Behavioural Ecology of the Red-Capped Robin

Behavioural ecology of the red-capped robin

(photo: Tobias Sahlman)

Submitted in total fulfilment of the requirements of the degree of Doctor of Philosophy

Damian Kimon Dowling May 2004 Department of Zoology University of Melbourne

Abstract

In this thesis, I describe aspects of the behavioural ecology of the red-capped robin Petroica goodenovii (Petroicidae), relating to its mating system and breeding biology, based on field research during two breeding seasons (2000/01 and 2001/02) in Terrick Terrick National Park (northern Victoria, Australia).

Breeding traits of the red-capped robin were typical of many other Australian passerines and included small clutches, long breeding seasons and multiple broods. A comparative analysis within the Petroicidae (members of which are distributed throughout Australasia) revealed that species endemic to Australia had shorter incubation periods, and species from semi-arid and dry woodlands had comparatively longer incubation periods.

Red-capped robin abundances within white cypress-pine woodlands of Terrick Terrick National Park were higher than those of nearby eucalypt woodlands, suggesting such pine woodlands provide high quality habitat for red-capped robins. The study site was saturated with robin breeding territories and few territory vacancies were available at any given time. Nestlings that were relatively heavier were more likely to reach independence and disperse. However, rates of juvenile recruitment into the study population were low. Juveniles may be forced to disperse far from their natal territories to establish breeding territories.

To investigate the role of sexually dichromatic plumage in the mating system of the red- capped robin, I isolated and characterised seven hypervariable microsatellite loci from the red-capped robin for use in paternity analyses. Five loci showed no evidence of null alleles, and together with two loci gained by cross-amplification, were suitably polymorphic for paternity analysis (exclusion probability for seven unlinked loci = 0.9760).

Extra-pair matings comprised 23% of fertilisations in this population. Males with the highest reproductive success in 2000/01 moulted into the most colourful plumage at the

conclusion of this season, suggesting red plumage may be a condition-dependent signal of quality. These males were in better body condition than other males during the study. Males with the most colourful forehead caps paired with the highest quality females, but the most colourful males did not gain increased reproductive success (within- or extra- pair) during the season they possessed their colourful plumage (2001/02). Instead, male reproductive success correlated with body condition, age, and the age of his social partner. When females gained extra-pair fertilisations, extra-pair males were more heterozygous and tended to be more distantly related to the social female than their within-pair counterparts. In females, the length of the rufous forehead patch was related to reproductive success; females with longer caps initiated breeding earlier in the season and produced more offspring than smaller-capped females.

Multiple factors were correlated with nestling sex. Extra-pair chicks tended to be sons more often than daughters, and yearling males (which possess female-like plumage) were more likely to sire sons than adult males in bright plumage. Adult females and yearling females in high body condition produced more sons than yearling females in poor condition. Sons were more likely to survive to nutritional independence than daughters when produced by adult females, but less likely when produced by yearling females. Sex allocation in this species may be maintained by differing production costs for each sex, and genetic benefits to females of producing sons when fertilised by males of high genetic quality.

ii This is to certify that

(i) the thesis comprises only my original work except where indicated in the preface, (ii) due acknowledgement has been made in the text to all other material used, (iii) the thesis is less than 100,000 words in length, exclusive of tables, maps, bibliographies and appendices.

Damian K. Dowling May 2004

iii

Preface

The research reported in this thesis was conducted with approval from the Faculty of Science Animal Experimentation Ethics Sub-committee at the University of Melbourne (reg. No. 99127) under Department of Natural Resources and Environment (now Department of Sustainability and Environment) permit numbers 10001446 and 10001853 and Australian Bird and Bat Banding Scheme authority number 2432. Some fieldwork was conducted with the assistance of volunteers, working under my supervision. In particular, these assistants contributed to the collection of plumage colour measurements (reflectance spectrophotometry) in which accurate data collection required two people (Chapter 5). They also assisted with bird capture and measurement by helping set-up mist-nets and recording data, and assisted with nestling measurement by helping set-up climbing equipment and recording data (Chapters 2, 3, 5, 6). Assistants also scanned areas outside the immediate study site for colour-banded juveniles that had dispersed from their natal territories (Chapter 3) and searched for nests outside of my study site (as part of an experiment not included in this thesis). All field assistants are mentioned in the acknowledgements section.

This thesis is a series of five papers (Chapters 2-6), preceded by a chapter of aims (Chapter 1) and conclusions (Chapter 7). This approach has led to some repetition in the methods sections. Chapter 2 is published in Australian Journal of Zoology (2003) 51, 533-549. Chapter 3 is published in Emu (2003) 103, 199-205, co-authored by Mark Antos and Tobias Sahlman. Mark conducted the population abundance transects and produced figure 3 and located the colour-banded robin in Gunbower State Forest. Tobias helped locate juveniles following natal dispersal in areas surrounding the study site. Chapter 4 is published in Molecular Ecology Notes (2003) 3, 517-519, co-authored by Greg Adcock and Raoul Mulder. Greg taught me the molecular techniques required to develop microsatellite markers. I conducted the lab work and analysis myself. In addition to Chapter 4, Raoul will co-author Chapters 5 and 6 when published. On these papers, Raoul provided detailed advice and feedback. I am the principal contributor to all chapters in this thesis, and the primary author on all publications arising from this thesis. iv

Acknowledgements

I am greatly indebted to Raoul Mulder for his fantastic supervision and input throughout this PhD. Since first meeting Raoul, he has been continually enthusiastic and accessible, always generous with support, assistance, drafting and advice; and a friend. Thanks for giving me this fulfilling opportunity to follow my interests in behavioural ecology.

I am very thankful to everyone that volunteered in assisting me at my field-site, who in doing so made the work much more manageable and enjoyable. In particular, thanks to Tobias, who came to Australia and devoted two months to fieldwork on the robins. Deborah, Sophie and Michelle provided invaluable assistance for a few weeks. Jessica, Nina and Thijs all provided invaluable assistance for shorter periods. I am very fortunate to have so many friends that were willing to come to my field-site to help me. I would like to thank Anne for her help. Wouter, Amy, Dave, Grainne, Robert and Tania all made fieldwork much more fun in the early days. Sorry for only providing you with the peanut butter sandwiches, but I thought you would all love them. I also thank Mark Antos. My field site doubled as one of his, and our sporadic, unplanned meetings sparked a collaboration.

I will always be indebted to Barry and Lois Schramm for their willingness to have me stay with them and their unending hospitality and kindness to both myself and my field assistants, during my stays in Mitiamo.

Thanks to Wouter for taking me through the basics in the molecular lab. I am very grateful to Greg for teaching me techniques required for microsatellite isolation and characterisation, and his assistance. I thank Iain for help in the lab and for helpful discussions.

There are many people within the Zoology Department that I am grateful to. Mark Elgar gave me much valuable advice and assistance over these years. I thank Michael Magrath

for reading drafts of my manuscripts, many helpful discussions and statistical advice. Thanks to David Morgan, Ken Kraaijeveld and Ellen van Wilgenburg for reading drafts of chapters and for helpful discussions. Thanks to Mick Keough, Steve Swearer and Therésa Jones for discussions regarding statistical analysis. I thank David Paul for advice with preparing posters for conferences, and for help in preparing figure 1, Chapter 3. Thanks to Marilyn Renfree and David Macmillan, who as Heads of the Department, and to Mick Keough and Mary Familari, who as post-graduate coordinators, saw to all of my immediate requirements. I am very thankful to the department for awarding me the funds that enabled me to complete the project, and for the Drummond Awards that enabled me to attend ISBE 2002 (thanks!) and to visit Staffan Andersson and his lab group in Göteborg, Sweden. I am very grateful to Josie, Sharon, Terry, Peter, Diana and Barb for their fantastic administrative help that made my life a lot easier, to Viv and Jo for help with organising field equipment and Bruce Abaloz for advice regarding avian haematology. I thank everybody in our ‘evolutionary ecology’ lab group for providing a great weekly forum to discuss current research and ideas.

I am very grateful to Graham Hepworth from the Statistics Consulting Unit, at the University of Melbourne, for many hours of advice regarding generalised linear modelling and mixed modelling.

I sincerely thank the Holsworth Wildlife Research Fund and Birds Australia, who through the Stuart Leslie Bird Research Award and VicGroup Research Grant, generously funded my research.

I thank Staffan Andersson and Anette Johansson for analysing the red-capped robin feather samples for carotenoid content, and Staffan for hosting me in Göteborg and for fantastic feedback and advice on the project. Sincere thanks to Jacob Höglund, as well as other members of Population Biology at Uppsala University, for their kind hospitality during my visits to Uppsala.

vi I am very grateful to all of my close friends for so many great times over the past four years; including Amy, Dave, Grainne, Wouter, Anne, Mark P., Ellen, Emile, Joel, Elisa, Fem, Ken, Matt B., Kath M., Mark G., Tania, Robert, Tobias, Patrick-Jean, Coralie, Deborah, Julie, Megan and Michael. I hope that our close bond remains wherever we end up.

My family has offered me endless love and support. My mum, Georgia, has played an important part in this PhD by constantly helping with everything, preparations for field trips, ensuring that I am always welcome, making sure I am well-fed, and proof reading this thesis. Mémé (Becky) has offered endless love, support and perspective as have Mark, Simon, Amanda and Dinushka. Pépé (Dimitri), unfortunately did not live to see me complete my PhD, but he taught me the values that I aspire to. Thanks also to dad, John.

Finally, I thank Magdalena. You are an inspiration. Thanks for the endless love and support, fantastic advice, discussions, reading drafts and encouragement. I am a very lucky person!

vii

viii Contents

Abstract i Declaration iii Preface iv Acknowledgements v

Chapter 1 Aims 1

Chapter 2 Breeding biology of the red-capped robin 5 Dowling (2003) Aust. J. Zool. 51, 533-549

Chapter 3 Dispersal and recruitment of juvenile red-capped robins 39 Dowling et al. (2003) Emu 103, 199-205

Chapter 4 Novel polymorphic microsatellite markers for paternity 59 analysis in the red-capped robin (Petroica goodenovii: Aves) Dowling et al. (2003) Mol. Ecol. Notes 3, 517-519

Chapter 5 Plumage ornaments, individual quality and reproductive 65 success in red-capped robins Unpublished manuscript

Chapter 6 Sex allocation in the red-capped robin 105 Unpublished manuscript

Chapter 7 General discussion and future directions 127

References 137 Appendices 161

Chapter 1

Aims

This thesis investigates the behavioural ecology and mating system of the red-capped robin, Petroica goodenovii (Petroicidae), a strikingly sexually dichromatic bird. Adult males are black and white, with scarlet forehead and breast patches, whereas females are predominantly buff-grey with rufous forehead caps. Sexual dichromatism is thought to result from sexual selection (reviewed in Andersson 1994) and, typically, it is associated with high variance in reproductive success between the sexes, with males usually having higher variance than females (reviewed in Andersson 1994). The red-capped robin is a socially monogamous species, and variance in reproductive success between the sexes under this mating system was traditionally expected to be similar, reducing the potential for sexual selection. However, recent studies have revealed that in socially monogamous species, males commonly supplement their reproductive success by mating with females other than their social partners (reviewed in Birkhead and Møller 1992). The resulting fertilisations are termed extra-pair fertilisations (EPFs). Furthermore, Owens and Hartley (1998) recently determined that the degree of sexual dichromatism correlates positively with the rate of extra-pair paternity.

The red plumage of male red-capped robins is carotenoid-based (S. Andersson, unpublished data). Birds cannot synthesise carotenoids de novo, so they must be acquired from the diet and carotenoid distributions vary with diet (Goodwin 1976, 1984). Recent studies provided evidence that red, carotenoid-based plumage can be both condition- dependent and sexually selected (Hill 1999, Wolfenbarger 1999, McGraw et al. 2001a, Pryke et al. 2001a, 2002). Such studies have focused mostly on granivorous species and it is unclear whether these findings can be generalised to insectivores. Furthermore, these studies did not include extra-pair paternity rates in their measure of reproductive success. Because extra-pair paternity is a key factor explaining the evolution and maintenance of sexual dichromatism, this appears to be an important omission.

Differential variance in reproductive success between the sexes also has bearing on sex allocation theory. Females are predicted to bias offspring sex ratios to maximise the reproductive value of their offspring. When male variance in reproductive success exceeds female variance, sons will gain greater fitness benefits from increased parental care during the dependent period than daughters (Trivers and Willard 1973), assuming that parental investment influences offspring quality and high quality juveniles become high quality adults. Thus, if mothers are capable of producing high quality offspring, they should produce sons because these individuals will have high relative fitness.

The two primary aims of this thesis were 1) to investigate the role of sexually dichromatic plumage on total (within- and extra-pair) reproductive success in the insectivorous red-capped robin and, 2) to determine whether there were biases in sex allocation in this species.

I first describe the breeding ecology and life-history of the red-capped robin, and compare these traits to those of the other petroicid robins (Chapter 2). In Chapter 3, I investigate patterns of natal dispersal and compare population abundances within the study site (Terrick Terrick National Park; dominated by white cypress-pine woodland) to those of nearby eucalypt woodlands to estimate habitat quality. Data from these chapters are necessary for interpretation of later chapters.

Objective measurement of reproductive success, using molecular tools, is important for studies attempting to determine whether ornaments, such as colourful plumage, are maintained through sexual selection. In Chapter 4, I describe the isolation and characterisation of seven novel, polymorphic DNA microsatellite markers from the red- capped robin. Combined with two more loci, gained from cross-amplification using primers for microsatellites in other species, a combined set of microsatellites were powerful enough to enable the unambiguous assignment of parentage in the red-capped robin.

2 Chapter 1 Aims

In Chapter 5, I use these markers to describe the genetic mating system of this species and examine the role of carotenoid-based plumage colouration in both sexes of the red- capped robin. The first aim is to determine whether red plumage patches in males were condition-dependent signals. I test two predictions: a) that males with higher reproductive success in one season moulted into more colourful plumage at the conclusion of that season to indicate their reproductive quality (the annual moult immediately follows the breeding season and plumage colour indicates condition at moult), and b) that males expressing the most colourful plumage were in highest body condition throughout the study. I then examine whether males and females paired on the basis of plumage or other morphological traits, and whether increased expression of carotenoid-based plumage patches resulted in increased reproductive success in both sexes.

In Chapter 6, I investigate sex allocation in red-capped robins. This species is a useful model with which to test sex allocation theory because it is sexually dichromatic, EPFs are common and, thus, male variance in reproductive success exceeds female variance. These characteristics suggest there may be potential differences in the costs and benefits of producing each sex under different conditions.

I conclude the thesis by discussing the main results of my research and providing suggestions for future research (Chapter 7).

Chapter 2

Breeding biology of the red-capped robin Dowling (2003) Australian Journal of Zoology 51, 533-549

Abstract

The breeding biology of the red-capped robin, Petroica goodenovii (Petroicidae), was studied over two breeding seasons (2000-2002) in Terrick Terrick National Park, Victoria. Breeding commenced in August and the last offspring fledged in January. Only females developed brood patches, built nests and incubated. However, both sexes fed the young. Clutch size ranged from one to three eggs, with a mean of 2.1, with clutches of three occurring relatively early in the season. For clutches of two, the period from laying of the first egg to hatching ranged from 14 to 15 days, with a mean of 14.2. The time from hatching to fledging ranged from 13 to 15 days, with a mean of 14. Thirty-four percent of nesting attempts successfully fledged offspring. On average, 0.62 fledglings were produced per nesting attempt, whilst 0.57 offspring reached independence. Nesting success peaked in October. Predation appears to be responsible for almost all nest failure, and predation rate varied over the season. Breeding pairs produced between zero and three broods per season (zero to five independent fledglings) and pairs that began nesting early in the season produced a greater number of independent offspring. Nestling weight was affected by both laying date and brood size. A comparative analysis within the Petroicidae, controlled for body size, revealed that species endemic to Australia have shorter incubation periods, and species from semi-arid and dry woodlands have longer incubation periods than other species. Findings from this study are discussed in relation to the breeding ecology of other members of the Petroicidae.

Introduction

Studies of the breeding ecology and behaviour of birds provide essential information to both evolutionary biologists and conservation managers. For the evolutionary biologist,

the breeding characteristics of a species provide insights into the selection pressures that individuals of that species have faced over time. Additionally, as more data become available on the breeding ecology of previously unstudied species, it is possible to conduct more rigorous comparative tests to determine what factors are responsible for the differences in breeding parameters between species. For the conservation manager, realistic and effective modelling of risk management for a population requires that these breeding characteristics be accurately quantified.

Most research on the life-history of passerines has been conducted in the Northern Hemisphere, on species belonging to the Passerida (Rowley and Russell 1991). Less research has focussed on passerines that evolved and radiated within Australasia; the Menuroidea, Meliphagoidea and Corvoidea that were previously assumed to form the monophyletic ‘Corvida’ (Sibley and Ahlquist 1990), now regarded as paraphyletic (Barker et al. 2002, Ericson et al. 2003). In contrast to many birds of temperate regions in the Northern Hemisphere, Australian passerines (at least the sedentary and colonial species) are generally characterised by small clutches, long breeding seasons, multiple broods and extended parental care (Woinarski 1985, Rowley and Russell 1991, Russell 2000). It has been argued that these breeding characteristics are adaptations to aseasonal climatic conditions and year-round availability of food (Woinarski 1985, Rowley and Russell 1991), high rates of nest predation (Robinson 1990, Martin 1993), or reduced adult mortality (Martin et al. 2000). However, to make robust comparative tests of these hypotheses, further information is required on more Australian passerine species.

Recent studies have documented the detailed breeding biology of a growing number of Australo-Papuan robins (family Petroicidae). Of the 44 species in the family, 13 are Australian endemics, 19 are confined to New Guinea, seven occur in both Australia and New Guinea and a further three in New Zealand or its surrounding islands. Research has focused exclusively on species found within Australia and New Zealand. Of the six Australian species studied, nesting success has been reported to vary greatly. For instance, a study of the scarlet robin (Petroica multicolor) revealed that only eight percent of eggs laid produced fledglings (Robinson 1990), whereas in a study of the grey-

6 Chapter 2 Breeding biology

headed robin (Heteromyias albispecularis) 39% of eggs produced fledglings (Frith and Frith 2000). However, interpretation of variation in nesting success between species is difficult since substantial spatial variation can occur between different populations of the same species (Armstrong et al. 2000, Powlesland et al. 2000), as well as temporal variation within populations (Flack 1976, Powlesland 1983). There is little data allowing a comparison of variation in nesting success within species in Australian robins, although nesting success in the eastern yellow robin varies among populations (Marchant 1985, Zanette and Jenkins 2000). Intra-specific variation in nesting success also occurs in North Island robin (Petroica australis longipes) (Armstrong et al. 2000, Powlesland et al. 2000) and North Island tomtit (Petroica macrocephala toitoi) (Knegtmans and Powlesland 1999) populations in New Zealand exposed to differing levels of predation, and temporal variation has been observed in the South Island robin (Petroica australis australis) (Flack 1976, Powlesland 1983). In addition to being affected by differences in predation rates, nesting success may also vary according to differences in microclimate and parasite densities (Eeva et al. 1994).

The red-capped robin (Petroica goodenovii, Petroicidae) is one of five Australian ‘red robins’ (genus Petroica). Of these, the breeding biology of the scarlet and flame robin has been the focus of intensive research (Robinson 1990). There has also been a previous study on the breeding behaviour of the red-capped robin in the Southern Tablelands of New South Wales (Coventry 1988). Although informative, the breeding parameters described in that study may not be typical of red-capped robins for two reasons; firstly, the species does not normally occur in the area where the research was conducted, and secondly the study involved observations from only three pairs (Coventry 1988). Here, I describe the breeding biology of a sedentary population of red-capped robins in Terrick Terrick National Park in the northern plains of Victoria. Furthermore, I conduct a comparative analysis of three life-history traits within the Petroicidae and compare the breeding characteristics of the red-capped robin with other species of this family.

Methods

Study area and species

The study was conducted at Terrick Terrick National Park (36º 10’ S, 144º 13’ E), located 45 km west of Echuca, Victoria. The woodland section of the park is approximately 2500 ha and consists of dry open woodland dominated by white cypress- pine (Callitris glaucophylla) and grey box (Eucalyptus microcarpa). Annual rainfall in the area is approximately 400 mm (LCC 1983). Areas of the park that are dominated by white cypress-pine woodlands appear to be saturated with red-capped robin breeding territories (Dowling et al. 2003a, Chapter 3).

The red-capped robin is a territorial, socially monogamous passerine. It is sexually dichromatic, with yearling (in their first year) males moulting into adult plumage at the end of their first year. Yearling males also establish territories and yearlings of both sexes can breed successfully (Dowling et al. 2003a, Chapter 3, 5, 6).

Bird capture, measurement and observations

I monitored the nesting success and breeding behaviour of 50 breeding pairs of robins during the 2000/01 breeding season and 60 pairs during the 2001/02 season. Birds (n=158) were caught in mist-nets and banded with a numbered metal band provided by the Australian Bird and Bat Banding Scheme and a unique combination of colour rings to permit individual identification. The lengths of the right tarsus, the right wing (maximum chord: flattened, straightened wing) and the distance from the back of the head to the tip of the bill (head-bill length) were measured with callipers to 0.01 mm. The weight of each bird was measured to 0.1 g.

The breeding activity of birds in each territory was determined by following territorial females continuously for 20 min. This observation period was long enough to determine whether birds had begun nesting. Each territory was checked at least every three days to

8 Chapter 2 Breeding biology

determine locations of colour-banded individuals, presence of nesting activity and stage of nesting. Once found, nests were checked every three days to determine their fate. The length, width (to 0.01 mm) and weight (to 0.1 g) of a small sample of eggs (n=14) were measured usually within the first three days of laying, and the remainder of eggs left undisturbed. A small number of nests (n=8 in 2000/01, n=9 in 2001/02) was inaccessible due to their position in the tree. At all other nests, each nestling was weighed once (anytime between three and fourteen days) to 0.1 g. Age was recorded, or calculated if unknown by comparing body traits such as body size, size of tarsi, presence of wing feather shafts, degree of body down and whether the eyes had opened with the data for the same traits in nestlings of known hatching date. Nestlings (n=240) were banded with a metal band and a unique combination of three colour-bands usually when they were around six to eight days old.

The sex of each member of a breeding pair was determined by examining reliable plumage and behavioural differences between the birds. Adult males are black and white with red forehead and breast patches, whereas females are buff-grey. The sexes also differ behaviourally. Only females build nests, incubate eggs and brood offspring. When breeding pairs contained yearling males (in female-like plumage), the sex of each bird was later confirmed using a molecular technique described in Griffiths et al. (1998) and Chapter 6.

Every time a territory was visited, the location of each bird within the territory was recorded. Throughout the breeding season, the boundaries of each territory were mapped. Territory boundaries were defined for each breeding pair in each breeding season, using movements of birds within territories, and locations and results of territory disputes between territory neighbours. A simple index of territory size was calculated by multiplying the length of a territory at its longest margin by the width at its perpendicular margin.

Comparative analysis within the Petroicidae

I compiled breeding data for the Petroicidae, from the primary literature cited in Table 5, and texts on Australian (Boles 1988), New Guinean (Rand and Gilliard 1967, Peckover and Filewood 1976, Coates 1990) and New Zealand (Falla et al. 1981, Moon 1992, Heather and Robertson 1996) birds (raw data presented in Appendix 1, p. 160). There are few data available on the breeding biology of species endemic to New Guinea. Data presented for species common to both Australia and New Guinea are collected from Australian populations. I compiled data on body size (mm), clutch size (number of eggs), egg volume (mm3) [egg volume index = π/6 × egg length × egg width2, Hoyt (1979)] and length of incubation (days). Data sources that described how the incubation period was measured, defined it as the period from laying of the last egg to hatching of the last egg. It was assumed that other data sources that gave values of incubation period used this same definition. The North Island (P. australis longipes) and South Island robin (P. australis australis) subspecies, and the North Island (P. macrocephala toitoi) and South Island tomtit (P. macrocephala macrocephala) subspecies, were treated as separate species for the statistical analysis because detailed breeding biology data were available for both, and they differ in clutch size, egg volume and duration of incubation. I tested two hypotheses: (1) species from different geographic regions have different breeding parameter values, and (2) species from different habitat types have different values. To test these hypotheses, I calculated the residuals from three separate linear regressions of clutch size, egg volume and incubation length on body size. The residuals of these regressions indicate measures of relative clutch size, relative egg volume and relative incubation length, controlled for size differences between species. To control for size differences, I used body size (traditionally measured as the distance from the tip of the bill to the end of the tail, mm) rather than mass (g) because more data were available for size and there is a strong linear relationship between the two measures (r2=0.90, n=20, p<0.001). Data were available for 24 species in the analysis of clutch sizes and egg volumes, but for only 17 species in the analysis of incubation.

10 Chapter 2 Breeding biology

Multiple regression was used to test the relationship between the above three dependent variables versus geographical region and habitat preference. Geographical range was divided into three broad categories: (1) Australian endemics, (2) species found both in Australia and New Guinea, and (3) New Zealand and surrounding island endemics. Habitat was divided into four categories: (1) semi arid and dry open woodland, (2) Eucalyptus spp. forest, woodland, (3) wet sclerophyll forest and coastal forest, and (4) rainforest.

I did not control for phylogeny in these analyses because these data are lacking within the Petroicidae.

Analysis of nesting success

I defined a nesting attempt as any nest that was built regardless of whether eggs were eventually laid in it.

I calculated total nesting success in two ways. First, I included all nests that were found regardless of whether they were found during nest-building or incubation (n=277). This estimate of nesting success may be biased if some nests failed during nest-building before I located them. Second, to account for this potential bias, I re-estimated population nesting success only using nests that were located prior to egg laying (n=174). All other calculations of nesting success (eg. mean nesting success of breeding pairs) are estimated from the total sample of nests (n=277).

Although I calculated the percentage of nest failures that occurred during pre-laying, incubation, and nestling provisioning, it is probable that some nests classified as pre- laying had commenced incubation at the time of failure (and to a lesser degree some nests classified as containing eggs, may have contained nestlings) considering nests were usually checked only once every three days.

Statistical analyses

Parametric tests were used to analyse the data after dependent variables were checked for normality. All tests are two-tailed, with a significance criterion of p<0.05. When testing the date of first nesting for breeding females versus number of fledglings produced per season, I used data from only one randomly chosen breeding season for females that were present in both seasons, to ensure statistical independence.

I tested whether nestling weight was related to date or brood size. These data are presented in two ways. First, nestling weights and ages are averaged for each nest to control for within brood effects. Mean nestling weight per nest was controlled for mean age at weighing by taking the residuals from the logarithmic regression of weight on age (relative nestling weight). Also, to control for perceived pseudoreplication caused by multiple nesting attempts by the same female being included in the analysis, I reanalysed these data, taking only one randomly selected nesting attempt for each female. I emphasise the first analysis, in which the individual nest is the unit of statistical analysis because I was interested in testing the effects of relative nestling weight on date, and this factor is specific to individual nesting attempts, not individual females.

In other tests in which an overall measure for the population was important, I included more than one nest per female per season.

Results

Territory sizes

Territory sizes ranged from 0.4 to 3 ha, with a mean of 1.22 ha (s.e =0.08, n=49) in 2000/01 and 1.19 ha (s.e.=0.07, n=58) in 2001/02.

12 Chapter 2 Breeding biology

Morphometric differences between sexes

There was a tendency for males to have longer tarsi than females (F1,155=2.95, p=0.09, Table 1), but no effect of age or interaction between sex and age (yearling or adult) on tarsus length. When age was removed from the model, males had significantly longer tarsi than females (t= -2.09, n=159, p=0.04). Males had longer wings than females

(F1,155=25.19, p<0.001) and adults (individuals older than 1 year) had longer wings than

yearlings (F1,155=31.14, p<0.001, sex*age interaction: ns). Males also had longer head-

bill lengths than females (F1,155=5.42, p=0.02), but there was no effect of age or interaction between sex and age on head-bill length (Table 1). Females that had commenced nesting activities possessed brood patches whereas males did not.

The body mass of individuals did not change throughout the season (r2=0.01, n=159, p=0.37), but did vary with time of day (r2=0.09, n=159, p<0.01), increasing slightly throughout the day. Combining sex and age classes, mean body mass was 8.85 g after removing outliers (n=155, s.e.=0.04). After controlling for time of day, females tended to be heavier than males and adults heavier than yearlings (sex: F1,150=2.87, p=0.09, age:

F1,150=3.08, p = 0.08, time: F1,150=17.28, p<0.01), with no interaction between sex and age.

Breeding season

Red-capped robins bred for five months each year (Table 2). First eggs of each season were laid on August 11, 2000 and August 21, 2001 and the last nestlings fledged on January 18, 2001 and January 8, 2002 respectively. Birds were multi-brooded, with new nests initiated from August to December.

Nest sites

All nests were built in forks of white cypress-pine (n=277). The average diameter of the nest cup was 42.4 mm (s.e.=0.52 mm, n=7). Average height above the ground of nests was 6 m (s.e.=0.13 m, n=277, range: 1.5 – 15.5 m). Ninety-one percent of nests were built in forks with either two or three supporting branches (mean number of branches= 2.67, s.e=0.04, n=267). Nests were often built on the main trunk (29%), and only rarely (4%) further than two metres from the trunk (mean distance from trunk=0.82 m, s.e.=0.05, n=266). The largest supporting branch had a variable diameter, ranging from 1.6 cm to as large as 35 cm when the nest was on the main trunk (mean=7.18 cm, s.e.=0.36, n=241). The average diameter of all supporting branches ranged from one centimetre to 16.5 cm (mean= 4.23 cm, s.e.=0.19, n=231). New nests were always built in a different tree to the previous nest.

Nesting cycle

Both sexes of a breeding pair participated in nest site selection. As observed in aviary- housed red-capped robins (Hutton 1991), the male initiated a nesting attempt by perching and rubbing his body in a forked branch and performing a continuous and distinctive trill until the female flew to the fork and examined it. Males may perform this display at a number of sites, but females appear to make the ultimate nest site decision because only female robins built nests and incubated eggs. Male robins fed females during nest- building and incubation of the eggs. The male robin with food sang a quiet, abbreviated song to which the incubating female responded by flying off the nest and perching next to the male, whereupon he passed the food to the female. Occasionally, the female was fed on the nest. Once eggs hatched, only females brooded the nestlings, but both sexes fed nestlings. Males arriving near the nest sang the same distinctive and soft, abbreviated song and females flew off the nests so that the male could feed the nestlings. Later in the nesting cycle, females also sporadically produced this call when they had food for the fledglings. Occasionally, male robins passed food to brooding females on the nest, who then passed the food items on to the nestlings.

14 Chapter 2 Breeding biology

Average egg dimensions were 16.00 mm (s.e.=0.15, n=14) × 12.71 mm (s.e.=0.08, n=14) and mean egg weight was 1.26 g (s.e.=0.03, n=13). Average clutch size was 2.1 eggs (n=104, s.e.=0.04) and ranged from one to three eggs, with 85.6% of clutches composed of two eggs and 12.5% of three eggs. Clutch size varied with month (F4,94=6.8, p<0.001, Fig. 1). All clutches of three eggs were laid in September with the exception of one clutch that was laid in October. There was no effect of breeding season (2000/01, 2001/02) or interaction between season and month on clutch size.

Eggs were laid on consecutive days. For clutches of two, the interval between laying of the first egg and hatching was 14 to 15 days (mean=14.2, s.e.=0.13, n=9). Hatching appears to be synchronous (n=5). Thus, the mean incubation period was 13.2 days. Nestlings fledged 13 to 15 days after hatching (mean=14 days, s.e.=0.11, n=20) and nestling growth followed a characteristic logarithmic function, described by the function weight=2.18(age)0.61, (n=235, r2=0.728).

After fledging of the young, parents fed offspring for at least three weeks. Each parent tended to feed one fledgling initially (for broods of two). However, females often began re-nesting two to three weeks after their offspring fledged, and males would then feed both fledglings. Parents usually stopped provisioning and began to chase begging fledglings about three to four weeks after fledging (although they appeared to be more tolerant of their juveniles remaining on their territories late in the breeding season when nesting activity had stopped). When re-nesting, parents always evicted juveniles from the territory. I observed no cases of cooperative breeding (additional birds helping the breeding pair to provision nestlings).

Although several pairs managed to successfully raise three broods in a season, the most common number of broods produced per pair was one (Table 3).

Nesting success

Thirty-four percent of all nests found (n=277) were successful (i.e. resulting in at least one fledgling reaching nutritional independence, 37.0% in 2000/01, 31.7% in 2001/02). Twenty-eight percent of nests first located during nest-building (n=174) were successful (31.6% in 2000/01, 24.5% in 2001/02). Thirty-three percent of eggs laid (n=474) resulted in independent fledglings (Table 4). On average, each pair made 2.56 nesting attempts per season (range=1-7), of which 0.88 nests per pair (range=0-3) were successful. On average, each pair produced 1.6 fledglings (range=0-5) and 1.45 (range=0-5) independent young per season (Table 4). In total, 0.62 fledglings were produced per nesting attempt (0.70 in 2000/01, 0.56 in 2001/02), and only 0.57 fledglings per attempt reached independence (0.60 in 2000/01, 0.54 in 2001/02).

Females that initiated their first nesting attempt earlier in the season produced more nests per season (r2=0.29, n=66, p<0.001), as well as a greater number of nests that successfully fledged offspring (r2=0.19, n=67, p<0.001), and produced a greater number of fledglings that reached independence (r2=0.15, n=67, p<0.01, Fig. 2).

The proportion of successful nests, producing at least one fledgling reaching independence, was lowest at the start of each season (August), peaked in October and declined again towards the end of the season (month: F4,269=3.05, p<0.05, season: ns, season*month: ns, Fig. 3).

Predation accounted for most nest failures. In three nests the eggs were abandoned, in another two nests the eggs were unfertilised, and in two nests the nestlings were found dead in the nest. In all other cases, nest contents were missing and the nest was usually either damaged or totally destroyed, indicating predation as the likely cause of nest failure. The estimated predation rate across both seasons was 65% (season 1: 61%,

season 2: 69%). Nest predation rate varied according to month (F4,269=3.483, p<0.01, Fig. 4), but there was no effect of season or interaction between month and season.

16 Chapter 2 Breeding biology

The majority of nest failures occurred pre-hatching (χ2=19, df=2, p<0.01), either pre- laying (22%) or during incubation (47.8%). Nests failed during nestling provisioning in 30.2% of cases.

Nestling weight

I calculated relative nestling weights by averaging weights and ages of nestlings from the same nest and then calculating the residuals of a logarithmic regression (function y = 2.293x0.581 r2=0.734, n=114) of nestling weight (y) on age (x). Nestlings that are heavier than expected for their age have positive residuals while those that are lighter than expected have negative residuals. The relative weight of nestlings increased throughout the season (r2=0.115, n=114, date: p<0.001, Fig. 5), and was not related to time of day (p=0.944). Controlling for date, relative nestling weight decreased with brood size

(ANCOVA: Brood size: F2,111=5.273, p<0.01; Date: F1,111=11.296 p<0.01, Fig. 6). If perceived pseudoreplication, caused by multiple nesting attempts by the same female being included in the analysis, is removed by taking only one randomly selected nesting attempt for each female, the direction of these trends remains (function: y=2.280x0.576, r2=0.729, n=74; relative nestling weight vs date and time: r2=0.044, n=74, date p<0.05,

time p=0.769; nestling weight vs brood size controlled for date: brood size F2,70=2.218, p=0.117, date F1,70=3.245, p=0.076).

Courtship behaviour

Hutton (1991) described characteristic circular flights that males kept in aviaries made around a perched female during courtship. I observed the same behaviour in the wild population I studied.

Pair fidelity, dispersal and survival

Pair-bonds were not always maintained within and between breeding seasons. At least nine new breeding pairs were formed during the 2000/01 breeding season and four new

pairs during the 2001/02 season containing birds that had been paired with other individuals earlier in the season. Most commonly, females abandoned a territory and paired with a nearby male (n = 6). On two occasions males switched territories, pairing with a new female. There were four cases of sequential polyandry, where females abandoned their male partners while fledglings were still being provisioned and paired with a new male, leaving their previous partner to rear the fledglings. I was unable to determine exactly how quickly the females swapped territories/males after fledging their initial young. In one instance, I observed a female with her new partner approximately 14 days after fledging offspring in her initial territory, and the other females were observed with their new partners between 18 and 24 days of fledging offspring in their previous territories. It is unclear whether these females that switched to new territories/males evicted the social females already occupying those territories or moved into territories that were already vacated by the previous female occupant.

Many individuals were sedentary, with males apparently defending territories year-round (males defended territories while I was at the study site from May – February, and probably remained in these territories during March and April). At the beginning of the 2001/02 breeding season, 30 of 48 (62.5%) banded males that had held territories during the previous season remained within the study area compared to 13 of 42 (31%) females. Only six breeding pairs (of 42 identifiable pairs) from the 2000/01 season remained together in the study area during the subsequent 2001/02 season. Retention rates for birds of each sex within the study area at the start of 2002/03 season were similar to each other: males 27 of 60 (45%), females 18 of 43 (41.9%). Five breeding pairs (of 43) from the 2001/02 season remained together during the 2002/03 season. Ten males and three females that were present as adults (at least one year old) in October 2000 were still in the study area in October 2002, indicating that longevity can be at least three years.

Territorial behaviour

One adult male was actively forced off his territory permanently by an intruding adult male during September 2000. The territory dispute resulted in both males fighting,

18 Chapter 2 Breeding biology

grappling with each other on the ground. The intruding male won the territory. In most cases, I was unable to conclude whether birds that disappeared from the study site had died or dispersed. However, it is likely that birds that disappear occasionally disperse elsewhere because I found three adult females that had been present at the site in 2000/01 returned briefly to occupy territory vacancies in 2001/02, before disappearing again. Additionally, an adult female that was paired with a yearling male in 2000, dispersed and paired with an adult male three territories away from its own when the female paired with that male died. Since the female had to move over two territories to reach her new male, this suggests that females probably leave their territories to actively search for other ‘better’ vacancies.

Male robins displayed distinctive escalation behaviour during territorial disputes. Males seeking to establish territory boundaries, create a new territory or seek a female partner would incessantly sing a distinctive, ‘insect-like’ territory song. Sometimes a disputed boundary resulted in two males perching close together on a horizontal branch. Constantly staring at each other, they performed a ‘stand off’ on the perch, with one male advancing a short distance (up to 40 cm), while the other male retreated a similar distance. Both males moved back and forth on the perch for some time, before one flew off. The retreating bird performed a ‘submission’ flight, whereby he flew in a direct line to a nearby tree within his own, undisputed territory. This flight was characterised by fast movement of the wings but low speed, so it seemed the bird was almost hovering. Ultimately, an unresolved territorial dispute results in a chase and physical confrontation.

Nest defence

Both sexes display the same distraction display behaviour described in other petroicid robins (Marchant 1985, Sullivan 1993, Frith and Frith 2000, Fitri and Ford 2003) when their brood or young fledglings are threatened. Birds made distinctive alarm calls when the nest was approached, and often either parent flew towards the nest, spread its wings aloft and hopped around before fluttering to the ground below. On the ground, the bird continued to hold its wings up as it hopped about.

Horsefield’s bronze cuckoos (Chrysococcyx basalis) were present at the study site from August 15th to August 28th 2000 and August 14th to August 21st 2001. Male robins reacted aggressively to the presence of these cuckoos by chasing them out of their territories on long, direct flights while making a distinctive shrill call, and mobbing and attacking persistent cuckoos. I did not find any parasitised robin nests.

Comparative analysis within the Petroicidae

Within the Petroicidae, clutch size was negatively related to body size (r2=0.206, n=24, p<0.05, Fig. 7a), egg volume was positively related to body size (r2=0.761, n=24, p<0.001, Fig. 7b) as was length of incubation (r2=0.334, n=17, p<0.05, Fig. 7c).

Controlling for body size, petroicid species endemic to Australia had shorter incubation periods than those found in other geographical regions. Species found in semi-arid and dry woodlands had longer incubation periods than those living in other habitats (r2=0.813, n=17, region: p<0.001, habitat: p<0.01, Fig. 8). Neither relative clutch size nor relative egg volume was related to the geographical region or habitat preference of each species.

Discussion

The red-capped robin has breeding traits characteristic of many other Australian passerines. These include small clutches, long breeding seasons, multiple broods, potentially high adult survival (Woinarski 1985, Rowley and Russell 1991) and extended parental care (Rowley and Russell 1991, Russell 2000) relative to members of the Passerida. This slow reproductive rate spread over a long breeding season and multiple breeding seasons is suggested to be an adaptation to a stable, favourable climate (Woinarski 1985, Rowley and Russell 1991) and a strategy in response to high predation rates (Robinson 1990, Martin 1993).

20 Chapter 2 Breeding biology

Life-history comparisons among the Petroicidae

Body size

Similar to allometric relationships reported by Yom-Tov (1987) and Trevelyan and Read (1989), body size was negatively related to clutch size and positively related to incubation length and egg volume in the Petroicidae.

Possible influence of nest predation and food abundance on incubation period

Predation is potentially an important selective pressure on growth rates in altricial birds. Species exposed to greater predation should have shorter incubation periods in the nest (Skutch 1976). Recently, growth rates of nestling birds have been shown to vary with nest predation pressure (Bosque and Bosque 1995, Martin 1995). Controlling for differences in body mass, Bosque and Bosque (1995) determined that open-nesting species native to islands that lack native mammalian and reptilian predators have longer incubation and nestling periods than related species from continental areas that contain predators.

Although sample sizes within each group were small, I found that petroicid species that are endemic to Australia had shorter incubation periods than those of other regions, and also that species found in semi-arid and dry woodlands had longer incubation periods than those living in other habitats. Nest predation rates appear to be high in both the Australian (Robinson 1990, Zanette and Jenkins 2000, this study) and New Zealand (King 1984, Powlesland et al. 2000) Petroicidae. However, high rates of nest predation in New Zealand are attributable to recently introduced mammals (King 1984, Powlesland et al. 2000), and are thus a recent selection pressure for New Zealand species. In contrast, Australian Petroicidae have evolved in the presence of many native nest predators (Trevelyan and Read 1989) and may have responded by evolving shorter incubation periods. Further research is required to test whether this trend occurs in other bird families that have species distributed in Australia and New Zealand. However, a previous

analysis of reproductive strategies between terrestrial Australian and New Zealand birds found no differences in incubation period between the two geographical regions (Trevelyan and Read 1989).

It is difficult to explain why petroicid species from semi-arid and dry woodlands appear to have longer incubation periods than species from other habitats. There are no data available on differences in predation pressures across habitat types. An alternative explanation is that differences in food abundance may possibly be related to differences in incubation periods (Bosque and Bosque 1995) between geographical regions and habitat types. Woinarski (1985) hypothesised that the life-histories of Australian land and freshwater birds have evolved in response to a stable, year-round food supply and suggested this factor is responsible for the differences in life-histories of Australian birds to those of the Northern Hemisphere. If food is more scarce in semi-arid and dry habitats, females may spend more time searching for food rather than incubating their clutch, and thus incubation periods may be longer.

Nesting success

Nesting success varies markedly among the Petroicidae (Table 5). However, it is difficult to compare differences in nesting success between species because there is often spatial (Armstrong et al. 2000, Powlesland et al. 2000) and temporal variation (Powlesland 1983, Flack 1976) within species. Within the Petroicidae, much of this variation may be explained by differing predator exposure (Table 5). Nest predation has a large impact on the nesting success of the North Island robin. When mammalian predators were controlled before the onset of the breeding season, nesting success was much higher than when there was no predator control (Powlesland et al. 2000). Nesting success was also relatively high in a separate population free from exotic mammalian predators (Armstrong et al. 2000). Predator control similarly increased nesting success of the North Island tomtit (Knegtmans and Powlesland 1999).

22 Chapter 2 Breeding biology

It is unknown how much variation in nesting success occurs within species in Australian Petroicidae because there have rarely been multiple studies on the same species within Australia. Nesting success of eastern yellow robins differed in two separate studies of different populations (Marchant 1985, Zanette and Jenkins 2000). A previous study of the breeding biology of the red-capped robin reported higher nesting success than this study. However, a small sample size was used in that study (n=3 pairs, 11 nests), and it was conducted in an area where the species does not normally occur (Coventry 1988).

The red-capped robin has a wide distribution, inland of the Great Dividing Range, in dry woodlands of Australia. Its range extends from central Victoria to central Queensland, and from the east to west coasts of Australia and Rottnest Island (Blakers et al. 1984). Predator diversity and abundance, and food abundance, probably differs across this distribution and, thus, it is probable that nesting success will also differ.

Brood parasitism can have a large impact on nesting success (Johnsgard 1997), and thus act as a major selection pressure in the life-histories of many passerines. Cuckoo densities and brood parasitism rates probably differ across the Australia-wide distribution of red- capped robins, potentially influencing nesting success in some populations. Although red- capped robins are a biological host of Horsfield’s bronze cuckoos (Brooker and Brooker 1989), I did not find any parasitised robin nests and thus brood parasitism apparently has no effect on nesting success of robins in this population. However, the cuckoos were only present at Terrick Terrick National Park for a short period (one to two weeks) at the onset of each breeding season. Horsfield’s bronze cuckoo is migrant in the southern half of Australia and the cuckoos were probably moving south to find better quality feeding habitat and/or better host habitat. Throughout Australia, the local malurid species (in Victoria, the superb fairy wren, Malurus cyaneus) is the major host of this cuckoo (Brooker and Brooker 1989). The superb fairy wren is in low abundance within the cypress-pine forests of Terrick Terrick National Park (pers. obs.) and the cuckoos were possibly migrating south to look for more suitable populations of wrens.

Weight of nestlings

Nestlings were relatively heavier in December and January than those produced in previous months, and nestlings from larger broods were lighter. There are several possible explanations for this pattern between nestling weight and time of year. It is possibly related to food abundance over the season. Food resources fluctuate throughout the breeding season of Australian birds (Recher et al. 1983, Woinarski and Cullen 1984, Bell 1985), although these fluctuations are generally less pronounced than those experienced by Northern Hemisphere species where there is a shorter peak in food resources (Lack 1954, Woinarski 1985). Alternatively, parents may invest more resources in nestlings later in the season because it is their last opportunity to produce fledglings for the season. Furthermore, summer months may allow breeding females more time to forage and feed nestlings because nestlings may not need as much brooding during warmer temperatures and there are more daylight hours to forage during summer. Warmer temperatures may also lower the metabolic expense of thermoregulation for nestlings, resulting in greater weight gain.

Although nestling weight varied with brood size and date, starvation of nestlings appeared to be rare (n=2 broods). Instead, predation was the major determinant of nesting success. Although predation appears to be the primary cause of nest failure at the study site, I was not able to identify the predators responsible. Potential predators include other passerines such as ravens, non-passerines such as raptors and owls, as well as monitors (Varanus spp.) and native and introduced mammals.

Absence of cooperative breeding

Cooperatively breeding in birds is characterised by the presence of more than two individuals (the breeding pair) rearing a single brood (Skutch 1961). Two prominent sets of models that address why the young of some species delay dispersal to assist their parents rear subsequent offspring are: the ‘ecological constraints’ and ‘benefits of philopatry’ models. ‘Ecological constraints’ models argue that cooperative breeding

24 Chapter 2 Breeding biology

occurs when young are unable to disperse due to a shortage of territories or mates (habitat saturation) (eg. Emlen 1982), whereas ‘benefits of philopatry’ models argue that such helping occurs when the fitness benefits young receive from remaining in their natal territories make delaying dispersal a better option than dispersing (eg. Stacey and Ligon 1987, 1991). Despite robust models, supported by empirical research on separate cooperatively breeding species (Koenig et al. 1992), it has not proved possible to predict when species will evolve delayed dispersal and cooperative breeding rather than alternative solutions to ecological constraints, such as ‘floating’ (Koenig et al. 1992, Cockburn 2003).

Five of the 44 Petroicidae (11%) have been noted to breed cooperatively (Brown 1987, Arnold and Owens 1998, Male 2000). The absence of cooperative breeding in red-capped robins is perhaps due to a combination of three factors. 1) Although cypress-pine woodland within Terrick Terrick National Park appears to be saturated with red-capped robin territories at any given time (Dowling et al. 2003, Chapter 3), dispersing juveniles may nevertheless have reasonable prospects of establishing their own territories within this woodland and reproducing as yearlings. Short-distance recruitment of juveniles dispersing from their natal territories into the study area and adjacent areas was 11.9% in 2000-2001 and 6.4% in 2001-2002. It is likely that additional juveniles recruited into areas further from their natal territories within Terrick Terrick National Park (outside of the study area), and hence went undetected. Furthermore, at least one juvenile dispersed 36 km over open, agricultural landscape to establish a territory within a separate woodland (Dowling et al. 2003, Chapter 3). 2) There is very low variation in clutch size in this species (clutches usually 2 or 3 eggs), and thus helpers are unlikely to increase the number of nestlings raised per nest. 3) The major cause of nest failure in this population is predation, not nestling starvation, and thus whether or not a nest is successful is probably largely stochastic. With high rates of nest predation, the presence of additional birds helping to provision young at the nest may increase the visibility of the nest to predators, resulting in decreased nesting success.

Turnover of breeding birds within the population

There is some evidence of a higher turnover of breeding females than males in the study population. At the beginning of the 2001/02 breeding season, there had been a greater rate of female dispersal and/or mortality than male dispersal/mortality for birds that had held territories during the previous season. This trend was less apparent during the following season.

Pair fidelity

The results of this study indicate that although the species is socially monogamous at any given time, long-term monogamous association between the sexes is uncommon. Furthermore, paternity analysis using DNA microsatellite markers (Dowling et al. 2003b, Chapter 4) has revealed high rates of extra-pair matings in this population (23% of all nestlings [n=227] are sired by extra-pair males, 37% of broods [n=113] contain extra-pair young, Chapter 5), whereby females mate with males other than their social partners.

Both Armstrong et al. (2000) and Powlesland et al. (2000) observed sequential polyandry in the North Island robin, where females paired and bred with a new male while their previous mates cared for the fledglings of the previous clutch. I observed this same behaviour on four separate occasions in the red-capped robin. Depending on whether a territory vacancy exists elsewhere, a female can abandon her previous partner to care for the fledglings of the previous clutch himself, and mate with a different male. It appears that males can successfully complete raising fledglings to independence themselves (in two cases both fledglings survived to independence, and in the other two cases one fledgling survived to independence). A female may potentially swap partners if she considers her new partner is of better individual ‘quality’. Additionally, females may possibly maximise their reproductive output through sequential polyandry if it allows them to produce more successful broods per season. This depends on whether it is more time efficient to move to a vacant territory/male after fledging the initial young or to re- nest in the same territory. Regardless of time efficiency, a female that moves to a vacant

26 Chapter 2 Breeding biology

territory, containing no fledglings, and re-mates with a new partner will potentially receive increased food provisioning during nesting because the new partner will not have the competing demands of provisioning both fledglings and her.

In contrast, it is possible for males to increase their reproductive output through extra-pair fertilisations, whereby they mate with females other than their social partners.

Conclusion

This study provides the first detailed account of the breeding biology of the red-capped robin. The results conform to those of other petroicid robins and more generally to other Australian passerines. Although multi-brooded, it has low annual productivity (on average fewer than two fledglings per pair in a year). The major cause of this low productivity in the red-capped robin, together with the other Petroicidae and many other Australian passerines, appears to be nest predation, indicating that nest predation is probably a major selective pressure in the life-history evolution of Australian passerines.

Table 1. Mean sizes (± standard errors) of body traits that differ between sexes or age classes Adults are individuals > 1 year, yearlings are individuals < 1 year. Females: n = 71, males: n = 104, adults: n = 137, yearlings: n = 39. Asterisks indicate probabilities (*, P < 0.05; ***, P < 0.001). Character Female mean size (s.e.) Male mean size (s.e.) Right tarsus 17.18 mm ± 0.07 17.36 mm ± 0.05* Right wing length 62.23 mm ± 0.20 63.84 mm ± 0.17*** Head-bill length 27.94 mm ± 0.07 28.19 mm ± 0.05* Adult mean size (s.e.) Yearling mean size (s.e.) Right wing length 63.55 mm ± 0.16*** 61.89 mm ± 0.23

Table 2. Numbers of new nests initiated in each month of the 2000/01, 2001/02 breeding seasons Month Nests 2000/01 Nests 2001/02 Total nests August 14 22 36 September 36 39 75 October 26 34 60 November 40 30 70 December 22 14 36 Total nests 138 139 277

Table 3. Number of successful broods produced per pair in both the 2000/01 and 2001/02 breeding seasons Broods produced 2000/01 2001/02 Combined seasons 0 19 15 34 1 20 35 55 2 12 5 17 3 2 0 2

28 Chapter 2 Breeding biology

Table 4. Nesting success of red-capped robins within the study population Total number of nests initiated, eggs, nestlings, fledglings and independent young produced within the study population over both breeding seasons (2000/01, 2001/02), and the mean per season for each pair. Values in parentheses indicate standard errors of the mean.

Nesting Eggs Nestlings Fledglings Independent attempts young Population 277 474 296 173 157 total Mean per pair 2.56 (0.14) 4.39 (0.25) 2.74 (0.17) 1.6 (0.13) 1.45 (0.12) (n=108)

Table 5. Summary of nesting success for the Petroicidae.

Species Total eggs % eggs Fledglings Fledglings % successful Reference producing (independent per nest nests - raising at fledglings young) per pair least one (independent fledgling young) Flame robin 189 22 1.2 - 25 Robinson (1990) Red-capped robin 13 54 1.2 0.88 63 Coventry (1988) Red-capped robin 474 36 (33) 1.6 (1.45) 0.57 34A (28B) This study Scarlet robin 115 8 0.39 - 10.3 Robinson (1990) Eastern yellow robinC 172 27 - 0.6 32 Marchant (1985) Eastern yellow robinD 67 45 - 1.1 30 Marchant (1985) Eastern yellow robin 267 nests - - - 19 Zanette and Jenkins (2000) Grey-headed robin - 39 - 0.7 53 Frith and Frith (2000) Hooded robin 46 20 0.7 0.39 22 Fitri and Ford (2003) Chatham Island robinE 418 39 (31) 1.4 (1.1) - - Butler and Merton (1992) North Island robinF - - 3.8, 1.5 - 75, 30 Powlesland et al. (2000) North Island robinG - - 0.4 - 11 Powlesland et al. (2000) North Island robinH - - 2.5 - 51 Armstrong et al. (2000) South Island robinI 405 26 2.5 [3J] - Powlesland (1983) North Island tomtit 45 - - 3.3 73.3 [45.4K, 6.9L] Knegtmans and Powlesland (1999) South Island tomtit - - - 4 31.3 Kearton (1979) in Knegtmans and Powlesland (1999) ASuccessful nests in my study are those that produce at least one fledgling reaching independence. BSuccessful nests only including nests found during nest building. CNo auxiliary helpers. DAuxiliary helpers. EThese statistics are for years 1989-1992 when management of population ceased. FMammalian predators at study site controlled prior to breeding season; italicised values indicate breeding success one year after predator control in population. GNo predator control prior to breeding season. HNo exotic mammalian predators at study site. IStudy from 1977-1979. JFlack (1976), study from 1971-1976 at same study site as used by Powlesland (1983). KNest Record Scheme cards of Ornithological Society of New Zealand (Knegtmans and Powlesland 1999). LBrown (1997).

30 Chapter 2 Breeding biology

n=38 2.5 n=3 n=15 n=31 n=17 2 1.5 1

Clutch size 0.5 0 Aug Sep Oct Nov Dec Month Fig. 1. Mean clutch size per month. Data are pooled from both breeding seasons. Bars indicate standard error, and sample size for each month is denoted above each column. Horizontal hashed line indicates modal clutch size.

0 2nd 22nd 11th 1st 21st 10th 30th Independent fledglings Aug Aug Sept Oct Oct Nov Nov Date

Fig. 2. The number of fledglings that were successfully raised to independence for each breeding female per year, and the date at which each female initiated her first nesting attempt of the season.

32 Chapter 2 Breeding biology

0.6 n=60 0.5 n=70 n=36 0.4 n=75 0.3 n=36 0.2 0.1

Successful nests 0 Aug Sep Oct Nov Dec

Month Fig. 3. Mean proportion of nests initiated in each month that subsequently fledged offspring that reached independence. Bars indicate standard error, and sample size for each month is denoted above each column.

n=36 1.00 n=75 n=36 0.80 n=60 n=70 0.60 0.40 0.20 0 Proportion predation Aug SepOct Nov Dec

Month Fig. 4. The proportion of nesting attempts initiated each month that succumbed to predation. Bars indicate standard error, and sample size for each month is denoted above each column.

34 Chapter 2 Breeding biology

1.2 n=18 n=31 n=30 n=33 n=3

0.8.

0.4

Relative nestling weight nestling Relative -0.4 Sept Oct Nov Dec Jan

Month Fig. 5. Mean relative nestling weight (mean weight per nest) for each month. Relative nestling weights are the residuals of the logarithmic regression of mean nestling weight per nest versus mean nestling age. Bars indicate standard error, and sample size for each month is denoted above each column.

1 n=6 n=100 n=9 0.5

-0.5

-1 123 -1.5 Relative nestling weight* Brood size Fig. 6. Mean relative nestling weight (mean weight per nest) for differing brood sizes. *In this figure, relative nestling weight is further controlled for date of weighing by taking the residuals of the linear regression of relative nestling weight versus date (r2 = 0.125, n = 115, p < 0.001). Bars indicate standard error, and sample size for each month is denoted above each column.

36 Chapter 2 Breeding biology

a. b.

4.5 6000 3.5 5000 4000 2.5 3000 1.5 2000 Egg volume Clutch size 1000 0.5 0 100 150 200 250 100 150 200 250 Body size Body size

20 18 16 14 12 10

Incubation period 100 150 200 250

Body size

Fig. 7. a. Clutch size (n=24), b. egg volume (mm3, n=24) and c. length of incubation period (days, n=17) versus body size (mm) for the Petroicidae.

a. n=9 n=3 n=5 2

0 -1

-2 Aust Aust+NG NZ

Relative incubation period Relative incubation Geographical region

n=3 n=3 n=9 n=2 b. 2

-1 Dry Euc Wet Rain

Relative incubation period* Habitat type

Fig. 8. a. Relative incubation period (residuals of incubation period on body size) for three geographical regions: petroicid species endemic to Australia, those present in Australia and New Guinea, and species endemic to New Zealand and its surrounding islands. b. Relative incubation period* (further controlled for geographical region) for four habitat types: Dry: semi-arid and dry woodland, Euc: Eucalyptus spp. forest and woodland, Wet: wet sclerophyll forest and coastal forest, and Rain: rainforest.

Chapter 3

Dispersal and recruitment of juvenile red-capped robins Dowling et al. (2003) Emu 103, 199-205

Abstract

Data on the dispersal and recruitment of juvenile birds following fledging are largely unreported for Australian birds. In this study, the short-distance dispersal of a sample of colour-banded, juvenile red-capped robins, Petroica goodenovii, was investigated in Terrick Terrick National Park, Victoria, Australia. Of 67 colour-banded juvenile birds that successfully reached independence during the 2000/01 breeding season, eight were recruited into the study area or adjacent areas for the following breeding season. A ninth bird was resighted in Gunbower State Forest, 36 km from where it was banded. This is the furthest recorded dispersal movement of a red-capped robin. Of 59 colour-banded juvenile birds that reached independence during the 2001/02 season, four remained within the study area for the remainder of the breeding season, but these were not present in the study area during the following breeding season. Juvenile birds that successfully reached independence and dispersed were heavier as nestlings, when controlled for age and date, than birds that disappeared (assumed dead) before reaching independence. Estimates of red-capped robin abundances within Terrick Terrick National Park were greater than those of nearby eucalypt woodlands, suggesting that the white cypress-pine, Callitris glaucophylla, woodlands within the park offer good quality habitat for red- capped robins, and may be saturated with breeding territories. Thus, juveniles may be forced to establish breeding territories far from their natal territories. These results are discussed in relation to avenues for further research of juvenile dispersal in Australian birds and their conservation implications.

Introduction

Natal dispersal occurs in most bird species and influences both population dynamics and genetics. With the exception of group-living birds, in which some offspring may remain in the natal territories post-fledging, in other species juveniles are forced out of natal territories by their parents to establish territories elsewhere. Juvenile dispersal in birds is often female-biased, with males remaining closer to their natal territories (Greenwood 1980). This pattern is particularly pronounced in cooperatively-breeding birds, since fledglings of one sex (usually the male) are often more likely to remain as ‘helpers’ in their natal territory. In these species, natal dispersal is well studied (Stacey and Koenig 1990). Less is known about natal dispersal in non group-living birds, particularly Australian species, although it can also be sex-biased, with one sex dispersing further than the other (Greenwood 1980).

The dispersal patterns of a species may be largely influenced by population density (Greenwood et al. 1979) and variation in habitat quality and suitability (Travis and Dytham 1999). For instance, in territorial species, the reproductive success of the individual depends on dominating a suitable habitat patch in which to breed (Kokko and Lundberg 2001). If suitable habitats within a population are already occupied, juveniles may be forced to disperse further from their natal territories, or to less preferable habitat, to establish their own breeding territories.

In passerines, differential mortality according to nestling weight is common (Martin 1987). Individuals that are relatively heavier at fledging often have increased rates of survival to independence, and a greater probability of surviving to breeding age (reviewed in Magrath 1991). In fact, the probability of surviving to nutritional independence might be an adequate estimate of the relative probability of recruitment to the breeding population in many bird species (Magrath 1991). Individuals that were heavier as nestlings may be both better able to survive and also compete for limited breeding vacancies. Competition for limited suitable breeding habitat may potentially increase with increasing habitat loss, fragmentation and degradation.

40 Chapter 3 Dispersal and recruitment

The red-capped robin (mean weight=8.92 g, s.e.=0.04, n=169) is an endemic passerine found in dry woodlands and scrub of mainland Australia (Blakers et al. 1984). Females are predominantly buff-grey, whereas adult males (birds older than 1 year) possess a characteristic red cap and bib. Males in their first year (yearlings) resemble adult females, and moult into bright male plumage at the end of their first year, following the breeding season. They, hereafter, retain this bright plumage, moulting yearly at the conclusion of the breeding season (Dowling 2003, Chapter 2). Red-capped robins are socially monogamous and territorial, with a pair defending a defined area in which they feed and breed. Males in their first year also establish territories and yearlings of both sexes can breed successfully (Chapter 5, 6).

Since the species is both socially monogamous and territorial, offspring are forced off their natal territories by their parents and establish breeding territories of their own (Dowling 2003, Chapter 2). The movements of these juvenile birds following their independence are unknown. In this study, the short-distance movements, condition and sex-ratio of a sample of colour-banded, juvenile red-capped robins were investigated following dispersal from their natal territories. Red-capped robin abundances were also estimated across a variety of woodland types within northern Victoria, Australia. Using these abundance data, I suggest which woodland types offer the most suitable habitat for the species, and hence in which habitats it might be difficult for a dispersing bird to find a territory vacancy.

Methods

Study site

The study was conducted within a roughly rectangular 80 ha area (Fig. 1), dominated by white cypress-pine, Callitris glaucophylla, in the southern section of Terrick Terrick National Park (36º 10’ S, 144º 13’ E), located approximately 45 km west of Echuca, Victoria. The woodland section of the park is approximately 2500 ha and consists of dry

open woodland, dominated by white cypress-pine and grey box, Eucalyptus microcarpa. Annual rainfall in the area is approximately 400 mm (LCC 1983). Areas of the park that are dominated by white cypress-pine woodlands appear to be saturated with red-capped robin breeding territories (D. Dowling, M. Antos, T. Sahlman, pers. obs.).

Bird capture, measurement and observations

In this study, 50 breeding pairs of robins were monitored during the 2000/01 breeding season and 60 pairs during the 2001/02 season. Birds (n=158) were caught in mist-nets and banded with a numbered metal band provided by the Australian Bird and Bat Banding Scheme, and a unique combination of plastic colour-bands to permit individual identification.

Nests were located by following breeding females continuously for 20 min. This observation period was long enough to determine whether birds had begun nesting. Each territory was checked at least every three days to determine locations of colour-banded individuals, presence of nesting activity and stage of nesting. Every time a territory was visited, the presence and location of all individuals within the territory was recorded. Throughout the breeding season, the boundaries of each territory were mapped. Territory boundaries were defined for each breeding pair over each breeding season, using movements of birds within territories, and locations of territorial disputes between neighbours. Once found, nests were checked every three days to determine their fate. A small number of nests (n=8 in 2000/01, n=9 in 2001/02) was inaccessible due to their position in the tree. At all other nests, each nestling was weighed once (anytime between three and fourteen days) to 0.1 g. Age was recorded, or calculated if unknown by comparing body traits such as body size, size of tarsi, presence of wing feather shafts, degree of body down and whether the eyes had opened with the data for the same traits in nestlings of known hatching date. Nestlings (n=240) were banded with a metal band and a unique combination of three colour-bands usually when they were around six to eight days old. A small blood sample (50µl) was taken by brachial venipuncture and stored in

42 Chapter 3 Dispersal and recruitment

100% ethanol for subsequent molecular sex determination according to the method described in Griffiths et al. (1998) and Chapter 6.

Once fledged, colour-banded juvenile robins were monitored every three to five days in their natal territories until evicted by their parents. Parents stop feeding fledglings and begin to actively chase them when they beg for food usually three to four weeks after fledging (although if it is late in the breeding season and the breeding pair has stopped all nesting activity, they are more tolerant towards their juveniles remaining on their territories) (Dowling 2003, Chapter 2). If juveniles disappeared from their natal territories within two weeks of fledging, while still clearly dependent on their parents for food, it was assumed these juveniles had died. Once parents were observed acting aggressively towards their offspring, three or four weeks after fledging, it was assumed that any juveniles that subsequently disappeared had dispersed. These juveniles dispersing from their natal territory were defined as nutritionally independent. Following this assumed dispersal, all territories within the 80 ha study area were scanned for the presence of these juvenile birds. During the 2001/02 breeding season, areas adjacent to the study area (about 246 ha in total) were also searched for colour-banded individuals (Fig. 1).

Population abundance

Red-capped robin counts were conducted along 5 ha (500x100m) fixed belt transects by an experienced observer. Transects were located within the four main woodland types of the northern Victoria, 1) white cypress-pine woodlands within Terrick Terrick National Park, 2) black box, Eucalyptus largiflorens, woodlands within Leaghur State Park, 3) grey box woodlands within Gunbower State Forest and 4) river red gum, E. camaldulensis, woodlands also within Gunbower State Forest. Six transects were surveyed within each woodland type (except for the grey box woodland, which contained only 5 transects). Between 2000 and 2002, each transect was surveyed five times during the breeding season (September-January) and four times during the non-breeding season (March-July). All transects consisted of open woodlands with similar visibility. Each transect was surveyed over a 40 minute period and birds were detected by visual scanning

of the habitat and listening for their calls, providing approximate counts. Birds behind the observer or well above the canopy were excluded. Surveys were conducted between 0600 and 1100 h during calm weather.

Statistical analysis

A combined application of ANCOVA, paired t-tests and the binomial probability distribution was used to analyse these data. All tests are 2-tailed with a significance criterion of 0.05.

I tested whether birds that fledged and successfully reached independence (and those that were resighted later) were heavier when weighed as nestlings than those birds that did not reach independence. Nestling weight was controlled for age at weighing by taking the residuals from the logarithmic regression of weight on age. Since brood size has a marked effect on nestling weight (Dowling 2003, Chapter 2), only birds that hatched from clutches of two eggs were used in this analysis (two eggs is the modal clutch size). Date of hatching is related to nestling weight (Dowling 2003, Chapter 2), and was included as a covariate in the analysis. The residuals for individual nestlings were chosen as the units for statistical analysis rather than the average for a brood because we were interested in the effects of nestling weight on dispersal success and sex, and these factors are specific to individuals rather than broods. To confirm that the results were not influenced by possible ‘within-brood’ effects, we repeated the ANCOVA without sex as a factor, after averaging within-brood residuals. Although the results were unaffected when ‘within brood’ residuals were averaged, some statistical power is lost since broods in which one nestling became independent while the other one did not were omitted from the analysis.

44 Chapter 3 Dispersal and recruitment

Results

Resightings of 2000/01 juveniles

During the 2000/01 breeding season, 84 juveniles were raised to independence within the study population, 67 (70.8%) of which were colour-banded. Of the colour-banded juveniles reaching independence, nine (13.4%) were resighted during the subsequent (2001/02) breeding season. Eight of these had established their own breeding territories within the white cypress-pine woodland of Terrick Terrick National Park (Table 1). Half of these successfully dispersing birds (4/8) established territories within the study area itself. One female paired with her putative father in her natal territory (his mate disappeared between seasons). However, paternity analysis, using polymorphic DNA microsatellite markers (Dowling et al. 2003b, Chapter 4), revealed that this female was not sired by her putative father, but probably by an adult male in the neighbouring territory. In her first breeding season, she produced two fledglings that reached independence. Another female paired with a yearling male in a territory adjacent to her natal territory and successfully raised two offspring to independence in her first breeding season. The other two birds to acquire territories within the study area were males. One of these males fledged two offspring that reached independence, although it is unknown whether he was the genetic sire (blood samples were not obtained from these offspring). The other male did not fledge offspring. The other four birds established territories in areas adjacent to the study population in which they fledged. Data regarding their breeding success were not collected.

I was unable to account for the number of birds that successfully dispersed outside of the study area and adjacent areas that we searched. However, on 14 November 2001, a yearling male was resighted in Gunbower State Forest (35 51’ 54’’S, 144 21’ 34’’E), 36 km from where it was colour-banded as a nestling (36 10’ 22’’S, 144 13’ 49’’E) on 2 January 2001.

Resightings of 2001/02 juveniles

During the 2001/02 breeding season, 76 juveniles were raised to independence within the study population, of which 59 (77.6%) were colour-banded (Table 1). Of the colour- banded juveniles, four (6.8%) remained within the study area following independence, occupying abandoned territories. Two female siblings were able to remain in and adjacent to their natal territory after their parents disappeared. A juvenile male also moved into this newly vacated territory from an adjacent territory. The other bird to remain within the study area was a female that moved into an abandoned area beside her natal territory. However, these territory acquisitions were temporary since none of these juvenile birds was present in the study area during the next breeding season (2002/03). However, only five days were spent in the 80 ha study area during this season, and no time was spent in the adjacent areas. Thus, birds that had dispersed to areas adjacent to the study area went undetected and therefore estimates of recruitment following the 2001/02 breeding season were conservative.

Dispersal and nestling weight

The residuals of a logarithmic regression of weight by age, described by the function y = 2.331x0.572 (r2=0.731, n=193), indicate relative nestling weight, controlled for age. Nestlings that are heavier than expected for their age have positive residuals while those that are lighter than expected have negative residuals. Juveniles that successfully reached independence, and were assumed to have dispersed, were heavier as nestlings when controlled for age and date than birds that disappeared before reaching independence (Table 2). Additionally, there is some suggestion that juvenile birds that established their own territories, after dispersal, within the 246 ha area that was searched were heavier as nestlings than those individuals that dispersed but were not resighted (Fig. 2). However, this statistical analysis lacks power since there were only 12 resighted birds.

46 Chapter 3 Dispersal and recruitment

An analysis using averages of residuals for nestlings from the same brood gave similar

results (ANCOVA: Dispersal status: F2,95 = 4.557, p = 0.013; Date: F1,95 = 12.46, p = 0.001).

Paired t-tests (within brood tests) were conducted comparing relative weight of female and male siblings (n=40); the relative weight of individuals that reached independence with their siblings that did not reach independence (n=15 cases); and also the relative weight of individuals that were resighted within the study area and adjacent areas following dispersal with their siblings that were not resighted (n=10 cases). These tests were not statistically significant, but lacked statistical power due to low sample sizes.

Sex ratio of resighted birds within the study area and adjacent areas.

Fifty-two percent of nestlings (n=239) were female. Fifty-three percent of colour-banded offspring that reached independence and dispersed (n=123) were female. Sixty-seven percent of the colour-banded juvenile birds resighted within the study area and adjacent areas, following short-distance dispersal from their natal territories, were females (binomial probability distribution, n=12, p = 0.12, Table 3).

Population abundances

Red-capped robins were more abundant in white cypress-pine woodlands than in black

box, grey box or red gum woodlands (F=11.1853,38, p<0.001, Fig. 3.). There was no difference in robin abundance between breeding and non-breeding seasons for any

woodland type (F=0.0491,38, p=0.827) and no interaction between season and woodland type (F=0.0613,38, p=0.980, Fig. 3). According to transect counts, the mean abundance of red-capped robins in white cypress-pine woodland throughout the year was 0.64 birds per hectare.

Discussion

Local recruitment

Many colour-banded juveniles appeared to successfully reach independence (n=126), but few were subsequently located once they dispersed from their natal territories. Recruitment of colour-banded juveniles that reached independence during the 2000/01 breeding season into the study area and adjacent areas in the following season was 11.9%. This value only indicates local recruitment within my small-scale study area and immediate surroundings. It is clear that this area does not cover the natal dispersal distance of red-capped robins (i.e. juveniles probably dispersed to territories outside this area) and, thus, further investigation is required to provide a clearer estimate of total juvenile recruitment into the population. Currently, it is unknown how far the remaining robin juveniles disperse, or how many survive. Recent research indicates that recruitment of breeding offspring into local plots does not necessarily reflect recruitment into the whole population, especially when plots do not cover the natal dispersal distance (Lambrechts et al. 1999, 2000). Because most studies of avian ecology are conducted in relatively small-scale study areas, it has not been previously possible to meaningfully compare dispersal and recruitment patterns across a wide range of species. Using ringing and recovery data of the British Trust for Ornithology, Paradis et al. (1998) collected data on natal and breeding dispersal of 75 terrestrial species. It is apparent from their raw data that mean natal dispersal distances for most species were larger than the distances encompassed by a typical study site.

Population abundance, habitat quality and dispersal

It appears the white cypress-pine woodland of Terrick Terrick National Park offers good quality habitat for red-capped robins, based on the high abundances of birds detected there in comparison to eucalypt-dominated woodlands of northern Victoria. It has been previously noted that red-capped robins have a preference for native pine woodlands (Blakers et al. 1984, Major et al. 2001). Additionally, it appears the woodland section of

48 Chapter 3 Dispersal and recruitment

Terrick Terrick National Park is saturated with contiguous red-capped robin breeding territories, unlike the eucalypt-dominated woodlands of northern Victoria where breeding territories appear to be non-contiguous (D. Dowling, M. Antos, T. Sahlman, pers. obs.). The study population within Terrick Terrick National Park is resident and sedentary (D. Dowling, M. Antos, pers. obs.) and the birds do not migrate outside of the breeding season, unlike their congener the flame robin, Petroica phoenicea (Robinson 1990). Consequently, there may be few opportunities within Terrick Terrick National Park for an incoming bird to establish a territory without usurping another individual, and thus dispersing juveniles may need to establish breeding territories far from their natal territories. So, juveniles may be over-represented in relatively poor quality habitat. Major et al. (1999) found that the age structure of red-capped robin populations in linear strips of forests, such as roadside corridors, is juvenile-biased in comparison to that of large forest blocks. Juveniles may use these linear strips as dispersal corridors, or may establish breeding territories within them.

Yearlings that found territories further from their natal territories within the Terrick Terrick woodlands or in other forest patches were not detected, but a colour-banded yearling was observed within Gunbower State Forest. This is the longest recorded movement (36 km) by a red-capped robin, and is more than twice as far as the previous recorded longest movement (14 km) (Coventry 1988). Cale (1990) determined that red- capped robins (in particular adult females and/or juveniles) show a yearly cyclical change in the number of individuals in roadside reserves, with the lowest numbers recorded during the breeding season. He proposed that this cyclical pattern arises from juveniles from the previous breeding season using roadside reserves as corridors for dispersal before the commencement of the following breeding season. The observation of a movement to Gunbower State Forest is of interest because the area between the two forests is mainly agricultural land with limited vegetation cover, and no roadside corridors of habitat. The vegetation that exists between the forests is limited to incomplete and degraded links mainly along creeks (County Fire Authority 2000). Some Australian birds are able to disperse over very fragmented landscapes. For instance, the blue-breasted fairy-wren, Malurus pulcherrimus, is capable of dispersing at least 9

km through agricultural land that does not provide breeding habitat (Brooker and Brooker 1997, 2002). However, habitat corridors may be important in this dispersal. Brooker et al. (1999) created a dispersal simulation model to generate movement frequencies and distances for comparison with real dispersal frequencies collected in the field for two habitat-specific, sedentary species, the blue-breasted fairy-wren and the white-browed babbler, Pomatostomus superciliosus. They found evidence that both species use habitat corridors during dispersal, and that blue-breasted fairy-wrens were inhibited by gaps in the corridors greater than about 60 metres whereas white-browed babblers could cross gaps at least 270 metres wide.

Dispersal and nestling weight

Nestlings that subsequently reached independence were heavier than those that did not. Two explanations may be proposed for this pattern. First, heavier nestlings may be better able to survive and eventually acquire their own territories. Heavier blackbird, Turdus merula, nestlings have an increased probability of survival to independence (Magrath 1991). However, in this red-capped robin population, starvation of nestlings was very rare (n=2 broods), and it appeared that most nest failure was caused by predation (Dowling 2003, Chapter 2). It was rare for one nestling within a brood to survive to fledging while the other did not. Generally entire broods survived or died in the nest. Furthermore, mortality between fledging and independence was rare (n=15). Thus, nestling weight did not appear to be related to starvation within the nest, with predation instead the major determinant of nesting success. Alternatively, parental quality may explain the observed correlation. Good quality parents may be potentially better able to conceal their nest from potential predators, defend the nest, and feed their nestlings. If good quality parents produce both more fledglings (lower nest predation) and heavier fledglings (increased food provisioning), this could explain the relationship between offspring survival to independence and their weight as nestlings.

50 Chapter 3 Dispersal and recruitment

Sex ratios and local recruitment

Two thirds of birds resighted within the study area and adjacent areas following their independence were female, suggesting natal dispersal may be male-biased in this species. Although not significant, this test lacked statistical power due to the low number of resighted birds. Sex-specific dispersal has been noted in other bird species and is usually female-biased, with males recruited closer to their natal territories (Greenwood 1980). It occurs in cooperatively-breeding species since, in these species, offspring delay dispersal from their natal territories to help their parents raise subsequent offspring, and these helpers are predominantly the one sex (Russell and Rowley 1993; Mulder 1995; Komdeur 1996; Brooker and Brooker 1997). However, sex-biased natal dispersal also occurs in non group-living birds, and is again predominantly female-biased. In these cases, the sex-bias in dispersal is related to distance dispersed rather than the likelihood of dispersal (Greenwood 1980, Clark et al. 1997). In fact, there is no clear evidence of any cases of male-biased natal dispersal occurring in non group-living passerines. Although Dallimer et al. (2002) revealed genetic evidence for male-biased dispersal in the red-billed quelea, Quelea quelea, it was unclear whether this represented natal or breeding dispersal (dispersal of birds that have previously reproduced). My study perhaps provides some suggestion that natal dispersal in non group-living passerines is not necessarily exclusively female-biased.

Due to low numbers of resighted birds, I was unable to conclude whether sex-biases in dispersal and recruitment occur in this population. However, eight of the 12 juveniles that were later resighted within Terrick Terrick National Park were females and this potential bias may be related to the higher turnover of breeding females within the study population. At the beginning of the 2001/02 breeding season 30 of 48 (62.5%) banded males that had held territories during the previous season remained within the study area compared to 13 of 42 (31%) females (although retention rates within the study area between the sexes at the start of 2002/03 season were similar: males 27 of 60 [45%], females 18 of 43 [41.9%], Dowling 2003, Chapter 2). Although I do not have data on turnover rates of breeding birds for areas adjacent to the study area, where three

dispersing juvenile females established territories compared to one male, the above data suggest that breeding females may have higher breeding dispersal or mortality rates between seasons, and thus there may be more opportunities for juvenile females to find vacant territories close to their natal territories.

Conclusions

This study suggests interesting avenues for further research into the dispersal and recruitment of juvenile red-capped robins, and other bird species from source populations. One useful approach may be to attach radio-transmitters to dispersing juveniles to enable collection of comprehensive data on dispersal distance and survival for both sexes. This would provide valuable information on relatively short-distance movements, whether different habitat types are used by different age-classes or sexes, and also whether habitat corridors are important in promoting dispersal of juvenile birds. Radio-tracking, used to collect data on natal dispersal in the acorn woodpecker, Melanerpes formicivorous, revealed that long-distance dispersal is much more frequent than previously suspected in this species (Koenig et al. 1996, Koenig et al. 2000).

Modern genetic techniques are useful in determining gene flow at larger scales, thereby indicating whether movement of individuals between populations occurs. Such analyses suggest detectable levels of gene flow over 1599 km in Australian magpie, Gymnorhina tibicen, populations (Baker et al. 2001) and between populations separated by over 1000 km in grey-crowned babblers, Pomatostomus temporalis (Edwards 1993).

The dispersal of a juvenile red-capped robin from Terrick Terrick National Park to Gunbower State Forest is an encouraging sign for this species, which is in decline in eastern Australia (Robinson 1994, Reid 1999). It confirms that juvenile red-capped robins can move between forest patches, and conserving the few corridors and remnant patches of vegetation still remaining will conceivably facilitate this dispersal. Apart from providing corridors and stepping-stones for dispersal, such patches may serve as sinks for juvenile birds. Further knowledge regarding the biology of dispersal and habitat

52 Chapter 3 Dispersal and recruitment requirements of dispersing birds will have implications for future conservation management.

Table 1. Breeding success of study population 2000/01 2001/02 No. of breeding pairs 50 60 No. of nesting attempts 138 142 No. of eggs 250 230 No. of nestlings 159 141 No. of fledglings 96 79 No. of juveniles reaching independence 84 76 No. of short-distance recruitsA 8B 0C AIncludes colour-banded birds resighted only within or adjacent to the study area. BA ninth bird was resighted in Gunbower State Forest. CFour juveniles remained in the study area following dispersal, but did not hold territories here as yearlings during the following breeding season. Following the 2001/02 season, only the study area (not the adjacent areas) was searched for yearlings recruited into the population.

Table 2. Relationship between nestling weight and dispersal status, sex and season Results of 3-factor ANCOVA testing the relationship between nestling weight and dispersal status of juvenile birds, sex and season. Nestling weight is standardised by age when weighed (residuals of regression), with date of weighing as a covariate. Dispersal status describes at what stage an individual was last sighted and is classified into 3 categories: disappeared (assumed dead) before reaching independence, reached independence and assumingly dispersed from natal territory, resighted following dispersal from natal territory. Factor / Interaction Fnumerator df, denominator df P Dispersal status 7.7702, 162 0.001 Sex 0.6081, 162 0.437 Season 1.0761, 162 0.301 Dispersal status*Sex 0.8722, 162 0.420 Dispersal status*Season 0.2942, 162 0.746 Sex*Season 0.1831, 162 0.669 Dispersal status*Sex*Season 0.7342, 162 0.481 Date 18.8321,162 0.000

Table 3. Sex ratios of juveniles that were resighted following independence (females:males) Percentage of females for each category is indicated in parentheses. Locality Between seasons 2000/01 to 2001/02 Within seasons Total Study area Adjacent area Combined In study area Terrick Terrick 2:2 (50%) 3:1 (75%) 5:3 (62.5%) 3:1 (75%) 8:4 (66.7%) Gunbower 0:1 (0%) 0:1 (0%)

54 Chapter 3 Dispersal and recruitment

Fig. 1. Map of the study area and its position within the woodland section of Terrick Terrick National Park. Top right hand map shows the location (grey shading) that this study was carried out within the park. The bottom diagram is an enlargement of the grey shaded area of the top map; showing the location of the study area where breeding pairs were colour-banded and their breeding success monitored (dark grey shading), and also the location of the areas adjacent to the study area that were scanned for the presence of birds that had dispersed from the study area (light grey shading). Tracks running through the area are marked, and ● indicates Mount Terrick Terrick.

0.6 n=12

0.4 n=97 0.2 n=84 0

-0.2

Residuals of weight x age -0.4 Deceased Independence Resighted

Fig. 2. Residuals of the logarithmic regression of weight (g) × age (days) of nestlings for three categories of birds: Deceased – birds that disappeared (assumed dead) before they reached independence and dispersed; Independence – individuals that successfully fledged and became independent of their parents, dispersing from their natal territories; Resighted – individuals that were resighted within the study area or adjacent areas following dispersal from their natal territories. Bars indicate standard error (± 1 s.e).

56 Chapter 3 Dispersal and recruitment

n=6 0.8

0.6 n=6 0.4 n=5

0.2 n=6 Abundance (birds per ha) 0 Cypress pine Black box Grey box Red gum

Woodland types Fig. 3. Mean abundance (birds per ha) of red-capped robins across four woodland types in northern Victoria. Shaded columns represent abundances during breeding seasons and non-shaded columns non-breeding seasons. Bars indicate standard error (± 1 s.e).

Chapter 4

Novel polymorphic microsatellite markers for paternity analysis in the red-capped robin (Petroica goodenovii: Aves) Dowling et al. (2003) Molecular Ecology Notes 3, 517-519

Abstract

Seven microsatellite loci were isolated and characterised from the red-capped robin Petroica goodenovii, using non-radioactive polymerase chain reaction (PCR)-based techniques to screen an enriched genomic library. Five loci showed no evidence of null alleles and were variable [mean heterozygosity (HE) = 0.440, mean number of alleles = 8]. Cross-amplification using primers for microsatellites in Phylloscopus occipitalis and Emberiza schoeniclus yielded another two polymorphic loci. The combined set of five red-capped robin and two cross-amplified loci are suitable for paternity assignment (exclusion probability for seven unlinked loci = 0.9760).

Primer note

During the past decade, genetic markers have been widely applied to resolve parentage in populations of wild animals. These studies have revealed unexpected variation in reproductive success among members of socially monogamous species. In birds, this variation occurs because paired males obtain extra-pair fertilisations (EPFs; Birkhead and Møller 1992), thereby enhancing their own reproductive success at the expense of the cuckolded individual.

Across bird species, variation in the frequency of extra-pair paternity is associated with the expression of male secondary sexual characters. Strong sexual dichromatism in plumage (where males have more brightly coloured plumage than females) is correlated with high rates of extra-pair paternity (Møller 1997; Owens and Hartley 1998). Therefore, objective measurement of reproductive success using molecular tools is

essential for studies that seek to examine whether a potential ornament is maintained through sexual selection.

The red-capped robin (Petroica goodenovii, Petroicidae) is a socially monogamous but strikingly sexually dichromatic bird, in which adult males possess bright red forehead and breast patches, and females are grey-brown in colour (Boles 1988). Here, I describe a microsatellite-based genotyping system that allows unambiguous assignment of parentage in this species.

DNA was extracted from blood samples taken from red-capped robins in Terrick Terrick National Park (36º 10’S, 144º 13’ E) in northern Victoria, Australia, using a salting-out procedure (Bruford et al. 1992). Genomic DNA was enriched for GAAA and GT repeat- containing fragments in separate polymerase chain reactions (PCRs) with the same conditions, using the method described by Gardner et al. (1999) with modifications as detailed in Adcock and Mulder (2002). Positive clones were amplified in 50 µl reactions and the DNA extracted using the Qiaquick PCR purification kit (QIAGEN) following the manufacturer’s instructions. PCR products were sequenced commercially (SUPAMAC, Sydney, Australia).

From 369 colonies screened in the GAAA-enriched genomic library, 16 positive clones were sequenced. Primers were designed (Life Technologies) for seven of these that contained five repeats or more and had suitable flanking sequence. From 48 colonies screened in the GT-enriched genomic library, nine positive clones were sequenced. Of these, primers were developed for three loci. Primer pairs that gave consistent, specific products were tested for polymorphism. One primer in each pair was manufactured with a 5’-M13 (5’CACGACGTTGTAAAACGAC) tail for use in the universal dye-labelling method described by Boutin-Ganache et al. (2001). Primer sequences, optimum annealing temperatures and MgCl2 concentrations are listed in Table 1. Polymorphism was assessed by typing at least 16 putatively unrelated individuals at each microsatellite

locus. All PCRs used Taq polymerase (0.25 units/10 µl), MgCl2 (see Table 1 for concentrations), and a reaction buffer (10 mM Tris-HCl, 50 mM KCl, 0.1% Triton X-

60 Chapter 4 Microsatellite markers

100) and dNTPs (200 µM) supplied by Promega. Reactions were run in 0.2 ml microtitre plate (Greiner) wells layered with a drop of mineral oil (Sigma) on a Corbett Research PC-960C thermocycler. Reactions (10 µl) contained an M13 primer (200 nM) 5’-labelled with a Beckman Coulter dye (D2, D3 or D4), and the locus-specific tailed (15nM) and untailed (200 nM) primer (200 nM), 40 ng of genomic DNA and the optimal

concentration of MgCl2. A total of 40 cycles of amplification were run: one cycle of 90 s at 94°C followed by 40 cycles of 94°C for 20 s, the optimal annealing temperature for 20 s and 73°C for 90 s. PCR products (0.25 µl) were electrophoresed on a Beckman Coulter 8000XL automated sequencer using the CEQ 2000XL fragment analysis kit (Beckman Coulter) according to the manufacturer’s instructions. Fragment sizes were estimated using the Beckman Coulter 8000XL fragment analysis software.

Seven loci were polymorphic. Table 1 shows the number of alleles found and the observed and expected heterozygosity for each locus. Pgm4 had low levels of variability

(NA = 2, HE = 0.18). The remaining loci were more variable (NA = 5-20, HE = 0.24-0.93). Pgm6 and Pgm7 showed heterozygote deficiency, probably indicating the presence of null alleles, and analysis using Genepop 3.3 (Raymond and Rousset 1995) indicated both loci deviated significantly from Hardy-Weinberg equilibrium. To increase the general exclusion probability (Equation 1a in Jamieson and Taylor 1997) for identifying extra- pair young, we used two further microsatellites isolated by cross-amplification using the Pocc6 and Escmu6 primers (Table 1). Using tests implemented in Genepop 3.3 (Raymond and Rousset 1995), no other loci showed significant deviation from Hardy- Weinberg equilibrium, and there was no linkage disequilibrium among loci (p>0.05). The general exclusion probability, in the case where the mother is known, of seven variable, unlinked loci (Pgm1, 2, 3, 4, 5, Pocc6, Escmu6) is 0.9760. Offspring are rarely recruited close to their natal territories (Dowling et al. 2003a, Chapter 3). Thus, assigning parentage is straightforward because potential parents are not closely related.

Table 1. Characterisation of microsatellite loci in the red-capped robin, Petroica goodenovii The final annealing temperature (TM) is in ºC and the MgCl2 concentration in mM. The number of individuals tested (n), number of alleles (NA), allele size range in base pairs (bp), and observed (HO) and expected (HE) heterozygosity and the probability of excluding a father (Ex) are listed for each locus. The M13 prefix in the primer sequence denotes a 5’ M13 tail (CACGACGTTGTAAAACGAC), attached to the primer sequence. Cloned sequences have been deposited with GenBank under Accession numbers AY289550- AY289556. Cross-amplification using primers for microsatellites in Phylloscopus occipitalis1 and Emberiza schoeniclus2 yielded two more polymorphic loci in Petroica goodenovii.

Locus Repeat motif in clone Primer sequence (5’-3’) n TM [MgCl2]NA bp HO HE Ex

Pgm1 (CTTT)3T(CTTT)20 F: TTTACTTGCTTAGCAGAAATGG 25 55 1.5 20 207- 0.88 0.93 0.82 277 R: M13-TTTCACAATTTTTGTGCATAGG

Pgm2 (TC)5(CTTT)6CTGT(CTTT)2 F: TCCTGTTACAAAACACTAATGAGG 29 52 2.5 8 223- 0.38 0.47 0.29 240 CCTTCTTTCTCTTT R: M13-TGTCTCACCACACCTTTATGC

Pgm3 (TC)4T(CTTT)5 F: M13-CACTGGGATGAAAAGACCTG 23 52 2.5 5 185- 0.26 0.24 0.13 202 R: TCTCCAGAGCTGGCTATAAAC

Pgm4 (CTTT)5 F: AGGCTCATAGCCTGAAAGC 16 52 2.5 2 244- 0.19 0.18 0.08 248 R: M13-TGCTCATTTTTCATTTATCAGG

Pgm5 (GT)2TT(GT)16 F: AGTGCTGAACTGGGAGACC 30 54 2 5 201- 0.47 0.39 0.2 289 R: M13-AACCTGTCCTGCTTCTCTCC

Pgm6 (CTTT)6 F: TGGGTAAGGAAAAGCTGACC 21 52 2.5 6 183- 0.33 0.63 215 R: M13-CAAATTTGTGAAGGAACAAGG

Pgm7 (CTTT)5CTTA(CTTT)3 F: AGAGGCTGAGGACTAGTTGC 28 52 2.5 12 220- 0.46 0.91 260 R: M13-TCAACCCTTTGACAGTTTGC

Pocc61 - F: TCACCCTCAAAAACACACACA 16 52 2.5 6 196- 0.75 0.75 0.50 206 R: M13-ACTTCTCTCTGAAAAGGGGAGC

Escmu62 - F: M13-CATAGTGATGCCCTGCTAGG 25 52 2.5 6 120- 0.56 0.67 0.43 132 R: GCAAGTGCTCCTTAATATTTGG 1. Bensch et al. (1997) 2. Hannotte et al. (1994)

Chapter 5

Plumage ornaments, individual quality and reproductive success in red- capped robins

Abstract

In birds, yellow, orange and red plumage colours are produced by the deposition of carotenoid pigments into the feathers. The expression of such plumage depends, in part, on ingestion of these pigments because birds can not produce them de novo. Recent studies have highlighted the role of red plumage in sexual signalling, suggesting it is condition-dependent and that the reddest males obtain the greatest mating benefits. But to date, studies of carotenoid-based ornaments have focused almost exclusively on granivorous species. Because carotenoid distributions differ between plants and arthropods, the associated costs of processing them may also differ. Thus, it is unclear whether previous results can be generalised to insectivorous birds. Furthermore, no study has yet investigated the relationship between the expression of red plumage (measured using objective colorimetry) and true reproductive success (combining within- and extra- pair matings). I examined the role of carotenoid-based plumage ornaments in both sexes of the insectivorous red-capped robin, Petroica goodenovii, over two breeding seasons (2000/01 and 2001/02). Males have scarlet red forehead and breast patches, while females have duller rufous forehead caps. Males with the highest reproductive success during 2000/01 moulted into the most colourful plumage at the conclusion of this season, suggesting expression of this plumage is condition-dependent. Additionally, males in high body condition in 2000/01 tended to subsequently moult into more colourful caps, and cap colour still tended to be related to male body condition during the 2001/02 season, suggesting some condition-dependence. High-quality females appeared to pair to males with the most colourful caps. Specifically, females with larger caps paired to males with higher cap chromas, and larger females paired to males with higher cap hues. However, the within-, extra-pair or total reproductive success of males in the breeding season following moult was not predicted by the brightness, hue or chroma of their

colour patches. Instead, male reproductive success correlated with male body condition, age, and the age of his social partner. In females, the length of the rufous forehead patch was related to reproductive success; females with longer caps began breeding earlier in the season and produced more offspring than smaller-capped females. Combined, these results suggest that the carotenoid-based ornaments of both sexes are probably subject to sexual selection.

Introduction

There is now abundant evidence that the sexual ornaments of many bird species, such as long tails and colourful plumage, may be maintained through sexual selection (reviewed in Andersson 1994). Whereas research initially focussed on male ornamentation, recent studies have shown that this selection can act on ornaments in both sexes (reviewed in Amundsen 2000). Because ornaments theoretically impose a cost on the bearer (either physiological or social), they should provide a reliable ‘handicap’ signal of individual quality (Zahavi 1975, Andersson 1994), such that the best quality individuals develop the most exaggerated ornaments. If differences between individuals in ornament elaboration are perceived by conspecifics, then agonistic competition or mate choice may result in the individuals with the most exaggerated traits benefiting through increased reproductive success (eg. Kodric-Brown 1989, Kappeler 1997, Jones and Hunter 1999, reviewed in Andersson 1994).

The relationship between plumage ornament expression and reproductive success has been studied in a variety of species, facilitated by molecular tools that allow paternity to be assigned (Hill et al. 1994, Weatherhead and Boag 1995, Sundberg and Dixon 1996, Yezerinac and Weatherhead 1997, Johnsen et al. 1998, Johnsen et al. 2001). Such tools are necessary even in studies of apparently monogamous species, since it is clear that monogamously-paired males often supplement paternity gained with their social mates (within-pair paternity) with extra-pair fertilisations (EPFs; Birkhead and Møller 1992, Griffith et al. 2002). In studies of sexual selection in such species, it is crucially

66 Chapter 5 Plumage ornaments

important to investigate the role of both components of reproductive success, because males may lose paternity in their own nests but gain paternity with females outside their territories (see Griffith et al. 2002). The importance of accurately characterising both components of reproductive success is further highlighted by the finding that sexual selection can act on the same ornamental signals in different directions. A study of blue tits, Parus caeruleus, for example, revealed that males with a more UV-shifted (shorter wavelengths within the UV) crown hue were less frequently cuckolded (i.e. they had higher within-pair mating success) while those with a less UV-shifted (longer wavelengths) crown sired more extra-pair young (Delhey et al. 2003).

Reds, yellows and oranges are common ornamental plumage colours, and their expression depends on a class of pigments known as carotenoids (Fox 1979, Olson and Owens 1998). Carotenoids are lipid-soluble, unsaturated C-40 hydrocarbons common in plants. Birds cannot synthesise carotenoids de novo, so they must be acquired from their diet (Goodwin 1976). Yellow carotenoids are much more abundant than red carotenoids in plants (Goodwin 1976) and therefore plant-eating species that possess red plumage must metabolise these yellow pigments before deposition into red plumage, a process which is probably costly (Hill 1996). Besides being used in plumage colouration, carotenoids are also essential for healthy immune functioning (Bendich 1993, Lozano 1994). In particular, they are antioxidants and reduce oxidative stress by binding to free radicals (von Schantz et al. 1999). If carotenoids are limited in availability or costly to metabolise, individuals may face a trade-off with respect to carotenoid allocation: they can either use them to enhance immune function, or they can be deposited into ornamental patches (Lozano 1994). Only high-quality individuals may then be able to invest in the most colourful carotenoid-based ornaments, and still have enough carotenoids or metabolic energy left-over to maintain healthy immune function. Thus, carotenoid-based plumage ornaments (and in particular red ornaments) are promising candidates for reliable sexual signals. Indeed, several studies have found that ecological stresses such as food limitation or parasite infections can influence the expression of carotenoid-based plumage ornaments (reviewed in Hill 1999).

Although several studies have provided evidence that red plumage is condition- dependent, there is less evidence that the most colourful individuals enjoy reproductive benefits. Such evidence comes from only three species: the house finch, Carpodacus mexicanus (Hill 1990), the northern cardinal, Cardinalis cardinalis (Wolfenbarger 1999), and the red-collared widowbird, Euplectes ardens (Pryke et al. 2001a, Pryke 2003). Furthermore, to date, no study has determined the relative importance of carotenoid- based plumage (using objective techniques to score colour) on a male’s overall reproductive output (i.e. within- and extra-pair reproductive success).

It is notable that all of the three species above feed predominantly or exclusively on plant material. Thus, they derive their carotenoids directly from the plant materials they eat, particularly yellow carotenoids such as lutein (Pryke 2003), which must then be metabolically converted into red pigments. Red carotenoids are much rarer in the diets of birds, but can be found in arthropod food sources (Goodwin 1976, 1984). Depending on their diet, insectivorous birds that possess red plumage may obtain at least some red carotenoids directly from their insect diet, and thus may not have to convert the carotenoids they deposit in their plumage from their yellow precursors. If the food source is abundant, and there are few costs associated with metabolising yellow pigments to red plumage, then the ornamental signal may be of little value as an honest handicap signal of the bearer’s quality. To date, studies addressing the function of red plumage in insectivorous birds have been conducted on only two species (both of which are partial, rather than strict, insectivores): the northern flicker, Colaptes auratus (Wiebe and Bortolotti 2002), and the red-winged blackbird, Agelaius phoeniceus (Searcy and Yasukawa 1995, Weatherhead and Boag 1995), and these studies found no relationship between red plumage and condition or reproductive success.

Here, I examine the role of red plumage in the insectivorous red-capped robin, Petroica goodenovii, in relation to reproductive success in both sexes. Although this species is sexually dichromatic (males are more colourful than females), both sexes possess carotenoid-based plumage patches. The first aim of this study was to determine whether red plumage patches in males were condition-dependent signals. I tested several

68 Chapter 5 Plumage ornaments

predictions: a) that males with higher reproductive success in one season would moult into more colourful plumage at the conclusion of that season to indicate their reproductive quality (the annual moult immediately follows the breeding season and plumage colour indicates condition at moult), b) that males in high body condition in one season would moult into more colourful plumage at the conclusion of the season, and c) that plumage colour also indicates male body condition in the subsequent breeding season (i.e. high quality males remain high quality, with plumage colour reliably indicating condition even 4-6 months after moult). I then examined whether males and females paired on the basis of plumage or other morphological traits, and whether increased expression of carotenoid-based plumage patches resulted in increased reproductive success in both sexes.

Methods

Species

Red-capped robins are strikingly sexually dichromatic. Adult males (> 1 year old) possess black and white plumage with characteristic scarlet forehead caps and breast bibs. The red plumage in males consists primarily of two red keto-carotenoid pigments, canthaxanthin (473 nm) and adonirubin (475 nm), both of which are potentially ingested directly from their insect diet (High Performance Liquid Chromatography analysis; S. Andersson, pers. comm.). In contrast, adult females (> 1 year old) are buff-grey, but possess rufous forehead caps that contain the same carotenoid pigments, but in much smaller quantities, possibly with some melanin pigments as well (S. Andersson, pers. comm.).

Each sex has distinctive delayed plumage maturation. As yearlings (in their first year, n=26), males resemble adult females but moult into bright plumage at the end of their first breeding season. All females banded as nestlings that recruited into the study area lacked rufous forehead caps as yearlings (n=6). It was assumed that other females, that recruited into the study area, that lacked forehead caps were also yearlings (n=16).

Study area

Refer to methods in chapters 2 and 3 for description of study area.

Bird capture and measurement

Red-capped robins (n=158) were caught in mist-nets and banded with a numbered metal band provided by the Australian Bird and Bat Banding Scheme and a unique combination of colour rings to permit individual identification. The lengths of both tarsi and the head- bill length were measured with callipers to 0.01 mm, and the length of the right wing measured to 0.5mm with a butted ruler. The length and width of the red forehead and breast patches of adult males were measured with callipers to the nearest 0.01mm. The length of adult female rufous forehead caps was measured to 0.01 mm and colour was subjectively classified as either pale brown, brown or rufous red. Female cap length was positively related to cap colour (F2, 43=4.038, p=0.025). Here, cap length is used as a measure of female cap ornamentation. The body mass of each bird was measured to the nearest 0.1 g. A small blood sample (approximately 70 µl) was taken by brachial venipuncture, and stored in 100% ethanol for subsequent paternity analysis.

Red-capped robins moult in February, following the breeding season. Normally, plumage colour can only change at moult, with the possible exception of minor changes caused by feather abrasion (Hill 1999). At the onset of the 2001/02 breeding season (between May and July), reflectance spectra of the red cap and breast were measured once for 35 adult males using a S2000 spectrometer, PX-2 pulse xenon light source, a fibre-optic reflectance probe and OOIBase32 software (Ocean Optics, Inc., Dunedin, USA). The end of the probe was machined at 45°, yielding a 4 mm wide measuring spot, and mounted in a supporting brace on the same angle in a tripod. Each plumage patch measured was held carefully against this probe so that feathers remained flat against the probe. Four replicate scans were taken of the cap and breast patch of each male. Reflectance spectra between 300 and 700 nm were measured relative to white Spectralon (Labsphere Inc.) and dark

70 Chapter 5 Plumage ornaments

references against which the spectrophotometer was calibrated between measurements of each new plumage patch.

Reflectance spectra were separated into three objective colour components: brightness (spectral intensity), hue (spectral location or colour: referred to as ‘redness’), and chroma

(spectral purity or saturation). Brightness was calculated as R300-700, the sum of reflectances from 300 to 700 nm. Hue was calculated as λ(R50), the wavelength halfway

between the minimum (Rmin) and maximum (Rmax) reflectance. The measurement of chroma is more contentious and various measures have been advocated (Andersson et al. 1998, Pryke et al. 2001a, Johnsen et al. 2003). I measured chroma as an index of carotenoid-saturation of the plumage, by dividing the reflectance of the red wavelengths of the spectrum by the total reflectance between 300 and 700 nm: R450-700/R300-700

(Andersson et al. 1998). This measure is strongly related to another currently used (R700-

R450/RT, Johnsen et al. 2003) to give an index of carotenoid-saturation (breast patch: n=140, r2=0.80, p<0.001, cap: n=131, r2=0.74, p<0.001).

Brightness and chroma measurements were calculated for each of the four replicate scans taken per plumage patch (replicate scans of the same patch were highly correlated; cap

brightness: F34,105=4.50, p<0.001, chroma: F34,105= 2.89, p<0.001, breast brightness:

F34,105=3.26, p<0.001, chroma F34,105=2.93, p<0.001), and then averaged. Raw spectra were averaged for each patch per individual and hue measures were calculated from these averaged spectra.

Nesting

I monitored the nesting success and breeding behaviour of 50 breeding pairs of robins during the 2000/01 breeding season and 60 pairs during the 2001/02 season. The breeding activity of birds in each territory was determined by following territorial females continuously for about 20 min. This observation period was usually long enough to determine whether birds had begun nesting (pers. obs.). Each territory was visited at least every three days to determine locations of colour-banded individuals, and monitor

nesting activity and nest fates. A small number of nests (n=8 in 2000/01, n=9 in 2001/02) was inaccessible due to their position in the tree. At all other nests, each nestling was weighed once (between three and fourteen days of age) to 0.1 g. Age was recorded, or estimated if unknown by comparing body traits such as body size, size of tarsi, presence of wing feather shafts, degree of body down and whether the eyes had opened with the data for the same traits in nestlings of known hatching date. Nestlings (n=240) were banded with a metal band and a unique combination of three colour-bands, usually between five and eight days after hatching. A small blood sample (approximately 50 µl) was taken by brachial venipuncture and stored in 100% ethanol for parentage analysis.

When females paired with first-year males, it was sometimes difficult to distinguish between the sexes on the basis of plumage. In these cases, I determined bird sex from behavioural differences between the birds. Only females build nests, incubate eggs and brood offspring (Dowling 2003, Chapter 2). The sex of each bird was later confirmed using a molecular technique described in Griffiths et al. (1998) and Chapter 6.

Microsatellite analysis and paternity assignment

DNA was extracted from blood samples using a salting-out procedure (Bruford et al. 1992) and stored in TE. All individuals were genotyped at six loci (Pgm 1-4, Escmu6, Pocc6) to determine paternity (Hanotte et al. 1994, Bensch et al. 1997, Dowling et al. 2003b, Chapter 4). PCR conditions for each locus are described in Dowling et al. (2003b, Chapter 4).

Standard exclusion probabilities were calculated for each locus (Dowling et al. 2003b, Chapter 4). The general exclusion probability, in the case where the mother is known, for all 398 genotyped individuals was 0.9877.

Two methods were used to assign paternity: exclusion and a likelihood-based approach in CERVUS 2.0 (Marshall et al. 1998). Firstly, putative paternal genotypes were identified by subtracting maternal alleles from the genotype of each nestling, and then this putative

72 Chapter 5 Plumage ornaments

genotype was compared to that of the social father. In cases where the social male mismatched the nestling at one or more loci, the nestling was initially assumed to be extra-pair. A database containing the genotypes of potential fathers in the population was searched for males that possessed all the paternal alleles in the offspring. In cases where more than one potential extra-pair sire matched the genotype of the nestling, paternity was assigned based on parsimony; males in close proximity to the offspring’s territory (usually the direct neighbour) were considered more likely to be the genetic sire than more distant males (Double and Cockburn 2000).

To confirm that exclusion had accurately identified the genetic sires, a likelihood-based approach was used to assign paternity which accounts for possible genotyping errors and mutations. The natural logarithm of the likelihood ratio is called the LOD score (Marshall et al. 1998). The simulation program in CERVUS 2.0 was used to estimate the required critical difference in LOD scores between the first and second most likely candidate parent for assignment at a 95% (strict) and 80% (relaxed) confidence level. The number of candidate parents was set at 92 (estimate of number of possible fathers in the population = number of breeding males that were banded plus the number of males with territories directly on the perimeter of the study population), and the proportion of candidate parents sampled set at 0.93. The proportion of loci typed was 1, and the proportion mistyped set to 0.01 (which equals the proportion of offspring mismatching the mother at one locus; see results). Nestling genotypes were compared to genotypes of all potential fathers in the population, using LOD scores to rank the likelihood of a given male being the genetic father, and assigning paternity at >80% confidence. In all cases but two where paternity had been assigned using exclusion, it was also assigned at >80% confidence in CERVUS. In these two cases, CERVUS produced similar LOD scores for two potential fathers that matched the offspring at all loci without the required 80% confidence separating one male from the other. However, one of the potential fathers held the territory next to that of the offspring, whereas the other resided more than four territories away. The neighbouring male was assigned as the father because most extra- pair fathers live in neighbouring territories to that of the offspring (see results). Thus sires were identified for 44 out of 53 assigned extra-pair fertilisations.

Analysis of genetic diversity and pairwise relatedness

To assess individual genetic diversity at the six microsatellite loci, I calculated individual heterozygosity (number of heterozygous loci/total number of typed loci). For broods of mixed paternity, I compared heterozygosity of within-pair sires to their extra-pair counterparts, and of extra-pair chicks to within-pair chicks, using paired t-tests.

I calculated pairwise relatedness values between breeding birds in the population (Queller and Goodnight 1989) using Relatedness 5.0 (http://www.gsoftnet.us/Gsoft.html). In cases where females engaged in EPFs, the relatedness between the female and her social partner was compared to the relatedness between the female and her extra-pair mate using paired t-tests.

Statistical analyses

Estimating body condition

The average length of both tarsi, the length of the right wing, and head-bill length were entered as variables into a Principal Components Analysis (PCA), and the first principal component (PC1) was used as an index of body size. Separate analyses were conducted for each sex because tarsus, wing and head-bill lengths all differ between the sexes (Dowling 2003, Chapter 2). PC1 accounted for 52% of the variance in males and 44% of the variance in females.

A body condition index was calculated separately for each sex by taking the residuals of REML mixed model regressions of body weight (g) on body size (PC1). LOWESS smoothing on the scatterplots of body weight and PC1 for both sexes revealed that the relationship between the two variables was linear. Body weight of individuals does not change throughout the breeding season (Dowling 2003, Chapter 2), but male weight varies according to time of day. Thus, time of day was included as a fixed effect in the male body condition model. Residuals were calculated from linear mixed models

74 Chapter 5 Plumage ornaments

(REML), with individual identity as a random effect to account for individuals that were measured in both breeding seasons. These REML models were performed using the statistical package JMP 5 (2002).

Male reproductive success

The total reproductive success of a male is the sum of within- and extra-pair paternities. I investigated the influence of a number of paternal and maternal traits on male reproductive success, separating reproductive success into its individual components (within- and extra-pair success), and examining total reproductive success. In each model, the measure of reproductive success was the response variable in either a generalised linear model (GLM), or generalised linear mixed model (GLMM) (descriptions below). For each male, measures of within-pair success were 1) the number/proportion of offspring produced by his social partner for which he was the genetic sire, and 2) the number of cuckolding males that sired young in his nest (the fewer cuckolds, the more successful the social male). Measures of extra-pair success were 1) whether a male gained EPFs and 2) the number of extra-pair young each male produced. Total reproductive success of each male was 1) the total number of fertilisations a male gained and 2) the total number of genotyped offspring he sired that reached nutritional independence.

Three different sets of models were required for each measure of male reproductive success. The first set of models examined the relationship between male reproductive success during the 2000/01 breeding season and properties of male plumage after moult (paternal cap and breast patch length, brightness, hue and chroma of both red patches measured just prior to or during the subsequent 2001/02 season). Patch lengths were used rather than areas (length×width) because length measurements had higher measurement repeatabilities within seasons than width measurements (Table 1). Some of the six components of plumage colour were inter-correlated (Table 2), with either positive or negative correlations. Such negative correlations between colour components are expected in pigment colours because absorptance (i.e. pigment concentration) increases

chroma at the expense of brightness, and also shifts hue (Pryke et al. 2001b, S. Andersson pers. comm.). Breast hue was strongly correlated with breast chroma (square of correlation coefficient, r2 >0.5), and breast chroma was also related to breast brightness. First, I removed breast chroma from the subsequent statistical analysis to reduce the potential for multicollinearity. I then checked the other variables for multicollinearity by examining the condition indices calculated using the eigenvalues of a principal components analysis (see Quinn and Keough 2002). Eigenvalues ranged from 2.07 to 0.23 for the first five components, and condition indices were consistently below 30, indicating multicollinearity was unlikely (Quinn and Keough 2002).

The second set of models examined the relationship between the same male plumage properties (again excluding breast chroma) and reproductive success in 2001/02 (the breeding season following moult). The third set of models examined the relationship between male reproductive success in both seasons and a number of other variables measured in both seasons; i.e. male age (yearling or adult), age of mate (yearling or adult), paternal cap length and breast patch length, maternal cap length, paternal and maternal body size and condition.

Female traits, pairing and reproductive success

Using GLMMs, I tested for relationships between four female traits (adult female cap length, female age [yearling or adult], female body condition, and female body size), none of which were inter-correlated, and a number of different variables; a) the date at which a female initiated her first nesting attempt of the season, b) the total number of offspring successfully raised to nutritional independence, c) the relative weight of nestlings produced (controlled for age, see Dowling 2003, Chapter 2), and d) whether the female had EPFs. To determine whether females paired with males according to morphometrics, I also included measures of her social partner: the age of the social male, cap length, breast patch length, body condition and size.

76 Chapter 5 Plumage ornaments

To determine whether the sexes paired according to male plumage components, in another set of models (GLMs) I compared these four female traits with the red plumage of their within-pair male partners (cap and breast lengths, brightness, hue and chroma of caps and brightness and hue of breasts), the colour data of which were only available during 2001/02.

Generalised Linear Models (GLMs) and Generalised Linear Mixed Models (GLMMs)

In all models, the response variable followed either a normal, binomial or Poisson distribution and was analysed in GLMMs or GLMs with normal (identity link), binomial (logit link) or Poisson (logarithm link) error variances.

GLMMs were used for analyses containing data from both breeding seasons, to account for individuals that were present during both seasons. In these cases, when individuals were repeated more than once within the data-set, individual identity was included as a random effect. All other variables were included as fixed effects.

Full models were reduced by sequentially excluding non-significant interactions and main effects from the model. For the analysis of female age (a binary response variable), the dispersion parameter was fixed at 1. For other analyses with binomial or Poisson error variances, dispersion parameters were estimated at first. In cases of under-dispersion, the analysis was repeated, fixing the dispersion parameter at 1.

Statistical significance of fixed effects was assessed using Wald statistics compared to a χ2 distribution on the respective degrees of freedom. Some authors argue that the appropriate comparison is with an F distribution rather than a χ2 distribution (Côte and Festa-Bianchet 2000). Although comparison to a χ2 distribution may give liberal probability values, these values are generally robust for large sample sizes (GenStat 2002). By contrast, it is unclear how the denominator degrees of freedom should be calculated when comparing Wald statstics to an F distribution. The statistical package GenStat 6.0 (2002) compares Wald statistics to a χ2 distribution, whereas SAS 8.2 (2001)

uses the Satterthwaite method to calculate the denominator degrees of freedom for each fixed effect in a mixed model. I compared probability values derived from the two distributions for the normally distributed response variables (female cap length, body condition and body size), using mixed models with normal error variance and identity links. In all cases probability values were similar, and all significant probability values gained using the χ2 distribution were always significant using the F distribution.

GLMs were used for analyses containing spectral colour components because these data were collected in only one breeding season. Also, occasionally the random term in the above GLMMs equalled zero (with zero standard error), and when this occurred I reanalysed the data using GLMs. In GLMs, full models were reduced sequentially by excluding variables that did not explain a significant part of the deviance. These models were confirmed by re-including excluded variables, one at a time, into the final model to check that they did not explain a significant part of the deviation. For simplification, only variables with p < 0.1 are presented in the results.

Both GLMMs and GLMs were conducted using GenStat 6.0.

Results

Genetic mating system and paternity

Of 227 genotyped offspring, there were two cases where offspring alleles did not match those of their social mothers at one of the typed loci (once with Pgm 1 and once with Escmu6). I assumed these were mutations or typing errors because all other loci matched the nestling to the social mother. Thus, there was no evidence of intra-specific brood parasitism within the study population.

Twenty-three per cent of typed offspring were sired by extra-pair fathers, and 37% per cent of broods contained at least one extra-pair offspring. Extra-pair sires were commonly males holding neighbouring territories to the offspring in question (25 extra-

78 Chapter 5 Plumage ornaments pair sires were direct neighbours, 15 sires resided two territories from the offspring, three sires were three territories distant and one sire was four territories distant).

Condition-dependence of male plumage

Birds with high within-pair reproductive success in the 2000/01 breeding season moulted into more colourful plumage (brighter caps and breast patches, higher carotenoid- saturation of cap and higher breast hue) after the post-breeding moult at the conclusion of that season (Table 3a, Fig. 1a). Males that gained at least one EPF in 2000/01 tended to moult into brighter breast plumage with longer breast patches (Table 3b). Combining fertilisation success (within- and extra-pair), those males with the most fertilisations in 2000/01, moulted into the brightest breast patches at the conclusion of this season (Table 3c). Finally, males that sired a greater number of offspring reaching independence during 2000/01 moulted into brighter breasts (Fig. 1b) and longer, but less red, caps at the conclusion of that season (Table 3d).

Males in high body condition in 2000/01 tended to moult into brighter (GLM, t=1.89, n=20, p=0.076), more carotenoid-saturated caps (t=1.80, n=20, p=0.09) following the post-season moult. Following this moult, males with brighter (GLM, t=1.73, n=34,p=0.09) and redder (t=1.86, n=34, p=0.07) caps tended to be in better body condition during the subsequent 2001/02 breeding season (at least four months after moult).

Male plumage and reproductive success

In 2001/02, male plumage colour was unrelated to any component of reproductive success measured in the same season the birds displayed the plumage: within-pair, extra- pair or total reproductive success.

Correlates of male reproductive success

Combining data from both seasons, males in higher body condition had higher within- pair success than those in lower body condition (Fig. 2). Those paired to yearling females had higher within-pair success than those paired to older females (Table 4a). However, yearling females produced fewer fledglings that reached independence than adult females (GLM with Poisson error and logarithm link, dispersion fixed at 1: t=2.45, n=85, p=0.014). The body condition of a male was also related to the number of different extra- pair males that sired young in that male’s nests (GLMM, Poisson error, logarithm link, dispersion fixed at 1, random effect: male =0.0 s.e.=0.276, Wald =-6.17, p=0.013), with males in high body condition cuckolded by fewer individuals than males in poor body condition.

Older males (> 1 year) gained EPFs more often than yearling males (Table 4b).

Combining data from both seasons, there were no significant relationships between the total number of fertilisations that a male gained and any maternal or paternal variable, however older males tended to gain more fertilisations than yearlings (GLMM, Poisson error, logarithm link, random term: male =0.000, s.e.=0.132, dispersion estimate =1.730, Wald=3.054, p=0.081).

Older males sired more offspring that reached nutritional independence than yearlings (GLMM, Poisson error, logarithm link, random term: male =0.000, s.e.=0.201, dispersion estimate =1.465, Wald =4.776, p=0.029, Fig. 3). They also started nesting earlier in the season than did yearlings (REML, random effect =0.0, s.e.=0.0, Wald =-21.49, p<0.001).

Comparison of social males to their extra-pair counterparts

For broods with mixed paternity, I compared the paternal characteristics of the within- and extra-pair sires using paired t-tests. The sires of extra-pair nestlings did not have more colourful plumage (all colour components and patch sizes tested) than the sires of

80 Chapter 5 Plumage ornaments the within-pair nestlings of the same brood, and they were not larger or in better body condition. However, extra-pair males were more heterozygous than their within-pair counterparts (t=-2.316, n=33, p=0.027; extra-pair males: mean =0.6, s.e.=0.03, within- pair males: mean =0.51, s.e.=0.03), and tended to be more distantly related to the breeding female than did the social male (t=-1.915, n=32, p=0.065; extra-pair males: mean =-0.08, s.e.=0.04, within-pair males: mean= 0.02, s.e.=0.05). However, this did not result in extra-pair offspring being more heterozygous than the within-pair offspring in their own brood (t=-0.08, n=30, p=0.939).

Female traits, pairing and reproductive success

Female age

Individuals paired assortatively according to age, with yearlings more often pairing with yearlings and adults with adults (GLMM, binomial error, logit link, random effect: female =0.200, s.e.=0.968, Wald =8.13, p=0.004). There was a trend for adult females to be more likely to have more extra-pair fertilisations than yearling females (Wald =3.20, p=0.073). Adult females paired with adult males that had less red cap hues than adult males that paired to yearling females (GLM, binomial error, logit link, dispersion fixed, male cap hue: t=-1.91, p=0.045, Fig. 4). The five yearling females that paired to adult males were not larger than the adult females (t=-0.557, n=21, p=0.601), or in better body condition (t=-0.764, n=19, p=0.470). Furthermore, these yearling females did not produce more independent offspring than the adult females (t=0.478, n=31, p=0.649), but tended to start breeding later in the season than did the adults (t=-1.962, n=30, p=0.072).

The number of independent fledglings raised, date of first breeding and number of EPFs was compared for yearling and adult females in separate analyses. Adult females produced more offspring that reached independence (GLM with Poisson error and logarithm link: t=0.207, n=89, p=0.039), started breeding earlier in the season (REML, random effect: female ID=337.3, s.e.=150.1, Wald =4.94, n=86, p=0.026) and tended to engage in more EPFs than yearlings (GLMM with Poisson error and logarithm link,

random effect: female ID =0.374, s.e.=0.281, dispersion fixed at 1, Wald =3.79, p=0.052).

Female cap length

Females with longer forehead caps initiated their first nesting attempts of the breeding season earlier than those with smaller caps (Fig. 5), but produced lighter nestlings (Table 5). Larger-capped females tended to produce larger broods (random effect: female ID: 6.27, s.e.=1.71, brood size: Wald = 3.36, p=0.067).

Females with long caps also paired more often with yearling males than those with smaller caps. There was also an effect of season on cap size, with females generally possessing longer caps in 2000/01 than 2001/02 (Table 5).

Females with longer caps paired to males with shorter, but more carotenoid-saturated (higher chroma) caps (Table 6, Fig. 6).

Female body condition and size

Female body condition was unrelated to components of female reproductive success and to the plumage colour of a female’s social partner. Larger females paired to males with redder caps than did smaller females (Wald=7.35, p=0.007, Fig. 7.).

Table 7 summarises all correlations involving male plumage colour.

Discussion

Males with highest reproductive success in 2000/01 moulted into the most colourful plumage at the post-season moult. Also, males in high body condition in 2000/01 tended to moult into brighter, more carotenoid-saturated caps at the conclusion of the breeding season. Subsequently, a male’s plumage colour tended to be correlated with his body

82 Chapter 5 Plumage ornaments

condition even four to six months after moult, and throughout the following 2001/02 breeding season. Combined, these results suggest condition-dependence of male plumage. Additionally, plumage ornamentation appeared important in the formation of breeding pairs because females with larger caps and body size paired to males with higher cap hue and chroma values. Given these results, it was surprising that males that moulted into more colourful plumage following the 2000/01 season did not sire more within- or extra-pair offspring in the subsequent 2001/02 breeding season (while possessing their colourful plumage) than their duller counterparts. Instead, male reproductive success in the breeding season after moult was best explained by other factors, such as male body condition, age, and the age of the female social partner. In contrast, the length of the rufous forehead cap of adult females (which is also a carotenoid-based patch) was positively related to the number of offspring produced that reached nutritional independence.

Is male plumage condition-dependent?

The production of carotenoid-based ornamentation is often condition-dependent and such ornaments may therefore serve as honest signals of individual quality (reviewed in Hill 1999). However, previous studies of carotenoid-based ornaments have typically focused on seed- or plant-eating birds, and it is unclear whether their conclusions apply to insectivorous species.

In this study, the relationships between male reproductive success in 2000/01 and red plumage following the post-season moult were striking because most of the colour components in 2001/02 (cap and breast brightness, cap length and chroma, breast hue and patch length) were related to the previous season’s reproductive success. These relationships demand an explanation, and the most likely explanation is that male plumage colour provided a condition-dependent signal of male quality. A male’s plumage colour in 2001/02 reliably indicated his reproductive success in the previous breeding season (2000/01), suggesting males in high condition can produce many offspring within a breeding season and still moult into the most colourful plumage at the conclusion of the

season. Thus, although red-capped robins are insectivorous, red plumage in this species appears condition-dependent, which, in turn, suggests that deposition of carotenoids into the plumage is probably costly (either dietary limited or metabolically/ physiologically costly to metabolise/ process). Currently, the primary sources of carotenoid pigments in this species (i.e. the major arthropod prey species and their associated carotenoid profiles) are unknown.

Red-capped robins moult annually (pers. obs.) and it is assumed that deposition of carotenoids into plumage occurs only at moult (Hill 1999). Thus, red plumage in males represents a ‘historical state’ signal of quality at the time of moult. Any change in plumage colour after moult may only come about through feather abrasion (although this assumption requires further study). The post-breeding moult in red-capped robins at Terrick Terrick began immediately following the breeding season in late January and continued through February (DKD, unpublished data). Pair formation occurs soon after moult (all new pairs had formed by May when I returned to the site; few pairs are retained between seasons, Dowling 2003, Chapter 2) and at this time male plumage colour should be a reliable indicator to females of male quality.

Males in high body condition in 2000/01 tended to moult into brighter, more saturated caps. Cap colour still appeared to provide some information about male condition four to six months after moult since cap hue and brightness tended to be positively correlated with body condition of males during the subsequent 2001/02 breeding season. Thus, females may be able to gain some information regarding male condition or quality from plumage colour even four months after moult. However, these relationships were not statistically significant, indicating the relationship between plumage colour and male condition is probably strongest at moult (February), and decreases in strength in the months post-moult.

84 Chapter 5 Plumage ornaments

Do individuals pair according to quality?

Assortative pairing or mating occurs when individuals of high phenotypic expression (higher body condition, larger or more colourful ornamentation) pair or mate together more often than would be expected by chance. It is assumed that this phenotypic expression is an indicator of individual quality (Burley 1983). Such positive assortative mating with respect to red plumage colour has been shown in adult house finches (Hill 1993), northern cardinals (Jawor et al. 2003) and northern flickers (Wiebe 2000).

Male and female red-capped robins do not share the same plumage ornaments and so by definition cannot pair assortatively according to plumage. However, it appeared the sexes paired according to quality because the expression of some quality-related female traits was correlated with male cap colour and size. Larger females paired to males with redder caps and females with longer forehead caps paired to males with shorter, but more carotenoid-saturated caps in 2001/02 (n.b. there was no relationship between female cap length and male cap length in 2000/01). This suggests a possible trade-off between cap size and colour, which is expected if carotenoid acquisition and metabolism is costly. A small cap possessing identical amounts of carotenoids to a large cap will be more intensely coloured because the carotenoids are concentrated into a smaller area (Andersson et al. 2002). Given that females paired according to male cap hue as well as chroma, and that the relationship between female cap length and male cap length was inconsistent (only appearing in one season), it would appear that cap colour is more important than cap size in female choice. If so, there must be a threshold level for ornament size, otherwise it would be possible for males to cheat by investing in increasingly smaller caps that are more saturated in carotenoids.

Although male cap and breast colour both provided reliable signals of previous reproductive history, only cap colour tended to be related to body condition and females only paired with males according to cap colour. This raises the possibility that male cap and breast patches are subject to differing selection pressures. Females may choose partners based on their cap colour, which indicates male body condition. In contrast, male

breast plumage may, for instance, provide an intra-selected signal to other males of agonistic competitiveness and be used in territory disputes (males display breast plumage in territory disputes with neighbours, pers. obs.). Such a scenario would help explain why each component of cap colour is unrelated to the equivalent component of breast colour (see Table 2). Furthermore, the possibility exists that a trade-off may occur between investment in cap and breast colour: if carotenoids are limited, males may either allocate them into their caps or their breasts.

The sexes paired assortatively according to age, with adult females more likely to pair with adult males, and yearling females with yearling males. In house finches, age is the most important factor in mate choice, but assortative mating also occurs with respect to plumage colour (Hill 1993). In red-capped robins, yearlings of both sexes start breeding later in the season and produce fewer independent offspring than adults. Thus, adult birds would be expected to preferentially pair with other adults. However, it is difficult to explain why the cap hues of adult males paired to adult females were less red than those of adult males paired to yearling females. These yearling females were not larger or in better body condition than the adult females, and they did not produce more offspring than the adults; indeed, they tended to initiate their first nesting attempt of the season later than the adults.

It was also surprising that adult females with the longest caps were more likely to pair to yearling males than those with shorter caps. Although yearling males are phenotypically inferior to adult males (i.e. in female-like plumage), it is possible that females assess yearling quality on the basis of their ability to establish territories. There is some evidence that only the highest quality yearling males can establish and maintain territories within the study site (Dowling et al. 2003a, Chapter 3, 6).

Do the most colourful males produce the most offspring?

Males that moulted into more colourful plumage following the 2000/01 season did not gain greater within-pair, extra-pair or total reproductive success during the subsequent

86 Chapter 5 Plumage ornaments

2001/02 season, while possessing this plumage. This was surprising and inconsistent with other results of this study, which suggest that red plumage is condition-dependent and females paired with males based on cap colour. If red plumage in this species is costly to produce (as the results suggest), the most colourful males must gain some fitness benefits; otherwise the signal could not be maintained through sexual selection.

I considered a number of possible explanations for the lack of a relationship between male plumage colour in 2001/02 and reproductive success during the same season. First, it is possible that more colourful males do sire more offspring, through within- and extra- pair matings, even though I did not detect an effect in this correlative study. This analysis of male colouration versus reproductive success was conducted over a single breeding season, and extrinsic conditions unique to that particular year may have confounded any existing relationship that may have been revealed in a longer-term study (see Koenig and Dickinson 1996, Griffith et al. 2003 for examples of year-specific effects). Furthermore, nest predation has a major impact on reproductive success in this population (Dowling 2003, Chapter 2). It is likely that the probability of a nest being depredated is largely stochastic and independent of male quality-related traits such as plumage colour. Considering that the study was conducted over just one breeding season, it is possible that the random effects of nest predation in this population masked any relationships between plumage colour and reproductive success.

Alternatively, the effect size may be smaller than could be detected in my study. Males in higher body condition tended to have more colourful caps throughout the study. I found that body condition was related to male within-pair reproductive success, over both seasons, suggesting that with a larger sample size plumage colour may also be related to within-pair success. If so, experimental manipulations of male colour and patch sizes would increase the effect size and could reveal any causal relationship between male ornaments and reproductive success.

Alternatively, it is theoretically possible fitness benefits to colourful males may come solely through producing higher quality offspring that have higher reproductive value

(i.e. through pairing with the highest quality females) rather than producing more offspring. If colourful males pair with the highest quality females, then although they may lose some paternity when their social partners engage in EPFs, the proportion of offspring they do sire with this female may receive a high degree of maternal provisioning and inherit her ‘good genes’. If so, these offspring will have higher relative reproductive success as adults than birds produced by lower quality females. For instance, larger-capped females produce more offspring than females with smaller caps, and males with high cap chroma pair with these females. Assuming female cap size is inherited, female offspring of larger-capped females may inherit large caps and produce more offspring themselves as adults and thus colourful males may gain fitness benefits by pairing with such females.

‘Good genes’ models of sexual selection assume females will receive fitness benefits from colourful males, and predict that females paired to the most colourful males should remain faithful to them (Birkhead and Møller 1992). My analysis of sex allocation in red- capped robins suggests females may engage in EPFs to obtain genetic benefits for their offspring (Chapter 6). This does not necessarily imply that females paired to colourful, high quality males should always remain faithful. If colourful males possess ‘good genes’ coding for colourful plumage, then females paired to these males still acquire these genetic benefits for most of their offspring because females are fertilised by their social mate the majority of the time. However, females may engage in EPFs for reasons other than obtaining ‘good genes’, such as to gain fertility insurance or increase genetic diversity within their broods (Brown 1997, Birkhead and Møller 1992, Griffith et al. 2002). Indeed, when female robins engaged in EPFs, the extra-pair sires were more heterozygous (at the six microsatellite loci scored), and tended to be more distantly related to the females, than their within-pair counterparts, but this did not translate to extra-pair offspring being more heterozygous than within-pair offspring. Combined, these findings suggest that females seek EPFs to increase genetic diversity of their offspring but cannot assess the extent of genetic similarity between themselves and males (see Griffith et al. 2002). In such a scenario, male plumage colouration may still be

88 Chapter 5 Plumage ornaments

maintained by sexual selection if offspring of the most colourful males have higher reproductive value as explained above.

If sexual selection is acting on male plumage in this species, then it will be necessary to investigate the possibility that such plumage is intra- rather than inter-sexually selected. Females may gain direct fitness benefits from pairing with colourful males if the most colourful males provide more food to the female and offspring (see Andersson 1994). Alternatively, the most colourful males may be competitively dominant, holding the largest territories and the highest quality females may choose to pair with the most colourful males to gain the benefits of greater food resources available in their territories.

Previous studies that have examined the relationship between carotenoid-based plumage colouration of males and mating success have produced conflicting results. The house finch provides the best example of red, carotenoid-based plumage correlated with high reproductive success in males and the only clear example of inter-sexual selection (Hill 1990). Hill (1991) found that colourful males had a better chance of pairing. Among paired males, redder individuals paired with females that initiated nesting earlier (Hill et al. 1999), and produced more fledglings (McGraw et al. 2001a). EPFs occur in this species (8% of offspring in a Michigan population), but colourful males were not cuckolded less than duller males. However, it is currently untested whether more colourful male house finches gain greater numbers of EPFs (Hill 2002). Wolfenbarger (1999) found a similar relationship in northern cardinals, whereby redder males paired with earlier breeding females and obtained territories of higher quality. These two factors resulted in higher reproductive success for redder males, although it was unclear whether red plumage was maintained through intra- or inter-sexual selection.

Other studies have failed to find a relationship between expression of red plumage and reproductive success. Dale (2000) found that the plumage ornamentation of male red- billed queleas, Quelea quelea (which is partially based on carotenoid colouration), is not correlated with physical condition, age or reproductive success, but is instead a genetically determined phenotype that is unresponsive to environmental variation. In the

only previous studies that examined the role of red plumage in reproductive success in insectivorous birds, no relationship was found between red epaulet size or colour and male reproductive success in red-winged blackbirds (Weatherhead and Boag 1995), although early studies from captive birds suggest red epaulets may signal dominance (Eckert and Weatherhead 1987), and no relationship was found between plumage colour and hatching or fledging success in a hybrid population of the northern flicker (Wiebe and Bortolotti 2002). This study on flickers was complicated by the fact that the study organism was a hybrid between two sub-species that differ in their plumage colour with the hybrid being of intermediate colouration (thus the trait is unlikely to have an environmentally-determined component). In a study of red-collared widowbirds, Pryke et al. (2001b) used the number of active nests on a male’s territory and the date at which a female laid her first egg of the breeding season as general measures of male reproductive success. Tail length was a stronger correlate of reproductive success than collar colouration (although collar chroma and size were related to mating success). Tail length was also strongly indicative of body condition, while collar size was less strongly related. They concluded that female choice targets only tail length in these widowbirds (Pryke et al. 2001b), while the hue, and to a lesser extent size, of the red collar functions in male agonistic interactions and is intra-sexually selected (Pryke et al. 2001a, 2002).

With the exception of the research on red-winged blackbirds (Weatherhead and Boag 1995), none of the other studies measured overall genetic reproductive success by accounting for both within- and extra-pair success of males. This omission is worrying because EPFs occur in most bird species, including those with bi-parental care (Birkhead and Møller 1992). The EPF rate in red-capped robins was 23%, and EPF rates may reach 80% in some birds (Mulder et al. 1994, Hughes et al. 2003). When I reanalysed my data using putative measures of reproductive success (i.e. total nestlings produced, and total nestlings surviving to independence in a male’s nests) rather than true (genetic) reproductive success, there were no relationships between male reproductive success in 2000/01 and plumage colour post-moult, or between reproductive success in 2001/02 and plumage colour in the same season. Therefore, putative reproductive success is a misleading index of true reproductive success in red-capped robins. Whether it is a

90 Chapter 5 Plumage ornaments misleading index of true reproductive success in the species described above remains unclear. However, it is clear that EPFs may have a large influence on male fitness in many species.

Red plumage and colour perception in birds

Female robins paired to males according to cap colour, suggesting they can perceive differences in these long-wave (red) signals. It could be argued that birds are unable to discriminate differences in red plumage between individuals because of limitations in their visual systems (S. Andersson, O. Håstad, pers. comm.). Birds possess four photoreceptive cones, one of which is located in or near the ultraviolet (Ödeen and Håstad 2003). Comparison of signals from these photoreceptors makes it possible to perceive colours. Birds also possess oil droplets that enhance colour discrimination (Vorobyev 2003). Peak spectral sensitivities in the medium- and long-wave cones are much closer together in humans than birds, which means that humans may be able to discriminate between long-wave colours better than birds (Staffan Andersson, Olle Håstad, pers. comm.). In fact, humans are very good at detecting small differences in red hues (down to 1 nm) at about 560 nm (Staffan Andersson pers. comm.). In red-capped robins, forehead cap hue ranges between 583-604 nm, and breast hue between 585-600 nm (n=35). With these large differences of up to 21 nm between males, it is conceivable that individuals can discriminate amongst others on the basis of plumage hue.

What are the correlates of male reproductive success?

Although males possessing colourful plumage did not produce more offspring, other variables correlated with male reproductive success. Males in higher body condition had higher within-pair success and were cuckolded by fewer males than those in poor condition. The within-pair success of a male may be to a large extent determined by his female partner, with females choosing to mate extra-pair more often when their social mate is in poor condition. When mating extra-pair, the sire that fertilised the female appeared to be determined by three factors: male age (generally yearling males did not

gain extra-pair fertilisations), proximity of the extra-pair male (extra-pair sires were often territory neighbours) and genetic diversity (extra-pair males were more heterozygous and tended to be more distantly related to the breeding female than their within-pair counterparts).

Additionally, males paired to yearling females had higher within-pair success than those paired to adults, probably because yearling females tend to be less likely to engage in EPFs. Nevertheless, it is probably more beneficial for a male to pair with an adult female because adult females produce more offspring that reach nutritional independence.

Male age is the most important predictor of male extra-pair and total reproductive success. Adult males began breeding earlier in the year, were more likely to gain EPFs and produced more independent offspring. Yearling males sometimes did not establish territories within the study site until quite late in the breeding season, when they managed to acquire small territories between adult territories, which they defended and expanded in the subsequent season once they acquired adult plumage (pers. obs.). This delayed establishment of territories by yearlings suggests young birds must first learn behaviours involved in territory establishment and courtship, perhaps through experience and examination of the behaviour of their adult counterparts.

Female reproductive success

Adult females began breeding earlier in the season and produced more independent offspring than yearlings, which are inexperienced breeders. Adult females possessed forehead caps of varying sizes. Those with longer caps appeared to be the best-quality females; they began breeding earlier than others and early breeding resulted in a greater number of offspring reaching independence (Dowling 2003, Chapter 2). Paradoxically, larger-capped females produced lighter nestlings even though lighter nestlings are less likely to reach nutritional independence (Dowling et al. 2003a, Chapter 3). The nestlings of larger-capped females were lighter because these females began breeding earlier in the year and the relative weight of nestlings increases throughout the season (Dowling 2003,

92 Chapter 5 Plumage ornaments

Chapter 2). Additionally, larger-capped females tended to produce larger broods, and nestlings from larger broods are lighter (Dowling 2003, Chapter 2).

Conclusions

The red plumage of male robins appeared to be condition-dependent and conferred some mating benefits because males with the most colourful caps paired with seemingly high- quality females. However, this did not result in the most colourful males producing more offspring because females commonly engaged in EPFs that compromised the reproductive output of the social male. Instead, male body condition and age were important in determining male reproductive success. In contrast, the length of the rufous female cap, a carotenoid-based patch, was related to her reproductive success. Further long-term monitoring (including tracking the future reproductive success of offspring sired by males of varying degrees of redness), together with experimental manipulations, are required to quantify more precise fitness benefits of male plumage colour in this species and determine whether females gain benefits from pairing or mating with the reddest males.

Table 1. Relationship between repeated measurements of male ornamentation variables collected for birds captured and measured on multiple occasions within the same breeding season. Ornament measure r2 males p Cap length 0.81 17 0.000 Cap width 0.69 17 0.013 Breast patch length 0.77 17 0.002 Breast patch width 0.70 17 0.012

Table 2. Pearson correlation matrix of the six plumage colour components (n=35). Correlation coefficients between the same colour component of different patches (eg. cap hue vs breast hue) are emboldened. Bonferroni probabilities (p<0.05) are indicated with asterisks. Breast Breast Breast Cap bright Cap hue bright hue chroma Breast bright Breast hue -0.622* Breast chroma -0.682* 0.838* Cap bright 0.219 0.064 0.010 Cap hue 0.245 -0.023 -0.079 -0.155 Cap chroma -0.520* 0.300 0.305 -0.401 0.179

94 Chapter 5 Plumage ornaments

Table 3. Relationships between male reproductive success in 2000/01 and their plumage colour following moult. a. Within-pair reproductive success of males Model has binomial error distribution and logit link. Response variate = number of within-pair fertilisations, binomial total = total number of nestlings genotyped in that male’s nests; n=19, dispersion fixed at 1. b. Extra-pair success Binomial error with logit link. Response variate is whether male gained extra-pair fertilisations (binary), binomial total = 1; n=20, dispersion fixed at 1. Removal of either variable from the model results in a significant change in deviance in model. c. Total fertilisations Poisson error and logarithm link. Components with p < 0.1 included in table, but breast brightness alone represents final model; n=20, dispersion estimate = 1.56. d. Total number of sired offspring per male reaching nutritional independence Poisson error, logarithm link; dispersion fixed at 1 because of under-dispersion in model; n=20. a. Within pair GLM estimate SE Wald statistic P

Constant -485 205

Cap chroma 59.1 26.8 4.86 0.027 Cap brightness 0.00584 0.00281 4.32 0.038 Breast brightness 0.01049 0.00360 8.50 0.004 Breast hue 0.684 0.315 4.72 0.030 b. Extra-pair GLM estimate SE Wald statistic P

Constant -33.5 16.2 Breast brightness 0.00747 0.00407 3.35 0.067 Breast patch length 0.545 0.286 3.61 0.057 c. Total fertilisations GLM estimate SE Wald statistic P

Constant -1.874 0.952 0.065 Breast brightness 0.001598 0.000501 10.18 0.005 Cap chroma 14.36 7.90 3.31 0.087 Cap length 0.235 0.131 3.20 0.092 d. Surviving offspring GLM estimate SE Wald statistic P

Constant 48.6 27.3 Breast brightness 0.002680 0.000902 8.82 0.003 Cap hue -0.0982 0.0482 -4.16 0.042 Cap length 0.367 0.159 5.34 0.021

Table 4. Correlates of male reproductive success. a. Within-pair success GLMM of combined seasons. Model has binomial error distribution and logit link. Response variate = number of within-pair fertilisations, binomial total = total number of nestlings genotyped in that male’s nests. Random effect: male = 0.060 (s.e.=0.480). Dispersion estimate = 1.03. b. Extra-pair success GLMM combined seasons. Binomial error distribution, logit link. Response variate = Gained EPFs (binary). Random term: male = 0.000 (0.551). Dispersion fixed at 1.

a. Within-pair success GLMM estimate SE Wald statistic P

Constant 2.203 0.5436 Female age -1.1368 0.5766 3.887 0.049 Male body condition 1.384 0.4849 8.146 0.004 b. Extra-pair success GLMM estimate SE Wald statistic P

Constant -2.375 0.7638 Male age 1.7042 0.8010 4.5266 0.033

Table 5. Relationships between relative nestling weight, date of a female’s first nesting attempt of the season, male age and breeding season on female cap length. GLMM with normal error variance and identity link. Random effect: female identity =2.506 (s.e.=1.594).

Term Effect SE Wald P Constant 15.47 1.112 Nestling residual -1.118 0.4949 5.10 0.024 Date of first breeding -0.059 0.013 20.91 <0.0001 Male age -4.228 1.137 13.828 <0.0002 Season -1.809 0.6001 9.09 0.003

Table 6. Relationships between female cap length and plumage ornamentation of the male partner. GLMM with normal error variance and identity link. Random effect: female identity =2.824 (s.e.=1.031).

Term Effect SE Wald P Constant 10.12 0.396 Male cap chroma 43.71 19.514 5.02 0.0251 Male cap length -1.049 0.3399 9.52 0.0020

Table 7. Summary of relationships involving male plumage colour components. ++=significant positive relationship (p<0.05), +=positive relationship (p<0.1), - = significant negative relationship (p<0.05).

Colour component Condition-dependence Pair formation Reproductive output in 2001/02 Previous reproductive success Male condition (2000/01) Breast brightness ++ Breast hue ++ Cap brightness ++ + Cap chroma ++ + + Cap hue - + +

(a)

3000

2500 2000

1500 1000

500 0 0.2 0.4 0.6 0.8 1 Breast brightness post-moult Prop WP success 2000/01 (b)

3000 2500 2000 1500 1000 500 0 1234 Breast brightness post-moult # Sired young to indep 2000/01

Fig. 1. Male reproductive success in the 2000/01 breeding season and the subsequent brightness (RT, %) of breast plumage following moult at the conclusion of the breeding season. (a) The proportion of fertilisations each male gained from nestlings hatched in nests on his own territory in the 2000/01 breeding season, and the subsequent brightness of his breast patch following moult. WP = within-pair success, calculated by dividing the number of offspring sired by a male on his own breeding territory by the total number of offspring genotyped in nests on that territory. Note, the GLM algorithm uses weighted proportions, with a response and binomial total. (b) The total number of offspring sired by each male in 2000/01 that reached nutritional independence, and the subsequent brightness of the male’s breast patch following moult.

98 Chapter 5 Plumage ornaments

1 0.8 0.6 0.4 0.2 0 Proportion WP success -1 -0.5 0 0.5 1 1.5

Male body condition

Fig. 2. The proportion of fertilisations each male gained from nestlings hatched in nests on his own territory (within-pair success) and the body condition of that male. WP = within-pair success, calculated by dividing the number of offspring sired by a male on his own breeding territory by the total number of offspring genotyped in nests on that territory. Note, the GLM algorithm uses weighted proportions, with a response and binomial total.

1.8 n=74 1.47 1.4

1 n=14 0.6 0.84 Sired offspring 0.2

Yearlings Adults Male age

Fig. 3. The mean total number of offspring sired (both within- and extra-pair) that reached independence for yearling and adult males. Columns denote means ± standard error, and horizontal lines beside each column denote the GLMM predictions accounting for the influence of the random effect.

100 Chapter 5 Plumage ornaments

n=5 602 600 598 n=26 596 594 592 590 Male cap hue (nm) 588 Yearling Adult

Female age

Fig. 4. Mean cap hue (nm) of adult males paired to yearling and adult females. Bars indicate standard errors.

101

20 18 16 14 12 10 8 6

Female cap length 4 2nd 11th 21st 30th Aug Sept Oct Nov Date of first breeding

Fig. 5. The date at which each adult female initiated her first nesting attempt of the season, and the length of her forehead cap (mm).

102 Chapter 5 Plumage ornaments

(a)

11 5 7 9 11 13 15 17 Male cap length (mm) Female cap length (mm)

(b)

0.94

0.9

0.86

Male cap chroma 0.82 5 7 9 11 13 15 17

Female cap length (mm)

Fig. 6. Relationships between female cap length (mm) of adult females and plumage ornamentation of their adult male social partners in 2001/02. (a) cap lengths of females and of their male partners (b) cap lengths of adult females and the forehead cap chromas of their male partners.

103

610 605 600 595 590 585 580 Male cap hue (nm) -2 -1 0 1 2 3 Female body size

Fig. 7. Body size (PC1) of females and the forehead cap hue (nm) of their male social partners.

104 Chapter 6

Sex allocation in the red-capped robin

Abstract

Recent attention has focused on the ability of birds to bias the primary sex ratio of their broods. I investigated sex allocation in the red-capped robin (Petroica goodenovii), a bird with striking sexual dichromatism. Male robins are black and white with scarlet forehead caps and breasts, whereas females are buff-grey. Males and females form monogamous pairs, but extra-pair fertilisations occur. Although the overall population offspring sex ratio was at parity, sex allocation varied among broods. Extra-pair chicks tended to be male more often than female. Unexpectedly, yearling males (which possess female-like plumage) were more likely to sire sons than adult males in bright plumage. Adult females and yearling females in high body condition produced more sons than yearling females in poor condition. Sons were more likely to survive to nutritional independence than daughters when produced by adult females, but less likely when produced by yearling females. I propose that biased sex allocation in this species is maintained by differing production costs for each sex, and genetic benefits to females of producing sons when fertilised by males of high genetic quality.

Introduction

When the fitness returns of producing sons and daughters differ, sex allocation theory predicts that females will manipulate offspring sex to maximise the reproductive value of their progeny (Trivers and Willard 1973, Charnov 1982). Biased sex allocation can occur through differential mortality of offspring between fertilisation and independence, or through manipulation of primary sex ratios (Krackow 1995). Because of the Mendelian process of meiotic segregation, sex ratios should normally be at parity (Williams 1979). Although a mechanism has yet to be identified, departures from parity may potentially arise through the biased production of gametes or the selective resorption or discarding of

105 ova (Krackow 1995, Pike and Petrie 2003). In birds, females are the heterogametic sex (Ellegren 2000), so the potential for female control over primary sex ratios is increased.

There are now many examples of adaptive deviations from parity in primary sex ratios, many of which involve birds. These studies have demonstrated adaptive manipulation of offspring sex in response to a variety of factors. These include measures of parental quality, such as male secondary sexual characteristics (Ellegren et al. 1996, Sheldon et al. 1999) or survival (Svensson and Nilsson 1996, Sheldon et al. 1999) and maternal body condition (Bradbury and Blakey 1998, Nager et al. 1999) or age (Côté and Festa-Bianchet 2000), or ecological parameters such as local resource enhancement and competition (Komdeur et al. 1997), diet (Arnold et al. 2003), habitat quality (Suorsa et al. 2003) and laying date (Dijkstra et al. 1990, McIntosh et al. 2003). However, there are also many cases where biased sex allocation was predicted but not found (Bradbury et al. 1997, Hartley et al. 1999, Saino et al. 1999, Leech et al. 2001, Bonenfant et al. 2003).

Sex allocation is predicted to occur in species where variance in male reproductive success is greater than that of females (Trivers and Willard 1973), such as commonly occurs in polygynous species. However, it is now apparent that higher variance in male reproductive success is also a feature of many socially monogamous species because extra-pair fertilisations (EPFs) are often common in such species (Birkhead and Møller 1992, Kempenaers et al. 1997, Dowling Chapter 5). In such systems, female reproductive success is characterised by the number of offspring she raises to independence in her own nests. However, male success may be either compromised (if he is cuckolded by neighbouring males) or augmented (if he cuckolds males in other territories in addition to assuring paternity in his own nests).

When male variance in reproductive success exceeds female variance, and maternal investment has a strong effect on male quality, it is predicted that male offspring will gain greater fitness benefits from increased maternal care during the dependent period than female offspring (Trivers and Willard 1973). Thus, mothers in high body condition (and thus capable of providing a high level of maternal care) should produce more sons, while

106 Chapter 6 Sex allocation those in poor condition should overproduce daughters (Trivers and Willard 1973). Empirical studies have supported this prediction in ungulates (Clutton-Brock 1984, Sheldon and West 2004) and birds (Bradbury and Blakey 1998, Nager et al. 1999, Parker 2002, Whittingham et al. 2002).

Male birds often possess elaborate ornamentation that provides an honest signal of their quality. In such cases, a male’s reproductive success can be increased by enhanced expression of these ornaments (Andersson 1994). In terms of sex allocation theory, females can potentially use these ornaments to assess mate quality and thus the subsequent reproductive value of their offspring, and adjust nestling sex accordingly (Sheldon and Ellegren 1996). Females mating to highly ornamented, high quality males should produce male offspring, assuming their male offspring inherit ‘good genes’ for elaborate ornamentation and have higher subsequent fitness as adults relative to other males. Conversely, females mating with poorly ornamented, poor quality males should produce female offspring.

Studies examining the effect of male ornamentation and quality on sex allocation have produced conflicting results. In blue tits, Parus caeruleus, positive correlations were found between brood sex ratios (proportion of males per brood) and male survival prospects (Svensson and Nilsson 1996), and the ultraviolet (UV) crown plumage colouration of male mates (Sheldon et al. 1999). Indeed, Sheldon et al. (1999) found that female blue tits had remarkable control over their primary sex ratios, with variation in sex ratios also explained by laying date and nesting area. Nevertheless, Leech et al. (2001) found no effect of parental quality (as indicated by morphometrics, feather mite loads, time of breeding or parental survival) on brood sex ratios in a separate population of blue tits. However, that study did not examine the effect of UV plumage colouration on sex allocation. In a third study of blue tits, Griffith et al. (2003) found that male crown UV colour, time of breeding, clutch size and female age all affected sex ratios in some years but not others, indicating that conclusions from such studies should be based on multiple years of data. A positive relationship between offspring sex ratios and paternal ornamentation was also found in collared flycatchers, Ficedulla albicollis (Ellegren et al.

107 1996), but no relationship was found between sex ratios and male quality in barn swallows, Hirundo rustica (Saino et al. 1999).

If it is costly for females to engage in EPFs (Birkhead and Møller 1992), then such fertilisations will only be beneficial if the resulting offspring are of higher reproductive value than within-pair offspring. Thus, it is predicted that extra-pair mates are better (higher quality or better genetic compatibility with the female) than within-pair mates, and that females fertilised by extra-pair males should therefore produce males (Leech et al. 2001). Kempenaers et al. (1997) reported that in nests with mixed paternity, blue tit offspring sired by extra-pair fathers were more often male than those sired by their social father. However, nestlings could only be sexed with 86% accuracy (Kempenaers et al. 1997). A subsequent study of the same species using molecular markers to assign sex (Leech et al. 2001) found no relationship between paternity source and sex ratio. Likewise, studies of other species in which the males gain EPFs have found no relationships between paternity source and sex ratios (Westneat et al. 1995, Sheldon and Ellegren 1996, Westerdahl et al. 1997, Saino et al. 1999, Magrath et al. 2002). Thus, no study to date has found a clear relationship between paternity source and biased sex allocation.

I examined sex allocation in the red-capped robin, Petroica goodenovii, a sexually dichromatic species. In this socially monogamous species there are high levels of EPFs (23% of nestlings, 37% of broods; Chapter 5) and thus males have greater variance in reproductive output than females. The species is also strikingly sexually dichromatic (males are more colourful) and both sexes exhibit delayed plumage maturation, moulting into adult plumage at the end of their first year. These characteristics suggest potential differences in the costs and benefits of producing each sex under different conditions, and thus make the red-capped robin an excellent model with which to test sex allocation theory.

108 Chapter 6 Sex allocation

Methods

Study site

The study was conducted at Terrick Terrick National Park (36º 10’ S, 144º 13’ E), located in the northern plains of Victoria, Australia. The park includes a dry, open woodland section of about 2500 ha dominated by white cypress-pine (Callitris glaucophylla) and grey box (Eucalyptus microcarpa). Annual rainfall is about 400 mm (LCC 1983). White cypress-pine woodland within the park appears to be saturated with red-capped robin breeding territories (Dowling et al. 2003a, Chapter 3).

Bird capture, measurement and observations

I monitored the nesting success and breeding behaviour of 50 breeding pairs of robins during the 2000/01 breeding season and 60 pairs during the 2001/02 season. Birds (n=158) were caught in mist-nets and banded with a unique combination of colour rings to permit individual identification. A small blood sample (70µl) was taken by brachial venipuncture and stored in 100% ethanol for subsequent DNA microsatellite parentage analysis. The length of the right tarsus and the distance from the back of the head to the tip of the bill (head-bill length) were measured with callipers to 0.01 mm, and the length of the right wing to 0.5 mm with a butted rule. The weight of each bird was measured to 0.1 g using a spring balance. These measurements were used to calculate indices of body size and body condition for each sex (described in Chapter 5).

Plumage ornamentation was scored for each captured bird. The species is sexually dichromatic, with birds moulting into adult plumage at the end of their first year. Adult males have black and white plumage and possess scarlet forehead and breast patches. Adult females are predominantly buff-grey, with rufous forehead patches. Yearling birds of both sexes resemble adult females, but yearling females do not possess forehead patches. For each captured bird, the length of each plumage ornament (forehead patch in adult females and yearling males, forehead and breast patch in adult males) was measured

109 to 0.01 mm. During the 2001/02 breeding season, the red plumage components of adult males were also measured using reflectance spectrophotometry (details in Chapter 5).

The breeding activity of birds in each territory was determined by following territorial females continuously for 20 min. This observation period was sufficient to determine whether birds had begun nesting. Each territory was checked at least every three days to determine presence of nesting activity and stage of nesting. Once found, nests were checked every three days to determine their fate. Each nestling was weighed once (anytime between three and fourteen days) to 0.1 g. Age was recorded, or calculated if unknown by comparing body traits such as body size, size of tarsi, presence of wing feather shafts, degree of body down and whether the eyes had opened with data for the same traits in nestlings of known hatching date. Nestlings (n=240) were banded with a unique combination of three colour-bands, usually when they were around six to eight days old. A small blood sample (50µl) was taken by brachial venipuncture and stored in 100% ethanol for subsequent molecular sex determination and paternity assignment.

Once fledged, colour-banded juvenile robins were monitored every three to five days in their natal territories until evicted by their parents. Juveniles reached nutritional independence three to four weeks after fledging (Dowling 2003, Chapter 2). At this stage, parents stopped feeding and began to actively chase away begging fledglings. If juveniles disappeared from their natal territories within two weeks of fledging (before they could forage independently), I assumed they had died. Juveniles that disappeared following parental aggression three or four weeks after fledging were assumed to have reached nutritional independence and dispersed.

Nestling sex determination

DNA was extracted from blood samples using a salting-out procedure (Bruford et al. 1992). The sex of each nestling was determined by Polymerase Chain Reaction (PCR) amplification of introns in two homologous genes (CHD-W and CHD-Z) using the P2/P8 primer pair (Griffiths et al. 1998). PCRs consisted of about 40 ng DNA, 1.5 µl of each

110 Chapter 6 Sex allocation

dNTP (2 mM, Promega), 1.5 µl of 10x PCR buffer (Promega), 3 µl MgCl2 (25 mM), 1.6 µl each of P2 and P8 primers and 0.15 µl of Taq polymerase (5U/ µl, Promega) in a total volume of 15 µl. Each reaction was overlaid with a drop of mineral oil. PCR conditions were as follows: initial denaturation at 94ºC for 2 min, then 35 cycles of denaturation at 94ºC for 1 min, annealing at 55ºC for 1 min and extension at 72ºC for 1 min, followed by a final extension at 72ºC for 10 min. PCR products were separated by electrophoresis at 110 V for 1 hour on 2% agarose gels stained with ethidium bromide and visualised by UV-trans-illumination. This technique was verified by testing it on adults of known sex (one male and one female) on each gel (different adults used for each gel, 24 adults in total). Adult red-capped robins are sexually dichromatic and can be sexed reliably according to plumage differences.

Extra-pair paternity

Details of molecular methods and paternity assignment are described in Chapter 5.

Data analysis

Male plumage colouration

Reflectance spectra measured from the red plumage patches of males were separated into three signal components: brightness, hue (colour) and chroma (absorbance). The calculation of these signal components is described in detail in Chapter 5.

Overall nestling sex ratio

The observed number of male and female nestlings was compared to parity using a G-test with William’s correction factor (Fowler et al. 1998).

111 Generalised Linear Mixed Models

Generalised linear mixed models (GLMMs) were used to investigate patterns of sex allocation. These models allow patterns to be explored at the level of the individual after accounting for variation attributable to differences between broods and mothers. Nestling sex was fitted as the response variable and analysed with a binomial error structure (female = 0, male = 1) and logit link function. Breeding females may produce multiple broods per season (Dowling 2003, Chapter 2). Thus brood identity nested within female identity was fitted as a random effect. The dispersion parameter was fixed at 1 because the response variable was ‘ungrouped binary’ data; thus the residual deviance does not have a χ2 distribution and over- and under-dispersion cannot be estimated from the data (Graham Hepworth, pers. com.). The influence of a number of predictor variables were then tested as fixed effects. Statistical significance of the fixed effects was assessed using Wald statistics, which approximately follow a χ2 distribution on the respective degrees of freedom. When using the χ2 distribution, all of the statistics are correct asymptotically, and when the dispersion parameter is fixed at 1, it is preferable to use the χ2 rather than the F distribution (Graham Hepworth, pers. com.). Probabilities are estimated here using a χ2 distribution and an a priori significance criterion (α) of 0.05. GLMMs were performed in the statistical package GenStat version 6.

It was necessary to fit three models because of the structure of the data. Most variables were collected over two breeding seasons, but male plumage colour was measured only in 2001/02. The data collected over two seasons were unbalanced. There was only one case where a yearling male gained an EPF and, therefore, ‘male age’ and ‘paternity source’ (i.e. whether the sire was within-pair or extra-pair) were analysed in separate models.

The first model contained fixed effects for which data had been collected during both breeding seasons: male age (yearling, adult), the age of the mother (yearling, adult), breeding season (2000/01, 2001/02), date the egg was laid, maternal and paternal body size and condition, brood size, relative nestling weight (residual of nestling weight on

112 Chapter 6 Sex allocation age; see Chapters 2, 3), whether the nestling fledged and survived to nutritional independence (termed ‘independence’), the length of the mother’s forehead cap, and the lengths of the genetic sire’s forehead and breast patch. Interactions between terms were also tested. The second model was identical except ‘male age’ was replaced with ‘paternity source’.

In the third model, all of the above variables were tested as fixed effects, as well as measures of the spectral components of male plumage that had been collected in 2001/02. These were: brightness, hue and chroma of the red forehead cap, and brightness and hue of the breast patch (see Chapter 5 for explanation of why breast chroma was omitted from the analysis). None of these spectral variables were related to sex allocation and, in fact, none of the other variables that had been related to nestling sex in the previous models were related to nestling sex allocation in this model. This suggests low statistical power of this model, and thus only the models representing data from both seasons are presented in the results.

In each model, non-significant terms were dropped one at a time from the model, starting with the least significant interactions, followed by the least significant main effects. For simplicity, only the final model is presented.

Results

Male robins had higher variance in reproductive success (coefficient of variation = 92.5) than females (coefficient of variation = 76.5).

The overall sex ratio of nestlings did not differ from parity (females = 126, males = 114, Gadj = 0.6, d.f. = 1, p>0.05).

113 Correlates of nestling sex

A number of variables were related to nestling sex. The age of the genetic sire was related to offspring sex; yearling males were more likely to produce sons than adult males (Table 1, Fig. 1a). Additionally, nestlings resulting from extra-pair fertilisations tended to be male more often than those resulting from within-pair fertilisations (Table 2, Fig. 1b), with this result approaching statistical significance.

Overall, adult females tended to produce more sons than yearling females. However, there was also an interactive relationship of maternal age and maternal body condition on offspring sex. Yearling females in high body condition were more likely to produce sons than those in low body condition, while it appeared that adult females in low body condition tended to produce more sons than those in high body condition (Table 1, 2, Fig. 1c). To further explore this interaction, I conducted separate GLMMs for yearling and adult females. Yearling females in high condition produced more sons than those in poor condition (Wald=5.56, p=0.018) but there was no statistical difference in sex allocation between adult females in high and low condition (Wald=2.17, p=0.141).

There was also an interaction between female age and whether the offspring reached nutritional independence on sex allocation (Table 2, Fig. 1d). Sons of yearling females tended to be less likely to reach nutritional independence than daughters (Wald=2.75, p=0.097). Conversely, among adult females, sons were more likely to reach independence than daughters (Wald=8.37, p=0.004).

Finally, there was a relationship between breeding season and sex allocation, with more males produced than expected in 2001/02 than 2000/01 (Table 1).

Recruitment, morphometrics and mating success of yearling versus adult males

At the onset of, and during, the 2000/01 breeding season, nine yearling males were recruited into the study site, all of which retained these territories as first-year adults for

114 Chapter 6 Sex allocation the subsequent 2001/02 season. I was unable to determine how many adult males were newly recruited into the site at the onset of 2000/01; however, during this season five incoming adults established territories. One of these was not colour-banded, and of the other four, none of these retained their territories for the subsequent 2001/02 season.

At the onset of the 2001/02 breeding season, and during this season, ten adult males were newly recruited into the study area compared to nine yearlings. Only three of the adults retained their territories for the 2002/03 season, while five of the yearlings retained their territories. During the 2002/03 season, twelve incoming adult males recruited into the study area compared to six yearlings. Overall, incoming yearlings were more likely to retain their territories for the subsequent breeding season than incoming adult males (GLM, response = retained territory [binary], t = -2.96, n = 31, p = 0.003).

Yearling males tended to be in poorer body condition (GLMM with binomial error, logit link, response variable = male age, random effect: male identity = 0.298, [s.e. = 1.002], dispersion fixed at 1, fixed effect: male body condition: Wald=2.91, p=0.088) and smaller (Wald=5.32, p=0.021) than males in adult plumage, independent of year. I monitored yearling males from 2000/01 that remained in the study site the next season as first-year adults. There was a positive relationship between body condition of these males as yearlings and as first-year adults (r2=0.627, n=6, p=0.037), and size as yearlings and first-year adults (r2=0.644, n=6, p=0.034). First-year adult males had smaller forehead caps (separate variance t-test: t=-3.158, n=24, p=0.008) and breast patches (t=-3.444, t=24, p=0.008) than older adults (≥ 2 years old). However, these first-year adults produced more offspring in their own territories (within-pair offspring) that reached independence than older males (t=2.088, n=27, p=0.053).

Discussion

Multiple factors were related to sex allocation in the red-capped robin, suggesting females may have a fine-tuned ability to manipulate offspring sex. Sex allocation was related to a combination of paternal and maternal characteristics.

115 Paternity and male quality

Nestlings fathered by extra-pair sires tended to be male more often than those fathered by within-pair sires. To my knowledge this is the first study to employ robust (molecular) methods to assign offspring sex and find that sex allocation may be related to the source of paternity. This result approached statistical significance, and is worthy of future experimental investigation.

Recent studies have tested the prediction that paternity source affects offspring sex. However, with the exception of some preliminary data on blue tits (Kempenaers et al. 1997), later refuted by another study on the same species (Leech et al. 2001), no study has found that paternity can influence sex allocation (Westneat et al. 1995, Sheldon and Ellegren 1996, Westerdahl et al. 1997, Saino et al. 1999, Magrath et al. 2002). Some authors have suggested that the lack of an expected correlation occurs because selection on sex allocation may not be accurate enough to target individual eggs (Leech et al. 2001). For instance, selection may be weak if extra-pair copulations (EPCs) do not always result in fertilisations. However, my study suggests that such mechanistic constraints are not necessarily always present.

There are several possible reasons why paternity source may relate to sex allocation in the red-capped robin. Females may perceive extra-pair mates to be of higher genetic quality than their social partners. Extra-pair fathers do not provide the females with any apparent direct fitness benefits (pers. obs.), thus any advantages to a mother of engaging in EPCs are presumably genetic. These genetic benefits may accrue if an extra-pair male has more elaborate ornamentation than the within-pair male, and this trait is inherited by his sons. Some studies have shown that offspring sex ratios of more highly ornamented or better-quality males can be male-biased (Ellegren et al. 1996, Sheldon et al. 1999). I found no such effect in red-capped robins. Instead, I found that extra-pair fathers were more heterozygous (at six microsatellite loci measured) and tended to be more distantly related to social females than their within-pair counterparts (Chapter 5). This indicates that females may mate with extra-pair males to gain increased genetic diversity for their

116 Chapter 6 Sex allocation offspring and, when fertilised by such males, overproduce sons. In turn, this suggests that sons gain greater fitness benefits from increased heterozygosity than daughters, but this remains to be tested. Another potential reason why females may mate with extra-pair males is that an extra-pair male’s genotype may be more compatible with the genotype of the female than the social male’s genotype (Welch 2001, Colegrave et al. 2002, Kraaijeveld-Smit et al. 2002, Freeman-Gallant et al. 2003), and females may produce more sons when mating with highly compatible males. However, I found no evidence of mating according to genetic compatibility (Chapter 5). Finally, sex-by-genotype interactions are known to occur in insects, where certain genotypes provide high fitness to male offspring and low fitness to female offspring, and vice versa (Rand et al. 2001). If this finding can be generalised to vertebrates, mating with the social partner could provide females with differing genetic benefits for sons or daughters in comparison to matings with extra-pair males.

It is unclear why I found a relationship between paternity source and sex allocation, while studies of other species have not. The red-capped robin was an excellent model species to investigate sex allocation theory because it is sexually dichromatic, males engaged in EPFs and therefore had higher variance in reproductive success than females, and extra- pair males were more heterozygous than their within-pair counterparts. However, the blue tit also fulfils all of these criteria (Delhey et al. 2003, Foerster et al. 2003), making it an apparently equally suitable candidate to investigate this question, but there has been only limited, unconvincing evidence to suggest that extra-pair nestlings are more often male (Kempenaers et al. 1997). Likewise, other species studied are sexually dimorphic, with males engaging in EPFs (Westneat et al. 1995, Sheldon and Ellegren 1996, Westerdahl et al. 1997, Saino et al. 1999, Magrath et al. 2002), but no relationships were found between paternity source and sex allocation. This tends to suggest that selection may not be accurate enough to target individual eggs in these species (which may, for instance, occur if EPCs do not predictably result in EPFs in these species), whereas it may be accurate enough to do so in red-capped robins. It is possible that the difference in clutch size between red-capped robins and these other species may explain why the relationship between sex allocation and paternity source occurs only in red-capped

117 robins. Because red-capped robins have small clutches relative to these other passerines, it is possible that female robins are better able to monitor and predict the paternity of their eggs (i.e. which eggs are fertilised by extra-pair sires). Alternatively, unlike red-capped robins, in the other species studied, the indirect (genetic) fitness benefits of being sired by extra-pair males may be equivalent for both daughters and sons (i.e. both sexes benefit from inheriting ‘good genes’ or ‘genetic diversity’).

Surprisingly, yearling males (which resemble females) were more likely to produce sons than adult males. This is not necessarily inconsistent with the idea that females adjust sex allocation according to the genetic quality of the sire. For example, females could assess the genetic quality of yearling males on the basis of their ability to procure breeding territories during their first year as breeders. Most territory vacancies were filled by incoming adult males. Only relatively heavy nestlings survive to nutritional independence (Dowling et al. 2003a, Chapter 3) and with few available territory vacancies for incoming juveniles, presumably only the highest-quality yearlings can successfully compete with adult males for these territories. Although more adult than yearling males were recruited into the study area, yearling males were more successful at retaining their breeding territories between seasons than newly recruited adult males. In particular, all of the yearlings recruited in 2000/01 successfully defended their territories for the subsequent breeding season, when they were in adult plumage (i.e. as first-year adults). Furthermore, these first-year adults produced more within-pair offspring that reached nutritional independence than older adults, suggesting they were indeed high quality. However, countering these arguments, yearling males tended to be in poorer body condition and were smaller than adult males within the population, and once they moulted into adult plumage in 2001/02 they had shorter forehead caps and breast patches than other older adult males that were at least two years old. Thus, overall, yearling males tended to be phenotypically inferior to older males, but they were more successful at retaining newly recruited territories and had higher within-pair success as first-year adults than older males and these two factors suggest these yearling males may have been high-quality.

118 Chapter 6 Sex allocation

Female quality

The maternal condition hypothesis (Trivers and Willard 1973) predicts females should allocate offspring sex according to their own body condition, assuming one sex has higher variance in reproductive success and is thus more costly to produce than the other. Initial studies of ungulate species revealed maternal condition can affect sex allocation, with mothers in good condition producing male offspring (eg. Clutton-Brock et al. 1984, Kruuk et al. 1999) and it was recently demonstrated that maternal age can also influence sex allocation (Côté and Festa-Bianchet 2000). Studies have also revealed that maternal condition can be an important factor in sex allocation in avian species, with the most costly sex over-produced when mothers are in high condition (Bradbury and Blakey 1998, Nager et al. 1999, Parker 2002, Velando 2002, Whittingham et al. 2002).

In this study, maternal characteristics were related to sex allocation and patterns in offspring survival. Adult females (regardless of condition) and yearling females in high body condition produced more sons than yearling females in low condition. Yearling females were relatively unsuccessful at raising sons to nutritional independence; most of their sons perished while their daughters survived to independence. In contrast, the sons produced by adult females were more likely to survive to independence than daughters.

Combined, these results suggest that sons may be more costly to produce than daughters, (which is probably a consequence of the differential variance in reproductive success between the sexes – see below). Since yearling females are inexperienced breeders, decreases in condition among yearlings may be more physically costly than among experienced breeders. Among yearlings, generally only those in high condition produced sons, suggesting those in low condition could not afford to raise sons. Adults are experienced breeders and the trends between body condition and sex allocation in this age class were predictably much weaker. Additionally, sons raised by yearling mothers were less likely to survive to independence than daughters, suggesting a potential cost. In contrast, adult mothers were more successful at raising sons than daughters, suggesting they may invest more into sons than daughters. This may relate to differential variance in

119 reproductive success between the sexes. Males have higher variance in reproductive success than females. Thus, sons will benefit if they receive increased investment as juveniles, assuming that increased parental care during the dependent stage positively affects future offspring fitness (Trivers and Willard 1973). In contrast, future reproductive success of daughters may be less dependent on parental investment because more females have the opportunity to breed (females have lower variance in reproductive success). Consequently, adult females may concentrate on producing and raising high quality sons which will have high relative fitness as adults. In contrast, yearlings, particularly those in low condition, may preferentially produce and raise daughters because, regardless of quality, these daughters will probably have higher relative, future fitness than the sons they are capable of producing.

Conclusions

Biased sex allocation in this species appears to be maintained by two factors; differing production costs for sons versus daughters, and genetic benefits to females of producing sons when fertilised by males of high genetic quality. This study provides some evidence that nestlings sired by extra-pair fathers were more likely to be male, and also found, unexpectedly, that offspring sired by yearling males were more often male. Both of these results suggest that females may acquire genetic benefits for their offspring by producing sons when mating with such males. Furthermore, several relationships involving maternal age and body condition suggest that sons are more costly to produce than daughters, and good quality mothers may be investing more into production of sons than daughters, possibly to increase the reproductive value of their male offspring relative to other males.

120 Chapter 6 Sex allocation

Table 1. Influence of paternal, maternal and environmental variables on sex allocation; model 1: with male age Generalised Linear Mixed Model (binomial error, logit link) describing final model of variables (fixed) related to nestling sex allocation in the red-capped robin. Random effect: female ID[brood]=0.454 (s.e.=0.656). Term Effect s.e. W P Female age*maternal BC -3.181 1.076 8.75 0.003 Female age 0.859 0.465 3.42 0.064 Male age -1.633 0.687 5.65 0.017 Season 0.830 0.402 4.27 0.039

Table 2. Influence of paternal, maternal and environmental variables on sex allocation; model 2: with paternity source Generalised Linear Mixed Model (binomial error, logit link) describing final model of variables (fixed) related to nestling sex allocation in the red-capped robin. Random effect: female ID[brood]=0.494 (s.e.=0.716). Term Effect s.e. W P Female age*maternal BC -2.400 1.103 4.72 0.03 Female age*independence 2.639 0.872 9.16 0.002 Paternity source 0.882 0.467 3.56 0.059 Season 0.771 0.417 3.41 0.065

121

0.9 n=18 0.8 0.81 0.7 0.6 n=150 0.5 0.45 0.4 0.3 0.2

Mean offspring sex 0.1 0 Yearling Adult

Male age

Fig. 1a. Offspring sex for nestlings sired by yearling (< 1 year old) and adult (> 1 year old) males. Columns denote means (± 1 standard error) of raw data and sample sizes are indicated above each column. Mean offspring sex ranges from 0 (0% males produced) to 1 (100% males produced). Horizontal lines beside each column, with values, denote GLMM predictions.

122 Chapter 6 Sex allocation

0.8 n=39 0.7 0.67

0.6 n=132 0.5 0.45 0.4 0.3 0.2 Mean offspring sex Mean offspring 0.1 0 Within pair Extra pair Sire

Fig. 1b. Offspring sex for nestlings sired by their social father (within-pair) and those sired by extra-pair males. Columns denote means (± 1 standard error) of raw data and sample sizes are indicated above each column. Horizontal lines beside each column, with values, denote GLMM predictions.

123

0.8 n=23 0.7 n=66

0.6 n=57 0.5

0.4 n=22 0.3 0.2

Mean offspring sex 0.1 0 Low BC High BC Low BC High BC Yearling female Adult female

Fig. 1c. Mean offspring sex (± 1 standard error) for nestlings sired by yearling (< 1 year old) and adult (> 1 year old) females in low and high body condition. Sample sizes are indicated above each column. Body condition in the analysis was a continuous variable, but was categorised in this figure to show the trend. Females with body condition values greater than 0 (heavier than expected for their weight) were classified as having high body condition (High BC), and those with negative values (lighter than expected for their weight) classified as having low body condition (Low BC). The probability value was derived from the GLMM.

124 Chapter 6 Sex allocation

0.8 0.74 n=25 0.69 n=69 0.7

0.6 0.48 0.5 n=57 n=20 0.4 0.33 0.3 0.2 0.1 Mean offspring sex 0 Deceased Indep Deceased Indep

Yearling female Adult female

Fig. 1d. Mean offspring sex (± 1 standard error) for nestlings produced by yearling (< 1 year old) and adult (> 1 year old) females that disappeared (assumed Deceased) before reaching nutritional independence and survived to independence (Indep). Sample sizes are indicated above each column. Horizontal lines beside each column, with values, denote GLMM predictions.

125 126 Chapter 7

General discussion

The findings reported in this thesis contribute both to our understanding of sexual signalling and sex allocation theory in general, and the breeding biology of red-capped robins in particular. Below, I highlight the most important findings of my research and offer suggestions for future research.

Plumage ornaments and reproductive success

Many aspects of carotenoid-based plumage ornamentation in both male and female red- capped robins were correlated with reproductive parameters (previous reproductive history and pair formation but not reproductive output in males; reproductive output in females), suggesting such plumage is sexually selected. Previous studies have provided similar evidence of condition-dependence and sexual selection of red, carotenoid-based plumage in plant-eating species (Hill 1990, Wolfenbarger 1999, Pryke et al. 2001, McGraw et al. 2001, Pryke et al. 2003), but this is the first to find such relationships in an insectivorous species (research on two previous insectivores found no relationship). This enables previous results to be generalised somewhat because my study suggests that carotenoids can either be limited in the diet or costly to metabolise into plumage, even in insectivores.

Most previous studies of red plumage have used fitness measures that indicate putative rather than true (realised) reproductive success (but see Weatherhead and Boag 1995), and this may be problematic if EPFs are common in these species. For instance, relationships I found between male reproductive success in 2000/01 and plumage colour post-moult (partitioning paternity into its within- and extra-pair components) disappeared when I reanalysed my data using putative measures of reproductive success (i.e. total

127 nestlings produced, and total nestlings surviving to independence in a male’s nests). Thus, putative reproductive success is a misleading index of true reproductive success in red-capped robins. Whether it is a misleading index of true reproductive success in other species studied that express red plumage remains to be seen.

When females gained EPFs, the extra-pair sires were not more colourful than the females’ social partners but they were more heterozygous and tended to be more distantly related to the females than the social partners. Yet, this did not result in extra-pair offspring being more heterozygous than within-pair offspring. These results suggest females may seek EPFs to gain genetic diversity for their offspring rather than to gain ‘good genes’ for colour, and that females are perhaps unable to assess the degree of genetic similarity between themselves and their mates (i.e. do not assess genetic compatibility), but may discriminate between males based on their genetic diversity (Griffith et al. 2002).

Adaptive manipulation of sex allocation

Female red-capped robins potentially have remarkable control over sex allocation because sex allocation was related to maternal age and condition, paternity source and the age of the sire. I found interactions between maternal age and body condition, and maternal age and the probability of offspring reaching independence. This suggests that males were the more costly sex to produce, consistent with predictions of sex allocation theory. Yearling males were more likely to sire sons than adult males. Females may assess the quality of yearling males on their ability to out-compete adult males and establish territories within the study site.

A long-standing prediction of sex allocation theory is that females should preferentially produce sons when fertilised by extra-pair males, but this prediction has not received robust empirical support to date. I found a relationship between nestling sex and paternity source that indicates female red-capped robins may be able to allocate nestling sex according to whether or not the sire is extra-pair. This may be based on the genetic

128 Chapter 7 General discussion diversity of the sire. Females fertilised by extra-pair sires tended to produce sons, and extra-pair sires were more heterozygous, and tended to be more distantly related to the social female, than their within-pair counterparts. This potential mode of sex allocation requires experimental investigation in this species. If this relationship proves to be causal, the question remains why paternity source may affect sex allocation in red-capped robins but not in other species.

Dispersal, competition, territory quality and habitat saturation

Abundance estimates of red-capped robins indicated that the white-cypress pine woodland within Terrick Terrick National Park was high quality (Dowling et al. 2003a, Chapter 3) and it appeared that the habitat was saturated with breeding territories (pers. obs.). Although red-capped robins are territorial and sedentary, rates of breeding dispersal (i.e. the dispersal of birds of breeding age) of robins within the study site were high (47% of males and 64% of females disappeared between seasons). There are few breeding territories available at any given time and, consequently, there is probably intense competition for all birds (whether breeders or juveniles dispersing from their natal territories) to establish and maintain territories within the study site. I found that heavier nestlings were more likely to reach independence and few juveniles managed to recruit to territories near their natal territories. Many were forced to disperse and such dispersal is probably costly.

Future directions

Carotenoid acquisition and utilisation

My results suggest that red plumage in male red-capped robins is condition-dependent and if so, this assumes that carotenoids are either limited in the diet, costly to metabolise or costly to process (or both limited and costly to metabolise and process). A series of studies is required to distinguish between these alternatives. First, the primary sources of carotenoid pigments (and the abundances of these food sources) in the diet of red-capped

129 robins must be identified to determine whether they are limited in abundance, and to determine the carotenoid profile of these food sources (i.e. do they mainly contain yellow or red carotenoid pigments?). The main prey items of red-capped robins can be identified through focal observation of birds and from detailed analysis of faecal samples collected from captured birds. Once identified, fresh specimens of each arthropod species can be collected and the carotenoid profile of each species determined using High Performance Liquid Chromatography.

Research into the mechanisms regulating red plumage colour has recently been conducted for some North American species (Hill 2000, McGraw and Hill 2001, McGraw et al. 2001b), in controlled laboratory conditions, and such a study is now required in red-capped robins to provide unequivocal evidence that red plumage in an insectivore can be condition-dependent. Below I suggest three experiments, conducted using robins housed in aviaries, which would address the proximate control of red plumage in this species. First, canthaxanthin and/ or adonirubin (both of which are the red keto-carotenoids primarily responsible for red plumage in this species) can be manipulated (supplemented or reduced) in the diet of male robins during a period prior to moult (keeping the nutritional value of the diet constant) to determine whether carotenoid abundance influences expression of red plumage. Males with access to more keto- carotenoids should moult into more colourful plumage than males with restricted access to such pigments. To determine whether male robins are able to metabolise yellow precursors into red pigments, male robins could be provided with a diet consisting only of yellow carotenes (no red pigments) in the period prior to moult. If males moult into red plumage post-moult, this indicates that they can metabolise such pigments. In both of the above experiments, the possibility exists that male robins can use stored carotenoids to colour feathers, and this can potentially confound the results. This should be controlled for by providing a sample of male robins with a diet entirely lacking in carotenoids during the same period prior to moult. If males do not use stored carotenoids to colour feathers, then such males will not possess any carotenoid plumage colouration post- moult.

130 Chapter 7 General discussion

Hill (2000) provided experimental evidence that nutritionally-stressed house finches grew duller feathers than non-stressed birds, even when provided with canthaxanthin during moult (a red pigment that can be deposited into plumage unaltered). Thus, even when yellow carotenoid pigments do not need to be metabolised into red pigments, there are costs associated with absorption, transport and deposition which may result in condition- dependence of red plumage. Hence, plumage may be condition-dependent even in insectivores that ingest primarily red carotenoids that are not limited in the diet. Hill’s (2000) experimental protocol could be applied to red-capped robins, allowing males access to the same amounts of canthaxanthin, but differing access to food (one group fed ad libitum, one group with restricted access to food). This would reveal whether nutritionally stressed robins grow duller feathers post-moult, even in the presence of abundant, red carotenoids.

The role of red plumage

I found some evidence that high-quality females paired to males with more colourful caps, but did not find any relationship between male plumage colour and reproductive output during the subsequent breeding season. Future research on the role of red plumage in red-capped robins should take an experimental approach. Manipulations of male plumage (enhancing or reducing individual redness and increasing or reducing patch size) are required in a wild population of robins to determine the precise fitness benefits of red plumage in red-capped robins. Experimental reductions in forehead patch size are straightforward in male robins because red patches are surrounded by black plumage, and may be reduced in size by blackening the edges (Copic pens). Breast patches are surrounded by white plumage on the flanks and abdomen, and reductions of breast patch size are possible by bleaching some of the outer red feathers. Forehead patch enlargements require bleaching the black feathers in question and re-colouring them the desired colour using red and black paints (Copic pens). Enlargement of breast patches is straightforward because the patch is surrounded by white plumage. When manipulating patch colour, it is important to verify that the red colour used has similar spectral properties to the natural red plumage and that the hues used fall within the natural range

131 of male robins (Pryke et al. 2002). Thus, male patches may be manipulated and subsequent reproductive success monitored. This could be combined with longer-term monitoring (including tracking the future reproductive success of offspring sired by males of different degrees of redness) to determine whether the fitness benefits of red plumage colouration include redder males producing offspring of greater reproductive value.

Additionally, by experimentally enhancing cap colour and concurrently reducing breast colour (and vice versa) it would be possible to determine the relative importance of male caps versus breast colour in intra- and inter-sexual selection in this species. Future studies of this species should include detailed measures of territory quality and size to determine the role of red plumage on territory attributes, and help determine whether red plumage is intra- or inter-sexually selected.

Further studies are required on other insectivores that express red plumage to determine whether carotenoid-based plumage has the same function as in granivorous species. Additionally, in species where it is already apparent that carotenoid-based plumage is sexually selected, it is important to now determine its effect on true reproductive success and extra-pair matings.

Sex allocation

The red-capped robin is the ideal candidate for further investigations of the adaptive nature of biased sex allocation because it is the only species discovered so far where it appears there may be a clear relationship between paternity source per se and sex allocation. Although my results suggested an effect of paternity source, I was unable to determine whether male plumage colouration also affected sex allocation because I collected plumage colour scores in just one season and statistical power of these analyses was low. Further monitoring of this population over more seasons will provide a clearer indication of the influence of paternal factors on sex allocation. Such research should incorporate experimental manipulations of male ornamentation (as described above) into

132 Chapter 7 General discussion the study to increase the effect size and thus the probability of observing a biological effect if one exists. These experiments could potentially be pursued in aviary populations of robins because the species can be successfully bred in such conditions (Hutton 1991). The ease with which aviary-kept birds can be captured-recaptured would greatly facilitate a captive bred study. In such a setting, females could be mated with males of differing plumage colour, heterozygosity and relatedness under controlled conditions and definitive effects of paternity and plumage ornamentation on sex allocation determined.

Although many empirical studies provide a robust indication that birds can indeed alter sex allocation away from parity, the physiological mechanisms behind how they do this are largely unknown (Krackow 1995, Pike and Petrie 2003) and future studies should now be directed towards these mechanisms. Potential sex-biases in laying order provide one mechanism by which females may control sex allocation. Previous studies have found relationships between nestling sex and laying order in some species (Ankney 1982, Dijkstra 1990, Blanco et al. 2002, Badyaev et al. 2002) and other studies have found that particular eggs in the laying sequence are more likely to be manipulated (Krebs et al. 2002, Velando et al. 2002). Future research of sex allocation in red-capped robins should address this question. If nestling sex varies predictably with laying sequence, then females can time occurrences of EPFs so they coincide with the egg most likely to be male in the laying order, and thus resulting offspring (probably male) will receive genetic fitness benefits of the extra-pair sire.

Population dynamics, habitat quality and dispersal

White cypress-pine woodlands within Terrick Terrick National Park contained higher abundances of red-capped robins than other woodland types within northern Victoria, and appeared to be saturated with robin breeding territories (Dowling et al. 2003a, Chapter 3). To confirm the habitat is saturated, removal experiments are required. By removing breeding males from their territories, it will be possible to determine whether these territory vacancies are immediately filled by males from a floating population, and furthermore, which males successfully compete for such vacancies. Since this species is

133 declining in eastern Australia (Robinson 1994, Reid 1999), males that are removed from territories can be translocated to other woodlands as part of another experiment, with conservation applications, designed to examine why areas that contain apparently suitable habitat are unoccupied with robins. Successful translocations (birds establish territories in new areas) would indicate that these areas contain suitable habitat but remain unoccupied due to dispersal limitations, whereas unsuccessful translocations (birds disappeared after relocation) would indicate that such areas contain unsuitable habitat for red-capped robins.

Previous research on red-capped robins found that large forest patches contain older birds and higher densities of birds than linear strips of habitat (such as road-side ‘corridors’; Major et al. 1999). It is possible that these linear strips provide dispersal opportunities for robins between forest patches, and it is possible that they provide breeding habitat for young birds that are unable to establish territories in higher quality habitat. Linear corridors may provide useful sinks for juvenile robins, which can then source other populations when these robins reach adulthood. It is also possible that different habitat types are used by different age classes. One attractive approach for future study of natal dispersal in this species would be to use radio-transmitters to track individual juveniles as they disperse. This approach is expensive and potentially time-consuming. Nevertheless, survival rates of offspring between fledging and independence are high (most mortality occurs in the nest, Dowling 2003, Chapter 2) and thus if transmitters are attached to fledglings, most of the birds sampled will disperse and can be monitored. Such an approach in this species will enable a clearer understanding of population sustainability and dynamics. In particular, it will provide information on possible source-sink dynamics and provide answers on where dispersing birds go and whether they seek refuge in linear habitat corridors.

The DNA microsatellite markers I developed would be a useful tool for a study of population dynamics in this species (across populations). Such an approach would enable identification of the level of gene flow between fragmented populations, and thereby improve our knowledge of population viability for this species in the face of further

134 Chapter 7 General discussion habitat degradation. Such data will be particularly helpful in conservation management, allowing managers to record the responses of key species for which life-history and ecological parameters are known and integrate the outcomes into future policy.

Furthermore, detailed analysis of territory quality within a population will provide further, valuable insights into the mating system, ecology and conservation biology of this species. For instance, male plumage colour may be maintained through either intrasexual (male-male competition) or inter-sexual (female choice) selection. If maintained through intra-sexual selection, then the most colourful males should possess the highest quality territories.

Finally, a novel approach to studying habitat quality as it relates to this species will be to quantify plumage colouration for males in different habitat types and compare colour values between habitats. Birds must ingest carotenoids in their diets and it is probable that carotenoid distributions differ between habitats. My research indicates that male red plumage is condition-dependent and, if so, then it may also be limited by habitat type and quality. For instance, it is possible that males occupying degraded habitat, such as linear strips of vegetation along roadsides, may possess duller plumage than males that occupy more suitable habitat within larger forest blocks.

The red-capped robin is one of many colourful Australian passerines for which we are only starting to understand the function of sexual dichromatism. My work raises many new questions about the function of red plumage in sexual selection and sex allocation. The empirical work presented here will hopefully provide a robust foundation for future testing of hypotheses by means of experimental manipulations of plumage in the field.

135 136 References

Adcock, G. J., and Mulder, R. A. (2002) Polymorphic microsatellite loci for paternity analysis in the Madagascar paradise flycatcher (Terpsiphone mutata: Aves). Molecular Ecology Notes 2, 287-289.

Amundsen, T. (2000) Why are female birds ornamented? Trends in Ecology and Evolution 15, 149-155.

Andersson, M. (1994) Sexual selection. Princeton University Press: Princeton.

Andersson, S., Örnborg, J., and Andersson, M. (1998) Ultraviolet sexual dimorphism and assortative mating in blue tits. Proceedings of the Royal Society Biological Sciences Series B 265, 445-450.

Andersson, S., Pryke, S. R., Örnborg, J., Lawes, M. J., and Andersson, M. (2002) Multiple receivers, multiple ornaments, and a trade-off between agonistic and epigamic signaling in a widowbird. The American Naturalist 160, 683-691.

Ankney, C. D. (1982) Sex ratio varies with egg sequence in Lesser Snow Geese. Auk 99, 662–666.

Armstrong, D. P., Ewen, J. G., Dimond, W. J., Lovegrove, T. G., Bergström, A., and Walter, B. (2000) Breeding biology of North Island robins (Petroica australis longipes) on Tiritiri Matangi Island, Hauraki Gulf, New Zealand. Notornis 47, 106-118.

Arnold, K. E., and Owens, I. P. F. (1998) Cooperative breeding in birds: a comparative test of the life history hypothesis. Proceedings of the Royal Society of London Series B 265, 739-745.

137 Arnold, K. E., Griffiths, R., Stevens, D. J., Orr, K. J., Adam, A., and Houston, D. C. (2003) Subtle manipulation of egg sex ratio in birds. Proceedings of the Royal Society of London, Series B - Biology Letters 270, S216-S219.

Badyaev, A. V., Hill, G. E., Beck, M. L., Dervan, A. A., Duckworth, R. A., McGraw, K. J., Nolan, P. M., and Whittingham, L. A. (2002) Sex-biased hatching order and adaptive population divergence in a passerine bird. Science 295, 316–318.

Baker, A. M., Mather, P. B., and Hughes, J. M. (2001). Evidence for long-distance dispersal in a sedentary passerine, Gymnorhina tibicen (Artamidae). Biological Journal of the Linnean Society 72, 333-343.

Barker, F. K, Barrowclough, G. F., and Groth, J. G. (2002) A phylogenetic hypothesis for passerine birds: taxonomic and biogeographic implications of an analysis of nuclear DNA sequence data. Proceedings of the Royal Society of London, Series B 269, 295-308.

Bell, H. L. (1985) Seasonal variation and the effects of drought on the abundance of arthropods in savanna woodland on the Northern Tablelands of New South Wales. Australian Journal of Ecology 10, 207-221.

Bendich, A. (1993) Biological functions of dietary carotenoids. Annals of the New York Academy of Sciences 691, 61-67.

Bennett, A. T. D., Cuthill, I. C., and Norris, K. J. (1994) Sexual selection and the mismeasure of color. The American Naturalist 144, 848-860.

Bensch, S., Price, T., and Kohn, J. (1997) Isolation and characterization of microsatellite loci in a Phylloscopus warbler. Molecular Ecology 6, 91-92.

138 Birkhead, T. R., and Møller, A. P. (1992) Sperm Competition in Birds: Evolutionary Causes and Consequences. Academic Press: London.

Blakers, M., Davies, S. J. J. F., and Reilly, P. N. (1984) The Atlas of Australian birds. Royal Australasian Ornithologists Union/ Melbourne University Press: Melbourne.

Blanco, G., Davila, J. A., Septiem, J. A. L., Rodriguez, R., and Martinez, F. (2002) Sex- biased initial eggs favour sons in the slightly size dimorphic Scops owl (Otus scops). Biological Journal of the Linnean Society 76, 1–7.

Boles, W. (1988) The Robins and Flycatchers of Australia. Angus and Robertson: NSW.

Bonenfant, C., Gaillard, J-M, Loison, A., and Klein, F. (2003) Sex-ratio variation and reproductive costs in relation to density in a forest-dwelling population of red deer (Cervus elaphus). Behavioral Ecology 14, 862-869.

Boutin-Ganache, I., Raposo, M., Raymond, M., and Descepper, C. F. (2001) M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. Biotechniques 31, 1-3.

Bosque, C., and Bosque, M. T. (1995) Nest predation as a selective factor in the evolution of developmental rates in altricial birds. American Naturalist 145, 234- 260.

Bradbury, R. B., Cotton, P.A., Wright, J., and Griffiths, R. (1997) Nestling sex ratio in the European starling (Sturnus vulgaris). Journal of Avian Biology 28, 255–258.

Bradbury, R. B., and Blakey, J. K. (1998) Diet, maternal condition, and offspring sex ratio in the zebra finch, Poephila guttata. Proceedings of the Royal Society of London, Series B 265, 895-899.

139 Brooker, L., and Brooker, M. (2002) Dispersal and population dynamics of the blue- breasted fairy-wren, Malurus pulcherrimus, in fragmented habitat in the Western Australian wheatbelt. Wildlife Research 29, 225-233.

Brooker, M. G., and Brooker, L. C. (1989) Cuckoo hosts in Australia. Australian Zoological Reviews 2, 1-67.

Brooker, M., and Brooker, L. (1997) Dispersal of the Blue-breasted Fairy-wren in fragmented habitat in the wheatbelt of Western Australia. Pacific Conservation Biology 3, 295-300.

Brooker, L., Brooker, M., and Cale, P. (1999) Animal dispersal in fragmented habitat: measuring habitat connectivity, corridor use, and dispersal mortality. Conservation Ecology [online] 3: 4. Available from the Internet. URL: http://www.consecol.org/vol3/iss1/art4.

Brown, J. L. (1987) Helping and communal breeding in birds: ecology and evolution. Princeton University Press: Princeton.

Brown, J. (1997) A theory of mate choice based on heterozygosity. Behavioral Ecology 8, 60-65.

Brown, K. P. (1997) Predation at nests of two New Zealand endemic passerines: implications for bird community restoration. Pacific Conservation Biology 3, 91- 98.

Bruford, M. W., Hanotte, O., Brookfield, J. F. Y. , and Burke, T. (1992) Single locus and multi-locus fingerprinting. In: Molecular Genetic Analysis of Populations- A Molecular Approach (ed Hoelzel AR), pp227-229, IRL Press: Oxford.

140 Burley, N. (1983). The meaning of assortative mating. Ethological Sociobiology 4, 191- 203.

Butler, D., and Merton, D. (1992) The Black Robin: Saving the World’s Most Endangered Bird. Oxford University Press: Auckland.

Cale, P. (1990) The value of road reserves to the avifauna of the central wheatbelt of Western Australia. Proceedings of the Ecological Society of Australia 16, 359- 367.

Charnov, E. L. (1982) The theory of sex allocation. Princeton University Press: Princeton.

Clarke, A. L., Sæther, B-E, and Røskraft, E. (1997) Sex biases in avian dispersal: a reappraisal. Oikos 79, 429-438.

Clutton-Brock, T. H., Albon, S. D., and Guinness, F. E. (1984) Maternal dominance, breeding success and birth sex ratios in red deer. Nature 308, 358-360.

Coates, B. J. (1990) The Birds of Papua New Guinea Including the Bismarck Archipelago and Bougainville. Volume II. Dove Publication: Queensland.

Cockburn, A. (2003) Cooperative breeding in oscine passerines: does sociality inhibit speciation? Proceedings of the Royal Society of London, Series B 270, 2207-2214.

Colegrave, N., Kotiaho, J. S., and Tomkins, J. L. (2002) Mate choice or polyandry: Reconciling genetic compatibility and good genes sexual selection. Evolutionary Ecology Research 4, 911-917.

141 Côté, S. D., and Festa-Bianchet, M. (2000) Offspring sex ratio in relation to maternal age and social rank in mountain goats (Oreamnos americanus) Behavioral Ecology and Sociobiology 49, 260-265.

Country Fire Authority (2000) CFA region 20 – rural directory. 2nd edn. Country Fire Authority: Kerang, Victoria.

Coventry, P. (1988) Notes on the breeding biology of the Red-capped Robin Petroica goodenovii. Australian Birdwatcher 12, 209-216.

Dale, J. (2000) Ornamental plumage does not signal male quality in red-billed queleas. Proceedings of the Royal Society Biological Sciences Series B 267, 2143-2149.

Dallimer, M., Blackburn, C., Jones, P. J., and Pemberton, J. M. (2002) Genetic evidence for male biased dispersal in the red-billed quelea Quelea quelea. Molecular Ecology 11, 529-533.

Delhey, K., Johnsen, A., Peters, A., Andersson, S., and Kempenaers, B. (2003) Paternity analysis reveals opposing selection pressures on crown coloration in the blue tit (Parus caeruleus). Proceedings of the Royal Society of London, Series B 270, 2057-2063.

Dijkstra, C., Daan, S., and Buker, J. B. (1990) Adaptive seasonal variation in the sex ratio of kestrel broods. Functional Ecology 4, 143–147.

Double, M., and Cockburn, A. (2000). Pre-dawn infidelity: females control extra-pair mating in superb fairy-wrens. Proceedings of the Royal Society of London, Series B 267, 465-470.

142 Dowling, D. K. (2003) Breeding biology of the red-capped robin. Australian Journal of Zoology 51, 533-549.

Dowling, D. K., Antos, M. and Sahlman, T. (2003a) Dispersal and recruitment of juvenile Red-capped Robins, Petroica goodenovii. Emu 103, 199-205.

Dowling, D. K., Adcock, G. A., and Mulder, R. A. (2003b) Novel polymorphic microsatellite markers for paternity analysis in the red-capped robin (Petroica goodenovii: Aves). Molecular Ecology Notes 3, 517-519.

Eckert, C. G., and Weatherhead, P. J. (1987) Ideal dominance distributions: a test using red-winged blackbirds Agelaius phoeniceus. Behavioral Ecology and Sociobiology 20, 43-52.

Edwards, S. V. (1993) Long-distance gene flow in a cooperative breeder detected in genealogies of mitochondrial DNA sequences. Proceedings of the Royal Society of London, Series B 252, 177-185.

Eeva, T., Lehikoinen, E., and Nurmi, J. (1994) Effects of ectoparasites on breeding success of great tits (Parus major) and pied flycatchers (Ficedula hypoleuca) in an air pollution gradient. Canadian Journal of Zoology 72, 624-635.

Ellegren, H. (2000) Evolution of the avian sex chromosomes and their role in sex determination. Trends in Ecology and Evolution 15, 188-192.

Ellegren, H., Gustafsson, L., and Sheldon, B. C. (1996) Sex ratio adjustment in relation to paternal attractiveness in a wild bird population. Proceedings of the National Academy of Sciences 93, 11723–11728.

Emlen, S. T. (1982) The evolution of helping. I. An ecological constraints model. American Naturalist 119, 29-39.

143 Ericson, P. G. P., Irestedt, M., and Johansson, U. S. (2003) Evolution, biogeography, and patterns of diversification in passerine birds. Journal of Avian Biology 34, 3-15.

Falla, R. A., Sibson, R. B., and Turbott, E. G. (1981) The New Guide to the Birds of New Zealand. Collins: Auckland.

Fitri, L., and Ford, H.A. (2003) Breeding biology of hooded robins Melanodryas cucullata in New England, New South Wales. Corella 27, 68-74.

Flack, J. A. D. (1976) New Zealand robins. Wildlife – A review 7, 15-19.

Foerster, K., Delhey, K, Johnsen, A., Lifjeld, J. T., and Kempenaers, B. (2003) Females increase offspring heterozygosity and fitness through extra-pair matings. Nature 425, 714-717.

Fowler, J., Cohen, L., and Jarvis, P. (1998) Practical statistics for field biology. John Wiley and sons: Chicester.

Fox, D. L. (1979) Biochromy: natural colouration of living things. University of California Press: Berkeley.

Freeman-Gallant, C. R., Meguerdichian, M., Wheelwright, N. T., and Sollecito, S. V. (2003) Social pairing and female mating fidelity predicted by restriction fragment length polymorphism similarity at the major histocompatibility complex in a songbird. Molecular Ecology 12, 3077-3083.

Frith, D. W., and Frith, C. B. (2000) The nesting biology of the Grey-headed Robin Heteromyias albispecularis (Petroicidae) in Australian upland tropical rainforest. Emu 100, 81-94.

144 Gardner, M. G., Cooper, S. J. B., Bull, C. M., and Grant, W. N. (1999) Isolation of microsatellite loci from a social lizard, Egernia stokesii, using a modified enrichment procedure. Journal of Heredity 90, 301-304.

GenStat 6.0 (2002) The Numerical Algorithms Group Ltd: Oxford.

Goodwin, T. W. (1976) Distribution of carotenoids. Biosynthesis of carotenoids, pp. 225- 261. In: Chemistry and biochemistry of plant pigments. (ed. T. W. Goodwin) Academic Press: New York.

Goodwin, T. W. (1984) The biochemistry of carotenoids. Volume 2, Animals, 2nd Ed. Chapman and Hall: New York.

Greenwood, P. J., Harvey, P. H., and Perrins, C. M. (1979) The role of dispersal in the great tit (Parus major): the causes, consequences and heritability of natal dispersal. Journal of Animal Ecology 48, 123-142.

Greenwood, P. J. (1980) Mating systems, philopatry and dispersal in birds and mammals. Animal Behaviour 28, 1140-1162.

Griffith, S. C., Owens, I. P. F., and Thuman, K. A. (2002) Extra pair paternity in birds: a review of interspecific variation and adaptive function. Molecular Ecology 11, 2195-2212.

Griffith, S. C., Örnborg, J., Russell, A. F., Andersson, S., and Sheldon, B. C. (2003) Correlations between ultraviolet coloration, overwinter survival and offspring sex ratio in the blue tit. Journal of Evolutionary Biology 16, 1045-1054.

Griffiths, R., Double, M. C., Orr, K., and Dawson, R. J. G. (1998) A DNA test to sex most birds. Molecular Ecology 7, 1071-1075.

145 Hanotte, O., Zanon, C., Pugh, A., Greig, C., Dixon, A., and Burke, T. (1994) Isolation and characterization of microsatellite loci in a passerine bird: the reed bunting Emberiza schoeniclus. Molecular Ecology 3, 529-530.

Hartley, I. R., Griffith, S. C., Wilson, K., Shepherd, M., and Burke, T. (1999) Nestling sex ratios in the polygynously breeding corn bunting Miliaria calandra. Journal of Avian Biology 30, 7–14.

Heather, B., and Robertson, H. (1996) The Field Guide to the Birds of New Zealand. Viking: Auckland.

Hill, G. E. (1990) Female house finches prefer colourful males: sexual selection for a condition-dependent trait. Animal Behaviour 40, 563-572.

Hill, G. E. (1991) Plumage coloration is a sexually selected indicator of male quality. Nature 350, 337-339.

Hill, G. E. (1993) Male mate choice and the evolution of female plumage coloration in the house finch. Evolution 47, 1515-1525.

Hill, G. E. (1996) Redness as a measure of the production cost of ornamental coloration. Ethology, Ecology and Evolution 8, 157-175.

Hill, G. E. (1999) Mate choice, male quality, and carotenoid-based plumage coloration. In: Proceedings of the 22nd International Ornithological Congress (ed. N. Adams and R. Slotow). Birdlife South Africa: Johannesburg, pp. 1654-1668.

Hill, G. E. (2000) Energetic constraints on expression of carotenoid-based plumage coloration. Journal of Avian Biology 31, 559-566.

146 Hill, G. E. (2002) A red bird in a brown bag: The function and evolution of colorful plumage in the house finch. Oxford University Press: New York.

Hill, G. E., Montgomerie, R., Roeder, C., and Boag, P. (1994) Sexual selection and cuckoldry in a monogamous songbird: implications for sexual selection theory. Behavioral Ecology and Sociobiology 35, 193–199.

Hill, G. E., Nolan P. M., and Stoehr, A. M. (1999) Pairing success relative to male plumage redness and pigment symmetry in the house finch: temporal and geographic constancy. Behavioral Ecology 10, 48-53.

Hoyt, D. F. (1979) Practical methods of estimating volume and fresh weight of bird eggs. Auk 96, 73–77.

Hughes, J. M., Mather P. B., Toon, A., Ma, J., Rowley, I., and Russell, E. (2003) High levels of extra-group paternity in a population of Australian magpies Gymnorhina tibicen: evidence from microsatellite analysis. Molecular Ecology 12, 3441-3450.

Hutton, R. (1991) Softbill Management. Aviary Studies of Wrens, Robins, Chats and Dotterels. Singil Press Pty Ltd: NSW.

Jamieson, A., and Taylor, S. S. (1997) Comparisons of three probability formulae for parentage exclusion. Animal Genetics, 28, 397-400.

Jawor, J. M., Linville, S. U., Beall, S. M., and Breitwisch, R. (2003) Assortative mating by multiple ornaments in northern cardinals (Cardinalis cardinalis). Behavioral Ecology 14, 515-520.

JMP 5 (2002) SAS Institute Inc: USA.

147 Johnsen, A., Lifjeld, J. T., Rohde, P. A., Primmer, C. R., and Ellegren, H. (1998) Sexual conflict over fertilizations: Female bluethroats escape male paternity guards. Behavioral Ecology and Sociobiology 43, 401-408.

Johnsen, A., Lifjeld, J. T., Andersson, S., Örnborg, J., and Amundsen, T. (2001) Male characteristics and fertilisation success in bluethroats. Behaviour 138, 1371-1390.

Johnsen, A., Delhey, K., Andersson, S., and Kempenaers, B. (2003) Plumage colour in nestling blue tits: sexual dichromatism, condition dependence and genetic effects. Proceedings of the Royal Society of London, Series B 270, 1263-1270.

Johnsgard, P. A. (1997) The avian brood parasites: Deception at the nest. Oxford University Press: New York.

Jones, I. L., and Hunter, F. M. (1999) Experimental evidence for mutual inter- and intrasexual selection favouring a crested auklet ornament. Animal Behaviour 57, 521-528.

Kappeler, P. M. (1997) Intrasexual selection in Mirza coquereli: Evidence for scramble competition polygyny in a solitary primate. Behavioral Ecology & Sociobiology 41, 115-127.

Kempenaers, B., Verheyen, G. R., and Dhondt, A. A. (1997) Extrapair paternity in the blue tit (Parus caeruleus): female choice, male characteristics and offspring quality. Behavioral Ecology 8, 481–492.

King, C. (1984) Immigrant Killers: Introduced Predators and the Conservation of Birds in New Zealand. Oxford University Press: Auckland.

148 Knegtmans, J. W., and Powlesland, R. G. (1999) Breeding biology of the North Island Tomtit (Petroica macrocephala toitoi) at Pureora Forest Park. Notornis 46, 446- 456.

Kodric-Brown, A. (1989) Dietary carotenoids and male mating success in the guppy: An environmental component to female choice. Behavioral Ecology and Sociobiology 25, 393-401.

Koenig, W. D., and Dickinson, J. L. (1996) Nestling sex-ratio variation in western bluebirds. Auk 113, 902-910.

Koenig, W. D., Pitelka, F. A., Carmen, W. J., Mumme, R. L., and Stanback, M. T. (1992) The evolution of delayed dispersal in cooperative breeders. The Quarterly Review of Biology 67, 111-150.

Koenig, W. D., Van Vuren, D., and Hooge, P. N. (1996) Detectability, philopatry, and the distribution of dispersal distances in vertebrates. Trends in Ecology and Evolution 11, 514-517.

Koenig, W. D., Hooge, P. N., Stanback, M. T., and Haydock, J. (2000) Natal dispersal in the cooperatively breeding Acorn Woodpecker. Condor 102, 492-502.

Kokko, H., and Lundberg, P. (2001) Dispersal, migration, and offspring retention in saturated habitats. The American Naturalist 157, 188-202.

Komdeur, J. (1996) Facultative sex ratio bias in the offspring of Seychelles warblers. Proceedings of the Royal Society of London, Series B 263, 661-666.

Komdeur, J., Daan, S., Tinbergen, J., and Mateman, C. (1997) Extreme adaptive modification in sex ratio of the Seychelles warbler’s eggs. Nature 385, 522–525.

149 Kraaijeveld-Smit, F. J. L., Ward, S. J., Temple-Smith, P. D., and Paetkau, D. (2002) Factors influencing paternity success in Antechinus agilis: Last-male sperm precedence, timing of mating and genetic compatibility. Journal of Evolutionary Biology 15, 100-107.

Krackow, S. (1995) Potential mechanisms for sex ratio adjustment in mammals and birds. Biological Reviews 70, 225–241.

Krebs, E. A., Green, D. J., Double, M. C., and Griffiths, R. (2002) Laying date and laying sequence influences the sex ratio of crimson rosella broods. Behavioral Ecology and Sociobiology 51, 447–454.

Kruuk, L. E. B., Clutton-Brock, T. H., Albon, S. D., Pemberton, J. M., and Guinness, F. E. (1999) Population density affects sex variation in red deer. Nature 399, 459– 461.

Lack, D. (1954) The Natural Regulation of Animal Numbers. Oxford University Press: London.

Lambrechts, M. M., Blondel, J., Caizergues, A., Dias, P. C., Pradel, R., and Thomas, D.W. (1999) Will estimates of lifetime recruitment of breeding offspring on small-scale study plots help us to quantify processes underlying adaptation? Oikos 86, 147–151.

Lambrechts, M. M., Visser, M. E., and Verboven, N. (2000) Consequences of dispersal for the quantitative study of adaptation in small-scale plots: a case study of an avian island population. Ecography 23, 525–530.

LCC (1983) Report on the Murray Valley Area. Land Conservation Council: Victoria.

150 Leech, D. I., Hartley, I. R., Stewart, I. R. K., Griffith, S. C., and Burke, T. (2001) No effect of parental quality or extrapair paternity on brood sex ratio in the blue tit (Parus caeruleus). Behavioral Ecology 12, 674-680.

Linville, S. U. and Breitwisch, R. (1997) Carotenoid availability and plumage coloration in a wild population of northern cardinals. Auk 114, 796-800.

Lozano, G. A. (1994) Carotenoids, parasites, and sexual selection. Oikos 70, 309-311.

Magrath, M. J. L., Green, D. J., and Komdeur, J. (2002) Sex allocation in the sexually monomorphic fairy martin. Journal of Avian Biology 33, 260-268.

Magrath, R. D. (1991) Nestling weight and juvenile survival in the blackbird Turdus merula. Journal of Animal Ecology 60, 335-352.

Major, R. E., Christie, F. J., Gowing, G., and Ivison, T. J. (1999) Age structure and density of Red-capped robin populations vary with habitat size and shape. Journal of Applied Ecology 36, 1-8.

Major, R. E., Christie, F. J., and Gowing, G. (2001) Influence of remnant and landscape attributes on Australian woodland bird communities. Biological Conservation 102, 47-66.

Male, T. D. (2000) Evidence for cooperative breeding in the Pale Yellow Robin Tregellasia capito. Emu 100, 333-336.

Marchant, S. (1985) Breeding of the Eastern Yellow Robin Eopsaltria australis. In Birds of Eucalypt Forests and Woodlands: Ecology, Conservation, Management. (Eds A. Keast, H. F. Recher, H. Ford, and D. Saunders) pp. 231-240. Surrey Beatty: Sydney.

151 Marshall, T., Slate, J., Kruuk, L., and Pemberton, J. (1998) Statistical confidence for likelihood-based paternity inference in natural conditions. Molecular Ecology, 7, 639–655.

Martin, T. E. (1987) Food as a limit on breeding birds: a life-history perspective. Annual Review of Ecology and Systematics 18, 452-487.

Martin, T. E. (1993) Nest predation and nest sites: new perspectives on old patterns. BioScience 43, 523-532.

Martin, T. E. (1995) Avian life history evolution in relation to nest sites, nest predation, and food. Ecological Monographs 65, 101-127.

Martin, T. E., Martin, P. R., Olson, C. R., Heidinger, B. J., and Fontaine, J. J. (2000) Parental care and clutch sizes in North and South American birds. Science 287, 1482-1485.

McGraw, K. J., and Hill, G. E. (2001)lCarotenoid access and intraspecific variation in plumage pigmentation in male American Goldfinches (Carduelis tristis) and Northern Cardinals (Cardinalis cardinalis). Functional Ecology 15, 732-739.

McGraw, K. J., Stoer, A. M., Nolan, P. M., and Hill, G. E. (2001a) Plumage redness predicts breeding onset and reproductive success in the House Finch: a validation of Darwin’s theory. Journal of Avian Biology 32, 90-94.

McGraw, K. J., Hill, G. E., Stradi, R., and Parker, R. S. (2001b) The influence of carotenoid acquisition and utilization on the maintenance of species-typical plumage pigmentation in male American goldfinches (Carduelis tristis) and northern cardinals (Cardinalis cardinalis). Physiological and Biochemical Zoology 74, 843-852.

152 McGraw, K. J., Hill, G. E., Stradi, R., and Parker, R. S. (2002) The effect of dietary carotenoid access on sexual dichromatism and plumage pigment composition in the American goldfinch. Comparative Biochemistry and Physiology B 131, 261- 269.

McIntosh, R. R., Kats, R., Berg, M., Komdeur J., and Elgar, M. A. (2003) Breeding ecology and bias in offspring sex ratio in little grassbirds (Megalurus gramineus). Australian Journal Of Zoology 51, 505-514.

Møller, A. P. (1997) Immune defence, extra-pair paternity, and sexual selection in birds. Proceedings of the Royal Society of London, Series B 264, 561-566.

Moon, G. (1992) A Field Guide to New Zealand Birds. Reed Books: Auckland.

Mountjoy D.J., and Robertson R.J., (1988) Why are waxwings ‘‘waxy’’? Delayed plumage maturation in the cedar waxwing. Auk 105:61–69.

Mulder, R. A., Dunn, P. O., Cockburn, A., Lazenby-Cohen, K. A., and Howell, M. J. (1994) Helpers liberate female fairy-wrens from constraints on extra-pair mate choice. Proceedings of the Royal Society of London, Series B 255, 223-229.

Mulder, R. A. (1995) Natal and breeding dispersal in a co-operative, extra-group-mating bird. Journal of Avian Biology 26, 234-240.

Nager, R. G., Monaghan, P., Griffiths, R., Houston, D. C., and Dawson, R. (1999) Experimental demonstration that offspring sex ratio varies with maternal condition. Proceedings of the National Academy of Sciences 96, 570–573.

Ödeen, A., and Håstad, O. (2003) Complex distribution of avian color vision systems revealed by sequencing the SWS1 opsin from total DNA. Molecular Biology and Evolution 20, 855-861.

153 Olson, V. A., and Owens, I. P. F. (1998) Costly sexual signals: are carotenoids rare, risky or required? Trends in Ecology and Evolution 13, 510-514.

Owens, I. P. F., and Hartley, I. R. (1998) Sexual dimorphism in birds: why are there so many different forms of dimorphism? Proceedings of the Royal Society of London, Series B 265, 397-407.

Paradis, E., Baillie, S. R., Sutherland, W. J., and Gregory, R. D. (1998) Patterns of natal and breeding dispersal in birds. Journal of Animal Ecology 67, 518-536.

Parker, T. H. (2002) Maternal condition, reproductive investment, and offspring sex ratio in captive Red Junglefowl (Gallus gallus). Auk 119, 840-845.

Peckover, W. S., and Filewood, L. W. C. (1976) Birds of New Guinea and Tropical Australia. A. H. and A. W. Reed: Sydney.

Pike, T. W., and Petrie, M. (2003) Potential mechanisms of avian sex manipulation. Biological Reviews 78, 553-574.

Powlesland, R. G. (1983) Breeding and mortality of the South Island Robin in Kowhai Bush, Kaikoura. Notornis 30, 265-282.

Powlesland, R. G., Knegtmans, J. W., and Marshall, I. S. J. (2000) Breeding biology of North Island robins (Petroica australis longipes) in Pureora Forest Park. Notornis 47, 97-105.

Pryke, S. R., Lawes, M. J., and Andersson, S. (2001a) Agonistic carotenoid signalling in male red-collared widowbirds: aggression related to the colour signal of both the territory owner and model intruder. Animal Behaviour 62, 695-704.

154 Pryke, S. R., Andersson, S. , and Lawes, M. J. (2001b) Sexual selection of multiple handicaps in the red-collared widowbird: female choice of tail length but not carotenoid display. Evolution 55, 1452-1463.

Pryke, S. R., Andersson, S. , Lawes, M. J., and Piper, S. E. (2002) Carotenoid status signaling in captive and wild red-collared widowbirds: independent effects of badge size and color. Behavioral Ecology 13, 622-631.

Pryke, S. R. (2003) Sexual selection and plumage ornamentation in widowbirds. PhD dissertation. Göteborg University.

Queller, D. C., and Goodnight, K. F. (1989) Estimating relatedness using genetic markers. Evolution 43, 258-275.

Quinn, G. P., and Keough, M. J. (2002) Experimental design and data analysis for

biologists. Cambridge University Press: Cambridge.

Rand, A. L., and Gilliard, E. T. (1967) Handbook of New Guinea Birds. Weidenfeld and Nicolson: London.

Rand, D. M., Clark, A. G., and Kann, L. M. (2001) Sexually antagonistic fitness interactions in Drosophila melanogaster. Genetics 159, 173-187.

Raymond, M., and Rousset, F. (1995) GENEPOP (Version 1.2) – population genetic software for exact tests and ecumenicism. Journal of Heredity 86, 248-249.

Recher, H.F., Gowing, G., Kavanagh, R., Shields, J., and Rohan-Jones, W. (1983) Birds, resources and time in a tablelands forest. Proceedings of the Ecological Society of Australia 12, 101-123.

155 Reid, J. R. W. (1999) Threatened and declining birds in the New South Wales sheep- wheatbelt. 1. Diagnosis, characteristics and management. Consultancy report to NSW National Parks and Wildlife Service. CSIRO Wildlife and Ecology: Canberra.

Robinson, D. (1990) The nesting ecology of sympatric Scarlet Robin Petroica multicolor and Flame Robin P. phoenicea populations in open eucalypt forest. Emu 90, 40- 52.

Robinson, D. (1994) Research plan for threatened woodland birds of southeastern Australia. Arthur Rylah Institute for Environmental Research, Technical Report Series No. 133. DCNR: Melbourne.

Rowley, I., and Russell, E. (1991) Demography of passerines in the temperate Southern Hemisphere. In Bird Population Studies: Relevance to Conservation and Management. (Eds C. M. Perrins, J.-D. Lebreton and G. J. M. Hirrons) pp. 22-44. Oxford University Press: Oxford.

Russell, E. M. (2000) Avian life histories: is extended parental care the southern secret? Emu 100, 377-399.

Russell, E. M., and Rowley, I. (1993) Philopatry or dispersal: Competition for territory vacancies in the splendid fairy-wren, Malurus splendens. Animal Behaviour 45, 519-539.

Saino, N., Ellegren, H., and Møller, A. P. (1999) No evidence for adjustment of sex allocation in relation to paternal ornamentation and paternity in barn swallows. Molecular Ecology 8, 399–406.

SAS 8.2 (2001) SAS Institute Inc: USA.

156 Searcy, W. A., and Yasukawa, K. (1995) Polygyny and sexual selection in red-winged blackbirds. Princeton University Press: Princeton.

Sheldon, B. C., and Ellegren, H. (1996) Offspring sex and paternity in the collared flycatcher. Proceedings of the Royal Society of London, Series B 263, 1017–1021.

Sheldon, B. C., and West, S. A. (2004) Maternal dominance, maternal condition, and offspring sex ratio in ungulate mammals. American Naturalist 163, 40-54.

Sheldon, B. C., Andersson, S., Griffith, S. C., Ornborg, J., and Sendecka, J. (1999) Ultraviolet colour variation influences blue tit sex ratios. Nature 402, 874–877.

Sibley, C. G., and Ahlquist, J. E. (1990) Phylogeny and Classification of Birds: a Study in Molecular Evolution. Yale University Press: London.

Skutch, A. F. (1961) Helpers among birds. Condor 63, 198-226.

Skutch, A. F. (1976) Parent Birds and their Young. University of Texas Press: Austin.

Stacey, P. B., and Koenig, W. D. eds. (1990) Cooperative breeding in birds: long term studies of ecology and behavior. Cambridge University Press: Cambridge.

Stacey, P. B, and Ligon, J. D. (1987) Territory quality and dispersal options in the acorn woodpecker, and a challenge to the habitat saturation model of cooperative breeding. American Naturalist 130, 654-676.

Stacey, P. B, and Ligon, J. D. (1991) The benefits-of-philopatry hypothesis for the evolution of cooperative breeding: variation in territory quality and group size effects. American Naturalist 137, 831-846.

157 Sullivan, D. (1993) The breeding and non-breeding behaviour of the Hooded Robin Melanodryas cucullata in Canberra, 1990-1991. Australian Birdwatcher 15, 99- 107.

Sundberg, J., and Dixon, A. (1996) Old, colourful male yellowhammers, Emberiza citrinella, benefit from extra-pair copulations. Animal Behaviour 52, 113-122.

Suorsa, P., Helle, H., Huhta, E., Jäntti, A., Nikula, A., and Hakkarainen, H. (2003) Forest fragmentation is associated with primary brood sex ratio in the treecreeper (Certhia familiaris). Proceedings of the Royal Society of London, Series B 270, 2215-2222.

Svensson, E., and Nilsson, J. (1996) Mate quality affects offspring sex ratio in blue tits. Proceedings of the Royal Society of London, Series B 263, 357–361.

Travis, J. M. J., and Dytham, C. (1999) Habitat persistence, habitat availability and the evolution of dispersal. Proceedings of the Royal Society of London, Series B 266, 723-728.

Trevelyan, R., and Read, A. F. (1989) Nest predators and the evolution of avian reproductive strategies: a comparison of Australian and New Zealand birds. Oecologia 81, 274-278.

Trivers, R. L., and Willard, D. E. (1973) Natural selection of parental ability to vary the sex ratio of offspring. Science 179, 90-92.

Velando, A. (2002) Experimental manipulation of maternal effort produces differential effects in sons and daughters: implications for adaptive sex ratios in the blue- footed booby. Behavioral Ecology 13, 443–449.

158 Velando, A., Graves, J., and Ortega-Ruano, J. E. (2002) Sex ratio in relation to timing of breeding, and laying sequence in a dimorphic seabird. Ibis 144, 9-16. von Schantz, T., Bensch, S., Grahn, M., Hasselquist, D., and Wittzell, H. (1999) Good genes, oxidative stress and condition-dependent sexual signals. Proceedings of the Royal Society of London, Series B 266, 1-12.

Vorobyev, M. (2003) Coloured oil droplets enhance colour discrimination. Proceedings of the Royal Society of London, Series B 270, 1255-1261.

Weatherhead, P. J., and Boag, P. (1995) Pair and extra-pair mating success relative to male quality in red-winged blackbirds. Behavioural Ecology and Sociobiology 37, 81-91.

Welch, A. W. (2001) How do parental genetic quality and genetic compatibility affect offspring growth in gray tree frogs? American Zoologist 41, 1653-1654.

Westerdahl, H., Bensch, S., Hansson, B., Hasselquist, D., and Von Schantz T. (1997) Sex ratio variation among broods of great reed warblers Acrocephalus arundinaceus. Molecular Ecology 6, 543–548.

Westneat, D. F., Clark, A. B., and Rambo, K. C. (1995) Within-brood patterns of paternity and paternal behavior in red-winged blackbirds. Behavioral Ecology and Sociobiology 37, 349-356.

Whittingham, L. A., Valkenaar, S. M., Poirier, N. E., and Dunn, P. O. (2002) Maternal condition and nestling sex ratio in House Wrens. Auk 119, 125-131.

Wiebe, K. L. (2000) Assortative mating by color in a population of hybrid Northern Flickers. Auk 117, 525-529.

159 Wiebe, K. L., and Bortolotti, G. R. (2002) Variation in carotenoid-based color in northern flickers in a hybrid zone. Wilson Bulletin 114, 393–400.

Williams, G. C. (1979) The question of adaptive sex ratio in outcrossed vertebrates. Proceedings of the Royal Society of London, Series B 205, 567–580.

Woinarski, J. C. Z. (1985) Breeding biology and life history of small insectivorous birds in Australian forests: response to a stable environment? Proceedings of the Ecological Society of Australia 14,159-168.

Woinarski, J. C. Z., and Cullen, J. M. (1984) Distribution of invertebrates on foliage in forests of south-eastern Australia. Australian Journal of Ecology 9, 207-232.

Wolfenbarger, L. L. (1999) Red coloration of male northern cardinals correlates with mate quality and territory quality. Behavioral Ecology 10, 80-90.

Yezerinac, S., and Weatherhead, P. J. (1997) Extra-pair mating, male plumage coloration and sexual selection in yellow warblers (Dendroica petechia). Proceedings of the Royal Society of London, Series B 264, 527-532.

Yom-Tov, Y. (1987) The reproductive rates of Australian passerines. Australian Wildlife Research 14, 319-330.

Zanette, L., and Jenkins, B. (2000) Nesting success and nest predators in forest fragments: a study using real and artificial nests. Auk 117, 445-454.

Zahavi, A. (1975) Mate selection – a selection for a handicap. Journal of Theoretical Biology 53, 205-214.

160 Appendices

Appendix 1. Life-history parameters of all members of the Petroicidae (Chapter 2). The data are mean values compiled from primary literature cited in Table 5, Chapter 2, and texts on Australian (Boles 1988), New Guinean (Rand and Gilliard 1967, Peckover and Filewood 1976, Coates 1990) and New Zealand birds (Falla et al. 1981, Moon 1992, Heather and Robertson 1996). (Geographical) Range is divided into four categories: (1) Australian endemics, (2) New Guinean endemics, (3) species found both in Australia and New Guinea, and (4) New Zealand and surrounding island endemics. Most data were lacking for New Guinean endemics and thus they were excluded from the comparative analysis. Habitat was divided into five categories: (1) semi arid and dry open woodland, (2) Eucalyptus spp. forest, woodland, (3) wet sclerophyll forest and coastal forest, (4) rainforest and (5) mangroves. Most data were missing for mangrove species and they were therefore also excluded from analysis. Length of breeding season is measured in months, body size (mm), clutch size in eggs, weight (g), egg length and width (mm), egg volume (mm3) and incubation length in days.

Species Range Habitat Breeding season Size (mm) Weight (g) Clutch size Egg length Egg width Egg volume (mm3) Incubation length Amalocichla incerta 2 4 145 1 28 20 5574.76 Amolocichla sclateriana 2 3 200 Dryomodes brunneopygia 1 1 6 220 37 1 25 19 4725.48 Dryomodes superciliaris 3 4 4 215 2 22 18 3732.21 Eopsaltria australis 1 3 7 160 20.5 2.5 22 16 2948.91 15 Eopsaltria flaviventris 4 3 145 Eopsaltria georgiana 1 3 7 157.5 2 21 16 2814.87 14 Eopsaltria griseogularis 1 2 6 155 2 22 16 2948.91 15 Eopsaltria pulverulenta 1 5 6 158.5 21 2.5 19 15 2238.38 Eopsaltria pulverulenta 2 5 145 2 Eugerygone rubra 2 3 107.5 Heteromyias albispecularis 3 4 6 192.5 35.5 1 26 19 4914.5 18 Melanodryas cucullate 1 1 5 157.5 24 2.5 21 16 2814.87 16.5 Melanodryas vittate 1 3 6 162.5 3 22 16 2948.91 14 Microeca flavigaster 3 3 7 127.5 13 1 15 12 1130.97 Microeca flavovirescens 2 4 7 135 2 Microeca griseoceps 3 4 4 120 10 2 15 12 1130.97 Microeca leucophaea 3 1 6 132.5 16 2.5 20 15 2356.19 16.5 Microeca papuana 2 3 122.5 Microeca tormenti 1 5 132.5 13 1 19 13 1681.28 Monachella muelleriana 2 6 145 2 Pachycephalopsis hattamensis 2 3 Pachycephalopsis poliosoma 2 3 157.5 1 27.3 19 5379.78 Peneothello bimaculatus 2 3 135 Peneothello cyanus 2 3 145 1 23.5 18 3986.68 Peneothello sigillatus 2 4 145 1 Petroica archiboldi 2 3

161 Petroica australis australis 4 3 6 180 35.1 2.7 25 19 4725.48 18 Petroica australis longipes 4 3 5 180 35 2.5 24 18 4071.5 19 Petroica bivittata 2 3 110.5 23 17 3398.95 Petroica goodenovii 1 1 5 117.5 8 3 15 13 1327.32 13.5 Petroica macrocephala macrocephala 4 3 5 130 11 3.5 18 15 2120.58 15 Petroica macrocephala toitoi 4 3 5 130 11 4.15 18 15 2120.58 16 Petroica multicolor 3 2 6 127.5 13 3 18 14 1847.26 15 Petroica phoenicea 1 2 6 132.5 14 3.5 28 14 2873.51 14 Petroica rodinogaster 1 3 4 122.5 9 3.5 17 14 1744.63 Petroica rosea 1 3 5 115 8.5 2.5 17 14 1744.63 13 Petroica traversi 4 3 3 150 23.5 2 22 17 3329.04 18.5 Poecilodryas albispecularis 2 4 165 1 24.3 20 4838.09 Poecilodryas albonotata 2 3 185 Poecilodryas brachyura 2 3 145 Poecilodryas hypoleuca 2 4 140 Poecilodryas placens 2 3 145 Poecilodryas superciliosa 1 4 7 160 19 2 20 15 2356.19 14 Tregellasia capito 1 4 3 127.5 16.5 2 20 16 2680.83 Tregellasia leucops 3 4 5 125 14.5 2 19 15 2238.38

162

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Dowling, Damian Kimon

Title: Behavioural ecology of the red-capped robin

Date: 2004-12

Citation: Dowling, D. K. (2004). Behavioural ecology of the red-capped robin. Doctorate thesis, Department of Zoology, University of Melbourne.

Publication Status: Unpublished

Persistent Link: http://hdl.handle.net/11343/38883

File Description: Behavioural ecology of the red-capped robin

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.