This article was downloaded by:[USYB - Systematic Biology] On: 15 February 2008 Access Details: [subscription number 768362667] Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Systematic Biology Publication details, including instructions for authors and subscription information: http://www.informaworld.com/smpp/title~content=t713658732 Morphological and Molecular Evidence for a Stepwise Evolutionary Transition from Teeth to Baleen in Mysticete Whales Thomas A. Deméré a; Michael R. McGowen bc; Annalisa Berta b; John Gatesy c a Department of Paleontology, San Diego Natural History Museum, San Diego, California, USA b Department of Biology, San Diego State University, San Diego, California, USA c Department of Biology, University of California, Riverside, California, USA

First Published on: 01 February 2008 To cite this Article: Deméré, Thomas A., McGowen, Michael R., Berta, Annalisa and Gatesy, John (2008) 'Morphological and Molecular Evidence for a Stepwise Evolutionary Transition from Teeth to Baleen in Mysticete Whales', Systematic Biology, 57:1, 15 - 37 To link to this article: DOI: 10.1080/10635150701884632 URL: http://dx.doi.org/10.1080/10635150701884632

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.informaworld.com/terms-and-conditions-of-access.pdf This article maybe used for research, teaching and private study purposes. Any substantial or systematic reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply or distribution in any form to anyone is expressly forbidden. The publisher does not give any warranty express or implied or make any representation that the contents will be complete or accurate or up to date. The accuracy of any instructions, formulae and drug doses should be independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising directly or indirectly in connection with or arising out of the use of this material. Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 O:10.1080/10635150701884632 DOI: online 1076-836X / print 1063-5157 ISSN: ak.We h asaentcmltl lsd the closed, completely items prey not entraps that sieve are a as functions jaws baleen frayed the baleen the of When margin medial mat- racks. the a on in fringe resulting of network plates, ted cornified the abra- of layer This medulla the plates. within tubules surfaces keratinous baleen individual the lingual exposes growing sion 1965). the continuously (Utrecht, abrade the cavity tongue of oral the the of oriented into Movements transversely extend of that typi- racks left and plates and palate is right the that forms of material cally epithelia keratinous gingival tough from a 1982). secreted is (Gaskin, it Rather, year homologous teeth. a not to in is baleen prey origin, of in epidermal kg Although 600,000 as much consume as to structure filtering unique this use species tant analyses. phylogenetic comprehensive and into characterized, incorporated formally not described, un- have adequately fossils is been transitional occurred crucial because anatomy part in feeding clear, of modern reorganization of fundamen- tal hallmark the how a Exactly 2000). (Werth, size, whales baleen body gigantic the of permitted Ul- strategy evolution resources. filter-feeding energy novel huge the timately, batch-feeding, to access efficiently gained shift by mysticetes ecological evolution; and mammalian morphological filter-feeding in of major origin a The represents baleen. derived, using to tran- filter-feeding predation the tooth-aided in primitive, from stages (e.g., sition intermediate tree preserve archaic 2002). that should family predicted Williams, forms is cetacean it and whales), (baleen the Mysticeti Thewissen For of 2001; al., base et Gingerich the macroevolutionary at of change examples remarkable provided Copyright Biol. Syst. opooia n oeua vdnefraSews vltoayTasto rmTeeth from Transition Evolutionary Stepwise a for Evidence Molecular and Morphological aeni enn etr fmdr ytcts ex- mysticetes; modern of feature defining a is Baleen have fossils whale early of discoveries Recent 71:53,2008 57(1):15–37,  c oiaepeeti ytct u aedgae opedgnsi hsgop h rmtctasomto nmysticete in ( transformation record [ameloblastin multifaceted dramatic a pattern. provides The evidence macroevolutionary molecular group. and this gap fossil this the of of bridged combination in phenotype a composite morphologies; pseudogenes a derived which in and to evolution primitive of degraded between mode stepwise have rare, apparently but an documents Mysticeti anatomy feeding in present are loci whale.] aen omdr aenwae htlc nautdniinbtrti eeomna n eei vdneo hi ancestral their and of teeth evidence includes both genetic and with that for developmental intermediate data retain supermatrix mosaic but data sequence a dentition a combined Comparative adult to The heritage. ancestor, an of toothed Mysticeti. lack toothed of that analyses a whales base from baleen Phylogenetic the transition modern at stepwise to mysticetes. relationships baleen, a resolve early supports consistently characters these genes 27,340 nuclear implies of in 11 foramina set for present nutrient data and were new teeth and baleen of taxa occurrence extinct and simultaneous The teeth baleen. structures both nourish homologous palates, that that their vessels of portions house lateral mysticetes the extant on sulci in associated and foramina nutrient have mysticetes toothed pce htpeual tlzdble ofe Rcn to (Recent feed to baleen utilized presumably that species eaddteeouino oenble-ern hls h ags nml nErh odt,alfral described formally all date, To Earth. on animals ( rocks and largest Oligocene-age niche from the species ecological toothed new whales, types: a two baleen-bearing of to conform exploitation modern fossils permitted of mysticete filter-feeding, evolution enables that the sieve heralded keratinous a specialization, key This Abstract.— oit fSseai Biologists Systematic of Society 1 eateto aenooy a ig aua itr uem a ig,Clfri 21,UA -al [email protected] E-mail: USA; 92112, California Diego, San Museum, History Natural Diego San Paleontology, of Department T HOMAS h rgno aeni ytct hlsrpeet ao rniini h hlgntchsoyo Cetacea. of history phylogenetic the in transition major a represents whales mysticete in baleen of origin The .D A. 2 eateto ilg,SnDeoSaeUiest,SnDeo aiona912 USA 92182, California Diego, San University, State Diego San Biology, of Department 3 EM eateto ilg,Uiest fClfri,Rvrie aiona951 USA 92521, California Riverside, California, of University Biology, of Department ER ´ E ´ , 1 M ICHAEL oBle nMsieeWhales Mysticete in Baleen to .M R. ENAM AMBN C G OWEN eaei)and (enamelin) ;ble;eaei ( enamelin baleen; ); ∼ 15 0mlinyasod.Hr,w hwta eea Oligocene several that show we Here, old). years million 30 r nepee sotooia orltsfrtepres- the 2001; Muizon, and for Fordyce 1965; correlates (Kellogg, generally baleen of osteological mysticetes ence as edentulous interpreted of are palate the on tures hypothesis. this of support in evidence anatomical absence of the been noted but have mysticetes toothed might some in baleen present that speculated 2006). isolated (1984) Fitzgerald, 2005b; Fordyce of 1995; al., et grasping Arnold al., tooth-aided 2000; (Werth, prey or et suction Barnes by (toothed whales) odontocetes 1994; to similarly fed Barnes, or 2005), Ichishima, and Fordyce seal, crabeater 1989; living multi- the carcinophagus their of manner with Lobodon the items in prey teeth filtered cusped lacked either mysticetes and toothed previous baleen these Most that 2006). suggested Muizon, Fitzgerald, studies and 2003a; Fordyce Fordyce, 1989; 2001; Mitchell, 1939; Ocean (Pritchard, Southern the from Llanocetidae Mammalodontidae, and of Janjucetidae, members and Pacific 1995) North al., the et from (Barnes aetiocetids include These Ma). 34 oee,tefsi eodas a ile mysticetes ( rocks yielded Oligocene-age Early to has Late from also teeth 2006). with record 1982, fossil (Fordyce, the Zealand Barnes, However, New and and (Sanders USA 2002b), Carolina, 2002a, South of [Ma]) old rmLt lgcn-g ok ( rocks Oligocene-age Late from tus ocpueageain fsalfih netbae,or invertebrates, fish, 2000). small (Werth, both of aggregations capture specializations, to behavioral and anatomical with unique combination other in (Pivorunas, racks, baleen mouth their utilize as the and (toothless) adults edentulous of are out mysticetes extant pass All 1979). to water allows but , 2 , lhuhble aeyfsiie,bn aclrstruc- vascular bony fossilizes, rarely baleen Although h aletkoneetlu ytcts( mysticetes edentulous known earliest The 3 , Micromysticetus A NNALISA AMBN ENAM aeolsi)idct htenamel-specific that indicate (ameloblastin) ∼ B 4t 4mlinyasod n toothless and old) years million 34 to 24 ERTA ;eouin le-edn;Mysticeti; filter-feeding; evolution; ); and , , 2 Frye 94 99 Mitchell, 1989; 1984, (Fordyce, AND Mauicetus J OHN ∼ 4t 0mlinyears million 30 to 24 aebe recovered been have ) G ATESY 3 Eomystice- ∼ 4to 24 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 ht rospitt uretfrmn n soitdsli ht of Photo sulci. associated physalus and foramina Balaenoptera nutrient to point arrows white hl)wt iscinsoigtohbd nuprjw n d e) (d, and jaw; upper of in holotype buds the of tooth palate showing dissection with whale) 16 hl) c aea iwo ytct eu ( fetus mysticete a of view lateral (c) whale); rma xateetlu ytct ( mysticete edentulous extant an from ilo er l) sa nagmn fteisti (blue a in inset the of enlargement an is b old). years million uretfrmn red foramen; nutrient F IGURE .Msieepltsaddniin.(,b ktho palate of sketch b) (a, dentitions. and palates Mysticete 1. sb lxAulr(GRUMM/FDS). Aguilar Alex by is = ucs.ei nelreeto h ne nd; in inset the of enlargement an is e sulcus). eictsweltoni Aetiocetus aanpeaacutorostrata Balaenoptera UM 122900; (UCMP aanpeaphysalus Balaenoptera YTMTCBIOLOGY SYSTEMATIC ∼ = —minke 4t 28 to 24 lateral —fin 04 u ta. 2005). al., al., et et Kawasaki the Huq 2003; of Weiss, 2004; development and proper (Kawasaki for dentition essential linked are several that includes genes loss family the gene (SCPP) with phos- phoprotein calcium-binding constraints secretory The selective teeth. functional the from of reg- release at should genes a change dental ister particular, evolutionary In involved level. molecular have but behavior must and anatomy also in changes extensive cluded Bouetel 2007). 2007; Steeman, 2006; 2005, Muizon, 2002a; Bisconti, and 2003; Barnes, Sanders, and and Sanders Geisler palate 2002; the Ozawa, from suspended and baleen (Kimura of with racks toothless left are and jaws right the saltatory where condition direct modern to a the jaws tooth-lined with imply form ancestral an instead from transition Mysticeti of phylogenetic analyses ontogeny recent most the However, mysticetes. in extant recapitulated of is that transformation charac- ter evolutionary ancient an developmen- represent This could series 1999). and tal al., (Ishikawa et adults Ishikawa and 1995; last juveniles Amasaki, the in whereas observed utero, baleen in is to occur stage stages germs, two plate first baleen the and only; teeth to 1c), teeth (Fig. 1999). with only stage al., a through et pass Ishikawa mysticetes modern 1962; Thus, Karlsen, 1962; Vervoort Slijper, and 1954; Dissel-Scherft 1923; (Ridewood, be- birth resorbed are fore ultimately and fetus, line, the gum the in break develop foramina never teeth nutrient lower and lateral upper distinct Both remain. the only until progressively ossifies palate the on same groove the alveolar co- open at the develop while time degeneration, to bud begin tooth plates with baleen incident primordial the subsequent of no papil- lae Dermal is 1999). al., there et (Ishikawa but enamel of stage, formation bell the during dentin msk,19;Ihkw ta. 99.I h ik whale minke the In ( the 1999). al., and reach et Ishikawa Ishikawa 1995; to 1962; Amasaki, odon- (Karlsen, fail macrophages by bell and but degradation and toclasts before 1c) cap, stage (Fig. bud, (maturation) crown the development through 1923). of pass stages (Ridewood, where germs palate develops tooth flat The dentition the groove of rudimentary alveolar edge open a lateral single the a along is running there mys- Instead, balaenopterid extant ticetes. of specimens fetal early of illa mysticetes. baleen-bearing to unique feature a neomorphic considered be can foramina nutrient lateral the foramina whereas placed foramina, palatine mammalian medially generalized the represent the Thus, develops baleen 1938). growing (Walmsley, continually the which epithe- from the lia nourish artery blood alveolar The superior the b). of 1a, the vessels (Fig. nerve of and branches artery alveolar for superior vascular passage associated provide and marked that foramina is grooves/sulci nutrient only) of series (maxillary a palate by the of conduct portion the contrast, maxillary) lateral In nerve. and and artery (palatine palatine descending palate the medial the the of on foramina portion taxa, extant In 2006). Fitzgerald, hshpoen sepesdi ot etnbtalso but dentin tooth in expressed is phosphoprotein) aanpeaacutorostrata Balaenoptera h hf oafitrfeigsrtg nMsieiin- Mysticeti in strategy filter-feeding a to shift The aea uretfrmn r o rsn ntemax- the on present not are foramina nutrient Lateral ,ootbat ei osecrete to begin odontoblasts ), DMP1 dni arxacidic matrix (dentin VOL. 57 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 ee l,2005). al., et Ye et oble nmsieewhales. mysticete from in baleen transformation to re- teeth macroevolutionary to database the combined construct this of charac- analyses execute we phylogenetic a Finally, Mysticeti. into for supermatrix evidence ter/taxon edentulous molecular generated of newly and the genomes morphological integrate we the Third, from whales. baleen genes, dental three including SCPP loci, nuclear and to 11 amplify of predation sequences PCR characterize we tooth-assisted Second, from baleen. with transition filter-feeding the critical in a in represent anatomy link that palatal mysticetes of aetiocetid observations Oligocene new document we baleen modern in genes functional, whales. not SCPP but present, enamel-specific be that would den- predicted mineralized we fully recently titions, with mysticetes ancestors edentulous from Ishikawa that descended 1954; Given 1995; 1999). enamel Vervoort Amasaki, al., whales, and and et Ishikawa baleen (Dissel-Scherft 1962; fetal not Karlsen, of is teeth apparently transient produced is the dentin Although al., in 2005). et al., Kim et 2004; Hu Masuya al., 2005; 2002; et al., Fukumoto, 2003; et (M˚ardh Yamakoshi, and hypocalcified and be can rough, enamel SCPP thin, malformed amelo- the these as where such imperfecta of defects, genesis dental mutants with associated enamel; are genes developing in proteins found matrix extracellular respectively, enamelin and fthe mutations of null by disrupted is bone of and development cartilage, dentin, normal tissues; skeletal in broadly more 2008 u weltoni tus Fg.1,ead2.W hncmae h ntm of anatomy the compared then We weltoni 2). A. and e surface 1d, palatal (Figs. well-preserved the reveal to mud- surrounding matrix the stone with left along skull the the removed from we dentary California (UCMP), of Paleontology University of the Museum of closely permission the the With by ma- trix. sedimentary obscured intervening and was jaws lower holotype articulated the of palatal this the anatomy 1995), When al., et (Barnes dentition. described first was and species palate preserved completely u oyavu,Atoeu oyetts hnctsgoed- colliveri Chonecetus Mammalodon polydentatus, ertorum, Aetiocetus cotylalveus, tus oiwudb erddpedgns eatmtdto attempted We these pseudogenes. that degraded or be baleen genes would that loci enamel-specific expected lack be would Ishikawa might whales it 1995; Therefore, Amasaki, 1999). al., and et Ishikawa 1954; Vervoort 1962; and Karlsen, (Dissel-Scherft enamel produce not “archaeo- 1). an Appendix (see and cete” odontocetes, mysticetes, edentulous mn eictdmsiee,tehltp of holotype the mysticetes, aetiocetid Among h betvso hssuyaetefloig First, following. the are study this of objectives The atrsac ugssta xatmsiee do mysticetes extant that suggests research Past e bevtoso ote ytct Palates Mysticete Toothed of Observations New DMP1 ota fohrtohdmsiee ( mysticetes toothed other of that to UM 122900; (UCMP CPLc Dna eeMatrix) Gene (Dental Loci SCPP ee(ege l,20;Msae l,2005; al., et Massa 2003; al., et (Feng gene M AMBN TRASAND ATERIALS and DEM ENAM ∼ ER ´ 4t 8M)hstemost the has Ma) 28 to 24 and , TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E M ´ ETHODS noeameloblastin encode ajctshunderi Janjucetus Aetioce- Aetioce- ), MTi,3m MgCl mM 3 Tris, mM ecin eedn n50- in done were reactions of list samples). complete DNA for of the sources 1 and Appendix of taxa (see analyses genes phylogenetic dental in three included were mammalian six species another from out- data 12 Published and taxa. species group mysticete edentulous 13 ex- from SCPP 6) exon four of ( segments ons sequence and amplify PCR 0cce t94 at cycles 50 NP,2 dNTPs, eauainpaea 94 at initial phase an denaturation included Amplifications (Invitrogen). merase 1mn;adafia lnainpaea 72 at phase elongation final a and min); (1 l seaoe n ih diinlncerlc ( loci nuclear additional eight and above) fam- (see SCPP the ily from com- genes dental three a surveyed extant we taxa, For into 2005). Lee, integrated (e.g., supermatrix were systematic bined outgroups and Mysticeti below). (see com- the supermatrix into mysticete incorporated bined were also Morphobank three genes dental to the SCPP submitted for This was Data (OTUs). (http://morphobank.geongrid.org). posi- matrix” units nucleotide taxonomic gene 1,708 operational “dental of 31 set for data tions single a into merged a hrcesfrom characters implemented and gap sequences is ¨uller, Aligned (M v.1.25 that 2005). SeqState 2000) in Ochoterena, and assigned (Simmons procedure coding” were gap 1.9a “simple alignments the using SeqApp final states character in using Gaps eye 1992). by (Gilbert, alignments other algorithmic for to the made used were were adjustments Minor settings parameters. default extension alignment and gap 1, 10, MacVector at was in set penalty was implemented penalty as Gap-opening 1994) 7.2.3. al., et (Thompson nos. (accession GenBank to EU445026-EU445074). submitted EU444965-EU445012, All were genes. data dental mysticete new in codons stop identification premature for of and concep- sequences DNA for of 7.2.3 sub- translation MacVector tual for used derived We was analyses. consensus sequent a and sequenced, were clones three minimally (Invitrogen), vector using 4-TOPO cloned pCR was product PCR sequenced the that cases, these product In cleanly. concentrated a amplifications produce not PCR did Some ambiguities. IUPAC as were coded in sites heterozygous assembled and were (Accelrys), Contigs 7.2.3 MacVector directions. se- both were in and quenced (Millipore) Devices Filter Centrifugal Montage PCR using concentrated and cleaned were products Anl ta. 05) netoso rnpsn (Nikaido transposons of insertions 2005a), pub- al., et with (Arnold patterns data coloration these including evidence merged systematic We fos- lished species. both living for and coded sil were characters morphological 102 DF CSN2 BDNF, C rmr o CPgnsaesoni al .PCR 1. Table in shown are genes SCPP for primers PCR oprtv opooia n oeua aafor data molecular and morphological Comparative rhlgu eune eeainduigCutlW Clustal using aligned were sequences Orthologous AMBN obndMrhlgcladMlclrData Molecular and Morphological Combined µ fec rmr n . o10Uof U 1.0 to 0.5 and primer, each of M xn n 13, and 6 exons , PKDREJ ◦ 1mn,53 min), (1 C MsieeSupermatrix) (Mysticete AMBN , 2 PRM1 66m (NH mM 16.6 , ◦ µ 2mn;floe y4 to 45 by followed min); (2 C oue n otie 67 contained and volumes L , ENAM ◦ , DMP1 Cto58 IL,RG,STAT5A RAG1, KITLG, and , xn9 and 9, exon ◦ 1mn,72 min), (1 C 4 ◦ ) 2mn.PCR min). (2 C 2 SO ENAM 4 200 , Taq ATP7A DMP1 poly- were µ ◦ 17 M C ); , Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 AMBN DMP1 Gene 18 sdt mlf rhlgu N rget rmdfeetmmainseis iain o ulse rmr r oe.PRamplifications PCR noted. are primers published for citations species; mammalian different second from the fragments with DNA orthologous amplify to used oaia(P3 foramina eo 3 CCGCTGGGT TCAGGGCTCTTGGAAACGC GCTCAGCCTTGGAGGGATG CTCAACAGCCAGGACAGAA ENAM 13) (exon AMBN 6) (exon KITLG CSN2 BDNF ATP7A PRM1 PKDREJ STAT5A RAG1 F T IGURE ABLE .PRpiesuiie nti td 5 o3) o ahgn rget lentv obntoso owr n ees rmr were primers reverse and forward of combinations alternative fragment, gene each For 3’). to (5’ study this in utilized primers PCR 1. .Seepi htgaho etsd fplt of palate of side left of photograph Stereopair 2. = hr pe premolar). upper third RAG1 owr rmrwr eune ihtethird the with sequenced were primer forward CTCGAGATCTGTGGCRTAATAGCCCCTGCTC TCAGGGCTCTTGGAAATGC CTTTGGTGGCTTTTCTGATG TCCTGCTGGAAGAAATACTTGG AGGATTTGGAGGCATGAGG TATGAATATTCTTTGCCTGTGC ate ta. 2001 al., et CATCTTGGCAATCATTGTCATCMatthee 2000 Arctander, and Gatesy 1996 al., et Gatesy 2001 al., et Murphy 2001 al., et Murphy CAAGACCCCAGCAGCGAGTC url ta. 1995 al., et Queralt AAGGGGAAGCGG CAGATACACCCCCCAAGGTAAAG CAAAAGTGTGAGTATAGGACCG CCGTGAGGATAAATAGGAACGACG CTCGCAACCTG ACACGGATGGCCAAGCAAACAGCTG AGCTCGTCAGCTTGTCTGTGCTC 2001 al., et Matthee TGACTCGATCCATCCCACT TGACTCGATCCATCCCACTGAGTTCTG ACTTCCTGGCCAGACCTCATTGC owr primers Forward YTMTCBIOLOGY SYSTEMATIC eictsweltoni Aetiocetus RAG1 owr rmrlse below. listed primer forward UM 290.Arw on otesxpseirms nutrient posterior-most six the to point Arrows 122900). (UCMP aeyadAcadr 2000 Arctander, and Gatesy 2001 al., et Murphy 2001 al., et Murphy ate ta. 2001 al., et Matthee 1996 al., et Gatesy url ta. 1995 al., et Queralt ate ta. 2001 al., et Matthee GTGAATCATGCTTAATCTGG TCTCCGATGGGTTTGTTGTG GCATTRTTRGCATARTAGCCC GTGGCAAGAGGGTCTTGAAG ATAT AGTGAGGATCGAAAGGAATG ees primers Reverse VOL. 57 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 crsfrtemrhlgclpriinaesonol tciia aa oe.Cmo ae o xattx r nbakt otergt and right, the to brackets in are taxa extant for names Common nodes. basal critical at “ by only marked shown are are taxa partition extinct morphological the for scores xic,ms oeua aaaemsig n opooyi h nypriincddfraltx.Nmesa nendsso parsimony show internodes at Numbers taxa. all for are coded Black species partition taxon. of only majority each the the for Because purple is sampled analyses: data. were morphology different published for (top) and previously support sets Bremer designate missing, data and circles are percentage which gray bootstrap data indicate and paper, circles molecular this gray most for and extinct, collected Black data collapsed. character asterisks specify with circles nodes three the unordered, l hrcesuodrd orange unordered; characters all 2008 ta. 06,mtcodil(t eoe ( genomes (mt) mitochondrial 2006), al., et 04 aaie l,20,20) n iest fnu- of diversity a ( and sequences 2006), 2005, DNA al., clear et Sasaki 2004; oosfralncerlc eea ecie above described the an- as for PCR were that temperature except loci Matrix]), nealing Gene nuclear [Dental Loci all (SCPP for tocols of sources see list). shows character examined; morphological 1 specimens for 2 museum Appendix Appendix and 4; samples 3, DNA (Figs. out- of taxa representatives five group and extinct) taxa 20 mysticete and 31 extant of (11 summarize attributes genomic al., that and Mysticeti physical et characters for the Rychel systematic supermatrix 2003; The 27,340 2006). Dizon, included al., and et Hatch Levenson 2004; 2003; al., et (59 (exon) intron), F C,sqecn,ainet n a-oigpro- gap-coding and alignment, sequencing, PCR, ◦ IGURE Cto63 CSN2 , .Src osnu redrvdfo asmn nlsso h ytct uemti sm hrcesodrd.Wt l characters all With ordered). characters (some supermatrix mysticete the of analysis parsimony from derived tree consensus Strict 3. KITLG ◦ ) C rmr for primers PCR C). (exon), eo n intron) and (exon PKDREJ † .” DEM rao ta. 92 Nishida 1992; al., et Arnason ´ = opooywt oecaatr ree;adblue and ordered; characters some with morphology ER ´ RAG1 (exon), TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ ATP7A RAG1 , eewshigher was gene PRM1 rao tal., et Arnason (exon), ´ eo) and (exon), eo and (exon BDNF = h ytct uemti a trda Morphobank at stored was (http://morphobank.geongrid.org). submitted and supermatrix were EU444877-EU445074), mysticete sequences nos. char- the (accession molecular DNA all GenBank New for to extinct 3). (?) evidence; (Fig. missing as acters systematic morpholog- coded published were our taxa and with data combined associated ical were and characters positions) DNA gap nucleotide generated (6083 newly supermatrix, sequences mysticete the For STAT5A hrces n h etlgn arx(1OTUs; (31 parsimony-informative PAUP matrix in gene executed characters) were 3574 parsimony-informative dental 698 characters; the 1750 and characters; characters) 27,340 uemti ihsm hrcesodrd green ordered; characters some with supermatrix asmn nlsso h uemti 3 OTUs; (36 supermatrix the of analyses Parsimony hlgntcAaye n hrce Mapping Character and Analyses Phylogenetic eo n nrn r niae nTbe1. Table in indicated are intron) and (exon = opooywt l hrcesuodrd Support unordered. characters all with morphology ∗ .b0(wfod 02.For 2002). (Swofford, 4.0b10 = uemti with supermatrix 19 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 xattx,adlgtga ice akndsta en eainhp mn hs aa asmn otta ecnae titroe are internodes at percentages 3). bootstrap (Fig. Parsimony consensus taxa. strict these (above the among only of relationships taxa resolution define extant connect that that incomplete the lineages nodes for highlight of branches mark accounted analyses gray circles Thick supermatrix and topologies. gray for analysis length light minimum this all and in in taxa, identical unstable were extant taxa were 32 remaining that the species among Relationships four to connect branches 20 eiie ybakt otergt n hlyetnttx r akdb ” by marked are taxa extinct wholly and right, the to brackets by delimited 03,adfrtedna eemti,mmesof members matrix, gene dental the ( for Euarchontoglires and 2003), “archaeocete” kochii the supermatrix, mysticete the pia re upre ytesprarx(ld :2;caeB ,2,3,6,7,8;caeC 8 ld :4 ld :4,4,5) h niut of antiquity The 53). 42, 41, E: clade 4; D: clade is 38; B C: clade all clade that in 83; suggests groups 79, 2006) these 61, Fordyce, for 36, 2002b; synapomorphies 22, 2002a, unreversed 5, Barnes, B: and and clade unique (Sanders 23; were mysticetes A: edentulous 2) (clade earliest (Appendix supermatrix the characters the following by The supported text. trees optimal the in discussed Mysticeti of erhswr ersi with heuristic Parsimony were 2). the searches of Appendix subset (see a super- characters ordering morphological the of were influence of the generally checked analyses matrix Characters changes supplementary state weight. but character unordered, equal analyses, given most In were 2001). al., et norvegicus Rattus titcnessteswr sdt umrz rela- and summarize to option), used (“amb-“ were zero trees collapsed was consensus were length strict branches minimum Internal if swapping. branch (TBR) reconnection bisection tree and replicates addition F IGURE E a sda h ugop(ese n Sanders, and (Geisler outgroup the as used was .Oeo i pia ldgasdrvdfo asmn nlsso h ytct uemti sm hrcesodrd.Dashed ordered). characters (some supermatrix mysticete the of analysis parsimony from derived cladograms optimal six of One 4. D C otdtermiig2 aa(Murphy taxa 27 remaining the rooted ) B oosapiens Homo A 100 100 96 96 ≥ 100 100 0 admstepwise- random 500 + u musculus Mus 64 76 = Zygorhiza YTMTCBIOLOGY SYSTEMATIC 88 90 oecaatr ree;below ordered; characters some 100 100 100 100 100 100 100 100 + 100 100 100 100 † upriin ftesprarx(e.g., supermatrix the individual for of executed were subpartitions searches topologies. tree length minimum Additional all by supported tionships cie bv,btwt 0t 0 admsews ad- stepwise random 100 PAUP to de- using 50 ditions, as with but were above, analyses scribed parsimony non- by calculations, and support 1994) Bremer For (Bremer, 1985). (Felsenstein, bootstrapping scores parametric support Bremer by only). taxa extant morphology, mtDNA, n B rnhswapping. branch additions stepwise TBR random and 10 with heuristic the was iteration, bootstrap search each for and executed, were pseudorepli- cates thousand One considered. parsimony-informative were characters only analysis, bootstrap each In ”Cptlltesa oe ihbakcrls( oE niaesubclades indicate E) to (A circles black with nodes at letters Capital .” upr nteprioyfaeokwsevaluated was framework parsimony the in Support Balaenoptera bonaerensis bonaerensis Balaenoptera Balaenoptera physalus physalus Balaenoptera Balaenoptera edeni / brydei brydei / edeni Balaenoptera Balaenoptera acutorostrata acutorostrata Balaenoptera Balaenoptera musculus musculus Balaenoptera Balaenoptera borealis Balaenoptera Physeter macrocephalus macrocephalus Physeter Eschrichtius robustus robustus Eschrichtius † † † † † † † † marginata Caperea †SDSNH 90517 † † † † novaeangliae Megaptera † † † Ziphiidae † † † † † † † Balaena mysticetus mysticetus Balaena Eubalaena Eubalaena Parietobalaena palmeri Parietobalaena hiatus Diorocetus patulus Aglaocetus laticephalus Isanacetus calvertensis Pelocetus oregonensis Cophocetus elysius Mixocetus rathkii Cetotherium gastaldii baulinensis “Balaenoptera” Parabalaenoptera miocaena “Megaptera” hubachi Megaptera Zygorhiza kochii Zygorhiza Agorophius calvertensis Squalodon hunderi Janjucetus colliveri Mammalodon goedertorum Chonecetus polydentatus Aetiocetus cotylalveus Aetiocetus weltoni Aetiocetus whitmorei Eomysticetus = l hrcesuodrd.Hge-ee aaare taxa Higher-level unordered). characters all ∗ n reo.2 Srno,1999). (Sorenson, TreeRot.v2c and ∼ 8M rolder. or Ma 28 †"Archaeoceti" †Eomysticetidae Odontoceti †Janjucetidae †Mammalodontidae †Aetiocetidae †"Cetotheriidae" Balaenidae Neobalaenidae Eschrichtiidae Balaenopteridae CSN2 Outgroups Mysticetes Toothed Mysticetes Toothless VOL. gene, 57 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 2008 hrces igemdlwsuiie o sequences for utilized was model from single A gap and characters. nucleotides aligned partitions: two was into set divided data The 2003). MrBayes Huelsenbeck, using and conducted (Ronquist was 3.1.1 matrix gene dental the of ae ihtesuladosue h ih ieo the of side foram- articu- right nutrient still the the of obscures is description following and mandible The palate). skull right the (the with M2 lated row tooth nutri- and left lateral C the to eight between medial of slightly occurs series foramina anterior A ent fine denticles. with posterior trian- complex and broadly topographically more and compressed, gular, transversely (P2– are teeth posterior M3) the crowns; simple with caniniform pointed, roughly sharply are (I1–P1) teeth anterior the 2), upre yprioyaayi ftemr compre- more the supermatrix. of those hensive analysis matrix, were parsimony gene mysticetes by dental extant supported the among of relationships analysis fa- and those Bayesian were by Mysticeti vored rela- to topology, outgroups this among In tree. tionships composite second, also we a results, utilized supermatrix re- and our because with unconventional conflicted but parsi- were sharply matrix, length Mysticeti gene minimum within dental This lationships the the matrix. for of gene trees one mony dental was the also of topology analysis from trees. consensus two Bayesian rule majority employed the the we was topology genes, first molec- dental The of in of optimization changes analyses For ular by supermatrix. morphological supported mysticete For trees the genes. utilized we and dental characters, insertions in 1995; (2) al., (indels) and et deletions 2006), Barnes Fitzgerald, 2003b; 2005; 1982, Bouetel, (Fordyce, filter-feeding to Mysticeti related in be may that changes anatomical state PAUP ing us- character parsimony by optimized hypotheses phylogenetic we onto changes Mysticeti, in changes ary remaining the of for probabilities clade. consensus posterior each summarize rule to taken majority was dis- trees 50% were output, a trees of inspection and 10,000 visual following first burn-in as the sampled carded generations, were Trees 100 and generations. every priors 5,000,000 for default run used was analysis characters. gap Bayesian associated Partitioned for “binary” implemented The was 2004). model (Nylander, crite- v2 information MrModelTest Akaike in the rion to according selected was e e´re 05 e´ree l,20) nteholotype of (also the skull aetiocetids In Oligocene al., 2006). Dem´er´e, Dem´er´e three al., et see discov- 2005; et in we Barnes features but these 1989; 2006), ered Fitzgerald, Mitchell, 2005; 2003a; Ichishima, Fordyce, 1995; 1989; 1939; 1984, (Pritchard, 1982, mysticetes fossil-toothed descriptions published of previously in documented been akvcanMneCro(CC aeinanalysis Bayesian (MCMC) Carlo Monte chain Markov orcntuttesqec n iigo evolution- of timing and sequence the reconstruct To aea uretfrmn n soitdslihv not have sulci associated and foramina nutrient Lateral DMP1 e bevtoso ote ytct Palates Mysticete Toothed of Observations New eictsweltoni Aetiocetus ∗ Sofr,20) npriua,w apd(1) mapped we particular, In 2002). (Swofford, , AMBN and , R DEM ESULTS UM 290 is d and e 1d, Figs. 122900; (UCMP ENAM ER ´ TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ h GTR the ; + I + model G o ssal( Foramen small 8). and is (no. 1 1) foramen no. (no. anteriormost foramen the to posteriormost proceeds the with begins ina onro h xoe 3ro,adteascae sulcus associated the and root, ( P3 exposed the of corner h eilavoa agno 2 n pn noafine, a sulcus into opens oriented and M2, anterolaterally of margin alveolar medial the om nageof angle an forms lel,adoesatrol noadlct ucsthat sulcus delicate a oriented into is anteriorly opens and alveoli, ntergtmxlabtenP n 3i le with filled is P3 and P2 between lies One maxilla matrix, foramina. right nutrient the lateral on distinct three 131146) LACM preserves County; Angeles Los of Museum of History skull holotype The h neirotfrmn(o )occurs 8) plane. (no. sagittal foramen the anteriormost to The parallel roughly poste- and more foramina, the with rior associated those to relative distinct otesgta ln n measures and plane sagittal the to of is foramen ( This P1. caliber and small C the between diastema the to te ag oae ( foramen large other inptencnit faruhyrda retto of orientation of radial arch roughly an a through of sulci vasculariza- consists maxillary pattern general tion the Thus, the to plane. parallel roughly sagittal oriented and formed poorly is cus imtri positioned is diameter ihtesgta ln n measures and plane sagittal the with cuso h etmxlaajcn oteM alveolus; oriented M2 anterolaterally the is to sulcus adjacent filled maxilla matrix the left the on occurs ucso hsfrmn(o )i hr ( short associated is 7) The (no. P2. foramen of this border of alveolar sulcus medial the of mm m epciey agrfrmn(o 6) (no. foramen larger A respectively. mm, h aitlpaeo 10 of plane sagittal the oitdwt hs eiaefrmn oma nl of angle an form foramina ∼ delicate these with sociated occurs 5) ( small of pair ofrmnn.1 w oaiao h aesaldi- small same the of foramina two ( 1, ameter no. foramen to 1avou.Teascae ucsfrsa nl of angle an forms sulcus associated The alveolus. M1 irt o iha neirydrce ucs( sulcus directed anteriorly an ante- with mm 2 6 no. occurs to 3) rior (no. foramen other the while plane, otro oae fti ar(o )adissulcus its and 2) (no. pair this ( of foramen posterior og hti angled is that long) fsmlrsz n retto ntoohrOligocene other two in orientation and aetiocetids, size similar of (see “cetotheres” fossil and below). b) to 1a, (Fig. Relative that balaenopterids palate. to of similar the orientation most is of parasagittal pattern portion this mysticetes, more anterior edentulous the a in and sulci 2) of (Fig. palate the 51)adocr ntergtmxlaajcn othe to adjacent maxilla right the diastema, on P4–M1 occurs and 25210) of palate cotylalveus the tus on obvi- found one was Only foramen 122900. nutrient UCMP ous in than poorer much was torum, ∼ ∼ 20 eas bevdltrlntin oaiaadsulci and foramina nutrient lateral observed also We 55m og angles long) mm 15.5 . mln)fr nageof angle an form long) mm 2.5 ◦ ihtesgta ln n measure and plane sagittal the with u rsraino h aaei hs specimens these in palate the of preservation but ∼ ∼ m r positioned are mm) 1 ∼ mfo h eileg fP;slias- sulci P4; of edge medial the from mm 9 ∼ eictscotylalveus Aetiocetus 4 o3m rmtemda agn fthe of margins medial the from mm 3 to 2 ∼ ∼ ◦ Uie ttsNtoa uem USNM Museum; National States (United ∼ mdaee)frmn n.4adno. and 4 (no. foramina diameter) mm 1 otesgta ln.Ascn foramen second A plane. sagittal the to mdaee) n t soitdsul- associated its and diameter), mm 1 mdaee) located diameter), mm 1 ∼ ∼ mfo h eilmri fthe of margin medial the from mm 3 40 ∼ ∼ ◦ 25 mdaee)ocr ihn4 within occurs diameter) mm 2 hnctsgoedertorum Chonecetus ◦ ∼ ihtesgta ln.Anterior plane. sagittal the with ◦ ∼ ∼ o60 to mfo h posteromedial the from mm 7 otesgta ln.Another plane. sagittal the to 50 10 ◦ ◦ ◦ ie,frigage with angles forming (i.e., otesgta ln.An- plane. sagittal the to ntepseirhl of half posterior the in ) ∼ ∼ and 1m nlnt that length in mm 11 ∼ mfo 1 The M1. from mm 3 ∼ 60 ∼ mi egh A length. in mm 5 ◦ ∼ hnctsgoeder- Chonecetus 3m nlength. in mm 13 ihtesagittal the with mln) less long), mm 7 ∼ ∼ mmedial mm 3 ∼ 0m from mm 10 ∼ . n 5.5 and 8.5 . min mm 1.5 ∼ (Natural Aetioce- . mm 6.5 ∼ ∼ 40 21 5 ◦ ◦ Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 rlntin oaiaadascae uc Gilrand 2006). (Geisler Fitzgerald, 2003; sulci Sanders, associated and lat- foramina lack nutrient to eral Mam- reported of are members Janjucetidae, as and malodontidae well PV4745). as ChM fossils, undescribed and These (The ChMPV5720 States United Museum; eastern Charleston archaic the of from discovery mysticetes Barnes the toothed abstract, announced meeting extant (1996) another Sanders in In and baleen b). with 1a, associated (Fig. species sulci the to mologous ailoinaintruha rhof arch an through orientation radial rrul) h itntsliascae ihtelateral the ( with Balaenopteridae foramina associated of nutrient sulci species distinct the extant (rorquals), most In mysticetes. u i o pcf h rsneo uretforamina nutrient ( of mysticete Oligocene presence Early the this specify in not did but ecito urnl slcig n ti o e clear of yet grooves not palatal is fine it the and lacking, whether is currently description uemti nlss ecoded we analysis, in supermatrix seen those foram- delicate like of detection ina allow not not might is palate fossil the preservation of poor this relatively of the and preparation however, complete, The examined. we aetiocetid fourth that the 12), AMP Paleontology; of in Museum sulci associated and tdslu sapoiaeyprle otesgta plane is sagittal and the to parallel approximately the is sulcus to ated adjacent maxilla left alveolus, the P4 on occurs foramen third 22 roe rudteavoi fteuprtehi the in teeth upper the of of skull alveoli” holotype the around fine grooves “abundant mys- observed toothed (2003a) other Fordyce of families. ticete members from reported have been foramina not Such apparently foramina. genus nutrient aetiocetid lateral third expresses a that noteworthy is it however, published; been the not has of vascularization account palatal thorough A (AMP14). Japan Hokkaido, of close species in undescribed features an of of these dentition of the presence with the association cited Sawamura (2006) abstract, al. meeting et recent a In Aetiocetidae. in 2). (Appendix palate the on nutrient of foramina presence/absence 38, no. character for (?) ocal n nlswt h aitlpaefo 15 from plane sagittal the with angles ing aallrw firglrysae n aibysized variably and shaped ( irregularly foramina of rows parallel two involves roughly condition eschrichtiid The are distinct. taxa these in patterns pos- vascularization the maxillary sulci, terior echelon en ori- somewhat parasagittally and elongate, of ented, consists also Bal- whales) right whales), (pygmy Neobalaenidae (gray and whales), bowhead Eschrichtiidae and in (right aenidae of vascularization maxillary members 1a, anterior (Fig. extant palate the parasagittal the Although more of a portion b). anterior and the palate in the orientation of half posterior the aea uretfrmn r rsn nalrecent all in present are foramina nutrient Lateral aea uretfrmn vdnl r widespread are evidently foramina nutrient Lateral Morawanocetus bevtoso aaeVsuaiaini Edentulous in Vascularization Palate of Observations ∼ mln.W i o n uretforamina nutrient find not did We long. mm 7 > 5prsd) ihvr hr ononexistent to short very with side), per 25 ∼ ytctsadi Odontocetes in and Mysticetes mfo t eilmri.Teassoci- The margin. medial its from mm 1 Atoeia)fo h aeOligocene Late the from (Aetiocetidae) lnctsdenticrenatus Llanocetus ∼ 0t 7prsd)hv general a have side) per 17 to 10 .weltoni A. eictspolydentatus Aetiocetus .polydentatus A. Fg.1 n ) nour In 2). and 1e (Figs. ∼ 4M) detailed A Ma). 34 Llanocetus ∼ 85 (Llanocetidae) ◦ ◦ ie,form- (i.e., o100 to YTMTCBIOLOGY SYSTEMATIC sequiv- as (Ashoro r ho- are ◦ )in ictd n dnuosmsiee.Zpid ipa a display Ziphiids ae- mysticetes. of edentulous foramina and palatal is tiocetids lateral the condition with ziphiid homologous the associated, not that of indicate lack the sulci and well-defined rostrum the of How- extreme margin the lateral on mysticetes. groove basirostral the edentulous of of position fetal, the ever, alveoli open of the dental groove and the alveolar aetiocetids) with (including cetaceans homologous toothed is basiros- groove ziphiid its the tral Clearly, along length. foramina oc- curvilinear spaced the broadly randomly on based small, location still of general is currence its the it obscure, discern where and to ossified individuals, possible well mature is groove physically basirostral Even which of 1971). to skulls Besharse, in 1937; degree and/or (Raven, species variable stages different ontogenetic in the developed “basiros- are note grooves the such and this groove” call tral morphologists Ziphiid present. (e.g., some offer to here. possible observations is general it but lacking, and are beaked in whales patterns sperm vascular compara- palate the detailed of knowledge, studies tive our To 1869, 1989). (Flower, erupt Rice, not soft 1878; do in generally embedded and are tissues teeth palatal the Instead, ( do exception). alveoli present an bony is when distinct and into rudimen- 1951) insert not typically 1950, are 1938, (Boschma, teeth members tary maxillary extant groups, In both discussion. of expanded de- more however, a whales), (beaked serve (sperm ziphiids exam- physeterids in and have vascularization whales) The palatal absent. we are of sulci that patterns and foramina odontocetes nutrient lateral extinct ined, and extant xatbleotrd,ecp hti ayo h “ce- the longer. distinctly of are many sulci of posterior in the that that totheres,” like except 2006; most balaenopterids, Muizon, is extant and condition Bouetel This 2002; obs.). Dem´er´e 1968c; Ozawa, pers. 1968b, oriented, and 1968a, 1965, Kimura parasagittally 1934, radially (Kellogg, anterior, sulci posterior, with elongate of sulci pattern a arranged describe mysticetes. generally “cetotheres” edentulous Miocene and of fossil are reports of these of majority number The been a have in sulci reported and foramina nutrient lateral prepared, maxilla. edge the of posterior plate the infraorbital to the extend of not does neobalaenid groove the balaenids, maxillary in condition the to contrast In groove. maxillary longitudinal medially continuous, originate nearly a that from sulci oriented transversely side) retdslia h rn fteplt.I h nyex- only the In palate. the of neobalaenid, front tant the maxil- at parasagittally the the sulci of with aligns oriented surface groove the the of axis across The lary. groove open this laterally of extend from edge sulci back curved Short, the plate. to infraorbital posteriorly the open sulci. is that well-formed groove max- illary longitudinal spaced a lack lies foramina widely these that to medial of Slightly foramina consists circular pattern single, balaenid The sulci. ayvsuaiainptenicue ueos( numerous includes pattern vascularization lary nzpid ihardmnaymxlaydentition maxillary rudimentary a with ziphiids In nte“rhect”outgroup, “archaeocete” the In adequately and preserved well always not Although Mesoplodon aee marginata Caperea p.,armatavoa roeis groove alveolar remnant a spp.), Zygorhiza h otro maxil- posterior the , amctssheperdi Tasmacetus n nall in and , > VOL. 5per 25 57 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 h 3tx,alfu xn mlfid n C prod- PCR and amplified, length. exons of expected 12 four of In were all species. ucts taxa, mysticete 13 13 from the exons SCPP four of e SFS o 106 a h exception. the Cen- was Z13086) Science no. Fisheries [SWFCS] Northeast ter whale; right Atlantic oaiawt soitdsulci. associated with foramina ofr ocae aa.A in As canal. this over concealed roofed a of is form individuals to length some in exposed and greater variable The is a groove maxilla. for the extending along groove dental distance open an with but hr r oidvda aea oaiaadn associ- no and In foramina sulci. lateral ated individual Importantly, no maxilla. the are of there tip the to extends alve- sulcus and the Anteriorly, olar artery dentition. rudimentary maxil- alveolar the the the to nerve transmits within presumably canal that a lary with posteriorly continuous eoe mlfiainuigpies3 oteregion the yield to to failed the 3’ also from here primers analyzed deleted using been Amplification has genome. gene this because of possibly species, part this for amplify not e fcaatr Apni )rsle nsxmini- six in resulted index retention 2) steps; (11,998 (Appendix trees length mum characters steps of 11,967 of set 1989] length [Farris, were minimum index there with (retention unordered, trees characters optimal all With 82 Mysticeti 5). for to 3 hypothesis (Figs. phylogenetic well-resolved a .glacialis E. agn ftemxla In maxilla. lateral the and of medial margins the between posi- is midway sulcus roughly longitudinal tioned the cases, both In in servation). maxilla each of portion groove”) seter middle “dental the (the on present groove” is marked “strongly a and 04 aaie l,20,20;Nkioe l,2006). al., to et species sister Nikaido extant the 2006; as placed 2005, robustus al., Eschrichtius et Sasaki 2004; in maxilla each of half anterior the on occurs cus” sulci. long the with commonly of foramina, pala- portion tine of pairs medial symmetrical bilaterally the includes that on palate pattern vascular variable 2008 atmsiee eegnrlycnretwt recent with ( parsimo- congruent studies most generally molecular were all ex- mysticetes among of relationships tant that Examination showed unordered cladograms 3). the nious than (Fig. resolution more analysis slightly gave and and marginata perea novaeangliae Megaptera hls aande eescesv itrtx othe to taxa sister successive Eschrichtiidae were Balaenidae) whales, iiyo oeetnttx Fg ) u hnfsiswere fossils when but 3), (Fig. taxa extinct insta- some the of by bility obscured were lineages extant among ships rsneo CPDna ee nEetlu Mysticetes Edentulous in Genes Dental SCPP of Presence eatmtdt C mlf n eunesegments sequence and amplify PCR to attempted We asmn nlsso h uemti produced supermatrix the of analyses Parsimony mn ebr fPyeeia,a avoa sul- “alveolar an Physeteridae, of members Among Eubalaena hlgntcHptee MsieeSupermatrix) (Mysticete Hypotheses Phylogenetic Foe,16;Shle 97 e´reproa ob- Dem´er´e personal 1917; Schulte, 1869; (Flower, . Physeter, + + pgyrgtwae Neobalaenidae) whale, right (pygmy aanpeia ld Fg ) Relation- 4). (Fig. clade Balaenopteridae aan mysticetus Balaena rao ta. 04 yhle al., et Rychel 2004; al., et Arnason ´ ga hl,Ecrctia)was Eschrichtiidae) whale, (gray h odto ssmlrto similar is condition the rrul,Balaenopteridae). (rorquals, DEM Kogia, ER ´ uaan glacialis Eubalaena = TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E Kogia, ´ .9) reigasub- a ordering 0.491); ENAM h lelrslu is sulcus alveolar the rgtadbowhead and (right Balaenoptera hr r olateral no are there eunefrom sequence ENAM .glacialis E. ENAM = (North spp. Kogia Kogia 0.495) Phy- did Ca- or + , , Fg.3 4). 3, (Figs. ( tween + faleetlu ytcts(ld ;Bremer B; (clade monophyly mysticetes the edentulous on substantiated all homoplasy trees of no length showed minimum that monophyletic characters mor- a Six phological 3). Ozawa, 2007), (Fig. supported and weakly Steeman, was (Kimura “Cetotheriidae” 2007; others Bisconti, and studies 2002; these to al., con- Dem´er´etrast In 2006). et 2003; Fitzgerald, 2006; Muizon, Sanders, and Bouetel cladis- and 2005; recent (Geisler several analyses in as tic Mysticeti group crown from Diorocetus Aglaocetus, Pelocetus, balaena, here sampled genera “cetothere” ( All Bremer 95%). to A; grouped 87% descendants) strap (clade its of “cetotheres” all with and ex- of edentulous whales changes ancestor baleen Among common tant were last characters. (the tree mysticetes dental crown supermatrix taxa, and the skeletal of in nodes molecu- synapomorphies 3). for basal optimized Fig. unequivocally coded at in all not shown data, were scores lar support mysticetes E; stem ordered to or Because A unordered clades were 4; characters (Fig. regard- the whether alone of of data analyses less morphological the by and supported supermatrix consistently was ticetes clades extant 4). (Fig. for revealed support was solid analysis, from excluded ote ytcts( mysticetes toothed uosmsiee cae oE.Tetohesforms toothless The ( E). Aetiocetidae to with C grouped (clades mysticetes Jan- eden- tulous to groups and sister successive as Mammalodontidae, placed were jucetidae Aetiocetidae, 4); 3, (Figs. colliveri .polydentatus A. a 20)btcnitdwt eethptee that 2006). hypotheses Fitzgerald, Stee- 2006; recent Muizon, and and (Bouetel with paraphyly aetiocetid (2007), conflicted favored but Bisconti (2007) (2002), (2003), man Ozawa Sanders and and Geisler of Kimura analyses the with agreed between usatae oohl fMsiei(ld ;Bremer E; (clade + Mysticeti of this monophyly and substantiated synapomorphies C, morphological Three unreversed clade 3). and (Fig. to unique supported weakly group was sister D, clade the grouping, as clustered dae) ictde(Bremer tiocetidae iee a eand(ld ) u Ctteide was “Cetotheriidae” but A), (clade retained was mys- ticetes crown and “cetotheres” of grouping A chrichtiidae. h xlso fohrtx nteaayi caeC Bre- C; (clade analysis the in mer taxa other of exclusion the ldsAt Fg )a ela dnoei Aetiocetidae, Odontoceti, su- Balaenopteridae as and well the Balaenopteridae, as supported Balaenidae, 4) of data (Fig. E phenotypic base to A The the clades 3). at (Fig. tree sequence permatrix branching the orated mysticetes. ∼ eohru,Mxcts ohcts sncts Parieto- Isanacetus, Cophocetus, Mixocetus, Cetotherium, 1 otta 9) n itrgoprltosi be- relationship group sister a and 99%), bootstrap 11; 2to l pia oooissgetta aeOligocene Late that suggest topologies optimal All h ai rnhn euneaogfsi tmmys- stem fossil among sequence branching basic The eaaeaayi ftemrhlgcldt corrob- data morphological the of analysis Separate 8M)adtermiigtohestx a resolved was taxa toothless remaining the and Ma) 28 + ;bootstrap 1; oytctswhitmorei Eomysticetus + , ;bosrp7%t 3) ihabslsplit basal a with 93%), to 73% bootstrap 3; ajctshunderi Janjucetus ajctshunderi Janjucetus , hnctsgoedertorum Chonecetus amldncolliveri Mammalodon < + eictsweltoni Aetiocetus 0 o5%.Mnpyyo Ae- of Monophyly 50%). to 50% 2to ersn nin lineages ancient represent ) + Jnueia)adalother all and (Janjucetidae) Aetiocetus ;bosrp7%t 83%) to 78% bootstrap 3; rmteLt Oligocene Late the from (Mammalodonti- + + eeexcluded were ) , 2to , .cotylalveus A. Chonecetus Mammalodon + ;boot- 5; + + 0to 10 )to Es- 23 , Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 ra otu caatrn.2 lowsueuvclyotmzdt h atcmo netro ytct,btteewr eea eesl to reversals several were there but relatively a Mysticeti, of of presence ancestor The right. common the last to the shown group. to is the changes optimized state in unequivocally character condition was inferred narrower of also a sequence 2) the no. left; (character the to rostrum shown broad are 3) (Fig. taxa outgroup five as such taxa, edentulous 24 sn aen a neirve fsul adbe,adble paau fetn dnuosmsiee( mysticete edentulous extant of apparatus baleen and mandibles, skull, of view Anterior (a) baleen. using o 1.Rltv ootrus h au ftemnil sltrlybwdin bowed (purple; 4), adults laterally no. in is teeth (blue; mineralized mandible maxillae and the of 1), Fig. of margins see ramus lateral 38; the no. thin (green; outgroups, 53), sulci to and no. foramina Relative character nutrient 61). (red; lateral 57), no. symphysis no. mandibular (yellow; mandibles unsutured of states: bowing character lateral five of distribution the cec uem oy)adatrltrlve fsuladmnilso osltohdmsiee( mysticete toothed fossil of mandibles and skull of view anterolateral and Tokyo) Museum, Science F IGURE .Ls fmnrlzdtehi ytct fe h vlto fltrlntin oaiaadohrfaue ikdt ukfilter-feeding bulk to linked features other and foramina nutrient lateral of evolution the after Mysticeti in teeth mineralized of Loss 5. .acutorostrata B. b asmn piiain fteefiecaatr napyoeei yohssfr3 ytctsand mysticetes 31 for hypothesis phylogenetic a on characters five these of optimizations Parsimony (b) . YTMTCBIOLOGY SYSTEMATIC .weltoni A. hsltrlcrauei ute cetae nsome in accentuated further is curvature lateral this ; eictsweltoni Aetiocetus aanpeaacutorostrata Balaenoptera CP120)showing 122900) UCMP ; National ; VOL. 57 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 h tblt fteoealresult. overall the of stability the demonstrating supermatrix, the from in- excluded were or cluded sequences satellite the whether topologies supported length were minimum same the Regardless, 1992). iei eae,Cetacea Cetacea, Mys- Odontoceti, Delphinida, ticeti, 2002). 1999, al., consis- et Cetartiodactyla (Gatesy were of analyses generally supermatrix recent with Mysticeti tent to retention outgroups among steps; Relationships 6a). (Fig. consensus (1967 majority-rule Bayesian topologies three index were length There results. congruent minimum gave genes dental h omnctca aelt eune( sequence satellite 4). cetacean (Fig. common supermatrix exant The the among by supported relationships species contradict mysticete strongly not did tree. mysticete the of base the state character at critical changes of interpretation the did influence but not results supermatrix our and mor- evidence phological the between 2006; incongruence strongest Muizon, the represents and Balaenoidea, clade, This Bouetel 2007). Steeman, 2006; Fitzgerald, 2005; 2005, Bisconti, al., Dem´er´e 2003; et Sanders, 2007; and (Geisler analyses been ical morpholog- has recent by that supported robustly result and uniformly a of Balaenidae, grouping ex- a with Among favored Neobalaenidae data 2007). morphological the Steeman, taxa, 2007; tant 2005, Ozawa, was Bisconti, and trees Kimura 2002; (see length Mysticeti minimum crown within some placed in and paraphyletic, 2008 eatoatl,adCetartiodactyla and Camelidae, Cetartiodactyla, Suina, Cetruminantia, Ruminantia, Pecora, Fg a.Smlreiec o epcaecne rper- or coalescence, deep for evidence Similar conspecifics 6a). from those (Fig. matched sequences new contamination, the PCR and to due not was result this that ensure oteecuinof exclusion the to showed robustly sequences grouped that satellite The results. partition supermatrix the molecular only ≥ the was 1992) ruigof grouping eotr acutorostrata aenoptera eeta noe nmln npriua,toadjacent in two particular, characters In gap enamelin. encodes that gene eea ldsspotdb h etlgn aaalso data Balaenidae, in- gene cluded these analyses; dental supermatrix the the by corroborated by were supported clades Mysticeti, Within several 6). (Fig. analyses all by supported were iul of for viduals trees length minimum set. the data of this one dental by previ- the and of matrix proposed analysis gene been Bayesian by never supported has was ously, which group, this 6a); physalus gliae etsrigo neta oyopimin polymorphism ancestral of sorting tent musculus B. 5 otta upr o ld htcnitdwith conflicted that clade a for support bootstrap 95% asmn n aeinaaye ftetreSCPP three the of analyses Bayesian and Parsimony nlsso niiulmlclrdt esgenerally sets data molecular individual of Analyses + hlgntcHptee Dna eeMatrix) Gene (Dental Hypotheses Phylogenetic = .physalus B. , .3) n n fteewsietclt the to identical was these of one and 0.738), aanpeaphysalus Balaenoptera B aee marginata Caperea . oee,teewseiec o inconsis- for evidence was there However, . borealis shihisrobustus Eschrichtius ENAM ENAM eatr novaeangliae Megaptera eatr novaeangliae Megaptera + + a mlfidfo diinlindi- additional from amplified was B and , .borealis B. . edeni DEM + upre nunconventional an supported aanpeabonaerensis Balaenoptera ipptmde Bovidae, Hippopotamidae, and ER / ´ with .brydei B. TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ , + shihisrobustus Eschrichtius aee marginata Caperea aanpeamusculus Balaenoptera B . + edeni and , ( Perissodactyla rao tal., et Arnason rao tal., et Arnason + ´ ´ / Balaenoptera .novaean- M. ENAM .brydei B. , the , (Fig. Bal- to + rnpsnisrin nMsiei(iad ta. 2006). al., et of (Nikaido analysis Mysticeti recent in a insertions in transposon reported was introgression, haps u osnl aepi nesi the in indels pair base single were codons to stop due premature outgroup the that to showed baleen sequences sequences of mysticete genes of enamel-specific Alignment prema- the whales. revealed in frames codons reading stop DNA ture three SCPP Mys- all of Translation in for 6). sequences hypotheses (Fig. phylogenetic outgroups and two ticeti onto genes tal and strategy filter-feeding cavity a Mysticeti. oral to in shift the initial of the volume designate may in expansion traits four an these suggest 5); (Fig. foramina the nutrient before of derived acquisition were im- characters four optimizations latter the Parsimony that 57). ply (no. bowing mandibles lateral the incipient and of 4), (no. maxillae of margins lateral 2), thin 53), (no. (no. rostrum symphysis mandibular broad unsutured relatively an a of by C) ancestor clade characterized 4, was common (Fig. mysticetes the toothless all nu- palate, and lateral Aetiocetidae the to on addition foramina In 5). trient (Fig. mys- condition transformation aetiocetid this intermediate and in mosaic, 61), the (no. documented teeth ticetes of loss 38) the no. (character preceded The foramina supermatrix. nutrient the lateral by of derivation supported evolution- trees the all unequivocally on and were mapped foramina adults nutrient lateral in of gain evolutionary teeth ary the mineralized 4), of 3, loss (Figs. analyses across consistent ee fvrosmsieeseis(i.6 n n non- one and the 6) in (Fig. substitution sense species mysticete various of genes n ulse aa h olwst icr common discern to was goal the data, published and trans- new of compiling by insertions characters; morphological markers, and posons, DNA nuclear 17 from data eempe otecmo netro l xatmys- extant 6). all of (Fig. of ancestor ticetes regions common the the to mapped For were miner- whales. the baleen of AMBN in loss dentition evolutionary alized to oc- subsequent indels frameshift curred these that parsimony implied 2 All basepairs). reconstructions and three of frameshifts multiples 8 in indels to 3 to 7 (minimally pre- codons in resulted stop mature that genes enamel-specific in frameshift mutations predominantly were indels tree). Mysticeti, each for Within indels 37 (minimally pairs multi- base were three of indels ples all Mysticeti, of Outside 0.895–0.930). hr a eyltl ools nteidlcharacter indel the in index (consistency homoplasy pattern. set little basic very same was the There showed topologies alternative two the onto characters indel of optimizations Parsimony bonaerensis eas apdmlclrcagsi he CPden- SCPP three in changes molecular mapped also We were tree mysticete the in relationships basal Because h uemti o ytct nldsm genomes, mt includes Mysticeti for supermatrix The and oso h etto n Inactivation and Dentition the of Loss acag rmTC[yoie oTA[stop]). TAA to [tyrosine] TAC from change (a ENAM fEae-pcfi Genes Enamel-Specific of hrce Mapping Character htw eune,n frameshifts no sequenced, we that D = ISCUSSION AMBN .7–.1;rtninindex retention 0.875–0.913; euneof sequence AMBN Balaenoptera and ENAM 25 = Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 ugop.Tetesadainet hwifre ne vns(red events indel inferred show alignments and trees The outgroups. 26 CPgns ao brvain ntesqec lgmnsaefis etro eu aefloe yfis he etr fseisname. species of letters three first three by the followed in name substitutions genus of of numbers letter the first to are proportional alignments are sequence lengths branch the Parsimony in space. abbreviations Taxon save genes. to omitted SCPP sequence of sections indicates “..” hw rmsitdlto foebs n eeino i ae ntesqec lgmn for alignment sequence the in bases six of deletion a and base one of deletion frameshift a shows o h etlgn arx ubr titroe hwprioybosrppretg tp n aeinpseirpoaiiy(bottom). probability posterior Bayesian and (top) cladograms percentage length minimum bootstrap the mammalian parsimony of one distant stem show to the more internodes identical on is at and dentition that tree adult Numbers Odontoceti consensus mineralized matrix. from Bayesian the “ (a) gene of absent 5b). loss dental Fig. but after see the Mysticeti occurred also for lines; and in purple genes (dashed present SCPP Mysticeti enamel-specific are of to lineage codons restricted were stop frameshifts premature All outgroups. cause that mutations Frameshift mn ytctsfloigtesprarxaayi Fg )adrltosisaogotrusbsdo aeinaayi ftetredental three ( the pig of analysis domestic Bayesian and on mysticetes based five outgroups among for relationships sequences and nucleotide 4) Aligned (Fig. analysis genes. supermatrix the following mysticetes among lgmn hr hr r pce-pcfi usiuin in substitutions species-specific are there where alignment < F 0 niae otta score bootstrap a indicates 50” IGURE .Lnt uain in mutations Length 6. < AMBN 0 n ak ldsta olpei h titcnesso he iiu eghtplge.Teinset The topologies. length minimum three of consensus strict the in collapse that clades marks and 50% , ENAM and , DMP1 YTMTCBIOLOGY SYSTEMATIC aee marginata Caperea apdot hlgntchptee o dnuosmsiee n toothed and mysticetes edentulous for hypotheses phylogenetic onto mapped = rmsitmtto;blue mutation; frameshift u scrofa Sus and shihisrobustus Eschrichtius lutaerpeettv nesi h CPdna genes. dental SCPP the in indels representative illustrate ) ENAM b opst oooywt relationships with topology Composite (b) . seik dniypstoso the of positions identify Asterisks . = ne nmlil ftrebs pairs). base three of multiple in indel VOL. ENAM 57 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 ie h hlgntcpsto fteacactoothless archaic the mysticete, of 5). position to 3 phylogenetic (Figs. the Mysticeti Given of base the consistent at a sequence with branching trees the supported of (Kluge, alone and data supermatrix phenotypic characters the of diverse analyses Parsimony 1989). from signals phylogenetic 2008 fti dnuosspecies, edentulous appearance this first of the to prior (pres- evolu- occurred teeth the of 61 loss adults), tionary in no. teeth character mineralized of of ence/absence optimization parsimony the n i o irp h edn rmso h den- the of Mysticeti, frames within reading contrast, By the genes. disrupt in- nucleotides tal not all three did of Mysticeti, Odonto- multiples and to were For outgroups events indel toothed 6). ferred other (Fig. and hypotheses ceti phylogenetic onto ee ihtels ffntoa et.Isrin and Insertions teeth. functional of in loss deletions the with genes enamel-specific on constraints selective from release a for and mysticetes 1c). (Fig. extant rudimen- condition present of its tary to relegated ancestors was dentition direct the op- when an the longer for no was the tion predation marks tooth-aided 5b) when (Fig. time transformation ancient This 2002a). eefudi w diinlatoei species, aetiocetid additional cotylalveus two ocetus in found were also Dem´er´e, features 2; Similar 1, 2005). (Figs. mysticete the in mutations frameshift multi-functional no were There ameloblasts. ENAM eswr rmsitmttosrsrce to restricted mutations frameshift were dels h aaeof of palate portion lateral the the on sulci associated and foramina ent the in whales. fossils” baleen modern “molecular of genomes represent enamel- 2, proteins encoded 1, previously specific that (Figs. genes heritage vestigial toothed 5); 6) and ancestral (Fig. genetic their and of 1c) evidence (Fig. developmental both mysticetes retain extant Thus, pseuodogenes. decaying are loci AMBN aaaitlslio h neirprino h palate the of portion by anterior shared the are parallel, on Nearly sulci whales. parasagittal nutri- baleen the modern in of to orientation foramina homologues ent as and coded position were aetiocetids, anatomical and, the mysticetes their al., edentulous on except et based cetaceans (Sawamura all ab- species in are sulci sent fourth and foramina such a knowledge, foramina our To in 2006). nutrient present that be suggests may abstract meeting cent a iegdi te xatmsieeclades. mysticete extant other in diverged has palate posterolateral the on foramina/sulci ar- of the rangement bal- that and the state primitive of the is approximation condition aenopterid an that implies 4), similarity Given 3, this b). (Figs. 1a, hypotheses (Fig. phylogenetic rorquals best-supported our extant in that of reminiscent u aaa aclrzto in vascularization palatal but uvyo CPgnsyeddcmeln evidence compelling yielded genes SCPP of survey A edsoee eiso ih elpeevdnutri- well-preserved eight of series a discovered We al vlto fNtin oaiaadBaleen and Foramina Nutrient of Evolution Early nmlgnsepesdpiaiyb secretory by primarily expressed genes enamel , and oytctswhitmorei Eomysticetus ENAM eictsweltoni Aetiocetus AMBN .weltoni A. DMP1 and , fble hlssgetta these that suggest whales baleen of ENAM hnctsgoedertorum Chonecetus ee rmtr tpcdn in codons stop Premature gene. n l xatmsieegenera, mysticete extant all and DEM ∼ and , 8M SnesadBarnes, and (Sanders Ma 28 ER ´ aeOioeetoothed Oligocene Late a , .weltoni A. TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ Lt lgcn) and Oligocene), (Late DMP1 soealmost overall is eemapped were ∼ AMBN 0 fin- of 70% n re- a and , Aeti- and bu hl)hsbe ecie stewrdslargest 2002); world’s Tershy, the and as (Croll event described biomechanical been has fish in whale) small feeding (blue and Lunge zooplankton 2000). of (Werth, aggregations on feed inte- to specializations an anatomical and utilize behavioral of balaenopterids suite grated extant example, hur- For macroevolutionary daunting dle. a with seem filter-feeding would to baleen predation tooth-aided from sition Fg 5a). dentition (Fig. lower when interdigitating the 2) with (Fig. occlusion dentition near upper in the of teeth spaced widely in in racks ocetus and baleen 1973), the (Williamson, of balaenopterids rear and modern front the Such at 7). occur (Fig. bundles tubules keratinous of bundles small as the haps complexity, in spectrum of baleen this Given 1965). tubules keratinous (Utrecht, single of keratin, composed of are layers hairs whereas cortical of outer smooth layer sand- between medulla and wiched together central 1973). cemented main are a that (Williamson, tubules include of keratinous “hairs” consist mysticetes and plates extant Individual plates, of minor racks plates, baleen confidence palate. with the The on sulci and determined foramina of arrangement be the early from cannot this of system morphology specific baleen the but baleen, of ence parsimonious less knowledge. be of Other state would prey. current evolutionary the and minute given function additional filter in require to changes was would baleen explanations early function this the that of and 7), available nutrient (Fig. lateral baleen the expressed with foramina of mysticetes toothed interpretation that analyses simplest is phylogenetic evidence the 1979). our 4), (Pivorunas, of 3, seawater context (Figs. groups the from strain in to items Therefore, is prey species small extant the of in primary nourish baleen of the of turn, that epithelia function In nerves 1938). (Walmsley, baleen-producing palate pas- and same the mysticete these vessels the innervate whales; blood serve baleen and extant to house all thought sages in are function sulci basic associated edentulous and and aetiocetids of evolved mysticetes, ancestor foramina common nutrient the lateral in that indicated states paau oki ocr n emttebl atr of capture bulk the filtering throat permit and baleen concert elastic in the work and highly apparatus externally, a pleated is kinesis, that rostral pouch and sys- cranial stay tem, frontomandibular ligamentous the a symphysis, dentaries, comparison articula- mandibular bowed jaw rostrum, in broad Modified a reorganized cetaceans. tions, odontocete radically extant been to has balaenopterid skull the volumes, huge To these 1979). process (Pivorunas, routinely episode feeding the one through in expelled filter then baleen and engulfed be may water of ae oeyo bevtoso xattx,tetran- the taxa, extant of observations on solely Based aea uretfrmn natoeisipytepres- the imply aetiocetids in foramina nutrient Lateral character ancestral of reconstructions Parsimony tpieTasto rmTeht aeni Mysticeti in Baleen to Teeth from Transition Stepwise ol aefre rmtv le ewe the between filter primitive a formed have could Aetiocetus > 8M Fg.4 ) h uretforamina nutrient The 5). 4, (Figs. Ma 28 a aebe ipyarne,per- arranged, simply been have may aanpeamusculus Balaenoptera > 0tons 70 Aeti- 27 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 28

FIGURE 7. Reconstruction of Aetiocetus weltoni, showing hypothesized simultaneous occurrence of teeth and baleen (painting by Carl Buell). Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 otnosysi ryfo h ae oun( column water and the from that prey whales skim Baleen continuously 2002). Tershy, 1995; and al., Croll et 2000; Werth, Lambertsen and 1983; Orton Lambertsen, 1979; 1987; 1977, Brodie, (Pivorunas, prey of schools entire 2008 vltoayslto otaesn hsgpi feeding in gap 5). stepwise this (Fig. anatomy a traversing reveals to mysticetes solution evolutionary aetiocetid toothed in see ina foram- nutrient but lateral of 2007; discovery The Steeman, 2006). 2006; Fitzgerald, Muizon, 2005, and Bisconti, Bouetel 2003; 2007; Sanders, and and Sanders Geisler suspended 2002; 2002a; Ozawa, are Barnes, and plates (Kimura baleen jaws palate the of the from where racks condition jaws and modern tooth-lined toothless the with are to form baleen primitive no and a recent evolution- from an jump Most imply ary Mysticeti mysticetes. of toothless analyses phylogenetic and toothed tween distant more and outgroups. odontocetes “archaeocete” to relative anatomies feed- derived ing highly have mysticetes extant All 2005). Boue- tel, 2004; 2000, Werth, 1979; (Pivorunas, modifications ( ihble Pvrns 97 odc,18;Lambert- 1982; vol- filter-feeding Fordyce, facilitate large 1977; and a (Pivorunas, mouth baleen the process with in to water mysticetes of specializa- ume extant anatomical allow Numerous tions sieve. relatively dental a escaped crude otherwise or- on have feeding would bulk that efficient ganisms more evolu- enabled the baleen that of possible seals tion is crabeater It extant 1990). in Cockroft, Barnes and as (Klages 2005), 1994; Ichishima, Barnes, 1995; and al., et Fordyce 1989; 1984, Mitchell, (Fordyce, mys- teeth 1989; their toothed with prey that small filtered ae- suggested ticetes in authors foramina nutrient several lateral tiocetids, of primi- discovery the the to mysticetes. toothed Prior in early of simply apparatus improvement filter-feeding may tive incremental or Mysticeti an in represent filter-feeding to transition al- these of all in teeth of topologies. ternative loss the before that evolved show aetio- baleen consistently in optimizations foramina parsimony nutrient lateral cetids, of but presence 2007), the Steeman, given Bouetel 2006; Fitzgerald, 2007; 2006; 2005, Muizon, 2002a; hypothesis Bisconti, and 2003; Barnes, systematic Sanders, and and overall Sanders Geisler 2002; our Ozawa, with and (Kimura detail in con- flict trees phylogenetic abandoned Published not 5b). (Fig. were prematurely structures be- feeding gradually ancestral evolve cause could charac- that filter-feeders traits derived of terize early complex that The prey of exploited. range mysticetes the broadened have may of baleen evolution feed- subsequent ancestral the retained, Because were structures 7). batch- ing (Fig. to items employed prey been smaller have filter could baleen state) incipient sug- derived and facets (the functional), were (wear have teeth prey the might that individual gest state) capture primitive to used (the been dentition full a and ically, Specif- ancestral expressed. are both morphologies which feeding in descendant taxa mosaic are aetiocetids Eschrichtius h oslrcr lososagpi ntm be- anatomy in gap a shows also record fossil The h eiaino aenmgtmr h initial the mark might baleen of derivation The Eubalaena oss oprbyeaoaeanatomical elaborate comparably possess ) rscinfe nbnhcinvertebrates benthic on suction-feed or ) eictsweltoni Aetiocetus DEM ER ´ TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ n te Oligocene other and Balaena eeaeasews atr feouini oecases. some in to evolution of expected pattern be stepwise a might generate and at 2003) divergence, occur (Zhang, duplication, may pseudogenization gene level; patterns molecular Analogous the 2003). species Queiroz, extant behav- related (de closely three in to All seen are state). repertoires state), ioral (derived (intermediate feeding feeding aquatic aquatic visual visual tac- and both to tile state), (primitive feeding aquatic change tactile included from behavior feeding in transition a snakes) ag n aooi ersnaino netdprey. ingested of Well- representation size mysticetes. taxonomic the toothed document and would of range contents ecology stomach feeding preserved the on Japan, America, North in Europe. and museums in represented examples undescribed are but additional and and 2003), Goodwin Barnes, 1989; Pilleri, and (Pilleri Pacific deposits the Neogene around several fossil from reported rare, structure been Although filter. the has baleen baleen reveal early might the of and extent baleen expres- and and joint teeth the of for sion evidence definitive provide aetiocetids from would baleen database. fossilized current level, basic the most of the At analysis extending by and These eries discov- paleontological toothless. future by are tested be that can inferences filter-feeders derived to captured forms toothed be ancestral from transition could the facilitated have aetiocetids that may of ex- prey anatomy by feeding of present composite that the range efficiently, were suggest size we baleen the Furthermore, and tending 7). teeth (Fig. adults both phe- in mosaic which a in had notype mysticetes aetiocetid that pothesize eQerz(03 ugse htin that suggested level, (2003) behavioral Queiroz the At de lungfishes). (e.g., in species found extant still is condition and intermediate mosaic gills The (derived state). to present lungs state), only to state), (primitive in- (intermediate lungs gills that from 1988) the (Liem, change is transformation cluded amniotes stepped a of of apparatus result the respiratory both the at example, For previously organization. of documented levels behavioral and been morphological has but rare 2005; Bouetel, in 1995; al., discussion 2006). et Fitzgerald, (see Barnes 2003b; functions 1982; Fordyce, alternative for were initially recruited filter-feeding for whales utilized baleen characters modern by that evo- alternatively, the or, before baleen occurred of lution have may transi- the filter-feeding the evo- to of that the suggests tion loss sequence before This subsequent 5). clade, and (Fig. dentition foramina mysticete nutrient the of in evolved lution mandibles nodes the basal of at bowing of lateral margins un- and lateral an maxillae, thin rostrum, symphysis, re- broadened mandibular a parsimony sutured that fossilize, Fitzgerald, imply that 2005; constructions Bouetel, characters 1995; Among al., 2006). et Barnes 1983; sen, eea ie feiec oetal fe insights offer potentially evidence of lines Several hy- we 5), to 3 (Figs. results phylogenetic our Given tpiepteno areouinaprnl is apparently macroevolution of pattern stepwise A uueTsso hlgntcPten n Evolutionary and Patterns Phylogenetic of Tests Future Scenarios Thamnophis (garter 29 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 rae rmwr o eosrcigteodrand events. order evolutionary the of reconstructing timing for and framework history broader phylogenetic a of hypotheses complete more provide will characters of combinations unique with taxa higher versus levels. lower trophic at fed that mysticetes help species stem discriminating in might by filter-feeding ratios to shift isotope the suggested calcium characterize recently of (2006) comparisons evidence al. that et independent Clementz provide paleo-diet. of tissues mineralized compositions of chemical the mys- and toothed generate 2006), of (Fitzgerald, could ticetes preferences also dietary wear the regarding dental clues other and of facets Examination shear lacking. are currently data Aetiocetidae but 2004), from Uhen, 1996; Barnes, and (Swift fish sumed htsm acaoee”( “archaeocetes” some that suggest whales Eocene from contents stomach Fossilized 30 96 odc,20a aauae l,20) nparticu- In 2006). Sanders, al., lar, and et Sawamura (Barnes 2003a; Fordyce, lineages 1996; mysticete an- represent toothed to however, thought cient 4); are 3, fossils (Figs. undescribed analysis several phylogenetic mys- our oldest in geologically ticete the was species, edentulous an a areouinr rniini Mysticeti. in fundamen- transition a macroevolutionary of tal record fossil multifaceted new a with provide combination evidence, in an- ancestors, from toothed heirlooms These cient birth. before resorbed are teeth that rudimentary and have pseudogenes that enamel whales degenerate baleen filter-feeding se- modern evolutionary is this quence of product only end with ex- The in mysticetes. state trajectory tant derived ontogenetic both the the mirrors to adults, with in 7), baleen state (Fig. intermediate baleen and an teeth archaic to an condition, from toothed The transformation phylogeny. evolutionary mysticete stepwise of yields reconstruction data coherent paleontological a and sequences, observa- DNA prey embryological of tions, underutilized that synthesis vast, broad evolution A of resources. mammalian exploitation in the shift permitted ecological major a lrf h rnhn atr ttebs fMysticeti this of in anatomy base feeding the group. of evolution further at sequential to the pattern and required branching be the will clarify fossils other discovered and this recently of study comparative For- and description 2003a). mal (Fordyce, boundary Oligocene/Eocene the LJla A,teNwYr olgclScey(rn,N) South Cen- NY), Mammal (Bronx, Marine Society the Australia), Zoological (Adelaide, York Museum tech- New Australian provided the Spaulding M. CA), Archive and Center–Genetics (LaJolla, Science Rychel, Fisheries A. Southwest assistance. Randall, H. nical anonymous Kalkat, K. K. an Lee, Gunther, Hayashi, and T. S. C. work. Summers, Lee, Gatesy, the A. improved S. Steppan, and S. Garb, discussed Queiroz, J. reviewer de Debry, A. R. Mead, N. Collin, Archibald, J. M. D. 122900. Buell, UCMP C. of skull Ayoub, the prepared Clark R. 122900. ntrso ytmtcaayi,icuino additional of inclusion analysis, systematic of terms In h rgno le-edn nMsieirepresents Mysticeti in filter-feeding of origin The .HlodadUM loe rprto n td fUCMP of study and preparation allowed UCMP and Holroyd P. lnctsdenticrenatus Llanocetus A CKNOWLEDGMENTS C ONCLUSION Basilosaurus Laoeia)dtst near to dates (Llanocetidae) oytctswhitmorei Eomysticetus and Dorudon YTMTCBIOLOGY SYSTEMATIC con- ) , h hlgntcaaye.Alatosdsusdterslsadwere paper. and the results writing the in discussed executed involved authors and All data analyses. molecular phylogenetic the compiled the MM and DNA new JG the data. generated sequence JG data. morphological mys- the compiled aetiocetid MM of and in anatomy palatal foramina the nutrient described and discovered the ticetes AB of and Contributions DEB-0212572 (AB). TD DEB-0212248 authors: (JG), fossil and DEB-0213171 to (TD), NSF access DEB-0212238 provided from (JG), Sawamura was H. Funding and Bohaska, specimens. D. Barnes, G. L. oee,V 05 hlgntcipiain fsulsrcueand structure skull of implications Phylogenetic 2005. V. Med- Zool. Bouetel, whales. ziphioid in teeth small of Rows 1951. H. Boschma, ans .G,adS ced 94 h oslrcr n hltcrela- phyletic and record fossil The 1984. McLeod. S. and G., L. Barnes, iikvth .Mrn .Rbrsn n .RsnamdntdDNA samples. donated Rosenbaum H. and Robertson, K. Morin, P. Milinkovitch, re cec etrSrnigNtok(od oe A,G Am- G. MA), U. Hole, (Woods ato, Network Center–Stranding Science Fish- Northeast eries AK), (Barrow, Borough Slope North CA), (Sausalito, ter ocm,H 98 ntetehadohrpriuaso h sperm the of particulars other and teeth the On 1938. H. Boschma, unusual an on hypothesis Functional 2000. Varola. A. and Pliocene M., Bisconti, the from whale balaenopterid basal new A 2007. M. Bisconti, relationships phylogenetic and morphology Skull 2005. M. Bisconti, prelimi- and analysis, character description, New 2000. M. Bisconti, ocm,H 90 ailr et nseiesof specimens in teeth Maxillary 1950. H. Boschma, ehre .C 91 auiyadsxa iopimi h skull, the in dimorphism sexual and Maturity 1971. C. J. Besharse, archaeo- from transition The 1996. Sanders. E. A. and G., L. Barnes, Clas- 1995. Sawamura. H. and Furusawa, H. Kimura, M. G., L. Barnes, Arnason, ans .G 90 h oslrcr n vltoayrltosisof relationships evolutionary and record fossil The 1990. G. L. Barnes, Dunstan. A. and Matthews, M. Sobtzick, S. Birtles, A. R. W., M. P. Arnold, and Lukoschek, V. Dunstan, A. Birtles, A. R. W., P. Arnold, Arnason, ´ ´ edn eairi aanpeis(eae,Msiei.J Mamm. J. Mysticeti). (Cetacea, 86:139–146. balaenopterids in behavior feeding 31:139–148. edelingen 53:3–14. C Ser. Wet. Akad. Ned. K. Proc. ¨uller)(M and inhp fga hls ae 3–32 Pages whales. gray of tionships York. New Academic, eds.). Reeves, R.R. and wood whale Palaeo. implications. behavioural and 87:19–35. systematic Miocene Ital. the its from and process Apulia coronoid of double with dentary mysticete 50:1103–1122. Palaeontology Italy. northern of Belgium. of Pliocene lower the from 48:793–816. balaenid Palaeontology diminutive new a of Italian the from skulls 87:37–66. Ital. Balaenidae Palaeo. two Pliocene. of assessment phyletic nary 52:297–315. Mamm. J. adbe n et ftebae whale beaked the of teeth and mandible, Spec. Soc. near Paleo. from Abstracts, 8:24. mysticetes NAPC Publ. toothed 6th Carolina. Oligocene South Late Charleston, mysticetes: to cetes Island Japan. and America (Mammalia; 3:392–431. North Arc Aetiocetidae western from Oligocene Mysticeti) of Cetacea; distribution and sification York. New demic, robustus h omnctca N aelt.Ml il vl 9:1018– Evol. Biol. Mol. of satellite. sequence the DNA upon cetacean 1028. based common relationships the whale) (baleen ticete h genus the 51:309– Mus. Queensland 332. Mem. observa- interpretation. Underwater functional whales: and rorqual tions in behaviour Gulping 2005b. 51:277– whale Mus. minke Queensland Mem. dwarf implications. 307. the taxonomic and of sis patterns acutorostrata Colour Balaenoptera 2005a. Matthews. Gene evolution. and origin cetacean into 333:27–34. insights new provide ses rao,S hvr,M rnn .Dzn .Dneln M. Donnellan, S. Dizon, A. Cronin, M. Chivers, S. Arnason, ´ Pyee macrocephalus (Physeter U. ´ . .Glbr,adA ak.20.Mtgnmcanaly- Mitogenomic 2004. Janke. A. and Gullberg, A. U., ´ M .Jns .L wrz n .Lahrod d..Aca- eds.). Leatherwood, S. and Swartz, L. S. Jones, L. (M. . .G´trdotr n .Wdge.19.Mys- 1992. Widegren. B. and Gr´etarsd´ottir, S. U., ´ Tursiops rao rvddcmo eaenstliesequences. satellite cetacean common provided Arnason ´ eoldngrayi Mesoplodon ae 3–26 Pages . R es ao ecito,caitcanaly- cladistic description, lato: sensu EFERENCES o as taddo h uc coast. Dutch the on stranded Haast von ..Tmici 3:151–278. Temminckia L.). in h oteoedlhn(.Leather- (S. dolphin bottlenose The in h rywhale gray The eictsweltoni Aetiocetus eoldndensirostris Mesoplodon yeodnrostratus Hyperoodon Eschrichtius VOL. D AB, TD, . 57 . Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 rl,D . n .R esy 02 itrfeig ae 428–432 Pages feeding. Filter Tershy. 2002. R. B. and A., D. Croll, evidence isotope Stable 2006. Edwards. R. and Fox, D. 10:295– T., M. Cladistics Clementz, stability. tree and support Branch 1994. K. Bremer, subfossilen und fossilen ¨uber die Untersuchungen 1873. F. J. Brandt, oee,V,adC uzn 06 h ntm n eainhp of relationships and anatomy The 2006. Muizon. C. and V., Bouetel, 2008 e´re .A 96 h oslwhale, fossil The 1986. A. Dem´er´e, T. lwr .H 89 nteotooyo h ahlto sperm-whale or cachalot the of osteology the On 1869. H. W. Flower, (Cetacea) mysticete toothed new bizarre A 2006. G. M. E. Fitzgerald, Kunieda, T. Tsutsui, W. T. Xie, Y. Ye, L. Lu, Y. Huang, H. approach Q., J. An Feng, phylogenies: on limits Confidence 1985. J. Felsenstein, index. consistency rescaled the and index retention The 1989. S. J. Farris, lwr .H 88 ute otiuint h nweg fthe of knowledge the to contribution further A 1878. H. W. Flower, islShrt .C . n evot .15.Dvlpeto the of Development 1954. W. Vervoort, and V., C. M. Dissel-Scherft, context- through hypothesis adaptive an Testing 2003. A. Queiroz, Pale- de 2006. Gatesy. J. and Berta, A. McGowen, R. M. A., Dem´er´e, T. and taxonomic The 2005. McGowen. R. M. and Berta, Dem´er´e, A. A., T. e´ re .A 05 aaevsuaiaini nOioeetohdmys- toothed Oligocene an in Dem´er´e, vascularization Palate 2005. A. T. odc,R .20a al rw-ru eae nteSuhr Ocean: Southern the in Cetacea crown-group mam- Early 2003a. marine E. R. Antarctic Fordyce, of evolution and Origins 1989. E. R. Fordyce, Aus- in cetaceans of zoogeography and Evolution Nat. 1984. Mem. E. Cetacea. R. Fordyce, fossil Australian of review A 1982. E. R. Fordyce, odc,R .18.Sseaiso h dnoeewhale odontocete the of Systematics 1981. E. R. Fordyce, odc,R .20b eaeneouinadEcn-lgcn oceans Eocene-Oligocene and evolution Cetacean 2003b. E. R. Fordyce, odc,R . n .G ans 94 h vltoayhsoyof history evolutionary The 1994. Barnes. G. L. and E., R. Fordyce, whales: baleen basal of diversity unexpected An 2006. E. R. Fordyce, o h vlto fdfeetfeigsrtge ihnteNoei J. 3):51A. Neoceti. to the 26(Suppl. within Paleo. strategies Vert. feeding different of evolution the for 304. [7] P´etersbourg St. Sci. Imp´eriale 20:1–372. Acad. M´em. Europa’s. cetaceen 28:319–395. Geodiversitas Peru. of Pliocene Early icbleanana Piscobalaena d..Aaei,London. Academic, eds.). ¨ursig, Thewissen, W J. B. and Perrin, (W. mammals marine of clopedia ( Soc. R. Proc. whales. 273:2955–2963. baleen B of evolution early the and Australia from 82:776– Res. Dent. The J. development. 2003. during mineral- 780. Mishina. tissues in Y. soft, expressed not specifically and but is Bonewald, ized, (dmp1) 1 B. protein L. matrix dentin Scott, G. Castranio, T. 39:783–791. Evolution bootstrap. the using 5:417–419. Cladistics 57:196–210. C Ser. Wet. Akad. Ned. K. xsigzpii hls genus whales. ziphioid existing et nfetal in teeth three 109:369–384. in Ethology behaviour snakes. foraging garter on of depth species water of Effects dependence: to 3):56A. teeth to from 26(Suppl. transition Paleo. Vert. the J. for baleen. evidence molecular and ontological 12:99–143. Evol. Mamm. J. mysticetes. balaenopteroid modern and fossil of history evolutionary Ohio. Akron, Conference, Tetrapods Aquatic of iee(eae:Msiei eictde:Ipiain o h evolu- 21 the Page baleen. for of of tion Implications Aetiocetidae): species Mysticeti: (Cetacea: Neogene ticete other 2:227–298. of Sci. Mamm. review Mar. Mysticeti). a (Cetacea: with 1872), h ote rhi mysticete archaic toothed The 47:269–281. Lond. Soc. Geol. Publ. Perth, Spec. Hesperion, mals. eds.). Clayton, G. and Archer Australia. (M. Australia in 929–948 Pages tralia. 43:43–58. Victoria Mus. 55:1028–1045. leo. pygmaeus 10:415–437. eiie.Pgs154–170 Pages revisited. 3):50A. hlsaddlhn.An.Rv at lnt c.22:419–455. Sci. Planet. Earth Rev. Annu. dolphins. and whales Paleo. Vert. J. Zealand. 3):62A. New to from 26(Suppl. Eomysticetidae Oligocene Late York. New Press, Nes- University L. Columbia and Ivany, eds.). C. bitt, L. Prothero, R. (D. transition Eocene-Oligocene hstrmacrocephalus Physeter n h aiyAoohia Mmai:Ctca.J Pa- J. Cetacea). (Mammalia: Agorophiidae family the and aanpeaphysalus Balaenoptera Ctca ytct) Cetotheriidae a Mysticeti), (Cetacea, in .Tas ol o.Ln.6:309–372. Lond. Soc. Zool. Trans. ). in btat o h orhTinulEvolution Triannual Fourth the for Abstracts in etbaezoegah n evolution and zoogeography Vertebrate rmgenos oieos:temarine the icehouse: to greenhouse From DEM Llanocetus Mesoplodon. ER ´ L)(eae,Msaoei.Proc. Mystacoceti). (Cetacea, (L.) TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ aanpeadavidsonii Balaenoptera .Vr.Plo 23(Suppl. Paleo. Vert. J. . rn.Zo.Sc Lond. Soc. Zool. Trans. s Balaenoptera . s Agorophius . rmthe from in (Cope Ency- elg,R 93 ecito ftosuldnsrcnl discovered recently squalodonts two of Description 1923. verte- R. and Kellogg, tissue Mineralized 2003. Weiss. M. K. and K., the Kawasaki, for basis Genetic 2004. Weiss. M. K. and Suzuki, T. K., Kawasaki, aey . n .Acadr 00 idnmrhlgclspotfor support morphological Hidden 2000. Arctander. P. and J., Gatesy, odc,R . n .Mio.20.Eouinr itr fcetaceans: of history Evolutionary 2001. Muizon. C. and E., R. Fordyce, akn .E 92 h clg fwae n dolphins and whales of ecology The 1982. E. D. Gaskin, Longenecker, G. Nakamura, T. Iehara, N. Hall, B. Kiba, T. S., Mus. Fukumoto, Br. Bull. cetaceans. in Hearing 1960. Purves. E. P. and C., F. Fraser, ese,J . n .Lo 96 h ersladinrerof ear inner and petrosal The 1996. Luo. Z. and H., J. Geisler, Stabil- 1999. Stanhope. M. and Waddell, V. Milinkovitch, of M. Resolution J., 2002. Gatesy, Hayashi. C. and DeSalle, R. Matthee, C. J., Gatesy, from Evidence 1996. Arctander. P. and Cronin, M. Hayashi, C. J., Gatesy, siaa . n .Aaai 95 eeomn n physiological and Development 1995. Amasaki. H. and H., Aetio- Ishikawa, the of relationships phyletic the on Notes 2005. H. Ichishima, of review A 2005. Reynolds. C. E. and Ung, autosomal- M. Cross, and J. K. Enamelin L., N. Huq, 2003. Yamakoshi. Y. and C.-C., J. whales Hu, beaked of anatomy facial Comparative 1989. E. Phylogenetic J. 2006. Harrison. Heyning, G. R. and Dopman, B. E. T., and L. analysis Hatch, isotope Carbon 2003. Barnes. G. L. and M., 2001. Malkani. Goodwin, M. and Khan, I. Zalmout, I. Haq, M. Indiana. D., Bloomington, P. 1.9a. Gingerich, version SeqApp 1992. the D. for Gilbert, evidence Morphological 2003. Sanders. E. A. and H., J. Geisler, ale,K 92 eeomn ftohgrsadajcn struc- adjacent and germs tooth of Development 1962. K. Karlsen, Suzuki. K. and Furuya, A. Dohguchi, H. Amasaki, H. H., Ishikawa, nteCletCif,Mrln;adntso h shark-toothed the on notes 62:1–69. and Mus. Nat. Maryland; U.S. Cliffs, Proc. cetaceans. Calvert the in 100:4060–4065. USA Sci. Acad. Natl. Proc. gene cluster. phosphoprotein calcium-binding secretory the evolution: brate USA Sci. 101:11356–11361. Acad. Natl. Proc. tissue. mineralized vertebrate of evolution 45:5–56. Skrifter erdto ftohbd n eeomn frdmn fbaleen of rudiment whale, of minke southern development in and plate buds tooth of degradation Ashoro Bull. mysticetes. 3:111–117. toothed Paleontol. of Mus. ecology feeding the and cetidae 50:599–609. Biol. Oral on Arch. encoded 4. stabilisation chromosome human phosphate calcium with and associated tissue proteins mineralised for organisation gene and structure protein 398. 14:387– Med. Biol. Oral Rev. Crit. imperfecta. amelogenesis dominant 405:1–64. Co. Angeles extant Los of Mus. families Hist. Nat. the Sci. among Contrib. revision Odontoceti. systematic a and (Ziphiidae) 41:12–27. Evol. Phylogenet. pa- Mol. and characters. maternally inherited on ternally based whales baleen the among relationships plates. 3):56A. baleen 23(Suppl. whale Paleo. mysticete Vert. modern J. and fossil in mineralization Eocene of feet and 239:2239–2242. Science hands Pakistan. artiodactyls: from early Protocetidae from whales of Origin 10:23–129. Evol. Mamm. J. Cetacea. of phylogeny 70:1045–1066. phylogeny Paleo. J. the mysticetes. for archaic implications of hearing their and and Cetacea) (Mammalia: sp. ue ntewaeoewae( whale whalebone the in tures 61:227–232. and whale, Sci. development Med. minke Vet. tooth J. of during fetuses laminin and in collagens, degeneration IV and III type I, tenascin, fibronectin, of distributions Immunohistological 1999. 57:665–670. Sci. h hlgntcpaeetof placement phylogenetic the Hampshire. New Portsmouth, eiw ae 169–233 Pages review. A h ifrnito tt faeolss .Cl il 167:973–983. 2004. Biol. Yamada. Cell maintaining Y. J. for ameloblasts. and required of molecule state Kulkarni, differentiation adhesion B. the cell A. a Nanci, is Ameloblastin A. Krebsbach, H. P. 7:1–140. (Zool.) Hist. Nat. Friedrich Dr. Verlag eds.). Buffrenil, Munchen. de V. Pfeil, and Mazin (J.-M. water in atltx.Ss.Bo.48:6–20. Biol. artio- Syst. higher-level taxa. and dactyl Cetacea between relationships cladistic of ity 51:652–664. Biol. Syst. paradox. supertree/supermatrix a 13:954–963. hippopotamid Evol. of Biol. relatives Mol. close are artiodactyls. cetaceans that genes casein milk 49:515–538. Biol. Syst. genes. DNA five and from evidence sequences anatomical gross of analysis combined A bovids: in eodr dpain fttaost life to tetrapods of adaptations Secondary aanpeaphysalus Balaenoptera aanpeaacutorostrata Balaenoptera suoy nghetinhensis Pseudoryx aanpeaacutorostrata Balaenoptera L).Hvalr˚adets(L.)). . Heinemann, ihbovine with .Vt Med. Vet. J. . Herpetocetus 31 . Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 lg,A 99 ocr o vdneadapyoeei hypothesis phylogenetic a and evidence for concern A 1989. captive A. a Kluge, of behaviour Feeding 1990. Cockroft. G. V. and T., Mysticeti) N. (Cetacea: Klages, cetothere new A 2002. Ozawa. T. and T., Kimura, from cetothere Miocene Early an of strategy Feeding 2002. T. Kimura, im .F 98 omadfnto flns h vlto fair slægtskabsforhold- of indbyrdes evolution Bardehvalernes The 2002. lungs: K. E. of B. function Lindow, and Form 1988. F. K. Liem, ancestral the for evidence Genetic 2003. Dizon. A. and Biol. H., D. origins. Levenson, snake marine and evidence Molecular 2005. Y. S. M. Lee, Frontomandibular 1995. Straley. J. J. and feeding. Ulrich, N. rorqual H., of R. mechanism Lambertsen, Internal 1983. H. R. Lambertsen, Sim- P. J. Gencay, K. Kiziltan, B. Lin, -J. P. B. Seymen, F. J.-W., Kim, elg,R 98.Splmn odsrpinof description to Supplement 1968c. R. Kellogg, Calvert. Miocene the from cetothere sharp-nosed A 1968b. R. Kellogg, U.S. Bull. cetothere. Calvert unrecognised Calvert hitherto A Miocene 1968a. the R. Kellogg, from whale whalebone new A Los 1965. at Formation R. Modelo Kellogg, the from cetothere new A 1934. R. Kellogg, 32 uzn .18.Teafiiisof affinities The 1987. C. Meseta Muizon, La Eocene Late the from cetacean new A 1989. Smithsonian D. skull. E. cetacean Mitchell, the of telescoping The 1923. S. G. Miller, and molecules, Morphology, 1998. McGuire. A. J. and L., S. Messenger, ced .A,F .Wimr,adL .Bre.19.Evolutionary 1993. Barnes. G. L. and Whitmore, C. F. A., Min- 2001. S. Davis. McLeod, K. S. and Taylor, F. J. Burzlaff, D. J. A., C. Matthee, A. Nagano, J. Sakuraba, Y. Sezutsu, H. Shimizu, K. H., Masuya, Arana-Chavez. E. V. and George, A. Ramachandran, A. F., L. Massa, M˚ aquatic to Mesonychia Terrestrial 1999. Gingerich. D. P. and Z., Luo, rh .K,B ¨cmn .Hlge,J .C u .P imr and Simmer, P. J. Hu, C.-C. J. Holmgren, B¨ackman, G. B. K., C. ardh, frltosisamong relationships of 10:403–404. Biol. Polar seal. crabeater 22:684–702. Paleo. Vert. J. Japan. of Miocene Early the from 6:179– Res. Paleo. Japan. 189. central formations, Akeyo and Toyama the 84:278–282. Res. Dent. J. imperfecta. amelogenesis nfrlbgaaye ae 12–19 Pages analyse. foreløbig en 28:739–759. Zool. Am. mechanisms. breathing 270:673–679. B Lond. and Soc. mysticete R. Proc. in cetaceans. pigments odontocete cone short-wavelength-sensitive of loss 1:227–230. Lett. 76:877–899. Mamm. J. feeding. dur- ing recapture momentum for mechanism A Balaenopteridae: of stay 64:76–88. Mamm. 25. 2005. Hu. -C C. J. and mer, 247:175–197. Mus. Natl. U.S. Bull. ul ..Nt.Ms 247:163–173. Mus. Natl. U.S. Bull. 247:133–161. Mus. Natl. 247:1–63. Mus. Natl. U.S. Bull. formation. 447:83–104. Wash. Inst. Carnegie Publ. California. Angeles, omto,SyorIln,AtrtcPnnua a.J ih Aquat. 46:2219–2235. Fish. Sci. J. Can. Peninsula. Antarctic Island, Seymour Formation, 76:1–71. Coll. Misc. 47:90–124. Biol. for Syst. cetaceans. Society of The phylogenetics eds). the Cowles, J. C. and Kansas. Montague, Lawrence, Mammalogy, J. Marine J. Burns, J. (J. eainhp n lsicto.Pgs45–70 Pages classification. and relationships Biol. Syst. systematics. artiodactyl for 50:367–390. genome mammalian the ing human 14:575–583. of Genet. subtypes Mol. Hum. clinical (AI). different imperfecta for amelogenesis models as mutants mouse Shiroishi. T. ( and Wakana, Enamelin S. Noda, 2005. Kobayashi, T. Gondo, K. Y. Kaneda, Maeda, T. H. Ishijima, Miura, J. I. high- Kawai, A. by Fujimoto, N. identified Shimizu, as molars dur- rat 124:197–205. 1 in Biol. Cell protein Histochem. dentinogenesis immunocytochemistry. resolution matrix early dentin the of ing appearance Developmental 2005. 11:1069–1074. Genet. Mol. imper- Hum. amelogenesis (AIH2). dominant fecta gene autosomal enamelin the hypoplastic in local mutation causes nonsense A 2002. Forsman-Semb. K. nwae.Ui.Mc.Pp ae.31:1–98. Paleo. Pap. Mich. Univ. whales. hearing in of evolution and basicranium the of Transformation Gram, Cetacea: Museum, Midtsønderjyllands ed.). Lindow, Denmark. (B.E.K. 2002 r retn.A.Ms o.2904:1–27. Nov. south- Mus. Am. Patagonia, Argentina. from ern Mammalia) (Cetacea, platanistoid Miocene Enam sesnilfraeoeei:ENU-induced amelogenesis: for essential is ) Epicrates ENAM Bia,Srets.Ss.Zo.38:7– Zool. Syst. Serpentes). (Boidae, uain nautosomal-dominant in mutations ooeu vanbenedeni Notocetus in eu´-æt.Hvaldag Resum´e-hæfte. in aitbleapalmeri Parietobalaena h oha whale bowhead The YTMTCBIOLOGY SYSTEMATIC nEarly an , . ihwk,M 92 eea ilg.Pgs3–204 gene Pages SRY biology. General 2003. 1972. Koike. M. Nishiwaki, H. and Goto, M. Pastene, A. L. S., Nishida, Goto, M. Takahashi, K. Sasaki, T. Makino, H. Hamilton, H. M., Nikaido, S. and Ryder, A. O. Zhang, P. Y. Johnson, E. W. Eizirik, E. J., W. Murphy, M¨ Proc. platanistoids? the to related squalodonts the Are 1994. C. Muizon, ilr,G,adO ilr.1989. Pilleri. O. and G., Pilleri, Miocene the from cetothere new A 1934. Kellogg. R. whales. and fin L., baleen of E. Packard, mechanics in Engulfing bones 1987. Brodie. hyoid F P. the and S., of L. Orton, study systematic A 1964. H. Omura, the of evolution and morphology Comparative 1986. the Oelschl¨ager, H. by distributed (Program v2. MrModelTest 2004. A. A. J. Nylander, ae,H .13.Ntso h aooyadotooyo w species two of osteology and taxonomy the on Notes 1937. H. C. G. H. Raven, and Retief, D. J. Winkfein, older J. R. the Oliva, in R. whale Adroer, fossil R. a R., of Queralt, discovery the On 1939. Am. B. whales. G. baleen Pritchard, of mechanisms feeding The 1979. A. Pivorunas, structures related and skeleton fibrocartilage The 1977. A. Pivorunas, ie .W 99 pr whale, Sperm 1989: W. D. Rice, oh .1978. phylo- F. Bayesian Roth, 3: MrBayes 2003. P. J. Huelsenbeck, and F., Ronquist, ieod .G 93 bevtoso h kl nfea pcmn of specimens foetal in skull the on Observations 1923. G. W. Ridewood, adro,S . n .Wsesg 93 ovretadalternative and Convergent 1993. Wassersug. R. and Late L., S. the Sanderson, of Paleontology 2002b. Barnes. G. L. and E., Late A. the Sanders, of Paleontology 2002a. Barnes. G. L. and E., A. Sanders, mysticete of Phylogeny 2004. Berta. A. and Reeder, W. T. L., A. Rychel, le,K 05 eSae rmrdsg n eunesaitc for statistics sequence and design primer SeqState: 2005. K. uller, of Mol. J. mammals. in genes P1 40:601–607. protamine Evol. of Evolution 1995. Dixon. 55:151–159. Nat. Vic. Victoria. Torquay, of Tertiaries 67:432–440. 151:299– Scient. Morph. J. whales. balaenopterid of pouch 314. ventral the of Ostermundi- Bern Switzerland. Universitat Bern, der gen, Institut Hirnanatomisches ed.). 905:1–30. eotrd(eae)asdrPsoFrainPrsI ae 63– Pages I. Perus Pisco-Formation der 106 aus (Cetacea) aenopterid tutr n hlgn ntectca pce.Mma Study Mammal species. cetacean the in 28:57–66. phylogeny and structure phy- whale inser- 23:866–873. Baleen SINE Evol. by Biol. 2006. revealed Mol. Okada. event analysis. radiation tion N. extensive past and a Pastene, and logeny A. L. Kanda, N. 409:614–618. placental Nature of origins mammals. the and phylogenetics Molecular 2001. O’Brien. J. 4:65–69. Bioinformatics Appl. datasets. DNA phylogenetic a ig u.Nt it 29:135–146. Hist. Nat. Mus. Diego San soi omto fNwot rgn angeIs.Washing. Inst. Carnegie Oregon. 447:1–62. Newport, Publ. of Formation Astoria 65:2898–2907. Zool. J. Can. 18:149–170. Inst. Res. Whales Rep. Sci. Anat. whales. J. Am. Mammalia). (Cetacea, whales toothed 177:353–368. in region otic Sweden.) Uppsala, Thomas, author, C. Charles ed.). Ridgway, (S. Illinois. medicine Springfield, and Biology sea: eei neec ne ie oes iifrais19:1572–1574. Bioinformatics models. mixed under inference genetic 211:209–272. B Lond. ae 177–233 Pages hlso h genera the of whales Press. Academic London, eds.). Harrison, J. R. and Ridgway ein o etbaesseso edn.Pgs37–112 Pages feeding. suspension vertebrate for designs 93:271–293. Paleobiol. Contrib. Car- Smithsonian South Cetacea). (Mammalia: of Formations Bridge 2: olina, Chandler and Ashley Oligocene 93:313–356. Paleobiol. Contrib. Car- (Mam- Smithsonian South mysticetes Cetacea). primitive malia: of of family Formations new a Eomysticetidae, Bridge 3: olina, Chandler and Ashley Oligocene Phylogenet. Mol. data. 32:892–901. nuclear Evol. and mitochondrial on the based and whales jaw lower 7:63–79. Scr. the Zool. phylogeny. on whale remarks in with system echolocation Denmark, of Miocene per oue3(.Hne n .K al d..Uiest fChicago, of University eds.). Hall, K. B. and Chicago. Hanken (J. 3 volume Mesoplodon in etaezrplenooi e eaenPrsI(.Pilleri, (G. I Perus cetaceen der palaeontologie zur Beitrage irmsieu rothauseni Micromysticetus eoeu argillarius Mesocetus ( .europaeus M. in adoko aiemmas oue4(.H. (S. 4 volume mammals, marine of Handbook Megaptera Gervais, hstrmacrocephalus Physeter and p .(eae,Msiei rmUp- from Mysticeti) (Cetacea, n. sp. aanpeasiberi Balaenoptera rmtv eohri mysticete cetotheriid primitive a , .mirus M. Balaenoptera re.A.Ms Novit. Mus. Am. True). hl rn.R Soc. R. Trans. Phil. . in i ee bal- neuer ein , aml fthe of Mammals ines1758. Linnaeus in VOL. h skull, The 57 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 et,A .20.Feigi aiemmas ae 487–526 Pages mammals. marine in Feeding fe- 2000. a J. of A. Werth, system vascular the on observations Some 1938. whale R. Walmsley, fin the of plate baleen the of growth the On 1965. V. ar- L. W. dorudontine Utrecht, of genus New 2001. Gingerich. D. P. and M., Uhen, e . .Msia .Ce,H un,S .Dla,M .Dla,P. Dallas, R. M. Dallas, L. S. Huang, H. Chen, D. Mishina, Y. L., Ye, Whales 1964. Borisov. I. V. and Bel’kovitch, M. V. V., A. Yablokov, Smith- Cetacea. the of interrelationships the ventral of review A and 1921. H. Winge, baleen measuring and Counting 1973. R. G. Williamson, whale bowhead the in flow hydrodynamic of Models baleen? 2004. J. in A. Werth, trapped prey remove mysticetes do How 2001. J. A. Werth, hn .20.Fr,fnto,adaaoyof anatomy and function, Form, 2004. M. Uhen, hn .19.Mdl oLt oeebslsuie n dorudon- and basilosaurines Eocene Late to Middle 1998. M. Uhen, adjacent and USSR the of Mammals 9 vol. Cetacea, 1967. G. A. Tomilin, W: CLUSTAL 1994. Gibson. J. T. and Higgins, G. D. radiations D., early J. The Thompson, 2002. Williams. M. E. and M., G. J. Thewissen, hn .19.Nwseiso rtctdacaoeewhale, archaeocete protocetid of species New 1999. M. Uhen, cut,H .11.Tesulof skull The 1917. W. H. Schulte, cut,H .11.Aaoyo eu of fetus a of Anatomy 1916. W. H. 2006. Schulte, Ishikawa. H. and Ito, H. Ichishima, H. Otani, S. H., Sawamura, wf,C . n .G ans 96 tmc otnsof contents Stomach 1996. Barnes. G. L. and C., C. Swift, aai . .Nkio .Wd,TK aaa .Co .Hasegawa, M. Cao, Y. Yamada, T.K. Wada, S. Nikaido, M. T., Sasaki, A. L. Kanda, N. Kato, H. Goto, M. Hamilton, H. Nikaido, M. T., Sasaki, 2008 wfod .L 02 PAUP 2002. L. D. Swofford, tuhr,J 89 nsm onsi h ntm fa of anatomy the in points some of On 1889. classification J. revised Struthers, a and analysis Cladistic 2007. E. M. Boston, University, Steeman, Boston 2c. version TreeRot, 1999. in D. M. characters Sorenson, Ithaca, as Press, University Cornell Gaps edition. 2nd 2000. Whales, 1962. J. Ochoterena. E. Slijper, H. and P., M. Simmons, aeftlfibc.Cnrb mro.27:109–178. Embryol. Contrib. finback. fetal male 35:3–38. Dierk. Bijdr. whale. blue the and Car- South 17:1–34. of Sci. Eocene Mamm. Mar. Middle-to-Late olina. the Late from to (Cetacea) chaeocete Middle 34:1–222. the Paleo. Pap. from Mich. Univ. Egypt. archaeocete of Eocene An Cetacea): (Mammalia, iaua,T uid,T .Tusi .Bse,L .Bnwl,and Bonewald, F. L. Boskey, of A. Tsutsui, W. T. Department Kunieda, T. Sivakumar, U.S. the for by English Service to Commerce.) Research (Translated Moscow. Publications Nauka, Joint Izd-vo Dolphins. and 72:1–97. Coll. Misc. sonian 25:279–292. Inst. Res. Whales Rep. Sci. whales. of grooves 207:3569–3580. Biol. Exp. J. apparatus. feeding filter 156:189–203. Zool. Comp. Mus. Bull Diego. San Academic, ed.). Schwenk, (K. ing ln.J ae.73:512–528. Paleo. J. olina. wardii ie.Pgs29–61 Pages tines. English). to Russian from Scientific for (translated Translation Program Israel Jerusalem: ed.) Heptner, (V.G. countries 22:4673–4680. Res. Acids penalties Nucleic choice. gap matrix align- position-specific weight sequence and weighting, multiple sequence progressive through of ment sensitivity the improving developmental 33:73–90. Syst. and Ecol. Rev. pattern Ann. Evolutionary correlations. (Mammalia): Cetacea of Massachusetts. Sunderland, Associates, Sinauer 4.0b. Version d) lnm e York. New Plenum, ed.). mana n .Oaa 2006. Okada. N. and Syst. whales. mysticete 54:77–90. of Biol. evolution and Mi- 2005. phylogenetics Okada. N. tochondrial and Hasegawa, M. Fordyce, E. R. Cao, Y. Pastene, ACAsrcs ae.Sc pc ul 8:380. Publ. Spec. 6th Soc. seas. Paleo. Eocene Abstracts, epicontinental NAPC of fauna vertebrate for evidence and cetoides m u.Nt it 1:389–502. Hist. Nat. Mus. Am. etrsipyn h einn fble rwhi aetiocetids. in growth 3):120A. baleen to 26(Suppl. of Paleo. Vert. beginning J. the implying Features Phylo- Mol. lineage. 41:40–52. evolutionary Evol. ancient genet. an represents that whale osladrcn ytcts ol .Ln.Sc od 150:875–894. Lond. Soc. Linn. J. Zool. mysticetes. recent and fossil Massachusetts. York. New 49:369–381. Biol. Syst. analyses. phylogenetic sequence-based 37:361–404. Hist. Nat. .Aa.Pyil 23:308–335. Physiol. Anat. J. . Mmai,Ctca,fo h ideEcn fNrhCar- North of Eocene Middle the from Cetacea), (Mammalia, mlctosfrteeouino eaenfeigbehavior, feeding cetacean of evolution the for Implications : in aanpeaomurai Balaenoptera h mrec fwae J .M Thewissen, M. G. (J. whales of emergence The ∗ hlgntcaayi sn parsimony. using analysis Phylogenetic : DEM oi breviceps Kogia ER ´ TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ sanwydsoee baleen discovered newly a is aanpeaborealis Balaenoptera liv ul m Mus. Am. Bull. Blainv. eatr longi- Megaptera ouo atrox Dorudon Basilosaurus in Eocetus Mem. . Feed- YS(e okZooia oit,NwYr,NwYr,USA), York, New York, New Society, USA), Zoological Alaska, York Barrow, Borough, (New Slope NYZS (North Sausalito, NSB Museum, Center, USA), Mammal Australian California, Marine (South (The SAM TMMC Australia), USA), Adelaide, California, Jolla, La sources: Center, DNA for Abbreviations Mysticeti ”Artiodactyla” Odontoceti cec etr tadn ewr;SFCZ38)ddntamplify not did Z13086) SWFSC for Network; Stranding Center, Science Perissodactyla matrix. gene dental the in OTUs 31 n ot aicpopulations. Pacific MorphoBank North and at four matrix artiodactyl, see acutorostrata seven (also of individuals taxa four perissodactyl, Two mysticete of [http://morphobank.geongrid.org]). one DNA segments 12 following from sequence and The and odontocete, exons amplify matrix. gene PCR gene to SCPP dental used the were in samples included and bank sapiens) Homo norvegicus, Rattus musculus, species mammalian six for sayfrtepoe eeomn ftehi aml (Kawasaki mammals in of teeth sequences Published of 2003). development Weiss, proper and the for essary dtri-he:RdPage Rod Editor-in-Chief: DeBry Ron Editor: Associate Evol. Ecol. Trends duplication. gene by Evolution 2003. J. Zhang, is umte 0Ags 06 eiw eund9Nvme 2006; November 9 returned reviews 2006; August 30 submitted First aan mysticetus Balaena australis Eubalaena japonica Eubalaena aee marginata Caperea robustus Eschrichtius physalus Balaenoptera musculus Balaenoptera aanpeaedeni Balaenoptera borealis Balaenoptera bonaerensis Balaenoptera acutorostrata Balaenoptera epiatrsleucas Delphinapterus aanpeaacutorostrata Balaenoptera novaeangliae Megaptera aaguanicoe Lama dromedarius Camelus tajacu Tayassu napu Tragulus americana Antilocapra dalli Ovis liberiensis Choeropsis ihia ( Ziphiidae macrocephalus Physeter epiia ( Delphinidae indicus Tapirus he ftegnsta esmldaeSP ee htaenec- are that genes SCPP are sampled we that genes the of Three nlacpac 3Spebr2007 September 13 acceptance final 18:292–298. 280:6197–6203. phenotype. Chem. chondrodysplasia-like Biol. a J. for responsible formation lage 2005. Feng. Q. J. ENAM Z5988) Z11995) TMMC) WS Z38069) SWFSC MIL) n a o nlddi u nlss nsm hr were there sum, In analyses. our in included not was and ao apigfrDna eeMatrix Gene Dental for Sampling Taxon (CRO) mnewae eesmldt ersn ot Atlantic North represent to sampled were whale) (minke eoldnbidens Mesoplodon isdlhsborealis Lissodelphis (NYZS) (NYZS) (NYZS) (NYZS) Dmp1 + SFCZ95fo NSB) from Z6985 (SWFSC SFCZ13190) (SWFSC SFCZ67 rmSMAT204 SWFSC ABTC27074; SAM from Z26572 (SWFSC SFCZ82 rmSMM16470) SAM from Z18928 (SWFSC brydei SFC340 WS 30493) SWFSC 30490; (SWFSC (NYZS) SFCZ39 rmTM;SFCZ5750) SWFSC TMMC; from Z13090 (SWFSC (NYZS) SFCZ57;NYZS) Z35275; (SWFSC SFCZ26295) (SWFSC (CRO) SFCZ4502) (SWFSC dfiin iedslysvr eet ncarti- in defects severe display mice -deficient (MIL) SFCZ12;MIL) Z11727; (SWFSC SFCZ30 rmSMM15375) SAM from Z23603 (SWFSC Bstuu,Sssrf,Cnsfmlai,Mus familiaris, Canis scrofa, Sus taurus, (Bos rmNrhAlni (ARN) Atlantic North from ( A rmNrhPcfi SFCZ39 from Z13091 (SWFSC Pacific North from aanpeaedeni Balaenoptera PPENDIX uaan glacialis Eubalaena WS SuhetFseisScience Fisheries (Southwest SWFSC WS Z3859; SWFSC WS Z176; SWFSC 1 eedwlae rmGen- from downloaded were DMP1 + brydei eoldnperuvianus Mesoplodon , NrhatFisheries (Northeast AMBN suoc crassidens Pseudorca ope SWFSC complex and , Balaenoptera ENAM 33 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 Mysticeti Odontoceti oia aafretn aawr opldfo rode l (2005a). al. et Arnold from compiled were that taxa Note morpho- extant Additional for 2]). ref- data see [Appendix logical 20 (also descriptions extant, characters character (11 morphological in 31 102 erences and for odontocete, taxa “archaeo- extinct) mysticete one two extinct) code extant, to (two used four were cete,” literature published and specimens USA). Connecticut, Haven, New University, Yale Cronin, (M. CRO I M iikvth aeUiest;cretyFe nvriyof University ( ARN Free Belgium), currently Brussels, University; Brussels, Yale Milinkovitch, (M. MIL 34 omamnpyei ru oteecuino te xatmysticetes. these extant of other taxonomy of the exclusion However, the to group species monophyletic these al. a that et genomes, form Sasaki mt of follows analyses This on based analyses. argued, phylogenetic who (2006), our in OTU single a as aiona S;MP,Msod elgaePlotlga Universita Paleontologia, e Geologia di Angeles, Museo Los MGPT, County, USA; Angeles California, Los of Museum Museum History MB, Natural LACM, Belgium; Brussels, Belgique, the de f¨ Insti- Sciences ChM, IRSNB, de USA; USA; Royal Carolina, tute California, South Francisco, Charleston, Museum, San Charleston Geology, of Sciences, of Department Academy California CASG, Japan; Hokkaido, Ashoro-cho, abbreviations: Institutional “Archaeoceti” searches. h eoa of removal the ow xctdpyoeei nlssbt ihadwithout and with both analyses + phylogenetic executed we so rNtrud,Hmod–nvria uBri,Bri,Germany; Berlin, Berlin, zu Humboldt–Universitat Naturkunde, ur .brydei B. † † † † † † † † † † † † † † † † † † † † ihia ( Ziphiidae macrocephalus Physeter Eubalaena marginata Caperea robustus Eschrichtius physalus Balaenoptera musculus Balaenoptera aan mysticetus Balaena aanpeaedeni Balaenoptera borealis Balaenoptera bonaerensis Balaenoptera acutorostrata Balaenoptera novaeangliae Megaptera † † † opooia data.— Morphological “ “ Mgpea hubachi “Megaptera” eoeu calvertensis Pelocetus aitbleapalmeri Parietobalaena ioeu elysius Mixocetus snctslaticephalus Isanacetus ohctsoregonensis Cophocetus gactspatulus Aglaocetus eohru rathkii Cetotherium irctshiatus Diorocetus oytctswhitmorei Eomysticetus hnctsgoedertorum Chonecetus eictspolydentatus Aetiocetus eictscotylalveus Aetiocetus eictsweltoni Aetiocetus amldncolliveri Mammalodon ajctshunderi Janjucetus qaoo calvertensis Squalodon Agorophius shihidenwgne p DN 90517 SDSNH sp. et gen new Eschrichtiidae yohz kochii Zygorhiza aaaanpeabaulinensis Parabalaenoptera eatr”miocaena Megaptera” aanpea gastaldii Balaenoptera” 18]and [1981] M-33622) aanpeaedeni Balaenoptera nldd rtclbslrltosiswr o etre by perturbed not were relationships basal Critical included. ( uaan glacialis Eubalaena amctsshepherdi Tasmacetus cmoiebsdon based (composite .edeni B. † ao apigfrSupermatrix for Sampling Taxon Agorophius SM11962 USNM + SM504,ISB1536 IRSNB 550146, USNM SM173 23494 16783, USNM AM882 LACM AM545 54479 54475, LACM CP122900 UCMP nFtgrl (2006) Fitzgerald in SM23690 USNM brydei nBad (1873) Brandt in SM504244 USNM AM890 86047 85980, LACM + ST21 AM86020 LACM 251, MSNT BM 28570 Ma MB SM11976 USNM o h uemti nlss h following the analysis, supermatrix the For AM752 ST250 MSNT 72562, LACM SM25210 USNM ato M 198 n nFtgrl (2006) Fitzgerald in and P199986 NMV of cast nFoe (1869) Flower in SM168 07,119 12697 16119, 10677, 10668, USNM nKlog(1923) Kellogg in nKmr n zw (2002) Ozawa and Kimura in SM10300 USNM ST23 SM369982 USNM 263, MSNT .brydei B. nPcadadKlog(1934) Kellogg and Packard in STM-19792 NSMT M 12 AMP h PV4253 ChM GT13802 MGPT AM131146 LACM M,Ahr uemo Paleontology, of Museum Ashoro AMP, AM558 SM513,MN 260 MSNT 571236, USNM 54598, LACM p h V26 5852) PV4256, ChM sp. ( and aanpeaedeni Balaenoptera AG66660 CASG AM573 ST303) MSNT 51763, LACM aanpeabrydei Balaenoptera Balaenoptera SM484878) USNM rmtesprarxi parsimony in supermatrix the from U. † ´ grpispygmaeus Agorophius rao,Uiest fLund), of University Arnason, ´ pce sntytsettled, yet not is species + brydei aebe merged been have ope NSMT complex YTMTCBIOLOGY SYSTEMATIC nFordyce in .edeni B. eeue oPRapiyadsqec emnso 1ncergenes nuclear 11 of segments sequence and ( amplify PCR to used were i uemo aenooy ekly aiona S;UN,US USNM, USA. USA; DC, Califor- California, Washington, Museum, Berkeley, of National Paleontology, University of UCMP, History Museum USA; Natural nia California, Diego Diego, San San SDSNH, National Museum, Japan; NSMT, Tokyo, Australia; Museum, Vic- Victoria, of Science Musuem Collections, National NMV, Paleontology Italy; Territo- Pisa, toria, del Pisa, e di Naturale Universita Storia de’ll di ria Museo MSNT, Italy; Torino, Torino, di h uemti nlss(hrcesta eeodrdi oeanaly- some in noted): ordered are were ses that (characters analysis supermatrix the ieaue nldn netoso rnpsn Nkioe l,20) mt 2006), ( al., et genomes gene (Nikaido transposons dental the of from the insertions compiled from including were literature, genes data SCPP molecular are Additional above). loci (see these matrix of three that note taxa; STAT5A RAG1, Odontoceti and 2003; 3 Fig. al., in [http://morphobank.geongrid.org]). shown (Morphobank et are supermatrix genes the (Nishida in these genes for sampled Y-linked Taxa 2006). three al., et of Hatch et segments (Rychel and sequences intron/exon 2004), autosomal al., 2003), Dizon, and enson eune ( sequences a oit,NwYr,NwYr,UA,AN( ARN USA), York, New York, of Zoologi- New York Society, University New cal Rosenbaum, Free (H. currently ROS Belgium), University; Brussels, USA), Yale Brussels, Alaska, Milinkovitch, Barrow, Borough, (M. Slope MIL Sausalito, (North Center, NSB Museum, Mammal USA), Australian Marine California, (South (the TMMC SAM Australia), USA), Adelaide, California, Jolla, La sources: Center, DNA for Abbreviations est,Ln,Sweden). Lund, versity, Mysticeti AMBN ihia ( Ziphiidae macrocephalus Physeter h olwn opooia hrceswr oe n tlzdin utilized and coded were characters morphological following The aan mysticetus Balaena aee marginata Caperea robustus Eschrichtius physalus Balaenoptera musculus Balaenoptera Eubalaena aanpeaedeni Balaenoptera borealis Balaenoptera bonaerensis Balaenoptera acutorostrata Balaenoptera novaeangliae Megaptera .Tases lp fmxlaa ipit(e´ree l,2005). (Dem´er´e al., midpoint et at maxilla of slope Transverse 3. .Rsrltases it tmdon eaiet condylobasal to relative midpoint at width transverse Rostral 2. .Ltrlmriso aile(oie rmBre,19;McLeod 1990; Barnes, from (modified maxillae of margins Lateral 4. .Rsrlcrauei aea set(ansadMLo,1984; McLeod, and (Barnes aspect lateral in curvature Rostral 1. oeua data.— Molecular WS 198fo A M16470) SAM from Z18928 SWFSC Z5988) 195 WS Z16039) SWFSC Z11995; MIL; 0 1) 3 31%); 0 1999). (Uhen, length dered). rhddroetal;3 dorsoventrally; arched 0 1998). McGuire, and Messenger 0 1993). al., et 3 = = = = = , ATP7A hc,1 Thick, etcl(90 Vertical tagt 1 Straight; eynro 51%;1 (5–12%); narrow Very lt(0 Flat ihu cavirostris Ziphius rao ta. 04 aaie l,20,20) aelt DNA satellite 2006), 2005, al., et Sasaki 2004; al., et Arnason ´ rao ta. 92,ncerpedgn eune (Lev- sequences pseudogene nuclear 1992), al., et Arnason ´ = ( eoldnbidens Mesoplodon uaan japonica Eubalaena eybod( broad Very rmtoetn dnoeead1 xatmysticete extant 11 and odontocete extant two from ) ◦ , BDNF o10 to = opooia hrce List Character Morphological + o h uemti,tefloigDAsamples DNA following the supermatrix, the For Thin. = ◦ SFCZ95fo NSB) from Z6985 (SWFSC SFCZ67 rmSMAT204 SWFSC ABTC27074; SAM from Z26572 (SWFSC (ordered). ) brydei SFC340 WS 30493) SWFSC 30490; (SWFSC ◦ lgtyace osvnrly 2 dorsoventrally; arched Slightly SFCZ39 rmTM;SFCZ5750) SWFSC TMMC; from Z13090 (SWFSC , SFCZ77 WS 225 ROS) Z26295; SWFSC Z4767; (SWFSC o20 to CSN2 SFCZ4502) (SWFSC (MIL) SFCZ12;MIL) Z11727; (SWFSC SFCZ30 rmSMM15375) SAM from Z23603 (SWFSC SFCZ39 rmTM;ARN) TMMC; from Z13091 (SWFSC ( A > MIL) aanpeaedeni Balaenoptera ◦ 1)(ordered). 31%) ,1 ), , PPENDIX DMP1 = WS SuhetFseisScience Fisheries (Southwest SWFSC WS Z3859; SWFSC WS Z13190; SWFSC = = togyace osvnrly(or- dorsoventrally arched Strongly lpd(20-35 Sloped arw(52%;2 (15–22%); Narrow , ENAM 2 , + PKDREJ U. brydei ´ eoldnperuvianus Mesoplodon ◦ rao,Ln Uni- Lund Arnason, ´ ,2 ), uaan australis Eubalaena ope SWFSC complex = , PRM1 = = te ( Steep Moderately ra (24– Broad VOL. , KITLG > 45 57 ◦ ), , Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 2008 0 aas hp fpseirmri Dme´ ta. 2005). (Dem´er´e al., margin et posterior of shape Nasals, 10. 1 rna,psobtlpoes(cede l,19;Ue,1998; Uhen, 1993; al., et (McLeod process postorbital Frontal, 21. 5 otroms deo sedn rcs fmxla(modified maxilla of process ascending of edge Posteriormost 15. 0 sedn rcs fmxlaadatro igo parietal of wing anterior and maxilla of process Ascending 20. 2 rna,sparia rcs,sz n hp Mle,1923). (Miller, shape and size process, supraorbital Frontal, 22. 9 arml(e´ree l,2005). (Dem´er´e al., Lacrimal et 19. 2 aas eaiepsto fpseiroteg mdfidfrom (modified edge posteriormost of position relative Nasals, 12. 3 rmxla otro rcs Mle,1923). (Miller, process posterior Premaxilla, 13. 4 otroms n facnigpoeso rmxla(modified premaxilla of process ascending of end Posteriormost 14. 7 ailr-rna uue(e´ree l,2005). (Dem´er´e al., suture et Maxillary-frontal 17. 8 sedn rcs fmxla(e´ree l,2005). (Dem´er´e al., maxilla et of process Ascending 18. 6 ecnigpoeso ail mdfidfo cede al., et McLeod from (modified maxilla of process Descending 16. 1 aas oslsrae(e´ree l,2005). (Dem´er´e al., surface et dorsal Nasals, 11. .Nsl,saeo neirmri Dme´ ta. 2005). (Dem´er´e al., margin et anterior of shape Nasals, 9. .Nsl,wdhrltv olnt Dme´ ta. 2005). (Dem´er´e al., length et to relative width Nasals, 8. .Peailr-ailr uue(ese n adr,2003). Sanders, and (Geisler suture Premaxillary-maxillary 5. .Nsl,lnt eaiet odlbsllnt Dme´ tal., (Dem´er´e et length condylobasal to relative length Nasals, 7. .Psto fnra os Dme´ ta. 2005). (Dem´er´e al., fossa et narial of Position 6. 0 3 0 directed). (anteriorly shaped 0 (ordered). otro oatria oc,2 notch, antorbital to posterior 0 0 2005). (ordered). nofotl Msae) 5 (M-shaped), frontals into 0 2002). Ozawa, and Kimura 0 0 2003). Sanders, and Geisler from (ordered). fossa 0 hpd,3 shaped), 0 shaped). nonsl figrsae) 2 (finger-shaped), nasals into 0 2005). (Dem´er´e al., et 0 process. zygomatic abutting nearly 0 frontal. of margin lateral to 3 0 2003). Sanders, and Geisler half. anterior fzgmtcpoes 4 process, zygomatic of fsparia rcs ffotl 2 frontal, of process supraorbital of otro eprlfsa(ordered). fossa temporal Posterior urobtlpoeso h rna,3 frontal, the of process supraorbital pda ra a,epsddral,2 dorsally, exposed bar, broad as oped 0 2003). Sanders, and Geisler from processes. ascending robust forming and frontals Contacting ia rcs ffotl 3 frontal, of process bital fsparia rcs ftefotl 3 frontal, the of process supraorbital of a,epsdltrly 3 laterally, exposed bar, odro urobtlpoeso h rna,2 frontal, the of process supraorbital of border 0 0 frontal. overrides e fsparia rcs,2 process, supraorbital of ner 0 1993). dered). 4 process, fsparia rcs raigapce,3 pocket, a creating process supraorbital of odro urobtlpoeso h rna,2 frontal, the of process supraorbital of border ======lne 1-5) 1 (15-25%), Slender neirt urobtlpoeso rna,1 frontal, of process supraorbital to Anterior ail bt rna,1 frontal, abuts Maxilla eaae 1 Separate, xrml ra ( broad Extremely ue oslyaogtemdie 1 midline, the along dorsally Fused xoe aeal,1 laterally, Exposed ogoelp 4 overlap, Long rsn,1 Present, rnasetn nonsl Wsae) 1 (W-shaped), nasals into extend Frontals neirt urobtlpoeso h rna,1 frontal, the of process supraorbital to Anterior neirt urobtlpoeso h rna,1 frontal, the of process supraorbital to Anterior eeoe sbutysae raglrwde 1 wedge, triangular bluntly-shaped as Developed ra natrpseirdmnin hr ntases di- transverse in short dimension, anteroposterior in Broad -o -hpd(otrol ietd,1 directed), (posteriorly V-shaped or U- ltee,1 Flattened, og(72%,1 (17-25%), Long ocnatwt h rnas 1 frontals, the with contact No elatro oatria oc,1 notch, antorbital to anterior Well elsprtdfo yoai rcs,1 process, zygomatic from Well-separated = = tagto erysrih agn 4 margin, straight nearly or Straight tlvlo otro eino eprlfsa(or- fossa temporal of region posterior of level At = = rsn sifaria lt,2 plate, infraorbital as Present = btigo eryautn,2 nearly-abutting, or Abutting aitlke nielnt,2 length, entire keel Sagittal = > = vryn (ordered). Overlying = = 1)(ordered). 71%) = = ra 2-5) 2 (26-45%), Broad DEM oeae(01%,2 (10-16%), Moderate = tlvlo otro eino temporal of region posterior of level At oee yfrontal. by Covered bet 4 Absent, = = tlvlo neirtpo zygomatic of tip anterior of level At = ail vrie neoeilcor- anteromedial overrides Maxilla aasetn nofotl Uo V- or (U frontals into extend Nasals = = ail vrie neirportion anterior overrides Maxilla ER ´ elpseirt nobtlnotch antorbital to posterior Well rnasetn nonsl (U- nasals into extend Frontals TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ = = otro odro supraor- of border Posterior = = ra ail,extending maxilla, Broad = otcigfotl,2 frontals, Contacting = = yoai rcs,4 process, Zygomatic = = tlvlo neirtip anterior of level At Unfused. eeoe snarrow as Developed = aallwt rjust or with Parallel eybod(46-70%), broad Very ail completely Maxilla ======otro border Posterior = tagt 2 Straight, otro afof half Posterior neirborder Anterior rnasextend Frontals Absent. = = hr overlap, Short aasextend Nasals hr (5-10%) Short aitlkeel Sagittal btigor Abutting = = = Anterior Anterior Devel- = V- = = 0 aaie,atro agn(e´ree l,2005). (Dem´er´e al., margin et anterior Palatines, 40. 9 aaie,pseiretnin(e´ree l,2005). (Dem´er´e al., extension et posterior Palatines, 39. 8 aea uretfrmn n uc nplt mdfidfrom (modified palate on sulci and foramina nutrient Lateral 38. 8 ciia hed hp fatro agn(e´ree al., et (Dem´er´e margin anterior of shape shield, Occipital 28. 3 aocptlpoes kl nvnrlapc mdfidfrom (modified aspect ventral in skull process, Paroccipital 43. 9 ciia hed aea agn Dme´ ta. 2005). (Dem´er´e al., margins et lateral shield, Occipital 29. 1 oe,pseirpsto Bre,19;MLo ta. 93 Mes- 1993; al., et McLeod 1990; (Barnes, position posterior Vomer, 41. 7 aae ailr idwo nrobtlpae(e´ree al., (Dem´er´e et plate infraorbital on window maxillary Palate, 37. 2 aiciia rss(oie rmLno,2002). Lindow, from (modified crests Basioccipital 42. 4 qaoa,pseirwdh(xciia it eaiet zygo- to relative width (exoccipital width posterior Squamosal, 34. 3 qaoa,geodfsaadzgmtcpoes(cede al., et (McLeod process zygomatic and fossa glenoid Squamosal, 33. 5 oae suooae osrcin(oie rmDem´er´e from (modified construction pseudo-ovale, Foramen 35. 7 pxo ciia hed(e´ree l,2005). (Dem´er´e al., shield et occipital of Apex 27. 1 qaoa os Dme´ ta. 2005). (Dem´er´e al., fossa et Squamosal 31. 0 qaoa,zgmtcpoess(e´ree l,2005). (Dem´er´e al., processes et zygomatic Squamosal, 30. 2 qaoa lf Dme´ ta. 2005). (Dem´er´e al., cleft et Squamosal 32. 1923). (Miller, slope process, supraorbital Frontal, 23. 6 aae hp mdfidfo cede l,19;Msegrand Messenger 1993; al., et McLeod from (modified shape Palate, 36. 4 ypncbla eilmri MLo ta. 1993). al., et (McLeod margin medial bulla, Tympanic 44. 5 aitl xoueo rna etx(odc,1984). (Fordyce, vertex cranial on exposure Parietal, 25. 6 aitlfotl neobtlrgo Dme´ ta. 2005). (Dem´er´e al., region et interorbital Parietal/frontal, 26. 4 rna,epsr ncailvre Lno,2002). (Lindow, vertex cranial on exposure Frontal, 24. trgis 2 pterygoids, 0 (ordered). fossa goid 0 0 2003). Sanders, and Geisler 0 2005). 0 2005). (ordered). orbit 0 2002). Ozawa, and Kimura 0 margins. straight with Broad 0 1998). McGuire, and senger eprlfsa 3 fossa, temporal eirhl ftmoa os,2 fossa, temporal of half terior norgtadlf ocv surfaces. concave left and right into 0 suture. basisphenoid-basioccipital covering and 0 2005). Dem´er´e al., width; et matic 0 1998). McGuire, and Messenger 1993; lshni,3 alisphenoid, 0 2005). al., et 0 region. interorbital 0 0 lnaetasesl,2 transversely, elongate 0 0 transversely. elongate 0 1998). McGuire, only. Frontal eso,1 mension, 0 odls 2 condyles, trally. 0 (ordered). 0 dered). 0 (ordered). vertex below deflected Abruptly ======qaoa ny 1 only, Squamosal bet 1 Absent, bet 1 Absent, bet 1 Absent, ln rUsae,1 U-shaped, or Blunt arwtasesl,1 transversely, Narrow 07% 1 50-70%, lvtd 1 Elevated, ag n eldvlpd 1 well-developed, and Large aallt aitlpae 1 plane, sagittal to Parallel ovx 1 Convex, one,1 Rounded, ogepsr,1 exposure, Long xeso otro otmoa os,1 fossa, temporal to posterior Extension xedt nenlnrs 1 nares, internal to Extend og 1 Long, ltwt omda el 1 keel, median no with Flat o xoe nbscaim 1 basicranium, on exposed Not tlvlo etx 1 vertex, of level At one/nae osvnrly 1 dorsoventrally, Rounded/inflated ohlre(parietal large Both otro oocptlcnye,1 condyles, occipital to Posterior > aitl 3 parietal, = = = oeaeybodatrpseiryadmoderately and anteroposteriorly broad Moderately = = = = = elatro oocptlcnye (ordered). condyles occipital to anterior Well = = hr,2 Short, ogoelpo trgisnal ecigptery- reaching nearly pterygoids of overlap Long = rsn,cnat trgi,2 pterygoid, contacts Present, = Present. Present. 08% 2 70-80%, tagt 2 Straight, rsn,cnat parietal. contacts Present, = Depressed. hrl raglr 2 triangular, Sharply xeso oobt 4 orbit, to Extension = = = ohrdcd 4 reduced, Both = = hr xoue 2 exposure, Short qaoa n trgi,2 pterygoid, and Squamosal = = eynro neootrol n very and anteroposteriorly narrow Very = aitlecue rmtevre (or- vertex the from excluded Parietal = = = W-shaped. rna) 1 frontal), rdal lpn rmvre,2 vertex, from sloping Gradually > Wide. ocv (ordered). Concave 0 (ordered). 80% = = = = = iegn rmsgta plane. sagittal from Divergent xedt lgtyoelpthe overlap slightly to Extend xeso oatro afof half anterior to Extension eue oabsent. to Reduced einke iiigpalate dividing keel Median = = = = xoe nbasicranium on Exposed = = Parietal = aitlecue from excluded Parietal lnl raglr 3 triangular, Bluntly aallwt occipital with Parallel = xeso neirto anterior Extension ltee dorsoven- Flattened eysotexposure short Very = = xeso opos- to Extension rsn,contacts Present, > = rna,2 frontal, Pterygoid 35 = = = Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 36 9 adbe adblrcnyeoinain(oie from (modified orientation condyle mandibular Mandible, 59. 8 adbe adblrfrmnsz mdfidfo ans 1990; Barnes, from (modified size foramen mandibular Mandible, 58. 0 adbe ooodpoes(oie rmBre n McLeod, and Barnes from (modified process coronoid Mandible, 60. 7 adbe uvtr frms ndra set(cede al., et (McLeod aspect dorsal in ramus, of curvature Mandible, 57. 2 et,htrdny(hsstudy). (this heterodonty Teeth, 62. 1 ieaie et naut GilradSnes 2003). Sanders, and (Geisler adults in teeth Mineralized 61. 3 adblrsmhss(izead 2006). (Fitzgerald, symphysis Mandibular 53. 4 ail,goer/ragmn fltrlntin oaiaand foramina nutrient lateral of geometry/arrangement Maxilla, 54. 6 adbe etoeilgov Bsot,2000). (Bisconti, groove ventromedial Mandible, 56. 5 adbe ek(oslapc;Dme´ ta. 2005). Dem´er´e al., aspect; et (dorsal neck Mandible, 55. 0 eitc urmaa ein(u n igrc,1999). Gingerich, and (Luo region suprameatal Periotic, 50. 9 eitc rmnoilgov nmda ieo ascochlearis pars of side medial on groove promontorial Periotic, 49. 5 ypncbla einfro GilradSnes 2003). Sanders, and (Geisler furrow median bulla, Tympanic 45. 3 etba,cria Dme´ ta. 2005). (Dem´er´e al., cervical Vertebrae, et 63. 7 eitc aea rjcino neirpoes(ese n Luo, and (Geisler process anterior of projection lateral Periotic, 47. 6 eitc rnvreeogto fpr ohers(ese n Luo, and (Geisler cochlearis pars of elongation transverse Periotic, 46. 8 eitc tahetfrtno ypn uce(ese n Luo, and (Geisler muscle tympani tensor for attachment Periotic, 48. 2 eitc norna pnn ffca ev aa Gilrand (Geisler canal nerve facial of opening endocranial Periotic, 52. 1 eitc eiypai oae mdfidfo ese n Luo, and Geisler from (modified foramen perilymphatic Periotic, 51. 0 2002). Ozawa, and Kimura 0 1993). al., et McLeod 0 1993). al., et McLeod 1984; terolaterally. = eiradps-aietehmdrtl eeoot 2 heterodont; moderately teeth post-canine and terior 0 1998). McGuire, and Messenger 1993; 0 0 o rs,4 crest, low n otcnn et ekyhtrdn,3 heterodont, weakly teeth post-canine and 0 oaiawt lnaesliprsgtal ragd 2 arranged, anterior parasagittally and sulci sulci elongate transverse with short foramina numerous with groove illary 0 study). (this sulci associated mysticetes). al ragd 1 arranged, parasagit- tally sulci elongate with foramina anterior and groove) illary eldvlpdsliadatro oaiawt lnaesulci elongate with 3 foramina arranged, parasagittally anterior and sulci well-developed without groove maxillary open from separate single, foramina rior 0 0 parasagittally maxillary sulci open elongate (no arranged. with foramina sulci anterior well-developed and without groove) rows) two in 0 0 2002). Ozawa, and (Kimura (promontorium) developed. poorly or 0 0 (ordered). tion 0 2003). Sanders, and Geisler 1996; 0 1996). furrow. posterior 0 2003). Sanders, and Geisler 1996; hypertrophied. and Present u,19;Kmr n zw,20;GilradSnes 2003). Sanders, and Geisler 2002; 0 Ozawa, and Kimura 1996; Luo, (ordered). tunda ue scmatui (ordered). unit compact as fused 0 2003). Sanders, and Geisler 1996; aiy 2 cavity, rmfnsr oud,2 rotunda, fenestra from ======eeoe scrni rs,3 crest, coronoid as Developed aeal ocv,1 concave, Laterally otro oaiawt uc ailyarne n pnmax- open (no arranged radially sulci with foramina Posterior bet 1 Absent, ag n ptlt,1 spatulate, and Large ietdpseiry 1 posteriorly, Directed ag,1 Large, rsn,1 Present, bet 1 Absent, tagtnc,1 neck, Straight bet 1 Absent, bet 1 Absent, ihatro sue 1 fissure, anterior With ra ocvt rfsa 1 fossa, or concavity Broad rsn selre os,1 fossa, enlarged as Present neiradps-aietehsrnl eeoot 1 heterodont; strongly teeth post-canine and Anterior uue,1 Sutured, bet 1 Absent, nue,1 Unfused, ofletwt eetartna 1 rotunda, fenestra with Confluent = ugn n rugose. and Bulging ======eeoe sruddpoeswt o crest. low with process rounded as Developed = = Small. = oc npseireg,2 edge, posterior on Notch Present. Present. Present. = Absent. = rsn n ml,2 small, and Present o uue lgmnosatcmn nextant in attachment (ligamentous sutured not otro oaiacicdn ihoe max- open with coincident foramina Posterior pt etba ue,2 fused, vertebrae 6 to Up = eee neck. Reflexed = tagt 2 Straight, = = = = = otro oaiamlil (roughly multiple foramina Posterior ieysprtdfo eetaro- fenestra from separated Widely igrlk n aeal eetd 2 deflected, laterally and Finger-like ietddral,2 dorsally, Directed vlsae,2 shaped, Oval = = = lto eryfltwtotcon- without flat nearly or Flat rsn sgov,2 groove, as Present eeoe ssalko and knob small as Developed = aeal ovx(ordered). convex Laterally = rsn n out 3 robust, and Present = = arwyseparated Narrowly = otnosantero- Continuous = = oootdenti- Homodont Circular. = l vertebrae 7 All ietdpos- Directed YTMTCBIOLOGY SYSTEMATIC = = Anterior = Absent = Poste- An- = 1 adbe oiino ooodpoes(icniadVarola, and (Bisconti process coronoid of position Mandible, 81. 0 trgi Fae n uvs 1960). Purves, and (Fraser Pterygoid 80. 9 rna,tmoa rs atcmn o eprlsmuscle) temporalis for (attachment crest temporal Frontal, 79. 8 ail,atria oc Frye 91 enn,1989). Heyning, 1981; (Fordyce, notch antorbital Maxilla, 78. 7 et,nme fuprmlr Ue n igrc,2001). Gingerich, and (Uhen molars upper of number Teeth, 77. 6 ogtdnlrde nrsrm(mr,1964). (Omura, rostrum on ridges Longitudinal 76. 2 aen hcns Wrh 2001). (Werth, thickness Baleen, 72. 1 aen(ese n adr,2003). Sanders, and (Geisler Baleen 71. 0 eta hotpuh(cut,1916). (Schulte, pouch throat Ventral 70. 5 oge(adro n asru,1993). Wassersug, and (Sanderson Tongue 75. 4 aen rne(et,20,2001). 2000, (Werth, fringe Baleen, 74. 3 aen eghadwdh(esne n cur,19;Werth, 1998; McGuire, and (Messenger width and length Baleen, 73. 6 ueu-aislnt ai mdfidfo iuaadOzawa, and Kimura from (modified ratio length Humerus-radius 66. 5 cpl,crci rcs Mle,12;Mio,1987). Muizon, 1923; (Miller, process coracoid Scapula, 65. 4 cpl,armo rcs mdfidfo uzn 1994). Muizon, from (modified process acromion Scapula, 64. 3 adbe hp fmniua odl Wne 1921). (Winge, condyle mandibular of shape Mandible, 83. 8 oslfi GilradSnes 2003). Sanders, and (Geisler fin Dorsal 68. 2 adbe otooodeeain(iua 2002). (Kimura, elevation postcoronoid Mandible, 82. 7 au,nme fdgt Bre n ced 94 Messenger 1984; McLeod, and (Barnes digits of number Manus, 67. 9 eta roe mdfidfo oii,1967). Tomilin, from (modified grooves Ventral 69. 5 adbe rprinlsz fmniua nl eaieto relative angle mandibular of size proportional Mandible, 85. 4 adbe retto fteage(icniadVrl,2000; Varola, and (Bisconti angle the of orientation Mandible, 84. 7 adbe eaiepsto fatro odro adblrfora- mandibular of border anterior of position relative Mandible, 87. 6 adbe ucnya urw(oh 1978). (Roth, furrow subcondylar Mandible, 86. 0 2000). process. eaieyfratro omniua condyle. mandibular to anterior far relatively ihrbs aua rcs,2 process, hamular robust with ffotl 1 frontal, of 0 frontal. of process 0 2003). Sanders, and (Geisler 0 0 (ordered). ridges longitudinal 0 0 n emnt ibd,3 midbody, terminate and 0 0 0 umbilicus. the to 0 0 wider. and 0 2001). 0 2002). opesd 1 compressed, 0 0 0 0 0 0 1998). McGuire, and radius. than adblrcnyei h osvnrlpae(oie from (modified 2002). 0 plane Kimura, 2000; dorsoventral Varola, and the Bisconti in condyle mandibular 0 2002). Kimura, n peia,2 spherical, and odpoes 2 process, noid 0 1978). Roth, 1889; (Struthers, men 0 (ordered). ie 2 size, 3 ======osntetn a nodra ufc fsparia process supraorbital of surface dorsal onto far extend not Does uclr 1 Muscular, neirt ooodpoes 1 process, coronoid to Anterior pn 1 Open, w,1 Two, hnadflxbe 1 flexible, and Thin bet 1 Absent, ie 1 Fine, bet 1 Absent, rsn,1 Present, ag,1 Large, rsn,1 Present, bet 1 Absent, iis 1 digits, 5 otrol,1 Posteriorly, bet 1 Absent, otro ocrni rcs (ordered). process coronoid to Posterior nl agrta odl,1 condyle, than larger Angle rnvreyepne n lgtyclnrcl 1 cylindrical, slightly and expanded Transversely oae eaieycoet adblrcnye 1 condyle, mandibular to close relatively Located ueu qa rlne hnrdu,1 radius, than longer or equal Humerus bet 1 Absent, aeneteeyln ( long extremely Baleen beto nitnt 1 indistinct, or Absent ml ihpol eeoe aua rcs,1 process, hamular developed poorly with Small = nl aftesz fcnye 3 condyle, of size the half Angle = = = = = he,2 Three, Coarse. = = = = osetn a nodra ufc fsupraorbital of surface dorsal onto far extend Does = = = = = lsd(-hpdinvagination). (V-shaped Closed eue rabsent. or Reduced = = = Present. Present. Present. Present. aensgicnl hre ( shorter significantly Baleen digits. 4 Absent. oslhms 2 humps, Dorsal -0 ofie otra ein 2 region, throat to confined 2-10, = nln ihpseireg fcrni process, coronoid of edge posterior with line In eue n rdmnnl oncietissue. connective predominantly and Reduced rnvreycmrse n ovoid. and compressed Transversely Posteroventrally. = = oeta he (ordered). three than More = hc n rigid. and Thick ueosadetn to posterior or at extend and Numerous > = 5 fbd egh n laterally and length) body of 15% ige einrde 2 ridge, median Single, = = = = nl n odl iia in similar condyle and Angle Absent. ag ihsalhamular small with Large nln ihmdl fcoro- of middle with line In = nl eeeyreduced severely Angle < = %o oylength) body of 6% ueu shorter Humerus = Numerous = = VOL. = = Bulbous Located Three Small 57 Downloaded By: [USYB - Systematic Biology] At: 19:00 15 February 2008 2008 4 yi,fsabtenatro rcse ti study). (this processes anterior between fossa Hyoid, 94. 3 yi,atro rcse Oua 1964). (Omura, processes anterior Hyoid, 93. 0 tru Yboo ta. 94 ihwk,1972). Nishiwaki, 1964; al., et (Yablokov Sternum 90. 9 adbe eiltrino h neirprin(Dem´er´e, portion 1986; anterior the of torsion medial Mandible, 89. 8 adbe eta ufc fmdl oto fmnil (Dem´er´e, mandible of portion middle of surface ventral Mandible, 88. 2 yi,aklsdbsha n hrhas(mr,1964). (Omura, thyrohyals and basihyal ankylosed Hyoid, 92. 1 yi,craueo ue aiyltyoyl(mr,1964). (Omura, basihyal-thyrohyal fused of curvature Hyoid, 91. 0 ihmr hnoerb 1 rib, one than more with 0 stages. 0 0 2002a). Barnes, and Sanders 0 2002). Ozawa, and Kimura 1986; 0 (ordered). length sihl uvd,2 curved), (slightly egh 1 length, 0 rib. one with articulating and bone, ======bet 1 Absent, bet 1 Absent, bet 1 Absent, one,1 Rounded, beto beti one niiul,1 individuals, younger in absent or Absent tru ag,cmoe fsvrlbnsadarticulating and bones several of composed large, Sternum togycre,srih eghls hn7%o curved of 75% than less length straight curved, Strongly = tagtlnt ewe 59%o uvdlength curved of 75–90% between length Straight = = = = Present. hr n out 2 robust, and Short Present. ld-iekeel. Blade-like = tagtlnt oeta 0 fcurved of 90% than more length Straight DEM = tru ml,cmoe fone of composed small, Sternum ER ´ TA.TASTO RMTEHT AENI MYSTICETI IN BALEEN TO TEETH FROM AL.—TRANSITION ET E ´ = ogadslender. and Long = rsn tall at Present 0.Eae npscnn et ihvria titos(hsstudy). (this striations vertical with teeth postcanine on Enamel 101. 0.Atro n otro etce npseiruprteh(this teeth upper posterior on denticles posterior and Anterior 102. 0.Poubn neirtehrltv opseirteh(hsstudy). (this teeth posterior to relative teeth anterior Procumbent 100. 5 aitlfotlstr,atro xeso ti study). (this extension anterior suture, Parietal-frontal 95. 9 otro et,ro odto ti study). (this condition root teeth, Posterior 99. 8 otro iu mdfidfo Oelschl¨ager, 1986). from (modified sinus Posterior 98. 7 aaienth(hsstudy). (this notch Palatine 97. 6 aaa idwepsn oe ti study). (this vomer exposing window Palatal 96. lmns 2 elements, 0 0 0 0 study). ufcs 2 surfaces, 0 0 0 lmns 3 elements, n ipe 2 simple, and 0 rooted. ======nlnulsraeol,1 only, surface lingual On orydvlpdo bet 1 absent, or developed Poorly bet 1 Absent, bet 1 Absent, bet 1 Absent, w otdwt ue ot,1 roots, fused with rooted Two rmr,lreadwl eeoe,1 developed, well and large more, or 5 oe 1 None, = = = orydvlpdo absent. or developed Poorly = = = = oaeadoelpigmda ota elements. rostral median overlapping and Lobate = raglradsprtdfo einrostral median from separated and Triangular etce bet(ordered). absent Denticles Present. Present. Present. oaeadsprtdfo einrostral median from separated and Lobate = eyhayo iga n labial and lingual on heavy Very = = Present. oberoe,2 rooted, Double = rfwr small fewer, or 3 = Single 37