Intraspecific Phylogeography of the Japanese Threadfin Bream

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Iranian Journal of Fisheries Sciences 16(2) 587-604 2017 Intraspecific phylogeography of the Japanese threadfin bream, Nemipterus japonicus (Perciformes: Nemipteridae), from the Persian Gulf and Indo-West Pacific: a preliminary study based on mitochondrial DNA sequence Farivar S.1*; Jalil-Piran Z.1; Zarei F.2; Hosseinzadeh Sahafi H.3 Received: September 2015 Accepted: June 2016 Abstract The Japanese threadfin bream, Nemipterus japonicus, the most abundant and crucially economic Nemipterus species is widespread throughout the Indo-West Pacific. The species has been studied widely for various aspects but genetic studies are scanty. This preliminary study contributes to the species phylogeography through the study of the genetic diversity and historical demography of N. japonicus populations from the Persian Gulf and Indo-West Pacific based on cytochrome c oxidase subunit I (COI) gene sequence. Grouping of the data into phylogenetic trees indicated that the Japanese threadfin bream consists of two reciprocally monophyletic phylogroups with 2.3% net sequence divergence which may qualify as cryptic species: clade I, consists of two sub- clades (Ia and Ib) occurs in the Persian Gulf and Western India, and clade II, which is restricted to the South China Sea. Historical and demographic hypotheses were raised to explain the observed phylogeographic pattern and population structure. Among the possible key mechanisms, sea level fluctuations driven by glacial episodes of the second half of the Pleistocene Epoch appear to have played an active role in initiating major phylogeographic separation. Apart from presumptive Pleistocene vicariance, a trend of increasing genetic differences with increasing geographic distance (i.e., isolation-by-distance) and regional differences in breeding season were also proposed as possible alternative scenarios. Since the baseline knowledge on the intraspecific genetic diversity and management and evolutionary significant units is the first step before any action to be taken, the basic findings provided by this research are particularly relevant to conservation efforts, fishery management and stock assessment. Keywords: Nemipterus Japonicus, mtDNA, Phylogeography, Persian Gulf, Indo-West Pacific 1-Department of Genetics, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University (GC), Tehran 1983963113, Iran. 2-Department of Animal Sciences, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University (GC), Tehran 1983963113, Iran. 3-Iranian Fisheries Science Research Institute (IFSRI), Agricultural Research Education and Extension Organization (AREEO), P.O. Box14155-6116, Tehran, Iran. *Corresponding author’s Email: [email protected] 588 Farivar et al., Intraspecific phylogeography of the Japanese threadfin bream, Nemipterus … Introduction 1996; Zacharia, 1998; Raje, 2003; The Japanese threadfin bream, Manojkumar, 2004; Joshi, 2010; Nemipterus japonicus (Bloch, 1795), Naqash and Nazeer, 2010), and the most abundant and crucially population dynamics (Vivekanandan economic Nemipterus species is and James, 1986; Iqbal, 1991; Zacharia, widespread throughout the Indo-West 1998; Rajkumar et al., 2003; Fazeli, Pacific ranging from East Africa, 2014; Rezayi et al., 2014), but including the Persian Gulf and Red Sea morphological and genetic studies are to the Indo-Malay Archipelago (Fig. scanty. Analysis of morphometric 1A). It is a benthic, non-migratory characters have indicated that separate species, very abundant in coastal stocks of this species may exist along waters, found on mud and sand bottoms the east and west coasts of India in the 5-80 m depth ranges, usually in (Sreekanth et al., 2015). Evaluation of schools (Russell, 1990). As a result of mitochondrial cytochrome b (Cyt b) faster growth rates in males, females gene sequence among N. japonicus predominate at small sizes and males at populations along the coast of large sizes (Lee, 1973). As a demersal Peninsular Malaysia by Jamsari et al. carnivore, the diet of this species (2008) and Lim et al. (2016) provided mainly consists of crustaceans, fishes, evidence for possible occurrence of molluscs, polychaetes and echinoderms cryptic species in that region. Analysis (Salarpouri et al., 2010; Afshari et al., of mitochondrial cytochrome c oxidase 2013; Manojkumar et al., 2015). This subunit I (COI) gene sequence among species is trawled in commercial nine Nemipterus species by quantities in the Persian Gulf and Oman Ravitchandirane et al. (2012) revealed Sea (Valinassab et al., 2006), the that the highest intraspecific K2P Andaman Sea (Senta and Tan, 1975), as distance belongs to N. Japonicus well as in the Bay of Bengal (0.069; based on 5 specimens). DNA (Krishnamoorthi, 1971), and the South barcode results based on COI gene for China Sea (Eggleston, 1972; Lee, 1973; three N. Japonicus specimens supported Weber and Jothy, 1977). It has been the possible existence of two studied widely for various aspects like geographically separated lineages, the maturity, reproduction and related Indian Ocean and West Pacific lineages aspects (Krishnamoorthi, 1971; (Ning et al., 2015). On the other hand, Eggleston, 1972; Murty, 1984; Russell, the population genetic structure and 1990; Bakhsh, 1996; Rajkumar et al., phylogeographic pattern within the 2003; Kerdgari et al., 2009; Fazeli, western range of species (consists of the 2013), biology and biochemistry Indian Ocean, Arabian Sea and two (Krishnamoorthi, 1971; Murty, 1984; evaporative basins, the Red Sea and Murty, 1987; Russell, 1990; Samuel, Persian Gulf) is even more poorly 1990; Bakhsh, 1996; Chawla et al., known. However, the early findings Iranian Journal of Fisheries Sciences 16(2) 2017 589 clearly suggest that the diversity of the collected from 8 stations along the Japanese threadfin bream in the Indo- northern coast of the Persian Gulf West Pacific remains largely which based on geographical proximity unexplored. were grouped into two populations (Fig. Mitochondrial DNA (mtDNA), due 1B and Table 1): the Bushehr to its maternal and non-recombining population (consists of 10 specimens mode of inheritance and rapid sequence from five sampling stations including evolution, provides multiple haplotypes the Bushehr waterfront, Bandar Deyr, that can be ordered phylogenetically Bandargah, the Nayband Gulf and the within a species (Avise, 2000). Among Suru Village coast) and the Hormozgan the mitochondrial genes, a 650 bp population (consists of 7 specimens fragment from the 5´ region of the from three sampling stations including mitochondrial COI gene, with a strong Bandar-e Kong, Bandar Abbas and the track record in revealing cryptic Salkh Village coast). All specimens species, has been adopted as a global were identified as N. japonicus based bio-identification system for members on taxonomic keys and descriptions as of the animal kingdom (Hebert et al., referenced in the FAO species 2004; Ward et al., 2005). Recent catalogue vol. 12 (Russell, 1990). In studies have successfully proved the addition, 14 previously published COI efficiency of this gene in diagnosis of sequences from the South China Sea, threadfin breams (Ravitchandirane et Western India (coast of Maharashtra; al., 2012) and other marine fishes from Lakra et al., 2011) and coast of Bushehr the Persian Gulf (Asgharian et al., Province (from Nayband National Park; 2011) and Indian Ocean (Lakra et al., Asgharian et al., 2011) were also 2011). This study contributes to the retrieved from the National Center for species phylogeography through the Biotechnology Information (NCBI). study of the genetic diversity and historical demography of N. japonicus DNA extraction and mtDNA sequencing populations from the Persian Gulf and DNA was isolated from fin tissue Indo-West Pacific based on original and samples by standard Phenol- published COI sequences. Results Chloroform method (Sambrook et al., should provide a primary understanding 1989), and diluted in TE buffer to a of the species history, and may have final concentration of 50 ng/μL. The relevance for conservation, stock COI gene (approximately 655 bp in assessment and fishery management. length) was amplified using a set of primers FishF1: 5´- Materials and methods TCAACCAACCACAAAGACATTGG Origin of samples and populations CAC-3´ and FishR1: 5´- From June to November 2012 a total TAGACTTCTGGGTGGCCAAAGAA number of seventeen specimens were TCA-3´ (Ward et al., 2005). The 25 μl 590 Farivar et al., Intraspecific phylogeography of the Japanese threadfin bream, Nemipterus … Figure 1: (A) Map of the Indo-West Pacific showing the current range of Nemipterus Japonicus (black area; after Russell, 1990). (B) The sample collection sites in the Persian Gulf. Numbers are the same as in Table 1. Table 1: Sampling localities, geographical coordinates and number of specimens. Population No.* Lat. N Lon. E n GenBank Acc. No. Bushehr 1 28˚17´ 51˚64´ 12 KU739523; KU739524; KU739525; KU739526; KU739527; KU739528; KU739529; KU739530; KU739531; KU739532; HQ149889; HQ149888 Hormozgan 2 26˚83´ 55˚45´ 7 KU739533; KU739534; KU739535; KU739536; KU739537; KU739538; KU739539 Western India 3 19˚01´ 72˚78´ 5 EF609553; EF609554; EF609555; EF609556; FJ347947 South China Sea 4 22˚39´ 114˚10´ 7 KF134003; KF134004; KF134005; EU871686; EU871687; JF493971; JQ681509 * Population number on Fig. 1, n = sample size. PCR reaction mixes included 16.5 μL Products were visualized on 1% of dH2O, 2.5 μL of 10X PCR buffer, 1 agarose gels and the sharp and most μL of Mg2+ (50 mM), 1 μL of each intense products were selected
Recommended publications
  • Bycatch Assessment in the Gambian Sole Bottom Gillnet Fishery

    Bycatch Assessment in the Gambian Sole Bottom Gillnet Fishery

    Bycatch Assessment in the Gambian Sole Bottom Gillnet Fishery Gambia-Senegal Sustainable Fisheries Project (USAID/BaNafaa) 2010-2011 This publication is available electronically on the Coastal Resources Center’s website at http://www.crc.uri.edu. For more information contact: Coastal Resources Center, University of Rhode Island, Narragansett Bay Campus, South Ferry Road, Narragansett, Rhode Island 02882, USA. Tel: 401) 874-6224; Fax: 401) 789-4670; Email: [email protected] The USAID/BaNafaa project is implemented by the Coastal Resources Center of the University of Rhode Island and the World Wide Fund for Nature-West Africa Marine Program Office (WWF-WAMPO) in partnership with the Department of Fisheries and the Ministry of Fisheries and Water Resources. Citation: Gabis, G., Drammeh, O., Nichols, E., Kelpsite, L., Castro, K., Parkins, C., Mendy, A., Ceesay, S. and F. Joof. 2012. Bycatch Assessment in the Gambian Sole Bottom Gillnet Fishery. Gambia-Senegal Sustainable Fisheries Project (USAID/Ba Nafaa). Coastal Resources Center, University of Rhode Island, pp. 20 Disclaimer: This report was made possible by the generous support of the American people through the United States Agency for International Development (USAID). The contents are the responsibility of the authors and do not necessarily reflect the views of USAID or the United States Government. Cooperative Agreement # 624-A-00-09-00033-00. Cover Photo: Gambia gillnet fishery Photo Credit: Christopher Parkins, USAID/BaNafaa project/World Wide Fund for Nature-West Africa Marine Program Office (WWF-WAMPO). 2 Acknowledgements There is little doubt that involving stakeholders as partners in developing management plans will assist in the progress towards improved management of the fishery resources.
  • Relative Abundance and Growth of Male and Female Nemipterus Furcosus Population (Kelimpahan Relatif Dan Tumbesaran Jantan Dan Betina Populasi Nemipterus Furcosus)

    Relative Abundance and Growth of Male and Female Nemipterus Furcosus Population (Kelimpahan Relatif Dan Tumbesaran Jantan Dan Betina Populasi Nemipterus Furcosus)

    Sains Malaysiana 45(1)(2016): 79–86 Relative Abundance and Growth of Male and Female Nemipterus furcosus Population (Kelimpahan Relatif dan Tumbesaran Jantan dan Betina Populasi Nemipterus furcosus) F.S. AMIRA, M.M. RAHMAN*, B.Y. KAMARUZZAMAN, K.C.A. JALAL, M.Y. HOSSAIN & N.S. KHAN ABSTRACT A study was conducted to understand the relative abundance and growth of male and female Nemipterus furcosus population in the Pahang coastal water, Malaysia. The sampling was done monthly for a period of one year. A total of 1446 fish specimens were studied in this research. The results showed that maleN. furcosus population was significantly more than female (p<0.01) N. furcosus population. The growth coefficient (b value) varied between 2.6808 and 3.2396 for male and 2.0926 and 3.2838 for female N. furcosus. The growth co-efficients of maleN. furcosus were significantly different than the growth co-efficients of female N. furcosus in all months (p<0.05). They showed negative allometric growths in February- June and September. Female N. furcosus showed positive allometric growths in November-January and August. Isometric growths of female were observed only in October and July. As for male N. furcosus, negative allometric growths were observed in March-June, November and January. Male N. furcosus showed positive allometric growths in August, September, October, December and February. Male N. furcosus showed isometric growth only in July. The overall mean condition factor of male and female was statistically similar (p>0.05). The condition factor (K) ranged from 1.2559 to 1.3917 for male while 1.2503 to 1.3926 for female N.
  • View/Download

    View/Download

    SPARIFORMES · 1 The ETYFish Project © Christopher Scharpf and Kenneth J. Lazara COMMENTS: v. 4.0 - 13 Feb. 2021 Order SPARIFORMES 3 families · 49 genera · 283 species/subspecies Family LETHRINIDAE Emporerfishes and Large-eye Breams 5 genera · 43 species Subfamily Lethrininae Emporerfishes Lethrinus Cuvier 1829 from lethrinia, ancient Greek name for members of the genus Pagellus (Sparidae) which Cuvier applied to this genus Lethrinus amboinensis Bleeker 1854 -ensis, suffix denoting place: Ambon Island, Molucca Islands, Indonesia, type locality (occurs in eastern Indian Ocean and western Pacific from Indonesia east to Marshall Islands and Samoa, north to Japan, south to Western Australia) Lethrinus atkinsoni Seale 1910 patronym not identified but probably in honor of William Sackston Atkinson (1864-ca. 1925), an illustrator who prepared the plates for a paper published by Seale in 1905 and presumably the plates in this 1910 paper as well Lethrinus atlanticus Valenciennes 1830 Atlantic, the only species of the genus (and family) known to occur in the Atlantic Lethrinus borbonicus Valenciennes 1830 -icus, belonging to: Borbon (or Bourbon), early name for Réunion island, western Mascarenes, type locality (occurs in Red Sea and western Indian Ocean from Persian Gulf and East Africa to Socotra, Seychelles, Madagascar, Réunion, and the Mascarenes) Lethrinus conchyliatus (Smith 1959) clothed in purple, etymology not explained, probably referring to “bright mauve” area at central basal part of pectoral fins on living specimens Lethrinus crocineus
  • DEEP SEA LEBANON RESULTS of the 2016 EXPEDITION EXPLORING SUBMARINE CANYONS Towards Deep-Sea Conservation in Lebanon Project

    DEEP SEA LEBANON RESULTS of the 2016 EXPEDITION EXPLORING SUBMARINE CANYONS Towards Deep-Sea Conservation in Lebanon Project

    DEEP SEA LEBANON RESULTS OF THE 2016 EXPEDITION EXPLORING SUBMARINE CANYONS Towards Deep-Sea Conservation in Lebanon Project March 2018 DEEP SEA LEBANON RESULTS OF THE 2016 EXPEDITION EXPLORING SUBMARINE CANYONS Towards Deep-Sea Conservation in Lebanon Project Citation: Aguilar, R., García, S., Perry, A.L., Alvarez, H., Blanco, J., Bitar, G. 2018. 2016 Deep-sea Lebanon Expedition: Exploring Submarine Canyons. Oceana, Madrid. 94 p. DOI: 10.31230/osf.io/34cb9 Based on an official request from Lebanon’s Ministry of Environment back in 2013, Oceana has planned and carried out an expedition to survey Lebanese deep-sea canyons and escarpments. Cover: Cerianthus membranaceus © OCEANA All photos are © OCEANA Index 06 Introduction 11 Methods 16 Results 44 Areas 12 Rov surveys 16 Habitat types 44 Tarablus/Batroun 14 Infaunal surveys 16 Coralligenous habitat 44 Jounieh 14 Oceanographic and rhodolith/maërl 45 St. George beds measurements 46 Beirut 19 Sandy bottoms 15 Data analyses 46 Sayniq 15 Collaborations 20 Sandy-muddy bottoms 20 Rocky bottoms 22 Canyon heads 22 Bathyal muds 24 Species 27 Fishes 29 Crustaceans 30 Echinoderms 31 Cnidarians 36 Sponges 38 Molluscs 40 Bryozoans 40 Brachiopods 42 Tunicates 42 Annelids 42 Foraminifera 42 Algae | Deep sea Lebanon OCEANA 47 Human 50 Discussion and 68 Annex 1 85 Annex 2 impacts conclusions 68 Table A1. List of 85 Methodology for 47 Marine litter 51 Main expedition species identified assesing relative 49 Fisheries findings 84 Table A2. List conservation interest of 49 Other observations 52 Key community of threatened types and their species identified survey areas ecological importanc 84 Figure A1.
  • Population Dynamics and Stock Assessment of Delegoa Threadfin Bream, Nemipterus Bipunctatus (Nemipteridae), from the Wadge Bank, South India

    Population Dynamics and Stock Assessment of Delegoa Threadfin Bream, Nemipterus Bipunctatus (Nemipteridae), from the Wadge Bank, South India

    Journal of Applied and Natural Science 10 (1): 59 - 63 (2018) Population dynamics and stock assessment of Delegoa threadfin bream, Nemipterus bipunctatus (Nemipteridae), from the Wadge Bank, South India K. Karuppasamy1*, S. David Kingston2, P. Jawahar1, S.Aanand1, V.K.Venkataramani3 and V.Vidhya1 1Fisheries College and Research Institute, TNFU, Tuticorin (Tamil Nadu), INDIA 2Fisheries Training and Research Centre, TNFU, Parakkai, Kanyakumari (Tamil Nadu), INDIA 3Kerala University of Fisheries and Ocean Studies, Panangad, Kochi (Kerala), INDIA *Corresponding author. E-mail: [email protected] Received: January 10, 2017; Revised received: August 14, 2017; Accepted: January 10, 2018 Abstract: Fishery, population characteristics and stock estimates of Nemipterus bipunctatus were studied during June 2015 to May 2016 from Wadge Bank, South India. This region is characterised by rich biodiversity and has a conducive influence of the Indian Ocean and Arabian Sea. The asymptotic length (L∞), growth coefficient (K) and arbitrary origin of growth (t0) were estimated as 30.5 cm, 0.85/year and 0.18 respectively. The mortality parameters, total mortality rate (Z), fishing mortality rate and natural mortality rate (M) were estimated as 2.20, 0.95 and 1.25 respectively. Exploitation ratio (E) was found to be 0.57 which showed marginal over exploitation of the species at Wadge Bank. This species has two recruitment seasons, one major season from October to December and another minor season in August. The length structured Virtual population analysis revealed heavy fishing pressure on the length group 24 to 28 cm and hence the delegoa threadfin bream was not found to suffer due to recruitment over- fishing in Wadge Bank.
  • Download Book (PDF)

    Download Book (PDF)

    A PICTORIAL GUIDE TO THE FISHES OF THE FAMILY NEMIPTERIDAE OF INDIA R.P. BARMAN and S.S. MISHRA Zoological Survey of India, Fire Proof Spirit Building, Kolkata- 700016 Edited by the Director, Zoological Survey of India, Kolkata Zoological Survey of India Kolkata CITATION Barman, R.P. and Mishra, S.S. 2009. A Pictorial Guide to the Fishes of the family Nemipteridae of India : 1-50. (Published by the Director, Zool. Surv. India, Kolkata) Published : September, 2009 ISBN 978-81-8171-232-5 © Govt. of India, 2009 ALL RIGHTS RESERVED • No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise without the prior permission of the publisher. • This book is sold subject to the condition that it shall not, by way of trade, be lent, resold, hired out or otherwise disposed of without the publisher's consent, in any form of binding or cover other than that in which, it is published. • The correct price of this publication is the price printed on this page. Any revised price indicated by a rubber stamp or by a sticker or by any other means is incorrect and should be unacceptable. PRICE • Indian Rs. 150.00 Foreign : $ 10; £ 7 Published at the Publication Division by the Director Zoological Survey of India, 234/4, AJC Bose Road, 2nd MSO Building, 13th floor, Nizam Palace, Kolkata 700020 and printed at MIs Alpha Printers, New Delhi - 110 015. PREFACE A pictorial guide or handbook on the Nemipterid fishes that occur in Indian waters is conceived to provide information on these fishes to the common or semi-technical people who often find it difficult to understand the taxonomic studies in its true sense.
  • Comparison of Fat Composition and Chemical Properties of Fat Extracts Between Fish Fillets of Selected Warm-Water and Cold-Water Fish

    Comparison of Fat Composition and Chemical Properties of Fat Extracts Between Fish Fillets of Selected Warm-Water and Cold-Water Fish

    1968 Bioscience Journal Original Article COMPARISON OF FAT COMPOSITION AND CHEMICAL PROPERTIES OF FAT EXTRACTS BETWEEN FISH FILLETS OF SELECTED WARM-WATER AND COLD-WATER FISH COMPARAÇÃO DA COMPOSIÇÃO DA GORDURA E PROPRIEDADES QUÍMICAS DOS EXTRATOS DE GORDURA ENTRE FILÉ DE PEIXE DE ÁGUA QUENTE E DE ÁGUA FRIA Siti Nadzirah HUSSIN1; Azrina AZLAN1,2,3*; Hock Eng KHOO1,3 ; Noor Atiqah Aizan ABDUL KADIR1; Muhammad Rizal RAZMAN4 1. Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences University Putra Malaysia, Selangor, Malaysia; 2. Laboratory of Analysis and Authentications, Halal Products Research Institute, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia; 3. Research Centre of Excellence for Nutrition and Non-Communicable Diseases, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Selangor, Malaysia; 4. Research Centre for Sustainability Science and Governance (SGK), Institute for Environment and Development (LESTARI), Universiti Kebangsaan Malaysia (UKM), 43600 UKM Bangi, Selangor, Malaysia ABSTRACT: The purpose of this study was to determine and compare fat composition and chemical properties of fish fillets of selected warm-water fish obtained from Straits of Malacca. A cold water fish, namely salmon was used for comparison. Moisture content, crude fat, fatty acids composition and chemical characteristics of fish fillets of Yellowstripe scad, Japanese threadfin bream and salmon were determined. Japanese threadfin bream fillet had highest moisture and crude fat contents, followed by fillets of Yellowstripe scad and salmon. A significantly strong and negative correlation was found between moisture and crude fat contents of these fish fillets. Fillets of Japanese threadfin bream and Yellowstripe scad also had higher total saturated fatty acids than total unsaturated fatty acids.
  • Age and Growth of Nemipterus Randalli in the Southern Aegean Sea, Turkey

    Age and Growth of Nemipterus Randalli in the Southern Aegean Sea, Turkey

    J. Black Sea/Mediterranean Environment Vol. 25, No. 2: 140-149 (2019) RESEARCH ARTICLE Age and growth of Nemipterus randalli in the southern Aegean Sea, Turkey Umut Uyan1*, Halit Filiz2, Ali Serhan Tarkan2,3, Murat Çelik2, Nildeniz Top2 1 Department of Marine Biology, Pukyong National University, (48513) 45, Yongso-ro, Nam-Gu, Busan, KOREA 2 Faculty of Fisheries, Muğla Sıtkı Koçman University, 48000, Menteşe, Muğla, TURKEY 3 Department of Ecology and Vertebrate Zoology, Faculty of Biology and Environmental Protection, University of Łódź, Łódź, POLAND *Corresponding author: [email protected] Abstract In this study, the age and growth characteristics of Randall’s threadfin bream (Nemipterus randalli Russell, 1986) in Gökova Bay (southern Aegean Sea) were examined. In total, 221 (varied between 10.8-21.9 cm in total length and 18.19-150.10 g in total weight) were examined on a monthly basis between May 2015 and April 2016. The sex ratio (male: female) was 1:0.51 and showed significant variation depending on age classes. The length-weight relationship parameters were estimated as follows; a = 0.0171, b = 2.92, r 2= 0.92 (n = 221). Ages ranged from 1 to 5, and the 2-years group was dominant (42.53%) for both sexes. von Bertalanffy growth parameters and phi-prime -1 growth performance index value calculated as L∞= 27.57 cm, k= 0.183 year , t0= -2.88 and Φ= 2.14 for all individuals. The results representing the first study on age and growth of N. randalli in the southern Aegean Sea. Keywords: Randall’s threadfin bream, Nemipteridae, Lessepsian fish, Gökova Bay Received: 10.02.2019 Accepted: 30.05.2019 Introduction Randall’s threadfin bream (Nemipterus randalli Russell, 1986) naturally exists in all the western Indian Ocean including the east and west coasts of India, Pakistan, the Persian (Arabian) Gulf, Red Sea, including the Gulf of Aqaba, the Gulf of Aden, and the eastern African coast: the Seychelles and Madagascar (Russell 1990).
  • The Food and Feeding Habits of the Delagoa Threadfin Bream, Nemipterus Bipunctatus (Valenciennes, 1830), from the Coastal Waters Around Dar Es Salaam, Tanzania

    The Food and Feeding Habits of the Delagoa Threadfin Bream, Nemipterus Bipunctatus (Valenciennes, 1830), from the Coastal Waters Around Dar Es Salaam, Tanzania

    WIO Journal of Marine Science 16 (1 ) 2017 13-23 Original Article 13 The food and feeding habits of the Delagoa threadfin bream, Nemipterus bipunctatus (Valenciennes, 1830), from the coastal waters around Dar es Salaam, Tanzania Joseph S. Sululu1,*, Simon G. Ndaro2, Simon J. Kangwe1 1 Tanzania Fisheries Research 2 Department of Aquatic Sciences * corresponding author: Institute, P.O. Box 78850, and Fisheries Technology, [email protected] Dar es Salaam, University of Dar es Salaam, Tanzania. P.O. Box 35064, Dar es Salaam, Tanzania. Abstract Nemipterus bipunctatus is among the Nemipterids that support artisanal fisheries throughout most of the Western Indian Ocean (WIO) region. Despite its economic importance, information on food and feeding habits is poorly known in the region. Feeding habit was examined with respect to size, sex, maturity stages of the predator, and season. The food preference for N. bipunctatus was determined using Index of Relative Importance (IRI). Crustaceans were the main prey group accounting for more than 40% IRI of the total food ingested with crabs being the most dominant prey item in the group. Fish ranked as the second prey group accounting for 32.1 % IRI of the total food consumed. Meiofauna, bivalves, miscellaneous and cephalopods made up the rest of the diet. Significantly higher mean number of major prey categories were encountered in N. bipunctatus stomachs during the southeast monsoon as compared to during the northeast monsoon (two way contingency table analysis test, χ2-test, df=3, p< 0.001). An ontogenic diet shift study revealed that meiofauna, cephalopods, and bivalves groups had higher contributions in the diet of smaller N.
  • Ecological Correlates of Dispersal Success of Lessepsian Fishes

    Ecological Correlates of Dispersal Success of Lessepsian Fishes

    Vol. 363: 273–286, 2008 MARINE ECOLOGY PROGRESS SERIES Published July 15 doi: 10.3354/meps07474 Mar Ecol Prog Ser Ecological correlates of dispersal success of Lessepsian fishes F. Ben Rais Lasram*,1,2, J. A. Tomasini1, F. Guilhaumon1, M. S. Romdhane2, T. Do Chi1, D. Mouillot1 1Laboratoire Ecosystèmes Lagunaires, UMR CNRS-IFREMER-UM2 5119, Université Montpellier 2, cc 093, place Eugène Bataillon, 34095 Montpellier Cedex 5, France 2Laboratoire Ecosystèmes et Ressources Aquatiques, Institut National Agronomique de Tunisie, 43 avenue Charles Nicolle, 1082 Tunis, Tunisie ABSTRACT: Despite the importance of Lessepsian invasion by migrant fish species from the Red Sea into the Mediterranean Sea via the Suez Canal, determinants of invasive success have been poorly investigated. In this study, we reconstructed the spatio-temporal dynamics of all Lessepsian fish species in the Mediterranean Sea and analysed the relationship between ecological variables and dispersal rate. We created a database on species occurrences based on historical data (1869 to 2005) and estimated the dispersal rate of each species. Overall, 30% of the Lessepsian species succeeded in colonizing the Mediterranean Sea. On average, the 43 Lessepsian species not included in the category ‘absence of dispersal’ disperse at a rate of 221 ± 5.4 km yr–1 (SE) on the northern side and 70 km yr–1 (SE = 3 km yr–1) on the southern side. Among the ecological variables studied, climate match, the year of introduction and interactions of both factors were significantly correlated with dispersal success. According to our observations, subtropical species introduced before 1980 have an advantage in the dispersal process.
  • Feeding Habits of Blacktip Sharks, Carcharhinus Limbatus, and Atlantic

    Feeding Habits of Blacktip Sharks, Carcharhinus Limbatus, and Atlantic

    Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School 2002 Feeding habits of blacktip sharks, Carcharhinus limbatus, and Atlantic sharpnose sharks, Rhizoprionodon terraenovae, in Louisiana coastal waters Kevin Patrick Barry Louisiana State University and Agricultural and Mechanical College Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_theses Part of the Oceanography and Atmospheric Sciences and Meteorology Commons Recommended Citation Barry, Kevin Patrick, "Feeding habits of blacktip sharks, Carcharhinus limbatus, and Atlantic sharpnose sharks, Rhizoprionodon terraenovae, in Louisiana coastal waters" (2002). LSU Master's Theses. 66. https://digitalcommons.lsu.edu/gradschool_theses/66 This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Master's Theses by an authorized graduate school editor of LSU Digital Commons. For more information, please contact [email protected]. FEEDING HABITS OF BLACKTIP SHARKS, CARCHARHINUS LIMBATUS, AND ATLANTIC SHARPNOSE SHARKS, RHIZOPRIONODON TERRAENOVAE, IN LOUISIANA COASTAL WATERS A Thesis Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College In partial fulfillment of the Requirements for the degree of Master of Science in The Department of Oceanography and Coastal Sciences by Kevin P. Barry B.S., University of South Alabama, 1996 August 2002 AKNOWLEDGEMENTS I would like to first and foremost thank my major professor, Dr. Richard Condrey, for giving me the opportunity to pursue this graduate degree. His willingness to accompany me during sampling trips, his enthusiasm and interest in my research topic, and his guidance throughout my time here has forged more than a major professor/graduate student relationship; it has formed a friendship as well.
  • Polydactylus Macrophthalmus (Bleeker, 1858), with Designation of a Lectotype and Notes on Distributional Implications

    Polydactylus Macrophthalmus (Bleeker, 1858), with Designation of a Lectotype and Notes on Distributional Implications

    Redescription of a rare threadfin (Perciformes: Polynemidae), Polydactylus macrophthalmus (Bleeker, 1858), with designation of a lectotype and notes on distributional implications Hiroyuki Motomura1*, Martien J. P. van Oijen2, Isaäc J. H. Isbrücker3, and Yukio Iwatsuki4 1 Miyazaki University, The United Graduate School of Agricultural Sciences, Kagoshima University, 1-1 Gakuen-kibanadai-nishi, Miyazaki 889-2192, Japan (e-mail: [email protected]) 2 National Museum of Natural History, P.O. Box 9517, 2300 RA Leiden, The Netherlands (e-mail: [email protected]) 3 Zoölogisch Museum Amsterdam, Universiteit van Amsterdam, P.O. Box 94766, 1090 GT Amsterdam, The Netherlands (e-mail: [email protected]) 4 Division of Fisheries Sciences, Faculty of Agriculture, Miyazaki University, 1-1 Gakuen-kibanadai-nishi, Miyazaki 889-2192, Japan (e-mail: [email protected]) Received: November 1, 2000 / Revised: March 2, 2001 / Accepted: March 15, 2001 Abstract A rare threadfin, Polydactylus macrophthalmus (Bleeker, 1858), having long Ichthyological been included in the genus Polynemus, is redescribed on the basis of 9 specimens and a lectotype designated. Polydactylus macrophthalmus is characterized by the following com- Research bination of characters: 7 pectoral filaments, upper 3 filaments extending beyond posterior ©The Ichthyological Society of Japan 2001 margin of hypural; 13 or 14 pectoral fin rays; 87–94 pored lateral line scales; 11 scales above lateral line, 15 or 16 below; 10–12 upper series gill rakers, 15 or 16 lower, 26 or 27 total; Ichthyol Res (2001) 48: 289–294 occipital profile concave in adults; second spine of first dorsal fin very strong; pectoral fin rays long (mean 24% [range 24–26%] of SL).