Clemson University TigerPrints
All Theses Theses
8-2017 Processing and Cooking on Lentil Prebiotics to Reduce Obesity Niroshan Siva Clemson University, [email protected]
Follow this and additional works at: https://tigerprints.clemson.edu/all_theses
Recommended Citation Siva, Niroshan, "Processing and Cooking on Lentil Prebiotics to Reduce Obesity" (2017). All Theses. 2745. https://tigerprints.clemson.edu/all_theses/2745
This Thesis is brought to you for free and open access by the Theses at TigerPrints. It has been accepted for inclusion in All Theses by an authorized administrator of TigerPrints. For more information, please contact [email protected]. PROCESSING AND COOKING ON LENTIL PREBIOTICS TO REDUCE OBESITY
A Thesis Presented to the Graduate School of Clemson University
In Partial Fulfillment of the Requirements for the Degree Master of Science Plant and Environmental Sciences
by Niroshan Siva August 2017
Accepted by: Dr. Dil Thavarajah, Committee Chair Dr. Susan Duckett Dr. Elliot Jesch Dr. William Whiteside Dr. Pushparajah Thavarajah ABSTRACT
Lentil is a rich source of proteins, range of prebiotic carbohydrates
including sugar alcohols (SA), raffinose family oligosaccharides (RFO),
fructooligosaccharides (FOS), and resistant starch (RS), minerals, and vitamins.
Research indicated that foods rich in prebiotics reduce obesity via modulating gut
microbiota. The objectives of this thesis were 1) to determine the effects of lentil
processing (dehulling, splitting, and cooking) on SA, RFO, FOS, and RS in three
lentil market classes (red, green, and pardina), and 2) to determine the effects of
lentil diet on rat body weight, percent body fat, plasma triglycerides (TGs)
concentration, and change of fecal bacteria. Lentil dehulling and splitting
decreased SA, and increased RFO and FOS concentrations. Concentration of
SA, RFO, and FOS increased with cooling and reduced after reheating. RS
concentration increased with cooling and reheating. For the rat study, lentil diet
significantly reduced body weight, percent body fat, plasma TGs concentration
within 6 weeks compared to the control diets. Abundance of fecal Firmicutes was
relatively low, and abundance of Actinobacteria and Bacteriodetes were relatively
high in rats fed with lentil diet than the control diets. In conclusion, processing,
and cooking can change the levels of prebiotic carbohydrates however, regular
consumption of lentil may tend to reduce obesity risk factors. Further human
studies are warrant to determine the potential of lentil to reduce obesity risk.
Key words: lentil, prebiotics, processing, microbiota, obesity
ii
DEDICATION
This thesis is dedicated to
my family and friends for their early inspiration, coaching, and
enthusiasm.
None of this would have happened
without them
iii
ACKNOWLEDGMENTS
I have been plentifully blessed during my degree program and research.
Most of all, I thank my family and friends who have given me better life and shaped me into who I am. I offer my sincere thanks to my advisor, Dr. Dil
Thavarajah and members of the graduate committee, Drs. Susan Duckett, Elliot
Jesch, Pushparajah Thavarajah, and William Whiteside who gave me
tremendous support on this research. I would like to thank Dr. Vincent P.
Richards’ research team, Godley-Snell Research Center, and Vegetable/Pulse
Quality and Nutrition Laboratory research team at Clemson University. Also, I
would like to thank Dhanuska Wijesinghe, Suranga Basnagala, Indika Pathirana,
and Anuradhi Wickramasinghe for their support in this research and my life.
Finally I would like to thank College of Agriculture, Forestry, and Life Sciences
(CAFLS), Clemson University, the American Pulse Association, the USA Dry Pea
Lentil Council, Clemson University Research Grant Committee, and CAFLS new
faculty startup funds for providing funds for this project.
iv
TABLE OF CONTENTS
Page
TITLE PAGE ...... i
ABSTRACT ...... ii
DEDICATION ...... iii
ACKNOWLEDGMENTS ...... iv
LIST OF TABLES ...... viii
LIST OF FIGURES ...... x
1. INTRODUCTION ...... 1
1.1. References ...... 3
2. HYPOTHESES AND OBJECTIVES ...... 7 2.1. Study 1 ...... 7 2.1.1. Hypotheses ...... 7 2.1.2. Objective ...... 7 2.2. Study 2 ...... 8 2.2.1. Hypotheses ...... 8 2.2.2. Objective ...... 8
3. CHAPTER ONE: CAN LENTIL (Lens culinaris Medikus) REDUCE THE RISK OF OBESITY? ...... 9 3.1. Abstract...... 9 3.2. Introduction ...... 9 3.3. Obesity Prevalence ...... 11 3.4. Lentils ...... 15 3.5. Lentil Prebiotic Carbohydrates ...... 20 3.5.1. Lentil sugar alcohols ...... 23 3.5.2. Lentil raffinose family oligosaccharides ...... 24
v
Table of Contents (Continued)
Page
3.5.3. Lentil fructooligosaccharides ...... 27 3.5.4. Lentil resistant starch ...... 27 3.6. Prebiotic carbohydrate consumption ...... 28 3.7. Human gut microbiome ...... 29 3.8. Mechanisms of prebiotic effects on metabolism ...... 31 3.9. Closing thoughts ...... 35 3.10. References ...... 36
4. CHAPTER TWO: THE IMPACT OF PROCESSING AND COOKING ON PREBIOTIC CARBOHYDRATES IN LENTIL (Lens culinaris MEDIKUS) .... 52 4.1. Abstract...... 52 4.2. Introduction ...... 53 4.3. Materials and Methods ...... 55 4.3.1. Materials ...... 55 4.3.2. Lentil samples ...... 55 4.3.3. Cooking, cooling, and reheating procedure ...... 56 4.3.4. Determination of SA, RFO, and FOS concentrations ...... 57 4.3.5. Determination of RS concentration ...... 58 4.3.6. Statistical analysis ...... 59 4.4. Results ...... 59 4.4.1. SA ...... 59 4.4.2. RFO and FOS ...... 63 4.4.3. RS ...... 67 4.5. Discussion ...... 67 4.6. Conclusion ...... 71 4.7. References ...... 71
5. CHAPTER THREE: WILL LENTIL (Lens culinaris MEDIKUS) DIET REDUCE THE RISK OF OBESITY? A RAT STUDY ...... 77
vi
Table of Contents (Continued)
Page
5.1. Abstract...... 77 5.2. Introduction ...... 78 5.3. Materials and methods ...... 81 5.3.1. Diet formulation ...... 81 5.3.2. Animals and feed trial ...... 82 5.3.3. Feed intake and body weight measurements ...... 83 5.3.4. Fecal sample collection ...... 83 5.3.5. Blood collection ...... 83 5.3.6. Fat% and liver weight measurements ...... 83 5.3.7. Triglyceride (TG) measurements ...... 84 5.3.8. Fecal 16S rRNA gene analysis ...... 85 5.3.9. Liver tissue slicing, staining, and imaging ...... 86 5.3.10. Statistical analysis ...... 87 5.4. Results ...... 88 5.5. Discussion ...... 97 5.6. Conclusion ...... 104 5.7. References ...... 104
6. GENERAL DISCUSSION ...... 116 6.1. References ...... 120
7. CONCLUSION AND FUTURE DIRECTION ...... 123
APPENDICES ...... 124 A: Primer design ...... 125
vii
LIST OF TABLES
Table Page
3.1. Common lentil market classes and consuming countries (Government of
Saskatchewan, 2016; Saskatchewan Pulse Growers, 2000; Thavarajah,
Ruszkowski, & Vandenberg, 2008)...... 17
3.2. Nutritional composition of lentil (de Almeida Costa, da Silva Queiroz-Monici,
Pissini Machado Reis, & de Oliveira, 2006; Hefni, McEntyre, Lever, & Slow,
2015; Iqbal, Khalil, Ateeq, & Sayyar Khan, 2006; Johnson, Thavarajah,
Thavarajah, Payne, et al., 2015; Johnson, Thavarajah, Combs, & Thavarajah,
2013; Ray et al., 2014; Solanki, Kapoor, & Singh, 1999; Thavarajah, Ruszkowski,
& Vandenberg, 2008; Thavarajah et al., 2011)...... 19
3.3. Prebiotic carbohydrates in common staple foods (Academy of Nutrition and
Dietetics, 2012; Berardini, Knödler, Schieber, & Carle, 2005; Brown & Serro,
1953; Campbell et al., 1997; Cruz & Park, 1982; Fanaro et al., 2007; Figuerola,
Hurtado, Estévez, Chiffelle, & Asenjo, 2005; Hidaka, Eida, Takizawa, Tokunaga,
& Tashiro, 1986; Johnson, Thavarajah, Combs, & Thavarajah., 2013; Kuo,
VanMiddlesworth, & Wolf, 1988; Lo Bianco, Rieger, & Sung, 2000; Loo et al.,
1999; Rupérez & Toledano, 2003; Sajilata, Singhal, & Kulkarni, 2006; Slavin,
1987; Wang, 2009; Yang & Keding, 2009)...... 22
3.4. Lentil sugar alcohol types and concentrations (Johnson, Thavarajah,
Thavarajah, Fenlason, et al., 2015)...... 24
viii
List of Tables (Continued)
Page
3.5. Raffinose family and fructooligosaccharide concentrations of lentil grown in
different countries (Johnson, Thavarajah, Thavarajah, Fenlason, et al., 2015)
...... 25
4.1. Description of lentil market classes used in this experiment...... 56
4.2. Concentrations of SA, RFO/FOS, RS, and total prebiotic carbohydrates (mg)
in a 100 g serving of cooked lentil with percent recommended dietary
allowance...... 60
5.1. Composition of standard, corn (3.5% high amylose corn starch), and lentil
(71%) diets...... 82
ix
LIST OF FIGURES
Figure Page
3.1. Obesity prevalence in regional countries, 2014 (OECD, 2013; The World
Factbook, 2015) ...... 14
3.2. Concentration of raffinose family oligosaccharides (mg/100 g; dry weight
basis) in whole and dehulled lentil grown in the USA (Johnson, Thavarajah,
Thavarajah, Payne, et al., 2015)...... 26
4.1. Sorbitol concentrations of different lentil market class after cooking, cooling,
and reheating. Values are presented on wet weight basis (14 % moisture).
Values within each lentil market class followed by a different letter are
significantly different at P < 0.05 (n=108)...... 61
4.2. Sorbitol concentrations of different lentil market class after cooking, cooling,
and reheating. Values are presented on wet weight basis (14 % moisture).
Values within each lentil market class followed by a different letter are
significantly different at P < 0.05 (n=108)...... 62
4.3. Raffinose and stachyose concentrations of different lentil market classes
after cooking, cooling, and reheating. Values are presented on wet weight
basis (14% moisture). Values within each lentil market class followed by a
different letter are significantly different at P < 0.05 (n=108)...... 64
x List of Figures (Continued)
Page
4.4. Verbascose and kestose concentrations of different lentil market classes
after cooking, cooling, and reheating. Values are presented on wet weight
basis (14% moisture). Values within each lentil market class followed by a
different letter are significantly different at P < 0.05 (n=108)...... 65
4.5. Nystose concentrations of different lentil market classes after cooking,
cooling, and reheating. Values are presented on wet weight basis (14%
moisture). Values within each lentil market class followed by a different letter
are significantly different at P < 0.05 (n=108)...... 66
4.6. Resistant starch concentrations of different lentil market classes after
cooking, cooling, and reheating. Values are presented on wet weight basis
(14% moisture). Values within each lentil market class followed by a different
letter are significantly different at P < 0.05 (n=108)...... 70
5.1. Feed and energy intakes of rats fed with different diets. Means; vertical bars
represent standard deviations. Values within each week followed by the
same letter are not significantly different, P > 0.05...... 89
5.2. Growth of rats fed different diets. Means; vertical lines represent standard
deviations. Values within weeks (n=36) followed by the same letter are not
significantly different, P > 0.05...... 90
xi List of Figures (Continued)
Page
5.3. Body fat (%), liver weight (g), and plasma TGs (triglycerides; mg/dl) of rats
fed with different diets. Means; vertical bars represent standard deviations;
values within body fat, liver weight, and plasma TGs followed by the same
letter are not significantly different, P > 0.05...... 92
5.4. Most abundant bacterial phyla (percentage of total) in rat feces. Weekly
average samples (n=36). Abundance were calculated after eliminating
unassigned species...... 93
5.5. Dominant species in rat fecal samples at initial week (0 week) and 6th week.
Inner circle represents phyla (Actinobacteria, Proteobacteria, Bacteroidetes,
and Firmicutes). Outer circle represents dominant species of corresponding
phyla: (A) control diet group at 0 week, (B) control diet group after 6 weeks,
(C) corn starch diet group at 0 week, (D) corn starch diet group after 6
weeks, (E) lentil diet group at 0 week, and (F) lentil diet group after 6 weeks.
...... 96
5.6. Light microscopic images of proximal tissues of rat liver after 6 weeks of
feeding lentil (6A), corn (6B), and control (6C) diets. Scale bar for all images
equal to 100 µm...... 101
6.1. Mechanisms of prebiotic carbohydrates on host pathophysiology related to
obesity. Changes in the gut microbiome and SCFA in the gut change the
xii List of Figures (Continued) Page
expression of genes related to food intake, gut motility, and adipogenesis.
...... ……...... 119
xiii 1. INTRODUCTION
Obesity is a global health problem. According to the World Health organization, 13% of the world population are obese (WHO, 2016). Obesity is the fifth major risk factor causing death particularly in high income countries (WHO,
2015). For an example, 35% of American adults (one in three adults) are obese.
By 2030, more than 50% of the American population will be obese (Finkelstein et al., 2012; NCD Risk Factor Collaboration, 2016). Major reason for increasing obesity is the unhealthy food consumption (WHO, 2016). Consumption of high fat, high added sugar diets increase caloric intake which increase obesity
(Drewnowski & Popkin, 1997; Kearney, 2010). Therefore, consumption of traditional whole foods (vegetables, fruits, and legumes) are highly recommended to reduce obesity and related non communicable diseases (WHO,
2016).
Lentil (Lens culinaris Medikus) is an ancient food legume crop, originating from the Near East approximately 10,000 years ago (Cubero, Pérez de la Vega,
& Fratini, 2009; Ladizinsky, 1979). Lentil is a rich source of protein (20-30 g/100 g), carbohydrates (40-60 g/100 g), essential fats (<2 g/100 g), minerals (Iron,
Zink, Selenium), vitamins (folate), and dietary fiber (Thavarajah & Thavarajah,
2012). Furthermore, lentil is a good source of prebiotic carbohydrates (Johnson,
Thavarajah, Combs, & Thavarajah, 2013). Prebiotic carbohydrates are selectively fermented by beneficial gut microbiome that allow specific
1 biochemical changes in gastrointestinal environment to increase host well-being and health (Roberfroid, 2007).
The human gut microbiome possess two dominant bacterial groups:
Bacteriodetes and Firmicutes, representing more than 90% of the gut microbial population (Ley, Turnbaugh, Klein, & Gordon, 2006). Bacteriodetes to Firmicutes ratio changes as a result of host obesity status (Ley et al., 2005). Few studies
(Ley et al., 2005; Turnbaugh et al., 2006) observed decreased ratio of
Bacteriodetes to Firmicutes in obese rats and some others (Collado, Isolauri,
Laitinen, & Salminen, 2008; Schwiertz et al., 2010) provide evident to decreased
ratio. These conflicting results were observed due to the differences in animal
models, duration of study, and different DNA sequencing approaches.
Prebiotics rich diet increase beneficial gut bacteria (Everard et al., 2011).
Extend of beneficial effects of the prebiotics depends on the prebiotic
concentration in the diets (Scholz-Ahrens, Schaafsma, van den Heuvel, &
Schrezenmeir, 2001). Food processing and cooking operations change prebiotic
concentration in foods. For an example, lentil prebiotic carbohydrates (raffinose
family oligosaccharides, fructooligosaccharides, and resistant starch) changed
after dehulling, cooking, cooling, and reheating (Johnson et al., 2015). Therefore,
it is important to know the impact of processing (dehulling, splitting) and thermal
treatments on prebiotic carbohydrates to maintain optimum prebiotics
concentration in processed food to maintain a healthy gut.
2
Legumes rich in prebiotic carbohydrates increase gut health via increasing
good bacteria. Chick pea (Cicer arietinum L.), pea (Pisum sativum L.), common
bean (Phaseolus vulgaris L.), and lentil (Lens culinaris Medikus) diets increase
bifidobacteria, a beneficial bacterial group (Queiroz-Monici, Costa, da Silva, Reis,
& de Oliveira, 2005). However, few studies were focused on the gut microbial
changes and related obesity bio markers changes respect to legume
consumption. No efforts have been made to determine the potential of lentil as a
food legume to reduce obesity risk via modulating gut microbiome. Therefore, the
overall objective of this thesis to study prebiotic rich lentil as a possible whole
food source to reduce obesity risk.
1.1. References
Collado, M. C., Isolauri, E., Laitinen, K., & Salminen, S. (2008). Distinct
composition of gut microbiota during pregnancy in overweight and normal-
weight women. The American Journal of Clinical Nutrition, 88(4), 894–9.
Cubero, J. I., Pérez de la Vega, M., & Fratini, R. (2009). Origin, phylogeny,
domestication and spread. In The lentil: botany, production and uses (pp.
13–33). Wallingford: CABI.
Drewnowski, A., & Popkin, B. M. (1997). The nutrition transition: new trends in
the global diet. Nutrition Reviews, 55(2), 31–43.
Everard, A., Lazarevic, V., Derrien, M., Girard, M., Muccioli, G. G., Muccioli, G.
M., Neyrinck, A. M., Possemiers, S., Holle, A. V., François, P., de Vos, W.
M., Delzenne, N. M., Schrenzel, J., & Cani, P. D. (2011). Responses of
3
gut microbiota and glucose and lipid metabolism to prebiotics in genetic
obese and diet-induced leptin-resistant mice. Diabetes, 60(11), 2775–86.
Finkelstein, E. A., Khavjou, O. A., Thompson, H., Trogdon, J. G., Pan, L., Sherry,
B., & Dietz, W. (2012). Obesity and severe obesity forecasts through
2030. American Journal of Preventive Medicine, 42(6), 563–570.
Johnson, C. R., Thavarajah, D., Combs, G. F., & Thavarajah, P. (2013). Lentil
(Lens culinaris L.): A prebiotic-rich whole food legume. Food Research
International, 51(1), 107–113.
Johnson, C. R., Thavarajah, D., Thavarajah, P., Payne, S., Moore, J., & Ohm, J.-
B. (2015). Processing, cooking, and cooling affect prebiotic concentrations
in lentil (Lens culinaris Medikus). Journal of Food Composition and
Analysis, 38, 106–111.
Kearney, J. (2010). Food consumption trends and drivers. Philosophical
Transactions of the Royal Society of London. Series B, Biological
Sciences, 365(1554), 2793–807.
Ladizinsky, G. (1979). The origin of lentil and its wild genepool. Euphytica, 28(),
179–187.
Ley, R. E., Bäckhed, F., Turnbaugh, P., Lozupone, C. A., Knight, R. D., &
Gordon, J. I. (2005). Obesity alters gut microbial ecology. Proceedings of
the National Academy of Sciences of the United States of America,
102(31), 11070–5.
4
Ley, R. E., Turnbaugh, P. J., Klein, S., & Gordon, J. I. (2006). Microbial ecology:
Human gut microbes associated with obesity. Nature, 444(7122), 1022–
1023.
NCD Risk Factor Collaboration. (2016). Trends in adult body-mass index in 200
countries from 1975 to 2014: a pooled analysis of 1698 population-based
measurement studies with 19·2 million participants. The Lancet,
387(10026), 1377–1396.
Queiroz-Monici, K. da S., Costa, G. E. A., da Silva, N., Reis, S. M. P. M., & de
Oliveira, A. C. (2005). Bifidogenic effect of dietary fiber and resistant
starch from leguminous on the intestinal microbiota of rats. Nutrition,
21(5), 602–608.
Roberfroid, M. (2007). Prebiotics: the concept revisited. The Journal of Nutrition,
137(3 Suppl 2), 830S–7S.
Scholz-Ahrens, K. E., Schaafsma, G., van den Heuvel, E. G., & Schrezenmeir, J.
(2001). Effects of prebiotics on mineral metabolism. The American Journal
of Clinical Nutrition, 73(2 Suppl), 459S–464S.
Schwiertz, A., Taras, D., Schäfer, K., Beijer, S., Bos, N. A., Donus, C., & Hardt,
P. D. (2010). Microbiota and SCFA in Lean and Overweight Healthy
Subjects. Obesity, 18(1), 190–195.
Thavarajah, D., & Thavarajah, P. (2012). US Pulse Quality Survey. Northern
Pulse Growers Association, USA Dry Pea and Lentil Council, and NDSU
North Dakota Agricultural Experiment Station. North Dakota State University,
5
Fargo, ND.
Turnbaugh, P. J., Ley, R. E., Mahowald, M. A., Magrini, V., Mardis, E. R., &
Gordon, J. I. (2006). An obesity-associated gut microbiome with increased
capacity for energy harvest. Nature, 444(7122), 1027–131.
WHO. (2015). Global Health Risks, Health statistics and information systems.
Retrieved May 17, 2017, from
http://www.who.int/healthinfo/global_burden_disease/GlobalHealthRisks_r
eport_part2.pdf
WHO. (2016). Data repository Reports Country Overweight and obesity,
Global Health Observatory (GHO) data. Retrieved May 17, 2017, from
http://www.who.int/gho/ncd/risk_factors/overweight/en/
6
2. HYPOTHESES AND OBJECTIVES
2.1. Study 1
2.1.1. Hypotheses
H1: Prebiotic carbohydrates concentrations [raffinose family
oligosaccharides (raffinose, stachyose, and verbascose), fructooligosaccharides
(kestose andnestose), sugar alcohols (sorbitol and mannitol), and resistant
starch) of different lentil market classes is affected by dehulling, splitting,
cooking, cooling, and reheating.
H0: Prebiotic carbohydrates concentrations of different lentil market
classes is not affected by dehulling, splitting, cooking, cooling, and reheating.
2.1.2. Objective
Determine the prebiotic carbohydrates concentrations [raffinose family
oligosaccharides (raffinose, stachyose, and verbascose), fructooligosaccharides
(kestose andnestose), sugar alcohols (sorbitol and mannitol), and resistant
starch) in hree lentil market classes (red, green, and Pardina) subjected to three
processing methods (whole, dehulled, and split), cooking, cooling, and reheating.
7
2.2. Study 2
2.2.1. Hypotheses
H1: Lentil change rat’s feed and energy intake, body weight, percent body fat, liver weight, blood plasma triglycerides (TG’s), and fecal microbial composition.
H0: Lentil does not change rat’s feed and energy intake, body weight, percent body fat, liver weight, TG’s, and fecal microbial composition of rats.
2.2.2. Objective
Determine the impact of lentil diet on rat feed and energy intake, body weight, percent body fat, liver weight, and blood plasma triglycerides (TG’s), and the fecal microbiome.
8
3. CHAPTER ONE
CAN LENTIL (Lens culinaris Medikus) REDUCE THE RISK OF OBESITY?
3.1. Abstract
Lentil (Lens culinaris Medikus), a cool season food legume, provides significant amounts of essential nutrients for healthy living. Lentil is a rich dietary source of low digestible carbohydrates (also known as prebiotic carbohydrates) that stimulate growth and activity of hind gut bacteria. These beneficial bacteria produce short-chain fatty acids that provide an energy source for colonocytes, strengthen the gut mucosal barrier, and suppress colonization of pathogens leading to reduced obesity and related non-communicable diseases. As such, products enriched with prebiotic carbohydrates are becoming popular health- promoting foods in human diets. This paper reviews an overview of current obesity prevalence, lentil production, available data on lentil prebiotic carbohydrates, and the promise of lentil as a whole food solution to combat global obesity. In addition, the effect of prebiotic carbohydrates on the human microbiome is briefly discussed.
3.2. Introduction
Obesity is a global health concern. Millions of deaths occurs annually as a result of obesity-related non-communicable diseases. Today, more than 50% of the population in the developed world are obese or overweight; specifically, 13% of adults are obese and 39% are overweight but this varies regionally (Wang,
Beydoun, Liang, Caballero, & Kumanyika, 2008; WHO, 2016). For example, 35%
9 of American adults (one in three adults) are obese, which is significantly higher than corresponding rates for Europe (17%), Africa (10%), or South East Asia
(3%) (Abubakari et al., 2008; OECD, 2012; OECD, 2013; Ogden et al., 2014;
WHO, 2015). It has been projected that by 2030 more than 50% of the American population and 20% world population will be obese (Finkelstein et al., 2012;
NCD, 2016). Therefore, government and non-government organizations not only
in the USA but internationally have mandates to prevent the global epidemic of
overweight and obesity (“globesity”). Specifically, the World Health Organization
(WHO) recommends the following actions: (1) a minimum of 150 min of physical
activity per week for regular adults, (2) reduced intake of added sugars and fat,
and (3) increased consumption of legumes, vegetables, and fruits by at least 5-6
servings per day (WHO, 2016).
Legumes have been a central part of vegetarian diets since the Paleo era.
Lentil (Lens culinaris Medikus) is an ancient food legume crop, originating from
the Near East approximately 10,000 years ago (Cubero, Pérez de la Vega, &
Fratini, 2009; Ladizinsky, 1979). Lentil is a medium energy food that is
recognized for its high nutritional value (Johnson, Thavarajah, Combs, &
Thavarajah, 2013; Wang & Daun, 2006; Thavarajah et al., 2011). In particular,
lentil is an excellent source of protein (20-30 g/100 g), healthy fat (<2 g/100 g),
carbohydrates (40-60 g/100 g), dietary fiber, and a range of micronutrients
(Thavarajah & Thavarajah, 2012). A 50 g serving of lentil can provide 3.7-4.5 mg
of iron, 2.2-2.7 mg of zinc, 22-34 µg of selenium, 50-250 µg of beta-carotene,
10 and 216-290 µg of folates (Sen Gupta et al., 2013; Thavarajah et al., 2011;
Thavarajah, Thavarajah, Sarker, & Vandenberg, 2009). Unlike other grains, lentil
is very low in phytic acid (2.5-4.4 mg/g), which binds iron and zinc and thus
renders these nutrients poorly bioavailable (Thavarajah, Thavarajah, &
Vandenberg, 2009).
Recent studies indicate that lentil is also a rich source of prebiotic
carbohydrates (Johnson, Thavarajah, Combs, & Thavarajah, 2013). Prebiotic
carbohydrates are a selectively fermented ingredient that allow specific
biochemical changes in gastrointestinal microflora that benefit host well-being
and health (Roberfroid, 2007). The human gut microbiome feature two dominant beneficial bacterial groups: Bacteriodetes and Firmicutes (Ley, Turnbaugh, Klein,
& Gordon, 2006). Interestingly, Bacteriodetes to Firmicutes ratios increase and a
number of metabolic parameters improve in obese mice fed a prebiotic rich diet
(Everard et al., 2011). However, these results are still inconclusive and more
research is required to measure the true prebiotic effect on obesity and
overweight. The objective of this review paper is to provide an overview of
current lentil production, available data on lentil prebiotic carbohydrates, and the
promise of lentil as a whole food solution to combat global obesity. The effect of
prebiotic carbohydrates on the human microbiome is also briefly discussed.
3.3. Obesity Prevalence
Obesity is defined as an excess fat accumulation in the body, measured by body mass index (BMI), waist circumference, skinfold thickness, and
11 bioimpedance (Kopelman, 2000). BMI is the most widely used method, with
values between 25.0 and 29.9 kg/m2 considered overweight, 30.0 to 39.9 kg/m2
obese, and ≥40 kg/m2 morbidly obese (Kopelman, 2000). Obesity increases the
risk of non-communicable diseases, including cardiovascular diseases, type 2
diabetes, and cancers (Beaglehole et al., 2011). Global obesity has doubled
since 1980, and by 2014 more than 1.9 billion adults (>18 y) were overweight
and more than 600 million were obese (WHO, 2016). The prevalence of obesity
is high in developed regions compared to developing regions; for example,
obesity prevalence in Asian and African countries is much lower than in Middle
Eastern, European, or North American countries (Figure 3.1) (OECD, 2013; The
World Factbook, 2015). The prevalence of overweight, obesity, and extreme
obesity in the USA is 33, 36, and 6%, respectively (Ogden & Carroll, 2010); this
means that approximately two out of every three adults in the USA are
overweight or obese. Within the USA, the state of Arkansas has the highest
obesity prevalence (36%) and Colorado the least (21%) (The State of Obesity,
2015). This variation in American obesity prevalence is mainly influenced by
social, economic, and demographic factors as well as access to nutritious foods
(Caprio et al., 2008; Cummins & Macintyre, 2006; Larson, Story, & Nelson,
2009). For example, the prevalence of obesity among non-Hispanic blacks, non-
Hispanic whites, and Hispanics is 36, 24, and 29%, respectively (Ogden, Carroll,
Kit, & Flegal, 2013). Non-Hispanic black women have the highest obesity
prevalence (39%) compared to non-Hispanic black men (32%), Hispanic women
12
(29%), Hispanic men (28%), non-Hispanic white men (25%), and non-Hispanic white women (22%) (Ogden, Carroll, Kit, & Flegal, 2013).
However, obesity is preventable. Changes in diet and physical activity are often benefits of changing environmental and societal behaviors (European Food
Information Council, 2014). Supportive government policies in health, agriculture,
transport, urban planning, environment, food processing, distribution, marketing,
and education are also important for preventing obesity and overweight
(Robinson & Sirard, 2005; Sallis & Glanz, 2009). Sedentary lifestyles and high
intake of energy dense (high in fat and/or sugar) foods increase weight gain and
obesity (WHO, 2016).
13
35
30
25
20
15 Average
Obesity prevalence% Obesity 10
5
0
UK Italy USA UAE India Qutar Brazil Egypt China Japan Sudan Ghana Nigera France Turkey Mexico Canada Malasia Uganda Ethiopia Germany Sri LankaSri Colombia Switzerland Saudi Arabia
Figure 3.1. Obesity prevalence in regional countries, 2014 (OECD, 2013; The World Factbook, 2015)
14
3.4. Lentils
Lentil is a cool season food legume commercially cultivated around the world (Cokkizgin & Shtaya, 2013). Current annual lentil production is approximately 5 million tons with the greatest production attributed to Western
Canada (38%) followed by India (23%), Turkey (8%), Australia (7%), and the
USA (5%) (FAOSTAT, 2015). More than 90% of the lentil produced in Canada, the USA, and Australia is exported to South East Asia, the Middle East, and
Africa (FAOSTAT, 2015). Lentil was first introduced to North America in the early
1980s and it has since become a major pulse crop in the Pacific Northwest and
Midwestern regions of the USA, including North Dakota, South Dakota, and
Montana. Lentils belong to the genus Lens and the tribe Fabeae of the Fabaceae family (Fikiru, Tesfaye, & Bekele, 2007), and are a self-pollinating dicot with diploid chromosomes (2n=2x=14) (Ford & Taylor, 2003). The size of the lentil
genome is approximately 4,063 Mbp (Arumuganathan & Earle, 1991), and
genome sequencing is currently underway (Kaur et al., 2011).
Several lentil market class are represented in the North American lentil
trade (Table 3.1) (Government of Saskatchewan, 2016; Saskatchewan Pulse
Growers, 2000; Thavarajah, Ruszkowski, & Vandenberg, 2008). These market
classes are based on consumer preference, seed size, and color. Two market
classes are based on seed size: large seeded Chilean type (1000 seed weight
>50 g) and small seeded Persian type (1000 seed weight <40 g). Also, 1000
seed weight is used to classify further lentils as extra small (29-32 g), small (33-
15
45 g), medium (51-52 g), or large (55-75 g). Lentil seed coat color can be green, brown, gray, purple, or black, and seed cotyledon colors range from yellow to red to green (Table 3.1) (Government of Saskatchewan, 2016; Saskatchewan Pulse
Growers, 2000; Thavarajah, Ruszkowski, & Vandenberg, 2008).
16
Table 3. 1. Common lentil market classes and consuming countries (Government of Saskatchewan, 2016;
Saskatchewan Pulse Growers, 2000; Thavarajah, Ruszkowski, & Vandenberg, 2008).
Market Class Seed size (1000 seed weight) Genotype Consuming countries Extra small (29-32 g) CDC Impala, CDC Imperial CL, CDC Red bow, CDC Robin, CDC Rosebud, CDC Rosetown Canada, United States of America, Turkey, Small (33-45 g) CDC Blaze, CDC Redberry, Egypt, India, Australia, CDC Rouleau, CDC Impact CL, Red Sri Lanka, Pakistan, CDC Red Rider, CDC Maxim Bangladesh, Syria, CL, CDC Imax CL, CDC Dazil Nepal CL, CDC Red coat, CDC
Redcliff, CDC Cherie Large (55-73 g) CDC KR-1, CDC-KR-2 Extra small (29-32 g) CDC Asterix Small (33-45 g) CDC Eston, CDC Milestone, CDC Icery, CDC Imvincible CL Spain, England, United Yellow Large (55-73 g) CDC Sedley, Laird, Plato, CDC States, Germany Sovereign, CDC Greenland, CDC Improve Extra small (29-32 g) CDC QG-2 Morocco, Greece, Italy, Small (33-45 g) CDC QG-3 Egypt, Mexico, Green Medium (51-52 g) CDC Impress, CDC Imigreen, Northwestern Europe, CDC Meteor, CDC Richlea Spain, Algeria, United States Spanish Brown Small (33-45) Pardina Spain
17
As noted above, lentil is a rich source of protein with a balanced amino acid profile, plentiful low digestible carbohydrates, and a range of human essential human micronutrients (Table 3.2) (de Almeida Costa, da Silva Queiroz-Monici,
Pissini Machado Reis, & de Oliveira, 2006; Hefni, McEntyre, Lever, & Slow,
2015; Iqbal, Khalil, Ateeq, & Sayyar Khan, 2006; Johnson, Thavarajah,
Thavarajah, Payne, et al., 2015; Johnson, Thavarajah, Combs, & Thavarajah,
2013; Ray et al., 2014; Solanki, Kapoor, & Singh, 1999; Thavarajah, Ruszkowski,
& Vandenberg, 2008; Thavarajah et al., 2011). For instance, a single serving of lentils (100 g) contains 2 g of fat, 4-9 g of dietary fiber, 23-27 g of protein, and 64-
74 g of total carbohydrates (by difference). As a result of high levels of low digestible carbohydrates, lentils have a low energy density that reduces glycemic response in humans (Chung, Liu, Hoover, Warkentin, & Vandenberg, 2008).
Lentil is low in fat (contributes <5% of its energy as fat) compared to other
legumes including chickpea (Cicer arietinum L.), field pea (Pisum sativum L.),
and soybean (Glycine max L.) that contain >15-45% of their energy as fat
(Messina, 1999). Lentil also contains substantial amounts of vitamins and minerals in relative proportions that are much higher than other grain legumes
(Messina, 1999).
Lentil starch refers to the non-structural carbohydrates that comprise the
47-52 g of total starch found in 100 g of lentil. Lentil starch is composed of
amylose (a linear glucan with few branches) and amylopectin (a larger and highly
branched molecule), and the higher levels of amylose starch mean legume
18
Table 3. 2. Nutritional composition of lentil (de Almeida Costa, da Silva Queiroz-
Monici, Pissini Machado Reis, & de Oliveira, 2006; Hefni, McEntyre, Lever, &
Slow, 2015; Iqbal, Khalil, Ateeq, & Sayyar Khan, 2006; Johnson, Thavarajah,
Thavarajah, Payne, et al., 2015; Johnson, Thavarajah, Combs, & Thavarajah,
2013; Ray et al., 2014; Solanki, Kapoor, & Singh, 1999; Thavarajah, Ruszkowski,
& Vandenberg, 2008; Thavarajah et al., 2011).
Nutrients Concentration Energy (kcal) 359-362 Carbohydrates Total starch (g/100 g) 45-48 Total prebiotic carbohydrates (g/100 g) 12-14 Resistant starch (mg/100 g) 2.8-3.4 Fiber (g/100 g) 4-9 Protein (g/100 g) 23-27 Fat (g/100 g) 2.0-2.3 Minerals Potassium (mg/100 g) 800-1002 Magnesium (mg/100 g) 94-107 Calcium (mg/100 g) 27-43 Iron (mg/100 g) 8-10 Zinc (mg/100 g) 4-5 Phosphorus (mg/100 g) 290-298 Copper (mg/ kg) 7-9 Selenium (μg/100 g) 43-67 Sodium (mg/100 g) 76-82 Vitamins Folate (µg/100 g) 216-290 Choline, total (mg/100 g) 176-196
19 starch digestion is significantly slower than foods high in amylopectin starch
(Thorne, Thompson, & Jenkins, 1983). This slower digestion is possibly due to
the degree of crystallization or character of the outermost layers of the starch
granule. In addition, lentil has approximately 12-14 g of prebiotic carbohydrates
per 100 g that pass through the gastrointestinal tract as they are resistant to
digestion by human digestive enzymes (Johnson, Thavarajah, Combs, &
Thavarajah, 2013). These prebiotic carbohydrates may also lower the rate and
extent of starch digestibility that is associated with increased satiety, resulting in
improved management of body weight, reduced glycemic response, and insulin
resistance (Cani & Delzenne, 2011; Delzenne & Cani, 2010; Kau, Ahern, Griffin,
Goodman, & Gordon, 2011).
3.5. Lentil Prebiotic Carbohydrates
Most dietary nutrients are metabolized in the human gastrointestinal tract using digestive enzymes. Some nutrients not utilized by digestive enzymes, called colonic nutrients or “prebiotics”, are used by human gastrointestinal
microflora. Prebiotics are defined as “selectively fermented components that
allows specific changes in the composition and/or activity in the gastrointestinal
microflora that confers benefits to host well-being and health” (Roberfroid, 2007).
Only two carbohydrates, inulin and trans-galactooligosaccharide, fulfill the original definition of prebiotics; however, several other carbohydrates are now considered prebiotics based on their chemical structure and beneficial impacts on human gut health (Table 3.3). Prebiotic carbohydrates are classified into two
20 major groups: dietary fiber and sugar alcohols. Dietary fiber is divided into categories of glucose based polymers (e.g., resistant starch and cellulose) and non-glucose based polymers. Non-glucose based polymers are further classified as either (1) fructose based polymers (e.g., kestose, nystose, and inulin) or (2) others, which includes raffinose family oligosaccharides (e.g., raffinose, stachyose, and verbascose), pectin, hemicellulose, guar gum, and polydextrose
(Table 3.3). Naturally occurring sugar alcohols include sorbitol, mannitol, and galactinol. Most legumes, cereals, fruits, and vegetables are naturally rich in prebiotic carbohydrates, and have a considerable potential to promote human health and nutrition. Major sources of dietary prebiotic carbohydrates are wheat, onion, and green bananas. These prebiotic carbohydrates have been used in the food industry in the production of dry cereals, beverages, dairy products, chewing gum, candy, and pharmaceuticals (Grabitske & Slavin, 2009).
21
Table 3. 3. Prebiotic carbohydrates in common staple foods (Academy of
Nutrition and Dietetics, 2012; Berardini, Knödler, Schieber, & Carle, 2005; Brown
& Serro, 1953; Campbell et al., 1997; Cruz & Park, 1982; Fanaro et al., 2007;
Figuerola, Hurtado, Estévez, Chiffelle, & Asenjo, 2005; Hidaka, Eida, Takizawa,
Tokunaga, & Tashiro, 1986; Johnson, Thavarajah, Combs, & Thavarajah., 2013;
Kuo, VanMiddlesworth, & Wolf, 1988; Lo Bianco, Rieger, & Sung, 2000; Loo et al., 1999; Rupérez & Toledano, 2003; Sajilata, Singhal, & Kulkarni, 2006; Slavin,
1987; Wang, 2009; Yang & Keding, 2009).
Category Examples Food Source A. Dietary fiber a. Glucose based polymers I. Resistant starch Potatoes, green banana, corn II. Cellulose Plant based foods b. Non-glucose based polymers 1. Fructose based I. Kestose Jerusalem artichoke II. Nystose Onion, Jerusalem artichoke, legumes III. Inulin Leeks, onion, garlic, asparagus, Jerusalem artichokes, chicory 2. Others (non-fructose based) Raffinose family oligosaccharides I. Raffinose Legumes, cereals II. Stachyose Legumes, cereals III. Verbascose Legumes, cereals Pectin Apple, pomace, citrus Hemicellulose Wheat bran, legumes Guar gum Guar or Cluster bean Polydextrose Cereals B. Sugar Sorbitol Peach, apple, pears, alcohols legumes Mannitol Seaweed, celery, legumes Galactinol Beet, legumes
22
3.5.1. Lentil sugar alcohols
Sugar alcohols include polyols, polyalcohols, and poly hydric alcohols
(Bieleski, 1982). Sugar alcohols are formed during plant growth, especially under water stress conditions (Loescher, 1987). In addition to moisture stress
tolerance, recent research reveals that sugar alcohols have a prebiotic effect as
they generate a low glycemic response similar to resistant starch (Foster-Powell,
Holt, & Brand-Miller, 2002). Lentil is a rich source of sugar alcohols, however the
type and concentration thereof varies with genotype, growing location, and
country (Table 3.4) (Johnson, Thavarajah, Thavarajah, Fenlason, et al., 2015).
For example, lentil grown in the USA has average concentrations of 1126-1392
mg/100 g sorbitol and 45-69 mg/100 g mannitol; however, moderate differences
are reported as a result of growing location, genotype, and environmental effects
(Johnson, Thavarajah, Combs, & Thavarajah, 2013). Quemener et al. reports
galactinol concentrations among pulse crops ranging from 50 to 170 mg/100 g,
results from Johnson et al. of 46-89 mg/100 g across all countries are within the
range (Johnson, Thavarajah, Thavarajah, Fenlason, et al., 2015; Quemener &
Brillouet, 1983).
23
Table 3. 4. Lentil sugar alcohol types and concentrations (Johnson, Thavarajah,
Thavarajah, Fenlason, et al., 2015).
Growing country Sugar alcohol (mg/100 g) Sorbitol Mannitol Galactinol USA 1126-1392 45-69 60-78 Lebanon 1358-1698 95-139 39-65 Morocco 1657-1991 112-152 49-77 Syria 1307-1531 69-105 35-57 Turkey 1230-1426 100-122 45-61 Ethiopia 1461-1761 97-139 73-105 Mean 1495 104 62
3.5.2. Lentil raffinose family oligosaccharides
Raffinose family oligosaccharides (raffinose, stachyose, and verbascose) are
plentiful in cereals and legumes (Bachmann, Matile, & Keller, 1994). Raffinose is
mainly present in cereals whereas stachyose and verbascose are mainly present
in legumes (Bachmann et al., 1994). Lentil is a rich source of raffinose family
oligosaccharides, with concentrations ranging from 5181-6763 mg/100 g
depending on genotype, growing location, and environmental conditions
(Johnson, Thavarajah, Combs, & Thavarajah, 2013; Johnson, Thavarajah,
Thavarajah, Fenlason, et al., 2015). Raffinose family oligosaccharides vary with
lentil growing location and country (Table 3.5) (Johnson, Thavarajah,
Thavarajah, Fenlason, et al., 2015). The mean concentration of raffinose family
oligosaccharides grown in the USA is 6409 mg/100 g, which is within the range
of values for Lebanon, Morocco, Syria, Turkey, and Ethiopia of 5240, 7149,
5225, 5767, and 6046 mg/100 g, respectively (Table 3.5). Processing may also
24 change lentil raffinose family oligosaccharide concentration. Johnson et al.
indicate that cooking, cooling, and reheating of lentil can reduce total raffinose
family oligosaccharide concentrations from 5500-6100 to 4300-4900 mg/100 g depending on the lentil market class (Figure 3.2) (Johnson, Thavarajah,
Thavarajah, Payne, et al., 2015). In contrast, Wang et al. show cooking significantly reduces the concentration of raffinose and stachyose but increases the concentration of verbascose in eight lentil varieties (Wang, Hatcher, Toews,
& Gawalko, 2009). Overall, these results clearly indicate that raffinose family
oligosaccharide concentrations are influenced by genotype, growing location,
country, and processing conditions, and therefore the careful genetic selection of
lentil germplasm may need to consider with those variables.
Table 3. 5. Raffinose family and fructooligosaccharide concentrations of lentil
grown in different countries (Johnson, Thavarajah, Thavarajah, Fenlason, et al.,
2015).
Growing Raffinose family oligosaccharides Fructo oligosaccharides country (mg/100 g) (mg/100 g) Raffinose+Stachyose Verbascose Nystose Kestose USA 3489-4423 2146-2760 4-12 nd-53 Lebanon 2915-3713 1634-2218 40-74 nd-239 Morocco 3913-5691 1712-2982 45-69 nd-1157 Syria 2979-3657 1636-2178 56-78 nd Turkey 3126-3862 2056-2490 90-132 nd Ethiopia 3458-4090 2012-2532 361-539 nd Mean 3776 2196 125 242 nd - not detected
25
7000 Raw Cooked Cooled Reheated a a a a a a 6000 a a a a b a b a 5000 b b
4000
3000 concentration (mg/100 g)
oligosaccharides family Raffinose 2000
1000
0 Whole red Dehulled Red Whole green Dehulled green Lentil market classes
Figure 3. 1. Concentration of raffinose family oligosaccharides (mg/100 g; dry weight basis) in whole and dehulled lentil grown in the USA (Johnson, Thavarajah, Thavarajah, Payne, et al., 2015).
26
3.5.3. Lentil fructooligosaccharides
Fructooligosaccharides are a mixture of oligosaccharides linking to fructose units
(Hidaka et al., 1986). Compared to raffinose oligosaccharides, very small quantities of fructooligosaccharides (nystose and kestose) are found in US-grown lentils (Bhatty,
1988; Biesiekierski et al., 2011; Johnson, Thavarajah, Combs, & Thavarajah, 2013),
and levels are significantly lower still in lentil grown in other countries such as Lebanon
and Morocco (Johnson, Thavarajah, Thavarajah, Fenlason, et al., 2015). Unlike sugar
alcohols and raffinose family oligosaccharides, fructooligosaccharide concentrations are
not affected by genotype but significantly vary with growing location and country
(Johnson, Thavarajah, Combs, & Thavarajah, 2013). A 100 g of lentil serving can
provide 0-988 mg of fructooligosaccharides, including kestose and nystose (Table 3.5)
(Johnson, Thavarajah, Thavarajah, Fenlason, et al., 2015).
3.5.4. Lentil resistant starch
Resistant starches are glucose-based polymers that are resistant to human
digestive enzymes. Jernkins et al. report that lentil induces a low-glycemic response as
a result of the high resistance of lentil starch to hydrolysis (Jenkins et al., 1981). Lentils,
on average, contain 63% carbohydrates calorically (Bhatty, 1988). Among lentil
carbohydrates, starch represents about 45-48% of total carbohydrates (Johnson
Thavarajah, Combs, & Thavarajah, 2013). Resistant starch accounts for approximately
1.6 to 8.4% of the dry weight of raw lentil and 1.6-9.1% after cooking and freeze-drying
(de Almeida Costa et al., 2006). Johnson et al. indicate that resistant starch concentrations in raw, cooked, cooled, and reheated lentil are 3.0, 3.0, 5.1, and 5.1%, respectively, demonstrating cooling-induced synthesis of resistant starch from
27 gelatinized starch (Johnson, Thavarajah, Thavarajah, Payne, et al., 2015); however, these values vary with lentil market class, genotype, and processing method (Johnson,
Thavarajah, Thavarajah, Payne, et al., 2015). Wang et al. show that cooking different
lentil varieties can increase resistant starch from 2-4 to 4-5 g/100 mg (Wang, Hatcher,
Toews, & Gawalko, 2009); however, de Almeida Costa et al. report a slight reduction in
lentil resistant starch after cooking (de Almeida Costa et al., 2006). Other pulse crops
including chickpea, field pea, and common bean (Phaseolus vulgaris L.) have
comparable amounts of resistant starch to lentils (de Almeida Costa et al., 2006).
3.6. Prebiotic carbohydrate consumption
Understanding of prebiotic carbohydrate consumption is still limited. A survey of
American diets estimates that human consumption of prebiotic carbohydrates ranges
from 1 to 10 g/d/capita in the United States (Van Loo, Coussement, De Leenheer,
Hoebregs, & Smits, 1995). The Institute of Medicine (IOM) set the Acceptable
Macronutrient Distribution Range (AMDR) for carbohydrates at 45-65% of total energy intake. The Adequate Intake (AI) of total fiber is 38 g for men and 25 g for women (The
National Academies of Sciences, Engineering and Medicine, 2016). Although many prebiotic carbohydrates are categorized as fiber, no official recommendations have been made specifically regarding their consumption. Several researchers have recommended intakes for fiber components, as follows:
1. Fructooligosaccharide (FOS) – 10 g/day (Hauly & Moscatto, 2002);
2. Galactooligosaccharide (GOS) – 2-3 g/day (Carabin & Flamm, 1999);
3. Xylooligosaccharide (XOS) – 0.7 g/day (Tomomatsu, 1994);
28
4. Resistant starch (RS) – 4 g/day (Australian National Health and Medical
Research Council and New Zealand Ministry of Health, 2006);
5. Inulin – no recommendations are available, but there are no known toxic
effects at any level of intake (Hauly & Moscatto, 2002).
Many of these prebiotic carbohydrates are found naturally in legumes, vegetables, and fruits (Table 3.3). However, legumes including lentil can be a major source of prebiotic carbohydrates. A 100 g serving of lentil provides 57% of the daily recommended intake of raffinose family oligosaccharides, which is higher than that provided by chickpea (42%), pea (52%), or common bean (38%); a 100 g serving of lentil also provides 78% of the recommended daily intake of resistant starch, which is also more than that provided by chickpea (56%), pea (47%), or common bean (58%)
(de Almeida Costa et al., 2006; Johnson, Thavarajah, Thavarajah, Payne, et al., 2015).
Thus, lentil is a possible source of prebiotic carbohydrates to combat obesity and provide moderate amounts of energy.
3.7. Human gut microbiome
The human intestinal tract is home to more than 100 trillion microorganisms
(Bäckhed, Ley, Sonnenburg, Peterson, & Gordon, 2005), over a surface area of 300 m2
(Bäckhed, Ley, Sonnenburg, Peterson, & Gordon, 2005; Holzapfel, Haberer, Snel,
Schillinger, & Huis in’t Veld, 1998). Gut microbes are involved in major physiological activities, acting as a barrier to pathogens attempting to invade gut epithelial cells, stimulating the immune system, increasing nutrient availability, stimulating bowel motility, and reducing cholesterol levels (Holzapfel, Haberer, Snel, Schillinger, & Huis in’t Veld, 1998; Holzapfel & Schillinger, 2002). Studies suggest the intestinal
29 microbiome and a low-calorie diet can play important roles in combating obesity and related non-communicable diseases (Ley, Turnbaugh, Klein, & Gordon, 2006; Nadal et al., 2009). A complex bacterial community inhabits the human gastrointestinal tract.
Three dominant phyla have been identified in fecal flora: Firmicutes, Bacteroides, and
Actinobacteria and sub-dominant groups include Enterobacteria, Streptococci, and
Lactobacilli (Sghir et al., 2000; Vrieze et al., 2010). The relative proportion of
Bacteroidetes is decreased in obese individuals compared to lean individuals; however,
this relative proportion rebounds with a low-calorie diet (David et al., 2013).
Furthermore, consumption of non-digestible, fermentable carbohydrates (or prebiotics) may stimulate the growth and activity of hind gut bacteria by producing short-chain fatty acids that provide an energy source for colonocytes, strengthen the gut mucosal barrier, and suppress colonization of pathogens. Even though several studies reveal that gut microbiome composition or activity is related to both obesity and related non- communicable diseases, none clearly describe the link between microbial composition and obesity prevention (Tremaroli & Bäckhed, 2012).
A diet rich in prebiotic carbohydrates can reduce cholesterol levels by modulating gut microbiomes (Cani et al., 2009). Cani et al. suggest that fructooligosaccharides increase the growth of Bifidobacteria, which increases the expression of tight junction proteins (zonula occludens 1 and occludin) and is linked to reduced permeability of the gut epithelium (Cani et al., 2009). As a result, cholesterol formation is reduced via a
reduction in blood lipopolysaccharide levels, leading to increased glucose tolerance,
insulin sensitivity, and reduced fat storage (Blaut & Bischoff, 2010). A recent human
study indicates that fructooligosaccharide supplementation reduces body weight as a
30 result of increasing satiety hormones including peptide YY (PYY) and ghrelin (Parnell &
Reimer, 2009). A diet rich in resistant starch can also reduce food intake as a result of increasing satiety hormones (Willis, Eldridge, Beiseigel, Thomas, & Slavin, 2009).
Further, resistant starch can influence long-term energy balance by altering the neuronal pathways associated with gut peptide YY (PYY) and glucagon like peptide
(GLP-1) signals (Keenan et al., 2006). Delzenne et al. clearly outline the effect of prebiotics on gut microbiota and metabolic disorders using animal and human models
(Delzenne, Neyrinck, & Cani, 2013). They conclude that highly fermented prebiotic carbohydrates are able to counteract several metabolic alterations linked to obesity, including hyperglycemia, inflammation, and hepatic steatosis. Delzenne et al. also discuss how initial mechanistic studies indicated prebiotics could only increase
Bifidobacteria counts, which are related to regulation of host energy homoeostasis
(Delzenne, Neyrinck, & Cani, 2013); however, it is clear now with animal models that
these bacteria can promote gut hormone release, change the gut barrier integrity, and
release bacterially derived metabolites that can reduce human food intake and obesity.
In conclusion, human intervention studies are required to test the ability of ‘colonic’
nutrients to selectively promote beneficial bacteria in the human gut as well as to
determine how promoting foods with colonic nutrients can aid in the nutritional
management of overweight and obesity.
3.8. Mechanisms of prebiotic effects on metabolism
Adipose tissue, once thought to be largely inactive, is now understood to be a
complex and highly interactive endocrine organ, with many secretory functions (e.g.
leptin, cytokines, adiponectin) and hormonal responses via receptors (e.g. via insulin,
31 glucagon, leptin, and catecholamines, among many others) (Kershaw & Flier, 2004).
Leptin, for example, is secreted in response to multiple hormonal stimuli and is critical for central feedback of total body energy reserves (Friedman & Halaas, 1998).
Cytokines are also produced within adipose tissue, including tumor necrosis factor
(TNF)-α, interleukin (IL)-1, and IL-6, all of which are immune activators and markers of inflammation (Amrani et al., 1996; Fried, Bunkin, & Greenberg, 1998; Hrnciar et al.,
1999).
Chronic, low-grade inflammation is characteristic of obesity and important in early pathogenesis of the disorder (Cani et al., 2007). Exogenous administration of lipopolysaccharide (LPS) in rats, normally shed from Gram-negative organisms in the gut microbiota, stimulated an inflammatory response and induced weight gain, insulin resistance, and hyperglycemia to a similar extent seen with high-fat diet (Cani et al.,
2007). These changes are mediated via activation of toll-like receptors (TLR); specifically, TLR4 responds to microbial LPS and lipids, resulting in increased production of NF- κB gene transcription (Creely et al., 2007). NF- κB signals production
of cytokines, such as TNF-α (Hotamisligil, Shargill, & Spiegelman, 1993), IL-1
(Hotamisligil, Shargill, & Spiegman, 1993; Weisberg et al., 2003), and IL-6 (Weisberg et
al., 2003), as well as chemotaxins, such as C3a (Koistinen et al., 2001), which activate
and recruit inflammatory cells to adipose tissue in obesity.
The same metabolic disturbances seen in rats injected with LPS (weight gain,
insulin resistance, and fasting hyperglycemia) (Cani et al., 2007) are observed with
high-fat diet and are associated with changes in gut microbiota, intestinal permeability,
and endotoxemia (Moreira, Texeira, Ferreira, Peluzio, & Alfenas, 2012). Specifically,
32 high-fat diet allows increased permeability to LPS by down-regulation of tight junction proteins, ZO-1 and occludin (Cani et al., 2009). These discoveries and others lent support to the hypothesis that diet can be used to alter microbiota populations and activities, reducing the inflammatory cascade seen in obesity and DM II. Researchers have since uncovered numerous interactions by which prebiotics improve obesity and
DM II, including anti-inflammatory and metabolic mechanisms, but, surprisingly, many of the prebiotic effects are moderated via hormones (Carnahan, Balzer, Panchal, & Brown,
2014).
Prebiotic fermentation in the gastrointestinal (GI) tract liberates short-chain fatty acids (SCFAs) (Gibson & Roberfroid, 1995). These microbial products have been studied extensively, and their many physiological actions are well documented
(Carnahan, Balzer, Panchal, & Brown, 2014). The presence SCFAs leads to a reduction in TLR4 expression and subsequent inflammatory response in colonocytes (Isono et al.,
2007). SCFAs also activate GPR43 receptors, reducing lipolysis and free fatty acids in serum, thus reducing TLR activation by lipids and the ensuing inflammatory cascade
(Maslowski et al., 2009). By treating neutrophils with propionate and acetate, the LPS- induced NF-κB and TNF-α inflammatory response was suppressed (Kiens, Alsted, &
Jeppesen, 2011). Furthermore, supplementation with 5% butyrate to mice fed a high-fat diet prevented development of obesity and insulin resistance (Gobinath, Madhu,
Prashant, Srinivasan, & Prapulla, 2010). Finally, propionate was able to reduce serum cholesterol in rats, indicating a possible interaction with HMG CoA reductase (Arora,
Sharma, & Frost, 2011).
33
Microbial fermentation of prebiotics induces endogenous release of a variety of hormones, controlling gut endothelial barrier functions and metabolic homeostasis
(Cani, 2016). Intestinal L cells release glucagon-like peptide (GLP)-1 and GLP-2, controlling metabolic hormone activity and gut permeability, respectively (Cani et al.,
2009; Delzenne, Cani, & Neyrinck, 2007). Prebiotic-induced changes in gut microbiota also modulate peptide YY (PYY) and ghrelin, involved in appetite regulation (Cani,
Dewever, & Delzenne, 2004).
Systematic review and meta-analysis of randomized controlled trials in humans revealed that prebiotic supplementation reduced total serum cholesterol and triglycerides and increased high-density lipoprotein cholesterol (Beserra et al., 2015).
Further, when taken as a symbiotic (i.e. with beneficial microbial species), prebiotics reduced insulin resistance and triglycerides (Beserra et al., 2015). Prebiotic effects on body weight have been controversial, with some studies showing improvement and others insignificant (Barengolts, 2016; Beserra et al., 2015); however, this is unsurprising for several reasons. 1) Obesity is an insidious disease, and short trials of prebiotic carbohydrates are insufficient to produce significant effects. 2) BMI, commonly used in clinical trials, is not an accurate measure of obesity as a disease, because it does not account for changes in lean body mass or distribution of adipose tissue, e.g. subcutaneous vs. visceral. Finally, 3) most trials focus on prebiotic use as a supplement rather than a staple component of diet, as they would have been consumed traditionally by ancient populations. To achieve significant, lasting effects from prebiotic use, prebiotic components must be consumed as part of a balanced, whole-food diet.
34
3.9. Closing thoughts
Millions of people around the world suffer from health issues as a result of poor nutrition. Obesity has been a severally neglected global public health concern for decades and, today, obesity is taking over many parts of the world. In fact, the global population continues to increase, with more than 90 million people to feed each year; global food demands are expected to double by 2050. Therefore, to combat global obesity, novel ways to produce nutritious foods, beyond calorie-focused approaches, are required. Investigating the potential of traditional food legumes including lentils may be necessary to provide better nutrition solutions towards improved human health.
Recent research demonstrated that prebiotic carbohydrate rich diet may reduce obesity related non communicable diseases via modulation of hind gut bacteria. Lentil is an emerging pulse crop in the USA that is typically grown in rotation with cereal and oil crops. Interestingly, research indicates that lentils may provide over 12-14 g of total prebiotic carbohydrates and a range of micronutrients per 100 g serving. In addtion, these levels can further increase two-fold after cooking, cooling, and re-heating.
Therefore, lentils offer new opportunities as a whole food solution to combat obesity and overweight. Finally, obesity is preventable, however holistic systemic approaches are required to combine agricultural production and human health.
35
3.10. References
Abubakari, A. R., Lauder, W., Agyemang, C., Jones, M., Kirk, A., & Bhopal, R. S.
(2008). Prevalence and time trends in obesity among adult West African
populations: a meta-analysis. Obesity Reviews, 9(4), 297–311.
Academy of Nutrition and Dietetics. (2012). Polydextrose: Health Benefits and Product
Applications. http://wmdpg.org/wp-content/uploads/2013/08/PDX-Science-
Brochure.pdf Accessed 26.03.2016.
Amrani, A., Jafarian-Tehrani, M., Mormede, P., Durant, S., Pleau, J., Haour, F.,
Dardenne, M., & Homo-Delarche, F. (1996). Interleukin-1 effect on glycemia in the
non-obese diabetic mouse at the pre-diabetic stage. Journal of endocrinology,
148(1), 139-148.
Arora, T., Sharma, R., & Frost, G. (2011). Propionate. Anti-obesity and satiety
enhancing factor? Appetite, 56(2), 511-515.
Arumuganathan, K., & Earle, E. (1991). Nuclear DNA content of some important plant
species. Plant Molecular Biology Reporter, 9(3), 208–218.
Australian National Health and Medical Research Council and New Zealand Ministry of
Health. Nutrient Reference Value for Australia and New Zealand (2006).
https://www.nrv.gov.au/nutrients/dietary-fibre Accessed 24.03.2016.
Bachmann, M., Matile, P., & Keller, F. (1994). Metabolism of the Raffinose Family
Oligosaccharides in Leaves of Ajuga reptans L. (Cold Acclimation, Translocation,
and Sink to Source Transition: Discovery of Chain Elongation Enzyme). Plant
Physiology, 105(4), 1335–1345.
Bäckhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., & Gordon, J. I. (2005).
36
Host-bacterial mutualism in the human intestine. Science (New York, N.Y.),
307(5717), 1915–20.
Barengolts, E. (2016). Gut microbiota, prebiotics, probiotics, and synbiotics in
management of obesity and prediabetes: review of randomized controlled trials.
Endocrine Practice, 22(10), 1224-1234.
Beaglehole, R., Bonita, R., Horton, R., Adams, C., Alleyne, G., Asaria, P., Baugh, V.,
Bekedam, H., Billo, N., Casswell, S., & Cecchini, M. (2011). Priority actions for the
non-communicable disease crisis. The Lancet, 377(9775), 1438–1447.
Berardini, N., Knödler, M., Schieber, A., & Carle, R. (2005). Utilization of mango peels
as a source of pectin and polyphenolics. Innovative Food Science & Emerging
Technologies, 6(4), 442–452.
Beserra, B. T., Fernandes, R., do Rosario, V. A., Mocellin, M. C., Kuntz, M. G., &
Trindade, E. B. (2015). A systematic review and meta-analysis of the prebiotics
and synbiotics effects on glycaemia, insulin concentrations and lipid parameters in
adult patients with overweight or obesity. Clinical Nutrition, 34(5), 845-858.
Bhatty, R. S. (1988). Composition and Quality of Lentil (Lens culinaris Medik): A
Review. Canadian Institute of Food Science and Technology Journal, 21(2), 144–
160.
Bieleski, R. L. (1982). Sugar Alcohols. In Plant Carbohydrates I (pp. 158–192). Berlin,
Heidelberg: Springer Berlin Heidelberg.
Biesiekierski, J. R., Rosella, O., Rose, R., Liels, K., Barrett, J. S., Shepherd, S. J.,
Gibson, P. R., & Muir, J. G. (2011). Quantification of fructans, galacto-
oligosacharides and other short-chain carbohydrates in processed grains and
37
cereals. Journal of Human Nutrition and Dietetics, 24(2), 154–176.
Blaut, M., & Bischoff, S. C. (2010). Probiotics and Obesity. Annals of Nutrition and
Metabolism, 57(1), 20–23.
Brown, R. J., & Serro, R. F. (1953). Isolation and Identification of O-α-D-
Galactopyranosyl-myo-inositol and of myo-Inositol from Juice of the Sugar Beet
(Beta Vulgaris). Journal of the American Chemical Society, 75(5), 1040–1042.
Campbell, J. M., Bauer, L. L., Fahey, G. C., Hogarth, A. J. C. L., Wolf, B. W., & Hunter,
D. E. (1997). Selected Fructooligosaccharide (1-Kestose, Nystose, and 1F-β-
Fructofuranosylnystose) Composition of Foods and Feeds. Journal of Agricultural
and Food Chemistry, 45(8), 3076–3082.
Cani, P. D. (2016). Interactions between gut microbes and host cells control gut barrier
and metabolism. International Journal of Obesity Supplements, 6, S28-S31.
Cani, P. D., & Delzenne, N. M. (2011). The gut microbiome as therapeutic target.
Pharmacology & Therapeutics, 130(2), 202–212.
Cani, P. D., Amar, J., Iglesias, M. A., Poggi, M., Knauf, C., Bastelica, D., Neyrinck, A.
M., Fava, F., Tuohy, K. M., Chabo, C., & Waget, A. (2007). Metabolic endotoxemia
initiates obesity and insulin resistance. Diabetes, 56(7), 1761-1772.
Cani, P. D., Dewever, C., & Delzenne, N. M. (2004). Inulin-type fructans modulate
gastrointestinal peptides involved in appetite regulation (glucagon-like peptide-1
and ghrelin) in rats. British Journal of Nutrition, 92(03), 521-526.
Cani, P. D., Possemiers, S., Van de Wiele, T., Guiot, Y., Everard, A., Rottier, O.,
Geurts, L., Naslain, D., Neyrinck, A., Lambert, D. M., Muccioli, G. G., & Delzenne,
N. M. (2009). Changes in gut microbiota control inflammation in obese mice
38
through a mechanism involving GLP-2-driven improvement of gut permeability.
Gut, 58(8), 1091-1103.
Caprio, S., Daniels, S. R., Drewnowski, A., Kaufman, F. R., Palinkas, L. A.,
Rosenbloom, A. L., Schwimmer, J. B., & Kirkman, M. S. (2008). Influence of Race,
Ethnicity, and Culture on Childhood Obesity: Implications for Prevention and
Treatment. Obesity, 16(12), 2566–2577.
Carabin, I. G., & Flamm, W. G. (1999). Evaluation of Safety of Inulin and Oligofructose
as Dietary Fiber. Regulatory Toxicology and Pharmacology, 30(3), 268–282.
Carnahan, S., Balzer, A., Panchal, S., & Brown, L. (2014). Prebiotics in obesity.
Panminerva Med, 56(2), 165-175.
Chung, H.-J., Liu, Q., Hoover, R., Warkentin, T. D., & Vandenberg, B. (2008). In vitro
starch digestibility, expected glycemic index, and thermal and pasting properties of
flours from pea, lentil and chickpea cultivars. Food Chemistry, 111(2), 316–321.
Cokkizgin, A., & Shtaya, J. (2013). Lentil: Origin, cultivation techniques, utilization and
advances in transformation. Agricultural Science, 1(1), 55–62.
Creely, S. J., McTernan, P. G., Kusminski, C. M., Da Silva, N., Khanolkar, M., Evans,
M., Harte, M., & Kumar, S. (2007). Lipopolysaccharide activates an innate immune
system response in human adipose tissue in obesity and type 2 diabetes.
American Journal of Physiology-Endocrinology and Metabolism, 292(3), E740-
E747.
Cruz, R., & Park, Y. K. (1982). Production of Fungal ?-Galactosidase and Its Application
to the Hydrolysis of Galactooligosaccharides in Soybean Milk. Journal of Food
Science, 47(6), 1973–1975.
39
Cubero, J. I., Pérez de la Vega, M., & Fratini, R. (2009). Origin, phylogeny,
domestication and spread. In The lentil: botany, production and uses (pp. 13–33).
Wallingford: CABI.
Cummins, S., & Macintyre, S. (2006). Food environments and obesity--neighbourhood
or nation? International Journal of Epidemiology, 35(1), 100–4.
David, L. A., Maurice, C. F., Carmody, R. N., Gootenberg, D. B., Button, J. E., Wolfe, B.
E., Ling, A. V., Devlin, A. S., Varma, Y., Fischbach, M. A., Biddinger, S. B., Dutton,
R. J., & Turnbaugh, P. J. (2013). Diet rapidly and reproducibly alters the human gut
microbiome. Nature, 505(7484), 559–563.
de Almeida Costa, G. E., da Silva Queiroz-Monici, K., Pissini Machado Reis, S. M., & de
Oliveira, A. C. (2006). Chemical composition, dietary fibre and resistant starch
contents of raw and cooked pea, common bean, chickpea and lentil legumes. Food
Chemistry, 94(3), 327–330.
Delzenne, N. M., & Cani, P. D. (2010). Nutritional modulation of gut microbiota in the
context of obesity and insulin resistance: Potential interest of prebiotics.
International Dairy Journal, 20(4), 277–280.
Delzenne, N. M., Cani, P. D., & Neyrinck, A. M. (2007). Modulation of glucagon-like
peptide 1 and energy metabolism by inulin and oligofructose: experimental data.
The Journal of nutrition, 137(11), 2547S-2551S.
Delzenne, N. M., Neyrinck, A. M., & Cani, P. D. (2013). Gut microbiota and metabolic
disorders: how prebiotic can work? British Journal of Nutrition, 109(S2), S81–S85.
European Food Information Council. Motivating Behaviour Change. (2014).
http://www.eufic.org/article/en/expid/Motivating-behaviour-change/ Accessed
40
03.03.2016.
Everard, A., Lazarevic, V., Derrien, M., Girard, M., Muccioli, G. G., Muccioli, G. M.,
Neyrinck, A. M., Possemiers, S., Holle, A. V., François, P., de Vos, W. M.,
Delzenne, N. M., Schrenzel, J., & Cani, P. D. (2011). Responses of gut microbiota
and glucose and lipid metabolism to prebiotics in genetic obese and diet-induced
leptin-resistant mice. Diabetes, 60(11), 2775–86.
Fanaro, S., Boehm, G., Garssen, J., Knol, J., Mosca, F., Stahl, B., & Vigi, V. (2007).
Galacto-oligosaccharides and long-chain fructo-oligosaccharides as prebiotics in
infant formulas: A review. Acta Paediatrica, 94(s449), 22–26.
FAOSTAT. (2015). http://faostat3.fao.org/home/E Accessed 19.03.2016.
Figuerola, F., Hurtado, M. L., Estévez, A. M., Chiffelle, I., & Asenjo, F. (2005). Fibre
concentrates from apple pomace and citrus peel as potential fibre sources for food
enrichment. Food Chemistry, 91(3), 395–401.
Fikiru, E., Tesfaye, K., & Bekele, E. (2007). Genetic diversity and population structure of
Ethiopian lentil (Lens culinaris Medikus) landraces as revealed by ISSR marker.
African Journal of Biotechnology. 6(12), 1460–1468.
Finkelstein, E. A., Khavjou, O. A., Thompson, H., Trogdon, J. G., Pan, L., Sherry, B., &
Dietz, W. (2012). Obesity and Severe Obesity Forecasts Through 2030. American
Journal of Preventive Medicine, 42(6), 563–570.
Ford, R., & Taylor, P. W. J. (2003). Construction of an intraspecific linkage map of lentil
( Lens culinaris ssp. culinaris ). TAG Theoretical and Applied Genetics, 107(5),
910–916.
Foster-Powell, K., Holt, S. H. A., & Brand-Miller, J. C. (2002). International table of
41
glycemic index and glycemic load values: 2002. The American Journal of Clinical
Nutrition, 76(1), 5–56.
Fried, S. K., Bunkin, D. A., & Greenberg, A. S. (1998). Omental and subcutaneous
adipose tissues of obese subjects release interleukin-6: depot difference and
regulation by glucocorticoid 1. The Journal of Clinical Endocrinology & Metabolism,
83(3), 847-850.
Friedman, J. M., & Halaas, J. L. (1998). Leptin and the regulation of body weight in
mammals. Nature, 395(6704), 763-770.
Gibson, G. R., & Roberfroid, M. B. (1995). Dietary modulation of the human colonic
microbiota: introducing the concept of prebiotics. The Journal of nutrition, 125(6),
1401.
Gobinath, D., Madhu, A. N., Prashant, G., Srinivasan, K., & Prapulla, S. G. (2010).
Beneficial effect of xylo-oligosaccharides and fructo-oligosaccharides in
streptozotocin-induced diabetic rats. British Journal of Nutrition, 104(01), 40-47.
Government of Saskatchewan. Varieties of Grain Crops. (2016).
http://www.saskseed.ca/images/varieties2016.pdf Accessed 26.03.2016.
Grabitske, H. A., & Slavin, J. L. (2009). Gastrointestinal Effects of Low-Digestible
Carbohydrates. Critical Reviews in Food Science and Nutrition, 49(4), 327–360.
Hauly, M. C. O, Moscatto, J. A. (2002). Inulin and oligofructosis: a review about
functional properties, prebiotic effects and importance for food industry. Semina:
Ciencias Exatas E Tecnologicas, 23, 105–118.
Hefni, M., McEntyre, C., Lever, M., & Slow, S. (2015). A Simple HPLC Method with
Fluorescence Detection for Choline Quantification in Foods. Food Analytical
42
Methods, 8(9), 2401–2408.
Hidaka, H., Eida, T., Takizawa, T., Tokunaga, T., & Tashiro, Y. (1986). Effects of
Fructooligosaccharides on Intestinal Flora and Human Health. Bifidobacteria and
Microflora, 5(1), 37–50.
Holzapfel, W. H., & Schillinger, U. (2002). Introduction to pre- and probiotics. Food
Research International, 35(2), 109–116.
Holzapfel, W. H., Haberer, P., Snel, J., Schillinger, U., & Huis in’t Veld, J. H. . (1998).
Overview of gut flora and probiotics. International Journal of Food Microbiology,
41(2), 85–101.
Hotamisligil, G. S., Shargill, N. S., & Spiegelman, B. M. (1993). Adipose Expression of
Tumor Necrosis Factor- : Direct Role in Obesity-Linked Insulin Resistance.
Science, 259, 87-87.
Hrnciar, J., Gabor, D., Hrnciarova, M., Okapcova, J., Szentivanyi, M., & Kurray, P.
(1999). Relation between cytokines (TNF-alpha, IL-1 and 6) and homocysteine in
android obesity and the phenomenon of insulin resistance syndromes. Vnitrni
lekarstvi, 45(1), 11-16.
Iqbal, A., Khalil, I. A., Ateeq, N., & Sayyar Khan, M. (2006). Nutritional quality of
important food legumes. Food Chemistry, 97(2), 331–335.
Isono, A., Katsuno, T., Sato, T., Nakagawa, T., Kato, Y., Sato, N., Seo, G. I., Suzuki, Y.,
& Saito, Y. (2007). Clostridium butyricum TO-A culture supernatant downregulates
TLR4 in human colonic epithelial cells. Digestive diseases and sciences, 52(11),
2963-2971.
Jenkins, D. J., Wolever, T. M., Taylor, R. H., Barker, H., Fielden, H., Baldwin, J. M.,
43
Bowling, A. C., Newman, H. C., Jenkins, A. L., & Goff, D. V. (1981). Glycemic index
of foods: a physiological basis for carbohydrate exchange. The American Journal of
Clinical Nutrition, 34(3), 362–6.
Johnson, C. R., Thavarajah, D., Combs, G. F., & Thavarajah, P. (2013). Lentil (Lens
culinaris L.): A prebiotic-rich whole food legume. Food Research International,
51(1), 107–113.
Johnson, C. R., Thavarajah, D., Thavarajah, P., Fenlason, A., McGee, R., Kumar, S., &
Combs, G. F. (2015). A global survey of low-molecular weight carbohydrates in
lentils. Journal of Food Composition and Analysis, 44, 178–185.
Johnson, C. R., Thavarajah, D., Thavarajah, P., Payne, S., Moore, J., & Ohm, J. B.
(2015). Processing, cooking, and cooling affect prebiotic concentrations in lentil
(Lens culinaris Medikus). Journal of Food Composition and Analysis, 38, 106–111.
Kau, A. L., Ahern, P. P., Griffin, N. W., Goodman, A. L., & Gordon, J. I. (2011). Human
nutrition, the gut microbiome and the immune system. Nature, 474(7351), 327–336.
Kaur, S., Cogan, N. O., Pembleton, L. W., Shinozuka, M., Savin, K. W., Materne, M.,
Savin, K. W., Materne, M., & Foster, J. W. (2011). Transcriptome sequencing of
lentil based on second-generation technology permits large-scale unigene
assembly and SSR marker discovery. BMC Genomics, 12(1), 265.
Keenan, M. J., Zhou, J., McCutcheon, K. L., Raggio, A. M., Bateman, H. G., Todd, E.,
Jones, C. K., Tulley, R. T., Melton, S., Martin, R. J., & Hegsted, M. (2006). Effects
of Resistant Starch, A Non-digestible Fermentable Fiber, on Reducing Body Fat*.
Obesity, 14(9), 1523–1534.
44
Kershaw, E. E., & Flier, J. S. (2004). Adipose tissue as an endocrine organ. The Journal
of Clinical Endocrinology & Metabolism, 89(6), 2548-2556.
Kiens, B., Alsted, T. J., & Jeppesen, J. (2011). Factors regulating fat oxidation in human
skeletal muscle. Obesity reviews, 12(10), 852-858.
Koistinen, H. A., Vidal, H., Karonen, S.-L., Dusserre, E., Vallier, P., Koivisto, V. A., &
Ebeling, P. (2001). Plasma acylation stimulating protein concentration and
subcutaneous adipose tissue C3 mRNA expression in nondiabetic and type 2
diabetic men. Arteriosclerosis, Thrombosis, and Vascular Biology, 21(6), 1034-
1039.
Kopelman, P. G. (2000). Obesity as a medical problem. Nature, 404(6778), 635–643.
Kuo, T. M., VanMiddlesworth, J. F., & Wolf, W. J. (1988). Content of raffinose
oligosaccharides and sucrose in various plant seeds. Journal of Agricultural and
Food Chemistry, 36(1), 32–36.
Ladizinsky, G. (1979). The origin of lentil and its wild genepool. Euphytica, 28(), 179–
187.
Larson, N. I., Story, M. T., & Nelson, M. C. (2009). Neighborhood Environments:
Disparities in Access to Healthy Foods in the U.S. American Journal of Preventive
Medicine, 36(1), 74–81.
Ley, R. E., Turnbaugh, P. J., Klein, S., & Gordon, J. I. (2006). Microbial ecology: Human
gut microbes associated with obesity. Nature, 444(7122), 1022–1023.
Lo Bianco, R., Rieger, M., & Sung, S.-J. S. (2000). Effect of drought on sorbitol and
sucrose metabolism in sinks and sources of peach. Physiologia Plantarum, 108(1),
71–78.
45
Loescher, W. H. (1987). Physiology and metabolism of sugar alcohols in higher plants.
Physiologia Plantarum, 70(3), 553–557.
Loo, J. Van, Cummings, J., Delzenne, N., Englyst, H., Franck, A., Hopkins, M., Kok, N.,
Macfarlane, G., Newton, D., Quigley, M. & Roberfroid, M. (1999). Functional food
properties of non-digestible oligosaccharides: a consensus report from the ENDO
project (DGXII AIRII-CT94-1095). British Journal of Nutrition, 81(02), 121–132.
Maslowski, K. M., Vieira, A. T., Ng, A., Kranich, J., Sierro, F., Yu, D., Schilter H. C.,
Rolph, M. S., Mackay, F., Artis, D., & Xavier, R. J. (2009). Regulation of
inflammatory responses by gut microbiota and chemoattractant receptor GPR43.
Nature, 461(7268), 1282-1286.
Messina, M. J. (1999). Legumes and soybeans: overview of their nutritional profiles and
health effects. The American Journal of Clinical Nutrition, 70(3), 439S–450S.
Moreira, A. P. B., Texeira, T. F. S., Ferreira, A. B., Peluzio, M. d. C. G., & Alfenas, R. d.
C. G. (2012). Influence of a high-fat diet on gut microbiota, intestinal permeability
and metabolic endotoxaemia. British Journal of Nutrition, 108(05), 801-809.
Nadal, I., Santacruz, A., Marcos, A., Warnberg, J., Garagorri, M., Moreno, L. A., Martin-
Matillas, M., Campoy, C., Marti, A., Moleres, A., & Delgado, M. (2009). Shifts in
clostridia, bacteroides and immunoglobulin-coating fecal bacteria associated with
weight loss in obese adolescents. International Journal of Obesity, 33(7), 758–767.
NCD Risk Factot Collaboration. Trends in adult body-mass index in 200 countries from
1975 to 2014: a pooled analysis of 1698 population-based measurement studies
with 19·2 million participants. (2016). The Lancet, 387(10026), 1377–1396.
OECD Factbook, Economic, Environmental and Social Statistics. (2013).
46
http://www.oecd-ilibrary.org/economics/oecd-factbook-2013_factbook-2013-en
Accessed 16.03.2016.
OECD. Health at a Glance: Europe (2012). http://www.oecd-ilibrary.org/social-issues-
migration-health/health-at-a-glance-europe-2012_9789264183896-en Accessed
02.03.2016.
Ogden, C. L., & Carroll, M. D. (2010). Prevalence of overweight, obesity, and extreme
obesity among adults: United States, trends 1960–1962 through 2007–2008.
National Center for Health Statistics. 6(1), 1–6
Ogden, C. L., Carroll, M. D., Kit, B. K., & Flegal, K. M. (2013). Prevalence of obesity
among adults: United States, 2011–2012. NCHS Data Brief, 131, 1–8
Ogden, C. L., Carroll, M. D., Kit, B. K., & Flegal, K. M. (2014). Prevalence of Childhood
and Adult Obesity in the United States, 2011-2012. JAMA, 311(8), 806.
Parnell, J. A., & Reimer, R. A. (2009). Weight loss during oligofructose supplementation
is associated with decreased ghrelin and increased peptide YY in overweight and
obese adults. American Journal of Clinical Nutrition, 89(6), 1751–1759.
Quemener, B., & Brillouet, J.-M. (1983). Ciceritol, a pinitol digalactoside form seeds of
chickpea, lentil and white lupin. Phytochemistry, 22(8), 1745–1751.
Ray, H., Bett, K., Tar’an, B., Vandenberg, A., Thavarajah, D., & Warkentin, T. (2014).
Mineral Micronutrient Content of Cultivars of Field Pea, Chickpea, Common Bean,
and Lentil Grown in Saskatchewan, Canada. Crop Science, 54(4), 1698–1709.
Roberfroid, M. (2007). Prebiotics: The Concept Revisited. The Journal of Nutrition,
137(3), 830S–837S.
Robinson, T. N., & Sirard, J. R. (2005). Preventing childhood obesity: A solution-
47
oriented research paradigm. American Journal of Preventive Medicine, 28(2), 194–
201.
Rupérez, P., & Toledano, G. (2003). Celery by-products as a source of mannitol.
European Food Research and Technology, 216(3), 224–226.
Sajilata, M. G., Singhal, R. S., & Kulkarni, P. R. (2006). Resistant Starch?A Review.
Comprehensive Reviews in Food Science and Food Safety, 5(1), 1–17.
Sallis, J. F., & Glanz, K. (2009). Physical Activity and Food Environments: Solutions to
the Obesity Epidemic. Milbank Quarterly, 87(1), 123–154.
Saskatchewan Pulse Growers. Pulse Production Manual (2000).
https://www.ndsu.edu/pubweb/pulse-info/resources.html Accessed 22.03.2016.
Sen Gupta, D., Thavarajah, D., Knutson, P., Thavarajah, P., McGee, R. J., Coyne, C. J.,
& Kumar, S. (2013). Lentils (Lens culinaris L.), a Rich Source of Folates. Journal of
agricultural and food chemistry, 61(32), 7794–7799.
Sghir, A., Gramet, G., Suau, A., Rochet, V., Pochart, P., & Dore, J. (2000).
Quantification of Bacterial Groups within Human Fecal Flora by Oligonucleotide
Probe Hybridization. Applied and Environmental Microbiology, 66(5), 2263–2266.
Slavin, J. L. (1987). Dietary fiber: classification, chemical analyses, and food sources.
Journal of the American Dietetic Association, 87(9), 1164–1171.
Solanki, I. S., Kapoor, A. C., & Singh, U. (1999). Nutritional parameters and yield
evaluation of newly developed genotypes of lentil (Lens culinaris Medik.). Plant
Foods for Human Nutrition, 54(1), 79–87.
Thavarajah, D., & Thavarajah, P. (2012). US Pulse Quality Survey. Northern Pulse
Growers Association, USA Dry Pea and Lentil Council, and NDSU North Dakota
48
Agricultural Experiment Station. North Dakota State University, Fargo, ND.
Thavarajah, D., Ruszkowski, J., & Vandenberg, A. (2008). High Potential for Selenium
Biofortification of Lentils (Lens culinaris L.). Journal of agricultural and food
chemistry. 56(22), 10747–10753.
Thavarajah, D., Thavarajah, P., Sarker, A., & Vandenberg, A. (2009). Lentils (Lens
culinaris Medikus Subspecies culinaris): A Whole Food for Increased Iron and Zinc
Intake. Journal of Agricultural and Food Chemistry, 57(12), 5413-5419.
Thavarajah, D., Thavarajah, P., Wejesuriya, A., Rutzke, M., Glahn, R. P., Combs, G. F.,
& Vandenberg, A. (2011). The potential of lentil (Lens culinaris L.) as a whole food
for increased selenium, iron, and zinc intake: preliminary results from a 3 year
study. Euphytica, 180(1), 123–128.
Thavarajah, P., Thavarajah, D., & Vandenberg, A. (2009). Low Phytic Acid Lentils (Lens
culinaris L.): A Potential Solution for Increased Micronutrient Bioavailability. Journal
of agricultural and food chemistry. 57(19), 9044-9049.
The National Academies of Sciences, Engineering and Medicine. Dietary reference
intakes: Macronutrients 2002/2005.
http://www.nationalacademies.org/hmd/~/media/Files/Activity%20Files/Nutrition/D
RIs/DRI_Macronutrients.pdf Accessed 24.03.2016.
The State of Obesity. New data: Obesity data trends and policy analysis. (2015).
http://stateofobesity.org/ Accessed 01.03.2016.
The World Factbook. Country comparison: Obesity-Adult prevalence rate (2015).
https://www.cia.gov/library/publications/the-world-factbook/rankorder/2228rank.html
Accessed 19.03.2016.
49
Thorne, M. J., Thompson, L. U., & Jenkins, D. J. (1983). Factors affecting starch
digestibility and the glycemic response with special reference to legumes. The
American Journal of Clinical Nutrition, 38(3), 481–488.
Tomomatsu, H. (1994). Health effects of oligosaccharides. Food Technology. 48(10),
61–65.
Tremaroli, V., & Bäckhed, F. (2012). Functional interactions between the gut microbiota
and host metabolism. Nature, 489(7415), 242–249.
Van Loo, J., Coussement, P., De Leenheer, L., Hoebregs, H., & Smits, G. (1995). On
the presence of Inulin and Oligofructose as natural ingredients in the western diet.
Critical Reviews in Food Science and Nutrition, 35(6), 525–552.
Vrieze, A., Holleman, F., Zoetendal, E. G., de Vos, W. M., Hoekstra, J. B. L., &
Nieuwdorp, M. (2010). The environment within: how gut microbiota may influence
metabolism and body composition. Diabetologia, 53(4), 606–613.
Wang, N., & Daun, J. K. (2006). Effects of variety and crude protein content on nutrients
and anti-nutrients in lentils (Lens culinaris). Food Chemistry, 95(3), 493–502.
Wang, N., Hatcher, D. W., Toews, R., & Gawalko, E. J. (2009). Influence of cooking and
dehulling on nutritional composition of several varieties of lentils (Lens culinaris).
LWT - Food Science and Technology, 42(4), 842–848.
Wang, Y. (2009). Prebiotics: Present and future in food science and technology. Food
Research International, 42(1), 8–12.
Wang, Y., Beydoun, M. A., Liang, L., Caballero, B., & Kumanyika, S. K. (2008). Will All
Americans Become Overweight or Obese? Estimating the Progression and Cost of
the US Obesity Epidemic. Obesity, 16(10), 2323–2330.
50
Weisberg, S. P., McCann, D., Desai, M., Rosenbaum, M., Leibel, R. L., & Ferrante, A.
W. (2003). Obesity is associated with macrophage accumulation in adipose tissue.
The Journal of clinical investigation, 112(12), 1796-1808.
Willis, H. J., Eldridge, A. L., Beiseigel, J., Thomas, W., & Slavin, J. L. (2009). Greater
satiety response with resistant starch and corn bran in human subjects. Nutrition
Research, 29(2), 100–105.
World Health Organization (WHO). Obesity and overweight. (2016).
http://www.who.int/mediacentre/factsheets/fs311/en/ Accessed 10.03.2016.
World Health Organization (WHO). Obesity. (2015).
http://www.who.int/gho/ncd/risk_factors/obesity_text/en/ Accessed 10.03.2016.
Yang, R., & Keding, G. (2009). Nutritional contributions of important African indigenous
vegetables. African indigenous vegetables in urban agriculture. Earthscan,
London, pp.105-144.
This chapter was published in Journal of Functional Foods; Siva, N., Thavarajah, D.,
Johnson, C. R., Duckett, S., Jesch, E. D., & Thavarajah, P. (2017). Can lentil (Lens
culinaris Medikus) reduce the risk of obesity? Journal of Functional Foods (in press)
51
4. CHAPTER TWO
THE IMPACT OF PROCESSING AND COOKING ON PREBIOTIC
CARBOHYDRATES IN LENTIL (Lens culinaris MEDIKUS)
4.1. Abstract
Lentil (Lens culinaris Medikus) is a significant food source of prebiotic carbohydrates, including sugar alcohols (SA), raffinose-family oligosaccharides (RFO), fructooligosaccharides (FOS), and resistant starch (RS). The levels of these carbohydrates and, hence, nutritional value, can change during processing and cooking.
This study determined changes in prebiotic carbohydrate types and concentrations in lentil from three market classes (red, green, and Spanish Brown) subjected to different processing methods (whole, dehulled, and splitting) and cooking, cooling, and reheating. Dehulling and splitting of lentil decreased SA in red and green market classes but RFO and FOS significantly decreased only in dehulled split red lentil.
Further, dehulling and splitting of red lentil significantly decreased RS concentrations compared to the whole seed. In some cases, SA, RFO, and FOS significantly increased with cooling but decreased after re-reheating. Cooling and reheating significantly increased lentil RS concentration for all market classes. Spanish Brown “Pardina” had the highest total prebiotic carbohydrates (9492 mg/100 g) of all market classes tested
(range 6935-8338 mg/100 g). Overall, selection of lentil market class, processing, and cooking method should be considered to optimize nutritional value.
Keywords: Lentil, sugar alcohols, raffinose-family oligosaccharides, fructooligosaccharides, resistant starch, dehulling, cooking
52
4.2. Introduction
Lentil (Lens culinaris Medikus) is a cool season pulse crop that is low in fat (<2%) and provides significant quantities of carbohydrate (40-50%), protein (20-30%), a range of minerals [iron (Fe), zinc (Zn), and selenium (Se)], carotenoids, and folates (Bhatty,
1988; Sen Gupta et al., 2013; Thavarajah et al., 2011). Lentil has significant amounts of prebiotic carbohydrates or low digestible carbohydrates, including sugar alcohols (SA), raffinose-family oligosaccharides (RFO), fructooligosaccharides (FOS), and resistant starch (RS) (Johnson et al., 2015a, 2013). A study of 10 lentil cultivars grown in North
Dakota, USA for two years reported mean concentrations of SA, RFO, FOS, and RS of
1423 mg, 4071 mg, 62 mg, and 7.5 g/100 g, respectively (Johnson et al., 2013). They
also reported significant variations in lentil prebiotic carbohydrate concentrations: RFO
concentrations varied with cultivars, RS varied with growing location, and SA varied with
both variety and location.
As a result of the increasing incidence of obesity in the USA, lentil is gaining
popularity in Western diets to combat systemic gut inflemation via modulating the human
gut microbiome. A diet rich in prebiotic carbohydrates promotes human gastrointestinal
health by increasing beneficial bacteria and reducing pathogenic bacteria (Roberfroid,
2007). A prebiotic was originally defined as “a selectively fermented ingredient that allows
specific changes, both in the composition and/or activity in the gastrointestinal microflora
that confers benefits upon host well-being and health” (Roberfroid, 2007). Thus, FOS,
galactooligosaccharides, and lactulose were the only bioactive compounds originally
classified as prebiotics (Kolida and Gibson, 2008). However, prebiotics are now included
under the broad category of low-digestible carbohydrates (Blaut, 2002; Grabitske and
53
Slavin, 2009; Johnson et al., 2013). Low-digestible carbohydrates are fermentable carbohydrates and are classified into three groups: (1) SA, (2) non-digestible oligosaccharides, and (3) RS. Sugar alcohols (also known as polyols, polyalcohols, and alditols) include sorbitol, mannitol, and galactinol. Non-digestible oligosaccharides include RFO (raffinose, stachyose, and verbascose) and FOS (kestose and nystose).
These low-digestible carbohydrates are poorly digested in the human digestive tract due to lack of specific enzymes, but are fermented in the large intestine by hindgut bacteria and used as a substrate for their growth and activity (Grabitske and Slavin, 2009).
Products of bacterial fermentation provide various health benefits including induction of satiety, reduction of serum cholesterol, glucose concentration, and reduce systemic inflammation (Cani et al., 2009; Lee and Mazmanian, 2010; Parnell and Reimer, 2012).
Food processing techniques (dehulling, splitting) and cooking can impact the concentrations of prebiotic carbohydrates that lead to projected human health benefits.
Dehulling is a process to remove the seed coat (hull) from the seed and is done in response to consumer preference with respect to taste and shorter cooking time (Kon et al., 1973; Singh and Singh, 1992). For example, dehulled red lentil (also known as
“football lentil”) is a popular lentil market class in South East Asia, specifically India,
Nepal, and Bangladesh. Dehulled split red lentil is a popular lentil market class in Sri
Lanka, the Middle East, and Turkey (Thavarajah et al., 2008). Both dehulling and splitting increase consumer acceptance as a result of increased taste, richer color, and shorter cooking time (Kon et al., 1973; Singh and Singh, 1992). Lentil low digestible carbohydrate concentrations change after processing and cooking for a short time
(Johnson et al., 2015b; Wang et al., 2009); however, no data have yet been reported on
54 corresponding changes in SA and FOS levels in popular lentil market classes. An understanding of changes in lentil prebiotic carbohydrates levels upon processing and cooking is vital with respect to defining consumer nutritional benefits, developing new food products, and other food industry considerations. Therefore, the objective of this study was to determine the concentrations of SA, RFO, FOS, and RS in lentils from three market classes (red, green, and Spanish Brown – variety “Pardina”) subject to three different processing methods (whole, dehulled, and split) as well as cooking, cooling, and reheating.
4.3. Materials and Methods
4.3.1. Materials
Chemicals used for high performance anion exchange chromatography and RS enzymatic assays were purchased from Sigma-Aldrich (St. Louis, MO 63104, USA),
Fisher Scientific (Asheville, NC 28804, USA), and VWR International (Satellite Blvd,
Suwanee, GA 30024, USA). Water was distilled and deionized (ddH2O) to a resistance
of ≥ 18.2 MΩ (NANO-pure Diamond, Barnstead, IA, USA) prior to use.
4.3.2. Lentil samples
Approximately 2-4 kg of six commercially available lentil seed samples were
collected from the Northern Pulse Growers Association, ND, USA (Table 4.1). These six lentil samples belong to three major market classes (red, green, and Spanish Brown – variety “Pardina”) and were selected based on consumer preferences. Red lentil is marketed as whole red (with seed coat), football (whole seed without seed coat), and dehulled split (split seed without seed coat) for local and international markets. Green lentil is marketed as whole green (with seed coat) and dehulled split. Pardina is
55 marketed as whole seed. Lentil samples were mixed thoroughly, subsampled (n = 6), and stored at -20°C prior to the cooking experiment. The treatment design was a completely randomized design with six lentil types, three food preparation methods
(cooked, cooled, reheated), and three replicates (n=54). The experiment was duplicated for a total of 108 samples analyzed. No raw lentil samples were analyzed for prebiotic carbohydrates as humans only consume cooked lentil; results with respect to increases and decreases relate only to cooked vs. cooled vs. reheated.
Table 4. 1. Description of lentil market classes used in this experiment.
1000 seed Market class Commercial form Consuming regions weight (g) Red Whole (with seed coat) 29 South East Asia (India, Sri Dehulled football 35 Lanka, Nepal, Pakistan, Dehulled split 32 Bangladesh), Middle East (Turkey, Egypt, Syria), Europe, Australia, USA Green Whole (with seed coat) 48 Europe, South/North Dehulled split 45 America, Africa, Asia Pardina Whole (with seed coat) 34 Spain, Europe
4.3.3. Cooking, cooling, and reheating procedure
Samples (~12 g) of lentil seeds were placed in 50 mL round bottom Pyrex tubes
with ddH2O at a weight ratio of 1:3 (seed:water). Samples were then suspended in a
boiling water (100°C) bath and cooked for 60 min. Immediately after cooking, samples
were refrigerated (ROPER, Whirlpool corporation, MI, USA) at 4°C for 24 h. Cooled
lentil samples were then reheated in a microwave oven (General Electronic Co.,
Louisville, KY, USA) at high power (950 W) for 1 min. Cooked, cooled, and reheated
samples were homogenized using a mortar and pestle prior to analysis for sugar
56 alcohols, RFO, FOS, and RS. The moisture content of each sample for each step was determined using a previously described method (AACC International, 2000). All data were reported on a wet weight basis (normalized to 14% moisture).
4.3.4. Determination of SA, RFO, and FOS concentrations
Homogenized finely ground lentil samples (500 mg) were incubated with 10 mL of ddH2O for 1 h at 80°C as previously described (Muir et al., 2009). Samples were then
centrifuged at 3000 g for 10 min (Fisher Scientific, USA). An aliquot (1 mL) of the
supernatant was diluted with 9 mL of ddH2O, then filtered through a 13 mm × 0.45 µm nylon syringe filter (Fisher Scientific, USA).
Sugar alcohol, RFO, and FOS concentrations were measured using high
performance anion exchange chromatography with pulsed amperometric detection
(HPLC-PAD; Dionex, ICS-5000, Sunnyvale, CA, USA) as per a previously published
method (Feinberg et al., 2009). These compounds were separated by a CarboPac PA1
column (250 × 4 mm; Dionex, CA, USA) connected to a CarboPac PA1 guard column
(50 × 4 mm; Dionex, CA, USA). Solvent A (100 mM sodium hydroxide/ 600 mM sodium
acetate), solvent B (200 mM sodium hydroxide), and solvent C (ddH2O) were used as
mobile phases with a flow rate of 1 mL/min as follows: 0-2 min, 50% B/ 50% C; 2-20
min, linear gradient change from 2% A/ 49% B/ 49% C to 16% A/ 42% B/ 42% C; final
extension, 50% B/ 50% C. Detection was carried out using a pulsed amperometric
detector with a working gold electrode and a silver–silver chloride reference electrode at
2.0 μA. Sugar alcohols, RFO, and FOS were identified and quantified based on pure
standards (>99%; sorbitol, mannitol, raffinose, stachyose, verbascose, kestose, and
nystose). Sugar alcohol, RFO, and FOS concentrations were detected within a linear
57 range of 3 to 100 μg/g, with a minimum detection limit of 0.2 μg/g. CDC Redberry lentil was used as an external reference to ensure accuracy and reproducibility of detection.
Peak areas for the reference sample, glucose (100 ppm), SA (3-100 ppm), RFO (3-100 ppm), and FOS (3-100 ppm) were routinely analyzed for method consistency and detector sensitivity with an error of less than 5%. Linear calibration curves for prebiotic carbohydrate standards had an error of less than 2%. Filtrate concentrations (C) of SA,
RFO, and FOS were used to determine oligosaccharides in the samples according to X
= (C × V) / m, where X is the concentration of oligosaccharides in the sample, V is the final diluted volume, and m is the mass of the dry sample aliquot (moisture corrected).
4.3.5. Determination of RS concentration
The concentration of RS in the lentil samples was determined using a previously described method (McCleary and Monaghan, 2002; Megazyme, 2012). Homogenized cooked/cooled/reheated lentil samples (500 mg) were incubated with 4 mL of enzyme mixture (3 U/mL amyloglucosidase and 10 mg/mL α-amylase in 100 mM sodium malate, pH 6) at 37°C for 16 h in a water bath with vertical shaking (Orbit shaker bath, Lab Line
Instruments Inc., Melrose Park, ILL.). After incubation, samples were diluted with 4 mL of 95% ethanol followed by centrifugation at 1500 g for 10 min at room temperature.
Pellets were re-suspended with 6 mL of 50% (v/v) ethanol, centrifuged, and decanted.
The remaining pellets were dissolved in 2 mL of 2 M potassium hydroxide at 0°C while stirring with a magnetic stirrer for 20 min. The suspension was then incubated with 8 mL of 1.2 M sodium acetate buffer (pH 3.8) and 0.1 mL of 3300 U/mL amyloglucosidase at
50 °C for 30 min. The suspension was centrifuged at 1500 g for 10 min at room temperature. An aliquot (1 mL) of supernatant containing the resistant starch fraction
58 was diluted with 19 mL of ddH2O and filtered through a 13 mm × 0.45 µm nylon syringe filter (Fisher Scientific, Asheville, NC 28804, USA). The concentration of glucose was determined using HPLC-PAD as described above. Starch fraction concentrations were
calculated by multiplying the glucose concentration by 0.9 (factor to convert free
glucose to anhydro-glucose as occurs in starch) (McCleary and Monaghan, 2002). Data
were validated using a standard reference material (regular corn starch; RS
concentration 1.0±0.1% (w/w)). Batches were checked regularly to ensure an analytical
error of less than 10%.
4.3.6. Statistical analysis
Replicates, runs, lentil types, and processing methods were considered as random
factors. Runs, lentil types, food preparation methods, and replicates were included as
class variables. Analysis of variance was performed using the General Linear Model
procedure (PROC GLM) of SAS version 9.4 (Version 9.4, SAS Institute, 2016). Fisher’s
protected least significant difference (LSD) at P < 0.05 was used to separate means.
4.4. Results
4.4.1. SA
Total SA concentrations (sum of sorbitol and mannitol) ranged from 353 to 813
mg/100 g in cooked lentil (Table 4.2). Pardina had the highest total SA concentration of all cooked lentil types tested. The total SA concentration significantly increased after cooling (P < 0.05 vs. cooked) and decreased after reheating (P < 0.05 vs. cooled) in all
lentil types except dehulled green and Pardina (data not shown). Further, lentil with
seed coat (whole red: 750 mg/100 g; whole green: 572 mg/100 g; Pardina: 813 mg/100
g) had higher concentrations of total SA than dehulled lentil (football red: 394 mg/100 g;
59 split red: 353 mg/100 g; decorticated green 525 mg/100 g) (Table 4.2). Among SAs,
sorbitol was present in higher concentrations (290-710 mg/100 g; Figure 4.1) than
mannitol (47 to 102 mg/100 g; Figure 4.2) in cooked lentil. Cooling significantly
increased sorbitol concentration in most lentil types except Pardina and dehulled split
green lentil (Figure 4.1). Upon reheating, sorbitol concentration significantly decreased
in dehulled split red and increased in whole green lentil (vs. cooled); changes noted for
other lentil types were not significant. Similar to sorbitol, cooling significantly increased
(vs. cooked) and reheating decreased (vs. cooled) mannitol concentration in all lentil
types except dehulled split green and Pardina (Figure 4.2).
Table 4. 2. Concentrations of SA, RFO/FOS, RS, and total prebiotic carbohydrates (mg)
in a 100 g serving of cooked lentil with percent recommended dietary allowance.
Lentil market class SA RFO+FOS RS Total % of RDA Whole red 750 4362 3026 8137 81 Football red 394 4577 1964 6935 69 Dehulled split red 353 3901 2922 7176 71 Whole green 572 5147 2614 8333 83 Dehulled green 525 5139 2674 8338 83 Pardina 813 6111 2569 9492 94
RDA (Recommended dietary allowance); 10 g/day (Douglas & Sanders, 2008), RFO
(raffinose family oligosaccharides), FOS (fructooligosaccharides), RS (resistant starch).
Values are presented on wet weight basis (14% moisture).
60
900 a a a Cooked 800 b b b Cooled 700 a a Reheated ab a b 600 1. Whole red a b c 2. Football red 500 b a 3. Split red 400 b 4. Whole green c 5. Dehulled split green 300 6. Pardina 200 Sorbitol concentration (mg/100 g)
100
0 1 2 3 4 5 6 Lentil market class
Figure 4. 1. Sorbitol concentrations of different lentil market class after cooking, cooling, and reheating. Values are presented on wet weight basis (14 % moisture). Values within each lentil market class followed by a different letter are significantly different at P < 0.05 (n=108).
61
140 Cooked a 120 Cooled ab a a a a 100 a b a Reheated a a 1. Whole red 80 b b b 2. Football red c a 3. Split red 60 b b 4. Whole green 5. Dehulled split green 40 6. Pardina Mannitol concentration (mg/100 g) 20
0 1 2 3 4 5 6 Lentil market class
Figure 4. 2. Sorbitol concentrations of different lentil market class after cooking, cooling, and reheating. Values are presented on wet weight basis (14 % moisture). Values within each lentil market class followed by a different letter are significantly different at P < 0.05 (n=108).
62
4.4.2. RFO and FOS
Total RFO and FOS concentrations ranged from 3901 to 6111 mg/100 g in cooked lentil (Table 4.2). Similar to SA, Pardina had higher RFO and FOS concentrations than all other types. Among the RFO and FOS, lentil has higher concentrations of raffinose and stachyose (2523-5157 mg/100 g; Figure 4.3) followed by verbascose and kestose
(451 to 1845 mg/100 g; Figure 4.4), and finally nystose (45 to 58 mg/100 g; Figure 4.5).
Cooling significantly increased (P < 0.05) stachyose and raffinose concentrations in whole
red and split red lentil and decreased concentrations in Pardina; no significant change
was noted for the other three lentil types. Reheating significantly reduced (vs. cooled)
stachyose and raffinose concentrations in dehulled split red lentil (Figure 4.3).
Among lentil types, whole green lentil had the highest concentrations of
verbascose and kestose after cooking, and whole red lentil the least (Figure 4.4). After
cooling, verbascose and kestose concentrations significantly increased in football red,
split red, and whole green lentil, decreased in Pardina, and remained unchanged for
dehulled split green and whole red lentil. Reheating significantly (P < 0.05) reduced
verbascose and kestose concentrations (vs. cooled) in split red and increased
concentrations in whole red and Pardina; concentrations in football red and whole green
were lower but changes were not significant (Figure 4.4). Processing did not affect
nystose concentrations in whole red, whole green, and dehulled split green lentil
(Figure 4.5). Cooling significantly increased nystose concentrations in football red,
dehulled split red, and Pardina lentil (vs. cooked) and reheating significantly reduced
nystose concentration in football red (vs. cooled).
63
90
a 80 a Cooked a 70 a a b ab Cooled b a b a a b a 60 a a a Reheated
50 a 1. Whole red
2. Football red 40 3. Split red 4. Whole green 30 5. Dehulled split green
20 6. Pardina Nystose concentration (mg/100 g) (mg/100 concentration Nystose
10
0 1 2 3 4 5 6 Lentil market classes
Figure 4. 3. Raffinose and stachyose concentrations of different lentil market classes after cooking, cooling, and reheating. Values are presented on wet weight basis (14% moisture). Values within each lentil market class followed by a
different letter are significantly different at P < 0.05 (n=108).
64
3000
a a 2500 a Cooked b a a Cooled 2000 b a ab Reheated a b 1. Whole red 1500 c 2. Football red
3. Split red a b 1000 4. Whole green b a b 5. Dehulled split green b 500 6. Pardina
g) (mg/100 concentration kestose and Verbascose 0 1 2 3 4 5 6
Lentil market classes
Figure 4. 4. Verbascose and kestose concentrations of different lentil market classes after cooking, cooling, and reheating. Values are presented on wet weight basis (14% moisture). Values within each lentil market class followed by a different letter are significantly different at P < 0.05 (n=108).
65
90
Cooked a 80 a Cooled a a 70 Reheated a b ab a b a a b 1. Whole red 60 b a a a a 2. Football red
50 a 3. Split red 4. Whole green 40 5. Dehulled split green 6. Pardina 30
g) (mg/100 concentration Nystose 20
10
0 1 2 3 4 5 6 Lentil market classes
Figure 4. 5. Nystose concentrations of different lentil market classes after cooking, cooling, and reheating. Values are presented on wet weight basis (14% moisture). Values within each lentil market class followed by a different letter are significantly different at P < 0.05 (n=108).
66
4.4.3. RS
Resistant starch concentration ranged from 1964 to 3026 mg/100 g in cooked lentil types (Table 4.2). In all lentil types, cooled lentil had significantly higher (P < 0.05)
RS concentrations than cooked lentil. In many cases, reheated lentil had significantly
higher (P < 0.05) RS concentrations than cooled lentil (Figure 4.6).
4.5. Discussion
Processing and cooking changes the concentration of food prebiotic
carbohydrates. Our results clearly indicate that dehulling and splitting reduce total
prebiotic carbohydrate levels in medium red lentil but do not affect levels in large green
lentil. Spanish Brown “Pardina” lentil had the highest concentration of total prebiotic
carbohydrates (9492 mg/100 g) of all market classes considered here (range 6935-8338
mg/100 g). All lentil market classes provide a significant percent of the recommended
intake (%RDA) of prebiotic carbohydrates from a single serving of cooked lentil, with
“Pardina” providing the most (94%) and Football red lentil the least (64%) (Table 4.2).
Variations in concentrations of SA, RFO, FOS, and RS in raw lentil have been
reported (Chung et al., 2008; de Almeida Costa et al., 2006; Johnson et al., 2013). For example, lentil has been reported to contain 880-1550 mg/100 g of sorbitol and 48-250
mg/100 g of mannitol prior to processing and cooking (Johnson et al., 2015a, 2013).
Data from the present study indicate lower concentrations of sorbitol (300-700 mg/100
g) and mannitol (45-100 mg/100 g), suggesting that cooking may reduce SA levels
compared to that of raw seeds. In addition, lentil seeds that are unprocessed – i.e.,
whole red, whole green, and “Pardina” – have more sorbitol, and whole green and
“Pardina” lentil have more mannitol; this indicates the dehulling process removes a
67 significant amount of SA. The seed coat might also act as a barrier to prevent thermal decomposition of SA during cooking at high temperature. Cooking breaks the chemical form of sorbitol and mannitol at high temperature (100°C), and excess water conditions
(Matsumoto et al., 2015; Matsumura, 2016). Overall, dehulling appears to reduce SA
concentration and thus the prebiotic nutritional value of cooked lentil.
RFOs are known antinutrients that cause human gastrointestinal discomfort and
flatulence (Fleming, 1981). As a result, most conventional lentil breeding programs aim
to reduce RFO levels in the seed using plant breeding and selection (Frias et al., 1999).
However, regular consumption of RFOs is recommended as an important dietary
component to combat chronic diseases (Cani et al., 2009; Parnell and Reimer, 2012),
reduce inflammation (Lee and Mazmanian, 2010), eliminate pathogens (Manning and
Gibson, 2004; Sousa et al., 2011), and stimulate mineral bioavailability (Coudray and
Fairweather-Tait, 1998; Yeung et al., 2005). Our previous work has shown that US-
grown lentil contains 4071 mg of RFO and 62 mg of FOS/100 g before processing and
cooking and after cooking total RFO ranges from 6000 mg/100 g in whole red to 5900
mg/100 g in football red, 5500 mg/100 g in duhulled green, and 5200 mg/100 g in whole
green (Johnson et al., 2015b, 2013). Our current study results do not follow the same
trend, and indicate cooked lentil has lower amounts of RFO+FOS (range 3901 mg/100 g
in dehulled split red to 6111 mg/100 g in Pardina; Table 4.2). These variations are
possibly the result of lentil growing conditions (location, variety, management practices,
and weather), processing method, and cooking time.
Lentil RFO and FOS concentrations are known to be affected by processing
(Wang et al., 2009), cooking, cooling, and reheating (Johnson et al., 2015b). Johnson et
68 al. (2015b) indicate that RFO concentrations of whole red and whole green lentil are reduced due to cooking and cooling, but our results do not show the same pattern; rather, cooling increased RFO and FOS concentrations. Regardless, evidence to date suggests higher concentration of raffinose are present in the seed coat of lentil than in the cotyledon, with the reverse being the case for stachyose and verbascose. Our results show reheating reduces RFO and FOS in all lentil market classes except
Pardina. Temperatures of 100°C can reduce RFO and FOS concentrations due to thermal hydrolysis; for example, the fructose furanosyl residues and glycosidic bonds in
FOS are sensitive to both thermal and acid hydrolysis (Courtin et al., 2009). Therefore, cooking, cooling, and reheating will have impact lentil RFO and FOS concentrations.
The concentration of RS in foods also changes as a result of processing,
cooking, and consumer handling. Mishra et al. (2008) indicate that RS levels in cooked
potato increase by more than 400% after 2 days of refrigeration. Even the simple
heating and cooling of autoclaved cereals, tubers, and legumes increases their RS
content by 30 to 70%, and additional heating and cooling further increases RS formation
(Yadav et al., 2009). Annealing of lentil increases RS concentrations from 6.5 to 9.5%
(Vasanthan and Bhatty, 1998). Our previous study reported RS changes in two
commercially available lentil market classes (medium green and small red) after
cooking, cooling, and reheating (Johnson et al., 2015b). Mean RS concentrations in
raw, cooked, cooled, and reheated lentil were 3.0, 3.0, 5.1, and 5.1% (w/w),
respectively, indicating cooling-induced synthesis of RS from gelatinized starch. Our RS
results presented here are comparable to these previous reports, with cooling and
69
7000 a
a a 6000 a a a Cooked
b Cooled 5000 b b a b b Reheated
4000 1. Whole red c 2. Football red c 3000 c b c 3. Split red 4. Whole green c 5. Dehulled split green 2000 6. Pardina
g) (mg/100 concentration starch Resistant 1000
0 1 2 3 4 5 6 Lentil market classes
Figure 4. 6. Resistant starch concentrations of different lentil market classes after cooking, cooling, and reheating. Values are presented on wet weight basis (14% moisture). Values within each lentil market class followed by a different letter are
significantly different at P < 0.05 (n=108).
70 reheating resulting in a two-fold increase in lentil RS concentration. During heating and cooling, starch molecules (i.e., amylose) in foods undergo a retrogradation process that results in the formation of a new type of RS and increases the overall nutritional value (Sievert and Pomeranz, 1989). Our results highlight the impact of temperature on lentil nutritional quality, and show lentil is more nutritious after cooling and reheating.
4.6. Conclusion
An understanding of prebiotic concentrations in different lentil market classes
provides key information to improve lentil nutritional quality through processing
and cooking. Results of this study clearly show that dehulling, cooking, cooling,
and reheating significantly alter the types and levels of prebiotic carbohydrates
present in lentil.
4.7. References
AACC International, 2000. Approved Methods of the American Association of
Cereal Chemists, 10th ed. AACC International, St. Paul, MN, USA.
Bhatty, R.S., 1988. Composition and quality of lentil (Lens culinaris Medik): a
review. Can. Inst. Food Sci. Technol. J. 21, 144–160.
Blaut, M., 2002. Relationship of prebiotics and food to intestinal microflora. Eur.
J. Nutr. 41, I/11–I/16.
Cani, P.D., Possemiers, S., Van de Wiele, T., Guiot, Y., Everard, A., Rottier, O.,
Geurts, L., Naslain, D., Neyrinck, A., Lambert, D.M., Muccioli, G.G.,
Delzenne, N.M., 2009. Changes in gut microbiota control inflammation in
71
obese mice through a mechanism involving GLP-2-driven improvement of
gut permeability. Gut. 58, 1091–103.
Chung, H.J., Liu, Q., Hoover, R., Warkentin, T.D., Vandenberg, B., 2008. In vitro
starch digestibility, expected glycemic index, and thermal and pasting
properties of flours from pea, lentil and chickpea cultivars. Food Chem. 111,
316–321.
Coudray, C., Fairweather-Tait, S.J., 1998. Do oligosaccharides affect the
intestinal absorption of calcium in humans? Am. J. Clin. Nutr. 68, 921–923.
Courtin, C.M., Swennen, K., Verjans, P., Delcour, J.A., 2009. Heat and pH
stability of prebiotic arabinoxylooligosaccharides, xylooligosaccharides and
fructooligosaccharides. Food Chem. 112, 831–837. de Almeida Costa, G.E., da Silva Queiroz-Monici, K., Pissini Machado Reis,
S.M., de Oliveira, A.C., 2006. Chemical composition, dietary fibre and
resistant starch contents of raw and cooked pea, common bean, chickpea
and lentil legumes. Food Chem. 94, 327–330.
Douglas, L., Sanders, M., 2008. Probiotics and prebiotics in dietetics practice. J.
Am. Diet. Assoc. 108, 510–521.
Feinberg, M., San-Redon, J., Assié, A., 2009. Determination of complex
polysaccharides by HPAE-PAD in foods: validation using accuracy profile. J.
Chromatogr. B. 877, 2388–2395.
Fleming, S.E., 1981. A study of relationships between flatus potential and
carbohydrate distribution in legume seeds. J. Food Sci. 46, 794–798.
72
Frias, J., Bakhsh, A., Jones, D.A., Arthur, A.E., Vidal-Valverde, C., Rhodes,
M.J.C., Hedley, C.L., 1999. Genetic analysis of the raffinose oligosaccharide
pathway in lentil seeds. J. Exp. Bot. 50, 469–476.
Grabitske, H.A., Slavin, J.L., 2009. Gastrointestinal effects of low-digestible
carbohydrates. Crit. Rev. Food Sci. Nutr. 49, 327–360.
Johnson, C.R., Thavarajah, D., Combs, G.F., Thavarajah, P., 2013. Lentil (Lens
culinaris L.): a prebiotic-rich whole food legume. Food Res. Int. 51, 107–113.
Johnson, C.R., Thavarajah, D., Thavarajah, P., Fenlason, A., McGee, R., Kumar,
S., Combs, G.F., 2015a. A global survey of low-molecular weight
carbohydrates in lentils. J. Food Compos. Anal. 44, 178–185.
Johnson, C.R., Thavarajah, D., Thavarajah, P., Payne, S., Moore, J., Ohm, J.B.,
2015b. Processing, cooking, and cooling affect prebiotic concentrations in
lentil (Lens culinaris Medikus). J. Food Compos. Anal. 38, 106–111.
Kolida, S., Gibson, G.R., 2008. The prebioitc effect: review of experimental and
human data, in: Gibson, G.R., Roberfroid, M. (Eds.), Handbook of Prebioitcs.
CRC Press: Boca Raton, FL, USA., pp. 69–93.
Kon, S., Brown, A.H., Ohanneson, J.G., Booth, A.N., 1973. Split peeled beans:
preparation and some properties. J. Food Sci. 38, 496–498.
Lee, Y.K., Mazmanian, S.K., 2010. Has the microbiota played a critical role in the
evolution of the adaptive immune system? Science. 330, 1768–1773.
Manning, T.S., Gibson, G.R., 2004. Prebiotics. Best Pract. Res. Clin.
Gastroenterol. 18, 287–298.
73
Matsumoto, R., Aki, T., Nakashimada, Y., 2015. Determination of mannitol
decomposition rate under hydrothermal pretreatment condition. J. Japan
Pet. Inst. 58, 252–255.
Matsumura, Y., 2016. Kinetics of sorbitol decomposition under hydrothermal
condition. J. Japan. 59, 241–241.
McCleary, B. V., Monaghan, D.A., 2002. Measurement of resistant starch. J.
AOAC Int. 85, 665–675.
Megazyme, 2012. Resistant starch assay procedure. RSTAR 11/02. Megazyme
Int. Ltd, Ireland.
Mishra, S., Monro, J., Hedderley, D., 2008. Effect of processing on slowly
digestible starch and resistant starch in potato. Starch. 60, 500–507.
Muir, J.G., Rose, R., Rosella, O., Liels, K., Barrett, J.S., Shepherd, S.J., Gibson,
P.R., 2009. Measurement of short-chain carbohydrates in common
Australian vegetables and fruits by high-performance liquid chromatography
(HPLC). J. Agric. Food Chem. 57, 554–565.
Parnell, J., Reimer, R., 2012. Prebiotic fibres dose-dependently increase satiety
hormones and alter Bacteroidetes and Firmicutes in lean and obese JCR:
LA-cp rats. Br. J. Nutr. 107, 601–613.
Roberfroid, M., 2007. Prebiotics: the concept revisited. J. Nutr. 137, 830S–837S.
Sen Gupta, D., Thavarajah, D., Knutson, P., Thavarajah, P., McGee, R.J.,
Coyne, C.J., Kumar, S., 2013. Lentils (Lens culinaris L.), a rich source of
folates. J. Agric. Food Chem. 61, 7794–7799.
74
Sievert, D., Pomeranz, Y., 1989. Enzyme-resistant starch. I. Characterization and
evaluation by enzymatic, thermoanalytical, and microscopic methods. Cereal
Chem. 66, 342–347.
Singh, U., Singh, B., 1992. Tropical grain legumes as important human foods.
Econ. Bot. 46, 310–321.
Sousa, V.M.C., Santos, E.F., Sgarbieri, V.C., 2011. The importance of prebiotics
in functional foods and clinical practice. Food Nutr. Sci. 2, 133–144.
doi:10.4236/fns.2011.22019
Thavarajah, D., Ruszkowski, J., Vandenberg, A., 2008. High potential for
selenium biofortification of lentils (Lens culinaris L.). J. Agric. Food Chem.
56, 10747–10753.
Thavarajah, D., Thavarajah, P., Wejesuriya, A., Rutzke, M., Glahn, R.P., Combs,
G.F., Vandenberg, A., 2011. The potential of lentil (Lens culinaris L.) as a
whole food for increased selenium, iron, and zinc intake: preliminary results
from a 3 year study. Euphytica. 180, 123–128.
Vasanthan, T., Bhatty, R.S., 1998. Enhancement of resistant starch (RS3) in
amylomaize, barley, field pea and lentil starches. Starch. 50, 286–291.
Wang, N., Hatcher, D.W., Toews, R., Gawalko, E.J., 2009. Influence of cooking
and dehulling on nutritional composition of several varieties of lentils (Lens
culinaris). LWT - Food Sci. Technol. 42, 842–848.
Yadav, B.S., Sharma, A., Yadav, R.B., 2009. Studies on effect of multiple
heating/cooling cycles on the resistant starch formation in cereals, legumes
75
and tubers. Int. J. Food Sci. Nutr. 60, 258–272.
Yeung, C.K., Glahn, R.E., Welch, R.M., Miller, D.D., 2005. Prebiotics and iron
bioavailability-is there a connection? J. Food Sci. 70, R88–R92.
76
5. CHAPTER THREE
WILL LENTIL (Lens culinaris MEDIKUS) DIET REDUCE THE RISK OF
OBESITY? A RAT STUDY
5.1. Abstract
Obesity prevalence is rapidly increasing due to increased consumption of high caloric foods. Research have been focused on dietary compounds including prebiotic carbohydrates to reduce obesity risk. Lentil is rich in prebiotic carbohydrates including sugar alcohols, raffinose family oligosaccharides, fructooligosaccharides, and resistant starch (RS). This study was carried out to assess the potential of lentil to reduce obesity risk in rats. Eight weeks old
Sprague Dawley male rats were fed with lentil, RS, and control diet for 6 weeks.
Rat feed intake, body weight, fat%, plasma triglycerides (TG) concentration, liver weight, and fecal microbiome were analyzed. Feed intake (22-28 g/week/rat) was not different among rats, but after 6 weeks mean body weight of rats fed with lentil (443 g/rat) significantly lower than rats fed with control (511 g/rat) and RS
(502 g/rat) diets. Mean body fat% and plasma TG concentration were lower in rats fed with lentil (20% and 109 mg/dl) than rats fed with control (24% and 133 mg/dl) and RS (29% and 169 mg/dl). Rat liver weight ranged from 12 to 22 g and did not significantly different among treatments. Phylum Actinobacteria and
Bacteriodetes abundance increased in rats fed with lentil (5% and 34%) and RS
(4% and 37%) diets than rats fed with control diet (2% and 30%). Firmicutes reduced in rats fed with lentil (57%) and RS (53%) than rats fed with control diet
77
(65%). These results shows lentil reduces body weight, fat%, and plasma TG and increases beneficial gut microbiome.
Keywords: obesity, lentil, prebiotic carbohydrate, gut microbiome
5.2. Introduction
Prevalence of obesity is dramatically increasing in developed countries
(Ogden et al., 2016). Current adult obesity prevalence in USA ranged from 19-
38% (CDC, 2016; The State of Obesity, 2016). It was estimated that more than
50% of people in USA will become obese by 2030 (Finkelstein et al., 2012).
Increasing obesity is considered as a serious problem because of obesity related health issues, associated medical cost and economic losses. Obesity often associated with coronary heart disease (CHD), non-insulin dependent diabetes mellitus (NIDDM), hyper tension, osteoarthritis and several cancers (WHO,
1997). Estimated annual medical cost for obese people is $190 billion which is
21% of total medical expenditure in US (Cawley & Meyerhoefer, 2012). It was estimated that total medical cost saving will be $550 billion, if the current obesity prevalence remains same for next 20 years (Finkelstein et al., 2012). Therefore, it is necessary to take preventive actions against increasing obesity risk.
Unhealthy eating behavior is one of the major factor for increasing obesity
(Malik, Willett, & Hu, 2012). People increase consumption of high caloric foods and beverages rich in fat and added sugar. High caloric, processed foods are highly available due to low cost compare to legumes, fruits, and vegetables
(Popkin, Adair, & Ng, 2012). However, obesity is related to complex factors
78 including food choice, knowledge, emotional state, and social context (Wardle,
2007). Therefore, multiple approaches including increase vegetable and fruits consumption, increase physical activities, changes in social behaviors, and surgical options are carried out to reduce obesity prevalence (Bischoff et al.,
2016). Among these approaches, dietary treatments gain central attention since obesity is highly influenced by dietary pattern (Fung et al., 2001). Therefore, recent research focused on legumes which are rich in proteins, micronutrients, and prebiotic carbohydrates as a dietary approach to reduce obesity risk.
Prebiotic carbohydrates are selectively fermented by gut beneficial microorganisms, resulting products increase host well-being and health
(Roberfroid, 2007). Beneficial gut microbiome and low fat, prebiotic carbohydrates rich diet reduce obesity risk (Wu et al., 2011). It was found that bacterial phyla Bacteroidetes and Firmicutes are associated with obesity (Ley et al., 2005). Lean rats had high proportion of Bacteroidetes and low proportion of
Firmicutes compare to obese rats (Ley et al., 2005). Similar results were found with human trials where the increased Bacteroidetes correlates with body weight loss (Ley, Turnbaugh, Klein, & Gordon, 2006). However, few studies are controversial to these finding (Collado, Isolauri, Laitinen, & Salminen, 2008;
Finucane, Sharpton, Laurent, Pollard, & Zafar, 2014; Schwiertz et al., 2010); hence the relationship between gut microbiome and obesity is still debatable.
Gut microbiota ferment prebiotic carbohydrates releasing short chain fatty acids (SCFA) including butyrate, acetate, and propionate (Cummings, Pomare,
79
Branch, & Naylor, 1987). SCFA stimulate endocrine L cells and produce gut hormones related to food intake, gut permeability, and insulin resistance (Cani et al., 2009; Everard et al., 2011; Gao, Yin, Zhang, Ward, & Martin, 2009; Keenan et al., 2006; Lin, Frassetto, Jr, & Nawrocki, 2012; Parnell & Reimer, 2009).
Addition, SCFA reduce lipolysis and free fatty acids in serum leads to low adiposity (Samuel et al., 2008). Therefore, supplementation of prebiotic carbohydrates and prebiotic carbohydrates rich foods may modulate gut microbiome and related SCFA; hence reduce obesity risk.
Currently consumption of legumes including lentil (Lens culinaris Medikus) is promoted due to theirs nutritional quality to combat obesity. Lentil is a cool season food legume, rich in protein, minerals (Fe, Zn, and Se), vitamins (folate, beta-carotene), and prebiotic carbohydrates (sugar alcohols, raffinose family oligosaccharides, fructooligosaccharides, and resistant starch) (Johnson,
Thavarajah, Combs, & Thavarajah, 2013; Sen Gupta et al., 2013; D. Thavarajah et al., 2011). A serving of lentil (16 g) provides 180-223 mg of sugar alcohols, 0-
158 mg of fructooligosaccharides, 829-1082 mg of raffinose family oligosaccharides, and 960-1424 mg of resistant starch (Johnson et al., 2013).
Therefore, lentil is currently looked as a potential legume to reduce obesity risk.
Dietary pattern can change the composition of gut microbiome (Wu et al.,
2011). Beneficial gut microbiome can be increased by incorporating legume foods rich in prebiotics. The effect of chick pea (Cicer arietinum L.), pea (Pisum sativum L.), common bean (Phaseolus vulgaris L.), and lentil (Lens culinaris
80
Medikus) diets on bifidobacteria, a beneficial bacterial group have been previously described (Queiroz-Monici, Costa, da Silva, Reis, & de Oliveira, 2005).
Addition, Yellow pea (Lathyrus aphaca L.) reduce Clostridium leptum, a Firmicute
group in obese rats (Eslinger, Eller, & Reimer, 2014). Few studies were focused
on the gut microbial modification and related obesity bio markers changes
respect to legume diets. No efforts have been made to determine the potential of
lentil as a food legume to reduce obesity risk via modulating gut microorganisms.
Therefore, the objectives of the study were to (1) determine the effects of lentil on
body weight, body fat%, plasma TG concentration, and liver weight, and (2)
determine the changes in fecal microbiome composition in rats after feeding
lentil.
5.3. Materials and methods
5.3.1. Diet formulation
Diets were formulated as 0.5 inch pellets (Teklad Lab Animal Diets,
Envigo RMS, 8520, Allison Pointe Boulevard, Suite 400, Indianapolis, IN 46250,
US). Control diet was formulated based on AIN-93 M diet suggested by American
Institute of Nutrition (Reeves et al., 1993). Resistant starch (3.5% w/w high
amylose corn starch) diet and lentil (71% w/w) diet were formulated with
substituting high amylose corn starch and red split lentils with control diet
respectively (Table 5.1) to match other nutrients.
81
Table 5. 1. Composition of standard, corn (3.5% high amylose corn starch), and lentil (71%) diets.
Formula Control diet Corn starch diet Lentil diet Casein (g/kg) 200 200 0 Lentils (g/kg) 0 0 708 L-Cysteine (g/kg) 3 3 0 Corn starch (g/kg)a 398 362 0 Maltodextrin (g/kg) 132 132 76 Sucrose (g/kg) 100 100 58 Soybean oil (g/kg) 70 70 61 Cellulose (g/kg) 50 50 50 Mineral mix, AIN-93G- 35 35 35 MX (94046) (g/kg) Vitamin mix, AIN-93-VX 10 10 10 (94047) (g/kg) Choline bitartrate (g/kg) 3 10 3 TBHQ, antioxidant (g/kg) 0.014 0.014 0.014 High amylose corn 0 35 0 starch (g/kg)b
Calculated composition: Protein, N x 6.25, % 18 18 18 Gross Energy, kcal/kg 3800 3700 3400 Total Carbohydrate, % 60 59 52 Resistant Starch, % 4 6 3 Fat, % 7 7 7
5.3.2. Animals and feed trial
Male, 8 weeks aged Sprague Dawley rats (n=36) were purchased
(Charles river, 251, Ballardvale St, Wilmington, MA, 01887-1096). Rats were housed in individual cages with controlled environmental conditions; temperature
25ºC, RH 60%, and 12 hour light/dark condition. Rats were randomly selected in
82 to three groups (n=12) and allowed for one week to adapt the environment prior to start the experiment. Rats were fed ad libitum water and 1 of 3 formulated diet for 6 weeks.
5.3.3. Feed intake and body weight measurements
Feed intake was measured on 3 days interval throughout the study period by weighing available feed in the cage and subtracting this weight from the previously measured weight. Body weights were measured using weighing balance (TS2KS, OHAUS Corporation, Parsippany, NJ, USA) from initial week
(before the feed trail) to 6th week at one week intervals. The protocol was approved by Clemson University Institutional Animal Care and Use Committee.
5.3.4. Fecal sample collection
Every two weeks interval, fresh fecal samples were collected from each
rat separately in sterilized conical tubes and immediately transferred to a -80°C
freezer and stored until further analysis.
5.3.5. Blood collection
End of the 6th week, blood samples (3 ml) were obtained from each rat
into sterilized tubes containing heparin as an anticoagulant. Tubes were
centrifuged at 1000 x g for 10 minutes at 4ºC. Top plasma layer was pipetted off
in to 1.5 ml microtube and stored at -80ºC until further analysis
5.3.6. Fat% and liver weight measurements
End of the 6th week, rats were euthanized with carbon dioxide in a closed
chamber. After euthanization, immediately fat% was determined using dual
83 energy x-ray absorptiometry technique (Hologic Discovery A, Hologic, Inc. 250,
Campus Drive, Marlborough, MA 01752, USA). Liver samples were collected and weighed. All procedures were approved by Clemson University Institutional
Animal Care and Use Committee.
5.3.7. Triglyceride (TG) measurements
Blood plasma TG concertation was measured using a colorimetric assay
(Cayman TG colorimetric assay kit, Cayman chemicals, 1180 East Ellsworth
Road, Ann Arbor, Michigan 48108, USA). An aliquot (10 µl) of blood plasma was
added into microwell plate. TG standard series and blank were prepared
according to the procedure given in the kit. A volume of diluted enzyme buffer
(150 µl) solution contains lipoprotein lipase, glycerol kinase, glycerol phosphate
oxidase, peroxidase, 4-aminoantipyrine, N-ethyle-N-(3-sulfopropyl)-m-anisidine, and sodium phosphate buffer were added in to each well. Microwell plate was shaken for few seconds to mix followed by a 15 minutes incubation period at room temperature. Absorbance were measured at 540 nm using a microplate reader (SpectaMax M2 with SoftMax pro software, Molecular Devices
Corporation, 1311 Orleans Drive, Sunnyvale, California 94089). Corrected absorbance values were obtained by subtracting blank value from sample value.
Standard curve was obtained using corrected absorbance values of standard series. TG concentration of sample were calculated using following equation.
(corrected absorbance-y intercept) TG concentration (mg/dl) = slope
84
5.3.8. Fecal 16S rRNA analysis
Fecal DNA was extracted using QIAamp DNA stool mini kit (QIAGEN, Inc.
19300, Germantown Road, Germantown, MD, 20874, USA). Concentration of
DNA was checked using Qubit dsDNA HS Assay Kit via Qubit 3.0 fluorometer
(Invitrogen Corporation, 5791 Van Allen Way, Carlsbad, CA 92008) to ensure proper DNA extraction from each sample. Extracted fecal DNA samples were stored in -80°C freezer until further analysis.
Gene specific primers were used to amplify the V4 region of the bacterial
16S rRNA gene as previously described by Caporaso et al., 2011. 16S rRNA V4 primers were as follows: 16S forward; GTGCCAGCMGCCGCGGTAA, 16S reverse; GGACTACHVGGGTWTCTAAT (Kozich, Westcott, Baxter, Highlander,
& Schloss, 2013). Illumina sequencing libraries were built in a single PCR by adding index and flow cell adaptor sequences to the 16S primers following
(Kozich et al. 2013). Each primer consisted of Illumina adaptor, an 8-nt index
sequence, a 10-nt pad sequence, a 2-nt linker, and the gene specific primer
(Appendix A). Index primers and Illumina primers were purchased from IDT
(Integrated DNA Technologies, Inc., 1710 Commercial Park, Coralville, IA,
52241, USA).
Amplicons were generated using PCR (AccuPrime Pfx super mix;
Invitrogen), and then quantified using a bioanalyzer (Agilant 2100 Bioanalyzer,
Agilent Technologies, 5301 Stevens Creek Blvd, Santa Clara, CA 95051, USA).
Amplicons were pooled into equimolar concentrations using a SequalPrep plate
85 normalization kit (Invitrogen Corporation, 5791 Van Allen Way, Carlsbad, CA
92008). Final concentration of the library was determined using previously published protocol (Kozich et al., 2013). Nucleotide diversity of the pooled sample was increased by spiking with 10% phiX DNA.
5.3.9. Liver tissue slicing, staining, and imaging
Liver samples were thawed at room temperature for 2 hrs. Proximal and distal parts of livers were kept in tissue cassettes to process for slicing. Liver tissues were processed in a tissue processor (Tissue-Tek VIP, Sakura Finetek
USA, Inc, Torrance, CA, USA). Following cycles were used to process liver samples, buffered formalin (10%); 2 min, buffered formalin (10%); 30 min, ethanol (70%); 30 min, ethanol (80%); 30 min, ethanol (95%); 45 min, ethanol
(95%); 30 min, ethanol (100%); 45 min, ethanol (100%); 45 min, xylene; 20 min, xylene; 40 min, paraffin; 30 min, paraffin; 30 min, paraffin; 30 min, and paraffin;
30 min. Above cycles were performed at 35 °C except paraffin cycles where those were performed at 58 °C. Cassettes with processed liver samples were transferred to Tissue-Tec tissue embedding console system (Sakura Finetek
USA Inc., Torrance, CA, USA). Liver samples were kept at 4 °C until solidify paraffin blocks. Liver tissue sections (thickness of 5 µm) were obtained using
Leica RM 2155 rotary microtome (Leica Microsystems, Nussloch, Germany).
Tissue sections were transferred to slides and kept in a slide warmer (Premiere slide warmer XH-2004, Premiere, 7241, Gabe court, Manassas, VA 20109) at 44
°C for 15 minutes to remove excess water. Then, slides were incubated in an
86 incubator (12-140E Incubator, Quincy Lab Inc., Chicago, IL, USA) at 55 °C for fix the tissue to slides. Finally dried slides were stained using Hematoxylin and
Eosin staining process. Liver tissue images were taken using Stereo Microscope
(M125, Leica Microsystems Inc., Buffalo Grove, IL, USA). Extended focus depth images was taken by focus stacking using Helicon Focus Software (HeliconSoft,
Kharkiv, Ukraine).
5.3.10. Statistical analysis
Diet types, weeks, and replicates were considered as random factors. Diet types, weeks, and replicates were included as class variables. Analysis of variance was performed using the General Linear Model procedure (PROC GLM) of SAS version 9.4 (Version 9.4, SAS Institute, 2016). Fisher’s protected least significant difference (LSD) at P < 0.05 was used to separate means.
Considering microbial analysis, Python scripts within the software package
QIIME version 1.9.0 (Caporaso et al., 2010) were used to analyze sequence reads.
Taxonomic assignments for assembled reads were obtained using the greengenes database (greengenes.lbl.gov). Normalized taxon counts were used to calculate beta diversity measures (Bray-Curtis). Sample groups were tested for significant differences in beta diversity using PERMANOVA tests. P values were corrected for multiple testing using the false discovery rate (FDR). The frequency of OTUs among sample groups was tested for significant difference using a Kruskal Wallis test. P values were generated using 10,000 permutations and corrected for multiple testing using FDR.
87
5.4. Results
Rat feed intake ranged from 21 to 30 g/rat/day during the study period
(Figure 5.1). At the first week, the feed intake of rats fed with lentil (21-25 g/rat/day) was significantly lower than other two groups (RS, 24-26 g/rat/day; control, 23-29 g/rat/day). Second week onwards, no significant differences (P >
0.05) were observed among feed intake of rats fed with lentil, RS, and control diets (Figure 5.1). End of the study period, the feed intake of rats fed with lentil,
RS, and control were 22-30, 23-29, and 22-28 g/rat/day respectively. Calculated
energy intake of rats fed with lentil is significantly lower (71-87 kcal/rat/day) than
rats fed with RS (88-98 kcal/rat/day) and control (84-110 kcal/rat/day) diets at
initial week. After third week, energy intake was similar among rats regardless
the type of diets (76-108 kcal/rat/day) (Figure 5.1).
Considering body weight, no significant differences (P > 0.05) were
observed among rats fed with lentil, RS, and control diet at initial week, ranged
from 245 g to 291 g/rat (Figure 5.2). After 6 weeks of feeding lentil, RS, and
control diets, significantly lower mean body weight was observed in rats fed with
lentil (383-522 g/rat) than rats fed with RS (431-555 g/rat) and control (440-609)
g/rat) (Figure 5.2). Overall, the growth rate (increased body weight per week per
rat) of rats fed with lentil (29 g/rat/week) was significantly lower than rats fed with
RS (39 g/rat/week) and control (41 g/rat/week).
88
Control diet High amylose corn starch diet Lentil diet Control diet High amylose corn starch diet 60 130 Lentil diet 117 50 a a 104 a a a a a a a 91 40 b ab a a b a a b b 78 a a a a a a a a 30 a a a a a a a a 65 ab b
52 20 39
26 10
Average per day) per (g rat intake feed Average 13
0 0 per day) per rat (kcal intake energy Average 1 2 3 4 5 6 Week
Figure 5. 1. Feed and energy intakes of rats fed with different diets. Means; vertical bars represent standard deviations. Values within each week followed by the same letter are not significantly different, P > 0.05.
89
550 a a a Control diet a 500 a b a High amylose corn starch diet a b a 450 b Lentil diet a a 400 b
b 350 a a b 300 a a a 250
200
Mean body weight (g) 150
100
50 0 0 1 2 3 4 5 6
Weeks
Figure 5. 2. Growth of rats fed different diets. Means; vertical lines represent standard deviations. Values within weeks (n=36) followed by the same letter are not significantly different, P > 0.05.
90
Lower body fat% was observed in rats fed with lentil (17-23%), but did not significantly different from body fat% of rats fed with control (16-32%). Highest body fat% was observed in rats fed with RS (25-33%) (Figure 5.3). Similar
pattern was observed in rat blood plasma TGs concentration. Lower plasma TG
concentrations were observed in rats fed with lentil (68-150 mg/dl), but did not
significantly different from plasma TGs concentration of rats fed with control (98-
168 mg/dl). Highest plasma TGs concentrations were observed in rats fed with
RS (128-210 mg/dl) (Figure 5.3). Liver weight of rats fed with lentil, RS, and
control ranged from 12-20, 14-22, and 14-20 g respectively. However, liver
weight of rats were not significantly different (P > 0.05) among rats fed with lentil,
RS, and control (Figure 5.3).
Figure 3.4 shows the abundance (percentage of total known gene
sequences) of major fecal bacterial phyla throughout the study period. Two major
bacterial phyla; Firmucutes and Bacteriodetes represent the rat fecal
microbiome. Firmucutes and Bacteriodetes represent 46-73% and 25-44% of
fecal microbiome respectively. Addition to these two phyla, Proteobacteria and
Actinobacteria represent 0-5% and 1-5% of total fecal microbiome.
At the initial week of the study, fecal Firmicutes abundance of rats fed with lentil,
RS, and control were 56%, 63%, and 58% respectively. After 6th week, the
abundance of Firmicutes were 57%, 53%, and 65% in rats fed with lentil, RS, and
control diets respectively. Abundance of fecal Bacteriodetes were 40%, 34%, and
37% in rats fed with lentil, RS, and control diets respectively at initial week. After
91
250 Control diet High amylose corn starch diet
Lentil diet a 200 ab
b 150
(mg/dl) 100
50 b a b a Body fat (%)/liver weight(g)/ plasmaTGs a a
0 Body fat (%) Liver weight (g) Blood plasma TGA (mg/dl)
Figure 5. 3. Body fat (%), liver weight (g), and plasma TGs (triglycerides; mg/dl) of rats fed with different diets.
Means; vertical bars represent standard deviations; values within body fat, liver weight, and plasma TGs followed by the same letter are not significantly different, P > 0.05.
92
90 Control diet
High amylose corn starch diet
80 Lentil diet
70
60 50
40
30
20 10
of knowntotal sequences Percentage 0 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6
Actinobacteria Proteobacteria Bacteroidetes Firmicutes Week
Figure 5. 4. Most abundant bacterial phyla (percentage of total) in rat feces. Weekly average samples (n=36).
Abundance were calculated after eliminating unassigned species.
93
6 weeks, Bacteriodetes abundance were 34%, 37%, and 30% respectively. Fecal
Actinobactria abundance (1.1-1.2%) did not show significant differences among rats fed with lentil, RS, and control diets at initial week. Actinobacteria abundance were increased after 6 week as 5%, 4%, and 2% in rats fed with lentil, RS, and control respectively (Figure 5.4). Similarly, abundance of fecal Proteobacteria (3-
4%) did not significantly different among rats fed with different diets at initial week. Six weeks of feeding lentil, RS, and control diets changed fecal
Proteobacteria abundance as 3%, 5%, and 4% respectively.
In phylum Firmicutes, 8 prominent species including Lachnospiraceae sp. and Peptostreptococcus stomatis were found (Figure 5.5). At the initial week, the abundance of Lachnospiraceae sp. was 12.8, 16.9, and 15.4% in rats fed with lentil, RS, and control diets respectively at initial week. After 6 weeks, the abundance was significantly lower in rats fed with lentil (8.7%) than RS (11.7%), and control (14.6%) diets. Peptostreptococcus stomatis abundance were ranged from 3.7 to 4.3% at initial week. After 6 weeks, the abundance was reduced in rats fed with lentil (2.9%) compare to RS (3.2%) and control (6.3%). Addition, lentil diet significantly reduce abundance of Streptococcaceae sp., and
Peptostreptococcus stomatis and increase Lachinospiraceae sp. and
Shutterworthia satelles, but abundance are less prominent (data not shown).
Two prominent bacterial species were found in phylam Bacteroidetes;
Bacteroides heparinolyticus sp. and Tannerella sp. (Figure 5.5). At initial week, abundance of Bacteroides heparinolyticus sp. in rats fed with lentil, RS, and
94 control were 33.8, 27.6, and 29.5% respectively. Six weeks of feeding lentil and control reduced the abundance of Bacteroides heparinolyticus sp. to 27.8% and
19.4% respectively. RS diet increase the abundance to 28.1%. The abundance
of Tannerella sp. were 5.9, 6.0, and 7.2% in rats fed with lentil, RS, and control
diets respectively at initial week. After 6 weeks, the abundance were 6.5, 9.4,
and 10.5% respectively.
In phylum Actinobacteria, two prominent bacterial species; Bifidobacterium
sp. and Eggerthella lenta were found (Figure 5.5). Bifidobacterium sp.
abundance were 1.1-1.2% at initial week and did not show any significant
differences among rats fed with lentil, RS, and control diets. After 6 week, the
Bifidobacterium sp. abundance increased in rats fed with lentil (5.3%) and RS
(4.0%) than rats fed with control (1.5%). Eggerthella lenta abundance ranged
from 1.5-3.5% at initial week. After 6 weeks, the abundance was lower in rats fed
with lentil (4.7%) and RS (5.7%) than rats fed with control (14.2%).
In phylum Proteobacteria, Lautropia mirabilis was the prominent species.
At initial week, no significance differences of Lautropia mirabilis abundance
(0.02-0.05%) were found among rats fed with lentil, RS, and control. After 6
week, Lautropia mirabilis abundance was lower in rats fed with lentil (2.84%)
than RS (5.02%) and control (3.58%).
95
Figure 5. 5. Dominant species in rat fecal samples at initial week (0 week) and
6th week. Inner circle represents phyla (Actinobacteria, Proteobacteria,
Bacteroidetes, and Firmicutes). Outer circle represents dominant species of corresponding phyla: (A) control diet group at 0 week, (B) control diet group after
6 weeks, (C) corn starch diet group at 0 week, (D) corn starch diet group after 6 weeks, (E) lentil diet group at 0 week, and (F) lentil diet group after 6 weeks.
96
5.5. Discussion
Obesity is an emerging problem in most developed as well as developing countries. Obese people may have increased risk of hypertension, type 2 diabetes mellitus, heart diseases, and several cancers. Obesity also associated with increased medical cost (Finkelstein et al., 2012). Therefore, several approaches have been carried out to reduce obesity risk including increasing consumption of fruits, vegetable, and legumes such as lentil. However, there are lack of evidences to illustrate the true potential of lentil to reduce obesity risk.
This study was carried to determine the effects on lentil based diet on rat body weight, percent body fat, plasma TG concentration, and fecal microbiome to evaluate the potential of lentil to reduce obesity risk in rats.
Consumption of legumes increase satiety, therefore reduce food intake
(Marinangeli & Jones, 2012). Present study, we did not observe significant reduction in feed intake of rats fed with lentil diet compare to control and high amylose corn starch diets. Several studies report similar results where increasing lentil supplementation did not change the feed intake and did not improve satiety responses (Erickson & Slavin, 2016; Landero, Beltranena, & Zijlstra, 2012).
Satiety responses significantly improved by anti-nutrient factors such as trypsin inhibitors and phytic acid, addition to legume fibers (Marinangeli & Jones, 2012).
Lentil is low in trypsin inhibitors and phytic acid (Guillamón et al., 2008; P.
Thavarajah, Thavarajah, & Vandenberg, 2009), which may explains the low responsiveness of lentil on feed intake. However, a study with several legumes
97 including pea (Pisum sativum L.), common bean (Phaseolus vulgaris L.), chick pea (Cicer arietinum L), and lentil revealed that lentil significantly reduce feed intake in rats (Queiroz-Monici et al., 2005). These controversial results may be due to differences in the animal model used in the experiments, lentil variety, type of lentil processing (whole vs dehulled vs split), and amount of lentil in the experimental diet.
Generally, legumes increase the fullness after a meal, therefore recommended to reduce body weight (Hermsdorff, Zulet, Abete, & Martínez,
2011). Increased bean and pea consumption associated with lower body weight
(Lambert et al., 2017; Papanikolaou & Fulgoni, 2008). Body weight of rats fed with lentil is significantly lower than rats fed with control and high amylose corn diets in current study. Similarly, inclusion of lentil (300 g/kg) in a starter diet for 3
weeks reduce pig body weight (Landero et al., 2012). Also, this study further
explains that 75-225 g/kg lentil supplementation did not show significant weight reduction in pigs revealing the dose dependency of lentil on body weight reduction (Landero et al., 2012). High amylose corn starch diet (RS content; 6
g/100 g) did not reduce rat body weight compare to control diet. Similar results
were found in a study with 0.8-9.6 g of RS fed to male rats which had no effects
of RS on body weight (Deckere, Kloots, & Van Amelsvoort, 1993). These results
highlighting that even though feed intake is same among rats, the body weight is
reduced in lentil fed rats may due to lentil’s nutrition profile.
98
Lentil is a rich source of proteins (24-30%; dry weight basis) (Wang &
Daun, 2006) including several bio active proteins such as lectins (10-100 mg/100 g dry weight; Peumans & Van Damme, 1996). At initial stages, these proteins considered as anti-nutrients (Peumans and Damme, 1996). However, recent scientific data demonstrate that these proteins have potential to reduce several cancers and reduce obesity risk (Mukherjee, Kim, Park, Choi, & Yun, 2015;
Pryme, Bardocz, Pusztai, & Ewen, 2006). Purified lentil proteins reduce plasma
TG concentration and very low density lipoprotein (VLDL). Also, lentil proteins reduce adipose lipoprotein lipase (LPL) activity which leads to hypotriglyceridemia; hence prevent access fat accumulation in adipose tissue
(Boualga et al., 2009). A study using 15 week old hypertensive rats fed with 30% bean, pea, lentil, and chickpea revealed that lentil associated with large artery remodeling and reduce the risk of high blood pressure (Hanson, Zahradka, &
Taylor, 2014). Also, the lentil flour and lentil proteins bind bile salts such as cholate, taurocholate, glycocholate, and chenodeoxycholate (Barbana, Boucher,
& Boye, 2011). Bile salts are biosynthesized from cholesterol in the liver and reabsorbed by the ileum. Therefore, binding bile salts in the ileum leads to more degradation of cholesterol in liver; hence lower cholesterol level in blood
(Barbana et al., 2011). Addition to lentil proteins, lentil prebiotic carbohydrates may have potential to reduce body fat (Siva et al., 2017).
Lentil is a rich source of prebiotic carbohydrates (Johnson et al., 2015,
2013). Prebiotic carbohydrates reduce body fat% by decreasing the
99 lipopolysaccharide uptake, increase fat oxidation, and decreasing adiposity
(Keenan et al., 2006; Shen et al., 2009; So et al., 2007). Present study, percent body fat, plasma TG concentration is lower in rats fed with lentil than rats fed with high amylose corn and control diets highlights that lentil prebiotic carbohydrates may reduce body fat.
Research have been found that RS decrease total cholesterol, and TG concentration in rats (Deckere et al., 1993). In present study, body fat% and plasma TG concentration are higher in rats fed with high amylose corn diet which had the highest RS content among used diets (Table 5.1). Further, we observed higher hepatic fat portions in the proximal liver tissues of rats fed with high amylose corn diet than lentil and control (Figure 5.6). This indicates that addition to RS, other prebiotics (SA, RFO, and FOS) in lentil (Johnson et al., 2013) may play vital roles in modifying fat metabolism via gut microbiome (Roberfroid,
2000).
Prebiotic carbohydrates change gut microbiome and improve host’s health status (Roberfroid, 2000). Present study, two dominant bacterial phyla were observed in rat fecal samples (Firmicutes and Bacteriodetes) which is similar to previous studies (Ley et al., 2005). Research have been found that the ratio of
Bacteriodetes and Firmicutes is related to obesity status of rats and human models, but the results were controversial (Ley, 2010). Some research found that increased Bacteriodetes and Firmicutes ratio in lean subjects (Ley et al., 2005;
Turnbaugh et al., 2006), some others found decreased ratio in lean subjects
100
A B C
Figure 5. 6. Light microscopic images of proximal tissues of rat liver after 6 weeks of feeding lentil (6A), corn (6B), and control (6C) diets. Scale bar for all images equal to 100 µm.
101
(Collado et al., 2008; Schwiertz et al., 2010) whereas some other research revealed that no association between Bacteriodetes and Firmicutes ratio and obesity (Finucane et al., 2014). Considering the present study, the ratio of
Bacteriodetes and Firmicutes did not associated with body weight, percent body fat, and plasma TG concentration. Addition, we found that lentil diet increase abundance of Actinobacteria in rats where lowest body weight and percent body fat, and plasma TG concentration found. This is contrast to previous finding that phylum Actinobacteria abundance is high in obese compare to lean (Turnbaugh et al., 2009). It is clear that there are much more complex relationship between gut microbiome and obesity. Therefore, rather looking the connection between obesity and gut microbiota at phylum level, the species level elaboration is more useful.
Few research have been focused to evaluate the relationship of individual bacterial species on obesity risk. Four weeks of feeding pea increased cecal
Bifidobacterium sp. in rats (Queiroz-Monici et al., 2005). High fat diet reduced
Bifidobacterium sp., a gram positive bacteria which related to low grade inflammatory tone (Cani et al., 2007). Bifidobacterium sp. negatively correlated with endotoxaemia and positively correlated with improved glucose tolerant and inflammatory tone (Cani et al., 2007). Present study, increased abundance of
Bifidobacterium sp. in lentil fed rats may related to lower body fat%, and plasma
TG concentration.
102
Present study, abundance of potential pathogenic bacterial species were
reduced in rats fed with lentil diet compare to control and high amylose corn
diets. Eggerthella lenta is a gram positive bacteria, causes abdominal pain and
severe ulcers (Gardiner et al., 2015). Lautropia mirabilis is gram negative
bacteria which is found in children who effected with HIV (Rossmann et al.,
1998). Tanneralla sp. and Bacteroides heparinolyticus are normally found at
periodontal disease stage in oral cavity (Okuda, Kato, Shiozu, Takazoe, &
Nakamura, 1985; Tanner & Izard, 2006). Lentil diet reduce abundance of above
bacterial species (except Bacteroides heparinolyticus) revealing that lentil
eliminate potential pathogenic bacteria which is related increased immune
responses associated with obesity status (Creely et al., 2007; Marti, Marcos, &
Martinez, 2001; Osborn & Olefsky, 2012).
Few studies observed reduction in Firmicute species after feeding
legumes. Six weeks of feeding yellow pea fiber reduced Clostridium leptum in
rats (Eslinger et al., 2014). In present study, lentil diet significantly lower the
abundance of Lachnospiraceae sp., Streptococcaceae sp., and
Peptostreptococcus stomatis. However, lentil increase abundance of few less
prominent Firmicutes revealing that all Firmicutes may be not responsible for increase body fat accumulation. However, individual mechanism of these species on body fat reduction still need to be revealed (DiBaise et al., 2008).
103
5.6. Conclusion
Reducing obesity risk via changing dietary pattern is an emerging approach. Legumes including lentil gained central attention due to its’ nutritional profile which includes bio active proteins and prebiotic carbohydrates. Six week of feeding lentil diet significantly reduced rat body weight than control and corn diets. Also, lentil diet significantly reduced percent body fat and plasma TG concentration than corn starch diet. Lentil diet reduced abundance of fecal
Firmicute species. Thus, Lentil is a potential food source to reduce obesity risk.
However, specific compounds in lentil and the related changes in fecal microbiome and fat metabolism is to be discovered. Further research are required to understand the fat lowering effect of lentil.
5.7. References
Barbana, C., Boucher, A. C., & Boye, J. I. (2011). In vitro binding of bile salts by
lentil flours, lentil protein concentrates and lentil protein hydrolysates.
Food Research International, 44(1), 174–180.
Bischoff, S. C., Boirie, Y., Cederholm, T., Chourdakis, M., Cuerda, C., Delzenne,
N. M., Deutz, N. E., Forque, D., Genton, L., Gil, C., Koletzko, B., Leon-Sanz,
M., Shamir, R., Singer, J., Singer, P., Stroebele-Benschop, N., Thorell, A.,
Weimann, A., & Barazzoni, R. (2016). Towards a multidisciplinary approach
to understand and manage obesity and related diseases. Clinical Nutrition,
36, 917–938.
104
Boualga, A., Prost, J., Taleb-Senouci, D., Krouf, D., Kharoubi, O., Lamri-
Senhadji, M., Belleville, J., & Bouchenak, M. (2009). Purified chickpea or
lentil proteins impair VLDL metabolism and lipoprotein lipase activity in
epididymal fat, but not in muscle, compared to casein, in growing rats.
European Journal of Nutrition, 48(3), 162–169.
Cani, P. D., Lecourt, E., Dewulf, E. M., Sohet, F. M., Pachikian, B. D., Naslain, D.,
De Backer, F., Neyrinck, A. M., & Delzenne, N. M. (2009). Gut microbiota
fermentation of prebiotics increases satietogenic and incretin gut peptide
production with consequences for appetite sensation and glucose response
after a meal. American Journal of Clinical Nutrition, 90(5), 1236–1243.
Cani, P. D., Neyrinck, A. M., Fava, F., Knauf, C., Burcelin, R. G., Tuohy, K. M.,
Gibson, G. R., & Delzenne, N. M. (2007). Selective increases of
bifidobacteria in gut microflora improve high-fat-diet-induced diabetes in
mice through a mechanism associated with endotoxaemia. Diabetologia,
50(11), 2374–2383.
Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D.,
Costello, E. K., Fierer, N., Pena, A. G., Goodrich, J. K., Gordon, J. I.,
Huttley, G. A., Kelley, S. T., Knights, D., Koenig, J. E., Ley, R. E.,
Lozupone, C. A., McDonald, D., Muegge, B. D., Pirrung, M., Reeder, J.,
Sevinsky, J. R., Turnbaugh, P. T., Walters, W. A., Widmann, J.,
Yatsunenko, T., Zaneveld, J., & Knight, R. (2010). QIIME allows analysis
105
of high-throughput community sequencing data. Nature Methods, 7(5),
335–336.
Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Lozupone, C. A.,
Turnbaugh, P. J., Fierer, N., & Knight, R. (2011). Global patterns of 16S
rRNA diversity at a depth of millions of sequences per sample. Proceedings
of the National Academy of Sciences of the United States of America,
108(1), 4516–4522.
Cawley, J., & Meyerhoefer, C. (2012). The medical care costs of obesity: An
instrumental variables approach. Journal of Health Economics, 31(1),
219–230.
CDC. (2016). Behavioral Risk Factor Surveillance System (BRFSS) Prevalence
Data (2011 to present) | Open Data | Centers for Disease Control and
Prevention. Retrieved April 14, 2017, from
https://chronicdata.cdc.gov/Behavioral-Risk-Factors/Behavioral-Risk-
Factor-Surveillance-System-BRFSS-P/dttw-5yxu
Collado, M. C., Isolauri, E., Laitinen, K., & Salminen, S. (2008). Distinct
composition of gut microbiota during pregnancy in overweight and normal-
weight women. The American Journal of Clinical Nutrition, 88(4), 894–9.
Creely, S. J., McTernan, P. G., Kusminski, C. M., Fisher, F. M., Da Silva, N. F.,
Khanolkar, M., Evans, M., Harte, A. L., & Kumar, S. (2007).
Lipopolysaccharide activates an innate immune system response in
106
human adipose tissue in obesity and type 2 diabetes. American Journal of
Physiology - Endocrinology and Metabolism, 292(3), E740-E747.
Cummings, J., Pomare, E., Branch, W., & Naylor, C. (1987). Short chain fatty acids
in human large intestine, portal, hepatic and venous blood. Gut. 28(10),
1221–1227.
Deckere, D., Kloots, E. A., & Van Amelsvoort, W. J. (1993). Resistant starch
decreases serum total cholesterol and triacylglycerol concentrations in
rats. The Journal of Nutrition Dec, 123(12). 2142–2151.
DiBaise, J. K., Zhang, H., Crowell, M. D., Krajmalnik-Brown, R., Decker, G. A., &
Rittmann, B. E. (2008). Gut Microbiota and Its Possible Relationship With
Obesity. Mayo Clinic Proceedings, 83(4), 460–469.
Erickson, J., & Slavin, J. (2016). Satiety Effects of Lentils in a Calorie Matched
Fruit Smoothie. Journal of Food Science, 81(11), H2866–H2871.
Eslinger, A. J., Eller, L. K., & Reimer, R. A. (2014). Yellow pea fiber improves
glycemia and reduces Clostridium leptum in diet-induced obese rats.
Nutrition Research, 34(8), 714–722.
Everard, A., Lazarevic, V., Derrien, M., Girard, M., Muccioli, G. G., Neyrinck, A. M.,
Possemiers, S., Holle, A. V., Francois, P., De Vos, W. M., Delzenne, N. M.,
Schrenzel, J., & Cani, P. D. (2011). Responses of gut microbiota and
glucose and lipid metabolism to prebiotics in genetic obese and diet-
induced leptin-resistant mice. Diabetes, 60(11), 2775–2786.
107
Finkelstein, E. A., Khavjou, O. A., Thompson, H., Trogdon, J. G., Pan, L., Sherry,
B., & Dietz, W. (2012). Obesity and Severe Obesity Forecasts through
2030. American Journal of Preventive Medicine, 42(6), 563–570.
Finucane, M. M., Sharpton, T. J., Laurent, T. J., Pollard, K. S., & Zafar, N. (2014).
A Taxonomic Signature of Obesity in the Microbiome? Getting to the Guts
of the Matter. PLoS ONE, 9(1), e84689.
Fung, T. T., Rimm, E. B., Spiegelman, D., Rifai, N., Tofler, G. H., Willett, W. C., &
Hu, F. B. (2001). Association between dietary patterns and plasma
biomarkers of obesity and cardiovascular disease risk. The American
Journal of Clinical Nutrition, 73(1), 61–67.
Gao, Z., Yin, J., Zhang, J., Ward, R., & Martin, R. (2009). Butyrate improves insulin
sensitivity and increases energy expenditure in mice. Diabetes. 58(7),
1509–1517.
Gardiner, B. J., Tai, A. Y., Kotsanas, D., Francis, M. J., Roberts, S. A., Ballard, S.
A., Junckerstorff, R. K., & Korman, T. M. (2015). Clinical and microbiological
characteristics of Eggerthella lenta bacteremia. Journal of Clinical
Microbiology, 53(2), 626–635.
Guillamón, E., Pedrosa, M. M., Burbano, C., Cuadrado, C., Sánchez, M. de C., &
Muzquiz, M. (2008). The trypsin inhibitors present in seed of different grain
legume species and cultivar. Food Chemistry, 107(1), 68–74.
108
Hanson, M. G., Zahradka, P., & Taylor, C. G. (2014). Lentil-based diets attenuate
hypertension and large-artery remodelling in spontaneously hypertensive
rats. British Journal of Nutrition, 111(4), 690–698.
Hermsdorff, H. H. M., Zulet, M. Á., Abete, I., & Martínez, J. A. (2011). A legume-
based hypocaloric diet reduces proinflammatory status and improves
metabolic features in overweight/obese subjects. European Journal of
Nutrition, 50(1), 61–69.
Johnson, C. R., Thavarajah, D., Combs, G. F., & Thavarajah, P. (2013). Lentil
(Lens culinaris L.): A prebiotic-rich whole food legume. Food Research
International, 51(1), 107–113.
Johnson, C. R., Thavarajah, D., Thavarajah, P., Fenlason, A., McGee, R.,
Kumar, S., & Combs, G. F. (2015). A global survey of low-molecular
weight carbohydrates in lentils. Journal of Food Composition and Analysis,
44, 178–185.
Keenan, M. J., Zhou, J., McCutcheon, K. L., Raggio, A. M., Bateman, H. G., Todd,
E., Jones, C. K., Tulley, R. T., Melton, S., Martin, R. J., & Hegsted, M.
(2006). Effects of Resistant Starch, A Non-digestible Fermentable Fiber, on
Reducing Body Fat. Obesity, 14(9), 1523–1534.
Kozich, J. J., Westcott, S. L., Baxter, N. T., Highlander, S. K., & Schloss, P. D.
(2013). Development of a dual-index sequencing strategy and curation
pipeline for analyzing amplicon sequence data on the MiSeq Illumina
109
sequencing platform. Applied and Environmental Microbiology, 79(17),
5112–20.
Lambert, J. E., Parnell, J. A., Tunnicliffe, J. M., Han, J., Sturzenegger, T., &
Reimer, R. A. (2017). Consuming yellow pea fiber reduces voluntary
energy intake and body fat in overweight/obese adults in a 12-week
randomized controlled trial. Clinical Nutrition, 36(1), 126–133.
Landero, J. L., Beltranena, E., & Zijlstra, R. T. (2012). The effect of feeding lentil
on growth performance and diet nutrient digestibility in starter pigs. Animal
Feed Science and Technology, 174(1), 108–112.
Ley, R. E. (2010). Obesity and the human microbiome. Current Opinion in
Gastroenterology, 26(1), 5–11.
Ley, R. E., Bäckhed, F., Turnbaugh, P., Lozupone, C. A., Knight, R. D., &
Gordon, J. I. (2005). Obesity alters gut microbial ecology. Proceedings of
the National Academy of Sciences of the United States of America,
102(31), 11070–5.
Ley, R. E., Turnbaugh, P. J., Klein, S., & Gordon, J. I. (2006). Microbial ecology:
Human gut microbes associated with obesity. Nature, 444(7122), 1022–
1023.
Lin, H., Frassetto, A., Jr, E. K., & Nawrocki, A. (2012). Butyrate and propionate
protect against diet-induced obesity and regulate gut hormones via free fatty
acid receptor 3-independent mechanisms. PloS One. 7(4), e35240.
110
Malik, V. S., Willett, W. C., & Hu, F. B. (2012). Global obesity: trends, risk factors
and policy implications. Nature Reviews Endocrinology. 9(1), 13–27.
Marinangeli, C., & Jones, P. (2012). Pulse grain consumption and obesity: effects
on energy expenditure, substrate oxidation, body composition, fat
deposition and satiety. British Journal of Nutrition. 108(S1), S46–S51.
Marti, A., Marcos, A., & Martinez, J. A. (2001). Obesity and immune function
relationships. Obesity Reviews, 2(2), 131–140.
Mukherjee, R., Kim, S. W., Park, T., Choi, M. S., & Yun, J. W. (2015). Targeted
inhibition of galectin 1 by thiodigalactoside dramatically reduces body
weight gain in diet-induced obese rats. International Journal of Obesity,
39(9), 1349–1358.
Ogden, C. L., Carroll, M. D., Lawman, H. G., Fryar, C. D., Kruszon-Moran, D.,
Kit, B. K., & Flegal, K. M. (2016). Trends in Obesity Prevalence Among
Children and Adolescents in the United States, 1988-1994 Through 2013-
2014. JAMA, 315(21), 2292–2299.
Okuda, K., Kato, T., Shiozu, J., Takazoe, I., & Nakamura, T. (1985). Bacteroides
heparinolyticus sp. nov. Isolated from Humans with Periodontitis.
International Journal of Systematic Bacteriology, 35(4), 438–442.
Osborn, O., & Olefsky, J. (2012). The cellular and signaling networks linking the
immune system and metabolism in disease. Nature Medicine. 18(3), 363–
374.
111
Papanikolaou, Y., & Fulgoni, V. L. (2008). Bean Consumption Is Associated with
Greater Nutrient Intake, Reduced Systolic Blood Pressure, Lower Body
Weight, and a Smaller Waist Circumference in Adults: Results from the
National Health and Nutrition Examination Survey 1999-2002. Journal of
the American College of Nutrition, 27(5), 569–576.
Parnell, J. A., & Reimer, R. A. (2009). Weight loss during oligofructose
supplementation is associated with decreased ghrelin and increased
peptide YY in overweight and obese adults. American Journal of Clinical
Nutrition, 89(6), 1751–1759.
Peumans, W. J., & Van Damme, E. J. M. (1996). Prevalence, biological activity
and genetic manipulation of lectins in foods. Trends in Food Science &
Technology, 7(4), 132–138.
Popkin, B. M., Adair, L. S., & Ng, S. W. (2012). Global nutrition transition and the
pandemic of obesity in developing countries. Nutrition Reviews, 70(1), 3–
21.
Pryme, I. ., Bardocz, S., Pusztai, A., & Ewen, S. W. (2006). Suppression of
growth of tumour cell lines in vitro and tumours in vivo by mistletoe lectins.
Histology and Histopathology. 21, 285–299.
Queiroz-Monici, K. da S., Costa, G. E. A., da Silva, N., Reis, S. M. P. M., & de
Oliveira, A. C. (2005). Bifidogenic effect of dietary fiber and resistant
starch from leguminous on the intestinal microbiota of rats. Nutrition,
21(5), 602–608.
112
Roberfroid, M. (2007). Prebiotics: the concept revisited. The Journal of Nutrition,
137(2), 830S–7S.
Roberfroid, M. B. (2000). Prebiotics and probiotics: are they functional foods?
The American Journal of Clinical Nutrition, 71(6), 1682S–7S.
Rossmann, S. N., Wilson, P. H., Hicks, J., Carter, B., Cron, S. G., Simon, C., Flaitz,
C. M., Demmler, G. J., Shearer, W. T., & Kline, M. W. (1998). Isolation of
Lautropia mirabilis from oral cavities of human immunodeficiency virus-
infected children. Journal of Clinical Microbiology, 36(6), 1756–1760.
Samuel, B. S., Shaito, A., Motoike, T., Rey, F. E., Backhed, F., Manchester, J. K.,
Hammer, R. E., Williams, S. C., Crowley, J., Yanagisawa, M., & Gordon, J.
I. (2008). Effects of the gut microbiota on host adiposity are modulated by
the short-chain fatty-acid binding G protein-coupled receptor, Gpr41.
Proceedings of the National Academy of Sciences of the United States of
America, 105(43), 16767–16772.
Schwiertz, A., Taras, D., Schäfer, K., Beijer, S., Bos, N. A., Donus, C., & Hardt,
P. D. (2010). Microbiota and SCFA in Lean and Overweight Healthy
Subjects. Obesity, 18(1), 190–195.
Sen Gupta, D., Thavarajah, D., Knutson, P., Thavarajah, P., McGee, R. J.,
Coyne, C. J., & Kumar, S. (2013). Lentils (Lens culinaris L.), a Rich
Source of Folates. Journal of Agricultural and Food Chemistry, 61(32),
7794–7799.
113
Shen, L., Keenan, M. J., Martin, R. J., Tulley, R. T., Raggio, A. M., McCutcheon,
K. L., & Zhou, J. (2009). Dietary Resistant Starch Increases Hypothalamic
POMC Expression in Rats. Obesity, 17(1), 40–45.
Siva, N., Thavarajah, D., Johnson, C. R., Duckett, S., Jesch, E. D., & Thavarajah,
P. (2017). Can lentil (Lens culinaris Medikus) reduce the risk of obesity?
Journal of Functional Foods (in press).
So, P. W., Yu, W. S., Kuo, Y. T., Wasserfall, C., Goldstone, A. P., Bell, J. D., &
Frost, G. (2007). Impact of Resistant Starch on Body Fat Patterning and
Central Appetite Regulation. PLoS ONE, 2(12), e1309.
Tanner, A. C. R., & Izard, J. (2006). Tannerella forsythia, a periodontal pathogen
entering the genomic era. Periodontology 2000, 42(1), 88–113.
Thavarajah, D., Thavarajah, P., Wejesuriya, A., Rutzke, M., Glahn, R. P., Combs,
G. F., & Vandenberg, A. (2011). The potential of lentil (Lens culinaris L.)
as a whole food for increased selenium, iron, and zinc intake: preliminary
results from a 3 year study. Euphytica, 180(1), 123–128.
Thavarajah, P., Thavarajah, D., & Vandenberg, A. (2009). Low phytic acid lentils
(Lens culinaris L.): a potential solution for increased micronutrient
bioavailability. Journal of agricultural and food chemistry. 57(19), 9044–
9049.
The State of Obesity. (2016). Adult Obesity in the United States. Retrieved April
14, 2017, from http://stateofobesity.org/adult-obesity/
114
Turnbaugh, P. J., Hamady, M., Yatsunenko, T., Cantarel, B. L., Duncan, A., Ley,
R. E., Sogin, M. L., Jones, W. J., Roe, B. A., Affourtit, J. P., & Egholm, M.,
Henrissat, B., Heath, A. C., Knight, R., & Gordon, J. I. (2009). A core gut
microbiome in obese and lean twins. Nature, 457(7228), 480–484.
Turnbaugh, P. J., Ley, R. E., Mahowald, M. A., Magrini, V., Mardis, E. R., &
Gordon, J. I. (2006). An obesity-associated gut microbiome with increased
capacity for energy harvest. Nature, 444(7122), 1027–131.
Wang, N., & Daun, J. K. (2006). Effects of variety and crude protein content on
nutrients and anti-nutrients in lentils (Lens culinaris). Food Chemistry,
95(3), 493–502.
Wardle, J. (2007). Eating behaviour and obesity. Obesity Reviews, 8(s1), 73–75.
WHO. (1997). Obesity: preventing and managing the global epidemic. Report of
a WHO Consultation presented at: the World Health Organization; June3-
5, 1997; Geneva, Switzerland: WHO.
Wu, G. D., Chen, J., Hoffmann, C., Bittinger, K., Chen, Y. Y., Keilbaugh, S. A.,
Bewtra, M., Knights, D., Walters, W. A., Knight, R., Sinha, R., Gilroy, E.,
Gupta, K., Baldassano, R., Nessel, L., Li, H., Bushman, F. D., & Lewis, J.
D. (2011). Linking long-term dietary patterns with gut microbial enterotypes.
Science, 334(6052), 105–108.
115
6. GENERAL DISCUSSION
Health and economic impact of obesity highlights the need of novel
obesity preventive actions. Such preventive actions focus on reducing energy
accumulation in the body. Increasing physical activities and consumption of low
energy foods such as vegetable, fruits, and legumes are widely used methods to
reduce obesity risk. Lentil is such a legume which has low energy due to low digestible carbohydrates (prebiotic carbohydrates) including SA, RFO, FOS, and
RS (Johnson et al., 2013; Johnson et al., 2015). Therefore, the knowledge about
the impact of processing and cooking on the prebiotic carbohydrates
concentration and the impact of lentil prebiotic carbohydrates on body weight and
body fat may useful to produce novel foods to reduce obesity risk.
Processing change prebiotic carbohydrate concentrations. The first study
showed that removal of seed coat reduces SA, raffinose and stachyose
concentration highlighting seed coat contains high amount of SA, raffinose, and
stachyose. The reverse is true for verbascose. Similarly, cooking decrease SA,
and RFO+FOS and cooling increase those compounds. Cooling and reheating
doubled the RS concentration. Overall, a serving of 100 g of cooked lentil has
353-813 mg of SA, 4-6 g of RFO and FOS, and 2-3 g of RS, providing 71-94% of
prebiotic carbohydrate recommended daily intake. Therefore, lentil is a potential
food source to increase intake of prebiotic carbohydrates.
The potential of legumes and associated prebiotic carbohydrates on
reduction of obesity risk have not been extensively studied. However, prebiotic
116 carbohydrates such as fructooligosachcharides, inulin, and RS have studied for their role in reduction of obesity risk. Prebiotic carbohydrates increase satiety, promote weight loss, lower body fat, and lower postprandial glucose level via interacting gut microbiome. The second study revealed that lentil reduce risk factors of obesity including body weight, percent body fat, blood plasma TG concentration, and reduce pathogenic gut bacteria. Lentil diet reduce 20-45% of body fat than control and corn diets. Addition, lentil diet reduce 22-55% of blood plasma TG concentration than control and corn diets. The exact mechanism of lentil on fat lowering effect is unknown. However, the bioactive proteins and prebiotic carbohydrates in lentil may be the reason for lower body fat in rats.
Prebiotic carbohydrates prevent excess body fat accumulation by three ways; reduce appetite, reduce gut permeability to lipopolysaccharides (LPS), and reduce fat deposition in adipose tissues (Figure 6.1). Fermentation of prebiotic carbohydrates produce short chain fatty acids (SCFA). It includes acetate (60%), propionate (20-25%), and butyrate (15-20%) (Cummings et al., 1987). These
SCFA stimulate the enteroendocrine cells via G-protein-coupled receptor (GPR) called GPR43. Enteroendocrine cells produce a gut peptide called PYY which can slow down the movement of food through digestive tract (Keenan et al.,
2006; Parnell & Reimer, 2009). Also, prebiotic fibers reduce the secretion of hunger hormone “ghrelin” by reducing the expression of ghrelin mRNA in gut
(Parnell & Reimer, 2009). Increased concentration of gut peptide PYY and reduced level of ghrelin increase satiety; hence reduce food intake.
117
Short chain fatty acids increase expression of tight junction mRNA expression in enteroendocrine L cells which produce glucagon like peptides called GLP-1 and GLP-2. Ultimately these peptides reduce the permeability of gut membrane via changing the distribution of tight junction proteins zonula occludens 1 (ZO-1) and occludin. Thus, reduces permeability of gut epithelial cells leads to low absorption of LPS (Cani et al., 2009; Everard et al., 2011).
Another mechanism of reduce membrane permeability is involved by endocannabinoid system (eCB). eCB system is a group of endogenous receptors located in mammalian nerve system which control appetite, digestion, and energy balance (Aizpurua-Olaizola et al., 2017). A receptor called CB1 in eCB system reduce gut permeability via changing the distribution of ZO-1 and occludin. Therefore, it reduce LPS absorption leads to low blood LPS concentration (Muccioli et al., 2010).
118
Figure 6.1. Mechanisms of prebiotic carbohydrates on host pathophysiology related to obesity. Changes in the gut microbiome and SCFA in the gut change the expression of genes related to food intake, gut motility, and adipogenesis.
119
Another distinguished mechanism of prebiotic carbohydrates is reduce fat deposition by modifying gene expression in adipose tissues. Dewulf et al., 2010 found that prebiotic carbohydrates led to form small adipose tissues compare to high fat diet.
Adipogenesis is controlled by GPR43 expression, adipocyte specific genes including adipocyte P2 gene (aP2) and stimulating factors peroxisome proliferator activated receptor gamma (PPARγ) and CCAAT-enhancer-binding protein α (C/EBPα)(Dewulf et al., 2010). It was found that prebiotic carbohydrates reduce the expression of GPR43 in adipose tissues (Dewulf et al., 2010). Further, prebiotic carbohydrates reduce aP2 and
C/EBPα mRNAs level. Also, the expression of cluster differentiation 36 (CD36) and lipoprotein lipase (LPL) mRNA levels controlled by PPARγ were significantly reduced
(Dewulf et al., 2010). Thus, the fat deposition in adipose tissues are reduced. However, these research are still in early stages, hence more systematic experiments with large number of replicates are needed to confirm the true prebiotic effects on host.
6.1. References
Aizpurua-Olaizola, O., Elezgarai, I., Rico-Barrio, I., Zarandona, I., Etxebarria, N., &
Usobiaga, A. (2017). Targeting the endocannabinoid system: future therapeutic
strategies. Drug Discovery Today, 22(1), 105–110.
Cani, P. D., Possemiers, S., Van de Wiele, T., Guiot, Y., Everard, A., Rottier, O.,
Geurts, L., Naslain, D., Neyrinck, A., Lambert, D. M., Muccioli, G. G., & Delzenne,
N. M. (2009). Changes in gut microbiota control inflammation in obese mice
through a mechanism involving GLP-2-driven improvement of gut permeability.
Gut, 58(8), 1091-1103.
120
Cummings, J., Pomare, E. W., Branch, W. J., Naylor, C. P., & Macfarlane, G. T. (1987).
Short chain fatty acids in human large intestine, portal, hepatic and venous blood.
Gut, 28(10), 1221–1227.
Dewulf, E. M., Cani, P. D., Neyrinck, A. M., Possemiers, S., Van Holle, A., Muccioli, G.
G., Deldicque, L., Bindels, L. B., Pachikian, B. D., Sohet, F. M., & Mignolet, E.
(2011). Inulin-type fructans with prebiotic properties counteract GPR43
overexpression and PPARγ-related adipogenesis in the white adipose tissue of
high-fat diet-fed mice. The Journal of nutritional biochemistry, 22(8), 712–722.
Everard, A., Lazarevic, V., Derrien, M., Girard, M., Muccioli, G. G., Muccioli, G. M.,
Neyrinck, A. M., Possemiers, S., Holle, A. V., François, P., de Vos, W. M.,
Delzenne, N. M., Schrenzel, J., & Cani, P. D. (2011). Responses of gut
microbiota and glucose and lipid metabolism to prebiotics in genetic obese and
diet-induced leptin-resistant mice. Diabetes, 60(11), 2775–86.
Johnson, C. R., Thavarajah, D., Combs, G. F., & Thavarajah, P. (2013). Lentil (Lens
culinaris L.): A prebiotic-rich whole food legume. Food Research International,
51(1), 107–113.
Johnson, C. R., Thavarajah, D., Thavarajah, P., Payne, S., Moore, J., & Ohm, J. B.
(2015). Processing, cooking, and cooling affect prebiotic concentrations in lentil
(Lens culinaris Medikus). Journal of Food Composition and Analysis, 38, 106–111.
Keenan, M. J., Zhou, J., McCutcheon, K. L., Raggio, A. M., Bateman, H. G., Todd, E.,
Jones, C. K., Tulley, R. T., Melton, S., Martin, R. J., & Hegsted, M. (2006). Effects
of Resistant Starch, A Non-digestible Fermentable Fiber, on Reducing Body Fat*.
Obesity, 14(9), 1523–1534.
121
Muccioli, G. G., Naslain, D., Bäckhed, F., Reigstad, C. S., Lambert, D. M., Delzenne, N.
M., & Cani, P. D. (2010). The endocannabinoid system links gut microbiota to
adipogenesis. Molecular systems biology, 6(1), 392.
Parnell, J. A., & Reimer, R. A. (2009). Weight loss during oligofructose supplementation
is associated with decreased ghrelin and increased peptide YY in overweight and
obese adults. American Journal of Clinical Nutrition, 89(6), 1751–1759.
122
7. CONCLUSION AND FUTURE DIRECTION
Lentil nutrient compounds including proteins, prebiotic carbohydrates, minerals, vitamins can be increased by conventional plant breading, processing (whole vs dehulling vs splitting), and cooking operations. However, it is important to know that exactly which compounds in lentil increase human health such as reducing body fat.
Also, in the present rat study, rats were fed with lentils only for 6 weeks. It may be not enough to evaluate the long term changes in obesity bio markers. Therefore, the future lentil research will include,
1. Determination of impact of lentil diet on obesity biomarkers and gut
microbiomes using human subjects for a long period.
2. Separation of lentil prebiotic carbohydrates (SA, RFO, FOS, and RS) and
evaluate the effect of those individual prebiotics on obesity biomarkers.
3. Determination of the impact of processing and thermal treatments on prebiotic
carbohydrates of other legumes including chickpea, cowpea and beans.
4. Development of legume based food products such as morning cereals, pasta
to provide optimum prebiotic carbohydrates to consumer.
In conclusion, prebiotic carbohydrates are important dietary component for healthy living. Lentil processing and cooking operations manipulate the prebiotic carbohydrate concentrations. Further, lentil significantly reduced body weight, and decrease pathogenic bacteria. Thus, lentil is a potential whole food legume to reduce obesity risk. However, further research with human models are required to confirm this hypothesis.
123
APPENDICES
124
Appendix A
Primer design
Primers were designed using a published method (Kozich et al., 2013). Each
primer consists of illumina adaptor, an 8-nt index sequence, a 10-nt pad sequence, a 2-
nt linker, and the gene specific primer. Primer sequences i5 and i7 are the 8-nt index
sequences. The pad is a 10-nt sequence to boost the sequencing primer melting
temperatures. Linker is a 2-nt sequence that is anti-complementary to the known sequences. The 16S forward and 16S reverse are the gene specific primer sequences for V4 region of 16S rRNA gene.
V4 region gene specific primers
16S forward: GTGCCAGCMGCCGCGGTAA 16S reverse: GGACTACHVGGGTWTCTAAT
V4 Link
Forward: GT Reverse: CC
Pad
Forward: TATGGTAATT Reverse: AGTCAGTCAG
Index primer i5
SA501: ATCGTACG SA502: ACTATCTG SA503: TAGCGAGT SA504: CTGCGTGT SA505: TCATCGAG SA506: CGTGAGTG SA507: GGATATCT SA508: GACACCGT SB501: CTACTATA SB502: CGTTACTA SB503: AGAGTCAC
125
SB504: TACGAGAC SB505: ACGTCTCG SB506: TCGACGAG SB507: GATCGTGT SB508: GTCAGATA
1.5. Index primer i7
SA701: AACTCTCG SA702: ACTATGTC SA703: AGTAGCGT SA704: CAGTGAGT SA705: CGTACTCA SA706: CTACGCAG SA707: GGAGACTA SA708: GTCGCTCG SA709: GTCGTAGT SA710: TAGCAGAC SA711: TCATAGAC SA712: TCGCTATA
1.6. Illumina adapter
P5: AATGATACGGCGACCACCGAGATCTACAC P7: CAAGCAGAAGACGGCATACGAGAT
126
1.7. Primers used to amplify 144 samples
SA501 AATGATACGGCGACCACCGAGATCTACACATCGTACGTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SA502 AATGATACGGCGACCACCGAGATCTACACACTATCTGTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SA503 AATGATACGGCGACCACCGAGATCTACACTAGCGAGTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SA504 AATGATACGGCGACCACCGAGATCTACACCTGCGTGTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SA505 AATGATACGGCGACCACCGAGATCTACACTCATCGAGTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SA506 AATGATACGGCGACCACCGAGATCTACACCGTGAGTGTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SA507 AATGATACGGCGACCACCGAGATCTACACGGATATCTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SA508 AATGATACGGCGACCACCGAGATCTACACGACACCGTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SB501 AATGATACGGCGACCACCGAGATCTACACCTACTATATATGGTAATTGTGTGCCAGCMGCCGCGGTAA SB502 AATGATACGGCGACCACCGAGATCTACACCGTTACTATATGGTAATTGTGTGCCAGCMGCCGCGGTAA SB503 AATGATACGGCGACCACCGAGATCTACACAGAGTCACTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SB504 AATGATACGGCGACCACCGAGATCTACACTACGAGACTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SB505 AATGATACGGCGACCACCGAGATCTACACACGTCTCGTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SB506 AATGATACGGCGACCACCGAGATCTACACTCGACGAGTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SB507 AATGATACGGCGACCACCGAGATCTACACGATCGTGTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA SB508 AATGATACGGCGACCACCGAGATCTACACGTCAGATATATGGTAATTGTGTGCCAGCMGCCGCGGTAA SA701 CAAGCAGAAGACGGCATACGAGATAACTCTCGAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA702 CAAGCAGAAGACGGCATACGAGATACTATGTCAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA703 CAAGCAGAAGACGGCATACGAGATAGTAGCGTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA704 CAAGCAGAAGACGGCATACGAGATCAGTGAGTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA705 CAAGCAGAAGACGGCATACGAGATCGTACTCAAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA706 CAAGCAGAAGACGGCATACGAGATCTACGCAGAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA707 CAAGCAGAAGACGGCATACGAGATGGAGACTAAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA708 CAAGCAGAAGACGGCATACGAGATGTCGCTCGAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA709 CAAGCAGAAGACGGCATACGAGATGTCGTAGTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA710 CAAGCAGAAGACGGCATACGAGATTAGCAGACAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA711 CAAGCAGAAGACGGCATACGAGATTCATAGACAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT SA712 CAAGCAGAAGACGGCATACGAGATTCGCTATAAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT
127
1.8. Schematic diagram of 96 well plates that assigned to dual index primers for 144 rat fecal samples
SA701 SA702 SA703 SA704 SA705 SA706 SA707 SA708 SA709 SA710 SA711 SA712 SA501 S01 S09 R17 L25 L33 S01 R13 R21 L29 S01 S09 R17 SA502 S02 S10 R18 L26 L34 S06 R14 R22 L30 S02 S10 R18 SA503 S03 S11 R19 L27 L35 S07 R15 R23 L31 S03 S11 R19 SA504 S04 S12 R20 L28 L36 S08 R16 R24 L32 S04 S12 R20 SA505 S05 R13 R21 L29 S05 S09 R17 L25 L33 S05 R13 R21 SA506 S06 R14 R22 L30 S02 S10 R18 L26 L34 S06 R14 R22 SA507 S07 R15 R23 L31 S03 S11 R19 L27 L35 S07 R15 R23 SA508 S08 R16 R24 L32 S04 S12 R20 L28 L36 S08 R16 R24
SB501 L25 L33 S05 R13 R21 L29 SB502 L26 L34 S06 R14 R22 L30 SB503 L27 L35 S07 R15 R23 L31 SB504 L28 L36 S08 R16 R24 L32 SB505 L29 S01 S09 R17 L25 L33 SB506 L30 S02 S10 R18 L26 L34 SB507 L31 S03 S11 R19 L27 L35 SB508 L32 S04 S12 R20 L28 L36
S01-S12; fecal samples of rats fed with standard diet, R13-R24; fecal samples of rats fed with 3.5% high amylose corn starch diet, L25-L36; fecal samples of rats fed with 70.8% lentil diet.
Initial week ; 2nd week ; 4th week ; 6th week
128