0.787). Low expression ofFOXD4 was associated with a good clinical outcome (P=0.001, HR=0.517, 95% CI=0.341-0.782). A total of 797 genes were correlated with FOXD4 and associated with cell proliferation, cell differentiation, nuclear matrix, Rap1 signaling pathway, RNA transport, and VEGF signaling pathway.
    [Show full text]
  • Supplemental Materials Supplemental Table 1
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2016 Supplemental Materials Supplemental Table 1. The differentially expressed proteins from rat pancreas identified by proteomics (SAP vs. SO) No. Protein name Gene name ratio P value 1 Metallothionein Mt1m 3.35 6.34E-07 2 Neutrophil antibiotic peptide NP-2 Defa 3.3 8.39E-07 3 Ilf2 protein Ilf2 3.18 1.75E-06 4 Numb isoform o/o rCG 3.12 2.73E-06 5 Lysozyme Lyz2 3.01 5.63E-06 6 Glucagon Gcg 2.89 1.17E-05 7 Serine protease HTRA1 Htra1 2.75 2.97E-05 8 Alpha 2 macroglobulin cardiac isoform (Fragment) 2.75 2.97E-05 9 Myosin IF (Predicted) Myo1f 2.65 5.53E-05 10 Neuroendocrine secretory protein 55 Gnas 2.61 7.60E-05 11 Matrix metallopeptidase 8 Mmp8 2.57 9.47E-05 12 Protein Tnks1bp1 Tnks1bp1 2.53 1.22E-04 13 Alpha-parvin Parva 2.47 1.78E-04 14 C4b-binding protein alpha chain C4bpa 2.42 2.53E-04 15 Protein KTI12 homolog Kti12 2.41 2.74E-04 16 Protein Rab11fip5 Rab11fip5 2.41 2.84E-04 17 Protein Mcpt1l3 Mcpt1l3 2.33 4.43E-04 18 Phospholipase B-like 1 Plbd1 2.33 4.76E-04 Aldehyde dehydrogenase (NAD), cytosolic 19 2.32 4.93E-04 (Fragments) 20 Protein Dpy19l2 Dpy19l2 2.3 5.68E-04 21 Regenerating islet-derived 3 alpha, isoform CRA_a Reg3a 2.27 6.74E-04 22 60S acidic ribosomal protein P1 Rplp1 2.26 7.22E-04 23 Serum albumin Alb 2.25 7.98E-04 24 Ribonuclease 4 Rnase4 2.24 8.25E-04 25 Cct-5 protein (Fragment) Cct5 2.24 8.52E-04 26 Protein S100-A9 S100a9 2.22 9.71E-04 27 Creatine kinase M-type Ckm 2.21 1.00E-03 28 Protein Larp4b Larp4b 2.18 1.25E-03
    [Show full text]
  • INO80C Remodeler Maintains Genomic Stability by Preventing Promiscuous Transcription at Replication Origins
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cell Rep Manuscript Author . Author manuscript; Manuscript Author available in PMC 2020 October 07. Published in final edited form as: Cell Rep. 2020 September 08; 32(10): 108106. doi:10.1016/j.celrep.2020.108106. INO80C Remodeler Maintains Genomic Stability by Preventing Promiscuous Transcription at Replication Origins Salih Topal1,4, Christopher Van1,4, Yong Xue2,3,4, Michael F. Carey2,*, Craig L. Peterson1,5,* 1Program in Molecular Medicine, University of Massachusetts Medical School, 373 Plantation Street, Worcester, MA 01605, USA 2Department of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles, CA 90095, USA 3Jiangsu Key Laboratory of Marine Pharmaceutical Compound Screening, Jiangsu Ocean University, Lianyungang 222005, China 4These authors contributed equally 5Lead Contact SUMMARY The proper coordination of transcription with DNA replication and repair is central for genomic stability. We investigate how the INO80C chromatin remodeling enzyme might coordinate these genomic processes. We find that INO80C co-localizes with the origin recognition complex (ORC) at yeast replication origins and is bound to replication initiation sites in mouse embryonic stem cells (mESCs). In yeast· INO80C recruitment requires origin sequences but does not require ORC· suggesting that recruitment is independent of pre-replication complex assembly. In both yeast and ESCs· INO80C co-localizes at origins with Mot1 and NC2 transcription factors· and genetic studies suggest that they function together to promote genome stability. Interestingly· nascent transcript sequencing demonstrates that INO80C and Mot1 prevent pervasive transcription through origin sequences· and absence of these factors leads to formation of new DNA double-strand breaks.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Open Huisinga Thesis Revisions Full All
    The Pennsylvania State University The Graduate School Department of Biochemistry and Molecular Biology GLOBAL REGULATION OF GENE EXPRESSION IN SACCHAROMYCES CEREVISIAE VIA TATA BINDING PROTEIN REGULATORY FACTORS A Thesis in Biochemistry, Microbiology, and Molecular Biology by Kathryn L. Huisinga Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2005 The thesis of Kathryn L. Huisinga was reviewed and approved* by the following: B. Franklin Pugh Professor of Biochemistry and Molecular Biology Thesis Advisor Chair of Committee Joseph C. Reese Associate Professor of Biochemistry and Molecular Biology Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Naomi S. Altman Associate Professor of Statistics Robert A. Schlegal Professor of Biochemistry and Molecular Biology Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School ABSTRACT The TATA Binding Protein (TBP) is a key component of gene regulation. It binds to the promoter region of eukaryotic genes and facilitates assembly of the transcription initiation machinery, including RNA Polymerase II. Many proteins interact with TBP to both positively and negatively regulate gene expression. My thesis utilized genome-wide expression profiling in Saccharomyces cerevisiae to define the target genes of, and relationships between, the factors that regulate transcription via TBP. I found the SAGA and TFIID co-activator complexes, both of which can deliver TBP to promoters, make overlapping contributions to the expression of nearly all yeast genes. The SAGA complex functions predominantly at ~10% of the genome, targeting genes that contain TATA boxes and are up regulated upon an environmental stress response.
    [Show full text]