Functional Characterisation of Schistosoma Japonicum Acetylcholinesterase Hong You1*, Geoffrey N

You et al. Parasites & Vectors (2016) 9:328 DOI 10.1186/s13071-016-1615-1

RESEARCH Open Access Functional characterisation of Schistosoma japonicum acetylcholinesterase Hong You1*, Geoffrey N. Gobert1,2, Xiaofeng Du1, Gabor Pali1, Pengfei Cai1, Malcolm K. Jones3 and Donald P. McManus1*

Abstract Background: Acetylcholinesterase (AChE) is an important metabolic enzyme of schistosomes present in the musculature and on the surface of the blood stage where it has been implicated in the modulation of glucose scavenging from mammalian host blood. As both a target for the antischistosomal drug metrifonate and as a potential vaccine candidate, AChE has been characterised in the schistosome species Schistosoma mansoni, S. haematobium and S. bovis,butnotinS. japonicum. Recently, using a schistosome protein microarray, a predicted S. japonicum acetylcholinesterase precursor was significantly targeted by protective IgG1 immune responses in S. haematobium-exposed individuals that had acquired drug-induced resistance to schistosomiasis after praziquantel treatment. Results: We report the full-length cDNA sequence and describe phylogenetic and molecular structural analysis to facilitate understanding of the biological function of AChE (SjAChE) in S. japonicum. The protein has high sequence identity (88 %) with the AChEs in S. mansoni, S. haematobium and S. bovis and has 25 % sequence similarity with human AChE, suggestive of a highly specialised role for the enzyme in both parasite and host. We immunolocalized SjAChE and demonstrated its presence on the surface of adult worms and schistosomula, as well as its lower expression in parenchymal regions. The relatively abundance of AChE activity (90 %) present on the surface of adult S. japonicum when compared with that reported in other schistosomes suggests SjAChE may be a more effective drug or immunological target against this species. We also demonstrate that the classical inhibitor of AChE, BW285c51, inhibited AChE activity in tegumental extracts of paired worms, single males and single females by 59, 22 and 50 %, respectively, after 24 h incubation with 200 μM BW284c51. Conclusions: These results build on previous studies in other schistosome species indicating major differences in the enzyme between parasite and mammalian host, and provide further support for the design of an anti-schistosome intervention targeting AChE. Keywords: Schistosoma japonicum, Acetylcholinesterase, Drug or vaccine target

Background the cholinergic system and neuromuscular signalling by Schistosomiasis remains one of the most insidious and targeting acetylcholinesterase (AChE). Metrifonate was, serious of the tropical parasitic diseases of clinical and however, withdrawn from the market because of un- public health significance. Currently, there is no effective acceptable toxicity to the host and variable efficacy vaccine to prevent schistosomiasis [1] and treatment is against different schistosome species [3]. dependent on praziquantel chemotherapy. Previous re- During the blood dwelling stages of schistosomes, ports showed that human schistosomiasis could be acetylcholinesterase (AChE) is present on the parasite treated using the drug metrifonate [2], which can disrupt tegument membrane [4] and in the musculature [5], both in adults and schistosomula. A previous study im- * Correspondence: [email protected]; Don.McManus@ plicated schistosome AChE in regulating glucose scaven- qimrberghofer.edu.au ging from the host [6]. It has been shown that the basal 1Molecular Parasitology Laboratory, Infectious Diseases Division, QIMR Berghofer Medical Research Institute, Brisbane, Queensland, Australia rate of glucose uptake in adult Schistosoma haemato- Full list of author information is available at the end of the article bium and S. bovis is about twice that in S. mansoni [7].

© 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. You et al. Parasites & Vectors (2016) 9:328 Page 2 of 12

Indicative of the higher metabolic requirements for glu- schistosome species, describe the distribution of the en- cose in S. haematobium and S. bovis, relatively higher zyme in schistosomula and adult worms, and show that amounts of AChE activity are present on their tegu- the classic inhibitor of BW284c51 effectively suppresses ments compared with S. mansoni [2]. These higher AChE activity in adult worms in vitro. levels of AChE activity result in the recorded higher sus- ceptibility to metrifonate [8]. It has also been shown that Methods S. mansoni AChE antibodies can lead to efficient Parasites complement-mediated killing of schistosomula in vitro Schistosoma japonicum adult worms were collected by [9]. Importantly, the absence of cross-reactivity with hu- perfusion of female ARC Swiss mice infected percu- man AChE further supports schistosome AChE as a taneously with 60 cercariae of S. japonicum (Anhui suitable target for immunological attack [9]. population, mainland China) shed from Oncomelania AChE has been characterised from S. mansoni,S.haema- hupensis hupensis snails as described [16]. In order to ob- tobium and S. bovis [10, 11], but not in S. japonicum.Re- tain schistosomula, cercariae were passed through a 22- cently, using a schistosome protein microarray, a predicted gauge emulsifying needle 25 times to mechanically shear S. japonicum acetylcholinesterase precursor (AY810792) the cercarial tails from the bodies. The resulting larvae was significantly targeted by protective IgG1 immune re- were separated from the free tails by centrifugation, sponses in S. haematobium-exposed individuals that had washed three times with a modified Basch’s medium [17] acquired drug-induced resistance to schistosomiasis after and incubated at 37 °C under a 5 % CO2 atmosphere be- praziquantel treatment [12]. This observation further sup- fore experimentation. ports consideration of S. japonicum AChE (SjAChE) as a suitable vaccine candidate against schistosomiasis. Cloning S. japonicum AChE The interaction between acetylcholine (ACh) and its re- A Qiagen RNeasy kit (Qiagen, Hilden, Germany) was ceptor, the nicotinic acetylcholine receptor (nAChR), re- used to purify total RNA from adult S. japonicum. A one sults in the opening of the ion channel in mammalian step RT-PCR (Qiagen) kit was employed to amplify spe- cells [7]. Schistosome AChE plays an important role in cific cDNA. Based on the conserved sequences of AChE limiting this interaction as the inhibition of AChE mimics in S. mansoni (AF279461), S. haematobium (AF279462) ligand excess and causes receptor desensitisation [11]. It and S. bovis (AF279463), and partial S. japonicum se- has been shown that circulating concentrations of ACh quences available at http://www.genedb.org/Homepage/ can result in an increase in glucose uptake in schistosomes Sjaponicum, four pairs of primers for SjAChE were de- in vitro, and this effect is ablated in the presence of anti- signed (Table 1) to obtain the full-length cDNA se- acetylcholinesterase antibodies [7]. Furthermore, the influ- quence to PCR amplify the full-length sequence of ence of acetylcholine on glucose uptake in these worms SjAChE using an overlap strategy. can be modulated through inhibition of either tegumental AChE or nAChR [11]. nAChRs are ligand-gated ion chan- Sequence and phylogenetic analysis nels within the nervous system that mediate the excitatory Searches for homologous acetylcholinesterase protein se- responses to acetylcholine. Three types of acetylcholine quences were performed using BLAST on the NCBI web receptors have been identified in S. haematobium: site (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and the Worm- ShAR1α (AY392150) [13, 14], ShAR1β (AY392151) [14] Base ParaSite web site (http://parasite.wormbase.org/ and ShAR2β [15]. It has been demonstrated that ShAR1α Multi/Tools/Blast). Phylogenetic analysis was performed is located on the parasite surface and may contribute to using online resources (http://www.phylogeny.fr/simple_- the potentiation of the uptake of glucose from the host phylogeny.cgi) [18] by uploading the set of available AChE blood in response to circulating concentrations of ACh. sequences from the different species presented. Molecular As the first step in determining the functional charac- weight and isoelectric point determinations were per- teristics of AChE from S. japonicum, we present the iso- formed using the ExPASy-Compute pI/Mw tool (http:// lated full-length sequence of the protein from this web.expasy.org/compute_pi/). The PHYRE2 protein fold

Table 1 Primers used in PCR to obtain the full-length cDNA sequence encoding S. japonicum acetylcholinesterase Primer ID Primer pair sequence (5′-3′) Forward Reverse Size (bp) SjAChE1 ACATGTAGATTCATTCACTATGAAAATG ACATTGGAGTATTTGGTACCCAC 655 SjAChE2 AAATTACCAGCCAGTTGTCCA CCGCCGAAATCTTCAATGTG 404 SjAChE3 TTTCTTTATATGAACACAGAAGAAGCACCAGGTAA TTCATAACCATGCATTGTACCAGTCC 936 SjAChE4 ACAGCTGTAACAAATGATTATCGTATACCAGGTC CACGCCTAAACAATGCTGACGATT 561 You et al. Parasites & Vectors (2016) 9:328 Page 3 of 12

recognition server (http://www.sbg.bio.ic.ac.uk/phyre2/) (Bio-Rad, Mississauga, Canada). Data are presented as was used to generate the three-dimensional (3D) model of antibody endpoint titres, defined as the highest dilution SjAChE [19] and binding site predictions were carried out of test serum that yielded an average O.D. two standard using the 3DLigandSite (http://www.sbg.bio.ic.ac.uk/3dli- deviations (SDs) greater than that obtained in the ab- gandsite/) [20]. sence of primary antibody.

Protein expression, purification and antibody generation Western blot analysis A C-terminal fragment of SjAChE (from Q465 to V680, The rabbit anti-SjAChEC serum was used in Western named SjAChEC) was amplified and cloned into the blotting to probe to the electrophoresed purified recom- pET28b vector (Novagen, Madison, USA), by using for- binant SjAChEC protein and the native SjAChE protein ward (5′-CGG GAT CCT CAG TTG CCG ACA CTT in a separated crude S. japonicum antigen extract. The GAA AGT TGG A-3′ with BamHI restriction site crude antigen was prepared from adult worms of S. underlined) and reverse (5′-CGC TCG AGC ACG CCT japonicum freshly perfused from mice percutaneously AAA CAA TGC TGA CGA TTA CG-3′ with XhoI re- infected with 60 cercariae six weeks previously. After striction site underlined) primers. The reconstructed three washes in perfusion buffer (8.5 g NaCl and 15 g vector was then transformed into Escherichia coli (BL21 NaCitrate in 1 l of water), to minimise contamination of strain) for expression induced with 1 mM IPTG (isopro- the schistosome protein extract with host components, pyl thio-b-D-galactoside) at 37 °C for 3 h. Recombinant an adult worm antigen preparation (SWAP) was made protein was purified from inclusion bodies by chroma- as described [21]. The recombinant SjAChEC and tography using a Ni-NTA His-tag affinity kit (Novagen) SWAP samples were separated on a 15 % (w/v) SDS- under denaturing conditions using 6 M guanidine ac- PAGE gel and transferred to an Immun-Blot® low cording to the manufacturer’s instructions. fluorescence-PVDF membrane. Overnight blocking was Antibodies were raised against the SjAChEC fusion performed with Odyssey buffer at 4 °C. Then, the mem- protein in a rabbit at the South Australian Health and brane was subjected to incubation with the rabbit anti- Medical Research Institute (SAHMRI). Briefly, the rabbit SjAChE anti-serum (1:100 dilution in Odyssey buffer was immunized three times each with 500 μg recombin- and 0.1 % Tween-20) for 1 h followed by incubation ant protein at three week intervals. Based on the fact with IRDye-labeled 680LT goat anti-rabbit IgG antibody that complete Freund’s adjuvant is the most effective (Li-COR Biosciences) (1:15,000 diluted in Odyssey buffer adjuvant available for consistently producing high titer with 0.1 % Tween-20 and 0.01 % SDS) for 1 h on a antibodies to diverse antigens, we used complete shaker in a dark chamber. After a final wash with dis- Freund’s adjuvant in the initial injection, but in the sub- tilled water, the membrane was allowed to dry in the sequent two used incomplete Freund’s adjuvant. The in- dark and visualized using the Odyssey® CLx Infrared Im- jections were delivered subcutaneously at multiple sites aging System [22]. along the neck and spine. Blood was collected two weeks after the final boost. The titre of the antibody was determined using an enzyme-linked immunosorbent assay Immunolocalisation (ELISA). Briefly, Maxisorb immunoplates (Nalge Nune Adult S. japonicum International, USA) were coated overnight at 4 °C with Horseradish peroxidise (HRP) labelling was used for the rSjAChE protein (100 μl of 0.5 μg/ml) in coating buffer immunolocalisation of SjAChE in adult S. japonicum. (100 μl/well). After three washes with 0.05 % (v/v) Freshly perfused male and female worms were fixed in Tween in PBS (PBST), wells were blocked with 200 μlof 100 % methanol, embedded in Tissue-Tek Optimal 5 % (v/v) skim milk in PBS (SMP) and incubated for 1 h Cutting Temperature (OCT) compound (ProSciTech, at 37 °C. The rabbit anti-SjAChE serum was serially di- Queensland, Australia), and 7.0 μm cryostat sections luted (from 1:200 to 1:102,400) in SMP and 100 μlin produced. The HRP labelling was performed according duplicate of each dilution were added to individual wells. to standard procedures [21]. The primary antibody solu- After incubation at 37 °C for 1 h, the wells were washed tion was a 1:200 dilution of the rabbit anti-SjAChE with PBST (3X) and 100 μl (1:2,000 dilution) of horse- serum, and normal rabbit serum was used as control. radish peroxidise (HRP)-conjugated goat anti-rabbit IgG Non-specific antibody binding was inhibited by incubat- (Invitrogen) was added. After incubation at 37 °C for ing the section in 10 % (v/v) normal goat serum in PBS. 1 h, the wells were washed with PBST (5X), 100 μlof ImmPRESSTM HRP Anti-Rabbit IgG (Peroxidase) Poly- substrate solution [2,2-azino-di-(ethyl-benzithiozolin sul- mer (Vector Labs, California USA) was used as second fonate)] (Sigma, Castle Hill, Australia) was added and antibody for the immunolocalisation. Slides were the wells were incubated at room temperature and read scanned and digitised using a ScanScope XT (Aperio, on a plate reader by using Microplate manager software California, USA). You et al. Parasites & Vectors (2016) 9:328 Page 4 of 12

Schistosomula concentrations of 0, 10, 100 and 1000 μMandthen Four-day old transformed larvae were cultured in Basch’s used in the AChE activity assays. medium [3] containing rabbit anti-SjAChEC serum (ii) Freshly perfused adult S. japonicum were cultured (1:100 dilution), or pre-immune rabbit serum (1:100 di- in RPMI medium containing 10 % (v/v) heat- lution) as negative control, at 4 °C overnight [23]. The inactivated fetal calf serum overnight. The worms were larvae were washed three times with Basch medium and then divided into three groups: single males, single fe- incubated with 1:300 donkey anti-rabbit IgG Alexa Fluor males and paired male and female worms (40 single 555 (2 mg/ml, Invitrogen) for 1 h at room temperature, worms or 20 pairs/group). Each group was then followed by three further washes in the medium. The treated with or without 200 μM BW284c51 for 24 h, larvae were fixed in 4 % paraformaldehyde in PBS for after which time the worms were rinsed 3 times in 10 min at room temperature, and then visualised under RPMI medium, collected and used for tegumental pro- fluorescence using a Zeiss 780 NLO confocal micro- tein and carcass protein extraction as described above. scope (Zeiss, Germany). AChE activities of all the protein samples (0.005 mg/ ml) from the various worm samples were measured using the Amplex Red Acetylcholine/Acetylcholin- Fluorescence-based enzyme assays esterase Assay Kit. The enzymatic activity of AChE in S. japonicum was de- Worm collections, protein extractions and AChE termined using the Amplex Red Acetylcholine/Acetyl- activity measurements in (i) and (ii) were performed cholinesterase Assay Kit (Invitrogen) according to the three times. T-test was employed to make the com- manufacturer’s instructions. The assay is fluorescence- parison between samples by using GraphPad software based and utilises the highly fluorescent end product (version 7.0). resorufin which is processed in black Costar 96-well plates (Sigma) and measured using the POLARstar Results OPTIMA (BMG Labtech, Ortenberg Germany) at an Full-length sequence of SjAChE absorption of 560 nm and an emission of 590 nm. Nega- The complete SjAChE cDNA sequence was obtained, tive and positive control samples are provided in the comprising an open reading frame (ORF) of 2,040 bp assay kit and BW284c51 [1,5-bis(4allyldimethylammo- (submitted to GenBank under accession number niumphenyl)pentan-3-one dibromide] (Sigma), a specific KX268651) encoding 680 amino acids. SjAChE shares inhibitor of AChE, was also used in the enzyme assay. 88 % amino acid sequence identity with the AChEs from Different protein extracts of S. japonicum used in the S. mansoni, S. haematobium and S. bovis, and 55 % iden- enzymatic assays: tity with the AChEs in Echinococcus granulosus [25] and (1) Tegument protein and residual carcass protein ex- E. multilocularis [26]. In contrast, SjAChE shares only tracted from adult S. japonicum freshly perfused from 25 % amino acid identity to human AChE and 26 % mice. The tegument was removed from paired adult identity to the AChE from Torpedo californica (Pacific worms by the freeze/thaw/vortex method [24]. Briefly, electric ray). Phylogenetic analysis was performed freshly perfused paired adult S. japonicum (50 pairs) using AChE protein sequences from a variety of spe- were frozen in liquid nitrogen, thawed on ice and 400 μl cies to produce a cladogram to infer evolutionary re- of ice-cold TBS (10 mM Tris-HCl, 0.84 % NaCl, pH 7.4) lationships between taxa (Fig. 1). Of the schistosome was added to each tube. The supernatant was removed sequences, the AChE coding region for S. japonicum after 1 min and then 400 μl of Tris-HCl, pH 7.4 was is most similar to that of S. haematobium.TheSchis- added and the tube left to incubate on ice for 5 min. tosoma spp. sequences are separated considerably Tubes were vortexed 8 times for 1 s to ensure tegument from those of Echinococcus speciesand,asexpected, release. The tegument-rich supernatant was transferred have more sequence similarity with the AChEs of to another tube where it was centrifuged for 30 min at other trematode species including Clonorchis sinensis, 12,000 g, 4 °C, the supernatant was discarded and the Opisthorchis viverrini and Fasciola hepatica. Crucially, tegument-rich pellet re-suspended in 60 μl 10 mM Tris- all residues within the AChE protein sequence that HCl, pH 8.0. The remaining carcasses were homogenised are currently known to be important for substrate using the protocol for making SWAP essentially as de- binding and catalytic activity, i.e. those comprising scribed in [21], and above. The protein concentrations of the peripheral anionic site [27], the catalytic triad the enriched tegument fraction and the residual carcass substrate inhibition of acetylcholinesterase residues in- preparation were measured using the Bio-Rad protein volved in signal transduction from the surface to the assay dye reagent (Bio-Rad, California, USA). These pro- catalytic center [28], and those lining the catalytic tein extracts (0.005 mg/ml) were pre-incubated at gorge [29], are conserved across all Schistosoma room temperature for 30 min with BW284c51 at species. You et al. Parasites & Vectors (2016) 9:328 Page 5 of 12

Fig. 1 Phylogenetic analysis of S. japonicum acetylcholinesterase and functionally characterised acetylcholinesterases from other taxa. Species (Sequence Accession Number) used for the analysis include: Mus musculus (EDL19281), Bos taurus (NP_001069688), Homo sapiens (AAA68151), Tetronarce californica (X03439), Xenopus tropicalis (XP_002931610), Ambigolimax valentianus (BAO00806), Crassostrea gigas (XP_011422197), Caenorhabditis elegans (W09B12.1.1*), Hymenolepis microstoma (HmN_000644400*), Taenia solium (TsM_000001700*), Echinococcus granulosus (EgrG_000732400*), Echinococcus multilocularis (EmuJ_000732400*), Clonorchis sinensis (csin108144*), Opisthorchis viverrini (T265_07137*), Fasciola hepatica (BN1106_s773B000378), Schistosoma. haematobium (AF279462), S. bovis (AF279463), S. mansoni (AF279461). Note: *: Gene ID from WormBase ParaSite web site (http://parasite.wormbase.org/Multi/Tools/Blast)

Using an in silico motif and domain search tool residues in S. japonicum, S. mansoni, S. haematobium (http://prosite.expasy.org/), we identified two conserved and S. bovis are all conserved, especially when taking sub-domains in the SjAChE protein sequence - a carbox- into consideration the accepted standard primary AChE ylesterase type-B signature 2 (E156-P166) region, and a (1EA5_A) sequence from the ray Torpedo californica. It carboxylesterase type-B serine active site (F258-G273), has been shown that the active site of T. californica both of which are shown boxed in red in Fig. 2. Several AChE consists of a catalytic triad (S200-H440-E327, in other motifs were also found in SjAChE (Fig. 2); these red stars, Fig. 2) which lies close to the bottom of a deep included: and narrow tertiary structure gorge, which is lined with the rings of 14 aromatic amino acid residues [31]. The 1) N-glycosylation sites underlined (N42-I45, N171- conserved catalytic triad is present in S. japonicum H174, N314-Q317, N418-D421, N630-K633); (S280-H54-E327), while the nine residues (W148, W186, 2) N-myristoylation sites boxed in purple (G71-Q76, W193, Y202, W304, F371, F404, Y407, Y537, in dark red G95-Q100, G298-N303, G305-E310, G395-E400, triangles, Fig. 2) in the rings of the 14 aromatic amino G532-Y537); acid residues of T. californica AChE, are conserved in 3) A casein kinase II phosphorylation site boxed in the appropriate locations in SjAChE. brown (S88-D91, S200-D203, S329-D332, S341- The tertiary protein structure for SjAChE was predicted E344, T351-D354, T456-E459, S471-E474, T559- using Phyre2 (Fig. 3a). Model dimensions for SjAChE (Å) E562, T592-E595); (X:61.705 Y:62.361 Z:71.856) are the same as those of S. 4) Protein kinase C phosphorylation sites boxed in blue haematobium AChE. Of note, we found four predicted N- (S105-R107, T316-R318, S379-R381, T473-R475, Acetylglucosamine (NAG) binding sites located at (i) S481-K486, S631-K633) which are specific for M123, D125; (ii) P423, K245, M428; (iii) R507-T510, P512; schistosomes; and (iv) Q550-F551, A553-Y556 in SjAChE (Fig. 3b). N- 5) A tyrosine kinase phosphorylation site boxed in Acetylglucosamine, a monosaccharide derivative of glu- green (R454-Y460); cose, is directly incorporated into glycosaminoglycans and 6) An amidation site boxed in yellow (P503-R506). glycoproteins, acting as a substrate for tissue repair mech- anisms [32]. The predicted four NAG binding sites in After comparisons with other species and the schisto- SjAChE are in line with previous findings which revealed some sequences published by Bentley et al [30], we dem- the presence of NAG in all forms of cholinesterases inves- onstrated that the catalytic and peripheral active site tigated [20], providing evidence for N-linked glycosylation You et al. Parasites & Vectors (2016) 9:328 Page 6 of 12

Fig. 2 (See legend on next page.) You et al. Parasites & Vectors (2016) 9:328 Page 7 of 12

(See figure on previous page.) Fig. 2 Alignment of acetylcholinesterases from S. mansoni,S.haematobium, S. bovis, Homo sapiens and T. californica. Red boxes indicate the two conserved subdomains including carboxylesterase type-B signature 2 (E156-P166) and carboxylesterase type-B serine active site (F258-G273). Sev- eral motifs are found in SjAChE: N-glycosylation sites underlined (N42-I45, N171-H174, N314-Q317, N418-D421, N630-K633); N-myristoylation sites boxed in purple (G71-Q76, G95-Q100, G298-N303, G305-E310, G395-E400, G532-Y537); Casein kinase II phosphorylation site boxed in brown (S88- D91, S200-D203, S329-D332, S341-E344, T351-D354, T456-E459, S471-E474, T559-E562, T592-E595); Protein kinase C phosphorylation sites boxed in blue (S105-R107, T316-R318, S379-R381, T473-R475, S481-K486, S631-K633) which are specific for schistosome; Tyrosine kinase phosphorylation site boxed in green (R454-Y460); amidation site (P503-R506). The conserved catalytic active catalytic triad site is observed S. japonicum (S280-H54- E327, in red stars), while the 9 residues (W148, W186, W193, Y202, W304, F371, F404, Y407, Y537, in dark red triangles) in the rings of 14 aromatic amino acid residues of T. californica AChE are conserved in the appropriate locations in S. japonicum AChE. The coloured boxes which covered only sequences from four species of schistosomes indicated the specific motifs for schistosome. Note: AChE from S. mansoni (SmAChE), S. haematobium (ShAChE), S. bovis (SbAChE), Homo sapiens (HsAChE) and T. californica (TcAChE) in SjAChE. The predicted protein structure for SjAChE understand how the anti-SjAChE serum interacted with also suggests that it may be fucosylated on the innermost schistosomula, we used immunofluorescence to show N-acetylglucosamine residue of the core [33]. SjAChE is also localized on the tegumental surface of live 4-day-old schistosomula (Fig. 4d) and the paren- Western-blot analysis chyma; the latter observation may be indicative of dam- SDS-PAGE showed the purified rSjAChEC migrated as a age to the schistosomula during labelling process. By single band with the predicted size of 30 kDa (Fig. 3c). using two different immunolocalisation methods involv- The specificity of the rabbit anti-SjAChEC antibody was ing HRP labelling and immunofluorescence, we showed confirmed as it bound a band of approximately 76 kDa a similar distribution of SjAChE in early (schistosomula) in adult S. japonicum SWAP, thereby matching well with and late (adult males and females) developmental stages the calculated molecular size for SjAChE (Fig. 3c). Con- in the mammalian host. trol serum from the pre-immunized control rabbit did not bind any protein component in S. japonicum SWAP. Inhibition of SjAChE activity SjAChE sensitivity to chemical inhibition, in extracts of Distribution of SjAChE in adults and schistosomula adult worms, was assessed by the pre-incubation of Indirect immunohistochemistry, incorporating HRP la- tegument or carcass proteins with BW284c51 at a con- belling, indicated that SjAChE immunoreactivity oc- centration range of 0–1,000 μM. SjAChE, present both curred in the tegument, the underlying musculature but in the worm tegument or carcass extract, was sensitive also throughout the parenchyma and tissues of both to BW284c51, and its activity exhibited a linear response males (Fig. 4a) and females (Fig. 4b). To better to concentration changes up to 1000 μM of BW284c51

Fig. 3 a Three dimensional model of S. japonicum acetylcholinesterase determined using PHYRE2. Image coloured by rainbow from N to C terminus, Model dimensions (Å) X: 61.705 Y: 62.361 Z: 71.856 are the same as that of ShAChE. b The predicted binding sites of SjAChE with N- Acetylglucosamine (NAG). The four predicted N-Acetylglucosamine binding sites (in blue) are located at (i) M123, D125; (ii) P423, K245, M428; (iii) R507-T510, P512; and (iv) Q550-F551, A553-Y556 in SjAChE. The NAG residues are shown in green. c Western blot analysis using anti- SjAChEC to detect the total extracts from adult S. japonicum. Left panel: SDS-PAGE gel of purified recombinant protein SjAChEC (Molecular size: 30 Kda); Right panel: western blot analysis of total extract from adult S. japonicum worms. The protein extract was probed with rabbit anti-SjAChEC antibody (Lane 1) by recognising a band of approximately 76 kDa which match the calculated molecular size for native SjAChE Pre-immune sera (Lane 2) was used as control. Lane M, PageRulerTM pre-stained protein ladder You et al. Parasites & Vectors (2016) 9:328 Page 8 of 12

Fig. 4 Immunolocalisation of SjAChE in adult S. japonicum and four-day mechanically transformed schistosomula. Adult male a and female b worm sections were labelled with rabbit anti-SjAChE antibody coupled with anti-rabbit HRP and scanned using an Aperio scanner. c Negative control sections of female worm were incubated with rabbit pre-immune serum. The female gut (b, c) appears non-specifically opaque due to the presence of red blood cell products, with the histochemical negative control demonstrating the dark region is due to gut contents. d Immunofluorescence of SjAChE in four-day old schistosomula probed with rabbit anti-SjAChE antibody. e Brightfield and corresponding fluorescence images f of schistosomula negative controls using pre-immune rabbit serum. Donkey anti-rabbit IgG 555 was used as secondary antibody and positive immunofluorescence is shown in red. As a negative control, f shows there is no signal produced when incubating parasites with rabbit pre-immune serum in the adult worm tissue. Scale-bars:a-c,100μm; d-f, 20 μm

(Fig. 5a). SjAChE activity in the tegument extract was 39.56, respectively, df =4, P<0.0001). Compared with significantly higher (about 10-fold; t-test, t = 1.881, df = the tegumental protein extract, there was much less 6, P<0.0001) than in the carcasses of adult worms, sug- SjAChE activity in the carcass protein extract, with a gesting the majority of the enzyme is located on the relatively higher activity in males compared with that in tegument of paired adult S. japonicum. The IC50 (50 % pairs and females (t-test, t = 29.41 and 39.07, respect- inhibition) of BW284c51 on SjAChE in the tegumental ively, df =4,P<0.0001), with the latter having the lowest protein extract of adult worms occurred at a concentra- level of SjAChE activity. SjAChE activity in the carcass tion of 16 μM which indicates a substantially higher sen- protein extracts of males and paired worms was inhib- sitivity than that reported for the AChEs from S. ited by 77 % (t-test, t = 32.69, df =4, P<0.0001) and mansoni, S. bovis and S. haematobium [2]. The sensitiv- 45 % (t-test, t = 15.07, df =4, P<0.0001), respectively in ity of SjAChE in the tegument and carcasses isolated the presence of 200 μM BW284c51. from cultured adult worms in the presence of 200 μM BW284c51 (IC80, 80 % inhibitory concentration) are Discussion shown in Fig. 5b. With the same concentration of tegu- Previous studies on AChE in schistosomes have focused ment protein, paired worms had a higher SjAChE activ- mainly on S. mansoni, S. haematobium and S. bovis and, ity than single-sex worms (t-test, t = 3.903, df =4, P = prior to this study, very limited information was avail- 0.0175) with male worms having a higher SjAChE activ- able for the enzyme in S. japonicum. Here, we report the ity than females (t-test, t = 18.66, df =4, P<0.0001). cloning and expression of the complete cDNA encoding After being treated with 200 μM BW284c51, the SjAChE S. japonicum AChE (SjAChE). To better understand its enzyme activity in tegument protein extracts of paired functions, we performed sequence and phylogenetic ana- worms, males and female worms decreased by 59 %, lysis on SjAChE and predicted its tertiary molecular 22 % and 50 %, respectively (t-test, t = 40.52,; 17.28; and structure. As might be expected, the protein has high You et al. Parasites & Vectors (2016) 9:328 Page 9 of 12

Fig. 5 Inhibition of AChE activity in adult Schistosoma japonicum protein preparations or intact worms. a SjAChE activity in the tegument extract was significantly higher (about 10-fold; P<0.0001) than in the carcasses of adult worms. The IC50 (50 % inhibition) of BW284c51 on SjAChE in the tegumental protein extract of adult worms is indicated as dotted lines at a concentration of 16 μM. b The sensitivity of SjAChE in the tegument and carcasses, isolated from cultured male and female worms in the presence of 200 μM BW284c51, were different. At the same concentration of tegument protein, paired worms had higher SjAChE activity than single-sex worms with male worms (P = 0.0175) having a higher SjAChE activity than females (P<0.0001). After treatment with BW284c51, SjAChE enzyme activity in tegument protein extracts of paired worms, male worms and female worms decreased by 59 %, 22 % and 50 %, respectively (P<0.0001). Compared with the tegumental protein extract, there was much less SjAChE activity in the carcass protein extract, with a relatively higher activity in males. Error bars represent the standard error of the mean (SEM). These experiments were performed three times (n = 3). Relative activity (%) = 100 × (sample fluorescence – negative fluorescence)/(positive– negative fluorescence). *P ≤ 0.05, **P ≤ 0.001, ***P ≤ 0.0001 sequence identity (88 %) with the AChEs in S. mansoni, of two principal molecular forms (external and internal) S. haematobium and S. bovis. The key residues that are of S. mansoni AChE, with approximately half of the important for the formation of the three disulphide AChE activity being found on the tegumental membrane bonds and two salt bridges characteristic of AChE [29], via a covalently attached glycosylphosphatidylinositol in substrate binding and for catalytic activity are con- (GPI) anchor and which may function in signal trans- served across the four species. These residues comprise duction, with the remainder mainly associated with important structural features including the peripheral muscle tissue and involved in cholinergic processes [34]. anionic site [27], the catalytic triad [28] and residues that These two forms of AChE were also shown to differ in line the catalytic gorge [29]. One particularly noteworthy their heparin-binding properties (only the internal form feature of the AChE protein sequence in schistosomes is interacted with heparin) and in immunological specifi- two “missing” residues that form part of the peripheral city (being located on the surface the GPI-anchored active site. Within the AChE of Torpedo californica, resi- form may be susceptible as an immunological target) due F330 has a neighbouring F residue in the same sec- [35]. Further investigation is required to determine ondary structure that is not indicated as playing a role in whether there are also different molecular forms of the catalysis of acetylcholine. However, whereas in schis- SjAChE and if so whether they have discrete functional tosomes, the equivalent of F330 is not present (Fig. 2), roles in S. japonicum. the neighbouring F residue is. It may be possible that To quantify the relative activity of SjAChE present this neighbouring F residue has taken over the catalytic within the tegument and in the musculature of adult S. role, or that this role has been lost altogether in schisto- japonicum, we separated the tegumental protein from somes. Similarly, an equivalent residue could not be the parasite carcass, and performed enzyme activity as- found at the position expected for W279 (Fig. 2), an- says. We found that most of the SjAChE activity was other peripheral active site residue. Considering these concentrated in the tegument, having 10-fold the activity residues are only part of the peripheral active site, they of the carcass (Fig. 5a), suggesting that SjAChE has po- may not be essential for the function of AChE in schisto- tential as a drug or immunological target. We also somes and have been lost over time through mutational showed that SjAChE activity was highly enriched in the events. male tegument and this observation is understandable as As with the other schistosomes, immunolocalisation male parasites, being larger in size, and having an in- showed that SjAChE is located on the tegumental sur- creased tegumental volume [36]. One established func- face and parenchyma of adult worms and 4-day-old tion of tegumental AChE in schistosomes is in the schistosomula [2]. Previous work showed the existence regulation of glucose uptake across the tegument in You et al. Parasites & Vectors (2016) 9:328 Page 10 of 12

response to ACh present in the mammalian host blood- demonstrated that purified polyclonal antibodies raised stream [7]. Given that male schistosomes play a more against S. mansoni AChE were cytotoxic and caused al- important role in host glucose uptake [37], it is reason- most total complement-dependent killing of parasites in able to consider that AChE activity would also be higher vitro [9, 35], while not cross-reacting with human AChE. in male S. japonicum, as we have shown. The distribution This observation and the results presented here of AChE in S. japonicum we established correlates with strengthen the view that immunological targeting of that reported in the other schistosome species [13, 38]. schistosome AChEs may be a highly suitable avenue for It has been shown that AChE activity and its sensitiv- future vaccine development and the prevention of ity to the inhibitor BW284c51 is dependent on the rela- schistosomiasis. tive amount of AChE expressed on the surface of adult schistosomes [2], since the inhibitor does not readily Conclusions penetrate membranes of the adult worms [2]. We In this paper, we have described the phylogenetic and showed a protein extract of the tegument of adult S. molecular/structural characterisation of the AChE pro- japonicum had an IC50 with BW284c51 of 16 μM, tein from S. japonicum. These findings improved the un- which is much lower than the reported IC50 for other derstanding of the biological function of AChE in schistosome species (0.1–5.0 mM) [2]. Those results schistosomes. The relative abundance of AChE activity may reflect a relatively larger amount of AChE activity (90 %) present on the surface of adult S. japonicum presented on the surface of adult S. japonicum compared when compared with that reported in other schisto- to the other schistosome species, indicating the AChE somes, suggests SjAChE may be a more effective drug or inhibitor may be more effective against S. japonicum. immunological target against thus species. Furthermore, We also found that live adults of S. japonicum incubated we show that the AChE activity in tegumental extracts with Bw284c51 (200 μM) displayed reduced AChE activ- of adult S. japonicum can be significantly inhibited by ity in tegumental protein by 50 % in females, but only the classical inhibitor of AChE (BW285c51) after incu- 22 % in males, suggesting that AChE present on the sur- bation with adult worms. The results we present support face of females is more sensitive to the inhibitor than the potential of AChE as a future drug target against S. that on males. Previous work has shown that AChE is japonicum and also strengthens the view that immuno- associated with the AChR on cell surfaces [39] and in logical targeting of schistosome AChEs may be a highly schistosomes the expression of AChR is increased in suitable avenue for future vaccine development and the sexually paired worms when female parasites mature prevention of schistosomiasis. into the egg producing stage [13]. The increased level of

AChR expression may require increased AChE activity Abbreviations on the surface of female worms to maintain cholinester- ACh, acetylcholine; AChE, acetylcholinesterase; ELISA, enzyme-linked ase receptor fidelity. A similar situation occurred in immunosorbent assay; GPI, glycosylphosphatidylinositol; HRP, horseradish peroxidise; nAChR, nicotinic acetylcholine receptor; NAG, N-Acetylglucosamine; paired worms, where a 59 % decrease in SjAChE activity PSMD4, proteasome non-ATPase regulatory subunit 4; SjAChE, Schistosoma was observed when paired incubated worms were japonicum acetylcholinesterase; SWAP, soluble adult worm antigen preparation treated with 200 μM of Bw284c51. The relatively high level of SjAChE activity distributed Acknowledgments We are grateful for funding provided by an Australian Infectious Disease within the carcass protein of males, when compared Research Centre Seed Grant and a Program Grant from the National Health with female and paired worms, may be indicative of its and Medical Research Council (NHMRC) of Australia (APP 1037304). involvement in muscle function [34], since male worms have more muscle tissue. The SjAChE activity in male Funding We are grateful for funding provided by an Australian Infectious Disease carcasses was decreased by 77 % after incubation of live Research Centre Seed Grant and a Program Grant from the National Health male parasites with BW284c51 for 24 h, suggesting that and Medical Research Council (NHMRC) of Australia (APP 1037304). the inhibitor can penetrate the tegument of male S. japonicum, which is a contradiction to previous reports stat- Availability of data and material The complete SjAChE cDNA sequence is submitted to the GenBank database ing the inhibitor cannot cross membranes [2]. (KX268651). It has been reported that AChE expression is induced during apoptosis and is regulated by the mobilization of Authors’ contributions Conceived and designed the experiments: HY GNG DPM. Performed the intracellular Ca2+ in various mammalian cell types [40]. experiments: HY XD, GP. Analysed the data: HY GNG PC MKJ DPM. Promoting apoptosis appeared to be a feature of the Contributed reagents/materials/analysis tools: HY XD GP PC. Wrote the mode of action of two already established anti- paper: HY GNG MKJ DPM. All authors read and approved the final version of schistosomal drugs, the artemisinins [41] and praziquan- the manuscript. tel [42], and drug targeting schistosome AChE may also Competing interests be effective by inducing apoptosis. Further, it has been The authors declare that they have no competing interests. You et al. Parasites & Vectors (2016) 9:328 Page 11 of 12

Consent for publication 18. Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, Dufayard JF, Not applicable. Guindon S, Lefort V, Lescot M, et al. Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008;36:W465–9. 19. Kelley LA, Sternberg MJ. Protein structure prediction on the web: a case Ethics approval and consent to participate study using the Phyre server. Nat Protoc. 2009;4:363–71. The conduct and procedures involving animal experiments were approved 20. Wass MN, Kelley LA, Sternberg MJ. 3DLigandSite: predicting ligand-binding by the Animal Ethics Committee of the QIMR Berghofer Medical Research sites using similar structures. Nucleic Acids Res. 2010;38:W469–73. Institute (project number P288). This study was performed in accordance 21. You H, Zhang W, Jones MK, Gobert GN, Mulvenna J, Rees G, Spanevello M, with the recommendations in the Guide for the Care and Use of Laboratory Blair D, Duke M, Brehm K, et al. Cloning and characterisation of Schistosoma Animals of the National Institutes of Health. japonicum insulin receptors. PLoS One. 2010;5:e9868. 22. Ranasinghe SL, Fischer K, Gobert GN, McManus DP. Functional expression of Author details a novel Kunitz type protease inhibitor from the human blood fluke 1Molecular Parasitology Laboratory, Infectious Diseases Division, QIMR 2 Schistosoma mansoni. Parasit Vectors. 2015;8:408. Berghofer Medical Research Institute, Brisbane, Queensland, Australia. School 23. McWilliam HE, Driguez P, Piedrafita D, Maupin KA, Haab BB, McManus ’ 3 of Biological Sciences, Queen s University Belfast, Belfast, UK. School of DP, Meeusen EN. The developing schistosome worms elicit distinct Veterinary Sciences, The University of Queensland, Brisbane, Queensland, immune responses in different tissue regions. Immunol Cell Biol. 2013; Australia. 91:477–85. 24. Jia X, Schulte L, Loukas A, Pickering D, Pearson M, Mobli M, Jones A, Received: 29 February 2016 Accepted: 1 June 2016 Rosengren KJ, Daly NL, Gobert GN, et al. Solution structure, membrane interactions, and protein binding partners of the tetraspanin Sm-TSP-2, a vaccine antigen from the human blood fluke Schistosoma mansoni. J Biol Chem. 2014;289:7151–63. References 25. Zheng H, Zhang W, Zhang L, Zhang Z, Li J, Lu G, Zhu Y, Wang Y, Huang Y, 1. Beaumier CM, Gillespie PM, Hotez PJ, Bottazzi ME. New vaccines for Liu J, et al. The genome of the hydatid tapeworm Echinococcus granulosus. neglected parasitic diseases and dengue. Transl Res. 2013;162:144–55. Nat Genet. 2013;45:1168–75. 2. Camacho M, Tarrab-Hazdai R, Espinoza B, Arnon R, Agnew A. The amount of acetylcholinesterase on the parasite surface reflects the differential sensitivity 26. Tsai IJ, Zarowiecki M, Holroyd N, Garciarrubio A, Sanchez-Flores A, of schistosome species to metrifonate. Parasitology. 1994;108(Pt 2):153–60. Brooks KL, Tracey A, Bobes RJ, Fragoso G, Sciutto E, et al. The genomes of four tapeworm species reveal adaptations to parasitism. Nature. 2013; 3. Salafsky B, Fusco AC, Whitley K, Nowicki D, Ellenberger B. Schistosoma mansoni: – analysis of cercarial transformation methods. Exp Parasitol. 1988;67:116–27. 496:57 63. 4. Wilson RA. Proteomics at the schistosome-mammalian host interface: any 27. Barak D, Ordentlich A, Bromberg A, Kronman C, Marcus D, Lazar A, Ariel N, prospects for diagnostics or vaccines? Parasitology. 2012;139:1178–94. Velan B, Shafferman A. Allosteric modulation of acetylcholinesterase activity 5. Levi-Schaffer F, Tarrab-Hazdai R, Schryer MD, Arnon R, Smolarsky M. Isolation by peripheral ligands involves a conformational transition of the anionic – and partial characterization of the tegumental outer membrane of subsite. Biochemistry. 1995;34:15444 52. schistosomula of Schistosoma mansoni. Mol Biochem Parasitol. 1984;13:283–300. 28. Shafferman A, Velan B, Ordentlich A, Kronman C, Grosfeld H, Leitner M, 6. Ribeiro-dos-Santos G, Verjovski-Almeida S, Leite LC. Schistosomiasis - a Flashner Y, Cohen S, Barak D, Ariel N. Substrate inhibition of century searching for chemotherapeutic drugs. Parasitol Res. 2006;99:505–21. acetylcholinesterase: residues affecting signal transduction from the surface – 7. Camacho M, Agnew A. Schistosoma: rate of glucose import is altered by to the catalytic center. EMBO J. 1992;11:3561 8. acetylcholine interaction with tegumental acetylcholine receptors and 29. Sussman JL, Harel M, Frolow F, Oefner C, Goldman A, Toker L, Silman I. acetylcholinesterase. Exp Parasitol. 1995;81:584–91. Atomic structure of acetylcholinesterase from Torpedo californica:a – 8. Harder A. Chemotherapeutic approaches to schistosomes: current prototypic acetylcholine-binding protein. Science. 1991;253:872 9. knowledge and outlook. Parasitol Res. 2002;88:395–7. 30. Bentley GN, Jones AK, Agnew A. Mapping and sequencing of 9. Espinoza B, Tarrab-Hazdai R, Himmeloch S, Arnon R. Acetylcholinesterase acetylcholinesterase genes from the platyhelminth blood fluke Schistosoma. – from Schistosoma mansoni: immunological characterization. Immunol Lett. Gene. 2003;314:103 12. 1991;28:167–74. 31. Sussman JL, Harel M, Silman I. Three-dimensional structure of 10. Bentley GN, Jones AK, Agnew A. Expression and comparative functional acetylcholinesterase and of its complexes with anticholinesterase drugs. – characterisation of recombinant acetylcholinesterase from three species of Chem Biol Interact. 1993;87:187 97. Schistosoma. Mol Biochem Parasitol. 2005;141:119–23. 32. Salvatore S, Heuschkel R, Tomlin S, Davies SE, Edwards S, Walker-Smith 11. Jones AK, Bentley GN, Oliveros Parra WG, Agnew A. Molecular JA, French I, Murch SH. A pilot study of N-acetyl glucosamine, a characterization of an acetylcholinesterase implicated in the regulation of nutritional substrate for glycosaminoglycan synthesis, in paediatric glucose scavenging by the parasite Schistosoma. FASEB J. 2002;16:441–3. chronic inflammatory bowel disease. Aliment Pharmacol Ther. 12. Pearson MS, Becker L, Driguez P, Young ND, Gaze S, Mendes T, Li XH, 2000;14:1567–79. Doolan DL, Midzi N, Mduluza T, et al. Of monkeys and men: immunomic 33. You H, McManus DP, Hu W, Smout MJ, Brindley PJ, Gobert GN. profiling of sera from humans and Transcriptional responses of in vivo praziquantel exposure in schistosomes non-human primates resistant to schistosomiasis reveals novel potential identifies a functional role for calcium signalling pathway member CamKII. vaccine candidates. Front Immunol. 2015;6:213. PLoS Pathog. 2013;9:e1003254. 13. Camacho M, Alsford S, Jones A, Agnew A. Nicotinic acetylcholine receptors 34. Tarrab-Hazdai R, Levi-Schaffer F, Gonzales G, Arnon R. Acetylcholinesterase on the surface of the blood fluke Schistosoma. Mol Biochem Parasitol. 1995; of Schistosoma mansoni. Molecular forms of the solubilized enzyme. 71:127–34. Biochim Biophys Acta. 1984;790:61–9. 14. Bentley GN, Jones AK, Oliveros Parra WG, Agnew A. ShAR1alpha and 35. Arnon R, Silman I, Tarrab-Hazdai R. Acetylcholinesterase of Schistosoma ShAR1beta: novel putative nicotinic acetylcholine receptor subunits from mansoni - functional correlates. Contributed in honor of Professor Hans the platyhelminth blood fluke Schistosoma. Gene. 2004;329:27–38. Neurath’s 90th birthday. Protein Sci. 1999;8:2553–61. 15. Bentley GN, Jones AK, Agnew A. ShAR2beta, a divergent nicotinic 36. Gobert GN, Stenzel DJ, McManus DP, Jones MK. The ultrastructural acetylcholine receptor subunit from the blood fluke Schistosoma. architecture of the adult Schistosoma japonicum tegument. Int J Parasitol. Parasitology. 2007;134:833–40. 2003;33:1561–75. 16. Jones MK, McManus DP, Sivadorai P, Glanfield A, Moertel L, Belli SI, Gobert 37. Cornford EM, Fitzpatrick AM. The mechanism and rate of glucose transfer GN. Tracking the fate of iron in early development of human blood flukes. from male to female schistosomes. Mol Biochem Parasitol. 1985;17:131–41. Int J Biochem Cell Biol. 2007;39:1646–58. 38. Camacho M, Agnew A. Glucose uptake rates by Schistosoma mansoni, S. 17. Gobert GN, Tran MH, Moertel L, Mulvenna J, Jones MK, McManus DP, haematobium, and S. bovis adults using a flow in vitro culture system. J Loukas A. Transcriptional changes in Schistosoma mansoni during early Parasitol. 1995;81:637–40. schistosomula development and in the presence of erythrocytes. PLoS Negl 39. Massoulie J, Pezzementi L, Bon S, Krejci E, Vallette FM. Molecular and cellular Trop Dis. 2010;4:e600. biology of cholinesterases. Prog Neurobiol. 1993;41:31–91. You et al. Parasites & Vectors (2016) 9:328 Page 12 of 12

40. Zhu H, Gao W, Jiang H, Jin QH, Shi YF, Tsim KW, Zhang XJ. Regulation of acetylcholinesterase expression by calcium signaling during calcium ionophore A23187- and thapsigargin-induced apoptosis. Int J Biochem Cell Bio. 2007;39:93. 41. Ho WE, Peh HY, Chan TK, Wong WS. Artemisinins: pharmacological actions beyond anti-malarial. Pharmacol Ther. 2014;142:126–39. 42. Hong Y, Donald PM, Geoffrey NG. Current and prospective chemotherapy options for schistosomiasis. Expert Opin Orphan D. 2015;3:195.

Submit your next manuscript to BioMed Central and we will help you at every step:

• We accept pre-submission inquiries • Our selector tool helps you to ﬁnd the most relevant journal • We provide round the clock customer support • Convenient online submission • Thorough peer review • Inclusion in PubMed and all major indexing services • Maximum visibility for your research

Submit your manuscript at www.biomedcentral.com/submit