Supporting Information Zhang et al. 10.1073/pnas.1309725110 SI Methods selection (day 6 postinfection), the cells were differentiated into Cell Culture and Neural Differentiation. The human embryonic stem NPCs using noggin induction (150 ng/mL) for 10 d then the cells cell (hESC) lines H1 (WA01) and H9 (WA09), both from WiCell, were gently propagated using Accutase and grown further on poly-L- 2 were maintained in an undifferentiated state by culturing on ornithine (20 μg/mL)/fibronectin (1.7 μg/cm )-coated plates in NPC Matrigel-coated plates (Becton & Dickinson) in feeder-free and medium with basic FGF (10 ng/mL) for 2 wk more before harvesting serum-free, component-defined conditions. H1 was cultured in the samples for RNA extraction or immunostaining (see below); (ii) DMEM/F12 medium with supplement components described for each shRNA a simultaneous cell culture was also maintained in previously (1); H9 was cultured in mTeSR medium (Stem Cell hESC medium to maintain pluripotency. The pluirpotent cells were Technologies). The neuronal induction, propagation and char- cultured for 24 d with medium change every 2 d. At the end of the acterization of neuronal progenitor cells (NPCs) were carried experiment cell lysates were collected in TRIzol reagent (In- out as we and others previously described (1, 2). vitrogen) and kept at −80 °C for RNA extraction. Viral Infection of hESCs. Pooled shRNA library screening. Colonies of FACS Sorting. Live neural cell surface antigen staining using anti- hESC maintained on Matrigel (BD Biosciences) were pretreated polysialylated neural cell adhesion molecule (anti–PSA-NCAM) for 1 h with 10 μM Y27632 compound (Calbiochem), dissociated antibody was performed as described by Pruszak et al. (3) with with Accutase (Millipore) and single-cell suspension of un- minor modifications. In preliminary experiments the concentra- differentiated hESCs were infected with pools of the pLKO.1- tion of primary and secondary antibodies were titrated for based lentiviral short hairpin RNA (shRNA) library targeting the specificity using isotype-specific antibody controls along with entire human genome [MISSION library, Sigma-Aldrich, origi- hESCs and their derived NPCs. Briefly, for large-scale, pre- nally from The RNA1 Consortium (TRC)/Broad Institute]. For parative FACS all of the infected NPCs cultured under puro- one viral pool (1/10th of the human genome, ∼8,600 distinct mycin selection for 4 wk were quickly digested at 37 °C using shRNAs with four to five different shRNAs targeting the same Accutase (Millipore) and collected in sterile tubes containing gene) we infected 1 × 108 undifferentiated hESCs prepared as FACS buffer [2% (vol/vol) BSA (Invitrogen) in HBSS (Gibco- a single-cell suspension, such that that at least 300 cells are in- Invitrogen)]. Following centrifugation at 100 × g for 4 min at fected with the same single species of viral particle when using a +4 °C, the pellets were resuspended in FACS buffer, triturated multiplicity of infection of 0.3. Forty-eight hours later the cells were with a glass pipet, and filtered using a 40-μm sterile strainer (BD split and an aliquot (∼5 × 107 cells) was collected for a time 0 (T0) Biosciences). A total of 2.5 × 107 cells were resuspended in 2.5 input reference; the rest of the cells cultured further in plurip- mL FACS buffer. After removing aliquots for unstained control otent condition. Because the pLKO.1 backbone harbors the and unsorted cells, the cell suspensions were incubated with puromycin resistance gene, the uninfected cells were eliminated anti–PSA-NCAM IgM monocolonal antibody (Millipore; 1:250 by adding this chemical (1 μg/mL) at 72 h after the infection. The dilution) for 30 min at 4 °C using gentle rotation. Following rest of the cell population was expanded for an additional 3 d as a wash with washing buffer [0.1% (vol/vol) BSA in HBSS], the pluripotent cells then divided into two experimental arms: (i) cells were incubated with Alexa-488 secondary antibody (1:500 propagated in a condition that maintains undifferentiated state dilution) for 20 min at +4 °C in the dark. The cell suspensions and (ii) differentiated into neuronal precursors/progenitors using were washed twice using washing buffer containing 0.1% BSA, a monolayer approach (1, 2). Puromycin selection was main- then sorted into three populations, PSA-NCAM–negative, tained throughout the entire experiment. The pluripotent arm of weakly positive, and PSA-NCAM strongly positive cells by pre- the experiment performed in parallel served as additional con- parative FACS sorting using a VantageSE sorter. trol to obtain a time course of for self-renewal and overall cel- lular survival. The undifferentiated cells were maintained in DNA Extraction, PCR Amplification Adapted for Deep Sequencing. To pluripotent ES medium, and ∼5 × 107 cells were collected every extract genomic DNA, lysis buffer (50 mM Tris, pH 7.5, 50 mM 5–6 d for genomic DNA extraction, over a total of 4 wk. For EDTA, pH 8.0, 100 mM NaCl, 5 mM DTT, 0.5 mM Spermidine- neuronal differentiation, cells were cultured in NPC medium HCl, 1% SDS) was added to the various cell samples. The cell [DMEM/F12 (Gibco-Invitrogen) containing 2% (vol/vol) B27 lysates were de-proteinized by incubation with 100 μL proteinase supplement and 1% (vol/vol) from a 10,000 units/mL penicillin K (10 mg/mL) overnight at 55 °C followed by RNase A (0.1 mg/ and 10,000 μg/mL streptomycin stock solution] in the presence of mL) treatment at 37 °C for half an hour. Finally, phenol-chloro- noggin (R&D Systems; 100 ng/mL) for 14 d before the cells were form and ethanol precipitation was used to extract genomic DNA. split and transferred to poly-L-ornithine (20 μg/mL)/fibronectin (3 A total of 3.0 μg gDNA for each experimental group was μg/cm2) -coated flasks, and maintained in NPC medium with a low PCR-amplified to recover shRNA inserts for deep sequencing. concentration of recombinant human basic FGF (Millipore) (10 The PCR was performed in multiple tubes, each with 50–100 ng ng/mL) but without noggin for another 33 d before live-cell FACS gDNA, 200 nM dNTPs, 200 nM forward (5′ AATGATACGG- sorting. The experimental schedule is illustrated by Fig. 1B. CGACCACCGATTCTTGGGTAGTTTGC) and reverse primers Individual viral shRNA infection. We infected undifferentiated H1 or (5′ CAAGCAGAAGACGGCATACGACTGCCATTTGTCTCG) H9 hESCs as single cell suspensions plated in multiwell plates containing Illumina Genome Analyzer II adapter sequences, 0.6 μL with viral lysates of individual pLKO.1-based shRNAs with DMSO, and 0.6 U Phusion Polymerase (New England Biosciences). a multiplicity of infection of 2. Two to three shRNA species The PCR program setting was 98 °C for 2 min, 26 cycles of 98 °C for targeting different regions of the same gene were used. As done at 30 s, 60 °C for 15 s, and 72 °C for 15 s, and then 72 °C for 5 min. The the primary screen with the pooled library, 72 h after transduction PCR products were pooled together and purified using MinElute puromycin (1 μg/mL) was added to each well, and this selection columns (Qiagen) before running onto a 2% (wt/vol) E-gel (In- was maintained throughout the rest of the experiment. To test vitrogen) and the PCR products were cut out and purified using a the effects of individual shRNAs, two parallel experiments were MinElute gel purification kit (Qiagen). The PCR products were performed: (i) after recovery from the infection and puromycin then sequenced using Illumina GAII with a customer designed Zhang et al. www.pnas.org/cgi/content/short/1309725110 1of13 sequencing primer (5′ TCTTGTGGAAAGGACGAAACACC- protein (TARDBP) immunostaining the cells were permeabilized GG) to capture the sequences of shRNA inserts (single-end, with 0.2% Triton X-100 and washed first before blocking; the 36-bp sequencing). PSA-NCAM immunostaining was performed without any de- tergent present. The following primary antibodies and dilutions RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR. For were used: PSA-NCAM (mouse mAb IgM, Chemicon; 1:175), cells cultured in pluripotent condition, total RNA was extracted NESTIN (mouse mAb, Millipore; 1:200), SOX1 (goat pAb, R&D with the TRIzol reagent (Invitrogen), then treated with DNase I Systems; 1:20), TARDBP (rabbit pAb, Proteintech; 1:100). Pri- fi and puri ed using an RNeasy mini kit (Qiagen). Differentiated mary antibodies were incubated overnight at + 4 °C and after – NPCs had a limited number of cells (20 5,000 per well), thus our washing the cells were incubated with the respective fluorescence- fi modi ed RNA extraction protocol was used using reagents of labeled secondary antibodies for 1 h at room temperature. After the RNeasy Plus Micro kit (Qiagen) (4). In brief, for samples washing and mounting Zeiss Apotome fluorescent microscope μ with less than 200 cells, 200 L of RLT Plus Lysis Buffer with providing optical sectioning was used for image acquisition. 2-mercaptoethanol (Qiagen) was added, the cells were re- suspended and vortexed at speed 8 on an SP vortex mixer Statistical Analyses. The statistical approach RIGER was de- – (Boxter) for 30 times, each for 1 s. For samples with 200 1,000 veloped at the Broad Institute specifically for pooled library μ cells and 350 L of RLT Plus Lysis Buffer with 2-mercaptoe- screening strategy using the TRC/Sigma library (5). It is a non- thanol were added and pipetted up and down 10 times, followed parametric approach, ultimately based on gene-enrichment fi by vortexing for 1 min. Afterward puri cation steps followed the analysis methodology with a consideration of the entire list of protocol of RNeasy Plus Micro kit, with 20 ng carrier RNA shRNAs and several hairpin shRNA features.