Convergent Evolution of Genes Controlling Mitonuclear Balance in Annual Fishes
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology
Cancer Research and Treatment 2003;35(4):304-313 New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology Yong-Wan Kim, Ph.D.1, Min-Je Suh, M.S.1, Jin-Sik Bae, M.S.1, Su Mi Bae, M.S.1, Joo Hee Yoon, M.D.2, Soo Young Hur, M.D.2, Jae Hoon Kim, M.D.2, Duck Young Ro, M.D.2, Joon Mo Lee, M.D.2, Sung Eun Namkoong, M.D.2, Chong Kook Kim, Ph.D.3 and Woong Shick Ahn, M.D.2 1Catholic Research Institutes of Medical Science, 2Department of Obstetrics and Gynecology, College of Medicine, The Catholic University of Korea, Seoul; 3College of Pharmacy, Seoul National University, Seoul, Korea Purpose: This study utilized both mRNA differential significant genes of unknown function affected by the display and the Gene Ontology (GO) analysis to char- HPV-16-derived pathway. The GO analysis suggested that acterize the multiple interactions of a number of genes the cervical cancer cells underwent repression of the with gene expression profiles involved in the HPV-16- cancer-specific cell adhesive properties. Also, genes induced cervical carcinogenesis. belonging to DNA metabolism, such as DNA repair and Materials and Methods: mRNA differential displays, replication, were strongly down-regulated, whereas sig- with HPV-16 positive cervical cancer cell line (SiHa), and nificant increases were shown in the protein degradation normal human keratinocyte cell line (HaCaT) as a con- and synthesis. trol, were used. Each human gene has several biological Conclusion: The GO analysis can overcome the com- functions in the Gene Ontology; therefore, several func- plexity of the gene expression profile of the HPV-16- tions of each gene were chosen to establish a powerful associated pathway, identify several cancer-specific cel- cervical carcinogenesis pathway. -
Unravelling the Cellular Origin and Clinical Prognostic Markers of Infant
Published Ahead of Print on January 24, 2019, as doi:10.3324/haematol.2018.206375. Copyright 2019 Ferrata Storti Foundation. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis by Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam Haematologica 2019 [Epub ahead of print] Citation: Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis Haematologica. 2019; 104:xxx doi:10.3324/haematol.2018.206375 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Screening of a Clinically and Biochemically Diagnosed SOD Patient Using Exome Sequencing: a Case Report with a Mutations/Variations Analysis Approach
The Egyptian Journal of Medical Human Genetics (2016) 17, 131–136 HOSTED BY Ain Shams University The Egyptian Journal of Medical Human Genetics www.ejmhg.eg.net www.sciencedirect.com CASE REPORT Screening of a clinically and biochemically diagnosed SOD patient using exome sequencing: A case report with a mutations/variations analysis approach Mohamad-Reza Aghanoori a,b,1, Ghazaleh Mohammadzadeh Shahriary c,2, Mahdi Safarpour d,3, Ahmad Ebrahimi d,* a Department of Medical Genetics, Shiraz University of Medical Sciences, Shiraz, Iran b Research and Development Division, RoyaBioGene Co., Tehran, Iran c Department of Genetics, Shahid Chamran University of Ahvaz, Ahvaz, Iran d Cellular and Molecular Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran Received 12 May 2015; accepted 15 June 2015 Available online 22 July 2015 KEYWORDS Abstract Background: Sulfite oxidase deficiency (SOD) is a rare neurometabolic inherited disor- Sulfite oxidase deficiency; der causing severe delay in developmental stages and premature death. The disease follows an auto- Case report; somal recessive pattern of inheritance and causes deficiency in the activity of sulfite oxidase, an Exome sequencing enzyme that normally catalyzes conversion of sulfite to sulfate. Aim of the study: SOD is an underdiagnosed disorder and its diagnosis can be difficult in young infants as early clinical features and neuroimaging changes may imitate some common diseases. Since the prognosis of the disease is poor, using exome sequencing as a powerful and efficient strat- egy for identifying the genes underlying rare mendelian disorders can provide important knowledge about early diagnosis, disease mechanisms, biological pathways, and potential therapeutic targets. -
A Genome-Wide Association Study of Asthma Symptoms in Latin American Children Gustavo N
Costa et al. BMC Genetics (2015) 16:141 DOI 10.1186/s12863-015-0296-7 RESEARCH ARTICLE Open Access A genome-wide association study of asthma symptoms in Latin American children Gustavo N. O. Costa1*, Frank Dudbridge12, Rosemeire L. Fiaccone2, Thiago M. da Silva1, Jackson S. Conceição2, Agostino Strina1, Camila A. Figueiredo3, Wagner C. S. Magalhães4, Maira R. Rodrigues4, Mateus H. Gouveia4, Fernanda S. G. Kehdy4, Andrea R. V. R. Horimoto5, Bernardo Horta6, Esteban G. Burchard7, Maria Pino-Yanes7, Blanca Del Rio Navarro8, Isabelle Romieu9, Dana B. Hancock10, Stephanie London8, Maria Fernanda Lima-Costa11, Alexandre C. Pereira11, Eduardo Tarazona4, Laura C Rodrigues13 and Mauricio L. Barreto1,14 Abstract Background: Asthma is a chronic disease of the airways and, despite the advances in the knowledge of associated genetic regions in recent years, their mechanisms have yet to be explored. Several genome-wide association studies have been carried out in recent years, but none of these have involved Latin American populations with a high level of miscegenation, as is seen in the Brazilian population. Methods: 1246 children were recruited from a longitudinal cohort study in Salvador, Brazil. Asthma symptoms were identified in accordance with an International Study of Asthma and Allergies in Childhood (ISAAC) questionnaire. Following quality control, 1 877 526 autosomal SNPs were tested for association with childhood asthma symptoms by logistic regression using an additive genetic model. We complemented the analysis with an estimate of the phenotypic -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name FAST kinase domain-containing protein 1 Gene Symbol Fastkd1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191738 UniGene ID Rn.226110 Ensembl Gene ID ENSRNOG00000024335 Entrez Gene ID 311112 Assay Information Unique Assay ID qRnoCEP0034063 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000036585 Amplicon Context Sequence AAAAAAAAAAACTACAGTCATGATCTGCCTGCTCCAAATATCTGTTCTCTCAGGTA GTCCATCCGTGTATCCTTCGTTGACATTGCCATGGAGTTCCA Amplicon Length (bp) 68 Chromosome Location 3:62537455-62537552 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 23.19 cDNA Tm (Celsius) 79 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Fastkd1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. -
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr. -
Characterization and Proteomic-Transcriptomic Investigation of Monocarboxylate Transporter 6 Knockout Mice
Supplemental material to this article can be found at: http://molpharm.aspetjournals.org/content/suppl/2019/07/10/mol.119.116731.DC1 1521-0111/96/3/364–376$35.00 https://doi.org/10.1124/mol.119.116731 MOLECULAR PHARMACOLOGY Mol Pharmacol 96:364–376, September 2019 Copyright ª 2019 by The American Society for Pharmacology and Experimental Therapeutics Characterization and Proteomic-Transcriptomic Investigation of Monocarboxylate Transporter 6 Knockout Mice: Evidence of a Potential Role in Glucose and Lipid Metabolism s Robert S. Jones, Chengjian Tu, Ming Zhang, Jun Qu, and Marilyn E. Morris Department of Pharmaceutical Sciences, School of Pharmacy and Pharmaceutical Sciences, University at Buffalo, State University of New York, Buffalo, New York (R.S.J., C.T., J.Q., M.E.M.); and New York State Center of Excellence in Bioinformatics and Life Sciences, Buffalo, New York (C.T., M.Z., J.Q.) Received March 21, 2019; accepted June 27, 2019 Downloaded from ABSTRACT Monocarboxylate transporter 6 [(MCT6), SLC16A5] is an or- Mct62/2 mice demonstrated significant changes in 199 genes phan transporter with no known endogenous substrates or in the liver compared with Mct61/1 mice. In silico biological physiological role. Previous in vitro and in vivo experiments pathway analyses revealed significant changes in proteins and molpharm.aspetjournals.org investigated MCT6 substrate/inhibitor specificity in Xenopus genes involved in glucose and lipid metabolism–associated laevis oocytes; however, these data remain limited. Transcrip- pathways. This study is the first to provide evidence for an tomic changes in the livers of mice undergoing different dieting association of Mct6 in the regulation of glucose and lipid schemes have suggested that Mct6 plays a role in glucose metabolism. -
(12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al
US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al. -
Gene Ontology Functional Annotations and Pleiotropy
Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question -
Genetic Variation As a Tool for Identifying Novel Transducers of Itch
Genetic variation as a tool for identifying novel transducers of itch By Takeshi Morita A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair Professor John Ngai Professor Kristin Scott Professor Michael W. Nachman Summer 2016 Abstract Genetic variation as a tool for identifying novel transducers of itch by Takeshi Morita Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair The mammalian somatosensory system mediates itch, the irritating sensation that elicits a desire to scratch. Millions of people worldwide suffer from chronic itch that fails to respond to current drugs and therapies. Even though recent studies have begun to elucidate the basic characteristics of the itch circuitry, we have little understanding about the molecules and signaling mechanisms that underlie detection and transduction of itch sensation, especially during chronic itch conditions. We have taken a genomic approach by harnessing natural variation in itch-evoked scratching behaviors in mice to identify novel molecular players that are involved in itch signal transduction at the level of primary sensory neurons. From our analysis, we identified numerous candidate itch genes, and further identified a serotonin receptor, HTR7 as a key transducer that is required for both development and maintenance of chronic itch. We further investigated the genetic basis of variation in itch, and identified a set of genes and regulatory pathways that may be involved in controlling itch behaviors. -
Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael
Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Mary-Claire King, Chair Akiko Shimamura Marshall Horwitz Program Authorized to Offer Degree: Molecular and Cellular Biology 1 ©Copyright 2015 Michael Yu Zhang 2 University of Washington ABSTRACT Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang Chair of the Supervisory Committee: Professor Mary-Claire King Department of Medicine (Medical Genetics) and Genome Sciences Bone marrow failure and myelodysplastic syndromes (BMF/MDS) are disorders of impaired blood cell production with increased leukemia risk. BMF/MDS may be acquired or inherited, a distinction critical for treatment selection. Currently, diagnosis of these inherited syndromes is based on clinical history, family history, and laboratory studies, which directs the ordering of genetic tests on a gene-by-gene basis. However, despite extensive clinical workup and serial genetic testing, many cases remain unexplained. We sought to define the genetic etiology and pathophysiology of unclassified bone marrow failure and myelodysplastic syndromes. First, to determine the extent to which patients remained undiagnosed due to atypical or cryptic presentations of known inherited BMF/MDS, we developed a massively-parallel, next- generation DNA sequencing assay to simultaneously screen for mutations in 85 BMF/MDS genes. Querying 71 pediatric and adult patients with unclassified BMF/MDS using this assay revealed 8 (11%) patients with constitutional, pathogenic mutations in GATA2 , RUNX1 , DKC1 , or LIG4 . All eight patients lacked classic features or laboratory findings for their syndromes.