MECHANISMS FOR THE REGULATION OF PRO-DEATH
GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE NUCLEAR
ACCUMULATION IN RETINAL MÜLLER CELLS UNDER HIGH
GLUCOSE CONDITIONS
By
E. CHEPCHUMBA KOECH YEGO
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Dissertation Advisor: Susanne Mohr, PhD
Department of Physiology and Biophysics
CASE WESTERN RESERVE UNIVERSITY
May, 2010 2
CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
____E Chepchumba Koech Yego______candidate for the _____Doctor of Philosophy (PhD)______degree *.
(signed) _____Corey Smith ______
(chair of the committee)
______Cathleen Carlin______
______Joseph LaManna______
______Carole Liedtke ______
______Andrea Romani______
______Michael Simonson _ _
______Susanne Mohr ______
(date) _____March 11th, 2010______
*We also certify that written approval has been obtained for any proprietary material contained therein. 3
Dedication This dissertation is dedicated to my grandparents Mark Tireito *, Dinah
Tireito *, Asbel Cheruiyot, Hannah Cheruiyot*, and John Korir.
*Deceased 4
TABLE OF CONTENTS
Dedication ...... 3
List of Figures ...... 8
List of Tables ...... 12
Acknowledgments ...... 13
List of Abbreviations ...... 14
Abstract ...... 16
INTRODUCTION ...... 18
GENERAL INTRODUCTION ...... 19
DIABETES MELLITUS ...... 19
DIABETES COMPLICATIONS ...... 20
DIABETIC RETINOPATHY ...... 21
RETINAL STRUCTURE AND FUNCTION ...... 28
RETINAL MÜLLER CELLS ...... 29
HYPERGLYCEMIA-INDUCED DYSFUNCTIONS IN RETINAL MÜLLER CELLS ...... 30
GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE (GAPDH) ...... 33
ALTERNATIVE FUNCTIONS OF GAPDH ...... 33
GAPDH AND CELL DEATH ...... 35
SEVEN IN ABSENTIA HOMOLOG-1 (SIAH-1) ...... 37
GAPDH NUCLEAR ACCUMULATION IS ACTIVATED BY A WIDE VARIETY OF
STIMULI ...... 39
PRO-INFLAMMATORY INTERLEUKIN-1 ΒETA SIGNALING ...... 40
IL-1 ΒETA IN DIABETIC RETINOPATHY ...... 41 5
OVERALL GOALS OF THIS DISSERTATION ...... 42
CHAPTER 2: MATERIALS AND METHODS...... 51
MATERIALS ...... 52
METHODS ...... 53
CHAPTER 3: DIFFERENTIAL REGULATION OF HIGH GLUCOSE-
INDUCED GAPDH NUCLEAR ACCUMULATION IN MÜLLER CELLS BY
INTERLEUKIN-1 ΒETA AND INTERLEUKIN-6 ...... 69
INTRODUCTION ...... 70
RESULTS ...... 72
High Glucose Exposure Leads to IL-1β, IL-6, But No TNF-α
Production by Müller Cells...... 72
IL-1β Initiates GAPDH Nuclear Accumulation in Retinal Müller Cells…
...... 72
GAPDH Nuclear Accumulation is IL-1β Concentration and Time
Dependent...... 73
IL-1β Induces Caspase Activation and Cell Death in Müller Cells. ... 74
Blocking IL-1 Receptor Action Prevents High Glucose-Induced
GAPDH Nuclear Accumulation in Retinal Müller Cells...... 75
Caspase-1 Inhibition Prevents High Glucose-Induced GAPDH
Nuclear Accumulation in Retinal Müller Cells...... 76
IL-6 Attenuates IL-1β and High Glucose-Induced GAPDH Nuclear
Accumulation in Retinal Müller Cells...... 76 6
TNFα Does Not Induce GAPDH Nuclear Accumulation in Retinal
Müller Cells...... 77
DISCUSSION ...... 78
FIGURES ...... 83
CHAPTER 4: SEVEN IN ABSENTIA HOMOLOG-1 PROTEIN IS
NECESSARY FOR HIGH GLUCOSE-INDUCED GAPDH NUCLEAR
ACCUMULATION AND CELL DEATH IN MÜLLER CELLS ...... 98
INTRODUCTION ...... 99
RESULTS ...... 101
Effect of High Glucose on Siah- 1 Expression in rMC-1 ...... 101
Determination of Siah-1 Levels and Localization in hMCs...... 101
Detection of High Glucose-Induced GAPDH-Siah-1 Complex in the
Nucleus of rMC-1 ...... 102
Effect of Siah-1 Knock-Down by Siah-1 siRNA on Siah-1 and GAPDH
Protein Levels ...... 103
Effect of Siah-1 Knock-Down on GAPDH Nuclear Accumulation
...... 104
GAPDH-Siah-1 Interaction is Necessary for GAPDH Nuclear
Accumulation...... 105
The Role of Siah-1 Knock-Down on p53 Phosphorylation Under High
Glucose Conditions...... 106
Effect of Siah-1 Knock-Down on High Glucose-Induced Cell Death in
Müller Cells...... 107 7
DISCUSSION ...... 108
FIGURES ...... 113
CHAPTER 5: MECHANISMS OF HIGH GLUCOSE-INDUCED CELL
DEATH OF RETINAL MÜLLER CELLS ...... 129
INTRODUCTION ...... 130
RESULTS ...... 134
Müller Cells do not Undergo Apoptotic Cell Death despite Decreased
Müller Cell Viability under High Glucose Conditions...... 134
Caspase-1 Inhibition Prevents Müller Cell Death Under High Glucose
Conditions...... 135
High Glucose-Induced Mitochondrial Activation in Müller Cells is
attenuated by Caspase-1 Inhibition ...... 136
High Glucose Exposure Leads to Increased Müller Cell Autophagy In
Vitro...... 137
Diabetes-Induced Müller Cell Loss In Vivo is Caspase-1/IL-1β
Signaling-Dependent...... 138
DISCUSSION ...... 139
FIGURES ...... 144
CHAPTER 6: SUMMARY, DISCUSSION AND FUTURE DIRECTION
...... 152
SUMMARY ...... 153
DISCUSSION ...... 155
Regulation of Pro-Death GAPDH Nuclear Accumulation...... 155 8
GAPDH Nuclear Functions ...... 157
IL-6 and its Protective Effects ...... 158
Pyroptosis and Autophagy during High Glucose-Induced Müller Cell
Death ...... 160
FUTURE STUDIES ...... 161
Mechanism for IL-6-Mediated Protection ...... 161
Nuclear GAPDH during Disease Development ...... 163
APPENDIX 1-COPYRIGHT PERMISSION ...... 168
REFERENCES...... 171
List of Figures
Figure 1. 1. Percentage of US Population with Diagnosed Diabetes ...... 44
Figure 1. 2. A Schematic Section through the Human Eye with
Enlargement of the Retina ...... 45
Figure 1. 3. Retina as Seen Through an Ophthalmoscope ...... 46
Figure 1. 4. Retinal Müller Cells Structure ...... 47
Figure 1. 5. Diabetic Retinopathy Flow Chart-What we Know From Animal
(Rodent) Studies ...... 48
Figure 1. 6. Glycolysis ...... 49
Figure 1. 7. How Does High Glucose Activate GAPDH Nuclear
Accumulation and Cell Death? ...... 50
Figure 3. 1. IL-1β Induces GAPDH Nuclear Accumulation in rMC-1...... 83 9
Figure 3. 2. IL-1β Induces GAPDH Nuclear Accumulation in Primary
Human Retinal Müller Cells ...... 85
Figure 3. 3. IL-1β Induces GAPDH Nuclear Accumulation in a
Concentration and Time Dependent Manner in rMC-1 ...... 87
Figure 3. 4. IL-1β Induces Activation of Executioner Caspases and Cell
Death in Müller Cells ...... 89
Figure 3. 5. Inhibition of the IL-1 Receptor Activation by IL-1 Receptor
Antagonist (IL-1ra) Prevents High Glucose-Induced GAPDH Nuclear
Accumulation in rMC-1 ...... 91
Figure 3. 6. Inhibition of Caspase-1 Activity Prevents High Glucose-
Induced GAPDH Nuclear Accumulation in rMC-1 and hMC cells ...... 92
Figure 3. 7. IL-6 Attenuates IL-1β and High Glucose-Induced GAPDH
Nuclear Accumulation ...... 94
Figure 3. 8. TNFα Does not Induce GAPDH Nuclear Accumulation in hMC
...... 96
Figure 3. 9: Differential regulation of GAPDH nuclear accumulation by pro- inflammatory cytokines IL-1β and IL-6...... 97
Figure 4. 1. Siah-1 is Regulated by High Glucose in Transformed Rat
Retinal Müller Cells ...... 113
Figure 4. 2. Siah-1 Levels are Increased in High Glucose-Treated Isolated
Human Müller Cells and are Localized in the Nucleus ...... 115 10
Figure 4. 3. High Glucose Induces Complex Formation Between GAPDH and Siah-1 Detectable in the Nucleus of Müller Cells ...... 117
Figure 4. 4. High Glucose-Induced GAPDH Nuclear Accumulation is
Decreased Following Siah-1 Knock-Down Using siRNA ...... 119
Figure 4. 5. Truncation of Siah-1 Prevents GAPDH Binding and
Translocation to the Nucleus ...... 121
Figure 4. 6. Siah-1 Knock-down Decreases High Glucose-Induced p53
Phosphorylation and Bax Up Regulation ...... 123
Figure 4. 7. Inhibition of High Glucose-Induced Cell Death by Siah-1
Knock-Down ...... 125
Figure 4. 8: Siah-1 Protein Facilitates Müller Cell GAPDH Nuclear
Accumulation and Cell Death under High Glucose Conditions ...... 127
Figure 5. 1. Decreased Müller Cell Viability under High Glucose
Conditions does not Result from Apoptotic Cell Death ...... 144
Figure 5. 2. High Glucose-Induced Müller Cell Death is Caspase-1-
Dependent ...... 145
Figure 5. 3. Caspase-1 Inhibition Prevents Increased rMC-1 Mitochondrial
Superoxide Production under High Glucose Conditions ...... 146
Figure 5. 4. High Glucose Treatment Activates Autophagy in rMC-1 .... 147
Figure 5. 5. Diabetes-Induced Müller Cell loss in the Retina of Diabetic
Mice is Dependent on Caspase-1/IL-1β Signaling ...... 148 11
Figure 5. 6. Mechanisms for High Glucose-Induced Müller Cell Death
...... ……..150
Figure 6. 1. Summary Scheme/Working Model for the High Glucose-
Induced Mechanism for Pro-Death GAPDH Nuclear Accumulation in
Retinal Müller Cells...... 166
Figure 6. 2. IL-6 Treatment Prevents High Glucose-Induced Caspase-1
Activity in Müller Cells ...... 167
12
List of Tables
Table 1. Rat ON-TARGET Smart Pool Siah-1 siRNA ...... 128
Table 2. Weights and Blood Glucose Levels for Normal and Diabetic Mice.
...... 151
13
Acknowledgments
I am deeply indebted to my dissertation advisor, Dr. Susanne Mohr for her guidance and interest in my development as a scientist. I would like to thank the members of my committee: Dr. Cathy Carlin, Dr. Joseph
LaManna, Dr. Carole Liedtke, Dr. Stephen Previs, Dr. Andrea Romani, Dr.
Michael Simonson and Dr. Corey Smith who have thoughtfully contributed their time and advice. I am also grateful to Dr. Scott Howell for assistance with fluorescence analysis and Mohr lab members Jason Vincent, Denise
Hatala, and Katherine Trueblood-Doreian for creating a favorable working atmosphere. To my family (Josphat, Emily, Kipruto, Chelimo, Kibet,
Naanjela, Harold, Vanessa, Sam, Helen, Timothy, Thomas, Kelvin, Susan,
Brianna), and friends, thank you for your encouragement. Finally, I would like to thank God for the health, strength, and ability to complete this project. 14
List of Abbreviations AFC 7-amino-4-trifluoromethylcoumarin
BSA Bovine Serum Albumin
CAD Caspase Activated DNAse
CDC Center for Disease Control
CHAPS 3-[(3-Cholamidopropyl)dimethylammonio]-1-
propanesulfonate
CHO Chines Hamster Ovary
DAPI 4,6’-diamidino-2-phenylindole
DMEM Dulbecco’s Modified Eagles Medium
DRAM Damage Autophagy Regulator Modulator Protein
DTT Dithiothreitol
EDTA Ethylenediaminetetraacetic Acid
FBS Fetal Bovine Serum
GAPDH Glyceraldehyde-3-Phosphate Dehydrogenase
GS Glutamine Synthetase hMC Isolated Human Müller Cells
HAT Histone Acetylation Enzyme
HEK 293 Human Embryonic Kidney 293 cells
HRP Horse Radish Peroxidase
ICAD Inhibitor of Caspase Activated DNAse
IL-1β Interleukin-1 β
IL-6 Interleukin-6
INL Inner Nuclear Layer 15 iNOS Inducible Nitric Oxide Synthetase
LC3 Light Chain 3 (Microtubule-associated protein 1)
LDH Lactate Dehydrogenase
LGN Lateral Geniculate Nucleus
LPS Lipopolysaccharide
MLI Inner Limiting Membrane
NaCl Sodium Chloride
NLS Nuclear Localization Signal
NO Nitric Oxide
NPH Neutral Protamine Hagedorn
ONL Outer Nuclear Layer
PBS Phosphate Buffered Saline
PCD Programmed Cell death
PMSF Phenylmethanesulphonylfluoride
P/S Penicillin/Streptomycin rMC-1 Transformed Rat Retinal Müller Cells
RIPA Radio-immunoprecipitation
SDS Sodium dodecyl sulfate
Siah-1 Seven in Absentia Homolog-1
STZ Streptozotocin
TNF-α Tumor Necrosis Factor α
TUNEL Terminal deoxynucleotidyl transferase dUTP nick end
labeling 16
Mechanisms for the Regulation of Pro-Death Glyceraldehyde-3-
Phosphate Dehydrogenase Nuclear Accumulation in Retinal Müller
Cells Under High Glucose Conditions
Abstract
by E. CHEPCHUMBA K. YEGO
Müller cells are the primary glia in the retina. These cells structurally and functionally maintain the retina and its vasculature. Therefore, it is possible that Müller cell dysfunctions, including cell death in a high glucose environment, contribute to the development of diabetic retinopathy. One of the changes that occur in retinal Müller cells in vitro and in vivo, under hyperglycemic conditions, is pro-death glyceraldehyde-
3-phosphate dehydrogenase (GAPDH) nuclear accumulation. Interfering with GAPDH nuclear accumulation prevents cell death, demonstrating the therapeutic potential for this pathway. The goal of my dissertation research was to determine mechanisms that regulate GAPDH nuclear accumulation, and subsequent cell death under high glucose conditions in
Müller cells. Transformed rat retinal Müller cells (rMC-l) and isolated human Müller cells (hMC) were used for our studies. Our results demonstrate that diabetic retinopathy-associated pro-inflammatory cytokines Interleukin-lβ (IL-1β) and Interleukin-6 (IL-6), differentially regulate GAPDH nuclear accumulation. Autocrine activation of the caspase-1/IL-1β signaling pathway strongly induces GAPDH nuclear accumulation and cell death while IL-6 is protective. In addition to 17
examining cytokine regulation, our studies also demonstrate that the E3 ubiquitin ligase seven in absentia homolog (siah-l) facilitates GAPDH transport into the nucleus through formation of a complex with GAPDH. In contrast to GAPDH, siah-l has a nuclear localization signal (NLS) motif which potentially activates the shuttle function of this protein. Siah-l siRNA studies confirm the necessity for this protein during GAPDH nuclear accumulation. Exclusion of GAPDH from the nucleus using siah-siRNA prevents high glucose-induced activation of a well known cell death regulator p53. Interestingly, p53 activation is also regulated by the caspase-1/IL-1β signaling pathway. Additional events regulated by caspase-l include mitochondrial superoxide production as well as cell death in vitro and cell loss in vivo. The central role for caspase-l/IL-lβ signaling during high glucose-induced Müller cell death indicates activation of pyroptosis during this process. 18
INTRODUCTION 19
General Introduction Diabetes Mellitus Diabetes Mellitus, often referred to as diabetes, is a condition characterized by chronic high blood glucose levels (fasted levels higher than 126mg/dl). The condition primarily results from defects in insulin action and/or secretion in the body. According to the Center for Disease
Control (CDC), in the year 2007 the disease affected 24 million individuals in the United States (30). This represents 8% of the total population.
According to statistics, another 57 million individuals are pre-diabetic. This is a condition whereby blood glucose levels are higher than normal but not high enough to be classified as diabetes (fasted levels 100-126mg/dl).
Taken together with trends over the last decade (Figure 1.1), a projected increase in the prevalence of the disease is anticipated (254). The projected increase in global diabetes from 2.8% in 2000 to 4.4% in 2030 demonstrates that the increase in diabetes frequency is not restricted to the United States (254). Diabetes is classified into two main categories based on the cause of the disease.
Type 1 diabetes:
Type 1 diabetes (also known as insulin-dependent diabetes) is characterized by a deficiency in the secretion of insulin, the hormone that stimulates glucose uptake from the blood by tissue. This deficiency results from the destruction of insulin-secreting pancreatic β cells 20 subsequent to an autoimmune response which is activated by environmental and/or genetic factors.
Type 2 diabetes
Type 2 (also known as noninsulin-dependent diabetes) results from defective insulin sensitivity. Various factors contribute to the development of type 2 diabetes. The major pre-disposing factors are obesity, high blood pressure and age. Genetic factors may contribute to the development of type 2 diabetes since there is a strong association between this form of diabetes and genetic variations in several genes, for example IGF2BP2,
SLC30A8 and PPAR2 (201, 204). Diabetes Complications Several complications including cardiovascular disease, neuropathy, nephropathy, retinopathy, Alzheimer’s disease, stroke, foot ulcers, and defects in wound healing are associated with diabetes.
Diabetes is also the leading cause for limb amputations in the United
States. Diabetic complications are broadly categorized as either micro- vascular or macro-vascular disease. The long list of diabetes-induced complication demonstrates that diabetes affects almost all the body organs. Despite tremendous efforts to understand the cause for these diabetes-related complications, most of the underlying mechanisms leading to the development of these complications are poorly understood.
There is currently no answer as to why some diabetic patients develop one or more complications and others develop none at all. The direct and 21 indirect economic cost of diabetes and its complications in the United
States in the year 2007 was 174 billion according to the National Diabetes
Clearing House (37). This figure is expected to rise with the projected increase in the prevalence of the disease (254). To date, there is no cure for diabetes. Strict blood glucose control has been shown to reduce the risk of developing major diabetic complications, such as nephropathy and retinopathy (71, 168). However, good blood glucose control is hard to achieve, and some diabetics still develop complications despite good blood glucose control. For most of the diabetic complications, there are insufficient treatment options available. Therefore, there is a pressing need to understand mechanisms that trigger these complications so that we can develop supplemental targeted and effective therapies. Our studies are broadly focused on understanding mechanisms involved in the development of diabetic retinopathy. Diabetic Retinopathy Diabetic retinopathy is a leading cause of blindness worldwide. The disease results from hyperglycemia-induced damage to the retina. After
15 to 20 years from the onset of diabetic retinopathy, most patients will have developed the earliest clinically detectable signs of diabetic retinopathy (118, 119). Clinical manifestations are examined using dilated pupil ophthalmoscopy (Figure 1. 3). It has been shown experimentally, that microscopic blood vessel alterations occur during the early background stage, prior to any clinical manifestation of the disease (4, 13, 22
65). The hallmark pathology of diabetic retinopathy, which can be detected during this background stage, is the formation of acellular capillaries.
Acellular capillaries are blood vessels lacking endothelial cells and are composed primarily from basement membrane due to accelerated cell death (112, 155). It is postulated that acellular capillaries lead to the clinically detectable vascular changes.
The earliest clinically detectable signs include formation of micro aneurisms and dot retinal intra-hemorrhages (63). As the disease progresses, patients develop blurred vision and glare as a result of blood and fluid leak from vessels to the tissue (63). Reduced vision and obstruction due to abnormal blood vessel growth and retinal hemorrhage are key features of the advanced sight threatening stage (63, 255). Retinal detachment leading to blindness may also occur during the advanced stages of the disease (63, 255).
Even though the clinical signs and stages of diabetic retinopathy are well described, the pathogenesis of the disease is unclear.
Nonetheless, the irreversible nature of the disease calls for early intervention. Consequently, therapies that target various events associated with early events in the background stage before clinical signs and advanced stages of diabetic retinopathy develop are being tested (4,
13, 65). Events associated with the background stages include inflammation, vascular hyper-permeability, vascular endothelial growth factor (VEGF) secretion, cell death, protein kinase C (PKC) activation, 23 increased formation of advanced glycation end (AGE) products, and increased activity of the hexosamine and polyol pathways. The listed events have been identified in diabetic rodents and seem to occur at different durations of diabetes (see Figure 1.5). Despite the progress made in understanding mechanisms underlying the development and progression of diabetic retinopathy, events that have been identified as potentially leading to disease development (as listed above) are incoherent, and cell type and animal model dependent. Therefore, a full picture of disease development is still elusive. The following provides an overview of diabetes-induced changes in the retina during the progression of diabetic retinopathy in diabetic rodents.
Studies have focused on diabetes-induced leukostasis, one of the earliest events in the development of diabetic retinopathy. Joussen et al. have reported that diabetes causes ICAM-1 (intracellular adhesion molecule-1) and CD18 (adhesion molecule expressed on monocytes and neutrophiles) upregulation, leukocytes adherence to the retinal microvasculature, and endothelial cell damage in the early stages of diabetic retinopathy in diabetic rats (105). Diabetes-induced leukocyte adherence was present in arterioles, venules, and capillaries. Inhibition of either ICAM-1 or CD18 by systemically injecting neutralizing antibodies against these surface markers in diabetic rats prevented leukocyte adherence to retinal endothelial cells and endothelial cell damage in all blood vessel types. Blocking of CD18 did not prevent diabetes-induced 24 leukocyte adhesion and endothelial cell damage in the arterioles of the retina but did so in retinal venules and capillaries.
Increased vascular permeability 2 months after the onset of diabetes is also classified as one of the earliest detectable changes in the diabetic retina (54, 188, 221). This hyper-permeability results from previously mentioned leukostasis, cytokine secretion, and VEGF secretion at this time point (3, 54, 113, 123, 163, 188, 221). Even though VEGF secretion is detected between 1 and 2 months, mRNA up regulation is evident as early as 1 week following the onset of diabetic retinopathy
(188). Cytokines detectable 2 months after the onset of diabetic retinopathy include IL-1β, IL-6, and TNFα (22, 107, 124, 176, 242). Müller cells, astrocytes, and retinal pigment epithelial (RPE) cells are key sources for these cytokines (3, 22, 124, 128, 242, 261). Strong caspase-1 activation, which is a precursor to IL-1β secretion, also occurs at this time point (242). In addition to caspase-1 activation, hyperglycemia induces activation of NFB, a transcription factor that has been implicated in the regulation of cytokine production (123). Retinal VEGF and cytokines are also increased due to decreased retinal docosahexaenoic acid (DHA) and very-long-chain polyunsaturated fatty acids (PUFA), following hyperglycemia-induced dyslipidimia in the retina (232).
Ganglion cell loss, which begins a few weeks after the onset of diabetes, is also evident at 2-3 ½ months of diabetes. However, this early loss of ganglion cells is currently disputed since it is not present in all 25 animal models of diabetic retinopathy and seems to depend on the strain and species used for experiments. Müller cell death, as determined by electron microscopy was detectable at 4 months of diabetes in diabetic rats (58, 91, 92, 144). Pro-death GAPDH nuclear accumulation has also been observed in retinal Müller cells at this time point in diabetic mice and rats indicating that Müller cells loss is a key event in the progression of diabetic retinopathy (131).
In addition to pro death and pro-inflammatory events, several biochemical events are strongly associated with the pathogenesis and development of experimental diabetic retinopathy. These include Protein
Kinase C (PKC) activation, increased amounts of advanced glycation end products (AGE) as well as activation of the polyol and hexosamine pathway. Mitochondrial superoxide production in the diabetic retina precedes these biochemical events (17, 80). Hyperglycemia induces de novo synthesis of diacyl glycerol (DAG) in the retina within two weeks of diabetes (21). This elevation in DAG levels leads to PKC activation 2 months after the onset of diabetes (97, 117, 126, 127). Even though several isoforms of PKC are elevated in the diabetic retina, the development of retinopathy is primarily associated with the activation of
PKCδ and PKCβ. Non-enzymatic glycation of proteins and lipids with reducing sugars also leads to formation of advanced glycation end product
(AGE) in retinal vesicles at this time point (82, 220). Activation of the 26 receptor of AGE (RAGE) by AGE is strongly associated with the development of experimental diabetic retinopathy (10, 178).
Retinal neuron cell death and the development of experimental diabetic retinopathy are also linked to activation of the hexosamine pathway (80, 167). During this process, fructose-6- phosphate is converted to UDP-N-acetylglucosamine (UDP-GlcNAc) through a series of enzymatic steps. O-GlcNAc transferase (OGT) then catalyzes a reversible post-translational protein modification through the addition of N- acetylglucosamine (GlcNAc) to protein serine and threonines residues.
This post-translational modification has been implicated in the development of diabetic complications (17). Elevation of intracellular glucose levels also activates the polyol pathway at 3 months of diabetes, leading to higher sorbitol concentration which is thought to lead to the development of diabetic complications (7). The rate limiting enzyme in the polyol pathway is aldose reductase.
Several events which are first seen at 2 months are still activated after 6 months of diabetes. These changes include caspase-1 activation,
IL-1β secretion, VEGF secretion, increased vascular permeability, dyslipidemia, activation of the polyol pathway as well as PKC activation
(80, 81, 113, 221, 242).
Development of experimental diabetic retinopathy as established by the formation of acellular capillaries occurs between 6 and 9 months (112,
155, 242). Genetic and drug studies have shown that interfering with 27 leukostasis, caspase-1 activation, IL-1β signaling, PKC activation, polyol pathway activation, AGE formation and mitochondrial superoxide production prevents this pathology (4, 18, 54, 82, 107, 113, 123, 242).
Based on these observations, several compounds that block these pathways have been approved for clinical studies (4, 65, 255).
Most studies to understand the development and progression of diabetic retinopathy have been performed in streptozotocin-injected rats and mice (streptozotocin=STZ; a drug that destroys pancreatic β cells and mimic type 1 diabetes). There are only very few studies in relation to diabetic retinopathy in type 2 diabetic animals. The scheme in Figure 1.5 summarizes events discussed above during the progression of diabetic retinopathy in STZ diabetic rats and mice. Although the rodent models for diabetic retinopathy help to understand diabetes-induced events in the background stages of the disease, these rodent models do not develop the irregular sight threatening neo-vascularization observed during the advanced stages of the diseases in humans. Therefore, formation of acellular capillaries is the accepted parameter for confirmation of the development of diabetic retinopathy in animal models.
Although diabetic retinopathy was originally characterized as a vascular disease, several retinal cell types including photoreceptors, astrocytes, pericytes, and Müller cells undergo pathological changes due to high glucose in the diabetic retina (58, 137, 144, 180, 184, 222). These observations led to the new idea that diabetic retinopathy is a 28 neurodegenerative disease. Our studies are interested in the contribution of Müller cell dysfunction during the development of the disease. Müller cells are unique in that they are the only retinal cell type that has contact with all neuroretinal cells as well as the retinal micro-vasculature.
Dysfunctional Müller cells have the potential to affect maintenance of the retinal vasculature leading to retinal pathology observed in diabetic retinopathy.
Retinal Structure and Function The retina processes visual images prior to transmission of information to the visual cortex in the brain. This highly structured tissue is composed of several layers and various cell types including neurons
(photoreceptors, amacrine, horizontal, and ganglion), glial cells
(astrocytes, microglia and Müller cells) endothelial, and retinal pigment epithelial cells (Figure 1.2B). With the exception of Müller cells, each cell type is restricted to a specific layer. The order for these layers is: 1) Inner limiting membrane (MLI) that separates the most proximal boundary of the retina and the vitreous humor and contains the end feet of Müller cells, 2) the nerve fiber layer composed from axons of the ganglion cells and astrocyte cell bodies and processes, 3) ganglion cell layer, 4) inner plexiform layer composed of the processes of ganglion bipolar and amacrine cells, 5) the inner nuclear layer (INL), that consists of cell bodies from amacrine, bipolar, Müller and horizontal cells, 6) the outer plexiform layer that contains the processes of horizontal bipolar and photoreceptors, 29
7) the outer nuclear layer (ONL) containing nuclei of photoreceptors, 8) the external limiting membrane, 9) the photoreceptor layer and 10) the retinal pigment epithelial layer.
The optic nerve which is located at the center of the retina (Figure
1.3) is made up of axons from the retinal ganglion cells. This nerve transmits visual information from the retina to a visual information processing center; the lateral geniculate nucleus (LGN) located in the thalamus of the brain. LGN neurons transmit information to the primary visual cortex.
The optic nerve head also coincides with the entry point for the central retinal artery. This artery is one of two major blood supply sources in the mammalian retina. It progressively branches off in a radial manner
(Figure 1.3) so as to efficiently nourish the inner layers of the retina including the MLI, nerve fiber layer, ganglion layer and INL. The second set of blood vessels that supplies the retina; the choroidal blood vessels maintain the outer retinal layers. Visual impairment from diabetic retinopathy results from changes to the vasculature under hyperglycemic conditions.
Retinal Müller Cells Müller cells are the primary glia in the retina and maintain the integrity of the retina and its microvasculature (49, 109, 153, 172, 191,
197, 203, 235). These cells are unique in that they span the entire retina 30
(Figure 1.4). The outer limiting membrane of the retina is composed from the inner segments of photoreceptor cells and tightly interacting Müller cells while the inner limiting membrane is composed of basement membrane and Müller cell end feet. Müller cells have several housekeeping functions. These cells, which are highly glycolytic, provide metabolic support to neighboring energy-demanding neurons by releasing lactate (185, 237). In addition to providing metabolic substrates for neurons, they take up and recycle excessive glutamine from the extracellular spaces (146, 192, 253). Additional regulation of neuronal excitability by Müller cells is achieved by their potential to release factors, for example D serine, that control excitability (173). Further, Müller cells take up excess K+ in the extracellular retinal space and participate in the regulation of retinal water and ion homeostasis (171, 172). Another function for these cells is the maintenance of the blood retinal barrier, through physical interaction and secretion of factors that induce formation of tight junctions (49, 235).
Studies demonstrating increased retinal degeneration following selective elimination of Müller cells in vivo indicate that retinal Müller cells play a central role in maintaining this tissue (53). Therefore, cell loss in the diabetic retina may compromise the integrity of this tissue during the development of diabetic retinopathy.
Hyperglycemia-Induced Dysfunctions in Retinal Müller Cells 31
Most of the studies performed to understand the consequence of elevated glucose levels on Müller cell function have been done using in vitro (cell culture) systems. Several hyperglycemia-induced dysfunctions in these cells have been reported (131, 135, 247, 258). Defects in the glutamate transporter shortly after the onset of experimental diabetes result in excessive extracellular glutamate (187, 247). It has been speculated that elevated glutamate levels may worsen oxidative stress in the diabetic retina (187). Hyperglycemia also induces the production of pro-inflammatory cytokines by retinal Müller cells which has led to the notion that Müller cells are a key source for pro-inflammatory cytokines detected in the diabetic retina of mice, rats, and humans (1, 22, 106, 158,
242, 260). Furthermore, endothelial cell death under hyperglycemic conditions result primarily from paracrine effects of high glucose-induced cytokine secreted by other retinal cells, including Müller cells and retinal pigment epithelial cells (22).
Several events associated with hyperglycemia-mediated cell death of Müller cells have also been shown. These include, decreased viability of Müller cells as determined by trypan blue viability assays, increased phosphatidylserine exposure as determined by Annexin V staining, glyceraldehydes-3-phosphate dehydrogenase (GAPDH) nuclear accumulation, decreased amounts of pro-survival protein Akt , increased cytochrome-c release, as well as increased activity of the cell death enzymes caspase-3 and caspase-6 in retinal Müller cells cultured under 32 high glucose in vitro (131, 242, 258). Surprisingly, there have been only a few in vivo studies performed to investigate Müller cell behavior and function in diabetic retinopathy.
Two studies utilizing electron microscopy have demonstrated fragmented Müller cells clearly undergoing cell death in the retina of diabetic rats as early as 4 months duration of diabetes. In retinal areas where Müller cell death was visible, vascular abnormalities like capillary basement thickening and sacking of the vasculature were also observed
(91, 92). It was speculated in these studies that loss of Müller cells participates in aneurism formation in diabetic retinopathy. At 4 months of diabetes, increased numbers of Müller cells showing GAPDH nuclear accumulation have been demonstrated in rat and mice retinas (131). The strongest evidence yet for Müller cell death during diabetic retinopathy stems from studies demonstrating that retinas from diabetic mice (7 months diabetes) have fewer Müller cells compared to age-matched controls (see Chapter 5-Figure 5.5). In view of the fact that these cells in general are important for blood barrier maintenance, Müller cell loss may compromise the integrity of the vasculature, thus leading to the vascular leakage and hemorrhaging associated with diabetic retinopathy. However, the exact mechanism by which Müller cell death occurs is unclear.
Understanding this mechanism is crucial to identifying cellular targets at which cell death can be halted and new potential treatments can be developed. One of the earlier events during hyperglycemia-induced Müller 33 cell death both in vitro and in vivo is the nuclear accumulation of the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
(131).
Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) The glycolytic enzyme GAPDH is commonly associated with the reversible conversion of glyceraldehyde-3-phosphate to 1,3- bisphosphoglycerate during glycolysis (Figure 1.5). This is the 5th step during the glycolytic process and the first NADH generating process. The catalytically active structure of GAPDH is a homotetramer of 37 KDa subunits. Under basal/normal conditions GAPDH is predominantly localized in the cytosol where all the glycolytic steps occur. Glycolytically active GAPDH has also been detected in the plasma membrane of erythrocytes as a complex with other glycolytic enzymes and in contact with the glucose transporter GLUT-1(25, 88). This protein is frequently considered a housekeeping gene/protein since it is constitutively expressed at high levels in many cell types and tissues (8). Nonetheless, there is considerable variability in the expression levels of this enzyme in various tissues with the highest expression levels occurring in energy demanding tissues, for example brain and skeletal muscle (8).
Alternative Functions of GAPDH In addition to its glycolytic function, GAPDH participates in various cellular functions including DNA repair, nucleo-cytosolic t-RNA transport, 34 vesicle formation and transport, microtubule bundling, endocytosis, and cell death (16, 151, 214-216).
During DNA repair, GAPDH acts as a uracil DNA glycosylase, excising the nucleotide uracil from DNA in order to prevent mutations (11).
DNA bound GAPDH also protects and maintains the telomeres thus reducing the rate of senescence (46, 225). GAPDH regulates endocytosis as demonstrated by studies indicating that a GAPDH-transferrin interaction is necessary for endocytosis-mediated uptake of iron by macrophages (190). During endoplasmic reticulum (ER) to Golgi vesicular transport, GAPDH participates in Rab2-mediated retrograde transport from vesicular tubular clusters (VTCs) by facilitating retrieval of COP-1 transport machinery from secretory vesicles back to the ER (234). GAPDH phosphorylation by the kinase src is necessary for this process.
Furthermore, membrane-bound GAPDH participates in the maturation of late endocytic compartments in Chinese hamster ovary (CHO) cells (193).
GAPDH together with other glycolytic enzymes assemble as a complex on erythrocyte membranes (25). It is postulated that membrane localization of this enzyme increases the efficiency of energy-demanding membrane proteins for example the NA+/K+ pump, by increasing the proximity of the
ATP supply (150). GAPDH also interacts with the glucose transporter
GLUT-1 in erythrocytes. This interaction may increase the efficiency of
ATP generation following glucose uptake (88). 35
The potential for GAPDH to distinguish, bind, and transport export- competent nuclear tRNA to the cytosol demonstrates a role for this protein during tRNA nucleo-cytosolic transport (214). The glycolytic cofactor nicotinamide adenine dinucleotide disrupts complex formation between tRNA and GAPDH, indicating that GAPDH-mediated t-RNA transport possibly involves this co-factor’s binding site (214). This enzyme also regulates the rate of microtubule bundling, a process that controls microtubule association and dissociation during various cellular processes, including vesicular transport and cytokinesis (164, 193).
GAPDH and Cell Death Most of the “death” functions for GAPDH are centered on its translocation from the cytosol to the nucleus and accumulation within the nucleus. GAPDH nuclear accumulation has been observed in a variety of cell types (23, 34, 35, 57, 83, 86, 87, 98-100, 110, 131, 199, 207, 216,
217, 230). Pro-death GAPDH nuclear accumulation was first identified in cortical cerebellar neurons undergoing age-induced and cytosine arabinonucleoside–induced apoptosis (99, 100, 101). Further studies have demonstrated this cell death phenomenon in various cell types including neurons (83, 87), retinal ganglion cells (115), isolated thymocytes (200), dopaminergic neurons (68), hepatocytes (9), retinal Müller cells (131) and insulin secreting β cells (23). Additional studies have demonstrated
GAPDH nuclear accumulation in fibroblast (44, 148, 202, 210), macrophages (83) prostate epithelial cells (57), adrenal 36 pheochomocytoma (PC12)(200, 210) and human embryonic kidney (HEK
293) cells (200, 210). The activation of pro-death GAPDH nuclear accumulation in a wide variety of cells indicates that it is a common cell death response.
In vivo, GAPDH nuclear accumulation has been associated with the pathogenesis and development of various degenerative diseases like
Alzheimer’s disease (42, 148), Parkinson’s disease (230), Huntington’s disease (147), stroke (227), and diabetic retinopathy (131). Studies using the monoamino oxidase (MAO-B) inhibitor R-(-)-deprenyl to chemically inhibit GAPDH nuclear accumulation have shown the potential for therapies that target this pathway during the treatment of neurodegenerative disease (87,21,22). R-(-)-deprenyl also prevents
GAPDH nuclear accumulation and subsequent cell death in retinal Müller cells cultured in a high glucose environment (131). A precise understanding of this pathway will uncover additional molecular targets that will aid the development of targeted therapies through intelligent drug design.
The exact mechanism of pro-death GAPDH translocation from the cytosol to the nucleus is undefined primarily because the protein lacks a nuclear localization signal (NLS). However, studies have proposed a role for the NLS-containing E3 ubiquitin ligase seven in absentia homolog-1
(siah-1) during lipopolysaccharide (LPS)-induced pro-death GAPDH nuclear accumulation in neurons and macrophages (83). According to 37 these studies, LPS induces GAPDH-siah-1 interaction and complex formation following GAPDH s-nitrosylation under these conditions. NLS- containing siah-1 then translocates in a complex with GAPDH to the nucleus. Whether cell death resulting from nuclear GAPDH translocation is contingent on nuclear siah-1 remaining as a complex with GAPDH has yet to be determined.
Very little is known about the action of GAPDH in the nucleus. It is known that the function of GAPDH in the nucleus is independent of its glycolytic function in the cytosol. Recently, it has been demonstrated that initiation of cell death involves activation of p53 via acetylation by p300/CBP, subsequent to GAPDH-mediated activation of these acetylation enzymes (207). Simply localizing GAPDH in the nucleus does not seem to lead to cell death as demonstrated by observations in neurons that made use of NLS-tagged GAPDH (120). Post-translational modifications including ribosylation, s-nitrosylation, O-GlcNAcylation, and carbonylation have been discussed to be important for nuclear import and the cell death functions of this protein (52, 83, 86, 110, 179). A lot of focus has been given to GAPDH s-nitrosylation. This NO-dependent process has been implicated in the formation of a complex between GAPDH and
NLS-bearing protein siah-1 which acts as a GAPDH nuclear shuttle (23,
52, 83, 86, 199, 207).
Seven in Absentia Homolog-1 (Siah-1) 38
Recent studies have described a function for the E3 ubiquitin ligase seven in absentia homolog-1 as a GAPDH nuclear shuttle during cell death (83). This protein contains a nuclear localization signal which facilitates this function. Based on Psort II prediction, this motif is localized between residues 230 and 233. Siah proteins are human homologues of the evolutionarily conserved drosophila E3 ubiquitin ligase seven in absentia (sina) protein. Two siah proteins, siah-1 and siah-2, are present in humans and rats, while mice have three siah genes, siah-1a, siah-1b, and siah-2. Siah-1a and siah-1b contain 98% homology.
E3 ubiquitin ligases function in concert with E1 ubiquitin activating enzymes and E2 ubiquitin conjugating enzymes to tag proteins with ubiquitin during ubiquitin-dependent proteosomal degradation. Sina was first identified as a key protein during R7 photoreceptor development in the drosophila fruit fly whereby it facilitates the degradation of the transcriptional repressor of neuronal fate tramtrack (TTK88) (28, 96, 228).
Follow up studies have identified several siah/sina substrates. These include: the mitotic protein Kid (73), group1 metabotropic glutamate receptors (162), netrin receptor (96), and syniphilin-1 (136, 165).
Transcriptional regulators that are degraded by sina/siah-1 proteins in the nucleus include the CtBP- interacting protein (CtIP) (74). However, the nuclear substrates for siah-1 following its translocation into the nucleus in complex with GAPDH (as well as possible nuclear substrates of GAPDH) are unknown. Whether or not this pathway contributes to high glucose- 39 induced pro-death GAPDH nuclear accumulation in Müller cells was a major focus of my studies. Identifying a potential trigger of siah-1 up regulation and GAPDH nuclear accumulation was another important point investigated in studies described later in this dissertation.
GAPDH Nuclear Accumulation is Activated by a Wide Variety of Stimuli Induction of GAPDH nuclear accumulation occurs following stimulation by a wide variety of stimuli. These include cytosine arabinonucleoside (99-102), N-methyl-(R)-salsolinol (endogenous neurotoxin) in human dopaminergic neurons (145), staurosporine or
MG132, as well oxidative stress ( hydrogen peroxide or ferricyanide) in neuroblastoma and fibroblast cells (44). The list of stimulant also includes
1-methyl-4-phenylpyridinium (MPP+)-induced death of mesencephalic dopaminergic neurons (68) and human neuroblastoma cells (209) and the aforementioned high glucose in retinal Müller cells (131). Several studies have demonstrated that inflammatory agents, for example lipopolysaccharide, and the pro-inflammatory cytokine IL-1β, activate
GAPDH nuclear accumulation (23, 83).
Although the triggers for the activation of GAPDH nuclear accumulation are diverse, nitric oxide (NO) appears to play a central role during this process (24, 84, 85, 87, 199, 205). One of the well known NO inducers is the pro-inflammatory IL-1β signaling pathway which activates
GAPDH nuclear accumulation in insulin secreting RINm5 cells (24). 40
Interestingly, the IL-1β signaling pathway has been strongly associated with the development of diabetic retinopathy (72, 124, 125,
242). Therefore, our studies were focused on a possible role for this particular pro-inflammatory cytokine on GAPDH nuclear accumulation in retinal Müller cells under high glucose conditions.
Pro-Inflammatory Interleukin-1β Signaling IL-1β affects cells in multiple fashions. There are 2 forms of biologically active IL-1 (α and β), which are initially synthesized as 35 kDa precursor that are processed to 17 kDa mature forms by distinct processing enzymes. Precursor IL-1α is cleaved by a calpain-like enzyme, whereas precursor IL-1β is processed by caspase-1 (also known as interleukin-1 converting enzyme/ICE). The biological activity of IL-1β is mediated by binding to a specific cell surface receptor (IL-1R1). Two homologous receptors (type I and type II) have been identified, which can bind either form of IL-1, although with different affinities (6). It has been shown that type I IL-1R is the only receptor capable of mediating signaling. Type II acts as a “decoy” receptor (213). IL-1β stimulates key pro-inflammatory regulators for example phosholipase A2, cyclooxygenase 2, prostaglandins, nitric oxide, and matrix metalloproteinases (194). It also induces the cytokines IL-6, TNFα, as well as itself (14, 36, 218). Cytokines such as IL-1β and TNFα have been associated with the induction of oxidative stress and mitochondrial death pathway (77). Recent studies have stressed the importance and central 41 role of caspase-1 (formerly known as ICE, interleukin-1β converting enzyme) and its product IL-1β during the activation of a newly described form of cell death termed pyroptosis (39, 59, 142, 262). This form of cell death is primarily characterized by caspase-1 activation and IL-1β production and release. IL-1β in Diabetic Retinopathy Increases in IL-1β levels have been shown in vitreous fluid of diabetic patients and in retinas of STZ diabetic rats and mice (1, 27, 124,
156, 242). In vivo experiments in diabetic animals have demonstrated that the activation of the pro-inflammatory caspase-1/IL-1β signaling pathway plays a central role in the development and progression of diabetic retinopathy. Diabetes leads to a strong caspase-1 activation and IL-1β production at 8 weeks of diabetes in the retina of mice. The activation of the caspase-1/IL-1β pathways is still detectable at 6 months of diabetes and inhibition of the caspase-1/IL-1β signaling pathway prevents pathology associated with diabetic retinopathy, demonstrating the central role for this pathway during the development of the disease (242). As already stated above, strong caspase-1 activation has been described in
Müller cells subjected to high glucose (158, 242). Activation of this pathway led to cell death in Müller cells. Hyperglycemia-induced IL-1β production has also been demonstrated in retinal astrocytes and pericytes suggesting that increased levels of IL-1β are a major outcome of 42 hyperglycemia in the retina. The effect of increased IL-1β levels on retinal function and survival have not been explored and studied in detail.
Overall Goals of This Dissertation Based on knowledge from previous studies that hyperglycemia leads to caspase-1 activation and IL-1β production in retinal Müller cells, and recent findings that IL-1β can induce GAPDH nuclear accumulation, a pathway closely associated with cell death induction, this dissertation was focused on:
Identifying whether the caspase-1/IL-1β signaling pathway can
induce GAPDH nuclear accumulation in retinal Müller cells and
testing the effect of other pro-inflammatory cytokines, such as
TNFα and IL-6 (all members of the “triumvirate” of acute pro-
inflammatory cytokines), on GAPDH nuclear translocation.
Identifying whether high glucose-induced GADPH nuclear
translocation and subsequent cell death in Müller cells is mediated
via an autocrine IL-1β feed-back mechanism.
Determining whether the E3 ubiquitin ligase siah-1, which in
contrast to GAPDH contains a nuclear localization signal, acts as a
carrier protein for GAPDH mediating transport of GAPDH from the
cytosol to the nucleus under high glucose conditions in Müller cells. 43
Examining Müller cell loss in vivo in the retina of diabetic animals
and identifying whether Müller cell loss is dependent on the
hyperglycemia-induced activation of the caspase-1/IL-1β signaling
pathway. If so, this would indicate the potential activation of a newly
described type of cell death known as pyroptosis which is per
definition mediated by strong and fast activation of caspase-1 and
release of IL-1β.
Three Specific Aims were proposed for this study:
Specific Aim 1: Establish the role of diabetic retinopathy-associated cytokines on GAPDH sub-cellular localization and cell death in retinal Müller cells during high glucose-induced cell death.
Specific Aim 2: Investigate a possible role for the E3 ubiquitin ligase siah-1 during high glucose-induced GAPDH nuclear accumulation and subsequent cell death in retinal Müller cells.
Specific Aim 3: Identify whether pyroptotic cell death mediates hyperglycemia–induced Müller cell loss by examining the requirement for caspase-1/IL-1β signaling during retinal Müller cell death under high glucose in vitro, as well as diabetes-induced cell loss in vivo. 44
Figure 1. 1. Percentage of US Population with Diagnosed Diabetes (29).
Reference 29. CDC. Diabetes is Common, Disabling, Deadly, and On the Rise [online]. http://wwwcdcgov/Features/dsDiabetesTrends/, Retrieved November 10, 2009. Image used with permission- Appendix 1 45
A)
B)
Figure 1. 2. A Schematic Section through the Human Eye with Enlargement of the Retina
(A) Cross section of the human eye with magnification of the retina.
Retinal enlargement image demonstrates angle of light entry (250).
(B) Cross section of the human retina demonstrating various cell types
localized to distinct retinal layers (252) .
Reference 250. Webvision. Section Through the Human Eye and Retina [online]. http://webvisionmedutahedu/imageswv/Sagschemjpeg, Retrieved January 4, 2009. 252. Webvision. Simple Organization of the Retina [online]. http://webvisionmedutahedu/imageswv/schemjpeg, Rerieved January 19, 2009. Images used with permission- Appendix 1 46
Figure 1. 3. Retina as Seen Through an Ophthalmoscope Human retina and vasculature as observed through an opthalmoscope during a dilated pupil exam (251).
Reference 251. Webvision. Simple Anatomy of the Retina [online]. http://webvisionmedutahedu/imageswv/huretinajpeg, Retrieved January 15, 2009. Image used with permission- Appendix 1 47
A) B)
Figure 1. 4. Retinal Müller Cells Structure (A) Schematic drawing of the relationship between Müller cells and other retinal neurons (249).
(B) Vertical view of golgi stained retinal Müller glial cells (248).
Reference 249. Webvision. Mueller Cell Golgi Stain [online]. http://webvisionmedutahedu/imageswv/Müller jpeg, Retrieved January 19, 2009. 248. Webvision. Relationship Between Mueller Cell and Other Retinal Neurons [online]. http://webvisionmedutahedu/imageswv/Reichembjpeg, Retrieved January19, 2009. Images used with permissions- Appendix 1
48
VEGF Up Regulation and Secretion Formation of Acellular Caspase-1 Activation Capillaries
IL-1β, TNF-α, Caspase-1 Activation IL-6 Secretion IL-1β Secretion Vascular Permeability Müller Cell Death and VEGF Secretion GAPDH Nuclear Leukostasis Accumulation Müller Cell Loss
↑ICAM Vascular Permeability
Ganglion Cell Loss Capillary Cell Death
Diabetes 1 m 2 m 3 m 4 m 5 m 6 m 7 m 8 m 9m Onset Dislipidemia Dislipidemia PKC ↓ DHA → ↑ASM ↓ DHA → ↑ASM Activation PKC Activation AGE Formation
AGE Formation Hexosamine Pathway Polyol Pathway ↓Transketolase Activity Figure 1. 5. Diabetic Retinopathy Flow Chart-What we Know From Animal (Rodent) Studies 49
ATP Glucose ADP Hexokinase Glycolysis Glucose-6-phosphate Phosphoglucose isomerase Fructose-6-phosphate ATP Phosphofructokinase-1 ADP Fructose-1,6-phosphate Aldolase
Triosephosphate isomerase Dihydroxyacetone Glyceraldehyde-3-phosphate phosphate P +NAD+ i GAPDH NADH 1,3-Bisphosphoglycerate ADP Phosphoglycerate kinase ATP 3-Phosphoglycerate Phosphoglyceromutase 2-Phosphoglycerate Enolase Phosphoenolpyruvate ADP Pyruvate kinase ATP Pyruvate Figure 1. 6. Glycolysis GAPDH catalyses the reversible conversion of Glyceraldehyde-3- phosphate to 1-3 bisphosphoglyerate which is the first NADH generating step during the glycolytic process. 50
HIGH GLUCOSE
? GAPDH
GAPDH
Nucleus
CELL DEATH Müller Cells
Figure 1. 7. How Does High Glucose Activate GAPDH Nuclear Accumulation and Cell Death?
The goal of this study will be to determine the mechanism for GAPDH nuclear accumulation and subsequent cell death under high glucose conditions in retinal Müller cells. 51
CHAPTER 2: Materials and Methods 52
Materials Cytokine LINCOplex kits were purchased from Millipore (St. Louis,
MO) while IL-1β and monoclonal mouse anti GAPDH antibody was purchased from Chemicon International (Temecula, CA). 7-amino-4- trifluoro-methylcoumarin (AFC) was from Sigma-Aldrich Chemical Co. (St.
Louis, MO). The caspase-1 inhibitor YVAD-fmk, caspase substrates (AFC coupled), and monoclonal mouse anti vimentin antibody were obtained from Calbiochem (San Diego, CA). IL-1 receptor antagonist (IL-1ra),
TNFα, IL-6 and polyclonal rabbit anti goat antibody conjugated to horse radish peroxidase (HRP) were purchased from R&D systems
(Minneapolis, MN). Monoclonal mouse anti histone 2B antibody was from
MBL laboratories (Naka-ku Nagoya, Japan). Polyclonal rabbit anti GAPDH antibody and polyclonal rabbit anti lactate dehydrogenase antibody were from Abcam (Cambridge, MA). Polyclonal goat anti mouse IgG conjugated to Texas red, polyclonal goat anti rabbit antibody conjugated to Oregon green and polyclonal rabbit anti goat antibody conjugated to Alexa 594 were from Invitrogen Inc. (Carlsbad, CA). Polyclonal goat anti siah-1 antibody and polyclonal goat anti mouse IgG conjugated to horseradish peroxidase (HRP) was from Santa Cruz Biotechnology Inc. (Santa Cruz,
CA). Polyclonal rabbit anti phospho p53-s15 and polyclonal rabbit anti p53 antibodies were purchased from Cell Signaling (Danvers, MA). Rabbit anti
Bax (polyclonal) was from BD Biosciences (San Jose, CA). Polyclonal rabbit anti LC3 was purchased from Abgent (San Diego, CA). Smart pool 53 siah-1 targeting siRNA, control non-targeting scrambled and risc free siRNA oligonucleotides were from Dharmacon (Lafayette, CO). Amaxa nucleofection kit L was purchased from Lonza (Cologne, Germany).
Methods Tissue culture: rMC-1: the transformed rat retinal Müller cell line (rMC-1) has been established by others and us as a useful tool for retinal Müller cell studies (131, 158, 198). rMC-1 were maintained in normal (5mM) glucose Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with
10% (FBS) and 1% penicillin/streptomycin (P/S) at 37°C and 5% CO2 in a humidified incubator. Experiments were done with passages lower than
25. Experimental conditions utilized normal (5mM) or high (25mM) glucose
DMEM supplemented with 2% FBS and 1%P/S for treatment conditions.
Human retinal Müller cells (hMC): Handling of human tissue conformed to the tenets of Declaration of Helsinki for research involving human tissue. hMC were generated from retinal tissue isolated from healthy donors with no history of diabetes. Retinal tissue was mechanically homogenized and homogenates treated with 0.1% trypsin for 1 hour. Following trypsinization, cells were plated in DMEM/Ham’s F12 (1:1 ratio, 17.8mM glucose) supplemented with 20% FBS and 1% P/S. After 24 hours, high trypsin-high FBS media was replaced with regular hMC growth media
(DMEM/Ham’s F12 (1:1 ratio), 7.8mM glucose) supplemented with 10%
FBS and 1% penicillin/streptomycin. hMC which are resistant to high trypsin concentrations, were trypsin purified (0.25% trypsin) during 54 subsequent passages. After the third passage, cell cultures were 95% pure for Müller cells. hMC cells were characterized as described previously (131, 187) using vimentin and CRALBP immunofluorescence as positive stains to identify Müller cells and GFAP as a negative control.
For experimental conditions cells were switched to normal DMEM/ HAMS
FI2 (1:1 ratio) containing (7.8mM) or high (25mM) glucose DMEM supplemented with 2% FBS and 1%P/S.
Cytokine treatment: rMC-1 (1x106) and hMC (5x105) were incubated in experimental medium (described above) supplemented with 2% FBS containing normal 5mM (rMC-1) or 7.8mM (hMC) glucose or normal glucose plus IL-1β, TNFα, or IL-6 (1ng/ml up to 10ng/ml) for 24 hours
(rMC-1) or 48 hours (HMC).
High glucose treatment: rMC-1 (1x106) and hMC (5x105) were treated in
DMEM medium supplemented with 2% FBS and 1% P/S containing high
(25mM) glucose or high (25mM) glucose plus individual treatments, such as IL-1 receptor blocker (IL-1ra: 50ng/ml, concentration determined by
ED50 based on IL-1β release, pre-incubated in 5mM glucose DMEM supplemented with 0.1% bovine serum albumin (BSA) and 1% P/S for 1 hour before high glucose treatment), caspase-1 inhibitor (YVAD-fmk,
100µM), or IL-6 (2ng/ml) for 24 hours (rMC-1) or 48 hours (hMC). Cells treated in normal glucose served as control. 55
For experiments going beyond 24 hour treatments, medium was changed every day to ensure glucose availability at the end of the respective experiments.
Measurement of cytokines: rMC-1 (1x106) and hMC (5x105) were treated with normal or high glucose media as described above. Following treatment, medium was removed and retained, cells were lysed, and protein content was determined using the Bradford assay. Cytokine concentrations in retained medium were determined using a human or rat cytokine LINCOplex kit (Millipore) according to the manufacturer’s instructions. Briefly, 75 µl of medium were incubated with 25 µl of beads pre-coated with individual cytokines (IL-1β, TNFα, IL-6) in a 96 well plate for overnight at 4ºC. Plates were washed, developed using detection antibody (1 hour, room temperature) and streptavidin solution, and analyzed using the Luminex compact analyzer. Values were compared to standard curve of individual cytokines, normalized to protein concentrations, and expressed as pg/ml/mg protein.
Immunofluorescence analysis: rMC-1 (5.0 x 104) or hMC (3.0 x 104) plated on glass cover slips were treated with normal or high glucose for 24
(rMC-1) or 48 (hMC) hours. Following treatment, cells were fixed in a solution of freshly prepared 4% paraformaldehyde for 10 minutes at room temperature and rinsed twice with PBS. Cells were permeabilized with ice cold acetone for 10 minutes, blocked with 1% BSA in PBS-T, and incubated over night at 4o C with commercially available antibodies 56 against GAPDH (1:800 dilution). For siah-1 primary antibody (1:200 dilution), cells were incubated at 4o C for at least 48 hours. Cells were then rinsed twice with PBS and incubated in either 5% rabbit serum (siah-1) or
5% goat serum (GAPDH) in 1% BSA/PBS for 30 minutes, followed by 1 hour incubation with the appropriate secondary antibody (anti goat secondary antibody conjugated to Alexa Fluor 594-1:1000 dilution for siah-
1-hMC, anti mouse secondary antibody conjugated to Texas Red-1:200 dilution for GAPDH-rMC-1) at room temperature. Cover slips were rinsed extensively in PBS-T and mounted on glass slides using vectashield anti- fade fluorescence mounting medium (Vector laboratories, Burlingame,
CA). Blinded samples were examined for siah-1 and GAPDH nuclear accumulation using a fluorescent microscope (40x magnification, ex:
540nm, em: 600nm). Digital images were acquired on a Leica DMI 6000 B inverted microscope using a Retiga EXI camera (Q-imaging Vancouver
British Columbia) at 40X magnification. The percentage of cells that were positive for nuclear siah-1 and GAPDH in four different fields per sample was established. Samples were then un-blinded, and the average values of several individual experiments presented. rMC-1 were also analyzed using scanning laser confocal microscopy (LSM
510; Carl Zeiss Meditec, Göttingen, Germany) at 568-nm wavelength lines of an argon-krypton laser and an oil objective (100x Plan-Neofluor; Carl
Zeiss Meditec) The percentage of cells positive for nuclear GAPDH in four 57 different fields per sample was determined and the average values of several individual experiments presented.
Sub - Cellular Fractionation: rMC-1 (2.5 x 106) were treated as described above with normal or high glucose for 24 hours. Treated cells were rinsed twice with ice cold hanks buffered saline solution (HBSS), scraped in ice cold homogenization buffer (HB) and re-suspended in
200uL HB. Suspension was homogenized with 10 strokes of a dounce homogenizer and nuclear fractions collected by a low speed spin (1000g) for 5 minutes. Nuclear fractions were washed in HB buffer twice and either: 1)Prepared for Western Blot analysis by re-suspended in 200µl of lysis buffer (50mM HEPES (pH7.5), 1% Triton X-100, 150mM NaCl, 1mM
EDTA and protease inhibitors 0.2mM PMSF and 1um leupeptin and sonicated for 15 s at a 10% pulse using a membrane dismembranator
(Fisher Scientific 550) or, 2)Prepared for co-immunoprecipitation analysis by resuspending nuclei in low stringency ice cold radio immunoprecipitation (RIPA) buffer (50mM Tris, pH 7.5, 1% triton X-100,
0.25% sodium deoxycholate, 0.1% SDS, 150mM sodium chloride, 1mM
EDTA, 1mM PMSF, 1 µg /ml leupeptin) for co-immunoprecipitation analysis (described below). Cytosolic fraction-containing supernatant was retained for analysis of fraction purity. Protein concentrations were determined via Bio-Rad protein assay.
Cytosolic Lysates: Treated Cells (rMC-1 [1.0 x 106] and hMC [5.0 x 105]) were scraped and centrifuged at 2000 × g for 5 minutes at 4°C. The 58 pellets were re-suspended in 200 μl of lysate buffer [100 mM Hepes, pH
7.5, 10% sucrose, 0.1% CHAPS, 1 mM EDTA, 10 mM DTT containing the protease inhibitors 1 mM phenylmethylsulfonyl fluoride, pepstatin (10
μg/ml), and leupeptin (10 μg/ml)]. The cellular material was left on ice for
30 min and then sonicated for 15 s at a 10% pulse using a Membrane
Dismembranator (Fisher Scientific model 550). The lysates were centrifuged at 10,000 × g for 10 min at 4°C. Cytosol containing supernatants were retained and protein concentration quantified with the
Bio-Rad protein assay.
Whole cell lysate: Whole cell lysates were generated from treated rMC-1
(1.0 x 106) and hMC (5.0 x 105 by adding 200μl whole cell lysis buffer
[50mM HEPES (pH7.5), 1% Triton X-100, 150mM NaCl, 1mM EDTA and protease inhibitors 0.2mM PMSF and 1um leupeptin] directly on rinsed cells attached to cell culture plate. After 10 minute incubation cells were scraped and sonicated for 15 seconds. Protein concentrations were determined using the Bio-Rad protein assay.
Western Blots Analysis: Lysates (20μg/30μg for siah-1 analysis) were separated on SDS gel by electrophoresis and blotted onto nitrocellulose membrane. Membranes were blocked in either filtered 5% bovine serum albumin (BSA) in PBS-T (Phosphate Buffered Saline containing 1%
Tween 20) [siah-1] or 5% milk in PBS-T [actin, GAPDH, phospho p53-s15,
Bax, p53, LC3] and incubated for 24 hours with the goat polyclonal antibody against either siah-1 (1:500), mouse monoclonal antibody 59 against GAPDH (1:5000), mouse monoclonal against β actin (1:10,000), rabbit polyclonal against phospho p53-s15(1:1000), rabbit polyclonal against Bax (1:1000), rabbit polyclonal against total p53 (1:1000) or rabbit polyclonal against LC3 (1:1000). Antibodies were diluted in respective blocking solutions. Membranes were incubated with HRP-conjugated secondary antibodies and developed using enhanced chemiluminescence
HRP detection reagent (Pierce Endogen, Rockford, IL). Bands were quantified via densitometry analysis using Biorad quantity one program and expressed as the ratio between proteins of interest to actin. Phospho p53-s15 bands were normalized to total p53.
Histone 2B (1:1000) and lactate dehydrogenase (1:1000) were used to demonstrate purity of nuclear or cytosolic fractions, respectively.
Co-Immunoprecipitation assays: Equal amounts of protein (1000 µg) were pre-cleared using 30 μl of Protein G plus agarose beads at 4 oC for 3 hours. Beads were pelleted and supernatant transferred to a fresh microfuge tube. 7.5 μg of anti siah-1 antibody was added to the supernatant and incubated for 2 hours with constant rotation. Protein G plus agarose beads (30μl) was then added to the supernatant, and incubated overnight at 4oC with constant rotation. Antibody and protein bound beads as well as the bead only controls were pelleted by a 14000 x g spin (1 min). Supernatants lacking siah-1 due to siah-1 protein pull down by immunoprecipitation were retained. These siah-1–depleted supernatants were subjected to siah-1 Western Blot analysis alongside a 60 siah-1 positive control to ascertain efficient siah-1 pull down.
Immunoprecipitates were washed five times in ice cold high stringency
RIPA buffer (50mM Tris, pH 7.5, 1% triton X-100, 0.25% sodium deoxycholate, 0.1% SDS, 500mM sodium chloride, 10mM sodium fluoride,
1mM EDTA, 1mM PMSF, 1 μg /ml leupeptin,), re-suspended in 20 μl sample buffer, vortexed, boiled at 100oC for 5 minutes, and subjected to
Western Blot analysis as described above. Membrane was then stripped and re-probed with antibody against GAPDH to determine complex formation. As control, LDH was used to demonstrate that siah-1/GAPDH binding is specific.
Caspase activity assay: Following treatment for 72 hours (IL-1β) or 96 hours (high glucose), cytosolic lysates were generated from cells as described above. Equal amounts of cytosolic lysates (15 µg) were incubated with fluorogenic caspase substrate (2.5 µM) at 32C for 1 hour
CHAPS buffer (100 mM Hepes, pH 7.5, 10% sucrose, 0.1% CHAPS, 10 mM DTT). Cleavage of the substrate emits a fluorescence signal that was quantified by Tecan Spectra FluorPlus fluorescence plate reader
(excitation: 400 nm, emission: 505 nm). Caspase activities were calculated against an AFC standard curve and expressed as pmol
AFC/mg protein/min.
Trypan blue cell death assay: Following treatment for 72 hours (IL-1β) or
96 hours (high glucose), cells were trypsinized (0.25% trypsin) for 2 min) at 37 degrees C in a humidified incubator. Equal amounts (100µl) of cell 61 suspension and trypan blue solutions were mixed. Blinded samples were counted using hemocytometer and cell death was quantified as the number of blue cells per total cell number. Samples were then un-blinded and values from independent experiments averaged.
Reverse transcription and real-time quantitative PCR: Total RNA from treated cells was isolated using Trizol reagent (Invitrogen, Carlsbad, CA,
USA) and treated with Purelink DNAse treatment (Invitrogen) to digest
DNA. RNA (2µg) was reverse transcribed using Applied Biosystem's High
Capacity cDNA Reverse Transcription Kit (Foster City, CA). Siah-1 mRNA levels were determined through quantitative real-time PCR assays using the TaqMan® Gene Expression Assays and the Applied Biosystems
PRISM 7900HT sequence detection system. 18S RNA was used to normalize for the starting amount of cDNA and assays were performed in triplicate. Fold changes relative to control treatment were quantified.
Context sequences provided by the manufacturer for amplified genes are follows: rat siah-1- CTTCACAGAGAATAAGGCACCCATC), rat 18s-
TGGAGGGCAAGTCTGGTGCCAGCAG human siah-1-
CTCTCCGCCCACAGAAATGAGCCGT, human 18s-
TGGAGGGCAAGTCTGGTGCCAGCAG.
Siah-1 siRNA transfection: To knock down siah-1, rMC-1 were transfected with siah-1-specific smartpool siRNA, which contains a pool of four siRNA duplexes (Table 1) using amaxa nucleofection electroporation system (Cologne, Germany). For control, cells were subjected to 62 electroporation only or transfected with 50nM non-specific scrambled siRNA or risc free siRNA. Sequences for control siRNA are patent protected. Transfection was performed according to the manufacturer’s instructions. Briefly, rMC-1 were harvested by centrifugation and re- suspended at 3.0 x 106 cells/100 µl in solution L (amaxa kit). 100 µl of cell suspensions with or without siRNA were dispensed to electroporation cuvettes. The final concentration of siRNA was either 20nM or 50 nM.
Transfection efficiency by this method was 65%. Following electroporation, cells were plated on tissue culture plates containing regular growth medium. For experiments, cells were switched to experimental medium 12 or 24 hours post transfection and treated as described above.
Siah-1 truncation mutation: Siah-1 C terminal truncation of the last 12 amino acids was generated by site-directed mutagenesis on a siah-1 cDNA, using PCR with stop codon-containing primers. Wild type siah-1 construct was also generated for control. A myc epitope tag
(EQKLISEEDL) was engineered into the N terminal of both proteins.
Primer sequences used for construct generation were as follows: Siah-1 wt, 5′-
TGATGAATTCATGGAACAAAAACTCATCTCAGAAGAGGATCTGAGCC
GTCAGACTGCTACAGCATTACC-3′ (outer forward primer); Siah-1wt, 5′-
GTCAGCGGCCGCTCAACACATGGAAATAGTTACATTGATGC-3′ (outer reverse primer); Siah-1Δ aa 1-270, 5′- 63
TGATGAATTCATGGAACAAAAACTCATCTCAGAAGAGGATCTGAGCC
GTCAGACTGCTACAGCATTACC-3′ (outer forward primer); Siah-1Δ aa 1-
270, 5′-
GACTGCGGCCGCCTAATTTTCTGCAAAGAGCTGTGCAATGCTG′
(outer reverse primer); Primers used for sequencing confirmation: Siah-
1wt, ATAGCCAAGTTGCGAATG
Siah-1Δ aa 1-270, CTCAAAGTGTCCACCATCC. The wild type (siah-1 wt) and truncated siah-1 (siah-1Δ aa 1-270) cDNAs were then cloned downstream of the cytomegalovirus promoter-enhancer in the mammalian expression vector pcDNA3.1 (Invitrogen, San Diego, CA). Construct generation, cloning and plasmid amplification services were provided by
Seqwright sequencing inc. (Houston, TX). rMC-1 cells were transfected with plasmid using amaxa electroporation transfection.
TUNEL Staining: Apoptotic cell death was quantified using ApopTag
Fluorescence kit (Chemicon International) to detect Terminal
Deoxynucleotide Transferase dUTP Nick End Label (TUNEL). Following treatment for 96 hours, rMC-1 cells on cover slips were processed, by fixation in 1% paraformaldehyde at room temperature for 10 minutes.
Cells were then rinsed in PBS and permeabilized using ethanol:acetic acid
(2:1) mixture for 5 minutes. After a brief PBS rinse, cells were exposed to equilibration buffer for 10 seconds before incubation at 37o C with TdT enzyme. One hour later, stop wash buffer was added and the cells rinsed with PBS. Next, warm anti-digoxigenin conjugate was added to cells and 64 incubated for 30 minutes in the dark. Following a PBS rinse, cells were mounted on glass slides using DAPI-containing mounting medium and the amount of fluorescence resulting from TUNEL stained cells observed and quantified. Digital Images were captured in 12 bits on a Leica DMI 6000 B inverted microscope using a Retiga EXI camera (Q-Imaging, Vancouver,
British Columbia, Canada) at 40X magnification. Image analysis was performed using Metamorph Imaging Software (Molecular Devices). Green intensity arbitrary fluorescence units, was quantified and normalized to
DAPI intensity (equivalent to cell number)
Mitotracker and Lysotracker Analysis: rMC-1 (1 x 105) cells were grown on cover slips and subjected to experimental conditions for 96 hours.
Medium was changed every 24 hours. Following treatment, superoxide- specific mitotracker red solution (Invitrogen) or the lysosensor lysotracker dye (Invitrogen) was added to the medium at a final concentration of 500
µmol/l. Cells were incubated in the dark for 20 min at 37°C/5% CO2. Cells were then rinsed twice with PBS, fixed in 4% paraformaldehyde for 10 min at room temperature, and washed twice with PBS. Coverslips were mounted on slides using an anti-fading fluorescence mounting medium containing DAPI to stain for nuclei (Vector Shield). Digital images were captured as described above (TUNEL staining). Red and green intensity arbitrary fluorescence units which are equivalent to mitochondrial superoxide production and acidic lysosomal vacuoles respectively were 65 quantified, integrated, and normalized to the integrated DAPI intensity
(equivalent to cell number).
Animals: Wild type c57 black six (C57BL6) mice (Jackson Laboratory), caspase-1 knock-out mice in C57BL6 background (provided by Dr. Tom
McCormick, Case Western Reserve University), and IL-1R1 null mice
(B6.129S7-Il1r1tm1jmx, Jackson Laboratories) were utilized for in vivo studies. Breeding and genotyping services were provided by the
Ophthalmology Core Facility. The retinas of all genetically modified animals were carefully evaluated for any structural abnormalities, abnormalities in the vasculature, and functional abnormalities.
Induction of diabetes using streptozotocin (STZ): Studies were conducted using experimentally diabetic mice. Male mice (C57BL/6) weighing 20 grams were randomly assigned to be made either diabetic or serve as controls. Diabetes was induced by streptozotocin (STZ) injections (60mg/kg body weight intraperitoneally on 5 consecutive days), and insulin was given as needed to achieve slow weight gain without preventing hyperglycemia and glycosuria (0.1-0.2 U of Neutral Protamine
Hagedorn (NPH) insulin subcutaneously, 2-3 times a week). Animals were caged in pairs with free access to food and water, and maintained under a 14-hour on/ 10-hour off light cycle. Body weight was measured weekly. Treatment of animals conformed to the Association for Research in Vision and Ophthalmology Resolution on Treatment of Animals in
Research. Shortly before the animals were sacrificed, the severity of 66 blood hexose elevation was estimated by measuring the level of non- enzymatically glycated hemoglobin (GHb) using affinity chromatography
(Glyc-Affin, Pierce, Rockford, Ill). Blood glucose levels were also established.
For studies to determine Müller cell loss in the retina, we utilized 15 diabetic wt mice, 5 diabetic cas-1-/- mice, and 5 IL-1R-/- mice. 15 normal wt mice, 5 normal cas-1-/- mice, and 5 normal IL-1R-/- served as control.
At 7 months of diabetes, animals along with age matched controls were sacrificed, and processed for glutamine synthetase (GS) immunofluorescence staining
In vivo GS Immunofluorescence staining: Animals were sacrificed after
7 months of diabetes along with age matched controls. Eyes were fixed in formalin and embedded in paraffin. Samples were then sectioned (10µm), de-waxed and rehydrated. Heat induced epitope retrieval (HIER) was performed and slides transferred to Shandon staining clips and into the
Shandon staining rack using PBS to attach the slides. Avidin D blocking solution (#SP-2001, Vector Laboratories, Burlingame, CA) was applied to samples which were then incubated for 15 minutes at room temperature.
After brief rinse in PBS, biotin blocking solution (#SP-2001, Vector
Laboratories, Burlingame, CA) was applied and 15 minute room temperature incubation performed. After another brief rinse in PBS, mouse on mouse (M.O.M) Ig Blocking Solution (M.O.M. Immunodetection Kit,
#PK-2200, Vector Laboratories, Burlingame, CA) was applied and 60 67 minutes room temperature incubation performed. Slides were rinsed with
2-3 drops of working solution of M.O.M. diluent prepared according to manufactures instruction. Primary antibody (mouse anti-Glutamine synthetase, #610517, clone 6/Glutamine Synthetase, Transduction
Laboratories, BD Biosciences Pharmingen [1:1000 diluted in working solution of M.O.M. diluents]) was applied to tissue section. After 1 hour room temperature incubation, slides were rinsed with PBS and stained with working solution of M.O.M. biotinylated anti-mouse Ig reagent prepared according to manufacturer’s instructions. Following a 10 minute incubation at room temperature and rinse with PBS, Fluorescein Avidin
DCS (Cell Sorter Grade), (#A-2011, Vector Laboratories, Burlingame, CA) prepared according to manufacturers instruction was applied to samples which were then subjected to final 10 minutes room temperature incubation in the dark. Samples were then rinsed with PBS and cover- sliped with DAPI containing Vectashield Hard Set. Blinded samples were visualized using scanning laser confocal microscopy (LSM 510; Carl Zeiss
Meditec, Göttingen, Germany) and a water objective (63x Plan-Neofluor;
Carl Zeiss Meditec). The number of Müller cells per standard retinal area
(143um x143um) as determined using Müller cell specific marker GS from eight independent areas was established. Samples were then un-blinded and the average number of Müller cells from individual animals groups, determined and graphed. 68
Statistical analysis: Data were analyzed using one-way ANOVA
(correlated samples, p<0.05) followed by Tukeys post analysis to determine statistical significance among groups. Ordinal data were analyzed using Kruskal-Wallis test (p<0.05) followed by Dunn’s post analysis to determine statistical significance among groups. For details in statistical analysis see VasserStats Statistical Computation Web Site
(http://faculty.vassar.edu/lowry/VassarStats.html).
69
CHAPTER 3: Differential Regulation of High Glucose- Induced GAPDH Nuclear Accumulation in Müller Cells by Interleukin-1β and Interleukin-6 70
Introduction The glycolytic enzyme glyceraldehyde-3- phosphate dehydrogenase
(GAPDH) is known for its function to convert glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate. Besides its glycolytic function, several non- glycolytic functions of GAPDH, such as microtubule bundling, DNA replication, DNA repair, and nucleo-cytosolic t-RNA transport, have been reported (151, 214-216). GAPDH has been associated with induction of cell death by different mechanisms (38). The movement of GAPDH from the cytosol and its accumulation in the nucleus has been identified as an early event for apoptosis induction (86). GAPDH nuclear accumulation is now considered a reliable indicator for early cell death events in vivo and has been implicated in several neurodegenerative diseases (148, 208,
230). This phenomenon has also been demonstrated in non-neuronal cells including epithelial cells and fibroblast cells (44, 57).
The signals and stimuli that potentially initiate GAPDH translocation from the cytosol to the nucleus are not clearly defined. A recent study has shown that lipopolysaccharide (LPS) is able to induce GAPDH nuclear accumulation in macrophages possibly linking this event to pro- inflammatory signaling (83). It is very well established that LPS stimulates the immediate production of the acute phase cytokines interleukin-1 β (IL-
1β), tumor necrosis factor α (TNFα), and interleukin-6 (IL-6), also called the “triumvirate” (169). However, the distinct role of the individual 71 cytokines in the process of GAPDH nuclear accumulation has not been determined.
Inflammation and retinal cell death seem to play an important role in the development of diabetic retinopathy (104, 106, 107, 128, 149, 242).
We have previously demonstrated that high glucose induced the activation of caspase-1, the enzyme that is responsible for the production of active interleukin-1β (IL-1β), and subsequent cell death in Müller cells which was prevented by the inhibition of the caspase-1/IL-1β signaling pathway(158),(242). Moreover, we have shown that high glucose-induced cell death of Müller cells is mediated by GAPDH nuclear accumulation, and inhibition of GAPDH nuclear accumulation protected Müller cells from high glucose-induced cell death (131). Hyperglycemia induced GAPDH nuclear accumulation in retinal Müller cells in vivo and in vitro (131).
Therefore, this study was aimed at identifying a link between high glucose-induced cytokine production and GAPDH nuclear accumulation.
We determined the role of the pro-inflammatory, acute phase cytokines IL-
1β, TNFα, and IL-6 in high glucose-induced nuclear accumulation of
GAPDH in retinal Müller cells. 72
Results High Glucose Exposure Leads to IL-1β, IL-6, But No TNF-α
Production by Müller Cells.
Incubation of Müller cells in high glucose (25mM glucose) significantly increased extracellular IL-1β concentrations to 553.4 ± 39.5 pg/mg protein/24 hours compared to control (248.6 ± 79.1 pg/mg protein/24 hours) in the rat retinal Müller cell line rMC-1 (n=5; p<0.05) and to 109.1 ± 3.2 pg/mg protein/24 hours compared to control (33.5 ± 1.4 pg/mg protein/24 hours) in human Müller cells (hMC) (n=7; p<0.05). IL-6 production slightly increased in hMC from 352.8±10 pmol/ml/mg/24 hours in normal conditions to 400.3±14.9 pmol/ml/mg/24 hours in high glucose conditions (n=7; p<0.05). Interestingly, TNFα production was not affected by high glucose in rMC-1 and hMC. Incubation of cells in normal (5mM) glucose medium supplemented with 20mM mannitol did not have any effect on cytokine production by Müller cells.
IL-1β Initiates GAPDH Nuclear Accumulation in Retinal Müller
Cells.
Since we have demonstrated that hyperglycemia leads to the production and release of the pro-inflammatory cytokine IL-1β from retinal
Müller cells, we tested whether IL-1β itself is capable of inducing GAPDH nuclear accumulation. Immunohistochemical analysis to examine GAPDH sub-cellular localization determined that GAPDH is localized in the 73 cytoplasm of rMC-1 in normal (5mM) glucose conditions. Addition of IL-1β
(2ng/ml) to normal glucose media significantly increased the number of cells positive for nuclear GAPDH by 16.3 ± 5.4% (Figure 3.1A and 3.1B).
In addition to immunofluorescence analysis, IL-1β-induced GAPDH nuclear accumulation was assessed using Western Blot analysis of nuclear fraction of rMC-1 treated with 2ng/ml IL-1β for 24 hours in normal
(5mM) glucose medium. Following IL-1β treatment, amounts of nuclear
GAPDH increased by 1.9±0.4 fold (Figure 3.1C and 3.1D).
Studies were also performed in isolated human Müller cells to ascertain that observations in rMC-1 were not due to the transformation of the cell line (Figure 3.2). Results show that treatment with 2ng/ml IL-1β significantly increased the number of human Müller cells positive for nuclear GAPDH from 10.9 ± 2.3% to 34.5 ± 7.1% compared to control.
We did observe that in rMC-1 (cell line) GAPDH nuclear accumulation in control cells is higher than in isolated human Müller cells. It could be due to the higher turn-over rate induced by transformation in the cell line compared to non-transformed cells, or species differences between rat and human.
GAPDH Nuclear Accumulation is IL-1β Concentration and Time
Dependent.
To strengthen the idea that IL-1β is responsible for the induction of
GAPDH nuclear accumulation, we evaluated GAPDH nuclear accumulation following treatment of rMC-1 with increasing concentrations 74 of IL-1β ranging from 1 to 10ng/ml. The number of rMC-1 positive for nuclear GAPDH following IL-1β treatment increased in a concentration- dependent manner with significant increases observed in nuclear GAPDH levels starting at 2ng/ml IL-1β (52.1 ± 7.3%) continuously increasing with higher concentrations of IL-1β (5ng/ml: 55.8 ± 4.6%; 10ng/ml: 63.9 ±
6.5%) (Figure 3.3A). IL-1β-induced GAPDH nuclear accumulation (2 ng/ml
IL-1β) was significantly increased in 46.5 ± 1.9% of rMC-1 cells compared to control cells (35.3 ± 2.2%) at 12 hours of treatment and remained elevated through 24 hours (Figure 3.3B).
IL-1β Induces Caspase Activation and Cell Death in Müller
Cells.
Previously, we have demonstrated that GAPDH nuclear accumulation is an early pro-apoptotic event preceding cell death in high glucose-treated retinal Müller cells which was detectable late at 72-96 hours of high glucose incubation. To demonstrate that high glucose- induced apoptosis in retinal Müller cells is a consequence of inflammatory signaling; we tested the effect of IL-1β on Müller cell survival. As observed in our previous studies, GAPDH nuclear accumulation preceded activation of caspase activities in IL-1β treated rMC-1 and hMC. 2ng/ml IL-1β significantly induced caspase-3 activity from 17.5 ± 5.8 to 41.4 ± 11.8 pmol AFC/mg/min and caspase-6 activity from 25.0 ± 9.2 to 74.3 ± 18.8 pmol AFC/mg/min significantly inducing cell death in 12.4 ± 2.7% of rMC-1 cells compared to untreated cells (6.4 ± 1.2%) (Figure 3.4A and 3.4 B). In 75 hMC, 2ng/ml IL-1β significantly induced caspase-3 activity from 10.6 ± 0.5 to 20.8 ± 3.4 pmol AFC/mg/min and caspase-6 activity from 25.6 ± 4.6 to
43.7 ± 9.3 pmol AFC/mg/min also significantly inducing cell death in 19.2 ±
3.6% of compared to untreated cells (3.3 ± 1.7%) (Figure 3.4C and 3.4D).
Blocking IL-1 Receptor Action Prevents High Glucose-Induced
GAPDH Nuclear Accumulation in Retinal Müller Cells.
Our previous studies have demonstrated that hyperglycemia induced nuclear accumulation of GAPDH in retinal Müller cells (131).
Therefore, we were interested in whether IL-1β mediates high glucose- induced GAPDH nuclear accumulation in an autocrine fashion, since high glucose leads to IL-1β production and release from retinal Müller cells, and IL-1β itself is capable of inducing GAPDH nuclear accumulation in these cells. Pre-treatment of rMC-1 with 50ng/ml IL-1 receptor blocker significantly decreased the number of rMC-1 positive for high glucose- induced nuclear GAPDH accumulation by 51.6±0.5% (Figure 3.5). As a control, rMC-1 were incubated for 24 hours in medium containing normal
(5mM) glucose and 20mM mannitol to demonstrate that high glucose- induced GAPDH nuclear accumulation is not due to changes in osmolarity. Mannitol treated cells did not alter the number of cells positive for nuclear GAPDH (33 ± 4%) compared to control cells cultured under normal (5mM) glucose conditions (32.8 ± 0.5%). Pre-treatment of normal
(5mM) glucose treated control cells with IL-1ra did not have any effect on
GAPDH nuclear accumulation (30.1 ± 2.4%). 76
Caspase-1 Inhibition Prevents High Glucose-Induced GAPDH
Nuclear Accumulation in Retinal Müller Cells.
Since exogenous inhibition of IL-1 receptor signaling prevented high glucose-induced GAPDH nuclear accumulation, we examined whether endogenous inhibition of IL-1β production using the specific caspase-1 inhibitor YVAD-fmk will do the same. Caspase-1, also known as IL-1β converting enzyme, converts pro-IL-1β to active IL-1β. Previous studies by us have shown that high glucose induces caspase-1 activation in Müller cells (158, 242). 100µM YVAD-fmk (caspase-1 inhibitor) significantly decreased the number of rMC-1 positive for nuclear GAPDH to 32.3±5.3% compared to high (25mM) glucose-treated cells (48.6±2.2%)
(Figure 3.6A) and to 7.1±2.8% in hMC cells compared to high (25mM) glucose treated hMC cells (25.6±4.5%) (Figure 3.6B). Incubation of normal
(5mM) glucose treated control cells with 100µM YVAD-fmk did not affect
GAPDH nuclear accumulation (rMC-1: 24.2 ± 2.9%; hMC: 9.8 ± 0.6%).
IL-6 Attenuates IL-1β and High Glucose-Induced GAPDH
Nuclear Accumulation in Retinal Müller Cells.
We have demonstrated that hyperglycemia leads to the slight production and release of IL-6 from retinal Müller cells. Therefore, we tested the ability of this pro-inflammatory cytokine to induce GAPDH nuclear accumulation. Our results demonstrate that IL-6 does not induce
GAPDH nuclear accumulation in retinal Müller cells (Figure 3.7A). To the contrary, IL-6 significantly attenuated IL-1β-induced GAPDH nuclear 77 accumulation in Müller cells by 84 ± 5.6% (Figure 3.7A). Since we have demonstrated in this study that high glucose-induced GAPDH nuclear accumulation is mediated by IL-1β signaling, we tested whether IL-6 is protective against high glucose-induced GAPDH nuclear accumulation in hMC. Indeed, IL-6 (2ng/ml) significantly decreased high glucose-induced
GAPDH nuclear accumulation by 64 ± 7.5% (Figure 3.7B). In addition, IL-6 significantly reduced high glucose-induced cell death of hMC from 18.6 ±
3.6% to 9.4 ± 3.2% representing a 75 ± 6.8% inhibition (control: 6.8 ±
2.9%; n=6; p<0.05).
TNFα Does Not Induce GAPDH Nuclear Accumulation in Retinal
Müller Cells.
Hyperglycemia did not induce TNFα production by retinal Müller cells. Thus, endogenous TNFα production would not play a role in high glucose-induced toxicity in these cells. To determine whether exogenously
TNFα can potentially induce GAPDH nuclear accumulation, we treated hMC with increasing concentrations of TNFα. Surprisingly; our results demonstrate that TNFα does not induce GAPDH nuclear accumulation in hMC (Figure 3.8). We also could not detect any synergistic effect of TNFα in combination with IL-1β (Figure 3.8). 78
Discussion Our study reveals a new mechanism for high glucose-induced toxicity in retinal Müller cells. We have previously demonstrated that diabetes and hyperglycemia initiate GAPDH nuclear accumulation in vivo and in vitro and inhibition of GAPDH nuclear accumulation prevented high glucose-induced cell death of Müller cells in vitro. In this study, we looked at high glucose-induced production of pro-inflammatory cytokines and their role as potential stimuli for GAPDH nuclear accumulation and glucose toxicity. Our study demonstrates that high glucose exposure of
Müller cells leads to IL-1β, IL-6, but no TNF-α production. Moreover, we demonstrated for the first time that IL-1β acts as a stimulus for GAPDH nuclear accumulation and that IL-1β production and subsequent signaling mediates high glucose-induced GAPDH nuclear accumulation in retinal
Müller cells in an autocrine fashion. Inhibition of IL-1β production or inhibition of the IL-1β receptor, both effectively prevented the accumulation of GAPDH in the nucleus under high glucose conditions clearly identifying IL-1β as an initiator of GAPDH nuclear accumulation.
Surprisingly, IL-6 had the opposite effect to IL-1β. It attenuated IL-1β as well as high glucose-induced GAPDH nuclear accumulation. Although detrimental effects of TNFα (31, 138) have been very well established in a diabetic environment, our study indicates that detrimental effects exerted by TNFα do not include initiation of GAPDH nuclear accumulation, at least not in retinal Müller cells. 79
Diabetic retinopathy has been identified as a disease with pro- inflammatory features, such as cytokine production, leukostasis, and nitric oxide production (1, 27, 50). Pro-inflammatory cytokines, like IL-1β, TNFα, and IL-6, have been detected in the vitreous of diabetic patients as well as the retinas of diabetic rats (1, 27, 50, 70, 156). Studies using drugs with anti-inflammatory properties have shown that these treatments are able to prevent the development of diabetic retinopathy (112, 113), (54, 123, 128,
156, 242). Our previous study demonstrated that specific inhibition of the caspase-1/ IL-1β pathway prevents capillary degeneration in retina of diabetic animals (242). The present study opens the possibility that drugs targeting IL-1β signaling might interrupt diabetes-induced translocation of
GAPDH from the cytosol to the nucleus since IL-1β seems to be an effective inducer of this process, therefore, inhibiting cell death of retinal cells. Besides anti-inflammatory drugs, R-deprenyl, a monoamino oxidase
B inhibitor, has been shown to increase survival of neurons and retinal
Müller cells by preventing GAPDH nuclear accumulation further demonstrating the potential of therapies that inhibit GAPDH nuclear accumulation (86, 87, 131). Although in the early literature GAPDH nuclear translocation/accumulation was termed a “marker” for early cell death events, used especially to characterize cellular damage of neurodegenerative diseases in vivo, a recent study has now demonstrated that nuclear GAPDH actually mediates cell death processes by activating p53 related pathways (207). This study suggests that inhibition of GAPDH 80 nuclear translocation is crucial to prevent cell death induced by inflammatory stimuli.
Several cellular sources for diabetes-induced cytokine production in the retina have been identified. For example, Müller cells very rapidly produce IL-1β in high glucose conditions (72, 158, 242) and as we have shown in this study also IL-6. However, under our experimental conditions, we could not detect TNFα production by Müller cells although a recent report has suggested that following serum starvation, Müller cells can potentially produce TNFα when exposed to high glucose (243). Microglia and astrocytes as well as retinal pigment epithelium are clearly able to produce TNFα and IL-1β (22, 128, 261). Whether these retinal cell types are all susceptible to GAPDH nuclear accumulation has to be examined.
Future studies are needed to evaluate if GAPDH nuclear accumulation is a common mechanism in hyperglycemia-induced cell death of retinal cells or if this mechanism is specific for retinal Müller cells. Although GAPDH nuclear accumulation has clearly been linked to cell death initiation (207), it is unclear whether Müller cells positive for nuclear GAPDH in vivo or in vitro are committed to cell death.
Our in vitro studies suggest that a proper balance between detrimental and protective cytokines is crucial for a healthy environment.
Elevated glucose levels seem to disrupt this balance. Several studies have demonstrated increased levels of IL-1β in the retina of diabetic animals or vitreous of diabetic patients with concentrations ranging from 81
10 pg/ml up to 50 pg/ml (47, 242). However, actual levels of IL-1β are potentially a lot higher since IL-1β is usually rapidly degraded. In our serum containing experimental environment, recovery of IL-1β was only
10-15%. In a recent study of ours, we have discussed that IL-1β levels can potentially reach ng/ml concentrations (22). Although Müller cells produced small amounts of IL-6 in high glucose conditions, the level of IL-
6 was not enough to protect against high glucose-induced GAPDH nuclear accumulation. Addition of IL-6 to the high glucose environment had a strong protective effect. In diabetes, IL-6 levels are generally elevated possibly reflecting an attempt by tissues to reduce the harmful effects of other cytokines. The inability of IL-6 to reach threshold levels might prevent the maintenance of homeostasis. Currently, there are no studies available that define “healthy” levels of IL-6. Although protective effects of
IL-6 have been established in the literature, at least for acute insults, the long-term effect of increased IL-6 levels is a matter of debate making it very difficult to evaluate the potential of this cytokine as a beneficial treatment to date (169). Effects of IL-6 on tissues, such as skeletal muscle, liver, adipose tissue and pancreatic β cells, are pleitropic with both protective and detrimental outcomes under diabetic conditions (for review (129)). Parameters measured in these studies include insulin resistance, obesity, elevation of plasma triglycerides, and β cell apoptosis which are all associated with the development of diabetes and diabetic complications. Some observations were species and gender specific 82 which further compounds our understanding on the role of this cytokine
(116, 169, 181).
Taken together, our results demonstrate that the pro-inflammatory cytokine IL-1β plays an important role in the induction of hyperglycemia- induced GAPDH nuclear accumulation in retinal Müller cells and subsequent cell death. Healthy and functional Müller cells are important to protect the retinal microvasculature and maintain the retinal-blood barrier.
Therapies that prevent GAPDH nuclear accumulation in vivo have shown promising results in the treatment of neurodegenerative diseases (87) and might have the potential as a treatment for diabetic retinopathy. Since a recent study has shown that GAPDH nuclear accumulation persists when poorly controlled diabetic animals were brought back to good control, inhibition of GAPDH nuclear accumulation might even be necessary to restore proper retinal functions (111). Anti-inflammatory agents and treatments that induce the production of protective cytokines that prevent diabetes-induced GAPDH nuclear accumulation might be considered as potential therapies to prevent cellular damage of retinal cells. 83
Figures
Figure 3. 1. IL-1β Induces GAPDH Nuclear Accumulation in rMC-1 rMC-1 were cultured in normal (5mM) glucose or normal (5mM) glucose +
IL-1β (2ng/mL) for 24 hours. (A) GAPDH immunofluorescence staining
(red) was visualized by confocal (100x magnification) and conventional
(40x magnification) fluorescent microscopy. Images represent results from at least 6 independent experiments. (B) Number of cells positive for nuclear GAPDH based on fluorescence microscopy images are presented 84 as mean ± SEM of eight independent experiments with * = p<0.05. (C)
GAPDH Western Blot analysis of nuclear fractions from rMC-1 treated in normal (5mM) glucose in the presence or absence of IL-1β (2ng/ml) for 24 hours. Histone 2B (nuclear marker) and lactate dehydrogenase (cytosolic marker) served as control proteins to determine fraction purity. (D)
GAPDH Western Blots of nuclear fractions were quantified using densitometry analysis, normalized, and graphed as mean ± SEM (n=3, * = p <0.05). 85
A)
Vimentin CRALBP GFAP
B) 7.8 mM Glucose 7.8 mM Glucose + 2ng/ml IL-1β
GAPDH
Vimentin
Merge
C)
*
for Nuclear GAPDH (%) (%) NuclearGAPDH for Number of Cells Positive Positive Cells of Number
Glucose (mM) 7.8 7.8 IL-1β (ng/ml) - 2
Figure 3. 2. IL-1β Induces GAPDH Nuclear Accumulation in Primary
Human Retinal Müller Cells
(A) hMC (passage 3) were characterized using the Müller cell specific markers vimentin and CRALBP. hMC are negative for GFAP 86
(fluorescence microscopy, 40 x magnifications). (B) hMC were cultured in normal (7.8 mM) glucose or normal (7.8mM) glucose + IL-1β (2ng/ml) for
48 hours. GAPDH sub-cellular localization (green stain) was visualized by fluorescence (40 x magnifications) microscopy. Immunofluorescence staining for vimentin is shown in red stain. (C) Fluorescence microscopy pictures were analyzed for the number of cells positive for nuclear GAPDH staining in each experimental condition. Results represent means ± SEM of eight independent experiments with * = p<0.05. 87
A)
70 * 60 * 50 * 40 30 20
10 for Nuclear GAPDH (%) (%) NuclearGAPDH for Number of Cells Positive Positive Cells of Number 0 1 2 3 4 5 Glucose (mM) 5 5 5 5 5 IL-1β (ng/ml) - 1 2 5 10
B) 6 hours 12 hours 24 hours 60 50 * * 40 30 20
10
for Nuclear GAPDH (%) (%) NuclearGAPDH for Number of Cells Positive Positive Cells of Number 0 Glucose (mM) 5 5 5 5 5 5 IL-1β (ng/ml) - 2 - 2 - 2
Figure 3. 3. IL-1β Induces GAPDH Nuclear Accumulation in a
Concentration and Time Dependent Manner in rMC-1
(A) rMC-1 were cultured under normal (5mM) glucose conditions in the presence of increasing concentrations of IL-1β for 24 hours. (B) rMC-1 were cultured under normal (5mM) glucose conditions plus 2ng/ml IL-1β for 6, 12, and 24 hours. Control cells were cultured in normal (5mM) glucose conditions. Following treatment, GAPDH nuclear accumulation 88 was assessed. Results represent the mean ± SEM (n=5) with * =p<0.05 compared to normal (5mM) glucose conditions. 89
A) B) Caspase-6 * 100 90 80 Caspase-3 70 25 60 * 50 20 40 15 * 30 10 20 10 5
0 Death Cell % 0 pmol AFC/mg protein/min AFC/mg pmol Glucose (mM) 5 5 5 5 Glucose (mM) 5 5 IL-1β (ng/ml) - 2 - 2 IL-1β (ng/ml) - 2
C) D)
100 90 80 Caspase-6 70 Caspase-3 * 25 60 20 * 50 * 40 15 30 10 20 10 5
0 Death Cell % 0 pmol AFC/mg protein/min AFC/mg pmol Glucose (mM) 7.8 7.8 7.8 7.8 Glucose (mM) 7.8 7.8 IL-1β (ng/ml) - 2 - 2 IL-1β (ng/ml) - 2
Figure 3. 4. IL-1β Induces Activation of Executioner Caspases and Cell Death in Müller Cells rMC-1 and hMC were cultured under normal glucose conditions in the presence or absence of IL-1β (2ng/ml) for 72 hours. The activities of caspase-3 and caspase-6 were measured (rMC-1, panel A; hMC, panel
C) and expressed as mean ± SEM (n=5) with * =p<0.05 compared to 90 untreated cells. Cell death was assessed using trypan blue staining (rMC-
1, panel B; hMC, panel D) and presented as mean ± SEM (n=5) with *
=p<0.05 compared to untreated cells. 91
60 * 50 # 40 30
20 for Nuclear GAPDH (%) (%) Nuclear GAPDH for
Number of Cells Positive Positive Cells of Number 10 0 Glucose (mM) 5 5 25 25 5 IL-1ra (ng/ml) - 50 - 50 - Mannitol (mM) - - - - 20
Figure 3. 5. Inhibition of the IL-1 Receptor Activation by IL-1 Receptor
Antagonist (IL-1ra) Prevents High Glucose-Induced GAPDH Nuclear
Accumulation in rMC-1
rMC-1 were treated in normal (5mM) glucose, high (25mM) glucose, or normal (5mM) glucose and high (25mM) glucose pre-incubated with
50ng/ml IL-1ra conditions. Treatment of rMC-1 with 5mM glucose plus
20mM mannitol served as control for osmolarity. After 24 hours, GAPDH nuclear accumulation was assessed. Results represent means ± SEM
(n=6) with * = p<0.05 compared to normal glucose, # = p<0.05 compared to high glucose. 92
A)
60 50 * 40 # 30 20
10
for Nuclear GAPDH (%) (%) Nuclear GAPDH for Number of Cells Positive Positive Cells of Number 0 Glucose (mM) 5 5 25 25 5 YVAD-fmk (µM) - 100 - 100 - Mannitol (mM) - - - - 20
B)
60 50 40 30 * 20 #
10
for Nuclear GAPDH (%) (%) Nuclear GAPDH for Number of Cells Positive Positive Cells of Number 0 Glucose (mM) 7.8 7.8 25 25 7.8 YVAD-fmk (µM) - 100 - 100 - Mannitol (mM) - - - - 20
Figure 3. 6. Inhibition of Caspase-1 Activity Prevents High Glucose-
Induced GAPDH Nuclear Accumulation in rMC-1 and hMC cells
rMC-1 (A) and hMC (B) cells were treated in normal glucose (5mM glucose for rMC-1, 7.8mM glucose for hMC), high (25mM) glucose, or normal and high glucose + 100 μM YVAD-fmk. At 24 hours (rMC-1) or 48 hours (hMC), GAPDH nuclear accumulation was assessed. Results represent means ± SEM (n=5) with * = p<0.05 compared to normal 93 glucose, # = p<0.05 compared to high glucose. Treatment with 5mM glucose (rMC-1) or 7.8mM glucose (hMC) plus 20mM mannitol served as control for osmolarity.
94
A) #
*
for Nuclear GAPDH (%) (%) NuclearGAPDH for Number of Cells Positive Positive Cells of Number
Glucose (mM) 7.8 7.8 7.8 7.8 7.8 7.8 7.8 IL-6 (ng/ml) - 1 2 5 10 - 2 IL-1β (ng/ml) - - - - - 2 2
# B)
*
for Nuclear GAPDH (%) (%) NuclearGAPDH for Number of Cells Positive Positive Cells of Number
Glucose (mM) 7.8 7.8 25 25 IL-6 (ng/ml) - 2 - 2
Figure 3. 7. IL-6 Attenuates IL-1β and High Glucose-Induced GAPDH
Nuclear Accumulation
(A) hMC were cultured under normal (7.8mM) glucose conditions in the presence of increasing concentrations of IL-6 (black bars), IL-1β (2ng/ml), or combination of IL-1β (2ng/ml) and IL-6 (2ng/ml) (striped bars) for 48 hours. Control cells were cultured in normal (7.8mM) glucose conditions
(white bar). GAPDH nuclear accumulation was analyzed and results presented as the mean ± SEM (n=6) with * =p<0.05 compared to normal
(7.8mM) glucose conditions, # =p<0.05 compared to IL-1β treated hMC.
(B) hMC were treated in normal glucose (7.8mM glucose), high (25mM) 95 glucose, or high (25mM) glucose + 2ng/ml IL-6. At 48 hours, GAPDH nuclear accumulation was assessed and results presented the mean ±
SEM (n=6) with * = p<0.05 compared to normal glucose, # = p<0.05 compared to high glucose.
96
ns
*
*
for Nuclear GAPDH (%) Nuclear(%) GAPDH for Number of Cells Positiveof Number
Glucose (mM) 7.8 7.8 7.8 7.8 7.8 7.8 7.8 TNFα (ng/ml) - 1 2 5 10 - 2 IL-1β (ng/ml) - - - - - 2 2
Figure 3. 8. TNFα Does not Induce GAPDH Nuclear Accumulation in hMC
hMC were cultured under normal (7.8mM) glucose conditions in the presence of increasing concentrations of TNFα (black bars), IL-1β
(2ng/ml), or combination of IL-1β (2ng/ml) and TNFα (2ng/ml) (striped bars) for 48 hours. Control cells were cultured in normal (7.8mM) glucose conditions (white bar). GAPDH nuclear accumulation was analyzed and results presented as the mean ± SEM (n=15) with * =p<0.05 compared to normal (7.8mM) glucose conditions (ns=not statistical significant).
97
HIGH GLUCOSE HIGH GLUCOSE
IL-1β IL-1 Receptor
GAPDH IL-6
IL-6
Caspase-1 Activity
GAPDH IL-1β
Nucleus
CELL DEATH Müller Cells
Figure 3. 9: Differential regulation of GAPDH nuclear accumulation by pro-inflammatory cytokines IL-1β and IL-6.
The pro-inflammatory cytokines IL-1β and IL-6 that are secreted by Müller cells under high glucose conditions differentially regulate GAPDH nuclear accumulation. The caspase-1 /IL-1β pathway strongly activates this early cell death event while IL-6 is protective. The threshold for the protective effect of secreted IL-6 to be observed is not achieved since the net effect is increased GAPDH nuclear accumulation and cell death.
98
Chapter 4: Seven in Absentia Homolog-1 Protein is Necessary for High Glucose-Induced GAPDH Nuclear Accumulation and Cell Death in Müller Cells 99
Introduction GAPDH nuclear accumulation has been suggested to participate in the development of various degenerative diseases including diabetic retinopathy (34, 35, 87, 110, 131, 148, 216, 223, 224, 238). Although events leading to GAPDH nuclear accumulation have been identified, the mechanism of movement of GAPDH from the cytosol to the nucleus is unclear. GAPDH lacks a common nuclear localization signal (NLS) and, therefore, cannot enter the nucleus by itself due to its size. A recent study has identified the E3 ubiquitin ligase seven in absentia homolog-1 (siah-1) as a potential carrier/shuttle protein (83). According to this study, GAPDH binds the NLS-bearing siah-1 forming a complex which subsequently promotes translocation of GAPDH from the cytosol to the nucleus. It is postulated that the NLS on siah-1 facilitates the nuclear movement of the complex.
Siah-1 proteins are human homologues of the evolutionarily conserved drosophila, E3 ubiquitin ligase seven in absentia (sina) protein
(170). Sina was first identified as a key protein during R7 photoreceptor development in the drosophila fruit fly whereby it facilitates the degradation of the transcriptional repressor of neuronal fate tramtrack
(TTK88) (28, 96, 228). Follow up studies have identified functions for siah-
1 in various cellular processes including mitosis, neuronal plasticity, development, angiogenesis, inflammation and cell death (20, 67, 73, 74,
78, 83, 96, 134, 162, 170, 186, 226). Two siah genes, siah-1 and siah-2 100 are present in humans and rats while mice have three siah genes siah-1a, siah-1b, and siah-2 (45, 95, 170). Siah-1a and siah-1b have 98% sequence homology. Structurally, siah-1 contains an N-terminal RING domain which facilitates the ligase function, two cysteine rich zinc finger domains and a substrate binding domain, which is localized on the C terminal of the protein (93, 94, 186). The last 12 amino acids on the C terminal in the substrate binding domain are necessary for GAPDH-siah-1 interaction (83). The NLS motif is also located in the substrate binding domain.
Elevated glucose levels act as a stimulus for GAPDH nuclear accumulation in retinal Müller cells via high glucose-induced activation of a caspase-1/interleukin-1β signaling pathway (260). We have also previously demonstrated that hyperglycemia-induced GAPDH nuclear accumulation not only occurs in retinal Müller cells in vitro but also in vivo during the development of diabetic retinopathy in rodents (131). Since
Müller cells maintain the retinal environment (109, 153, 172, 191, 197,
203), death processes within these cells can potentially compromise their function leading to disease. A better understanding of mechanisms leading to GAPDH translocation from the cytosol to the nucleus would be valuable because inhibition of this event has been demonstrated to increase cell survival in vivo and in vitro (86, 87, 131, 231). Therefore, the purpose of this study was to determine if high glucose regulates siah-1 and to examine the potential of this protein to bind and regulate Müller cell 101
GAPDH nuclear movement and cell death under hyperglycemic conditions. Results Effect of High Glucose on Siah- 1 Expression in rMC-1
We have recently shown that hyperglycemia leads to cell death of retinal Müller cells via GAPDH nuclear accumulation (131, 260). However, the mechanism of GAPDH translocation from the cytosol to the nucleus is unknown. Since a recent report has suggested that siah-1 can act as a carrier protein during this process (83), we determined whether high glucose can regulate expression of this protein. High (25 mM) glucose significantly increased siah-1 mRNA levels within 12 hours by 1.9±0.1 fold in rMC-1 compared to control cells cultured under normal (5 mM) glucose conditions (Figure 4.1A). In addition, a significant, 1.4±0.1 fold increase in siah-1 protein was detected after 12 hours of treatment (Figure 4.1B).
Increased siah-1 protein levels were sustained throughout 24 hours, the time point at which GAPDH nuclear accumulation can significantly be determined (260).
Determination of Siah-1 Levels and Localization in hMCs
To confirm that high glucose-induced changes in siah-1 were not the result of transformation in the rMC-1 cell line, the effect of elevated glucose levels on isolated human Müller cells (hMC) was determined.
High glucose (25 mM) treatment induced a modest but significant increase in siah-1 mRNA levels by 1.4±0.03 fold compared to control (Figure 4.2A) 102 and a significant 1.7±0.2 fold increase in siah-1 protein levels as determined by Western Blot analysis (Figure 4.2B). The antibody against human siah-1 allowed for determination of siah-1 localization within hMC under normal and high glucose conditions. A significant increase in the number of cells positive for nuclear siah-1 was observed in cells cultured under high glucose (69.7±9.4 %) conditions compared to control cells cultured in normal glucose (24.5±4.0 %) (Figure 4.2C).
Detection of High Glucose-Induced GAPDH-Siah-1 Complex in the Nucleus of rMC-1
A recent study suggested that formation of a complex between siah-1 and GAPDH is essential in the process of GAPDH nuclear accumulation (83). Since we have demonstrated that high glucose up- regulates siah-1, we were interested in examining whether such a complex can be detected in the nucleus of Müller cells further identifying a potential role of siah-1 as a shuttle protein for GAPDH to allow for translocation to the nucleus.
First, several immunoprecipitation control experiments were performed. Figure 4.3A shows that immunoprecipitation using goat serum did not pull down siah-1 or GAPDH. The siah-1 antibody used for immunoprecipitation assays was specific for siah-1, since pull-down of siah-1 and subsequent analysis of the immunoprecipitates for siah-1 using
Western Blot analysis detected only the siah-1 protein. To confirm that
GAPDH does not just bind to proteins in an unspecific manner, 103 immunoprecipitation assays using LDH were performed, since retinal
Müller cells highly express LDH. Figure 4.3A shows that GAPDH binds to siah-1 but not to the abundant LDH protein. Input levels of siah-1 and
GAPDH are presented as control. Finally, the siah-1 Western Blot analysis in the right panel demonstrates that lysates subjected to siah-1 immunoprecipitation are devoid of the protein indicating that pull-down of siah-1 was efficient and complete under our experimental conditions.
To demonstrate the presence of a siah-1-GAPDH complex in the nucleus of Müller cells, co-immunoprecipitation studies were done using equal amounts of nuclear fractions from rMC-1 cells subjected to normal or high glucose treatment. The 24 hour treatment time point was chosen, because this is the time point at which GAPDH nuclear accumulation can significantly be detected (260). High glucose treatment led to a significant increase in the amounts of siah-1 proteins in the nucleus and increased levels of nuclear GAPDH bound to siah-1 (Figure 4.3B). To determine whether increased levels of nuclear GAPDH bound to siah-1 were due to a potential increased binding of GAPDH to siah-1, ratios of GAPDH to siah-1 protein levels were calculated based on densitometry analysis of
Western Blots. High glucose treatment significantly increased the ratio of
GAPDH: siah-1 binding by 1.9±0.3 fold based on this analysis (Figure
4.3B).
Effect of Siah-1 Knock-Down by Siah-1 siRNA on Siah-1 and
GAPDH Protein Levels 104
Although the co-immunoprecipitation assays indicated the formation of a complex between siah-1 and GAPDH under hyperglycemic conditions, which was detectable in the nucleus of Müller cells, we opted to use siRNA technology to knock-down siah-1 to further confirm the necessity of siah-1 in the process of GAPDH translocation from the cytosol to the nucleus. 50nM siah-1 siRNA significantly decreased siah-1 mRNA expression at 20 hours by 63.9±8.5% compared to electroporation only (Figure 4.4A). Scrambled siRNA had no significant effect on siah-1 mRNA levels. In addition, 50nM siah-1 siRNA decreased siah-1 protein levels by 48.3±11.8% compared to electroporation only (Figure 4.4B).
Scrambled and risc free siRNA had no apparent significant effect on siah-
1 protein levels. Siah-1 knock-down did not affect GAPDH protein levels
(Figure 4.4B).
Effect of Siah-1 Knock-Down on GAPDH Nuclear Accumulation
Since we had established that 50 nM siRNA significantly reduced siah-1 protein levels, this concentration was used for further experiments.
To test whether siah-1 knock-down can prevent high glucose-induced
GAPDH nuclear accumulation, levels of nuclear GAPDH were determined following siah-1 knock-down in high glucose-treated retinal Müller cells.
The number of rMC-1 cells positive for nuclear GAPDH following high glucose treatment significantly decreased from 60.7±4.3% in scrambled siRNA-transfected control cells to 36.6±5.2% in siah-1 siRNA-transfected cells strongly indicating that siah-1 is necessary for GAPDH nuclear 105 translocation (Figure 4.4C). The number of GAPDH positive cells in the normal scrambled control siRNA control cells was 31.1±2.5%.
GAPDH-Siah-1 Interaction is Necessary for GAPDH Nuclear
Accumulation.
A previous study has shown that a 12 amino acid truncation of the siah-1 C terminal prevented complex formation with GAPDH (83). These
12 amino acids are part of the substrate binding domain. Using a truncated form of siah-1, we confirmed the necessity of GAPDH-siah-1 interaction for high glucose-induced GAPDH nuclear accumulation. Cells transfected with truncated siah-1 lacking residues 271-282 (siah-1 Δ aa 1-
270) did not show any increase in the number of cells positive for nuclear
GAPDH following high glucose stimulation compared to control. In contrast, cells transfected with vector only showed a significant increase of
55.6±10.5% in cells positive for nuclear GAPDH when exposed to high glucose compared to control (Figure 4.5A). Transfection of Müller cells with wt siah-1 leads to a similar increase of cells positive for nuclear
GAPDH as observed in cells transfected with vector only following high glucose stimulation (data not shown). As control, Figure 4.5B shows that
GAPDH does not increasingly bind to truncated siah-1 in hyperglycemic conditions as determined by Western Blot although overall unspecific binding of GAPDH to siah-1 seemed to have been elevated. High glucose led to a significant 1.65±0.36 fold increase in the ratio of GAPDH binding to siah-1 in vector only treated cells compared to cells transfected with 106 truncated siah-1 (0.06±0.02). These data provide further evidence that
GAPDH-siah-1 interaction is crucial for high glucose-induced GAPDH nuclear translocation in retinal Müller cells.
The Role of Siah-1 Knock-Down on p53 Phosphorylation Under
High Glucose Conditions.
So far, we have demonstrated that siah-1 is necessary for GAPDH nuclear translocation. Although nuclear GAPDH has strongly been linked to cell death induction, the function of GAPDH in the nucleus is unknown and has only been speculated about. To date, only one study has proposed a mechanism for cell death induction by nuclear GAPDH. This recent report suggested that GAPDH plays an integral role in the acetylation of p53, a well known protein involved in a variety of cell death processes, connecting nuclear siah-1 and GAPDH to cell death induction
(207). Since transcriptional activity of p53 is also heavily regulated by phosphorylation, we examined the effect of siah-1 knock-down on p53 phosphorylation at serine 15. Serine 15 is the most common phosphorylation site of p53 leading to p53 transcriptional activity during cell death. High glucose increased phosphorylation of serine 15 by
17.5±3.1% compared to control cells. Siah-1 knock-down which prevents
GAPDH from entering the nucleus inhibited p53 phosphorylation at serine
15, indicating that nuclear GAPDH might regulate p53 transcriptional activity (Figure 4.6A). Siah-1 knock-down also prevented high glucose- induced acetylation of p53 (data not shown). To test whether changes in 107 the phosphorylation state of p53 at serine 15 indeed induce transcriptional activity of p53 and whether siah-1 knock-down can prevent p53 transcriptional activity, we determined protein expression levels for the well know p53 driven target gene Bax. A significant 21.2±0.6% increase in
Bax protein was observed following high glucose treatment compared to normal glucose in the control scrambled siRNA-treated cells (Figure 4.6B), whereas siah-1 knock-down using siRNA reduced high glucose-induced
Bax levels by 15.2±3.8%.
Effect of Siah-1 Knock-Down on High Glucose-Induced Cell
Death in Müller Cells.
To reinforce the idea that GAPDH nuclear translocation leads to cell death under high glucose conditions, the effect of siah-1 knock-down on high glucose-induced cell death was determined using caspase-6 activity and trypan blue viability assays. High glucose significantly increased the activity of caspase-6, an executioner caspase, to 166.8±4.2 pmol AFC/mg/min from 118.3±11.5 pmol AFC/mg/min in control cells.
Siah-1 siRNA knock-down reduced high glucose-induced caspase-6 activity to 123.6.±13.6% (Figure 4.7A). Further, high glucose treatment increased cell death by 4.5±2.0 fold. High glucose-induced cell death was diminished 1.6±0.6 fold in cells subjected to siah-1 siRNA indicating that inhibition of GAPDH nuclear translocation within the first 24 hours strongly affects cell death detectable at 96 hours (Figure 4.7B). 108
Discussion Hyperglycemia causes GAPDH nuclear translocation and accumulation in retinal Müller cells in vivo and in vitro (131, 260). The mechanism underlying the movement of GAPDH from the cytosol to the nucleus under high glucose conditions in these cells is not completely understood. In the present study, we have demonstrated that the E3 ubiquitin ligase siah-1 facilitates GAPDH nuclear translocation via formation of a complex with GAPDH. In contrast to GAPDH, siah-1 carries a NLS motif allowing for transport to the nucleus.
More importantly, siah-1 knock-down studies and studies using a truncated form of siah-1 have confirmed that siah-1 is necessary and crucial for the processes of high glucose-induced GAPDH nuclear accumulation and subsequent cell death in Müller cells. Although the exact function of GAPDH in the nucleus is largely unknown, our results indicate that nuclear GAPDH seems to be involved in the regulation of p53 activation.
Our current studies provide evidence that siah-1 plays a critical role in the process of GAPDH nuclear translocation. However, it is somehow surprising that this type of protein is critically involved in this process.
Siah-1 is most commonly associated with its E3 ubiquitin ligase function during ubiquitin-dependent proteasomal degradation (67, 74, 136, 165,
226, 257). In diabetic retinopathy, proteins associated with ubiquitination and protein turnover are up regulated during the development of the 109 disease (2). The glucose transporter GLUT1 and angiotensin II type 1 receptor (AT1R) have been identified as specific targets for protein degradation through this pathway in the diabetic retina. In addition to tagging proteins for proteasomal degradation, post-translational modification via ubiquitination may also acts as signaling mechanisms.
Increased ubiquitination has been associated with the progression of neurodegenerative diseases. For example, ubiquitination by siah-2 has been shown to induce alpha synuclein aggregation and cytotoxicity in neuronal cells during the development of Parkinson’s disease, and siah-1 auto-ubiquitination has been suggested to occur during complex formation between GAPDH and siah-1 (83, 134).
Other functions of siah-1 involve regulation of cell cycle and pro- survival proteins through protein degradation (20, 139, 226, 257). Whether inhibition of high glucose-induced cell death of Müller cells by siah-1 knock-down results from the inhibition of these alternative functions of siah-1 is not known. Future studies need to be done to determine the role of ubiquitination in this process. The focus of our study was to understand the role of siah-1 in the process of GAPDH nuclear translocation and subsequent cell death induction. Although humans and rats have two siah-
1 homologs: siah-1 and siah-2 (45, 95, 170), our studies have focused on siah-1, since siah-2 does not have a NLS motif based on sequence prediction analysis. 110
Even though GAPDH does not contain a NLS, the protein contains an export signal for protein extrusion from the nucleus (16). It is possible that the absence of GAPDH in Müller cell nuclei under normal glucose conditions results from efficient nuclear to cytosolic export. Impaired protein export in high glucose conditions might also be responsible for accumulation of GAPDH in the nucleus. Conformational changes to
GAPDH following siah-1 binding may also affect the ability of GAPDH to interact with the export machinery of the nucleus.
Although the translocation and accumulation of GAPDH has been linked to cell death induction, the function(s) of GAPDH within the nucleus have not fully been identified. Studies in neurons that made use of an
NLS-tagged GAPDH construct indicate that simple localization of GAPDH in the nucleus might not be sufficient to initiate cell death (120). Post- translational modifications of GAPDH appear to be necessary for nuclear import and the cell death functions of this protein (52, 83, 86, 110).
Several studies suggest that nitric oxide (NO) is a key regulator of these post-translational modifications (23, 52, 83, 86, 199, 207). Some of these post-translational modifications of GAPDH have recently been demonstrated in nuclear extracts of retinas obtained from diabetic rats
(110). We have previously shown that the caspase-1/IL-1β signaling pathway mediates hyperglycemia-induced GAPDH nuclear accumulation in Müller cells (51). IL-1β is very well known to induce NO production and high glucose-induced NO production has been demonstrated in Müller 111 cells (51) indicating the possibility of NO-mediated post-translational modification of GAPDH during GAPDH nuclear translocation.
One, newly identified potential function of GAPDH in the nucleus seems to involve the regulation of p53 activation, a well known protein heavily involved in induction of several types of cell death (207). A recent study has suggested that the process involves activation of p53 via acetylation by p300/CBP subsequent to GAPDH-mediated activation of these acetylation enzymes (207). Our studies also suggest that besides acetylation of p53 nuclear GAPDH might also regulate phosphorylation of p53, which stabilizes p53. The role of siah-1 in both of these processes, acetylation and phosphorylation of p53 has not been determined and might just be related to transport of GAPDH to the nucleus. On the other hand, a previous study not focused on the interaction between GAPDH and siah-1 has demonstrated a role for siah-1 itself in the process of p53 activation (20). Siah-1 and p53 seem to be connected and regulated via a positive feedback mechanism because siah-1 is also regulated by p53
(62). More studies are needed to clearly identify the role of nuclear siah-1 and GAPDH in the process of cell death induction.
Retinal Müller cells structurally and functionally maintain the retina and its vasculature (49, 109, 153, 172, 191, 197, 203). Therefore, Müller cell dysfunction and loss in the diabetic retina (159) possibly compromises the integrity of retinal tissue leading to disease. GAPDH nuclear accumulation might play an integral role in the induction of cell loss within 112 the diabetic retina. A recent report has demonstrated that GAPDH nuclear accumulation persists when diabetic animals were brought back from poor to good control of blood glucose levels (110). The study also indicated that in these animals progression of diabetic retinopathy was still present.
Although our studies have focused on identifying mechanisms underlying
GAPDH nuclear accumulation in Müller cells in vitro and in vivo (131,
260), we do not want to exclude the possibility that other retinal cells are affected by hyperglycemia in a similar fashion. High glucose induces cell death in several other retinal cell types in the diabetic retina (58, 137, 144,
180, 184, 222). Inhibition of GAPDH nuclear translocation is clearly protective. We have previously shown that the mono amino oxidase inhibitor R-deprenyl prevents GAPDH nuclear accumulation and cell death in Müller cells cultured under high glucose conditions (131). Recently, a study has demonstrated that R-deprenyl acts by interfering with GAPDH- siah-1 interaction (87). Taken together, our results indicate the potential of compounds that target the GAPDH-siah-1 interaction as therapies to increase Müller cell survival under hyperglycemic conditions and potentially prevent the progression of diabetic retinopathy. 113
Figures
A)
12 hrs 2.2 2.0 * 1.8 1.6 1.4 1.2 1.0 0.8
0.6
1 mRNA/ 18S mRNA mRNA mRNA/ 18S 1 (Relative Intensity) Intensity) (Relative - 0.4 0.2 Siah - Glucose (mM) 5 25
B) 12 hrs 24 hrs
Siah-1 (32 kDa)
Actin (43 kDa) Glucose (mM) 5 25 5 25
2.5 * 2.0 *
1.5
1.0
1:Actin ratio 1:Actin -
0.5 Siah
0.0 Glucose (mM) 5 25 5 25
Figure 4. 1. Siah-1 is Regulated by High Glucose in Transformed Rat
Retinal Müller Cells rMC-1 were cultured in normal (5mM) glucose or high (25mM) glucose for up to 24 hours. (A) Siah-1 mRNA levels were quantified using real-time quantitative PCR analysis following treatment for 12 hours. Values from independent experiments were normalized and graphed as mean ± SEM
(n=5, * = p <0.05). (B) Changes in siah-1 protein levels were determined 114 using Western Blot analysis. Siah-1 Western Blots were quantified using densitometry analysis, normalized to actin, and graphed as mean ± SEM
(n=4, * = p <0.05). 115
A) B) 24 hrs
Siah-1 (32 kDa) 12 hrs 2.0 Actin (43 kDa) 1.8 Glucose (mM) 7.8 25 1.6 1.4 * 1.2 2.5 * 1.0 2.0 0.8 1.5
0.6
1 mRNA/ 18S mRNA mRNA mRNA/ 18S1
(Relative Intensity) Intensity) (Relative 1:Actin ratio 1:Actin - 1.0 0.4 - 0.5
Siah 0.2 Siah - 0.0 Glucose (mM) 7.8 25 Glucose (mM) 7.8 25
C)
Siah-1 80 * 70
60 1 (%)
- 50 40 Dapi 30 20
10 Nuclear Siah Nuclear
0 No. of for of Positive Cells No. Merge Glucose (mM) 7.8 25
7.8mM Glucose 25mM Glucose Figure 4. 2. Siah-1 Levels are Increased in High Glucose-Treated
Isolated Human Müller Cells and are Localized in the Nucleus hMC were cultured in normal (7.8 mM) glucose or high (25mM) glucose for up to 48 hours. (A) Siah-1 mRNA levels were quantified using real-time quantitative PCR analysis following treatment for 12 hours. Values from independent experiments were normalized and graphed as mean ± SEM
(n=3, * = p <0.05). (B) Changes in siah-1 protein levels were examined using Western Blot analysis following treatment for 24 hours. Siah-1
Western Blots were quantified using densitometry analysis, normalized to actin, and graphed as mean ± SEM (n=4, * = p <0.05). (C) Siah-1 116 fluorescence microscopy analysis was used to determine siah-1 sub- cellular localization following high glucose treatment for 48 hours. Number of cells positive for nuclear siah-1 were quantified and values from independent experiments were graphed as mean ± SEM (n=4, * = p<0.05). 117
A)
IP: Goat IP: Siah-1 IP: LDH Siah-1 Depleted Siah-1 Serum Lysates control Siah-1 (32 KDa) WB: Siah-1 GAPDH (37 KDa) (32 kDa) Glucose (mM) 5 25 LDH (45 KDa) Glucose (mM) 5 25 5 25 5 25
Siah-1 Input (32 KDa)
GAPDH Input (37 KDa)
Glucose (mM) 5 25 5 25 5 25
B)
Nuclear Fraction 1.2 IP: Siah-1 WB: 1.0
1 Ratio1 * Siah-1 (32 KDa) - 0.8 IP: Siah-1 WB: 0.6 GAPDH (37 KDa) 0.4 0.2 Histone 2B (14KDa)
GAPDH:Siah 0.0 Glucose (mM) 5 25 LDH (45KDa)
Cytosolic control
Siah-1 Input (32 KDa)
GAPDH Input (37KDa)
Glucose (mM) 5 25 Figure 4. 3. High Glucose Induces Complex Formation Between
GAPDH and Siah-1 Detectable in the Nucleus of Müller Cells
(A) rMC-1 cells cultured under normal (5mM) or high (25mM) glucose conditions for 12 hours were subjected to goat serum, siah-1, or LDH immunoprecipitation followed by Western Blot analysis. Membranes were probed for siah-1 and LDH to confirm protein pull down. Membranes were 118 then stripped and re-probed for GAPDH to evaluate the specificity of
GAPDH binding to siah-1 (n=3). As control, input levels of siah-1 and
GAPDH are presented. To determine efficiency of siah-1 protein pull down, lysates devoid of siah-1 due to siah-1 immunoprecipitation were subjected to siah-1 Western Blot analysis (n=3) – right panel. (B) rMC-1 cells were cultured under normal (5mM) or high (25mM) glucose conditions for 24 hours. Crude nuclear fractions were generated from treated cells and equal amounts of lysate assessed for GAPDH-siah-1 complex formation using co-immunoprecipitation analysis. Siah-1 immunoprecipitates were first probed against siah-1. Stripped membranes were re-probed for GAPDH. Fraction purity was assessed using nuclear marker histone 2B and cytosolic marker LDH. Images are representative of results from 3 independent experiments. The ratio of GAPDH to siah-1 binding under treatment conditions was calculated. Results are presented as the mean ± SEM (n=3, * =p<0.05). 119
A) 1.0 0.8 0.6
0.4 *
1 / 18S mRNA mRNA 18S / 1 -
0.2 (Relative Intensity) Intensity) (Relative Siah 0.0 Glucose (mM) 25 25 25 3.5 Siah-1 Electro only + - - Scrambled siRNA (nM) - 50 - 3.0 Siah-1 siRNA (nM) - - 50 2.5 2.0 *
1.5 1:Actin Ratio 1:Actin B) - 1.0 0.5
Siah-1 (32 kDa) Siah 0.0 GAPDH (32 kDa)
Actin (43 kDa) 2.0 GAPDH Glucose (mM) 25 25 25 25 25 Electro only + - - - - 1.5 Scrambled siRNA (nM) - - 50 - - 1.0 Risc Free siRNA (nM) - - 50 - - Siah-1 siRNA (nM) - - - 20 50 0.5
0.0 GAPDH :Actin Ratio :Actin GAPDH Glucose (mM) 25 25 25 25 25 Electro only + - - - - Scrambled siRNA (nM) - 50 - - - Risc Free siRNA (nM) - - 50 - - Siah-1 siRNA (nM) - - - 20 50
C) Scrambled Siah-1 Scrambled siRNA Siah-1 siRNA siRNA (50nM) siRNA (50nM) (50nM) (50nM) 70 * 60 GAPDH 50 # 40 Dapi 30 20
Merge GAPDH (%) Nuclear 10 No. of of No. CellsPositivefor 0 Glucose 5 mM 25mM 5mM 25mM Glucose (mM) 5 25 5 25 Figure 4. 4. High Glucose-Induced GAPDH Nuclear Accumulation is
Decreased Following Siah-1 Knock-Down Using siRNA rMC-1 transfected with 50nM scrambled control siRNA, 50nM risc free control siRNA, 20nM siah-1 siRNA or 50nM siah-1 siRNA were treated in high (25mM) 120 glucose. (A) At 20 hours post-transfection, siah-1 mRNA levels were quantified using real-time quantitative PCR analysis. Results are presented as the mean ±
SEM (n=4, * =p<0.05). (B) Siah-1 protein levels were determined using Western
Blot analysis at 48 hours post-transfection. Membranes were stripped and re- probed for GAPDH and actin. Siah-1 and GAPDH were quantified using densitometry analysis, normalized to actin, and graphed as mean ± SEM (n=4, *
= p <0.05). (C) rMC-1 cells transfected with either scrambled control siRNA
(50nM) or siah-1 siRNA (50nM) were treated in normal (5mM) or high (25mM) glucose for 24 hours. Following treatment, cells were processed for GAPDH immunofluorescence analysis and cells positive for nuclear GAPDH were counted. Results represent the mean ± SEM (n=4, * = p<0.05 compared to scrambled control siRNA normal glucose, # = p<0.05 compared to scrambled control siRNA high glucose). 121
A)
Vector Siah-1 Δ aa 1-270 60.0
50.0 *
40.0 #
30.0 GAPDH (%) GAPDH 20.0
10.0 No. of of No. CellsPositivefor Nuclear
0.0 Glucose (mM) 5 25 5 25
B) Vector Siah-1 Δ aa 1-270 IP: Siah-1 WB: Siah-1 (37 kDa) IP: Siah-1 WB: GAPDH (32 kDa) Glucose (mM) 5 25 5 25
Siah-1 Input (32 KDa) GAPDH Input (37 KDa) Glucose (mM) 5 25 5 25 Figure 4. 5. Truncation of Siah-1 Prevents GAPDH Binding and
Translocation to the Nucleus
(A) rMC-1 cells transfected with either control vector (10µg) or siah-1Δ aa
1-270 (10µg) were treated in normal (5mM) or high (25mM) glucose for 24 hours. Following treatment, cells were processed for GAPDH immunofluorescence analysis and cells positive for nuclear GAPDH were counted. Results represent the mean ± SEM (n=8, * = p<0.05 compared to cells transfected with vector only in normal glucose, # = p<0.05 compared to high glucose treated cells transfected with vector only). (B) rMC-1 cells transfected with control vector (10µg) or siah-1Δ aa 1-270 (10µg) were treated in normal (5mM) or high (25mM) glucose for 12 hours. Cells were 122 subjected siah-1 immunoprecipitation followed by siah-1 Western Blot analysis after treatment. Membranes were then stripped and re-probed for
GAPDH to evaluate the effect of siah-1 truncation on GAPDH siah-1 complex formation (n=3). Western Blot is representative of 4 independent experiments. 123
A) Scrambled siRNA Siah-1 siRNA (50nM) (50nM)
1.8 * # Scrambled siRNA Siah-1 siRNA 1.6
(50nM) (50nM) 15 :Total p53 ratio p53 :Total 15
Phospho p53 – -
Ser-15 (53 kDa) 1.4
Ser - Total p53 (53 kDa) 1.2 Glucose (mM) 5 25 5 25
Phospho p53 Phospho 1 Glucose (mM) 5 25 5 25
B) Scrambled siRNA Siah-1 siRNA (50nM) (50nM)
1.8 1.6 Scrambled siRNA Siah-1 siRNA 1.4 * (50nM) (50nM) 1.2 #
Bax (20 kDa) 1 0.8 Actin (43 kDa) Bax :Actin ratio :Actin Bax 0.6
Glucose (mM) 5 25 5 25 0.4 0.2 0 Glucose (mM) 5 25 5 25 Figure 4. 6. Siah-1 Knock-down Decreases High Glucose-Induced p53 Phosphorylation and Bax Up Regulation rMC-1 cells transfected with scrambled control siRNA (50nM) or siah-1 siRNA (50nM) were treated in normal (5mM) or high (25mM) glucose for
24 hours. (A) Following treatment, p53 phosphorylation at serine 15 was determined using Western Blot analysis of total lysates. Membranes were stripped and re-probed for total p53. Phospho p53 Western Blots were quantified using densitometry analysis, normalized to total p53, and graphed as mean ± SEM (n=5, * = p<0.05 compared to cells transfected with scrambled siRNA in normal glucose, # = p<0.05 compared to cells transfected with scrambled siRNA in high glucose). (B) Total lysates generated from treated cells were assessed for Bax protein levels using 124
Western Blot analysis. Membranes were stripped and re-probed for actin.
Bax Western Blots were quantified using densitometry analysis, normalized to actin and graphed as mean ± SEM (n=3, * = p<0.05 compared to cells transfected with scrambled siRNA in normal glucose, #
= p<0.05 compared to cells transfected with scrambled siRNA in high glucose). 125
A)
Scrambled siRNA Siah-1 siRNA (50nM) (50nM) 180.0 *
160.0 6 Activity Activity 6 - 140.0 #
120.0
Caspase (pmol AFC/mg/min) (pmol 100.0 Glucose (mM) 5 25 5 25
Scrambled siRNA Siah-1 siRNA (50nM) (50nM) B) 14.0 * 12.0
10.0
8.0
6.0 # % Cell Death Death % Cell 4.0
2.0 (Based on Trypan Blue Assay) Blue Trypan on (Based 0.0
Glucose (mM) 5 25 5 25
Figure 4. 7. Inhibition of High Glucose-Induced Cell Death by Siah-1
Knock-Down rMC-1 cells transfected with scrambled control siRNA (50nM) or siah-1 siRNA (50nM) were treated in normal (5mM) or high (25mM) glucose for
96 hours. (A) Following treatment, caspase-6 activity was measured.
Results represent the mean ± SEM (n=8, * = p<0.05 compared to scrambled siRNA normal glucose, # = p<0.05 compared to scrambled 126 siRNA high glucose). (B) Cell viability was determined using trypan blue viability assays. Results represent the mean ± SEM (n=8, * = p<0.05 compared to scrambled siRNA normal glucose, # = p<0.05 compared to scrambled siRNA high glucose). 127
HIGH GLUCOSE
GAPDH
Siah-1 NLS GAPDH
Siah-1 NLS
GAPDH
Siah-1 NLS Nucleus
Müller Cells P53 ACTIVATION
CELL DEATH
Figure 4. 8: Siah-1 Protein Facilitates Müller Cell GAPDH Nuclear
Accumulation and Cell Death under High Glucose Conditions
Our results demonstrate that siah-1 is up regulated under high glucose conditions in retinal Müller cells. The GAPDH binding capacity for this protein also increases under these conditions. Siah-1 knock down studies indicate that this protein is necessary for GAPDH nuclear accumulation in retinal Müller cells under high glucose conditions. Further, elimination of
GAPDH from the nucleus, using siah-1 knock down indicates that nuclear localization of these two proteins is necessary for activation of the transcription factor p53 and subsequent cell death. 128
ON-TARGETplus SMART pool siRNA Target sequence
J-094413-09, SIAH-1 CAACAAUGACUUGGCGAGU
J-094413-10, SIAH-1 GGUCAUGGGCCACCGCUUU
J-094413-11, SIAH-1 CCGAAAAGGCAGAGCACGA
J-094413-12, SIAH-1 GAGAUAACUCUGCCGCACA
Table 1. Rat ON-TARGET Smart Pool Siah-1 siRNA 129
Chapter 5: Mechanisms of High Glucose-Induced Cell Death of Retinal Müller Cells 130
Introduction Our studies have outlined a mechanism for pro-death GAPDH nuclear accumulation in retinal Müller cells subjected to high glucose conditions. This mechanism is strongly dependent on caspase-1/IL-1β signaling, as well as complex formation between GAPDH and the protein siah-1. Even though the series of events in the early phases of cell death are now clearer, mechanisms for Müller cell death execution during the final stages of cell death are less well understood. In vitro studies demonstrate that Müller cells die slowly in hyperglycemic conditions.
Müller cell death in vivo has been a controversial topic.
Few studies on Müller cell death in vivo during the development of diabetic retinopathy have demonstrated any TUNEL positive Müller cells.
TUNEL staining is the most common technique to identify apoptosis and aims at detecting specific DNA cleavage induced by ICAD in the very late stages of the apoptotic event. Apoptosis in vivo is notoriously difficult to determine as apoptotic cells in vivo are usually cleared very rapidly by phagocytosis. The lack of other experimental tools leaves TUNEL staining and electron microscopy (EM) as the only tools available to detect cell death.
Even though Müller cell apoptosis has sparsely been detected in vivo using TUNEL staining, two studies performed in 1980 that utilized electron microscopy (EM), describe “partial cell death” of Müller cells in the retina of diabetic rats at 4 months duration of diabetes (89, 90). The 131 use of different techniques to determine Müller cell death has significantly contributed to the controversy of this topic. The papers using EM describe structural changes and vasculature loss in retinal areas undergoing Müller cell death. The most prominent observation from these studies is the description of vacuolar/ “Swiss cheese-like structures” in Müller cells from diabetic animals. These studies also describe increased numbers of lysosomes within Müller cells. These observations are strikingly similar to the autophagy phenomenon which is described by increased lysosomal activity and formation of double-membraned vacuoles as key features associated with this mechanism of cell death. Although potentially very interesting, these observations were never followed up by newer more specific studies identifying Müller cell loss in diabetic retinopathy.
The most well established form of programmed death is apoptosis.
In the past, the terms apoptosis and programmed cell death (PCD) were actually used synonymously. However, several additional types of cell death processes have been described during the last two decades (129).
In addition to apoptosis, the 2009 recommendations from the
Nomenclature Committee on Cell Death (NCCD) put forth autophagy, pyroptosis, necrosis, pyroptosis, entosis, mitotic catastrophe, cornification and necroptosis as some of newly defined types/classes of cell death
(129).
Apoptosis 132
As stated above, apoptosis is the most well known form of programmed cell death. Major features that typify cells undergoing apoptosis include specific DNA fragmentation (karyorrhexis), chromatin condensation, cell shrinkage (pyknosis), blebbing, organelle preservation, and caspase enzyme activation (129). DNA fragmentation which is the hallmark feature of apoptosis is detected using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL). Chromosomal DNA fragmentation results from increased caspase activated DNAse (CAD) activity (165).
Caspases (derived from the term cysteine-aspartic proteases) are a family of structurally similar proteases which play major roles during apoptosis and inflammation. Caspases implicated in apoptosis can be further divided into initiator and effector subgroups. Initiator caspases
(caspase-2, -8, -9, and -10) have long pro-domains and function to activate effector caspases (caspase-3, -6, and -7). Effector caspases in turn cleave other substrates to activate apoptotic processes. One such substrate for effector caspases, in particular caspase-3 is the inhibitor of
CAD (ICAD) which performs its inhibitory action by forming a complex with
CAD. ICAD cleavage dissociates this complex, allowing CAD to cleave chromosomal DNA (165). Cells that lack ICAD or that express caspase- resistant mutant ICAD do not show DNA fragmentation during apoptosis, although they do exhibit some other features of apoptosis and die (165). 133
No studies have clearly demonstrated Müller cell apoptosis in the diabetic retina. However, Müller cell death has been detected in the diabetic retina, leaving the possibility that diabetes-induced Müller cell death is mediated by a cell death type other than apoptosis. Since our in vitro studies have demonstrated that hyperglycemia-induced cell death is strictly caspase-1/IL-1β dependent, pyroptosis could be the potential cell death process induced by diabetes.
Pyroptosis
One of the more recently defined forms of cell death is pyroptosis.
This term derives its origins from the Greek words "pyro," relating to fire or fever, and "ptosis" which means to fall (39). Pyroptosis is primarily associated with cell death resulting from microbial infections (232). This pro-inflammatory form of cell death is defined by its unique dependence on pro-inflammatory caspase-1 (15, 32, 87). Loss of membrane permeability in the late stages of this type of cell death has been suggested as a potential feature of this form of cell death (15, 47, 102).
However, this is difficult to determine because dying cells in in vitro systems are generally known to undergo “secondary necrosis” due to the lack of phagocytosis and loss of membrane integrity might just be an artifact of cell culture. In contrast to apoptosis, cells undergoing pyroptosis appear to swell due to increased pore formation and potential membrane permeability (60). Lack of caspase-3 activation is another distinguishing factor between pyroptosis and apoptosis (15). Nonetheless, some studies 134 have demonstrates very few, unspecific TUNEL positive cells during pyroptosis (12, 60, 142, 159). These observations may also represent the occurrence of multiple cell death processes at the same time. Some studies also indicate that caspase-1 activation during apoptosis may partially rely on caspase-2 activity and other early pro-apoptotic events
(102). Besides the strong and rapid activation of caspase-1 and IL-1β production, mechanisms regarding the execution phase of this cell death type are mostly unknown.
Therefore, the overall goal of this study was to indentify whether hyperglycemia-induced cell death of Müller cells in vitro and in vivo is processed via apoptosis or potentially pyroptosis.
Results Müller Cells do not Undergo Apoptotic Cell Death despite
Decreased Müller Cell Viability under High Glucose Conditions.
Müller cells subjected to high glucose treatment display some cell death features consistent with apoptosis (p53, reactive oxygen species formation by mitochondria, and downstream caspase activation). Other apoptosis defining features (strong downstream caspase-3 activation,
ICAD cleavage, and classical DNA laddering), however, are missing. We determined Müller cell death using two different techniques, trypan blue exclusion and TUNEL assays. The trypan blue assay is a crude but widely accepted assay to distinguish between live and dead cells by the ability of 135 the cells to keep the blue dye out indicating a cell is alive. This assay only provides a yes or no result regarding cell death, but does not determine the type of cell death. The TUNEL assay is considered a specific technique to determine cell death by apoptosis in which specific apoptotic
DNA cleavage sites are labeled. High glucose significantly increased cell death as determined by trypan blue assay from 6.0±2.0% to 19.3±2.4%
(Figure 5.1A). These observations confirm that Müller cells are indeed dying following exposure to high glucose. However, no significant changes in TUNEL staining were observed under the same treatment conditions indicating that high glucose-induced cell death does not occur through apoptosis (Figure 5.1B). These findings are consistent with the observation that hyperglycemia-induced caspase-3 activation is significant but very low in comparison to activation of caspase-3 found in apoptotic events.
Caspase-1 Inhibition Prevents Müller Cell Death Under High
Glucose Conditions.
Previous studies have demonstrated a central role for caspase-1 activation during the development of pathology associated with diabetic retinopathy (157, 241). Studies have also shown that Müller cells are a major source for the increased caspase-1 activity and subsequent IL-1β production (241, 259). In addition, we have shown that treating cells with
IL-1β leads to increased cell death (259). Since caspase-1 is clearly up regulated by high glucose in Müller cells and caspase-1 activation plays a 136 central role during pyroptotic cell death, we examined the effect of caspase-1 inhibition on human Müller cell death in vitro as determined by trypan blue viability assays. 100µM YVAD-fmk (caspase-1 inhibitor) treatment significantly decreased high glucose-induced cell death to
3.7±2.4% compared to cells treated under high glucose alone
(19.3±2.4%). Cell death in normal glucose and the normal glucose plus
100µM-YVAD-fmk control was 6.0±2.0% and 8.3±3.0% respectively
(Figure 5.2).
High Glucose-Induced Mitochondrial Activation in Müller Cells is attenuated by Caspase-1 Inhibition.
Increased mitochondrial superoxide production has previously been associated with Müller cell death under high glucose conditions (50).
Since this event has been associated with apoptotic as well as pyroptotic cell death mechanisms (131), we examined whether changes in mitochondrial superoxide production are caspase-1-dependent to determine if pyroptotic cell death is present. High glucose significantly increased rMC-1 mitochondrial superoxide production by 79.5±33.6 % compared to normal glucose treated cells, whereas 100µM YVAD-fmk
(caspase-1 inhibitor) significantly decreased this effect by 23.1±9.8%
(Figure 5.3). 137
High Glucose Exposure Leads to Increased Müller Cell
Autophagy In Vitro.
Since the execution phase of hyperglycemia-induced cell death of
Müller cells does not follow apoptotic pathways, we determined whether autophagy, recently described as an alternative death pathway, plays a role in the execution of cell death. Formation of double-membraned vacuoles and increased lysosomes in Müller cells from diabetic rats (89,
90) point to possible activation of autophagic cell death in these cells under hyperglycemic conditions. To examine Müller cell autophagy in normal (5mM) and high (25mM) glucose conditions, LC3 Western Blot and immunohistochemical analysis were used. Degradation of autophagic contents occurs via lysosomal degradation. Therefore, we also examined changes in lysosmal activity using lysotracker dye. A significant
43.0±8.0% increase in lysotracker activity compared to normal glucose was detected following high glucose treatment (Figure 5.4C). High glucose treatment also increased amounts of LC3 II as detected via
Western Blot and immunofluorescence analysis (Figure 5.4A and 5.4B) demonstrating a possible role for autophagy during the execution of Müller cell death. 138
Diabetes-Induced Müller Cell Loss In Vivo is Caspase-1/IL-1β
Signaling-Dependent.
Caspase-1 inhibition prevents Müller cell death in vitro, in line with a potential pyroptotic cell death pathway. If hyperglycemia-induced cell death of Müller cells is mediated via a pyroptotic mechanism, caspase-1 and IL-1β receptor knock-out mice should be protected from diabetes – induced loss of Müller cells. Therefore, we examined effects of diabetes on Müller cell loss in wild type, caspase-1, and IL-1 receptor knockout mice. Diabetes was induced in wild type, caspase-1 knock-out [cas-1(-/-)] and IL-1 receptor knock-out [IL-1R(-/-)] mice via STZ injections as described in the material and methods section (Chapter 2). After 7 months of diabetes, animals along with age-matched controls were sacrificed and the eyes processed for GS staining to visualize retinal Müller cells.
Weights and blood glucose levels were determined at the time of euthanasia (Table 2), to ascertain that mice were indeed diabetic. The number of Müller cells in each treatment condition per unit area was determined. We observed a significant decrease in the number of Müller cells from 1368.2±9.8 cells/mm2 in normal wild type mice to
1201.22±28.72 cells/mm2 in diabetic wild type mice (Figure 5.5).
Decreased Müller cell numbers were not observed in the diabetic IL-1R knockout mice (1368 .00±39.53 cells/mm2) and caspase-1 knockout mice
(1334.88±27.09 cells/mm2) demonstrating the involvement of the caspase- 139
1/IL-1β signaling pathway during diabetes-induced Müller cell loss in vivo
(Figure 5.5).
Discussion Our current studies show that hyperglycemia leads to Müller cell loss in vivo and in vitro. We have also determined that Müller cells do not undergo apoptotic cell death (Figure 5.1A and 5.1B) when exposed to elevated glucose levels but rather die by a pyroptotic process. The lack of
TUNEL staining in pyroptotic cell death may explain why despite earlier observations demonstrating Müller cell death in the diabetic retina as determined by electron microscopy (89, 90), the role for this event during the development of diabetic retinopathy was never followed up, possibly because these cells did not display apoptotic features.
Studies by us have shown that other pro-death features for example increased mitochondrial superoxide production, up regulation of the pro-death transcriptional regulator p53, GAPDH nuclear accumulation, increased caspase-6 activity, and a modest increase in caspase-3- activity precede loss of Müller cell viability under high glucose (summarized in
Figure 5.6). Despite the small increase in caspase-3 activity under high glucose conditions, we do not observe ICAD cleavage and consequent
DNA laddering (158), indicating that this activity may not be sufficient to activate this series of events. The small amount of caspase-3 activity may actually represent caspase-7 activity since these enzymes cleave similar sequences. 140
Several additional molecular processes leading to programmed cell death in addition to apoptosis have been described during the last two decades. Since Müller cells clearly display loss of cell viability in high glucose conditions, we investigated recently uncovered death processes pyroptosis and examined whether autophagy is involved in the execution of the pyroptotic death pathway. Macro autophagy (often referred to simply as autophagy) is characterized by the formation of large double membrane autophagosomal vacuoles which digest organelles in a specific order prior to fusion of the autophagosome with the lysosome for organelle destruction. The main features that typify autophagy are formation of large vacuoles, target of rapamycin (TOR) inhibition, up regulation of ATG
(autophagy) proteins and organized lysosome-mediated organelle degradation prior to nuclear destruction. Detection of microtubule- associated protein light chain 3 II (LC3 II) is widely used to monitor autophagy (153). This protein is a major component of the autophagosomal vacuole.
Autophagy usually occurs at basal levels in most tissues to ensure the routine turnover of cytoplasmic elements. Components degraded via autophagy include cytoplasmic proteins, abnormal protein aggregates, pathogenic bacteria, and damaged cellular organelles. Activation of this process has also been observed during development, tissue remodeling and development. Lack of nutrients in the environment may activate autophagy as a catabolic response so that products generated may be 141 used for energy production and survival. A seemingly divergent role for autophagy is the activation of this process during cell death when components for the entire cell are degraded.
Our preliminary studies on autophagy indicate that high glucose regulates the autophagic protein LC3 in Müller cells. Increased amounts of both LC3 I and LC3II were observed in high glucose-treated cells demonstrating increased rate of autophagic flux. To determine changes in formation of autophagosomal lysosomes changes in the ratio of LC3 II to
LC3 I will be examined. Although our in vitro data suggest that Müller cells might undergo autophagy under hyperglycemic conditions, the results were not conclusive. However, it is interesting that the studies using EM to determine Müller cell death in vivo describe the formation of vacuoles consistent with the formation of autophagosomes.
The activation of p53 was originally linked to apoptotic cell death mechanisms. Recent studies have identified that p53 activation also plays a role in the induction of autophagy, especially in the presence of early pro-apoptotic events (40). Given that high glucose-induced caspase-1 activation is necessary for p53 action in Müller cells, it would be interesting to determine if caspase-1 also regulates autophagic events. More detailed studies need to be done to confirm autophagy as a potential execution pathway. 142
There is sufficient evidence indicating that caspase-1/IL-1β signaling pathways are key players during capillary degeneration in the diabetic retina (123, 124, 241). Our studies strongly demonstrate that caspase-1/IL-1β signaling pathway is necessary for high glucose-induced
Müller cell death in vitro and diabetes-induced Müller cell loss in vivo
(Figure 5.2 and 5.5). Furthermore, high glucose-induced p53 activation,
GAPDH nuclear accumulation, mitochondrial superoxide production as well as caspase-6 and caspase-3 activity is caspase-1 dependent. The necessity for caspase-1 activation during Müller cell death under high glucose conditions seems to confirm pyroptotic cell death. Caspase-1 activation has also been associated with pyronecrosis, however, in contrast to pyroptosis, caspase-1 activation is not absolutely required for this form of cell death (129). Additional defining features for pyronecrosis include: formation of the inflammasome complex, cryopyrin (CIAS1,
NLRP3), ASC activation, and activation of a family of Nod-like receptor known as NALP1 and NALP3 (255).
Our study is the first to demonstrate a possible role for pyroptosis during the development of diabetes complications. It is surprising that pyroptosis plays a central role during Müller cell death under these conditions since it is mainly associated with death during an infection. On the other hand, activation of chronic low grade inflammation in the diabetic retina may explain this choice of death. 143
In summary, it appears that under high glucose conditions, Müller cell death is executed by multiple mechanisms. These include pyroptosis and potentially autophagy. It is not unusual for several PCD mechanisms to occur in parallel during cell death. As details on these newly defined processes emerge, we will investigate their involvement during hyperglycemia-induced Müller cell death.
144
Figures
25 * 20
15
10 % Cell Death Death % Cell 5
0 (Based on Trypan Blue Assay) Blue Trypan on (Based Glucose (mM) 7.8 25
25
20
15
10 % Cell Death Death Cell %
(TUNEL staining) (TUNEL 5
0 Glucose (mM) 7.8 25
Figure 5. 1. Decreased Müller Cell Viability under High Glucose
Conditions does not Result from Apoptotic Cell Death
Isolated human Müller cells were treated in normal (7.8mM) glucose or high (25mM) glucose for 96 hours. Media was changed every 24 hours.
(A) Following treatment, cell death was determined using trypan blue viability assays. Results represent means ± SEM (n=5) with * = p<0.05 compared to normal glucose. (B) Treated cells were also subjected to
TUNEL assay to examine apoptotic cell death. 145
25 # * 20
15
% Cell Death Death % Cell 10
(Based on Trypan Blue Assay) Blue Trypan on (Based 5
0 Glucose (mM) 7.8 7.8 25 25 - - YVAD-fmk (µM) 100 100
Figure 5. 2. High Glucose-Induced Müller Cell Death is Caspase-1-
Dependent hMC cells were treated in normal (7.8mM) or high (25mM) glucose in the presence or absence of 100 μMYVAD-fmk for 96 hour. Experimental media was changed every 24 hours. Following treatment, cell death was determined using trypan blue viability assays. Results represent means ±
SEM (n=5) with * = p<0.05 compared to normal glucose, # = p<0.05 compared to high glucose. 146
rMC-1 Mitochondrial Superoxide 14.0 #
12.0 *
10.0
) 2
8.0
6.0 (Intensity/mm
4.0 Normalized Mitotracker activity Mitotracker Normalized
2.0
0.0 Glucose (mM) 5 25 25 YVAD-fmk (µM) - - 100
Figure 5. 3. Caspase-1 Inhibition Prevents Increased rMC-1
Mitochondrial Superoxide Production under High Glucose
Conditions rMC-1 were treated in normal (5mM), high (25mM) glucose or high
(25mM) + 50 μMYVAD-fmk for 96 hours. Experimental media was changed after 24 hours. Following treatment cells were processed to examine changes in mitochondrial superoxide production using live cell mitotracker analysis. This analysis leads to activation of a dye which was detected using immunofluorescence analysis, quantified and graphed.
Results represent means ± SEM (n=4) with * = p<0.05 compared to normal glucose, # = p<0.05 compared to high glucose. 147
A) B)
LC3 stain– 72 Hours
LC3 Western Blot– 72 Hours WB: LC3 I (16 kDa) LC3 II (14 kDa) Actin (43 kDa) 5mM Glucose 25mM Glucose Glucose (mM) 5 25
C) Lysosomal Activity – 72 hours Lysotracker Staining– 72 hours 40 *
30 ) 4 20
( x 10x ( 10
5mM Glucose 25mM Glucose Lysotracker Intensity Intensity Lysotracker 0 Glucose (mM) 5 25
Figure 5. 4. High Glucose Treatment Activates Autophagy in rMC-1 rMC-1 were treated in normal (5mM) glucose or high (25mM) glucose for
72 hours. Media was changed every 24 hours. (A) Lysates from treated cells were subjected to LC3 Western Blot analysis. (B) Treated cells were also subjected to LC3 immunofluorescence analysis. (C) Changes in low pH vacuoles which are mainly composed of lysosomes were examined following treatment for 72 hours. Changes in lysotracker were quantified and results from independent experiments averaged. Results represent means ± SEM (n=4) with * = p<0.05 compared to normal glucose. 148
A) Outer Nuclear Layer
Inner Nuclear Layer
Green-Glutamine Synthetase (Müller Cell Marker) Blue-DAPI
Normal 1500.0 Diabetic B) #
1400.0 # 2 2 1300.0 * 1200.0
1100.0
1000.0 No. of of mm Müller cells/ No.
900.0
800.0 Wild type IL-1R(-/-) Cas1(-/-)
Figure 5. 5. Diabetes-Induced Müller Cell loss in the Retina of
Diabetic Mice is Dependent on Caspase-1/IL-1β Signaling
Diabetic wild type, IL-1 receptor knockout [IL-1R (-/-)] and caspase-1 knockout [cas-1(-/-)] C57Bl6 mice were sacrificed after 7 months of 149 diabetes along with age-matched normal controls. Blood glucose levels at the time of euthanasia were determined to confirm diabetic status (Table
2). (A) Eyes were processed for Glutamine Synthetase (retinal Müller cell marker-green) and dapi (blue) staining and blinded samples visualized using confocal microscopy Z sections. Retinal Müller cell nuclei are localized within the inner nuclear layer (white arrow). These cells also have distinct hexagonally shaped nuclei which were used to determine cell number. (B) Samples were blinded and the number of Müller cells per standard retinal area from eight independent areas per sample established. Samples were un-blinded and the average number of Müller cells from at least four animals per group, determined and graphed. * = p<0.05 compared to normal wild type mice, # = p<0.05 compared to wild type diabetic mice. 150
High Glucose
↑Caspase-1/Interleukin-1β
GAPDH Nuclear Accumulation
↑p53 ↑ROS ↑ Caspase-6 ↑ Caspase-3 like/Caspase-7 ↑Autophagy (LC3/Lysotracker)
No ICAD Müller Cell Death No TUNEL (Trypan Blue Viability Assay) Staining
Figure 5. 6. Mechanisms for High Glucose-Induced Müller Cell Death Several parallel pathways appear to participate during high glucose- induced Müller cell death execution. Strong caspase-1 activation indicates that pyroptosis is a dominant mechanism during this process. Activation of
GAPDH nuclear accumulation, pro-death caspase-6, the pro-death transcriptional regulator p53 as well as mitochondrial superoxide production under these conditions is also caspase-1-dependent which provides further support for pyroptotic cell death. Autophagy as detected using LC3 II analysis also appears to contribute to Müller cell death under high glucose conditions. Lack of TUNEL staining and ICAD cleavage indicate that this process occurs independently of apoptosis despite a small caspase-3 like/caspase-7 activity. 151
Table 2. Weights and Blood Glucose Levels for Normal and Diabetic
Mice
Wild type, IL-1 receptor knockout [IL-1R (-/-)] and caspase-1 knockout
[Cas-1( -/-)] C57Bl6 mice were randomly assigned to diabetes or control group. Diabetes was induced via streptozotocin injections and animals sacrificed after 7 months of diabetes along with age-matched normal controls for experiments. Blood glucose levels were established and averaged at the time of animal euthanasia to ascertain that animals had maintained diabetic status. Animal weights were also obtained. *=p<0.05 compared to normal control for individual experimental condition (n= at least 5 animals per group). 152
Chapter 6: Summary, Discussion
and Future Direction
153
Summary In the current study, we tested the hypothesis that the pro- inflammatory cytokines IL-1β, IL-6 and TNFα regulate pro-death GAPDH nuclear accumulation in retinal Müller cells. These pro-inflammatory cytokines have been put forth as potential targets for the treatment of diabetic retinopathy since their secretion in the retina is associated with the development and progression of the disease. Our studies demonstrate that they have varied effects on GAPDH nuclear accumulation; an early cell death event that occurs in Müller cells in diabetic retinas. Our studies also examined the role of the protein siah-1 which mediates GAPDH nuclear transport during neuronal and macrophage cell death. In addition, the activation of alternative cell death mechanism pyroptosis and autophagy during high glucose-induced Müller cell death was examined.
My results show that: (1) Müller cells are a source for IL-1β and IL-6 production under high glucose conditions. (2) Activation of the caspase-
1/IL-1β signaling pathway by high glucose strongly induces GAPDH nuclear accumulation and cell death of Müller cells via an autocrine feed- back mechanism in vitro. (3) Müller cells treated with IL-1β under normal glucose undergo GAPDH nuclear accumulation and cell death. (4)
Surprisingly and in stark contrast to IL-1β, IL-6 exerts strong protective effects. IL-6 prevented IL-1β and high glucose-induced GAPDH nuclear accumulation and subsequent cell death in Müller cells. (5) TNF-α is not secreted by Müller cells in a high glucose environment nor does it have an 154 effect on GAPDH nuclear accumulation. TNF-α is the third component of the IL-1β, IL-6 triumvirate of acute phase inflammatory cytokines. (6)TNF-
α also does not have any synergistic properties with high glucose or IL-1β- induced GAPDH nuclear accumulation (Chapter 3).
Our studies on the protein siah demonstrate that: (1) This protein is up-regulated by high glucose at the transcriptional and protein level in
Müller cells. (2) Siah-1 is predominantly localized in the nucleus of human
Müller cells following high glucose treatment. (3) Increased GAPDH-siah-1 complex formation is detectable in the nucleus of high glucose-treated
Müller cells. (4) Siah-1 knockdown via siRNA prevents GAPDH nuclear accumulation under high glucose conditions demonstrating the necessity for siah-1 during GAPDH nuclear accumulation under these conditions. (5)
Interfering with GAPDH-siah-1 interaction using truncated siah-1 that cannot bind GAPDH prevent GAPDH nuclear accumulation under high glucose conditions. (6) Inhibition of GAPDH nuclear accumulation using siah-1 siRNA prevents p53 activation via phosphorylation as well as up regulation of the p53-regulated protein Bax thus supporting previous studies which have shown that the cells death function of GAPDH involves p53 activation. (7) High glucose-induced cell death is attenuated in Müller cells subjected to siah-1 knock-down indicating that GAPDH exclusion from the nucleus prevents cell death (Chapter 4).
Based on the results described above we have a better understanding on pro-death GAPDH nuclear accumulation in retinal Müller 155 cells under high glucose conditions. Even though our understanding of this early cell death event is clearer, the mechanism of Müller cell death execution during the final stages is still unclear. Foundational studies on the mechanism for cell death execution demonstrate that: (1) Müller cells do not undergo apoptotic cell death despite decreased Müller cell viability under high glucose conditions. (2) Müller cell death as determined using trypan blue viability assays is caspase-1 dependent. (3) High glucose- induced mitochondrial activation in Müller cells is caspase-1 dependent.
(4) Müller cell death following high glucose treatment demonstrates features that are consistent with autophagy activation. (5) Diabetes- induced Müller cell loss is dependent on caspase-1/IL-1β signaling. The central role for caspase-1 signaling during high glucose-induced Müller cell death indicates that pyroptosis is activated (Chapter 5).
Discussion Regulation of Pro-Death GAPDH Nuclear Accumulation Retinal Müller cells structurally and functionally maintain the retina and its vasculature. Therefore, Müller cell loss in vivo possibly leads to disease. Pro-death GAPDH nuclear accumulation has been put forth as a therapeutic target for the treatment of degenerative disease. The studies we performed expand our understanding of the mechanisms for the regulation of GAPDH nuclear accumulation in retinal Müller cells under high glucose conditions. 156
According to our studies, GAPDH nuclear accumulation is strongly regulated by the caspase-1/IL-1β signaling pathway. The process involves caspase-1 activation, IL-1β secretion, and autocrine activation of the IL-1 receptor. This is consistent with other studies demonstrating IL-1β- dependent activation of this pathway in insulin secreting cells (23).
According to these studies, the process depends on IL-1β-induced up regulation of inducible nitric oxide synthetic (iNOS) and subsequent NO production. Consequent GAPDH post-translational modification by NO activates GAPDH nuclear movement. Observations by others indicate that
GAPDH post-translational modification by NO appears necessary for its nuclear movement (24, 84, 85, 87, 199, 205). Increased NO production occurs in Müller cells cultured under high glucose conditions (51).
However, NO-dependent GAPDH post-translational modification in Müller cells under these conditions has not been examined. Even so, other studies have shown that retinal cells undergo GAPDH nitration during diabetes-induced nuclear accumulation of this protein in rats in vivo (110).
Additional NO-dependent mechanisms which modify GAPDH include,
NADH attachment, ADP ribosylation, nitrosation and nitrosylation of reactive cysteines as well as O-linked N-acetylglucosamine modification
(O-GlcNAcylation) (19, 23, 90, 157, 179). Future studies will examine the role of possible post-translational modification during high glucose- induced GAPDH nuclear accumulation. 157
GAPDH Nuclear Functions Numerous reports demonstrate an association between GAPDH nuclear accumulation and cell death. However, characterizing the cell death function of nuclear GAPDH remains elusive since this protein binds numerous partners and has additional nuclear functions besides cell death. In addition to regulating cell death, nuclear GAPDH also protects telomeres (46, 225) and repairs DNA (151). The latter function appears contrary to our current studies on its pro-death function (151).
Interestingly, an increase in GAPDH nuclear accumulation over a certain threshold is associated with a progressive decrease in its uracil-DNA glycosylase activity during DNA repair (151). This indicates that GAPDH may act as a “molecular switch” controlling the change from a pro-survival to a pro-death mode. This potential function is supported by studies demonstrating that this early cell death event occurs before cells commit themselves to die (202).
Others have also shown that nuclear GAPDH activates the histone acetyl transferase p300/CBP (207). The ability of GAPDH to regulate histone post-translational modification is of great interest to our field since increased histone modification is linked with the development of epigenetic changes, and it has been suggested that epigenetic histone alterations may be a main underlying trigger for metabolic memory in diabetes (133, 152, 239, 241). The term metabolic memory was coined following the land mark DCCT and EDIC studies which demonstrated that 158 the effects of good blood glucose control persist after several years of diabetes, as demonstrated by the lower frequency of complications after many years of diabetes in subjects who maintained good blood glucose during the earlier stages of the disease. The metabolic memory phenomenon describes how the system can remember good or bad glucose control (71, 121, 56, 64, 122). This phenomenon has also been associated with GAPDH nuclear accumulation in the diabetic retina (110).
No studies have determined a causal role for nuclear GAPDH during the development of epigenetic changes/metabolic memory or possible activation of p300/CBP in the retina. Since nuclear GAPDH activates the histone acetylation enzymes p300/CBP in neurons, it would be interesting to determine if these enzymes have increased activity in the diabetic retina. It would also be interesting to determine whether nuclear
GAPDH and/or p300/CBP play a role during the development of metabolic memory.
IL-6 and its Protective Effects The protective effect of IL-6 on GAPDH nuclear accumulation and subsequent cell death was one of the more surprising observations from this study. Protective effects were observed only after IL-6 secreted under high glucose was supplemented with exogenous recombinant IL-6. This demonstrates that despite increased IL-6 secretion under high glucose, threshold levels are not achieved for protection to be observed. This is an interesting observation since the release of IL-6 during diabetic 159 retinopathy is well documented in the literature (69, 70). However, no studies have investigated the specific function of this cytokine during the development of disease. This observation also points out the need to distinguish protective and harmful responses under pathological conditions.
IL-6 regulates various cellular events including differentiation, proliferation, survival and cell death (review (108)). This 21-28-kDa multifunctional cytokine belongs to the gp130 family of cytokines and signals via the IL-6α receptor and gp130 (IL-6 signal transducer) following formation of a hexameric complex (ratio 2:2:2) between these three components (246).
Protective effects of IL-6 have been described in neuronal cells and neurodegenerative disease (5, 66, 182, 244, 245). In the retina, IL-6 is protective on pressure-induced retinal ganglion cell death (195, 196), retinal ischemia induced cell death (195) and experimental models of retinal detachment (33). Furthermore, the neuroprotective peptide pituitary adenylate cyclase activating peptide (PACAP) which has promising therapeutic potential as an intra-vitreally injected treatment, confers protection through secretion of IL-6 and activation of the IL-6 signaling pathway (175, 211, 212). In spite of exciting observations on a protective role for IL-6 on various tissues in disease conditions, the effect of IL-6 on cell survival are controversial (review(169)). Examining possible 160 mechanism through which this cytokine exerts protective effects will be the focus of future studies.
Pyroptosis and Autophagy during High Glucose-Induced Müller
Cell Death
Observations from this project demonstrate the potential for autophagy and pyroptosis as mechanisms for Müller cell death execution. p53 activation which occurs in Müller cells under high glucose conditions has also been shown to activates autophagy via up regulation of the protein Damage Autophagy Regulator Modulator Protein (DRAM) during doxycycline-induced cell death in human osteosarcoma cells as well as human colon carcinoma cells (41). Since our studies demonstrate activation of both p53 and autophagy by high glucose in Müller cells, it would be interesting to determine whether there is any direct interaction between these two events under these conditions. To determine whether autophagy precedes p53 activation the effect of an autophagy inhibitor for example 3-methyladenine on high glucose–induced p53 activation would be examined.
p53 activation is one of several events including production of mitochondrial superoxide, increased caspase-3 and caspase-6 activation as well as loss of membrane permeability which is activated during the later stages of high glucose-induced cell death in retinal Müller cells (159).
These events are regulated by the caspase-1/IL-1β signaling pathway 161 which indicates that pyroptotic-like mechanisms regulate cell death under these conditions (159).
The literature on both autophagy and pyroptosis as cell death mechanism is still relatively new. Nonetheless, pyroptosis bears some common features with necrosis for example nitric oxide and mitochondrial superoxide production (130, 132, 174). Therefore, our observation demonstrating caspase-1 dependent mitochondrial superoxide production under high glucose supports activation of pyroptotic-like Müller cell death.
Additional studies will be designed and performed to establish if these pathways are potential targets for the treatment of diabetic retinopathy as details on mechanistic activation of these pathways emerge.
Future Studies Mechanism for IL-6-Mediated Protection Our studies clearly indicate that IL-6 secretion under high glucose conditions is a protective mechanism against Müller cell death. Ours is the first study that demonstrates protective effects of IL-6 on retinal cells under diabetic conditions. We will examine if knocking down the IL-6 gene exacerbates formation of acellular capillaries; the hallmark feature of this disease. These studies will utilize diabetic wild type and IL-6 knockout mice. Diabetes will be induced using streptozotocin (STZ) injections as described in Chapter 2. Control age matched wild type and IL-6 knockout mice will also be included in the study. After 4 months of diabetes, formation of acellular capillaries will be examined. To determine formation 162 of acellular capillaries the retinal vasculature will be isolated from the whole retina using the trypsin digest technique (43). To identify areas in the vasculature with cells, isolated vasculature will then be subjected to periodic acid Schiff and hematoxylin staining (43). Areas in the vasculature composed mainly from basement membrane due to accelerated cell death will then be identified using light microscopy and quantified.
It would also be interesting to examine the effects of exogenous IL-
6 on the development of experimental diabetic retinopathy. For these studies, IL-6 (15ng) will be administered intra-vitreously in treatment groups twice a month for four months. Following treatment, formation of acellular capillaries will be examined by isolating the capillaries using the trypsin digest techniques and observing acellular capillary formation of hematoxylin-stained capillaries using light microscopy (43).
The mechanisms underlying the protective effects of IL-6 on Müller cells under high glucose conditions are unknown. Preliminary studies indicate that IL-6 inhibits high glucose-induced caspase-1 activity in Müller cells leading to the hypothesis that IL-6 interferes with the activation of the caspase-1/IL-1β signaling pathway which we have identified is crucial for high glucose-induced cell death in Müller cells (Figure 6.1). Therefore, future studies will: (1) Investigate the effect of IL-6 treatment on the caspase-1/IL-1β signaling pathway in Müller cells under high glucose conditions in vitro. (2) Determine effects of IL-6 treatment on diabetes- induced caspase-1 activity and IL-1β secretion in the retina in vivo. We 163 have previously shown that inhibition of hyperglycemia-induced caspase-1 activity and subsequent IL-1β production prevents capillary degeneration associated with the development of diabetic retinopathy (158, 242). (3)
Determine the effect of PACAP on Müller cell survival and IL-6 secretion under high glucose conditions in vitro. Retinal Müller cells express PACAP receptors (PAC1R) and secrete IL-6 upon PACAP stimulation (206). In order to explore its therapeutic potential, this polypeptide will be used as a tool to stimulate additional IL-6 secretion by retinal Müller cells under high glucose conditions.
Nuclear GAPDH during Disease Development Resolving the mechanism for cell death activation by nuclear
GAPDH is the ultimate goal of this project. Several suggestions have been put forth. These include transcriptional regulation and stabilization of pro- death proteins (84, 161, 207, 214). To date, only one study has put forth a potential mechanism for cell death which involves p53 activation (207).
According to these studies, nuclear GAPDH binds and activates the histone acetyl transferase (HAT) CBP/P300. Increased p53 transcriptional activity following acetylation by p300 leads to up regulation of death proteins including Bax and puma. Our observations support these studies in that, exclusion of GAPDH from the nucleus using siah-1 siRNA following high glucose treatment prevent p53 activation. High glucose- induced up regulation of the p53-regulated protein Bax is also inhibited.
Pro-death p53 may also activate cell death by increasing cytochrome c 164 release, subsequent to complex formation with mitochondrial membrane protein Bcl-2. Interestingly, over expression of the anti-apoptotic protein
Bcl-2 prevents GAPDH nuclear accumulation and cell death (145).
Increased activity of the histone acetylation enzymes p300/CBP has been linked with the development of diabetic epigenetic changes
(133). Therefore, it would be interesting to determine if these enzymes are activated in the retinas of diabetic mice (110, 121). In regard to these future studies, we will determine whether, nuclear GAPDH in Müller cells cultured under high glucose conditions and retinal lysates from diabetic mice after 4 months of diabetes binds and/or activates p300/CBP.
Changes in interaction between GAPDH and p300/CBP following high glucose treatment would be detected via nuclear fraction co- immunoprecipitation assays. Activity assays for the enzyme p300/CBP would be examined by performing an in vitro histone acetylation assay
(79). This assay entails incubating equal amounts of lysate from treated cells with isotopically labeled acetyl-CoA ([1-14 C] acetyl-CoA) and histone protein in a reaction buffer for 30 minutes. Changes in amounts of acetylated histones are then assayed by subjecting reaction mixture to
SDS-PAGE followed by detection via autoradiography.
Several studies point to a role for GAPDH post-translational modification during GAPDH nuclear accumulation (199). Therefore, future studies will assess high glucose-induced post-translational modifications of cytosolic and nuclear GAPDH. To identify post-translational 165 modifications, we will assess GAPDH protein profiles of high glucose- treated nuclear and cytosolic fractions using 2D gel electrophoresis followed by GAPDH Western Blot analysis. This analysis will separate post-translationally modified GAPDH proteins based on their iso-electric point and molecular weight. To assess the exact nature of post- translational modification(s) of GAPDH in high glucose treated rMC-1 cells, the different GAPDH forms identified using 2 D gels will be subjected to tandem mass spectrometry.
Results from studies presented above provide new information on mechanisms for GAPDH nuclear translocation. The process is strongly dependent on the caspase-1/IL-1β signaling pathway and GAPDH-siah-1 complex formation. Even though mechanisms underlying detrimental effects of nuclear GAPDH are still unknown, these results are beneficial since they open up the potential for anti-inflammatory agents which interfere with caspase-1/IL-1β signaling as well as inhibitors of GAPDH- siah-1 complex formation as agents for the preservation of Müller health under high glucose conditions.
166
HIGH GLUCOSE IL-1 Receptor IL-1β
GAPDH
Siah-1 NLS GAPDH
Caspase-1 Siah-1 NLS Activity
IL-1β GAPDH
Siah-1 NLS Nucleus
P53 ACTIVATION Müller Cells
CELL DEATH
Figure 6. 1. Summary Scheme/Working Model for the High Glucose-
Induced Mechanism for Pro-Death GAPDH Nuclear Accumulation in
Retinal Müller Cells. 167
Preliminary Data for Future Directions
Caspase-1 Activity
22 20 18 16 14 12
protein/min 10 8 6 4 2 AFC/mg 0
pmol
Glucose (mM) 7.8 25 25 IL-6 (ng/ml) - - 2
Figure 6. 2. IL-6 Treatment Prevents High Glucose-Induced Caspase-
1 Activity in Müller Cells
Isolated human Müller cells were treated in normal (7.8mM) glucose, high
(25mM) glucose or high glucose in the presence of IL-6 (2ng/ml) for 96 hours. Cells were then subjected to a fluorogenic enzyme activity assay.
IL-6 treatment reduced caspase-1 activity in high glucose conditions by
57±18% (n=2)
168
Appendix 1-Copyright Permission
Copyright permission for Figure 1.1.
169
170
Copyright permission for Figures 1.2, 1.3 and 1.4
171
References 1. Abu el Asrar AM, Maimone D, Morse PH, Gregory S, and Reder
AT. Cytokines in the vitreous of patients with proliferative diabetic retinopathy. Am J Ophthalmol 114: 731-736, 1992.
2. Adachi-Uehara N, Kato M, Nimura Y, Seki N, Ishihara A,
Matsumoto E, Iwase K, Ohtsuka S, Kodama H, Mizota A, Yamamoto
S, Adachi-Usami E, and Takiguchi M. Up-regulation of genes for oxidative phosphorylation and protein turnover in diabetic mouse retina.
Exp Eye Res 83: 849-857, 2006.
3. Aiello LP, Bursell SE, Clermont A, Duh E, Ishii H, Takagi C,
Mori F, Ciulla TA, Ways K, Jirousek M, Smith LE, and King GL.
Vascular endothelial growth factor-induced retinal permeability is mediated by protein kinase C in vivo and suppressed by an orally effective beta- isoform-selective inhibitor. Diabetes 46: 1473-1480, 1997.
4. Aiello LP, Clermont A, Arora V, Davis MD, Sheetz MJ, and
Bursell SE. Inhibition of PKC beta by oral administration of ruboxistaurin is well tolerated and ameliorates diabetes-induced retinal hemodynamic abnormalities in patients. Investigative ophthalmology & visual science 47:
86-92, 2006.
5. Ali C, Nicole O, Docagne F, Lesne S, MacKenzie ET, Nouvelot
A, Buisson A, and Vivien D. Ischemia-induced interleukin-6 as a potential endogenous neuroprotective cytokine against NMDA receptor- 172 mediated excitotoxicity in the brain. J Cereb Blood Flow Metab 20: 956-
966, 2000.
6. Arend WP, Malyak M, Smith MF, Jr., Whisenand TD, Slack JL,
Sims JE, Giri JG, and Dower SK. Binding of IL-1 alpha, IL-1 beta, and
IL-1 receptor antagonist by soluble IL-1 receptors and levels of soluble IL-
1 receptors in synovial fluids. J Immunol 153: 4766-4774, 1994.
7. Asnaghi V, Gerhardinger C, Hoehn T, Adeboje A, and Lorenzi
M. A role for the polyol pathway in the early neuroretinal apoptosis and glial changes induced by diabetes in the rat. Diabetes 52: 506-511, 2003.
8. Barber RD, Harmer DW, Coleman RA, and Clark BJ. GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of
72 human tissues. Physiol Genomics 21: 389-395, 2005.
9. Barbini L, Rodriguez J, Dominguez F, and Vega F.
Glyceraldehyde-3-phosphate dehydrogenase exerts different biologic activities in apoptotic and proliferating hepatocytes according to its subcellular localization. Mol Cell Biochem 300: 19-28, 2007.
10. Barile GR, Pachydaki SI, Tari SR, Lee SE, Donmoyer CM, Ma
W, Rong LL, Buciarelli LG, Wendt T, Horig H, Hudson BI, Qu W,
Weinberg AD, Yan SF, and Schmidt AM. The RAGE axis in early diabetic retinopathy. Invest Ophthalmol Vis Sci 46: 2916-2924, 2005.
11. Baxi MD and Vishwanatha JK. Uracil DNA- glycosylase/glyceraldehyde-3-phosphate dehydrogenase is an Ap4A binding protein. Biochemistry 34: 9700-9707, 1995. 173
12. Bergsbaken T and Cookson BT. Macrophage activation redirects yersinia-infected host cell death from apoptosis to caspase-1-dependent pyroptosis. PLoS Pathog 3: e161, 2007.
13. Bolton WK, Cattran DC, Williams ME, Adler SG, Appel GB,
Cartwright K, Foiles PG, Freedman BI, Raskin P, Ratner RE,
Spinowitz BS, Whittier FC, and Wuerth JP. Randomized trial of an inhibitor of formation of advanced glycation end products in diabetic nephropathy. Am J Nephrol 24: 32-40, 2004.
14. Boutin H, LeFeuvre RA, Horai R, Asano M, Iwakura Y, and
Rothwell NJ. Role of IL-1alpha and IL-1beta in ischemic brain damage. J
Neurosci 21: 5528-5534, 2001.
15. Brennan MA and Cookson BT. Salmonella induces macrophage death by caspase-1-dependent necrosis. Mol Microbiol 38: 31-40, 2000.
16. Brown VM, Krynetski EY, Krynetskaia NF, Grieger D, Mukatira
ST, Murti KG, Slaughter CA, Park HW, and Evans WE. A novel CRM1- mediated nuclear export signal governs nuclear accumulation of glyceraldehyde-3-phosphate dehydrogenase following genotoxic stress.
Journal of Biological Chemistry 279: 5984-5992, 2004.
17. Brownlee M. Biochemistry and molecular cell biology of diabetic complications. Nature 414: 813-820, 2001.
18. Brownlee M, Vlassara H, Kooney A, Ulrich P, and Cerami A.
Aminoguanidine prevents diabetes-induced arterial wall protein cross- linking. Science 232: 1629-1632, 1986. 174
19. Brune B and Mohr S. Protein thiol modification of glyceraldehyde-
3-phosphate dehydrogenase and caspase-3 by nitric oxide. Curr Protein
Pept Sci 2: 61-72, 2001.
20. Bruzzoni-Giovanelli H, Faille A, Linares-Cruz G, Nemani M, Le
Deist F, Germani A, Chassoux D, Millot G, Roperch JP, Amson R,
Telerman A, and Calvo F. SIAH-1 inhibits cell growth by altering the mitotic process. Oncogene 18: 7101-7109, 1999.
21. Bursell SE, Takagi C, Clermont AC, Takagi H, Mori F, Ishii H, and King GL. Specific retinal diacylglycerol and protein kinase C beta isoform modulation mimics abnormal retinal hemodynamics in diabetic rats. Invest Ophthalmol Vis Sci 38: 2711-2720, 1997.
22. Busik JV, Mohr S, and Grant MB. Hyperglycemia-induced reactive oxygen species toxicity to endothelial cells is dependent on paracrine mediators. Diabetes 57: 1952-1965, 2008.
23. Cahuana GM, Tejedo JR, Jimenez J, Ramirez R, Sobrino F, and
Bedoya FJ. Nitric oxide-induced carbonylation of Bcl-2, GAPDH and ANT precedes apoptotic events in insulin-secreting RINm5F cells. Experimental cell research 293: 22-30, 2004.
24. Cahuana GM, Tejedo JR, Jimenez J, Ramirez R, Sobrino F, and
Bedoya FJ. Nitric oxide-induced carbonylation of Bcl-2, GAPDH and ANT precedes apoptotic events in insulin-secreting RINm5F cells. Exp Cell Res
293: 22-30, 2004. 175
25. Campanella ME, Chu H, and Low PS. Assembly and regulation of a glycolytic enzyme complex on the human erythrocyte membrane. Proc
Natl Acad Sci U S A 102: 2402-2407, 2005.
26. Candi E, Schmidt R, and Melino G. The cornified envelope: a model of cell death in the skin. Nat Rev Mol Cell Biol 6: 328-340, 2005.
27. Carmo A, Cunha-Vaz JG, Carvalho AP, and Lopes MC. L- arginine transport in retinas from streptozotocin diabetic rats: correlation with the level of IL-1 beta and NO synthase activity. Vision Res 39: 3817-
3823, 1999.
28. Carthew RW and Rubin GM. seven in absentia, a gene required for specification of R7 cell fate in the Drosophila eye. Cell 63: 561-577,
1990.
29. CDC. Diabetes is Common, Disabling, Deadly, and On the Rise
[online]. http://wwwcdcgov/Features/dsDiabetesTrends/, Retrieved
November 10, 2009.
30. CDC. Number of People with Diabetes Increases to 24 Million. http://wwwcdcgov/media/pressrel/2008/r080624htm, [June 24, 2008].
31. Chen W, Esselman WJ, Jump DB, and Busik JV. Anti- inflammatory effect of docosahexaenoic acid on cytokine-induced adhesion molecule expression in human retinal vascular endothelial cells.
Invest Ophthalmol Vis Sci 46: 4342-4347, 2005. 176
32. Chen Y, Smith MR, Thirumalai K, and Zychlinsky A. A bacterial invasin induces macrophage apoptosis by binding directly to ICE. EMBO J
15: 3853-3860, 1996.
33. Chong DY, Boehlke CS, Zheng QD, Zhang L, Han Y, and Zacks
DN. Interleukin-6 as a photoreceptor neuroprotectant in an experimental model of retinal detachment. Invest Ophthalmol Vis Sci 49: 3193-3200,
2008.
34. Chuang DM, Hough C, and Senatorov VV. Glyceraldehyde-3- phosphate dehydrogenase, apoptosis, and neurodegenerative diseases.
Annual Review of Pharmacology and Toxicology 45: 269-290, 2005.
35. Chuang DM and Ishitani R. A role for GAPDH in apoptosis and neurodegeneration. Nature medicine 2: 609-610, 1996.
36. Chung IY and Benveniste EN. Tumor necrosis factor-alpha production by astrocytes. Induction by lipopolysaccharide, IFN-gamma, and IL-1 beta. J Immunol 144: 2999-3007, 1990.
37. Clearinghouse NDI. National Diabetes Statistics, 2007 [online]. http://diabetesniddknihgov/dm/pubs/statistics/indexhtm#costs, Retrieved
January 4, 2009.
38. Colell A, Ricci JE, Tait S, Milasta S, Maurer U, Bouchier-Hayes
L, Fitzgerald P, Guio-Carrion A, Waterhouse NJ, Li CW, Mari B,
Barbry P, Newmeyer DD, Beere HM, and Green DR. GAPDH and autophagy preserve survival after apoptotic cytochrome c release in the absence of caspase activation. Cell 129: 983-997, 2007. 177
39. Cookson BT and Brennan MA. Pro-inflammatory programmed cell death. Trends Microbiol 9: 113-114, 2001.
40. Crighton D, O'Prey J, Bell HS, and Ryan KM. p73 regulates
DRAM-independent autophagy that does not contribute to programmed cell death. Cell Death Differ 14: 1071-1079, 2007.
41. Crighton D, Wilkinson S, and Ryan KM. DRAM links autophagy to p53 and programmed cell death. Autophagy 3: 72-74, 2007.
42. Cumming RC and Schubert D. Amyloid-beta induces disulfide bonding and aggregation of GAPDH in Alzheimer's disease. The FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 19: 2060-2062, 2005.
43. Danis RP and Wallow IH. HRP/trypsin technique for studies of the retinal vasculature. Invest Ophthalmol Vis Sci 27: 434-437, 1986.
44. Dastoor Z and Dreyer JL. Potential role of nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase in apoptosis and oxidative stress. J Cell Sci 114: 1643-1653, 2001.
45. Della NG, Senior PV, and Bowtell DD. Isolation and characterisation of murine homologues of the Drosophila seven in absentia gene (sina). Development 117: 1333-1343, 1993.
46. Demarse NA, Ponnusamy S, Spicer EK, Apohan E, Baatz JE,
Ogretmen B, and Davies C. Direct binding of glyceraldehyde 3- phosphate dehydrogenase to telomeric dna protects telomeres against chemotherapy-induced rapid degradation. J Mol Biol, 2009. 178
47. Demircan N, Safran BG, Soylu M, Ozcan AA, and Sizmaz S.
Determination of vitreous interleukin-1 (IL-1) and tumour necrosis factor
(TNF) levels in proliferative diabetic retinopathy. Eye 20: 1366-1369, 2006.
48. Dinarello CA. An IL-1 family member requires caspase-1 processing and signals through the ST2 receptor. Immunity 23: 461-462,
2005.
49. Distler C and Dreher Z. Glia cells of the monkey retina--II. Muller cells. Vision Res 36: 2381-2394, 1996.
50. Doganay S, Evereklioglu C, Er H, Turkoz Y, Sevinc A, Mehmet
N, and Savli H. Comparison of serum NO, TNF-alpha, IL-1beta, sIL-2R,
IL-6 and IL-8 levels with grades of retinopathy in patients with diabetes mellitus. Eye 16: 163-170, 2002.
51. Du Y, Sarthy VP, and Kern TS. Interaction between NO and COX pathways in retinal cells exposed to elevated glucose and retina of diabetic rats. American Journal of Physiology Regulatory, Integrative and
Comparative Physiology 287: R735-741, 2004.
52. Du ZX, Wang HQ, Zhang HY, and Gao DX. Involvement of glyceraldehyde-3-phosphate dehydrogenase in tumor necrosis factor- related apoptosis-inducing ligand-mediated death of thyroid cancer cells.
Endocrinology 148: 4352-4361, 2007.
53. Dubois-Dauphin M, Poitry-Yamate C, de Bilbao F, Julliard AK,
Jourdan F, and Donati G. Early postnatal Muller cell death leads to 179 retinal but not optic nerve degeneration in NSE-Hu-Bcl-2 transgenic mice.
Neuroscience 95: 9-21, 2000.
54. El-Remessy AB, Al-Shabrawey M, Khalifa Y, Tsai NT, Caldwell
RB, and Liou GI. Neuroprotective and blood-retinal barrier-preserving effects of cannabidiol in experimental diabetes. Am J Pathol 168: 235-244,
2006.
55. Elliget KA, Phelps PC, and Trump BF. HgCl2-induced alteration of actin filaments in cultured primary rat proximal tubule epithelial cells labelled with fluorescein phalloidin. Cell Biol Toxicol 7: 263-280, 1991.
56. Engerman RL and Kern TS. Progression of incipient diabetic retinopathy during good glycemic control. Diabetes 36: 808-812, 1987.
57. Epner DE, Sawa A, and Isaacs JT. Glyceraldehyde-3-phosphate dehydrogenase expression during apoptosis and proliferation of rat ventral prostate. Biol Reprod 61: 687-691, 1999.
58. Feit-Leichman RA, Kinouchi R, Takeda M, Fan Z, Mohr S, Kern
TS, and Chen DF. Vascular damage in a mouse model of diabetic retinopathy: relation to neuronal and glial changes. Invest Ophthalmol Vis
Sci 46: 4281-4287, 2005.
59. Fernandes-Alnemri T, Wu J, Yu JW, Datta P, Miller B,
Jankowski W, Rosenberg S, Zhang J, and Alnemri ES. The pyroptosome: a supramolecular assembly of ASC dimers mediating inflammatory cell death via caspase-1 activation. Cell Death Differ 14:
1590-1604, 2007. 180
60. Festjens N, Vanden Berghe T, and Vandenabeele P. Necrosis, a well-orchestrated form of cell demise: signalling cascades, important mediators and concomitant immune response. Biochim Biophys Acta
1757: 1371-1387, 2006.
61. Fink SL and Cookson BT. Caspase-1-dependent pore formation during pyroptosis leads to osmotic lysis of infected host macrophages.
Cell Microbiol 8: 1812-1825, 2006.
62. Fiucci G, Beaucourt S, Duflaut D, Lespagnol A, Stumptner-
Cuvelette P, Geant A, Buchwalter G, Tuynder M, Susini L, Lassalle
JM, Wasylyk C, Wasylyk B, Oren M, Amson R, and Telerman A. Siah-
1b is a direct transcriptional target of p53: identification of the functional p53 responsive element in the siah-1b promoter. Proc Natl Acad Sci U S A
101: 3510-3515, 2004.
63. Frank RN. Diabetic retinopathy. The New England journal of medicine 350: 48-58, 2004.
64. Frank RN. Metabolic memory in diabetes is true long-term memory.
Arch Ophthalmol 127: 330-331, 2009.
65. Freedman BI, Wuerth JP, Cartwright K, Bain RP, Dippe S,
Hershon K, Mooradian AD, and Spinowitz BS. Design and baseline characteristics for the aminoguanidine Clinical Trial in Overt Type 2
Diabetic Nephropathy (ACTION II). Control Clin Trials 20: 493-510, 1999. 181
66. Fujita T, Tozaki-Saitoh H, and Inoue K. P2Y1 receptor signaling enhances neuroprotection by astrocytes against oxidative stress via IL-6 release in hippocampal cultures. Glia 57: 244-257, 2009.
67. Fukuba H, Yamashita H, Nagano Y, Jin HG, Hiji M, Ohtsuki T,
Takahashi T, Kohriyama T, and Matsumoto M. Siah-1 facilitates ubiquitination and degradation of factor inhibiting HIF-1alpha (FIH).
Biochem Biophys Res Commun 353: 324-329, 2007.
68. Fukuhara Y, Takeshima T, Kashiwaya Y, Shimoda K, Ishitani R, and Nakashima K. GAPDH knockdown rescues mesencephalic dopaminergic neurons from MPP+ -induced apoptosis. Neuroreport 12:
2049-2052, 2001.
69. Funatsu H, Yamashita H, Ikeda T, Mimura T, Eguchi S, and Hori
S. Vitreous levels of interleukin-6 and vascular endothelial growth factor are related to diabetic macular edema. Ophthalmology 110: 1690-1696,
2003.
70. Funatsu H, Yamashita H, Noma H, Mimura T, Yamashita T, and
Hori S. Increased levels of vascular endothelial growth factor and interleukin-6 in the aqueous humor of diabetics with macular edema. Am J
Ophthalmol 133: 70-77, 2002.
71. Genuth S. Insights from the diabetes control and complications trial/epidemiology of diabetes interventions and complications study on the use of intensive glycemic treatment to reduce the risk of complications of type 1 diabetes. Endocr Pract 12 Suppl 1: 34-41, 2006. 182
72. Gerhardinger C, Costa MB, Coulombe MC, Toth I, Hoehn T, and
Grosu P. Expression of acute-phase response proteins in retinal Muller cells in diabetes. Investigative ophthalmology & visual science 46: 349-
357, 2005.
73. Germani A, Bruzzoni-Giovanelli H, Fellous A, Gisselbrecht S,
Varin-Blank N, and Calvo F. SIAH-1 interacts with alpha-tubulin and degrades the kinesin Kid by the proteasome pathway during mitosis.
Oncogene 19: 5997-6006, 2000.
74. Germani A, Prabel A, Mourah S, Podgorniak MP, Di Carlo A,
Ehrlich R, Gisselbrecht S, Varin-Blank N, Calvo F, and Bruzzoni-
Giovanelli H. SIAH-1 interacts with CtIP and promotes its degradation by the proteasome pathway. Oncogene 22: 8845-8851, 2003.
75. Gilmore AP. Anoikis. Cell Death Differ 12 Suppl 2: 1473-1477,
2005.
76. Golstein P and Kroemer G. Cell death by necrosis: towards a molecular definition. Trends Biochem Sci 32: 37-43, 2007.
77. Goossens V, Grooten J, De Vos K, and Fiers W. Direct evidence for tumor necrosis factor-induced mitochondrial reactive oxygen intermediates and their involvement in cytotoxicity. Proc Natl Acad Sci U S
A 92: 8115-8119, 1995.
78. Groenman F, Rutter M, Caniggia I, Tibboel D, and Post M.
Hypoxia-inducible factors in the first trimester human lung. J Histochem
Cytochem 55: 355-363, 2007. 183
79. Gu W and Roeder RG. Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90: 595-606,
1997.
80. Hammes HP, Du X, Edelstein D, Taguchi T, Matsumura T, Ju Q,
Lin J, Bierhaus A, Nawroth P, Hannak D, Neumaier M, Bergfeld R,
Giardino I, and Brownlee M. Benfotiamine blocks three major pathways of hyperglycemic damage and prevents experimental diabetic retinopathy.
Nature medicine 9: 294-299, 2003.
81. Hammes HP, Lin J, Bretzel RG, Brownlee M, and Breier G.
Upregulation of the vascular endothelial growth factor/vascular endothelial growth factor receptor system in experimental background diabetic retinopathy of the rat. Diabetes 47: 401-406, 1998.
82. Hammes HP, Martin S, Federlin K, Geisen K, and Brownlee M.
Aminoguanidine treatment inhibits the development of experimental diabetic retinopathy. Proc Natl Acad Sci U S A 88: 11555-11558, 1991.
83. Hara MR, Agrawal N, Kim SF, Cascio MB, Fujimuro M, Ozeki Y,
Takahashi M, Cheah JH, Tankou SK, Hester LD, Ferris CD, Hayward
SD, Snyder SH, and Sawa A. S-nitrosylated GAPDH initiates apoptotic cell death by nuclear translocation following Siah1 binding. Nature cell biology 7: 665-674, 2005.
84. Hara MR, Agrawal N, Kim SF, Cascio MB, Fujimuro M, Ozeki Y,
Takahashi M, Cheah JH, Tankou SK, Hester LD, Ferris CD, Hayward
SD, Snyder SH, and Sawa A. S-nitrosylated GAPDH initiates apoptotic 184 cell death by nuclear translocation following Siah1 binding. Nat Cell Biol 7:
665-674, 2005.
85. Hara MR, Cascio MB, and Sawa A. GAPDH as a sensor of NO stress. Biochim Biophys Acta 1762: 502-509, 2006.
86. Hara MR and Snyder SH. Nitric Oxide-GAPDH-Siah: A Novel Cell
Death Cascade. Cell Mol Neurobiol, 2006.
87. Hara MR, Thomas B, Cascio MB, Bae BI, Hester LD, Dawson
VL, Dawson TM, Sawa A, and Snyder SH. Neuroprotection by pharmacologic blockade of the GAPDH death cascade. Proc Natl Acad
Sci U S A 103: 3887-3889, 2006.
88. Heard KS, Diguette M, Heard AC, and Carruthers A. Membrane- bound glyceraldehyde-3-phosphate dehydrogenase and multiphasic erythrocyte sugar transport. Exp Physiol 83: 195-202, 1998.
89. Hilbi H, Moss JE, Hersh D, Chen Y, Arondel J, Banerjee S,
Flavell RA, Yuan J, Sansonetti PJ, and Zychlinsky A. Shigella-induced apoptosis is dependent on caspase-1 which binds to IpaB. J Biol Chem
273: 32895-32900, 1998.
90. Holtgrefe S, Gohlke J, Starmann J, Druce S, Klocke S, Altmann
B, Wojtera J, Lindermayr C, and Scheibe R. Regulation of plant cytosolic glyceraldehyde 3-phosphate dehydrogenase isoforms by thiol modifications. Physiol Plant 133: 211-228, 2008. 185
91. Hori S and Mukai N. Ultrastructural lesions of retinal pericapillary
Muller cells in streptozotocin-induced diabetic rats. Albrecht Von Graefes
Arch Klin Exp Ophthalmol 213: 1-9, 1980.
92. Hori S, Nishida T, and Mukai N. Ultrastructural studies on lysosomes in retinal Muller cells of streptozotocin-diabetic rats. Invest
Ophthalmol Vis Sci 19: 1295-1300, 1980.
93. House CM, Frew IJ, Huang HL, Wiche G, Traficante N, Nice E,
Catimel B, and Bowtell DD. A binding motif for Siah ubiquitin ligase. Proc
Natl Acad Sci U S A 100: 3101-3106, 2003.
94. House CM, Hancock NC, Moller A, Cromer BA, Fedorov V,
Bowtell DD, Parker MW, and Polekhina G. Elucidation of the substrate binding site of Siah ubiquitin ligase. Structure 14: 695-701, 2006.
95. Hu G, Chung YL, Glover T, Valentine V, Look AT, and Fearon
ER. Characterization of human homologs of the Drosophila seven in absentia (sina) gene. Genomics 46: 103-111, 1997.
96. Hu G, Zhang S, Vidal M, Baer JL, Xu T, and Fearon ER.
Mammalian homologs of seven in absentia regulate DCC via the ubiquitin- proteasome pathway. Genes & development 11: 2701-2714, 1997.
97. Ishii H, Koya D, and King GL. Protein kinase C activation and its role in the development of vascular complications in diabetes mellitus. J
Mol Med 76: 21-31, 1998.
98. Ishitani R. A role for GAPDH in neuronal apoptosis. Seikagaku The
Journal of Japanese Biochemical Society 69: 1107-1111, 1997. 186
99. Ishitani R and Chuang DM. Glyceraldehyde-3-phosphate dehydrogenase antisense oligodeoxynucleotides protect against cytosine arabinonucleoside-induced apoptosis in cultured cerebellar neurons.
Proceedings of the National Academy of Sciences of the United States of
America 93: 9937-9941, 1996.
100. Ishitani R, Kimura M, Sunaga K, Katsube N, Tanaka M, and
Chuang DM. An antisense oligodeoxynucleotide to glyceraldehyde-3- phosphate dehydrogenase blocks age-induced apoptosis of mature cerebrocortical neurons in culture. The Journal of pharmacology and experimental therapeutics 278: 447-454, 1996.
101. Ishitani R, Sunaga K, Hirano A, Saunders P, Katsube N, and
Chuang DM. Evidence that glyceraldehyde-3-phosphate dehydrogenase is involved in age-induced apoptosis in mature cerebellar neurons in culture. Journal of neurochemistry 66: 928-935, 1996.
102. Ishitani R, Sunaga K, Tanaka M, Aishita H, and Chuang DM.
Overexpression of glyceraldehyde-3-phosphate dehydrogenase is involved in low K+-induced apoptosis but not necrosis of cultured cerebellar granule cells. Molecular pharmacology 51: 542-550, 1997.
103. Jesenberger V, Procyk KJ, Yuan J, Reipert S, and Baccarini M.
Salmonella-induced caspase-2 activation in macrophages: a novel mechanism in pathogen-mediated apoptosis. J Exp Med 192: 1035-1046,
2000. 187
104. Joussen AM, Huang S, Poulaki V, Camphausen K, Beecken
WD, Kirchhof B, and Adamis AP. In vivo retinal gene expression in early diabetes. Investigative ophthalmology & visual science 42: 3047-3057,
2001.
105. Joussen AM, Murata T, Tsujikawa A, Kirchhof B, Bursell SE, and Adamis AP. Leukocyte-mediated endothelial cell injury and death in the diabetic retina. Am J Pathol 158: 147-152, 2001.
106. Joussen AM, Poulaki V, Le ML, Koizumi K, Esser C, Janicki H,
Schraermeyer U, Kociok N, Fauser S, Kirchhof B, Kern TS, and
Adamis AP. A central role for inflammation in the pathogenesis of diabetic retinopathy. The FASEB journal : official publication of the Federation of
American Societies for Experimental Biology 18: 1450-1452, 2004.
107. Joussen AM, Poulaki V, Mitsiades N, Kirchhof B, Koizumi K,
Dohmen S, and Adamis AP. Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy via TNF-alpha suppression. The FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 16: 438-440, 2002.
108. Kamimura D, Ishihara K, and Hirano T. IL-6 signal transduction and its physiological roles: the signal orchestration model. Rev Physiol
Biochem Pharmacol 149: 1-38, 2003.
109. Kannan R, Bao Y, Wang Y, Sarthy VP, and Kaplowitz N.
Protection from oxidant injury by sodium-dependent GSH uptake in retinal
Muller cells. Experimental eye research 68: 609-616, 1999. 188
110. Kanwar M and Kowluru RA. Role of glyceraldehyde 3-phosphate dehydrogenase in the development and progression of diabetic retinopathy. Diabetes 58: 227-234, 2009.
111. Kanwar M and Kowluru RA. Role of Glyceraldehyde 3-Phosphate
Dehydrogenase in the Development and Progression of Diabetic
Retinopathy. Diabetes, 2008.
112. Kern TS and Engerman RL. Pharmacological inhibition of diabetic retinopathy: aminoguanidine and aspirin. Diabetes 50: 1636-1642, 2001.
113. Kern TS, Miller CM, Du Y, Zheng L, Mohr S, Ball SL, Kim M,
Jamison JA, and Bingaman DP. Topical administration of nepafenac inhibits diabetes-induced retinal microvascular disease and underlying abnormalities of retinal metabolism and physiology. Diabetes 56: 373-379,
2007.
114. Kerr JF, Wyllie AH, and Currie AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer
26: 239-257, 1972.
115. Kim C-I, Lee S-H, Seong G-J, Kim Y-H, and Lee M-Y. Nuclear translocation and overexpression of GAPDH by the hyper-pressure in retinal ganglion cell. Biochemical & Biophysical Research
Communications 341: 1237-1243, 2006.
116. Kim HJ, Higashimori T, Park SY, Choi H, Dong J, Kim YJ, Noh
HL, Cho YR, Cline G, Kim YB, and Kim JK. Differential effects of 189 interleukin-6 and -10 on skeletal muscle and liver insulin action in vivo.
Diabetes 53: 1060-1067, 2004.
117. King GL, Ishii H, and Koya D. Diabetic vascular dysfunctions: a model of excessive activation of protein kinase C. Kidney Int Suppl 60:
S77-85, 1997.
118. Klein R, Klein BE, Moss SE, Davis MD, and DeMets DL. The
Wisconsin epidemiologic study of diabetic retinopathy. II. Prevalence and risk of diabetic retinopathy when age at diagnosis is less than 30 years.
Arch Ophthalmol 102: 520-526, 1984.
119. Klein R, Klein BE, Moss SE, Davis MD, and DeMets DL. The
Wisconsin epidemiologic study of diabetic retinopathy. III. Prevalence and risk of diabetic retinopathy when age at diagnosis is 30 or more years.
Arch Ophthalmol 102: 527-532, 1984.
120. Kodama R, Kondo T, Yokote H, Jing X, Sawada T, Hironishi M, and Sakaguchi K. Nuclear localization of glyceraldehyde-3-phosphate dehydrogenase is not involved in the initiation of apoptosis induced by 1-
Methyl-4-phenyl-pyridium iodide (MPP+). Genes to cells : devoted to molecular & cellular mechanisms 10: 1211-1219, 2005.
121. Kowluru RA. Effect of reinstitution of good glycemic control on retinal oxidative stress and nitrative stress in diabetic rats. Diabetes 52:
818-823, 2003.
122. Kowluru RA and Chan PS. Metabolic memory in diabetes - from in vitro oddity to in vivo problem: Role of Apoptosis. Brain Res Bull, 2009. 190
123. Kowluru RA and Kanwar M. Effects of curcumin on retinal oxidative stress and inflammation in diabetes. Nutr Metab (Lond) 4: 8,
2007.
124. Kowluru RA and Odenbach S. Role of interleukin-1beta in the development of retinopathy in rats: effect of antioxidants. Invest
Ophthalmol Vis Sci 45: 4161-4166, 2004.
125. Kowluru RA and Odenbach S. Role of interleukin-1beta in the pathogenesis of diabetic retinopathy. Br J Ophthalmol 88: 1343-1347,
2004.
126. Koya D, Jirousek MR, Lin YW, Ishii H, Kuboki K, and King GL.
Characterization of protein kinase C beta isoform activation on the gene expression of transforming growth factor-beta, extracellular matrix components, and prostanoids in the glomeruli of diabetic rats. J Clin Invest
100: 115-126, 1997.
127. Koya D and King GL. Protein kinase C activation and the development of diabetic complications. Diabetes 47: 859-866, 1998.
128. Krady JK, Basu A, Allen CM, Xu Y, LaNoue KF, Gardner TW, and Levison SW. Minocycline reduces proinflammatory cytokine expression, microglial activation, and caspase-3 activation in a rodent model of diabetic retinopathy. Diabetes 54: 1559-1565, 2005.
129. Kristiansen OP and Mandrup-Poulsen T. Interleukin-6 and diabetes: the good, the bad, or the indifferent? Diabetes 54 Suppl 2: S114-
124, 2005. 191
130. Kroemer G, Galluzzi L, Vandenabeele P, Abrams J, Alnemri ES,
Baehrecke EH, Blagosklonny MV, El-Deiry WS, Golstein P, Green DR,
Hengartner M, Knight RA, Kumar S, Lipton SA, Malorni W, Nunez G,
Peter ME, Tschopp J, Yuan J, Piacentini M, Zhivotovsky B, and
Melino G. Classification of cell death: recommendations of the
Nomenclature Committee on Cell Death 2009. Cell Death Differ 16: 3-11,
2009.
131. Kusner LL, Sarthy VP, and Mohr S. Nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase: a role in high glucose- induced apoptosis in retinal Muller cells. Investigative ophthalmology & visual science 45: 1553-1561, 2004.
132. Labbe K and Saleh M. Cell death in the host response to infection.
Cell Death Differ 15: 1339-1349, 2008.
133. Lawless MW, O'Byrne KJ, and Gray SG. Histone deacetylase inhibitors target diabetes via chromatin remodeling or as chemical chaperones? Curr Diabetes Rev 5: 201-209, 2009.
134. Lee JT, Wheeler TC, Li L, and Chin LS. Ubiquitination of alpha- synuclein by Siah-1 promotes alpha-synuclein aggregation and apoptotic cell death. Hum Mol Genet 17: 906-917, 2008.
135. Li Q and Puro DG. Diabetes-induced dysfunction of the glutamate transporter in retinal Muller cells. Investigative ophthalmology & visual science 43: 3109-3116, 2002. 192
136. Liani E, Eyal A, Avraham E, Shemer R, Szargel R, Berg D,
Bornemann A, Riess O, Ross CA, Rott R, and Engelender S.
Ubiquitylation of synphilin-1 and alpha-synuclein by SIAH and its presence in cellular inclusions and Lewy bodies imply a role in Parkinson's disease.
Proceedings of the National Academy of Sciences of the United States of
America 101: 5500-5505, 2004.
137. Lieth E, Gardner TW, Barber AJ, and Antonetti DA. Retinal neurodegeneration: early pathology in diabetes. Clin Experiment
Ophthalmol 28: 3-8, 2000.
138. Limb GA, Chignell AH, Green W, LeRoy F, and Dumonde DC.
Distribution of TNF alpha and its reactive vascular adhesion molecules in fibrovascular membranes of proliferative diabetic retinopathy. Br J
Ophthalmol 80: 168-173, 1996.
139. Liu J, Stevens J, Rote CA, Yost HJ, Hu Y, Neufeld KL, White
RL, and Matsunami N. Siah-1 mediates a novel beta-catenin degradation pathway linking p53 to the adenomatous polyposis coli protein. Mol Cell 7:
927-936, 2001.
140. Luo L and O'Leary DD. Axon retraction and degeneration in development and disease. Annu Rev Neurosci 28: 127-156, 2005.
141. Mansilla S, Bataller M, and Portugal J. Mitotic catastrophe as a consequence of chemotherapy. Anticancer Agents Med Chem 6: 589-602,
2006. 193
142. Mariathasan S, Newton K, Monack DM, Vucic D, French DM,
Lee WP, Roose-Girma M, Erickson S, and Dixit VM. Differential activation of the inflammasome by caspase-1 adaptors ASC and Ipaf.
Nature 430: 213-218, 2004.
143. Mariathasan S, Weiss DS, Dixit VM, and Monack DM. Innate immunity against Francisella tularensis is dependent on the ASC/caspase-
1 axis. J Exp Med 202: 1043-1049, 2005.
144. Martin PM, Roon P, Van Ells TK, Ganapathy V, and Smith SB.
Death of retinal neurons in streptozotocin-induced diabetic mice. Invest
Ophthalmol Vis Sci 45: 3330-3336, 2004.
145. Maruyama W, Akao Y, Youdim MB, Davis BA, and Naoi M.
Transfection-enforced Bcl-2 overexpression and an anti-Parkinson drug, rasagiline, prevent nuclear accumulation of glyceraldehyde-3-phosphate dehydrogenase induced by an endogenous dopaminergic neurotoxin, N- methyl(R)salsolinol. J Neurochem 78: 727-735, 2001.
146. Matsui K, Hosoi N, and Tachibana M. Active role of glutamate uptake in the synaptic transmission from retinal nonspiking neurons. J
Neurosci 19: 6755-6766, 1999.
147. Mazzola JL and Sirover MA. Alteration of nuclear glyceraldehyde-
3-phosphate dehydrogenase structure in Huntington's disease fibroblasts.
Brain Res Mol Brain Res 100: 95-101, 2002. 194
148. Mazzola JL and Sirover MA. Subcellular alteration of glyceraldehyde-3-phosphate dehydrogenase in Alzheimer's disease fibroblasts. Journal of neuroscience research 71: 279-285, 2003.
149. Meleth AD, Agron E, Chan CC, Reed GF, Arora K, Byrnes G,
Csaky KG, Ferris FL, 3rd, and Chew EY. Serum inflammatory markers in diabetic retinopathy. Investigative ophthalmology & visual science 46:
4295-4301, 2005.
150. Mercer RW and Dunham PB. Membrane-bound ATP fuels the
Na/K pump. Studies on membrane-bound glycolytic enzymes on inside- out vesicles from human red cell membranes. J Gen Physiol 78: 547-568,
1981.
151. Meyer-Siegler K, Mauro DJ, Seal G, Wurzer J, deRiel JK, and
Sirover MA. A human nuclear uracil DNA glycosylase is the 37-kDa subunit of glyceraldehyde-3-phosphate dehydrogenase. Proceedings of the National Academy of Sciences of the United States of America 88:
8460-8464, 1991.
152. Miao F, Gonzalo IG, Lanting L, and Natarajan R. In vivo chromatin remodeling events leading to inflammatory gene transcription under diabetic conditions. J Biol Chem 279: 18091-18097, 2004.
153. Miller RF and Dowling JE. Intracellular responses of the Muller
(glial) cells of mudpuppy retina: their relation to b-wave of the electroretinogram. Journal of neurophysiology 33: 323-341, 1970. 195
154. Mizushima N and Yoshimori T. How to interpret LC3 immunoblotting. Autophagy 3: 542-545, 2007.
155. Mizutani M, Kern TS, and Lorenzi M. Accelerated death of retinal microvascular cells in human and experimental diabetic retinopathy. The
Journal of clinical investigation 97: 2883-2890, 1996.
156. Mohr S. Potential new strategies to prevent the development of diabetic retinopathy. Expert Opin Investig Drugs 13: 189-198, 2004.
157. Mohr S, Stamler JS, and Brune B. Post-translational modification of glyceraldehyde-3-phosphate dehydrogenase by S-nitrosylation and subsequent NADH attachment. J Biol Chem 271: 4209-4214, 1996.
158. Mohr S, Xi X, Tang J, and Kern TS. Caspase activation in retinas of diabetic and galactosemic mice and diabetic patients. Diabetes 51:
1172-1179, 2002.
159. Mohr S, Yego ECK, Trueblood-Doreian K, Vincent J, Sarthy V,
Nassal D, Hatala DA, and Howell S. Hyperglycemia Leads to Muller Cell
Death through Induction of Pyroptosis-Like Mechanisms. Association for
Research in Vision and Ophthalmology Annual Meeting, edited by IOVS,
Fort Lauderdale, FL. IOVS, 2009, p. 15.
160. Monack DM, Navarre WW, and Falkow S. Salmonella-induced macrophage death: the role of caspase-1 in death and inflammation.
Microbes Infect 3: 1201-1212, 2001.
161. Morgenegg G, Winkler GC, Hubscher U, Heizmann CW, Mous
J, and Kuenzle CC. Glyceraldehyde-3-phosphate dehydrogenase is a 196 nonhistone protein and a possible activator of transcription in neurons. J
Neurochem 47: 54-62, 1986.
162. Moriyoshi K, Iijima K, Fujii H, Ito H, Cho Y, and Nakanishi S.
Seven in absentia homolog 1A mediates ubiquitination and degradation of group 1 metabotropic glutamate receptors. Proceedings of the National
Academy of Sciences of the United States of America 101: 8614-8619,
2004.
163. Murata T, Nakagawa K, Khalil A, Ishibashi T, Inomata H, and
Sueishi K. The relation between expression of vascular endothelial growth factor and breakdown of the blood-retinal barrier in diabetic rat retinas. Lab Invest 74: 819-825, 1996.
164. Muronetz VI, Wang ZX, Keith TJ, Knull HR, and Srivastava DK.
Binding constants and stoichiometries of glyceraldehyde 3-phosphate dehydrogenase-tubulin complexes. Arch Biochem Biophys 313: 253-260,
1994.
165. Nagano Y, Yamashita H, Takahashi T, Kishida S, Nakamura T,
Iseki E, Hattori N, Mizuno Y, Kikuchi A, and Matsumoto M. Siah-1 facilitates ubiquitination and degradation of synphilin-1. Journal of
Biological Chemistry 278: 51504-51514, 2003.
166. Nagata S. Apoptotic DNA fragmentation. Exp Cell Res 256: 12-18,
2000.
167. Nakamura M, Barber AJ, Antonetti DA, LaNoue KF, Robinson
KA, Buse MG, and Gardner TW. Excessive hexosamines block the 197 neuroprotective effect of insulin and induce apoptosis in retinal neurons. J
Biol Chem 276: 43748-43755, 2001.
168. Nathan DM, Cleary PA, Backlund JY, Genuth SM, Lachin JM,
Orchard TJ, Raskin P, Zinman B, and Diabetes Control and
Complications Trial/Epidemiology of Diabetes Interventions and
Complications Study Research G. Intensive diabetes treatment and cardiovascular disease in patients with type 1 diabetes. The New England journal of medicine 353: 2643-2653, 2005.
169. Naugler WE and Karin M. The wolf in sheep's clothing: the role of interleukin-6 in immunity, inflammation and cancer. Trends Mol Med 14:
109-119, 2008.
170. Nemani M, Linares-Cruz G, Bruzzoni-Giovanelli H, Roperch JP,
Tuynder M, Bougueleret L, Cherif D, Medhioub M, Pasturaud P,
Alvaro V, der Sarkissan H, Cazes L, Le Paslier D, Le Gall I, Israeli D,
Dausset J, Sigaux F, Chumakov I, Oren M, Calvo F, Amson RB,
Cohen D, and Telerman A. Activation of the human homologue of the
Drosophila sina gene in apoptosis and tumor suppression. Proceedings of the National Academy of Sciences of the United States of America 93:
9039-9042, 1996.
171. Newman E and Reichenbach A. The Muller cell: a functional element of the retina. Trends Neurosci 19: 307-312, 1996. 198
172. Newman EA, Frambach DA, and Odette LL. Control of extracellular potassium levels by retinal glial cell K+ siphoning. Science
225: 1174-1175, 1984.
173. Newman EA and Zahs KR. Modulation of neuronal activity by glial cells in the retina. J Neurosci 18: 4022-4028, 1998.
174. Nicotera P, Bernassola F, and Melino G. Nitric oxide (NO), a signaling molecule with a killer soul. Cell Death Differ 6: 931-933, 1999.
175. Ohtaki H, Nakamachi T, Dohi K, Aizawa Y, Takaki A, Hodoyama
K, Yofu S, Hashimoto H, Shintani N, Baba A, Kopf M, Iwakura Y,
Matsuda K, Arimura A, and Shioda S. Pituitary adenylate cyclase- activating polypeptide (PACAP) decreases ischemic neuronal cell death in association with IL-6. Proc Natl Acad Sci U S A 103: 7488-7493, 2006.
176. Opreanu M, Lydic TA, Reid GE, McSorley KM, Esselman WJ, and Busik J. Docosahexaenoic Acid Inhibits Cytokine Signaling in Human
Retinal Endothelial Cells by Downregulating Sphingomyelinases. Invest
Ophthalmol Vis Sci.
177. Overholtzer M, Mailleux AA, Mouneimne G, Normand G,
Schnitt SJ, King RW, Cibas ES, and Brugge JS. A nonapoptotic cell death process, entosis, that occurs by cell-in-cell invasion. Cell 131: 966-
979, 2007.
178. Pachydaki SI, Tari SR, Lee SE, Ma W, Tseng JJ, Sosunov AA,
Cataldergirmen G, Scarmeas N, Caspersen C, Chang S, Schiff WM, 199
Schmidt AM, and Barile GR. Upregulation of RAGE and its ligands in proliferative retinal disease. Exp Eye Res 82: 807-815, 2006.
179. Park J, Han D, Kim K, Kang Y, and Kim Y. O-GlcNAcylation disrupts glyceraldehyde-3-phosphate dehydrogenase homo-tetramer formation and mediates its nuclear translocation. Biochim Biophys Acta
1794: 254-262, 2009.
180. Park SH, Park JW, Park SJ, Kim KY, Chung JW, Chun MH, and
Oh SJ. Apoptotic death of photoreceptors in the streptozotocin-induced diabetic rat retina. Diabetologia 46: 1260-1268, 2003.
181. Pedersen BK, Steensberg A, Fischer C, Keller C, Keller P,
Plomgaard P, Wolsk-Petersen E, and Febbraio M. The metabolic role of
IL-6 produced during exercise: is IL-6 an exercise factor? Proc Nutr Soc
63: 263-267, 2004.
182. Peng YP, Qiu YH, Lu JH, and Wang JJ. Interleukin-6 protects cultured cerebellar granule neurons against glutamate-induced neurotoxicity. Neurosci Lett 374: 192-196, 2005.
183. Phelps PC, Smith MW, and Trump BF. Cytosolic ionized calcium and bleb formation after acute cell injury of cultured rabbit renal tubule cells. Lab Invest 60: 630-642, 1989.
184. Podesta F, Romeo G, Liu WH, Krajewski S, Reed JC,
Gerhardinger C, and Lorenzi M. Bax is increased in the retina of diabetic subjects and is associated with pericyte apoptosis in vivo and in vitro. Am
J Pathol 156: 1025-1032, 2000. 200
185. Poitry-Yamate CL, Poitry S, and Tsacopoulos M. Lactate released by Muller glial cells is metabolized by photoreceptors from mammalian retina. J Neurosci 15: 5179-5191, 1995.
186. Polekhina G, House CM, Traficante N, Mackay JP, Relaix F,
Sassoon DA, Parker MW, and Bowtell DD. Siah ubiquitin ligase is structurally related to TRAF and modulates TNF-alpha signaling. Nat
Struct Biol 9: 68-75, 2002.
187. Puro DG and Mano T. Modulation of calcium channels in human retinal glial cells by basic fibroblast growth factor: a possible role in retinal pathobiology. J Neurosci 11: 1873-1880, 1991.
188. Qaum T, Xu Q, Joussen AM, Clemens MW, Qin W, Miyamoto K,
Hassessian H, Wiegand SJ, Rudge J, Yancopoulos GD, and Adamis
AP. VEGF-initiated blood-retinal barrier breakdown in early diabetes.
Invest Ophthalmol Vis Sci 42: 2408-2413, 2001.
189. Raff MC, Whitmore AV, and Finn JT. Axonal self-destruction and neurodegeneration. Science 296: 868-871, 2002.
190. Raje CI, Kumar S, Harle A, Nanda JS, and Raje M. The macrophage cell surface glyceraldehyde-3-phosphate dehydrogenase is a novel transferrin receptor. J Biol Chem 282: 3252-3261, 2007.
191. Reichenbach A, Stolzenburg JU, Eberhardt W, Chao TI,
Dettmer D, and Hertz L. What do retinal muller (glial) cells do for their neuronal 'small siblings'? Journal of chemical neuroanatomy 6: 201-213,
1993. 201
192. Riepe RE and Norenburg MD. Muller cell localisation of glutamine synthetase in rat retina. Nature 268: 654-655, 1977.
193. Robbins AR, Ward RD, and Oliver C. A mutation in glyceraldehyde 3-phosphate dehydrogenase alters endocytosis in CHO cells. J Cell Biol 130: 1093-1104, 1995.
194. Rothwell NJ and Luheshi GN. Interleukin 1 in the brain: biology, pathology and therapeutic target. Trends Neurosci 23: 618-625, 2000.
195. Sanchez RN, Chan CK, Garg S, Kwong JM, Wong MJ, Sadun
AA, and Lam TT. Interleukin-6 in retinal ischemia reperfusion injury in rats. Invest Ophthalmol Vis Sci 44: 4006-4011, 2003.
196. Sappington RM, Chan M, and Calkins DJ. Interleukin-6 protects retinal ganglion cells from pressure-induced death. Invest Ophthalmol Vis
Sci 47: 2932-2942, 2006.
197. Sarthy VP. Muller cells in retinal health and disease. Archivos de la
Sociedad Espanola de Oftalmologia 75: 367-368, 2000.
198. Sarthy VP, Brodjian SJ, Dutt K, Kennedy BN, French RP, and
Crabb JW. Establishment and characterization of a retinal Muller cell line.
Invest Ophthalmol Vis Sci 39: 212-216, 1998.
199. Saunders PA, Chen RW, and Chuang DM. Nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase isoforms during neuronal apoptosis. J Neurochem 72: 925-932, 1999.
200. Sawa A, Khan AA, Hester LD, and Snyder SH. Glyceraldehyde-
3-phosphate dehydrogenase: nuclear translocation participates in 202 neuronal and nonneuronal cell death. Proc Natl Acad Sci U S A 94:
11669-11674, 1997.
201. Saxena R, Voight BF, Lyssenko V, Burtt NP, de Bakker PI,
Chen H, Roix JJ, Kathiresan S, Hirschhorn JN, Daly MJ, Hughes TE,
Groop L, Altshuler D, Almgren P, Florez JC, Meyer J, Ardlie K,
Bengtsson Bostrom K, Isomaa B, Lettre G, Lindblad U, Lyon HN,
Melander O, Newton-Cheh C, Nilsson P, Orho-Melander M, Rastam L,
Speliotes EK, Taskinen MR, Tuomi T, Guiducci C, Berglund A,
Carlson J, Gianniny L, Hackett R, Hall L, Holmkvist J, Laurila E,
Sjogren M, Sterner M, Surti A, Svensson M, Tewhey R, Blumenstiel B,
Parkin M, Defelice M, Barry R, Brodeur W, Camarata J, Chia N, Fava
M, Gibbons J, Handsaker B, Healy C, Nguyen K, Gates C, Sougnez C,
Gage D, Nizzari M, Gabriel SB, Chirn GW, Ma Q, Parikh H, Richardson
D, Ricke D, and Purcell S. Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. Science 316: 1331-1336,
2007.
202. Schmitz HD. Reversible nuclear translocation of glyceraldehyde-3- phosphate dehydrogenase upon serum depletion. Eur J Cell Biol 80: 419-
427, 2001.
203. Schutte M and Werner P. Redistribution of glutathione in the ischemic rat retina. Neuroscience letters 246: 53-56, 1998.
204. Scott LJ, Mohlke KL, Bonnycastle LL, Willer CJ, Li Y, Duren
WL, Erdos MR, Stringham HM, Chines PS, Jackson AU, Prokunina- 203
Olsson L, Ding CJ, Swift AJ, Narisu N, Hu T, Pruim R, Xiao R, Li XY,
Conneely KN, Riebow NL, Sprau AG, Tong M, White PP, Hetrick KN,
Barnhart MW, Bark CW, Goldstein JL, Watkins L, Xiang F, Saramies
J, Buchanan TA, Watanabe RM, Valle TT, Kinnunen L, Abecasis GR,
Pugh EW, Doheny KF, Bergman RN, Tuomilehto J, Collins FS, and
Boehnke M. A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 316: 1341-1345, 2007.
205. Sedlak TW and Snyder SH. Messenger molecules and cell death: therapeutic implications. JAMA 295: 81-89, 2006.
206. Seki T, Hinohara Y, Taki C, Nakatani M, Ozawa M, Nishimura S,
Takaki A, Itho H, Takenoya F, and Shioda S. PACAP stimulates the release of interleukin-6 in cultured rat Muller cells. Ann N Y Acad Sci
1070: 535-539, 2006.
207. Sen N, Hara MR, Kornberg MD, Cascio MB, Bae BI, Shahani N,
Thomas B, Dawson TM, Dawson VL, Snyder SH, and Sawa A. Nitric oxide-induced nuclear GAPDH activates p300/CBP and mediates apoptosis. Nat Cell Biol 10: 866-873, 2008.
208. Senatorov VV, Charles V, Reddy PH, Tagle DA, and Chuang
DM. Overexpression and nuclear accumulation of glyceraldehyde-3- phosphate dehydrogenase in a transgenic mouse model of Huntington's disease. Molecular and cellular neurosciences 22: 285-297, 2003. 204
209. Sharma SK, Carlson EC, and Ebadi M. Neuroprotective actions of
Selegiline in inhibiting 1-methyl, 4-phenyl, pyridinium ion (MPP+)-induced apoptosis in SK-N-SH neurons. J Neurocytol 32: 329-343, 2003.
210. Shashidharan P, Chalmers-Redman RM, Carlile GW, Rodic V,
Gurvich N, Yuen T, Tatton WG, and Sealfon SC. Nuclear translocation of GAPDH-GFP fusion protein during apoptosis. Neuroreport 10: 1149-
1153, 1999.
211. Shioda S, Ohtaki H, Nakamachi T, Dohi K, Watanabe J, Nakajo
S, Arata S, Kitamura S, Okuda H, Takenoya F, and Kitamura Y.
Pleiotropic functions of PACAP in the CNS: neuroprotection and neurodevelopment. Ann N Y Acad Sci 1070: 550-560, 2006.
212. Shioda S, Ozawa H, Dohi K, Mizushima H, Matsumoto K,
Nakajo S, Takaki A, Zhou CJ, Nakai Y, and Arimura A. PACAP protects hippocampal neurons against apoptosis: involvement of JNK/SAPK signaling pathway. Ann N Y Acad Sci 865: 111-117, 1998.
213. Sims JE, Gayle MA, Slack JL, Alderson MR, Bird TA, Giri JG,
Colotta F, Re F, Mantovani A, Shanebeck K, and et al. Interleukin 1 signaling occurs exclusively via the type I receptor. Proc Natl Acad Sci U
S A 90: 6155-6159, 1993.
214. Singh R and Green MR. Sequence-specific binding of transfer
RNA by glyceraldehyde-3-phosphate dehydrogenase. Science 259: 365-
368, 1993. 205
215. Sirover MA. New insights into an old protein: the functional diversity of mammalian glyceraldehyde-3-phosphate dehydrogenase.
Biochimica et biophysica acta 1432: 159-184, 1999.
216. Sirover MA. New nuclear functions of the glycolytic protein, glyceraldehyde-3-phosphate dehydrogenase, in mammalian cells. Journal of cellular biochemistry 95: 45-52, 2005.
217. Sirover MA. Role of the glycolytic protein, glyceraldehyde-3- phosphate dehydrogenase, in normal cell function and in cell pathology. J
Cell Biochem 66: 133-140, 1997.
218. Sparacio SM, Zhang Y, Vilcek J, and Benveniste EN. Cytokine regulation of interleukin-6 gene expression in astrocytes involves activation of an NF-kappa B-like nuclear protein. J Neuroimmunol 39: 231-
242, 1992.
219. Sperandio S, de Belle I, and Bredesen DE. An alternative, nonapoptotic form of programmed cell death. Proc Natl Acad Sci U S A
97: 14376-14381, 2000.
220. Stitt AW, Li YM, Gardiner TA, Bucala R, Archer DB, and
Vlassara H. Advanced glycation end products (AGEs) co-localize with
AGE receptors in the retinal vasculature of diabetic and of AGE-infused rats. Am J Pathol 150: 523-531, 1997.
221. Sueishi K, Hata Y, Murata T, Nakagawa K, Ishibashi T, and
Inomata H. Endothelial and glial cell interaction in diabetic retinopathy via 206 the function of vascular endothelial growth factor (VEGF). Pol J Pharmacol
48: 307-316, 1996.
222. Sugiyama T, Kobayashi M, Kawamura H, Li Q, and Puro DG.
Enhancement of P2X(7)-induced pore formation and apoptosis: an early effect of diabetes on the retinal microvasculature. Invest Ophthalmol Vis
Sci 45: 1026-1032, 2004.
223. Sunaga K, Takahashi H, Chuang DM, and Ishitani R.
Glyceraldehyde-3-phosphate dehydrogenase is over-expressed during apoptotic death of neuronal cultures and is recognized by a monoclonal antibody against amyloid plaques from Alzheimer's brain. Neurosci Lett
200: 133-136, 1995.
224. Sunaga K, Takahashi H, Chuang DM, and Ishitani R.
Glyceraldehyde-3-phosphate dehydrogenase is over-expressed during apoptotic death of neuronal cultures and is recognized by a monoclonal antibody against amyloid plaques from Alzheimer's brain. Neuroscience letters 200: 133-136, 1995.
225. Sundararaj KP, Wood RE, Ponnusamy S, Salas AM, Szulc Z,
Bielawska A, Obeid LM, Hannun YA, and Ogretmen B. Rapid shortening of telomere length in response to ceramide involves the inhibition of telomere binding activity of nuclear glyceraldehyde-3- phosphate dehydrogenase. J Biol Chem 279: 6152-6162, 2004.
226. Susini L, Passer BJ, Amzallag-Elbaz N, Juven-Gershon T,
Prieur S, Privat N, Tuynder M, Gendron MC, Israel A, Amson R, Oren 207
M, and Telerman A. Siah-1 binds and regulates the function of Numb.
Proc Natl Acad Sci U S A 98: 15067-15072, 2001.
227. Tanaka R, Mochizuki H, Suzuki A, Katsube N, Ishitani R,
Mizuno Y, and Urabe T. Induction of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression in rat brain after focal ischemia/reperfusion. J Cereb Blood Flow Metab 22: 280-288, 2002.
228. Tang AH, Neufeld TP, Kwan E, and Rubin GM. PHYL acts to down-regulate TTK88, a transcriptional repressor of neuronal cell fates, by a SINA-dependent mechanism. Cell 90: 459-467, 1997.
229. Tasdemir E, Galluzzi L, Maiuri MC, Criollo A, Vitale I, Hangen E,
Modjtahedi N, and Kroemer G. Methods for assessing autophagy and autophagic cell death. Methods Mol Biol 445: 29-76, 2008.
230. Tatton NA. Increased caspase 3 and Bax immunoreactivity accompany nuclear GAPDH translocation and neuronal apoptosis in
Parkinson's disease. Experimental neurology 166: 29-43, 2000.
231. Tatton WG, Chalmers-Redman RM, Elstner M, Leesch W,
Jagodzinski FB, Stupak DP, Sugrue MM, and Tatton NA.
Glyceraldehyde-3-phosphate dehydrogenase in neurodegeneration and apoptosis signaling. Journal of neural transmission Supplementum (60):
77-100, 2000.
232. Tikhonenko M, Lydic TA, Wang Y, Chen W, Opreanu M,
Sochacki A, McSorley KM, Renis RL, Kern T, Jump DB, Reid GE, and
Busik JV. Remodeling of retinal Fatty acids in an animal model of 208 diabetes: a decrease in long-chain polyunsaturated fatty acids is associated with a decrease in fatty acid elongases Elovl2 and Elovl4.
Diabetes 59: 219-227.
233. Ting JP, Willingham SB, and Bergstralh DT. NLRs at the intersection of cell death and immunity. Nat Rev Immunol 8: 372-379,
2008.
234. Tisdale EJ, Kelly C, and Artalejo CR. Glyceraldehyde-3- phosphate dehydrogenase interacts with Rab2 and plays an essential role in endoplasmic reticulum to Golgi transport exclusive of its glycolytic activity. J Biol Chem 279: 54046-54052, 2004.
235. Tout S, Chan-Ling T, Hollander H, and Stone J. The role of
Muller cells in the formation of the blood-retinal barrier. Neuroscience 55:
291-301, 1993.
236. Trump BF, Berezesky IK, Chang SH, and Phelps PC. The pathways of cell death: oncosis, apoptosis, and necrosis. Toxicol Pathol
25: 82-88, 1997.
237. Tsacopoulos M and Magistretti PJ. Metabolic coupling between glia and neurons. J Neurosci 16: 877-885, 1996.
238. Tsuchiya K, Tajima H, Yamada M, Takahashi H, Kuwae T,
Sunaga K, Katsube N, and Ishitani R. Disclosure of a pro-apoptotic glyceraldehyde-3-phosphate dehydrogenase promoter: anti-dementia drugs depress its activation in apoptosis. Life Sciences 74: 3245-3258,
2004. 209
239. Turner BM. Histone acetylation as an epigenetic determinant of long-term transcriptional competence. Cell Mol Life Sci 54: 21-31, 1998.
240. Vakifahmetoglu H, Olsson M, and Zhivotovsky B. Death through a tragedy: mitotic catastrophe. Cell Death Differ 15: 1153-1162, 2008.
241. Villeneuve LM, Reddy MA, Lanting LL, Wang M, Meng L, and
Natarajan R. Epigenetic histone H3 lysine 9 methylation in metabolic memory and inflammatory phenotype of vascular smooth muscle cells in diabetes. Proc Natl Acad Sci U S A 105: 9047-9052, 2008.
242. Vincent JA and Mohr S. Inhibition of caspase-1/interleukin-1beta signaling prevents degeneration of retinal capillaries in diabetes and galactosemia. Diabetes 56: 224-230, 2007.
243. Walker RJ and Steinle JJ. Role of beta-adrenergic receptors in inflammatory marker expression in Muller cells. Invest Ophthalmol Vis Sci
48: 5276-5281, 2007.
244. Wang XC, Qiu YH, and Peng YP. Interleukin-6 protects cerebellar granule neurons from NMDA-induced neurotoxicity. Sheng Li Xue Bao 59:
150-156, 2007.
245. Wang XQ, Peng YP, Lu JH, Cao BB, and Qiu YH.
Neuroprotection of interleukin-6 against NMDA attack and its signal transduction by JAK and MAPK. Neurosci Lett 450: 122-126, 2009.
246. Ward LD, Howlett GJ, Discolo G, Yasukawa K, Hammacher A,
Moritz RL, and Simpson RJ. High affinity interleukin-6 receptor is a 210 hexameric complex consisting of two molecules each of interleukin-6, interleukin-6 receptor, and gp-130. J Biol Chem 269: 23286-23289, 1994.
247. Ward MM, Jobling AI, Kalloniatis M, and Fletcher EL. Glutamate uptake in retinal glial cells during diabetes. Diabetologia 48: 351-360,
2005.
248. Webvision. Mueller Cell Golgi Stain [online]. http://webvisionmedutahedu/imageswv/mullerjpeg, Retrieved January 19,
2009.
249. Webvision. Relationship Between Mueller Cell and Other Retinal
Neurons [online]. http://webvisionmedutahedu/imageswv/Reichembjpeg,
Retrieved January19, 2009.
250. Webvision. Section Through the Human Eye and Retina [online]. http://webvisionmedutahedu/imageswv/Sagschemjpeg, Retrieved January
4, 2009.
251. Webvision. Simple Anatomy of the Retina [online]. http://webvisionmedutahedu/imageswv/huretinajpeg, Retrieved January
15, 2009.
252. Webvision. Simple Organization of the Retina [online]. http://webvisionmedutahedu/imageswv/schemjpeg, Rerieved January 19,
2009.
253. White RD and Neal MJ. The uptake of L-glutamate by the retina.
Brain Res 111: 79-93, 1976. 211
254. Wild S, Roglic G, Green A, Sicree R, and King H. Global prevalence of diabetes: estimates for the year 2000 and projections for
2030. Diabetes Care 27: 1047-1053, 2004.
255. Wilkinson-Berka JL and Miller AG. Update on the treatment of diabetic retinopathy. ScientificWorldJournal 8: 98-120, 2008.
256. Willingham SB, Bergstralh DT, O'Connor W, Morrison AC,
Taxman DJ, Duncan JA, Barnoy S, Venkatesan MM, Flavell RA,
Deshmukh M, Hoffman HM, and Ting JP. Microbial pathogen-induced necrotic cell death mediated by the inflammasome components
CIAS1/cryopyrin/NLRP3 and ASC. Cell Host Microbe 2: 147-159, 2007.
257. Winter M, Sombroek D, Dauth I, Moehlenbrink J, Scheuermann
K, Crone J, and Hofmann TG. Control of HIPK2 stability by ubiquitin ligase Siah-1 and checkpoint kinases ATM and ATR. Nat Cell Biol 10:
812-824, 2008.
258. Xi X, Gao L, Hatala DA, Smith DG, Codispoti MC, Gong B, Kern
TS, and Zhang JZ. Chronically elevated glucose-induced apoptosis is mediated by inactivation of Akt in cultured Muller cells. Biochemical and biophysical research communications 326: 548-553, 2005.
259. Yego EC, Vincent JA, Sarthy V, Busik JV, and Mohr S.
Differential regulation of high glucose-induced glyceraldehyde-3- phosphate dehydrogenase nuclear accumulation in Muller cells by IL-
1beta and IL-6. Invest Ophthalmol Vis Sci 50: 1920-1928, 2009. 212
260. Yego EC, Vincent JA, Sarthy VP, Busik J, and Mohr S. High
Glucose-Induced Glyceraldehyde-3-Phosphate Dehydrogenase Nuclear
Accumulation in Mueller Cells is Regulated by Interleukin-1{beta} and
Interleukin-6. Invest Ophthalmol Vis Sci, 2008.
261. Yuan L and Neufeld AH. Tumor necrosis factor-alpha: a potentially neurodestructive cytokine produced by glia in the human glaucomatous optic nerve head. Glia 32: 42-50, 2000.
262. Zychlinsky A, Fitting C, Cavaillon JM, and Sansonetti PJ.
Interleukin 1 is released by murine macrophages during apoptosis induced by Shigella flexneri. J Clin Invest 94: 1328-1332, 1994.