Production of Recombinant Human Butyrylcholinesterase in Nicotiana benthamiana
by
Robin L. Hayward
A Thesis Presented to The University of Guelph
In partial fulfilment of requirements for the degree of Master of Science in Environmental Sciences
Guelph, Ontario, Canada
Robin L. Hayward, September, 2012
ABSTRACT
PRODUCTION OF RECOMBINANT HUMAN BUTYRYLCHOLINESTERASE
IN NICOTIANA BENTHAMIANA
Robin L. Hayward Advisor: University of Guelph, 2012 Professor J. Christopher Hall
Nerve agents (NAs) inhibit the essential enzyme acetylcholinesterase. Classified as chemical weapons, NAs are considered a threat to soldiers on the frontlines of warzones. Current treatments can prevent death from NA poisoning, but are not effective in preventing convulsions, seizures, or subsequent brain damage.
Butyrylcholinesterase (BChE) binds to NAs, rendering the chemicals harmless to acetylcholinesterase.. Two hundred mg of BChE is the putative prophylactic dose for adult humans, but is difficult to obtain in large quantities from expired human serum.
Although recombinant BChE has been expressed in several organisms, the yields are still low.
Nicotiana benthamiana is an attractive plant for transient protein production due to its quick growth rate, abundance of tissue, and history of successful recombinant protein production. For this research, N. benthamiana was infiltrated with viral based vectors as well as binary vectors containing the human BChE gene. Multiple assays indicated that binary vector BChE-105-1 + P19 enabled the best expression, producing 26 mg BChE/kg tissue. ACKNOWLEDGEMENTS
There are many people, both in the lab and at home, without whom this achievement would not have been possible. Firstly, I would like to thank Dr. J. C. Hall, whose guidance, support and patience is wholeheartedly appreciated. To my committee members Dr. Hung Lee and Dr. Annette Nassuth, I thank you for your advice and direction. To Dr. Michael McLean and Dr. Frey Garabagi I thank you for your interest and expertise. To Linda Veldhuis, Erin Gilbert, and Jessica Rouleau I thank you all for your extensive and valuable technical help, your brainstorming sessions, and your friendship. To John Teat who spent way too many hours infiltrating plants with me, your expertise and patience is appreciated. I would like to thank Haifeng Wang for your advice and superior cloning abilities, and Asma Ziauddin for your enthusiasm and support. I would like to thank Paddy McManus, my office mate and ear lender, and Ashley Meyers,
Brittany Grohs, and Joanna Pistilli, whose friendship and advice are appreciated and valued. I would like to thank Ashley Dickson, without whose suggestion I never would have sought after a masters degree, and Gord Furzer who made it happen. Finally, I would like to thank my mom, dad, brother and sister-in-law for endless financial and emotional support. Your belief in my abilities always surpasses my belief in myself. To
Amanda, Jay, Tara, and Graham, you have stood by me, encouraged me, and distracted me when necessary. And to Ryan, you may now meet the non-student Robin. Thank you for your support and endless understanding.
iii
LIST OF ABBREVIATIONS
Abbreviation Definition
2-PAM (2-pyridine aldoxime methyl chloride (Pralidoxime)
ACh Acetylcholine
AChE Acetylcholinesterase
AP Alkaline phosphatase
AT542 Agrobacterium tumefaciens, strain 542
ATCh Acetylthiocholine
BChE Butyrylcholinesterase
BHK Baby hamster kidney bp Base pairs
BSA Bovine serum albumin
BTCh Butyrylthiocholine cDNA Complementary DNA
ChAT Choline acetyltransferase
CHO Chinese hamster ovary dpi Days post infiltration
DTNB Diothio-bis-nitrobenzoic acid
ER Endoplasmic reticulum
Fab Fragment, antigen binding
FBS Fetal bovine serum
iv
Abbreviation Definition
Fuc Fucose
FucT Fucosyltransferase
GA Tabun
GB Sarin
GD Soman
GF Cyclosarin
GOI Gene of interest hBChE Human butyrylcholinesterase
HBV Hepatitus B virus
IC50 Median inhibition concentration
IgA Immunoglobulin A
KD Dissociation constant kDa Kilodalton
Ki Bimolecular rate constant
Km Michaelis constant
Kp Phosphorylation constant
Ks Reactivation of inhibited enzyme
LB Luria bertani media
LD50 Median lethal dose mAChR Muscarinic acetylcholine receptor
MCS Multiple cloning site mRNA Messenger RNA
v
Abbreviation Definition
NA Nerve agent nAChR Nicotinic acetylcholine receptor nm Nanometre
Nos Nopaline synthase
O/N Overnight
OD Optical density
OD600 Optical density at 600 nm
Osm Osmotin
PBST Phosphate-buffered saline with Tween 20
PCR Polymerase chain reaction
PTGS Post-transcriptional gene silencing
PVX Potato virus X
Rbc Ribulose-1,5-bisphosphate carboxylase oxygenase
RE Restriction enzyme
RER Rough endoplasmic reticulum
RNAi RNA interference rpm Revolutions per minute
RT-PCR Reverse transcriptase polymerase chain reaction
RuBisCO Ribulose-1,5-bisphosphate carboxylase oxygenase scFv Single-chain variable fragment
SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis
vi
Abbreviation Definition
T-DNA Transfer DNA
TBSV Tomato bushy stunt virus
TFF Tangential flow filtration
Ti Tumour inducing
TMP Transmembrane pressure
TMV Tobacco mosaic virus
TNB 5-thio-2-nitro-benzoic acid
TSP Total soluble protein
U Units
UTR Untranslated region vir Virulence genes
Vmax Maximum velocity
Xyl Xylose
XylT Xylosyltransferase
YEP Yeast extract peptone
ΔFX Knock-down N. benthamiana plants with xylose and α-1,3 fucose glycans removed
vii
TABLE OF CONTENTS Acknowledgements...... iii List of Abbreviations ...... iv List of Tables ...... x List of Figures...... xi 1 General overview and research objectives...... 1 1.1 Introduction...... 1 1.2 Hypothesis and research objectives ...... 1 2 Literature review...... 3 2.1 Cholinergic system of vertebrates...... 3 2.1.1 Acetylcholinesterase ...... 5 2.1.2 Butyrylcholinesterase...... 7 2.2 Organophosphate nerve agents ...... 10 2.2.1 Cholinesterase inhibition ...... 12 2.2.2 Symptoms ...... 15 2.3 Treatment of nerve agent poisoning with acetylcholinesterase and butyrylcholinesterase ...... 15 2.4 Acetylcholinesterase and butyrylcholinesterase production...... 18 2.4.1 Mammalian, bacterial and yeast cultures...... 18 2.4.2 Insects ...... 20 2.4.3 Mammals...... 20 2.4.4 Acetylcholinesterase and butyrylcholinesterase in planta...... 20 2.5 Plant production of therapeutic proteins...... 24 2.5.1 Agrobacterium tumefaciens ...... 27 2.5.2 Stable transformation...... 27 2.5.3 Transient transformation...... 29 2.5.4 Glycosylation ...... 30 2.6 Enzyme functionality testing with the Ellman assay ...... 32 2.7 Restatement of research objectives and hypothesis...... 34 3 The production of recombinant human butyrylcholinesterase in Nicotiana benthamiana...... 36 3.1 Materials and methods ...... 36 3.1.1 Cloning of the butyrylcholinesterase gene into viral-based vectors...... 36 3.1.2 Spot infiltrations of Nicotiana benthamiana with ICON genetics modules. 38 3.1.3 Cloning of the butyrylcholinesterase gene into binary vectors...... 42 3.1.4 Spot infiltrations of Nicotiana benthamiana with binary vectors...... 46 3.1.5 Whole plant infiltration of Nicotiana benthamiana with binary vectors...... 48 3.1.6 Determination of enzyme activity using the Ellman assay...... 50 3.1.6.1 Assay I – Determination of units BChE/µg TSP...... 51 3.1.6.2 Assay II – Determination of Km and Vmax...... 51 3.1.7 Purification of BChE from transformed N. benthamiana...... 52 3.1.7.1 Tangential flow filtration (TFF)...... 53
viii
3.1.7.2 Procainamide column...... 53 3.2 Results and discussion ...... 55 3.2.1 Spot infiltrations of Nicotiana benthamiana with ICON genetics modules. 55 3.2.2 Spot infiltrations of Nicotiana benthamiana with binary vectors...... 58 3.2.3 Whole plant infiltration of Nicotiana benthamiana with BChE-105-1 + P19 binary vectors...... 61 3.2.4 Purification of BChE from transformed N. benthamiana...... 64 5 Conclusions and future directions...... 67 6 Literature cited...... 70 7 Appendix...... 81 7.1 Ellman assay SOP...... 81
ix
LIST OF TABLES
Table 1 Butyrylthiocholine hydrolysis by recombinant and wild- type human butyrylcholinesterase as reported in the literature………...... 10
Table 2 Nerve agent toxicity……………………………………...11
Table 3 Rate constants for AChE inhibition by nerve agents, and reactivation of nerve agent inhibited AChE……………...13
Table 4 Dissociation constants for the reactivation of nerve agent inhibited AChE…………………………………………..14
Table 5 Summary of protection experiments of hBChE-treated monkeys against soman and VX administered in an iv bolus injection……………………………………………17
Table 6 Recombinant acetylcholinesterase and butyrylcholinesterase production………………………..22
Table 7 Vmax, Km and mg/kg fresh weight for spot infiltrations with binary vectors.……………………………………………60
Table 8 Vmax, Km and mg/kg fresh weight for whole plant infiltration with binary vectors………………………...…61
Table 9 Purification efficiency of BChE-105-1 + P19 expressed in N. benthamiana…………….…………………………….64
Table 10 Procainamide column purification efficiency …..……….66
x
LIST OF FIGURES
Figure 1 The cholinergic synapse…………………………………...4
Figure 2 Schematic model of the molecular polymorphism of acetylcholinesterase and butyrylcholinesterase…………...6
Figure 3 Schematic structure of the butyrylcholinesterase active site…………………………………………………………8
Figure 4 Schematic representation of a Ti plasmid, binary vector, and helper plasmid……………………………………….28
Figure 5 N-glycans of human antibodies and recombinant hamster, mouse and plant antibodies………………………………31
Figure 6 Chemical structures of acetylcholine, acetylthiocholine, butyrylcholine, and butyrylthiocholine…………………..33
Figure 7 Ellman assay reaction……………………………………34
Figure 8 Sequence alignment of human butyrylcholinesterase and human butyrylcholinesterase codon optimized for Nicotiana benthamiana…………………………………..37
Figure 9 Schematic of binary vectors p103, p104, & p105-anti- atrazine scFv……………………………………………..42
Figure 10 Schematic of recombinant human butyrylcholinesterase binary vectors…………………………………………….45
Figure 11 Whole plant infiltration images………………………….49
Figure 12 Beginning signs of necrotic tissue in N. benthamiana plant spot infiltrated with BChE-TMV, (Day 4 dpi)……..…….55
Figure 13 Western blot of spot infiltration with viral-based vectors….....……………………………………………...56
Figure 14 Electrophoresis gel of BChE cDNA from infiltrated tissue….………………………………………………….57
Figure 15 Butyrylthiocholine hydrolysis of BChE-105-1 and BChE 105-1 + P19 spot infiltrations…………………..………..58
xi
Figure 16 Butyrylthiocholine hydrolysis of BChE-103+P19, BChE - 104 + P19, BChE-105-1+P19 and BChE-105-2+P19 spot infiltration………………………………………………..59
Figure 17 Greenhouse temperatures during post-infiltration/pre- harvest growth periods…………………………………...63
Figure 18 Butyrylthiocholine hydrolysis of BChE-105-1 + P19 and BChE-105-1 + P19 (boiled) to show loss of activity…….63
xii
1 General overview and research objectives
1.1 Introduction
Organophosphate nerve agents are highly toxic compounds. As inhibitors
of the essential enzyme acetylcholinesterase (AChE), these compounds are
lethal at low doses through inhalation, ingestion, or percutaneous exposure, and
are classified as chemical weapons. While current treatments, such as atropine,
pralidoxime and diazepam, do not efficiently prevent convulsions, seizures, and
in some cases brain damage (Doctor and Saxena 2005) , butyrylcholinesterase
(BChE) is a promising treatment for the protection of soldiers (Doctor and
Saxena 2005) in areas with increased threats of chemical exposure. Purification
of BChE from human serum fails to provide sufficient quantities for
prophylactic treatments (Geyer et al. 2010) thus several organisms have been
considered for recombinant BChE production. Plants are currently being used as
biofactories for therapeutic proteins due to their low cost, scalability and safety.
Transient production of BChE in plants, such as Nicotiana benthamiana, could
provide a means of obtaining large quantities of the enzyme at a relatively low
cost.
1.2 Hypothesis and research objectives
Hypothesis – Recombinant human butyrylcholinesterase can be transiently
produced in sufficient quantities, i.e. 200 mg/kg fresh tissue, in glycomodified
Nicotiana benthamiana to enable prophylactic treatment of nerve agent
poisoning.
1
Main research objectives are to: i. Transiently express recombinant human butyrylcholinesterase in
glycomodified Nicotiana benthamiana, using various plant-based
expression systems ii. Assess recombinant human butyrylcholinesterase functionality by
determining Km and Vmax values. iii. Purify the recombinant human butyrylcholinesterase from Nicotiana
benthamiana leaf tissue.
2
2 Literature review
2.1 Cholinergic system of vertebrates
The nervous systems of all vertebrates rely on neurotransmitters and
receptors for inhibition or excitation (Salvaterra 2001). Neurons release
transmitters into the synaptic cleft, where they can bind to their receptors. If the
receiving receptor is part of another neuron, it will release a transmitter and the
message will continue. If the receptor is in the neuromuscular junction, then
muscular excitation will take place (Salvaterra 2001). Acetylcholine (ACh) is a
neurotransmitter of the nervous system found in all vertebrates, and is an ester
of choline and acetic acid (Salvaterra 2001). Choline present in the cytoplasm is
acetylated by choline acetyltransferase (ChAT), resulting in ACh (Parsons et al.
1993). Much of the resulting ACh is stored in synaptic vesicles and is released
from the nerve terminal into the synaptic cleft from the opening of voltage-
dependent calcium channels, initiated by an action potential (Parsons et al.
1993). Once released into the synaptic cleft, in response to excitation of a
cholinergic neuron, ACh can bind to receptor proteins (Figure 1). Receptors of
ACh are classified as either nicotinic (nAChR) or muscarinic (mAChR) type
receptors of ACh because they bind nicotine and muscarine, respectively
(Salvaterra 2001). nAChRs are involved with fast synaptic transmissions that
occur at neuromuscular junctions, autonomic ganglia, as well as the central
nervous system (Taylor 1996). When bound with ACh, these ligand-gated ion
3
Figure 1. The cholinergic synapse. Acetylcholine-coenzyme A (Acetyl-CoA) and choline are synthesized into acetylcholine (ACh) by choline- acetyltransferase (ChAT). Vesicular ACh transporter (vAChT) moves ACh into synaptic vesicles. ACh are released into the synaptic cleft when an action potential occurs. Once in the synaptic cleft, ACh binds to post-synaptic receptors, such as muscarinic receptors (M1 and M2). AChE-R (monomers within the synaptic cleft) and AChE-S (tetramers attached to the neuromuscular junction) hydolyzes ACh. Reprinted by permission from Macmillan Publishers Ltd: Nature Reviews, Neuroscience, Soreq and Seidman, Acetylcholinesterase – New Roles for an Old Actor, (2001)
channel receptors trigger either an end-plate potential on skeletal muscles, or they initiate an excitatory postsynaptic potential in a nerve (Taylor 1996). mAChRs are generally located on autonomic effector cells, found in the parasympathetic neuroeffector junction. These G-protein receptors are stimulated by postganglionic parasympathetic nerves, resulting in a slow
4
metabolic response which utilizes secondary messengers (Brown and Taylor
1996).
2.1.1 Acetylcholinesterase
The release of ACh into the synaptic cleft, and subsequent binding to
receptors, results in stimulation of neural or neuromuscular cells. Removal of
ACh must occur to prevent continuous signalling in the synapses. This role is
fulfilled by the enzyme acetylcholinesterase (AChE) (EC 3.1.1.7), which
hydrolyzes ACh to acetic acid and choline (Quinn 1987). AChE has one of the
highest reported rates of catalysis, with a turnover of 104 s-1 (Quinn 1987). It is
composed of subunits, either globular or asymmetric, and each subunit has a
single active site (Quinn 1987). Globular units consist of G1 monomer (single
subunit ~65 kD), G2 dimer (two subunits linked by disulfide bonds ~130 kD),
and G4 tetramer (two dimers ~260 kDa held together by hydrophobic
interactions) (Figure 2). Asymmetric units, found in mammalian skeletal
muscle, consist of A4 (single tetramer), A8 (2 tetramers), or A12 (3 tetramers)
linked to a collagen tail (Quinn 1987). Subunits are encoded by a single gene
(Fernandez et al. 1996), but form different structures as a result of alternative
mRNA splicing (Shen et al. 2002).
The G1, G2, and G4 forms of AChE are translated and synthesized in the
rough endoplasmic reticulum (RER). The assembly of A4, A8, and A12 take
place in the Golgi apparatus (Fernandez et al. 1996). G1 is found in the soluble
fraction of the ER, G2 and G4 are found anchored to the plasma membrane, and
A12 is found anchored to the basal lamina in the neuromuscular junction, where
5
Figure 2. Schematic model of the molecular polymorphism of AChE and BChE. Open circles designate catalytic subunits. Disulphide bonds are indicated by S- S. Hydrophilic forms are G1, G2 and G4 forms. The asymmetric A12 forms have three hydrophilic G4 heads linked to a collagen tail via disulphide bonds. The G4 amphiphilic forms are anchored into a phospholipid membrane through a 20 kDa anchor. The G2 amphiphilic forms of erythrocytes have a glycolipid anchor. Reproduced with permission, from Chatonnet and Lockridge, (1989) Comparison of Butyrylcholinesterase and Acetylcholinesterase Biochemical Journal, 260 625-634. The Biochemical Society.
6
it helps regulate ACh concentrations. Each subunit of AChE has an active site,
which is at the base of a narrow gorge about 20 Å long (Shen et al. 2002). Due
to electrostatic attraction, the ligand and enzyme collide at a rapid rate. ACh
enters the gorge, and then must move through a bottleneck in the channel,
which is open wide enough less than 5% of the time. As ACh moves along this
channel, water molecules must be moved away. A secondary channel exists,
allowing these water molecules to move in and out of the enzyme (Shen et al.
2002).
Once in the region of the active site, ACh binds to the catalytic triad of a
Ser, His and a Glu (Zhang et al. 2002). The Ser is used as a nucleophilic
attacking group, the His acts as a acid-base catalytic component, and it is
believed that the Glu plays a role in stabilization of the reaction. The reaction
takes place in two steps; first acylation, then deacylation. The Ser O is added to
the carbonyl C of ACh, expedited by a proton transfer from the Ser to the His
residue (Zhang et al. 2002). The result is acetic acid and choline, which then
exits the gorge; choline is taken up by the pre-synaptic neuron and used to
synthesize more ACh (Salvaterra 2001).
2.1.2 Butyrylcholinesterase
Butyrylcholinesterase (BChE) (EC 1.1.1.8) is an enzyme found in most
vertebrates (Chatonnet and Lockridge 1989). In humans, BChE is synthesized in
the liver (Lockridge 1988) and has been found in plasma at a concentration of 5
µg/mL (Weber et al. 2011). Similar to AChE in both structure and function,
BChE can hydrolyze ACh. Like AChE, BChE is made up of 1, 2 or 4 identical
7 subunits. Each subunit has a MW of 85 kDa (a dimer is 170 kDa and a tetramer is 340 kDa) (Weber et al. 2011). Within human serum, BChE is predominantly found in the tetrameric form (Blong et al. 1997). There is no known physiological function of BChE; however, it can act as a bioscavenger (Blong et al. 1997), hydrolyzing cocaine and succinylcholine, as well as binding organophosphates (OPs) (Wei et al. 2000). As with AChE, the BChE catalytic
Figure 3. Schematic structure of cholinesterase active site of butyrylcholinesterase monomer. A, alanine; D, aspartic acid; E, glutamic acid; G, glycine; H, histidine; L, leucine; S, serine; V, valine; W, tryptophan; Y, tyrosine. Reproduced with permission, from Cokugras, (2003) Butyrylcholinesterase: Structure and Physiological Importance Turkish Journal of Biochemistry, 28 (2) 54-61.
8 triad which hydrolyzes ACh is composed of a Ser, His and Glu (Weber et al.
2011).
The catalytic mechanism of BChE consists of the peripheral anionic site
(Asp70 and Tyr332) binding to the substrate (Weber et al. 2011) (Figure 3). The substrate then moves down further into the gorge and binds to Trp82. This occurs due to the coming together of the arms of the omega loop (Cokugras
2003), which is a surface loop (Cys65- Cys92) connecting Asp70 and Trp82
(Masson et al. 2001). Gly116, Gly117, and Ala199, known as an oxyanion hole, aid in rotating the substrate (vertical to horizontal), where it binds to the active site (Ser198, His438, and Glu325) and is hydrolyzed (Cokugras 2003; Weber et al. 2011). Here it is stabilized by Leu286 and Val288 (Cokugras 2003).
Hydrolysis occurs due to a “charge relay system”, where His438 moves electrons from Glu325 to Ser198. The hydroxyl oxygen of Ser198 then becomes a nucleophile. An acyl-enzyme intermediate and a free choline moiety are the result of nucleophilic attack on Ser198. Finally, the acyl-enzyme group is hydrolyzed from Ser198 by a nucleophilic attack by a water molecule, which is activated by procurement of a proton from His438 (Cokugras 2003).
Fourteen aromatic amino acid residues line the active site gorge of AChE
(Cokugras 2003). In BChE, six of these are replaced by aliphatic amino acid residues, resulting in a larger active site gorge in BChE (Cokugras 2003).
To compare the activity of BChE between production systems, Michaelis-
Menten kinetics are used. Maximum velocity, or Vmax, is measured at infinitely large substrate concentrations (i.e. the maximum rate achieved), and is
9
Table 1. Butyrylthiocholine hydrolysis by recombinant and wild-type human butyrylcholinesterase as reported in the literature.
Production Organism Recombinant BChE Native Human Reference
BChE
Km (µM)
Nicotiana benthamiana 146 ± 26 147 ± 24 Geyer et al., (2010)
CHO cells 150 20 Lockridge et al.,
(1997)
Human embryonal - 50 Kaplan et al., (2001) kidney-derived cell line Bombyx mori 17.7 - Li et al., (2010)
(silkworm)
Bombyx mori 185 181 Wei et al., (2000)
(silkworm)
calculated by fitting data to the equation for a hyperbola (Horton et al. 2006). The
Michaelis constant, or Km, is used to describe a substrate’s concentration when
the initial velocity (i.e. reaction rate), or V0, is equal to one-half of the Vmax
(Horton et al. 2006). Km is often chosen as the value used to compare the affinity
of enzymes for their substrates or cofactors (Table 1). There is variability in the
reported Km values of native BChE, as pointed out by Geyer et al., (2010).
2.2 Organophosphate nerve agents
Organophosphates (OPs) were first synthesized in 1930s Germany by Dr.
Gerhard Schrader of I.G. Farbenindustrie (Tucker 2006). He had been
investigating new compounds for use as insecticides, as Germany wanted to
10 reduce its dependence on both imported food and pesticides (Tucker 2006). His research resulted in nerve agents (NAs) extremely high in mammalian toxicity, specifically tabun and sarin, both of which went into development as chemical weapons (Marrs 2007), but were never used in battle (Watson et al. 2006).
Other NAs, such as soman, cyclosarin and VX, were synthesized within 10 years after WWII. NAs were used in two terrorist attacks in Japan in 1994 and
1995 (Ohbu et al. 1997), and allegedly used in an attack against Kurdish people in Iraq in 1988 (Reutter 1999).
Table 2. Nerve agent toxicity. Estimated human LD50 of nerve agents with percutaneous and inhalation exposure. Table adapted from the Review of Acute Human-Toxicity Estimates for Selected Chemical-Warfare Agents (NRC 1997)
Percutaneous Inhalation Vapour LD50, mg/kg LD50, mg/kg Tabun 21 135
Sarin 24 70
Soman 5 70
Cyclosarin 5 35
VX 0.1 30
There are two main classifications of NAs; G agents and V agents
(Watson et al. 2006). The G series, likely meaning “German”, include tabun
(GA), sarin (GB), soman (GD) and cyclosarin (GF). The V series, believed to
11
be named for “Venom”, contain VG and VX, the latter being synthesized in the
United Kingdom in the 1950s (Watson et al. 2006).
VX is much less volatile than tabun, which is less volatile than sarin or
soman (Marrs 2007). As it is a non-volatile liquid, VX is not as toxic when
inhaled, unless it is aerosolized (Table 2). When pure, all nerve agents are
colourless liquids. Most are odourless, except for tabun, which has a fruity
scent. Tabun, as well as VX, are easier NAs to produce because they lack
fluorine groups. Sarin, soman and cyclosarin all have fluorine leaving groups
that require hydrofluoric acid for synthesis. Hydrofluoric acid is corrosive to
glass, so production must occur in a silver-lined vessel (Marrs 2007).
2.2.1 Cholinesterase inhibition
The mechanism of action of NAs is the inhibition of AChE (Marrs 2007).
The Ser hydroxyl group of the enzyme is phosphorylated by the NA, and the
enzyme cannot hydrolyze ACh, resulting in the accumulation of the
neurotransmitter and subsequent continuous stimulation of the ACh receptors.
The reaction is similar to what takes place with the acetylation of the enzyme
with ACh. With acetylation, AChE can hydrolyze the neurotransmitter rapidly
and be reactivated (Marrs 2007). Although hydrolysis does occur with NAs, it is
the leaving group that is hydrolyzed, and the highly stable phosphoryl group
remains bound to the serine residue, thus inhibiting any further enzyme activity
12 against the intended target (Fukuto 1990). The equation for the reaction of
AChE and a NA is:
KD Kp Ks E + PX ⇔ EPX ⇒ EP + X ⇒ E + P
|______| Ki
Where E is the enzyme (AChE), PX is the substrate (NA), EPX is the enzyme and substrate complex (reversible complex), EP is the phosphorylated enzyme, X is the leaving group, and P is the phosphoryl group (Marrs 2007).
KD, dissociation constant, is a measure of the dissociation of the enzyme and inhibitor compound that estimates binding. Kp, the phosphorylation constant, estimates the reactivity of the inhibitor compounds. Ki, the bimolecular rate constant, estimates the potency of the inhibitor compounds, and is equal to
Kp/KD (Fukuto 1990). Ks is the
Table 3. Rate constants for AChE inhibition by nerve agents, and reactivation of nerve agent inhibited AChE. Table taken from Worek et al. (2004).
-1 -1 -1 Organophosphate ki (M min ) ks (h ) VX 1.2 ± 0.002 x 108 0.021 ± 0.001 Sarin 12.7 ± 0.1 x 107 Ø* Soman 9.2 ± 0.4 x 107 Ø* Cyclosarin 4.9 ± 0.006 x 108 Ø* Tabun 7.4 ± 0.2 x 106 Ø* * No reactivation of AChE occurred during the observation period of 10-63 h as discussed in Worek et al. (2004)
13
reactivation of the inhibited enzyme (Worek et al. 2004). Both the inhibition
and the reactivation of inhibited AChE differs depending on the NA (Table 3)
(Worek et al. 2004).
In normal situations, reactivation of AChE after acetylation with ACh
takes place in a fraction of a millisecond (Patocka et al. 2005). Conversely,
reactivation after phosphorylation, i.e., reversal of inhibition, is extremely slow.
It is essentially irreversible unless there is introduction of a nucleophilic agent,
such as an oxime. Pyridinium oximes, such as pralidoxime (2-PAM), HI-6, HLö
7 and obidoxime will reactivate AChE by removing the phosphoryl group from
a phosphorylated enzyme, resulting in phosphorylation of the oxime and, hence,
a reactivated enzyme (Patocka et al. 2005). Such reactivation by oximes occurs
for both NAs (Table 4) and OP insecticides (Worek et al. 2004). However,
oximes are ineffective against enzymes that have undergone the process of
“aging”. “Aging” is characterized by dealkylation of the phosphoryl moiety,
which can occur after
Table 4. Dissociation constants for the reactivation of nerve agent-inhibited AChE. Table taken from Worek et al. (2004).
OP Obidoxime Pralidoxime HI 6 HLö 7
KD (µM) VX 27.4 28.1 11.5 7.8 Sarin 31.3 27.6 50.1 24.2 Cyclosarin 945.6 3159 47.2 17.9 Tabun 97.3 ± 10.6 706 ± 76 Ø 106.5 ± 15 * No HI-6 reactivation of AChE when inhibited with tabun occurred during the observation period of 10-63 h as discussed in Worek et al. (2004)
14
phosphorylation of the Ser residue (Sultatos 2006). An alkyl group is removed,
leaving a negatively charged serine ester that cannot be reactivated by an oxime
(Sultatos 2006). The rate of aging differs depending on which NA or OP
insecticide is inhibiting AChE (Worek et al. 2004).
2.2.2 Symptoms
When excess amounts of ACh bind to muscarinic ACh receptors, the
parasympathetic system is affected. The primary symptoms are: redness and
swelling of the eyes, miosis, eye muscle spasm, nasal and bronchial secretion,
poor appetite, vomiting, abdominal cramps, sweating, diarrhea, bradycardia and
low blood pressure (Watson et al. 2006). Excessive nicotinic ACh receptor
stimulation affects the somatic and sympathetic system, the symptoms of which
are muscle twitch and paralysis. The central nervous system is also affected by a
sharp increase in receptor stimulation, and the mammalian symptoms of this
are: confusion, anxiety, slurred speech, forgetfulness, fatigue, and respiration
difficulties. With mammalian exposure to nerve agents, death occurs from a loss
of respiratory control (Watson et al. 2006).
2.3 Treatment of nerve agent poisoning with acetylcholinesterase and butyrylcholinesterase
There are several options for treatment of exposure to NAs; mainly,
administration of atropine, pyridinium oximes, diazepam and human
cholinesterases. Atropine is used to counteract the effects of AChE inhibition at
the muscarinic sites (Marrs 1993). Competing against the muscarinic ACh
receptors, atropine is anticholinergic and alleviates the symptoms of excessive
15 muscarinic receptor stimulation, such as miosis, diarrhea, nasal and bronchial secretions, and bradycardia (Lallement et al. 1997). Pyridinium oximes, such as pralidoxime (2-PAM), HI-6 and obidoxime are administered to reactivate the phosphorylated AChE. Diazepam acts as an anticonvulsant. Atropine, pyridinium oximes and diazepam can be administered together or individually, and should be taken as soon as possible after exposure to a nerve agent, preferably within the first 6 hours (Lallement et al. 1997).
These three treatments will prevent death from NA exposure; however, they are not reliable in preventing convulsions, seizures, or subsequent brain damage (Doctor and Saxena 2005). Human cholinesterases can be used as a prophylactic treatment against NA toxicity, and will prevent these post- exposure symptoms. Either AChE or BChE can be used, and will bind the NA at a 1:1 molar ratio (Huang et al. 2007). Prophylactic treatment with one of these enzymes will sequester the nerve agents before the native AChE can be inhibited (Raveh et al. 1993). The putative dose for humans is 200 mg of BChE per 70 kg to protect against 2X LD50 of soman (Saxena et al. 2008). There is currently no putative human dose for AChE.
Fetal bovine serum AChE (FBS-AChE) has been tested as a prophylactic treatment against VX, soman and MEPQ (an intravascular ChE inhibitor) in mice, and was shown to confer protection against the effects of exposure (Wolfe et al. 1987; Raveh et al. 1989; Ashani et al. 1991). In the 1987 publication by
Wolfe et al., mice were injected with 10.89 nmol FBS-AChE ~20 hrs before
16
challenge with VX. The results were 5/5 mice surviving 2.12 x LD50 of VX,
4/5 surviving 3 x LD50, and 1/4 surviving 4.2 x LD50 of VX.
Table 5. Summary of protection experiments of hBChE-treated monkeys against soman and VX administered in an iv bolus injection. Table taken from Raveh et al. (1997)
hBChE:OP hBChE Monkey OP xLD50 Toxic Signs nmol ratio (nmol)* Moderate toxic signs, 1 Soman 062 259 3.3 recovered after 4 hr 2 Soman 0.67 239 2.8 None Severe toxic 3 Soman 0.71 368 4.1 signs 4 Soman 0.76 272 2.7 None 5 Soman 0.89 358 3.3 None Mild weakness, 6 Soman 0.91 374 3.3 recovered within 2 hr Mild weakness, 7 Soman 0.94 290 2.3 recovered after 15 min 8 Soman 1.18 309 1.7 None Severe toxic 9 VX 0.64 217 2.6 signs Moderate 10 VX 0.67 195 2.6 toxic signs 11 VX 1.19 323 2.1 Mild 12 VX 1.56 527 2.3 None * hBChE in the circulation of monkeys prior to injection of the challenge. Endogenous BChE activity subtracted
As well, human serum BChE has been tested and shown to be effective as
a prophylactic treatment against tabun, VX, sarin, soman and MEPQ in mice
and rats (Ashani et al. 1991; Raveh et al. 1993), and against soman and VX in
17
Rhesus monkey (Raveh et al. 1997) (Table 5) and Guinea pig (Allon et al. 1998;
Saxena et al. 2011).
2.4 Acetylcholinesterase and butyrylcholinesterase production
To obtain AChE and BChE for the purpose of prophylactic treatment, the
first consideration was retrieval of the enzymes from serum. AChE was purified
from fetal bovine serum (Hoz et al. 1986) and BChE was purified from horse
serum (Main et al. 1974) and expired human serum (Saxena et al. 2008). Two
hundred mg of human BChE was isolated from 80 L of human plasma
(Grunwald et al. 1997). Since 80 L of plasma contains approximately 280 mg of
BChE, this was an efficient purification. However, since 200 mg is the putative
dose for the average adult human, a better source (i.e. better yield) than plasma
is needed. Thus, researchers have been looking for alternate means of producing
BChE.
2.4.1 Mammalian, bacterial and yeast cultures
In 1992, Kronman et al., reported recombinant hAChE expressed in
human embryonic kidney cell line 293, capable of hydrolyzing 1500 nmol
acetylthiocholine per minute. The secreted recombinant enzyme appears in the
monomeric, dimeric and tetrameric globular forms (Velan et al. 1991). Clones
expressing and secreting as much as 25 pg of enzyme per cell (200 mg/2.5x1010
cells) per 24 h resulted in 6000 units per mg BChE (Kronman et al. 1992)
(Table 6).
18
Recombinant rat AChE was expressed in the yeast Pichia pastoris by
Morel and Massoulie (1997), at about 1 mg of enzyme per litre of culture medium. The following year, Heim et al. (1998) compared expression of recombinant rat brain AChE in Escherichia coli and P. pastoris. AChE expression in E. coli occurred mainly in cytoplasmic inclusion bodies. The inclusion bodies, refolded in vitro, yielded up to 1.42 U/mg of active AChE which, when purified, resulted in 250 U/mg AChE. In yeast the yield was 1x10-
9 U/mL in the medium (Heim et al. 1998).
Ma et al. (2006) reported that human cerebral tissue AChE was expressed in P. pastoris. Seventy-six percent of the total secreted protein consisted of
AChE, and was present in the supernatant at 40 U/mL. After anion-exchange and affinity chromatography purification, the concentration of enzyme was 200
U/mg BChE (Ma et al. 2006).
Mutant Nippostrongylus brasilienis (gastrointestinal nematode parasite of rats) AChE was expressed and secreted in P. pastoris by Richter et al. (2006) and resulted in 2000 mg/L of nbAChE being found in the supernatant.
Nachon et al. (2002) reported recombinant human BChE expression in
Chinese hamster ovary (CHO) cells, up to 5 mg/L of culture. Duysen et al.
(2002) increased the half-life of hBChE expressed as monomers and dimers in
CHO mammalian cells by expressing a mutant that assembled into tetramers.
The activity was not affected, but half-life in the circulation of rats and mice was increased from minutes to 16 hours (Duysen et al. 2002).
19
2.4.2 Insects
Recombinant human BChE was expressed via a baculovirus vector, which
was used to infect Bombyx mori (silkworm) cells as well as silkworm larvae
(Wei et al. 2000). The resulting amounts of secreted enzyme were 1.5 mg/L of
culture media for the cells, and 35 mg/L of hemolymph for the larvae (Wei et al.
2000). In 2010, rhBChE was again expressed via a baculovirus vector in B.
mori, with 6.4 units/larvae being produced (Li et al. 2010).
2.4.3 Mammals
Huang et al. (2007) successfully expressed recombinant human BChE in
the milk of transgenic goats. Expression levels reached up to 5000 mg/L of
active enzyme. Although monomers, dimers and tetramers were produced,
dimers were the predominant form produced (Huang et al. 2007). This
production method has produced the greatest yield of BChE to date, however,
there are concerns with therapeutic protein production in animals. The process
of herd establishment is lengthy and can take several years before production
can occur (Larrick and Thomas 2001). As well, animals such as goats are
susceptible to infections diseases which can, and do, devastate livestock herds
(Larrick and Thomas 2001). Due to these concerns, researchers continue to look
for alternate means to produce recombinant BChE.
2.4.4 Acetylcholinesterase and butyrylcholinesterase in planta
In 2001, Mor et al. (2001) expressed AChE-E4, a recombinant isoform of
human AChE, in tomato plants. The fresh-weight activities measured up to 1 x
20
10-9 U/mg of fresh leaf tissue (Table 6), which is low compared to the 40 U/mL of human cerebral tissue AChE produced in yeast by Ma et al. (2006). When inhibited by neostigmine (a reversible acetylcholinesterase inhibitor),
BW284c51 (an AChE-specific bisquaternary inhibitor), paraoxon (a model OP compound), and iso-OMPA (a BChE-specific OP), the results of this in planta produced AChE were comparable to the inhibition achieved with human erythrocyte AChE and transgenic mice AChE. The authors assumed that the slight difference that does exist is due to the variations between monomeric and dimeric activity, as well as post translational modifications, such as glycosylation (Mor et al. 2001).
In 2005, Geyer et al. (2005) engineered a codon-optimized gene of a recombinant AChE monomeric isoform (AChE-R) for stable expression in N. benthamiana. They achieved approximately 19 U/mg total soluble protein extracted from leaf tissue. After purification, the specific activity was over 3000
U/mg protein, with a yield of 2.4 mg AChE/kg fresh weight (Geyer et al. 2005).
In 2007, Tama Evron et al. (2007) tested recombinant AChE-R (AChE with a C-terminus that directs production of AChE monomers) protection against OPs. Citing Kaplan et al. (2001), they explain that AChE displays faster binding kinetics to OPs than BChE, resulting in smaller dose requirements. This is an idea shared by Raveh et al. (1993), who showed that when inhibited by soman or sarin, hBChE reacts approximately 1.5 fold slower than hAChE. As well, Evron et al. tested Km values for plant derived AChE-R, human AChE-S
(AChE with a C-termini that directs production of AChE dimers and tetramers),
21
al. 2001)
References (Kronman al. et 1992) (Morel1997) al. et (Heim1998) al. et (Heim1998) al. et (Ma2006) al. et (Richter al. et 2006) (Nachon al. et 2002) (Wei2000) al. et 2010) (Lial. et (Huang2007) al. et (Moret (Geyer2005) al. et (Geyer2007) al. et (Geyer2010) al. et
g (Purified) /mg
Yield Yield U/mg6000 - - - U 250 - U/m 200 ------mg/kg 2.4 - - -
.
tissue mph
(avg) (high)
leaf
g
TSP TSP TSP m TSP culture TSP culture L hemoly L U/
9 m -
U/mL U/ .2 x 10
Units - - 0.1 U/mg 1.42 - U/mL40 - - - - U/larvae 6.4 2 - 1 U/mg19 U/mg 0.265 U/mg 0.22 U/mg 10.2
)
Nicotiana benthamiana Nicotiana
(avg)
*
(high *
cell * TSP mg/ leaf tissue
g 8 g TSP g - g/L culture g/L milk g/L g TSP g 10 m m
000 000
ato plants, and and plants, ato Amount x 2.5 culture mg/L 1 - - - - - 2 culture mg/L 5 hemolymphmg/L 35 - - 5 - mg/kg 30 mg/ 0.37 mg/ 0.31 mg/14
) east
(yeast) (y (yeast) (yeast)
(silkworm) (silkworm) i
Organism kidney embryonic Human cells pastoris Pichia pastoris Pichia coli Escherichia pastoris Pichia pastoris Pichia cells mammalian CHO mori Bombyx mor Bombyx Goat plants Tomato benthamiana Nicotiana benthamiana Nicotiana benthamiana Nicotiana
yeast, silkworm, goats milk, tom milk, goats silkworm, yeast, , AChE
E4 R s - - - brasilienis brasilienis AChE Table 6. Recombinant acetylcholinesterase and butyrylcholinesterase production by various scientists in mammalian cells, mammalian in scientists by various production butyrylcholinesterase and acetylcholinesterase 6. Recombinant Table coli Escherichia Enzyme hAChE AChE Rat AChE Rat AChE Rat h N. hBChE hBChE hBChE hBChE AChE AChE AChE hBChE * values determined by converting with 718 U/mg BChE as published in Weber et al., (2011) al., et Weber in published U/mgBChE 718 as with converting by determined values *
22 and cell culture-derived human AChE-S. The mouse trials indicated that pre- treatment with AChE-R 10 min before challenge, reduced mortality, even with less than a 1:1 molar ratio with paraoxon. Although symptoms arose in all the mice, some did recover and survive. With increased quantities of AChE-R, increased protection was achieved: moderate symptoms were observed in mice with AChE-R/paraoxon ratios of >0.09, mild symptoms at >0.2, and no symptoms showing with AChE-R/paraoxon ratio of >0.5 (Evron et al. 2007).
Geyer et al. (2007) expressed codon optimized AChE-S (Mor et al. 2001) in N. benthamiana (Mor et al. 2001; Geyer et al. 2007). Comparing non- optimized to optimized sequences, they report an increase in plant tissue from
0.058 U/mg TSP to 0.265 U/mg TSP (Geyer et al. 2007).
Currently, research has moved away from AChE production and has focussed on BChE. This is mainly due to the postulated reduction of complications from introducing large concentrations of BChE, as administration of large concentrations of AChE is controversial due to the enzymes’ important role in the human nervous system. In 2008, Geyer et al. (2008) reported stable production of BChE in N. benthamiana. In 2010, the same group reported stable expression of codon-optimized hBChE for N. benthamiana (pBChE) compared to stable expression of non-codon optimized hBChE in N. benthamiana (Geyer et al. 2010). Both constructs included a SEKDEL tag for endoplasmic reticulum
(ER) retention. Expression of the codon-optimized pBChE resulted in an overall accumulation of 1.84 ± 0.22 U/mg TSP in leaf tissue with the highest value being 10.1 U/mg TSP; whereas expression of native hBChE resulted in a mean
23
of 0.33 ± 0.03 U/mg TSP with a maximal yield of 2.2 U/mg TSP (Geyer et al.
2010).
Geyer et al. (2010) published a follow-up paper, in which further
experiments were performed with pBChE expressed in N. benthamiana. The
steady-state kinetics of pBChE was compared to hBChE. The Km of pBChE for
the substrate butyrylthiocholine was essentially the same as native hBChE (147
µM and 146 µM, respectively). pBChE was incubated with paraoxon to
determine its ability to scavenge OPs. Again, the results were very similar
-8 -8 between pBChE and hBChE, the IC50 values were 0.65 x 10 M and 1 x 10 ,
respectively (Geyer et al. 2010). pBChE was also tested as a prophylactic
against soman in guinea pigs. Two hours after being injected with a dose of
26.15 mg/kg pBChE , none of four guinea pigs showed symptoms of exposure.
After 24 hours one of the four died, while the other three guinea pigs showed no
signs of toxicity to soman (Geyer et al. 2010).
2.5 Plant production of therapeutic proteins
Biopharmaceuticals are most commonly produced in mammalian or
bacterial cells (Karg and Kallio 2009). Many organisms have been used for
production of therapeutic proteins: Bacteria (E. coli, Bacillus subtilis),
mammalian cells (CHO cells, baby hamster kidney (BHK) cells, mouse
myeloma cell lines, hybridoma cell lines), yeasts (Saccharomyces cerevisiae, P.
pastoris, Schizosaccharomyces pombe), filamentous fungi (Aspergillus niger,
Asperfillus oryzae), insect cells and transgenic animals (Karg and Kallio 2009).
24
The biopharmaceutical industry has been growing rapidly and in 2007 accounted for about 10% of the pharmaceutical market (Karg and Kallio 2009).
In that year as well, biopharmaceuticals made up 20% of newly approved drugs and 40% of drugs in research. When biopharmaceuticals were in the early stages, they consisted mainly of replacement therapy hormones. Currently, antibodies and other therapeutic proteins, such as enzymes, are being produced
(Gomord et al. 2010).
With the advent of humanized antibody production, the applications for this technology have increased and with it the demand for production on a larger scale (Stoger et al. 2005). Industry has responded to this growing demand by optimizing product yield, increasing the number of production facilities, and by using novel production systems, such as plants (Karg and Kallio 2009).
Plants are an attractive production system as a result of their lower production costs, unlimited scalability and safety (Stoger et al. 2005). The lower production costs come as a result of some plants ability to produce large quantities of biomass in a relatively short period of time, without the requirement for expensive media. The scalability is an advantage as production can range from a small greenhouse, to acres of land (Stoger et al. 2005). A higher level of safety is achieved due to plants inability to carry human or zoonotic pathogens (Karg and Kallio 2009). In addition, the targeting of proteins to plant cell compartments, for example the cytosol, apoplast, endoplasmic reticulum, chloroplast, etc. (Meyers et al. 2011), as well as their
25 ability for full post-translational modifications, make plants ideal for recombinant protein production.
Full-size antibodies, Fab fragments, diabodies, single chain antibody fragments (scFvs) and heavy-chain camelid antibodies have been expressed in planta (De Muynck et al. 2010). In addition, many different species of plants have been used for recombinant protein production: Nicotiana tabacum,
Nicotiana benthamiana, potato, rice, wheat, oil seed rape, tomato, alfalfa, and
Arabidopsis (Karg and Kallio 2009).
Planet Biotechnology Inc. produces CaroRx™, an IgA against tooth decay caused by Streptococcus mutans, in tobacco. This drug has been approved for human use in the E.U. As well, Cobento AS has produced human intrinsic factor (a dietary supplement) in Arabidopsis, which has also been approved for human use in the E. U. (Karg and Kallio 2009). Another example of approved proteins comes from SemBioSys Genetics Inc., who produces recombinant proteins, specifically insulin, in oil bodies of safflower grown in the field. In this method, recombinant plants produce seeds containing oil bodies which will bind to plant derived proteins (Meyers et al. 2011), making separation of the proteins from plant material straightforward. In addition, the expression of
Hepatitis B virus (HBV) surface antigen in tobacco has added to the knowledge of the production of antigens in plants, as well as the production of edible vaccines (Karg and Kallio 2009).
26
2.5.1 Agrobacterium tumefaciens
Generally, transformation of plants or plant cells for the expression of
foreign proteins is either achieved by Agrobacterium mediated gene transfer or
by particle bombardment (biolistics) (Meyers et al. 2011), the most common
being the use of Agrobacterium tumefaciens (from here on in referred to as
Agrobacterium). Agrobacterium is a soil-borne bacterium with the unique
ability to transfer a part of its DNA to the genome of a plant via infection (Finer
2010). Agrobacterium contains tumor-inducing (Ti) plasmids (Figure 4) which
have the necessary genes for host cell transformation, specifically, virulence
genes (vir) and left and right borders, which define the transfer DNA (T-DNA)
region (Meyers et al. 2011). There are also peripheral genes, such as oncogenes
and opine genes, which produce tumors. In response to host signals, T-DNA is
excised from the Ti plasmid, exported to the host cell, and becomes
incorporated into the host genome. This natural process has been manipulated
for the purpose of expressing foreign genes in planta (Meyers et al. 2011).
2.5.2 Stable transformation
Stable transformation refers to the permanent alteration of a plant, by
changes made to its genome. Stable transformation of a plant can be performed
by three general methods (Chawla 2007). The first is by wounding a plant, for
example a decapitated seedling, and then inoculating the wound with
Agrobacterium. This results in tumour growth, or callus, which can be grown in
tissue culture. A second method is the isolation of protoplasts which are then
27
Figure 4. Schematic representation of a Ti plasmid (A), and diagrams of a typical binary vector (B) and a helper plasmid (C) used for transformation. Reprinted from Physiological and Molecular Plant Pathology Vol 76, Păcurar et al. Agrobacterium tumefaciens: From crown gall tumors to genetic transformation. 76-81 © 2011 with permission from Elsevier.
28
incubated with Agrobacterium. Cocultivation occurs for a few days, and then
selection media are used to select transformants. The third, and most common,
method of stable plant transformation is the leaf disc method. With this method,
explants are excised and incubated in Agrobacterium for several hours. After
incubation they are cultured on media that promote bacterial growth. Next, they
are placed on media which kill the bacteria, then finally placed on selection
media which will select for the transformed plants (Chawla 2007).
In order to deliver the gene sequences via Agrobacterium to plant cells,
binary-vectors are often used (Meyers et al. 2011). With this method, two
vectors are inserted into Agrobacterium. The first plasmid contains vir genes,
but not the T-DNA, oncogenes, and opine genes. The second plasmid contains
the left and right borders and the gene of interest (GOI), which is transferred to
the host plant by the vir proteins from the first vector (Meyers et al. 2011). A
disadvantage of stable transformation is low expression levels of the gene of
interest (Meyers et al. 2011). To obtain greater levels of expression, transient
transformation can be used.
2.5.3 Transient transformation
Transient transformation refers to short-term expression of the introduced
DNA (Finer 2010). Once DNA is introduced into the nucleus, the DNA can
begin to function as an extrachromosomal entity, without being incorporated
into the genome. This type of transformation can be obtained by performing
“agroinfiltration”. Agroinfiltration consists of infiltrating leaves of a plant with
29
a suspension of Agrobacterium, by way of a needless syringe into a single leaf
or full foliar immersion in suspension and then application of a vacuum. The
Agrobacterium is thus introduced into the cells of the leaves, and the foreign
DNA can begin to function upon reaching the nucleus. This particular method
works well with N. benthamiana (Finer 2010). The main advantage of
agroinfiltration is speed (Gleba et al. 2005) as plants can be infiltrated and
harvested for protein within a week. As with stable transformation, binary
vectors can be used to introduce the foreign DNA, using agroinfiltration instead
of traditional stable transformations. In addition, viral vectors can be used
(Meyers et al. 2011). With viral vectors, Agrobacterium is used to deliver virus-
based vectors which have been engineered to contain a GOI. Delivered in
different modules, the DNA assembles in planta. The GOI can then replicate
within the host, producing large quantities of the desired protein (Gleba et al.
2007).
2.5.4 Glycosylation
Most human proteins are glycosylated, with one or more carbohydrate
chains attached to one or more polypeptide chains (Meyers et al. 2011). These
carbohydrate chains have a distinct effect on the properties of the protein, by
influencing folding, transport and stability (Meyers et al. 2011). Since many
proteins of interest as pharmaceuticals are glycosylated, the issue of
glycosylation patterns is significant (Karg and Kallio 2009).
30
Figure 5. N-glycans of human antibodies, and recombinant hamster, mouse and plant antibodies. Reprinted from Plant Biotechnology Journal Vol 8(5), Gormord et al. Plant-Specific Glycosylation Patterns in the Context of Therapeutic Protein Production. 564-587 © 2010 with permission from John Wiley and Sons.
N-linked glycosylation is when the glycan is linked to the nitrogen of the side chain of asparagine, and can affect the structure of the protein, as well as its immunological interactions and its activity (Karg and Kallio 2009). N-glycans are synthesized in the ER, and are similar amongst eukaryotic species.
However, N-glycan processing by glycosidases and glycosyltransferases within the Golgi apparatus differ among kingdoms, resulting in different structures between plants and mammals (Gomord et al. 2010). For example, the monosaccharide xylose (Xyl) is found in plant but not mammalian glycans. The monosaccharide fucose (Fuc) is found in both plant and mammalian N-glycans, however, the linkage is different; α-1,6 in mammals and α-1,3 in plants
(Meyers et al. 2011) (Figure 5).
31
Humans have antibodies against certain plant carbohydrate epitopes (Karg
and Kallio 2009). The serum of non-allergic humans was screened for
antibodies against plant produced glycoproteins Xyl and α-1,3-Fuc; 50% of
those screened had antibodies against core Xyl, and 25% of those screened had
antibodies against core α-1,3-Fuc. The presence of antibodies against plant-
specific glycoprotein epitopes indicates immunogenicity towards plant
glycosylation patterns, which is undesirable when producing biosimilar proteins
to be administered to humans. Immunogenicity towards plant glycans has been
addressed with glycoengineering, which is a process by which desired
glycosylation patterns of a particular kingdom are mimicked by species of
another kingdom (Karg and Kallio 2009). To humanize protein N-glycosylation
within plant cells, knockout of plant N-glycan-processing genes, as well as the
introduction of genes required for the addition of human sugars has taken place
(Gomord et al. 2010). For example, RNA interference (RNAi) technology was
used by Strasser et al. (2008) to down-regulate the β 1,2-xylosyltransferase
(XylT) and α 1,2-fucosyltransferase (FucT) genes in N. benthamiana. This
down-regulation of glycosyltransferases resulted in knock-down plants with the
α-1,3 fucose and xylose glycans removed (Strasser et al. 2008). These plants
can be used for transient expression of proteins that will more closely resemble
human glycosylation patterns.
2.6 Enzyme functionality testing with the Ellman assay
In 1961, Ellman et al. (1961) published the paper “A New and Rapid
Colorimetric Determination of Acetylcholinesterase Activity” (Ellman et al.
32
1961). This publication outlines a sensitive assay for use in detecting the presence of acetylcholine, as well as determining its activity. This is beneficial, as merely detecting the presence of the enzyme does not aid in determining the quality of the enzyme, i.e. how many moles of substrate can be bound and in some cases hydrolyzed (i.e. NA are bound but not hydrolyzed but OP insecticides are bound and hydrolyzed).
Figure 6. Chemical structures of acetylcholine, acetylthiocholine, butyrylcholine, and butyrylthiocholine
The assay is based on use of a sulphur analog, acetylthiocholine (ATCh)
(Figure 6), which is hydrolyzed by AChE. It was later found that BChE hydrolyzes butyrylthiocholine (BTCh). This method measures the rate of thiocholine production as acetyl/butyrylthiocholine is hydrolyzed. The thiol reacts with diothiobisnitrobenzoic acid (DTNB), producing the yellow anion of
5-thio-2-nitro-benzoic acid (TNB) (Figure 5), which can be measured at 412 nm in a spectrophotometer (Ellman et al. 1961). Ellman’s assay was designed for use with a spectrophotometer, before microplate readers were common. Modern
33
Ellman assays are now often performed using microplate readers. In addition,
Ellman reported reading samples at 412 nm, however, a 405 nm filter will also
detect efficiently (Mor et al. 2001), provided that the assay is performed at
25°C, as the absorbance spectra of TNB is affected by increased temperature
(Eyer et al. 2003).
The Ellman Assay is widely used to determine the units of activity of
AChE and BChE, both purified from serum or tissue, as well as produced
recombinantly in different organisms.
(enzyme) acetylthiocholine → thiocholine + acetate
thiocholine + dithiobisnitrobenzoate → yellow colour
Figure 7. Ellman assay reaction. Figure adapted from (Ellman et al. 1961)
2.7 Restatement of research objectives and hypothesis
The objectives of this thesis are to transiently express human
butyrylcholinesterase in glycomodified N. benthamiana using various plant-
based expression systems. A second objective is to assess recombinant human
butyrylcholinesterase functionality by determining Km and Vmax values. The
final objective of this thesis is to purify the recombinant human
butyrylcholinesterase from N. benthamiana leaf tissue.
The hypothesis for the following research is that human
butyrylcholinesterase can be transiently produced recombinantly in
34 glycomodified N.benthamiana, and it will provide sufficient quantities to enable prophylactic treatment for nerve agent poisoning. A sufficient quantity would be 200 mg/kg fresh weight, based on the expression levels of in planta antibody production which has taken place in the Dr. J. C. Hall lab.
35
3 The production of recombinant human butyrylcholinesterase in Nicotiana benthamiana.
3.1 Materials and methods
3.1.1 Cloning of the butyrylcholinesterase gene into viral-based vectors.
ICON genetics GmbH (Halle, Germany) provided the magnICON
expression vectors pICH21595, pICH25433, pICH20999, pICH23002, and
pICH14011 (referred to hereafter as 3’ TMV, 3’ PVX, 5’ TMV, 5’ PVX, and
integrase, respectively). These viral-based vectors were constructed by
Marillonnet et al. (2004) from the tobacco mosaic virus (TMV) and potato virus X
(PVX). Cloning of the hBChE gene, codon optimized for N. benthamiana, into
these viral-based vectors was performed by Don Schwab of the
DNA/Gene/Microarray Synthesis Laboratory, National Research Council Canada
(Saskatoon, Saskatchewan, Canada). The 3’ vectors contain the GOI and are co-
infiltrated into plant tissue along with the 5’ vectors, which contain the elements
required for gene expression (i.e. 3’TMV + 5’ TMV, and 3’PVX + 5’PVX).
Additionally, integrase, a site-specific recombinase which assembles the 3’ and 5’
modules intracellularly (Marillonnet et al. 2004), is also infiltrated along with the
3’ and 5’ vectors. The TMV vectors and PVX vectors can be used on their own,
or can be used together in instances where expression of large proteins are desired
(for example, one vector set can carry an antibody light chain sequence, and the
other can carry the heavy chain sequence and the two can then be assembled to
produce a whole antibody in planta) (Meyers et al. 2011).
36
I W S Q G E D D I I I A T K N G K V R G M N L T V F BChE optimized for Nb --ATTTGGTCTCAAGGTGAAGATGATATTATTATTGCTACTAAGAATGGTAAGGTTAGAGGTATGAATCTTACTGTTTTT Human BChE ATATATGGTCTCAAGGTGAAGATGACATCATAATTGCAACAAAGAATGGAAAAGTCAGAGGGATGAACTTGACAGTTTTT ** ******************** ** ** ***** ** ******** ** ** ***** ***** * ** ****** G G T V T A F L G I P Y A Q P P L G R L R F K K P Q BChE optimized for Nb GGTGGTACTGTTACTGCTTTTCTTGGTATTCCTTATGCTCAACCTCCTCTTGGTAGACTTAGATTCAAGAAGCCTCAATC Human BChE GGTGGCACGGTAACAGCCTTTCTTGGAATTCCCTATGCACAGCCACCTCTTGGTAGACTTCGATTCAAAAAGCCACAGTC ***** ** ** ** ** ******** ***** ***** ** ** *************** ******* ***** ** ** S L T K W S D I W N A T K Y A N S C C Q N I D Q S F P BChE optimized for Nb TCTTACTAAGTGGTCTGATATTTGGAATGCTACTAAGTATGCTAATTCTTGTTGTCAAAATATTGATCAATCTTTTCCTG Human BChE TCTGACCAAGTGGTCTGATATTTGGAATGCCACAAAATATGCAAATTCTTGCTGTCAGAACATAGATCAAAGTTTTCCAG *** ** *********************** ** ** ***** ******** ***** ** ** ****** ****** * G F H G S E M W N P N T D L S E D C L Y L N V W I P A BChE optimized for Nb GTTTTCATGGTTCTGAAATGTGGAATCCTAATACTGATCTTTCTGAAGATTGTCTTTATCTTAATGTTTGGATTCCTGCT Human BChE GCTTCCATGGATCAGAGATGTGGAACCCAAACACTGACCTCAGTGAAGACTGTTTATATCTAAATGTATGGATTCCAGCA * ** ***** ** ** ******** ** ** ***** ** ****** *** * ***** ***** ******** ** P K P K N A T V L I W I Y G G G F Q T G T S S L H V BChE optimized for Nb CCTAAGCCTAAGAATGCTACTGTTCTTATTTGGATCTATGGTGGTGGTTTTCAAACTGGTACTTCTTCTCTTCATGTTTA Human BChE CCTAAACCAAAAAATGCCACTGTATTGATATGGATTTATGGTGGTGGTTTTCAAACTGGAACATCATCTTTACATGTTTA ***** ** ** ***** ***** * ** ***** *********************** ** ** *** * ******** Y D G K F L A R V E R V I V V S M N Y R V G A L G F L BChE optimized for Nb TGATGGTAAGTTTCTTGCTAGAGTTGAAAGAGTTATTGTTGTTTCTATGAATTATAGAGTTGGTGCTCTTGGTTTTCTTG Human BChE TGATGGCAAGTTTCTGGCTCGGGTTGAAAGAGTTATTGTAGTGTCAATGAACTATAGGGTGGGTGCCCTAGGATTCTTAG ****** ******** *** * ***************** ** ** ***** ***** ** ***** ** ** ** * * A L P G N P E A P G N M G P F D Q Q L A L Q W V Q K N BChE optimized for Nb CTCTTCCTGGTAATCCTGAAGCTCCTGGTAATATGGGTCTTTTTGATCAACAACTTGCTCTTCAATGGGTTCAAAAGAAT Human BChE CTTTGCCAGGAAATCCTGAGGCTCCAGGGAACATGGGTTTATTTGATCAACAGTTGGCTCTTCAGTGGGTTCAAAAAAAT ** * ** ** ******** ***** ** ** ****** * *********** * ******** *********** *** I A A F G G N P K S V T L F G E S A G A A S V S L H BChE optimized for Nb ATTGCTGCTTTTGGTGGTAATCCTAAGTCTGTTACTCTTTTTGGTGAATCTGCTGGTGCTGCTTCTGTTTCTCTTCATCT Human BChE ATAGCAGCCTTTGGTGGAAATCCTAAAAGTGTAACTCTCTTTGGAGAAAGTGCAGGAGCAGCTTCAGTTAGCCTGCATTT ** ** ** ******** ******** *** ***** ***** *** *** ** ** ***** *** ** *** * L L S P G S H S L F T R A I L Q S G S F N A P W A V T BChE optimized for Nb TCTTTCTCCTGGTTCTCATTCTCTTTTTACTAGAGCTATTCTTCAATCTGGTTCTTTTAATGCTCCTTGGGCTGTTACTT Human BChE GCTTTCTCCTGGAAGCCATTCATTGTTCACCAGAGCCATTCTGCAAAGTGGATCCTTTAATGCTCCTTGGGCGGTAACAT *********** ***** * ** ** ***** ***** *** *** ** ***************** ** ** * S L Y E A R N R T L N L A K L T G C S R E N E T E I I BChE optimized for Nb CTCTTTATGAAGCTAGAAATAGGACTCTTAATCTTGCTAAGCTTACTGGTTGTTCTAGAGAAAATGAGACTGAAATTATT Human BChE CTCTTTATGAAGCTAGGAACAGAACGTTGAACTTAGCTAAATTGACTGGTTGCTCTAGAGAGAATGAGACTGAAATAATC **************** ** ** ** * ** * ***** * ******** ******** ************** ** K C L R N K D L Q E I L L N E A F V V P Y G T P L S BChE optimized for Nb AAGTGTCTTAGAAACAAGGATCCTCAAGAGATTCTTCTTAATGAGGCTTTTGTTGTTCCTTATGGTACTCCTCTTTCTGT Human BChE AAGTGTCTTAGAAATAAAGATCCCCAAGAAATTCTTCTGAATGAAGCATTTGTTGTCCCCTATGGGACTCCTTTGTCAGT ************** ** ***** ***** ******** ***** ** ******** ** ***** ****** * ** ** V N F G P T V D G D F L T D M P D I L L E L G Q S K K BChE optimized for Nb TAATTTTGGTCCTACTGTTGATGGTGATTTTCTTACTGATATGCCTGATATTCTTCTTGAACTTGGTCAATTCAAGAAGA Human BChE AAACTTTGGTCCGACCGTGGATGGTGATTTTCTCACTGACATGCCAGACATATTACTTGAACTTGGACAATTTAAAAAAA ** ******** ** ** ************** ***** ***** ** ** * *********** ***** ** ** * T Q I L V G V N K D E G T A F L V Y G A P G F S K D N BChE optimized for Nb CTCAAATTCTTGTTGGTGTTAACAAGGATGAAGGTACTGCTTTTCTTGTTTATGGTGCTCCTGGTTTTTCTAAGGATAAC Human BChE CCCAGATTTTGGTGGGTGTTAATAAAGATGAAGGGACAGCTTTTTTAGTCTATGGTGCTCCTGGCTTCAGCAAAGATAAC * ** *** * ** ******** ** ******** ** ****** * ** ************** ** ** ****** N S I I T R K E F Q E G L K I F F P G V S E F G K E BChE optimized for Nb AATTCTATTATTACTAGAAAGGAATTTCAAGAAGGTCTTAAGATTTTTTTTCCTGGTGTTTCTGAATTTGGTAAGGAATC Human BChE AATAGTATCATAACTAGAAAAGAATTTCAGGAAGGTTTAAAAATATTTTTTCCAGGAGTGAGTGAGTTTGGAAAGGAATC *** *** ** ******** ******** ****** * ** ** ******** ** ** *** ***** ******** S I L F H Y T D W V D D Q R P E N Y R E A L G D V V G BChE optimized for Nb TATTCTTTTTCATTATACTGATTGGGTTGATGATCAAAGACCTGAAAATTATAGAGAAGCTCTTGGTGATGTTGTTGGTG Human BChE CATCCTTTTTCATTACACAGACTGGGTAGATGATCAGAGACCTGAAAACTACCGTGAGGCCTTGGGTGATGTTGTTGGGG ** *********** ** ** ***** ******** *********** ** * ** ** * ************** * D Y N F I C P A L E F T K K F S E W G N N A F F Y Y F BChE optimized for Nb ATTATAATTTTATTTGTCCTGCTCTTGAATTCACTAAGAAGTTTTCTGAATGGGGTAACAATGCTTTTTTCTATTATTTT Human BChE ATTATAATTTCATATGCCCTGCCTTGGAGTTCACCAAGAAGTTCTCAGAATGGGGAAATAATGCCTTTTTCTACTATTTT ********** ** ** ***** * ** ***** ******** ** ******** ** ***** ******** ****** E H R S S K L P W P E W M G V M H G Y E I E F V F G BChE optimized for Nb GAACATAGATCTTCTAAGCTTCCTTGGCCTGAATGGATGGGTGTTATGCATGGTTATGAAATTGAATTTGTTTTTGGTCT Human BChE GAACACCGATCCTCCAAACTTCCGTGGCCAGAATGGATGGGAGTGATGCATGGCTATGAAATTGAATTTGTCTTTGGTTT ***** **** ** ** ***** ***** *********** ** ******** ***************** ****** * L P L E R R D N Y T K A E E I L S R S I V K R W A I F BChE optimized for Nb TCCTCTTGAAAGAAGAGATAATTATACTAAGGCTGAAGAGATTCTTTCTAGATCTATTGTTAAGAGATGGGCTAATTTTG Human BChE ACCTCTGGAAAGAAGAGATAATTACACAAAAGCCGAGGAAATTTTGAGTAGATCCATAGTGAAACGGTGGGCAAATTTTG ***** ***************** ** ** ** ** ** *** * ****** ** ** ** * ***** ******* A K Y G N P N E T Q N N S T S W P V F K S T E Q K Y L BChE optimized for Nb CTAAGTATGGTAATCCTAATGAGACTCAAAACAATTCTACTTCTTGGCCTGTTTTTAAGTCTACTGAGCAAAAGTATCTT Human BChE CAAAATATGGGAATCCAAATGAGACTCAGAACAATAGCACAAGCTGGCCTGTCTTCAAAAGCACTGAACAAAAATATCTA * ** ***** ***** *********** ****** ** ******** ** ** ***** ***** ***** T L N T E S T R I M T K L R A Q Q C R F W T S F F P BChE optimized for Nb ACTCTTAATACTGAATCTACTAGAATTATGACTAAGCTTAGAGCTCAACAATGTAGATTTTGGACTTCTTTTTTTCCTAA Human BChE ACCTTGAATACAGAGTCAACAAGAATAATGACGAAACTACGTGCTCAACAATGTCGATTCTGGACATCATTTTTTCCAAA ** * ***** ** ** ** ***** ***** ** ** * ************ **** ***** ** ******** ** K V L E M T G N I D E A E W E W K A V F H R W N N Y M BChE optimized for Nb GGTTCTTGAAATGACTGGTAATATTGATGAAGCTGAATGGGAATGGAAGGCTGGTTTTCATAGGTGGAACAATTATATGA Human BChE AGTCTTGGAAATGACAGGAAATATTGATGAAGCAGAATGGGAGTGGAAAGCAGGATTCCATCGCTGGAACAATTACATGA ** * ******** ** ************** ******** ***** ** ** ** *** * *********** **** M D W K N Q F N D Y T S K K E S C V G L - BChE optimized for Nb TGGATTGGAAGAATCAGTTTAATGATTATACTTCTAAGAAGGAATCTTGTGTTGGTCTTTGAGCTTAGAGACCTATT— Human BChE TGGACTGGAAAAATCAATTTAACGATTACACTAGCAAGAAAGAAAGTTGTGTGGGTCTCTAAGCTTAGAGACCTATATA **** ***** ***** ***** ***** *** ***** *** ****** ***** * ***************
Figure 8. Sequence alignment of human butyrylcholinesterase (EC 1.1.1.8) and human butyrylcholinesterase codon optimized for Nicotiana benthamiana. 37
The hBChE gene (Figure 8) was inserted between the BsaI sites in the
multiple cloning site (MCS) of 3’ PVX and 3’TMV, and transformed into E.coli
DH10b. Electrocompetent Agrobacterium tumefaciens (strain 542, AT542) cells
were transformed with the plasmid preparation of 3’ PVX-BChE and 3’TMV-
BChE, via electroporation (Bio-Rad GenePulser Xcell Electroporation System),
following the procedure found in the “Gene Pulser Xcell Electroporation System
Instruction Manual”. The transformations were spread on LB-Miller agar plates
with 50 µg/mL carbenicillin and 50 µg/mL rifampicin (for binary vector
selection), and grown for 48 hours in 28°C (Marillonnet et al. 2004).
3.1.2 Spot infiltrations of Nicotiana benthamiana with ICON genetics modules.
Following procedures described in Marillonnet et al., (2004) and Grohs et
al., (2010), 5 x 10-mL yeast extract peptone (YEP) medium cultures, with 50
µg/mL carbenicillin and 50 µg/mL rifampicin, were each inoculated with single
AT542
colony bearing one of 3’TMV-BChE, 3’ PVX-BChE, 5’ TMV, 5’ PVX and
Integrase, respectively, and the cultures were grown in 5-mL centrifuge tubes at
200 rpm, 28°C overnight (O/N).
When optical densities at 600 nm (OD600) of each of the 5 cultures were
approximately 1.8, the cultures were removed from the incubator. A 1-ml aliquot
of each culture was centrifuged at 6000 x g for 3 min. The resulting pellet was
resuspended in 0.5 mL of agroinfiltration buffer (AI Buffer, 10 mM MgSO4, 10
mM MES, pH 5.5). Resuspended pellets were added to AI buffer for a final
OD600 of 0.2.
38
Three separate infiltration solutions were made:
1) 3’ PVX-BChE, 5’ PVX and Integrase cell cultures, OD 0.2 (1:1:1 v/v/v)
2) 3’ TMV-BChE, 5’ TMV and Integrase cell cultures, OD 0.2 (1:1:1 v/v/v)
3) 3’ PVX-BChE, 5’ PVX, 3’ TMV-BChE, 5’ TMV, and Integrase cell cultures, OD 0.2 (1:1:1:1:1 v/v/v/v/v)
Spot infiltrations took place using transgenic N. benthamiana plants with plant-specific glycans removed (Strasser et al. 2008). These plants were obtained from Herta Steinkellner (Institute of Applied Genetics and Cell Biology,
University of Natural Resources and Applied Life Sciences, Muthgasse 18, 1190
Vienne, Austria, [email protected]) and were created using RNA interference (RNAi) technology to create knock-down N. benthamiana with the xylose and α-1,3 fucose glycans removed to more closely resemble human glycosylation patterns (Strasser et al. 2008). These plants are referred to as ΔFX .
Using a 1-mL needleless syringe, 100 µL per spot of each infiltrate was loaded into the underside of the leaves of 7-week-old ΔFX N. benthamiana plants
(3 repetitions of the 3 treatments for harvest on days 4, 5, 6, and 7 days post infiltration [dpi]).
For each harvest day (4, 5, 6 and 7), an infiltration spot of each treatment was cut from a leaf and kept on ice until weighed. One hundred mg of the tissue was weighed and added to 2-mL centrifuge tubes containing homogenizing beads, and 300 µL of extraction buffer (40 mM sodium phosphate dibasic, 50 mM ascorbic acid, 10 mM EDTA, pH 7) was added. Tissue samples were homogenized using a bead beater (Retsch mm300 Mixer Mill) for 5 min, 30 Hz
39 and centrifuged for 30 min at 10,600 x g and 4°C. The supernatant was stored at -
20°C until it was used in an assay.
The total soluble protein (TSP) was determined for all samples via the
Bradford Protein Assay (Bio-Rad, Protein Assay Dye Reagent Concentrate, Cat
No. 500-0006), using bovine serum albumin (BSA) as the standard. TSP samples
(30 µg) were run on 12% sodium dodecyl sulfate polyacrylamide gels by electrophoresis (SDS-PAGE), under reducing and non-reducing conditions, using active hBChE (abcam, Cat No. ab96367, butyrylcholinesterase [active]) as a positive control, and non-infiltrated ΔFX N. benthamiana as a negative control.
The SDS-PAGE gels were transferred to a nitrocellulose membrane which was blocked O/N with 3% milk blocking solution. The membrane was washed with phosphate-buffered saline containing 1% Tween 20 (PBST) and probed first with an anti-hBChE polyclonal rabbit antibody (Sigma-Aldrich, Cat No.
AV44208, Anti-BChE antibody produced in rabbit, IgG fraction of antiserum), then with a goat anti-rabbit antibody, conjugated to alkaline phosphatase (AP)
(Sigma-Aldrich, Cat No. A3937, Anti-Rabbit IgG (Whole Molecule) F(ab)2 fragment – alkaline phosphatase, antibody developed in goat, affinity isolated antibody). Substrate (1-Step NBT/BCIP, Thermo Scientific, Cat No. 34042) was added and developed for 50 min.
To determine whether messenger RNA (mRNA) was present in the infiltrated ΔFX N. benthamiana, RT-PCR was performed on spot infiltrated leaves, 5 dpi. RNA extraction was performed using the RNeasy Mini Kit (Qiagen,
Cat No. 74106). Two infiltration spots, and one non-infiltrated spot of plant tissue
40 were weighed and processed following the method published in the RNeasy Mini
Kit manual. One µg of RNA was added to PCR tubes along with 1 µL of a Oligo dT primer (Invitrogen Cat No. 58862) and water to bring each reaction volume to
11 µL. A master mix containing: 4 µL 5 x First Strand Buffer (Invitrogen, Part
No. Y02321), 2 µL 0.1 M DTT (Invitrogen, Part No. Y00147), 1 µL RNase
OUT (Invitrogen, Part No. 100000840), 1 µL 10 mM dNTP (Invitrogen, Cat
No. 18427-0B) was prepared. Reactions were run in a thermal cycler (PTC-100
Programmable Thermal Controller, MJ Research, Inc.) at 65°C for 5 min, placed on ice for 2 min, after which the master mix was added. The reaction was run at
42°C for 2 min, and 1 µL SuperScript II Reverse Transcriptase (Invitrogen, Part
No. 100004925) was added to each tube. Finally, the reaction was continued at
42°C for 60 min followed by 95°C for 15 min. The resulting cDNA underwent a
PCR amplification reaction. The primers used were: BChE Forward – 5’-
CCTTATGCTCAACCTCCTC TTGGTAGAC and BChE Reverse - 5’-
CCAGCCTT CCATTCCCATTCAGC. The master mix consisted of 2.5 µL 10 x
Buffer (Invitrogen, Part No. Y02028), 2.5 µL 2 mM dNTPs, 1 µL 50 mM MgCl2
(Invitrogen, Part No. Y02016), and 0.13 µL 5 U/µL Platinum Taq Polymerase
(Invitrogen, Cat No. 10966-018), and was added to reactions containing either 1 or 2 µL of sample cDNA, 0.5 µL of 20 pmol/µL forward and reverse primers and water to bring total volume to 25 µL. The negative control consisted of the master mix and primers without the cDNA. The reaction took place in the PTC-100 thermal cycler: 1 cycle of 3 min at 95°C, 30 cycles of 30 sec at 94°C, 30 sec at
56°C, and 2 min, 30 sec at 72°C. The resulting reaction was run on a 1% agarose
41
gel, using EZ-Vision Two 6X dye (Amresco, Cat No. N650-Kit) to visualize
DNA.
3.1.3 Cloning of the butyrylcholinesterase gene into binary vectors.
The hBChE gene, codon optimized for N. benthamiana, was cloned into 3
different binary vectors by Haifeng Wang. The starting vectors were p103-anti-
atrazine-scFv, p104-anti-atrazine-scFv, and p105-anti-atrazine-scFv (Figure 9)
(Garabagi et al. 2012). These vectors needed to be digested with BglII (New
England Biolabs, Cat No. R0144L) and BspE1 (New England Biolabs, Cat No.
Figure 9. Schematic of binary vectors p103-anti-atrazine-scFv, p104-anti- atrazine-scFv, and p105-anti-atrazine-scFv
R0540L). As BspE1 is blocked by dam methylation, the plasmids were
first transformed into, and then extracted from, dam-negative E. coli cells
(Invitrogen, One Shot INV110 Chemically Competent E. coli, Cat No. C7171-
03). Three µg of DNA from each plasmid was then digested by BglII and BspE1
42 in 50 µg of NEBuffer 3 (New England Biolabs, Cat No. B7003S) at 37°C for 6 h.
The phosphate groups at the end of the DNA fragments were removed with
Antarctic Phosphatase (New England Biolabs, Cat No. M0289S) at 37°C for 1 h.
A QIAquick PCR Purification Kit (Qiagen, Cat No. 28104) was then used to purify the DNA.
hBChE was amplified by PCR. The master mix consisted of 2.5 µL 10 x
Buffer, 2.5 µL 2 mM dNTP, 1 µL 50 mM MgCl2, and 0.13 µL 5 U/µL Platinum
Taq polymerase, and was added to reactions containing 1 µL of 1 ng/µL hBChE,
0.5 µL of 20 pmol/µL forward and reverse primers and water to a total volume of
25 µL. The primers used were: BChE Forward - 5’-
CCTTATGCTCAACCTCCTCTTGGTAGAC and BChE Reverse - 5’-
ATATATTCCGGATCAAAGACCAACACAAGATTCCTTC. The negative control consisted of the master mix and primers without DNA. The reaction took place in the PTC-100 thermal cycler: 1 cycle of 3 min at 95°C, 30 cycles of 30 sec at 94°C, 30 sec at 56°C, and 2 min at 72°C. The resulting product was run on 1% agarose gel, using EZ-Vision Two 6X dye to visualize the DNA. This hBChE
PCR product was purified using the QIAquick PCR Purification Kit , and then 1
µL of purified PCR product was digested by Aar1 (Fermentas, Cat No. ER1581) and BspE1 in 50 µL Aar1 buffer at 37°C for 6 h. Resulting digested hBChE was purified again using the Qiagen PCR purification kit.
In order to ligate digested and purified hBChE with digested, purified and dephosphorylated p103, p104, and p105 vectors, 20 fmol of each vector DNA was mixed with 60 fmol of the hBChE gene in 10 µL of ligation buffer at 16°C
43 overnight. Five µL of this ligation was then transformed into 50 µL of One-shot
TOP10 Chemically Competent E. coli cells (Invitrogen, Cat No. C4040-10) by the heat-shock method described in the One-shot manual. Two hundred µL of
S.O.C. medium (Invitrogen, Cat No. 15544034) was added and 100 µL was streaked onto a LB agar plate containing 50 µg/mL carbenicillin, and grown at
37°C O/N.
Transformants were screened by colony PCR, restriction analysis, and sequencing. For colony PCR, single colonies were added to separate reactions containing 2.5 µL 10 x buffer, 0.5 µL 10 mM dNTPs, 1 µL 25 µM forward primer, 1 µL 25 µM reverse primer, 2 µL 25 mM MgCl2, 0.13 µL 5 U/µL
Platinum Taq polymerase, and 17.87 µL H2O. The forward primer used was the same used for the cDNA amplification procedure described previously, and the reverse primer used was: BChE Reverse - 5’-
ATATATTCCGGATCAAAGACCAACACAAGATTCCTTC. The PCR reaction was also the same as described, with the exception of the denaturing temperature, which was 94 °C.
The transformants that showed the correct size DNA band (~ 1800 bp) were further screened with restriction enzymes. The plasmid DNA of each transformant was extracted using the QIAprep Spin Miniprep Kit (Qiagen, Cat
No. 27104) and then double digested by Xho1 (New England Biolabs, Cat No.
R0146S) and Spe1 (New England Biolabs, Cat No. R0133L). Positive transformants showed two DNA bands, of 0.8 kb and 1.8 kb, and the 1.8 kb bands were sent for sequencing to Laboratory Services, University of Guelph.
44
Four binary vectors resulted from this cloning, BChE-103, BChE-104 and two versions of BChE-105 (Figure 10); BChE-105-1 contains a truncated 3’UTR with 162 less base pairs (bps), due to an extra BspE1 site, while BChE-105-2 contains the complete 3’UTR, achieved by using BglII and Spe1 to prepare the vector, and Aar1 and Spe1 to cut the hBChE PCR product.
AT542 electrocompetent cells were transformed with the plasmid preparation of BChE-103, BChE-104, BChE-105-1 and BChE-105-2, via electroporation (Bio-Rad GenePulser Xcell Electroporation System) following the procedure found in the “Gene Pulser Xcell Electroporation System Instruction
Manual”. Transformations were plated on LB agar with 50 µg/mL carbenicillin and 50 µg/mL rifampicin, and grown for 48 h at 28°C.
Figure 10. Schematic of the butyrylcholinesterase binary vectors. All 4 have the Heat shock protein (Hsp81.1) promoter followed by the 35S promoter, 35S 5’ UTR, and the codon optimized hBChE gene. Binary vector BChE-103 contains the Nopaline Synthase (Nos) 3’ UTR and terminator, BChE-104 contains the Osmotin (Osm) 3’ UTR and terminator, and BChE-105-1 and 105-2 contain the RuBisCO (Rbc) 3’ UTR and terminator sequence. The 3’ UTR for BChE-105-1 was truncated (162 bp removed) when compared to BChE-105-2.
45
3.1.4 Spot infiltrations of Nicotiana benthamiana with binary vectors
Several spot infiltration experiments were performed to assess the BChE
expression levels produced by the 4 different binary vectors. In addition, the P19-
103 vector (Garabagi et al. 2012) containing the P19 gene was co-infiltrated along
with some of the BChE binary vectors. P19 is a protein of the tomato bushy stunt
virus (TBSV) that suppresses post-transcriptional gene silencing (PTGS). BChE-
103 and BChE-104 were spot infiltrated with and without P19. Five-mL LB-
Miller liquid medium with 50 µg/mL rifampicin was inoculated with a single
colony of AT542. Three x 5-mL LB-Miller cultures, with 50 µg/mL rifampicin
and 50 µg/mL carbenicillin were inoculated with a single colony each of BChE-
103, BChE-104 and P19. Cultures were grown in 5-mL centrifuge tubes O/N (18
h) at 28°C and 200 rpm. ODs were read at 600 nm, and the cultures were diluted
with non-inoculated media to a final OD of 0.4. Equal volumes of BChE-103 and
P19, and BChE-104 and P19 were combined before infiltration, for treatments
containing P19.
Three replicate infiltrations (100 µl ea) were made into the underside of
leaves of 6- week-old ΔFX N. benthamiana plants using a 1-mL syringe, i.e.,
three spots per leaf on 1 leaf per plant, 3 plants per treatment. The infiltrated area
(i.e. each spot) was harvested at 6 dpi. One hundred mg of tissue was taken from
each spot and the tissue from the three spots combined (300 mg total per leaf), cut
into small pieces, and put into 2-mL centrifuge tubes with homogenizing beads,
and 900 µL of extraction buffer (1xPBS). The tissue in each centrifuge tube was
homogenized using a bead beater for 5 min, 30 Hz and then centrifuged at 10,600
46 x g and 4°C for 30 min. The supernatant was stored at -20°C until assayed, at which time the samples were thawed on ice, centrifuged at 10,600 x g for 1 min, and the supernatant used to determine TSP via the Bradford assay, using BSA as the standard. A modified Ellman assay was used to determine activity of the expressed enzyme.
A similar experiment was done to test BChE-105-1 and BChE-105-2.
Both vectors were spot infiltrated with and without P19. The infiltration and harvest methods were performed as described for BChE-103 and BChE-104.
A final experiment utilizing spot infiltrations took place. As all of the previous spot infiltration tests indicated that the use of P19 increased production of the enzyme, this test was of all 4 of the BChE binary vectors with P19, as well as infiltration with wild type AT542 as a control. All were infiltrated at the same time, on the same batch of plants and tested on the same assay. Specifically, six 5- mL LB-Miller media with 50 µg/mL rifampicin and 50 µg/mL carbenicillin, were each inoculated with a single colony of AT542, P19, BChE-103, BChE-104,
BChE-105-1, and BChE-105-2. A. tumefaciens AT542 culture without carbenicillin was used as a negative control. Cultures were grown O/N (18 h) at
28°C and 200 rpm. OD600 values were read, and the cultures were diluted to an
OD of 0.4. The AT542, BChE-103, BChE-104, BChE-105-1, and BChE-105-2 diluted cultures were combined with an equal volume of P19 before infiltration.
Each infiltration solution was loaded in 100 µL amounts at three different locations into the underside of leaves of 7-week-old ΔFX N. benthamiana plants, using a 1 mL needleless syringe (three spots per leaf, 1 leaf per plant, 3 replicate
47
plants per treatment). The spots for BChE-103 were harvested 5 dpi, the spots for
BChE-104 were harvested 4 dpi, and both BChE-105 spots, and the tissue
infiltrated with wild type AT542, were harvested 6 dpi, based on an experiment
determining the optimal days for harvest (not shown). The method of harvest was
the same as described previously.
3.1.5 Whole plant infiltration of Nicotiana benthamiana with binary vectors
After using spot infiltration to determine the best vector to use (BChE-
105-1), whole plant infiltrations were performed, following procedures described
by Marillonnet et al. (2004) and Grohs et al. (2010). Five-mL LB-Miller cultures,
containing 50 µg/mL rifampicin and 50 µg/mL carbenicillin, were inoculated with
a single colony of BChE-105-1 and P19. Cultures were grown in 5-mL centrifuge
tubes O/N (18 h) at 28°C, 200 rpm. ODs were read at an absorbance of 600 nm,
until an OD of approximately 1.8 was reached. The BChE-105-1 and P19 cultures
were diluted down to a final absorbance of OD 0.2 and equal volumes of each
were combined together in 5 x 250-mL centrifuge tubes. The tubes were
centrifuged at 6000 x g for 4 min, the supernatant was discarded, and the pellets
were resuspended in 2-L of AI buffer. The 2-L suspensions were added to 2-L
infiltration buckets. Five plants, around 6 weeks old, with soil covered with tin
foil, were placed upside down into infiltration buckets, and secured in place by
lids with the centre removed so that only the foliage was submerged in the
suspension. All 5 infiltration buckets containing plants were placed into the
48
A)
B)
C)
Figure 11. Whole-plant infiltration. A) ΔFX N. benthamiana plant with foil covering soil. B) Plant submerged upside down in infiltration bucket filled with infiltration solution. C) Plants in infiltration chamber
49
infiltration chamber (Eagle Stainless CTH-43), and the lid was secured (Figure
11). The vacuum pump (Lafert LME80L4) was set to deliver 0.5-0.9 bar negative
pressure. The vacuum was held for 45 seconds and then slowly released, allowing
the suspension to enter into the plant cells. This process was repeated until 72+
plants were infiltrated. Plants were placed in the greenhouse for 6 days, and then
harvested. For harvesting, the leaves were cut from the infiltrated plants where the
stalk meets the leaf. Ten leaves, all from different plants, were taken for sampling.
The remaining tissue (between 500 and 1000 g) was placed in a plastic bag and
stored in -20°C for later use.
To prepare the samples to determine the level of expression, a total of 300
mg each from the 10 random leaves (300 mg/leaf) were collected, cut into small
pieces, put in 2-mL centrifuge tubes with homogenizing beads, and 900 µL of
extraction buffer (1xPBS) was added. The tubes were homogenized in bead beater
for 5 min, 30 Hz and centrifuged in 4°C for 30 min at 10,600 x g. The supernatant
was stored at -20°C until needed. TSP was determined for all samples via BCA
protein assay (Thermo Scientific, Cat No. 23225, Pierce BCA Protein Assay
Kit), using BSA as the protein standard, and a modified Ellman assay was used to
determine activity of the expressed enzyme.
3.1.6 Determination of enzyme activity using the Ellman assay
To determine the enzyme activity of BChE, a modified Ellman assay is
used. For BChE assessment, butyrylthiocholine is used as the substrate. To
determine Km and Vmax values, two parts of the assay must occur.
50
3.1.6.1 Assay I – Determination of units BChE/µg TSP.
Fifty µg of TSP from the samples were loaded into the wells of a 96-well
microplate. hBChE standards (i.e., 0.005, 0.01, 0.0125, 0.050, and 0.100 units)
were also loaded onto the plate. Fifty µg of TSP from non-infiltrated ΔFX N.
benthamiana tissue was spiked into the standards. The samples and standards
were brought up to a volume of 50 µL with 0.1 M sodium phosphate buffer, pH
7.0. Two hundred fifty µL of Ellman’s reagent (0.1 M NaHPO4 pH 7.0, 7.5 mM
butyrylthiocholine, and 10 mM DTNB at a ratio of 150:2:5) was added to the
wells containing samples and standards, and was immediately read at 405 nm,
once a min, for 20 min. The absorbance values for the standards and samples were
plotted versus time. A time point from the initial linear phase of the curve (point
in the graph where the incline is) was chosen. The raw data (absorbance) was
taken at this time for each standard, and a standard curve plotted (absorbance
versus concentration of BChE). From this standard curve, the equation of the line
was generated to determine the number of units in each sample.
3.1.6.2 Assay II – Determination of Km and Vmax.
The same number of units of BChE (0.02 U), for all the samples were
loaded into the wells of a 96-well microplate along with hBChE standards of
0.020 U (n=8). The samples and standards were brought up to a volume of 50 µL
with 0.1 M sodium phosphate buffer, pH 7.0. Eight different concentrations of
butyrylthiocholine, (0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 µM ) were combined with
Ellman’s reagent (100 mM NaHPO4 pH 7.0, 10 mM DTNB at a ratio of 150:5),
51
and 250 µL were added to each of the wells. The plate was immediately read at
405 nm, once a min, for 20 min.
On a graph of time versus absorbance, the standards and samples were
plotted. A time was chosen on the linear component of the curve and an absorbance
value for each sample and standard was determined by interpolation. This data was
analyzed using Graph Pad Prism 5 to calculate Vmax and Km. However, the values
can also be calculated by plotting the OD/min obtained from the Ellman assay.
OD/min = velocity (v). Using a Lineweaver-Burk plot, 1/v is plotted against 1/[s].
From the resulting graph, the y intercept = 1/Vmax, and the x intercept = -1/Km. For
more information regarding the Ellman assay, consult the Ellman assay SOP
(Appendix 1).
3.1.7 Purification of BChE from transformed N. benthamiana
In 1 L of extraction buffer (40 mM sodium phosphate buffer pH 7.0 with
EDTA and ascorbic acid), 500 g of BChE-105-1 + P19 infiltrated (and stored at -
20°C) N. benthamiana tissue was liquefied in a blender (Waring Laboratory,
Heavy Duty Blender) on high, for 3 x 30 sec. Next, the tissue was homogenized
(Brinkmann Instruments, Polytron) for 2 min. Homogenate was poured through
miracloth, and ammonium sulfate was added to bring the concentration to 30%
(w/v). The solution was then stirred slowly in 4°C O/N, and then added to 6 x 250
mL centrifuge tubes and spun for 30 min at 10,600 x g. The supernatant was
diluted to 3 L with extraction buffer.
52
3.1.7.1 Tangential flow filtration (TFF)
The supernatant from the extraction was passed through a 0.5 µm hollow
fibre tangential flow filtration (TFF) column (Spectrum Labs, Cat No. C85E-051-
01N, CellFlo Plus Module) at 3500 mL/min, continuous mode, transmembrane
pressure (TMP) ~2 (Cole-Parmer Masterflex L/S, Model no. 77250-62). As this
was a filtration step, the permeate was collected and the retentate was discarded
after taking a sample. The permeate was then passed through a 30 kD cut-off
hollow fibre TFF column (Spectrum Labs, Cat No. P-N1-030E-100-01N,
MiniKros module, 2600 cm2 surface area) at 3500 mL/min, continuous mode,
TMP ~2. As this was a concentration step and the MW of BChE is 85-340 kD
including carbohydrate chains, the retentate was collected and the permeate was
discarded after taking a small sample. The retentate was passed through 0.45 and
0.22 µm filters.
3.1.7.2 Procainamide column
A procainamide column was made utilizing the method of Grunwald et al.,
(1997). Five g of CNBr-activated sepharose 4B (Sigma-Aldrich, Cyanogen
bromide-activated-Sepharose 4B, lyophilized powder, Cat No. C9142) were
added to coupling buffer (0.2 M Na2CO3/NaHCO3, pH 9.0, with 0.4 M NaCl)
containing 189 mg of ε-aminocaproic acid, and then stirred at 4°C for 48 h. The
gel was washed with ddH2O, resuspended in ddH2O, and 473 mg of
procainamide-HCl (Sigma-Aldrich, procainamide hydrochloride, Cat No. P9391)
was added, and the pH adjusted to 4.5. 1-ethyl-3(3-
53 dimethylaminopropyl)carbodimide-HCl (877 mg) was added to the suspension and stirred for 4 h, while maintaining the pH at 4.5. The mixture was stirred for
24 h, after which the gel was washed with ddH2O. The gel was resuspended in 40 mM sodium phosphate buffer, pH 7.0 and packed into a 2.5 x 20 cm column (Bio-
Rad, Econo-Column, Cat No. 737-2522).
The procainamide column was tested with purchased human butyrylcholinesterase. Forty mM sodium phosphate buffer, pH 7.0, was flushed through the column using a peristaltic pump (Bio-Rad, Econo Pump, Model EP1) until baseline was achieved (150-mL). Seven-mL of 40 mM sodium phosphate buffer, pH 7.0, containing 3.4 U of hBCHE was loaded onto the column, followed by 60-mL of 40 mM sodium phosphate buffer, pH 7.0, 40-mL of 100 mM NaCl,
95-mL of 1 M NaCl, 40-mL of 100 mM NaCl + 200 mM procainamide-HCl, 40- mL 500 mM NaCl + 200 mM procainamide-HCl, 60-mL 1M NaCl + 500 mM procainamide-HCl, and then flushed with 40 mM sodium phosphate buffer, pH
7.0. The resulting flowthrough and NaCl elutions were run on an Ellman assay to determine the purification efficiency (elutions containing procainamide-HCl were not run on the Ellman assay, as the procainamide creates a strong background).
54
3.2 Results and discussion
3.2.1 Spot infiltrations of Nicotiana benthamiana with ICON genetics modules.
When spot infiltrations were conducted using BChE-PVX, BChE-TMV
and BChE-PVX+TMV the tissue became necrotic. The first signs of tissue
damage were visible 4-5 dpi (Figure 12), and the tissue became necrotic 6-7 dpi.
Although samples were taken of the necrotic tissue, only day 4 samples were
assessed for BChE activity, since tissue from days 5, 6, and 7 was too damaged to
assess. A western blot was run using the day 4 samples (Figure 13). Although
there was a band present in day 4 of BChE TMV at 250 kDa, and a band for
BChE-TMV + PVX at 250 kDa, they did not match those of the hBChE standard,
and there were many background bands. As well, this result was not repeatable.
Samples from this infiltration were analyzed for BChE activity; however, no
BChE activity was found.
Figure 12. First signs of necrotic tissue in N. benthamiana after spot infiltrated with BChE-TMV (4 dpi).
55
Figure 13. Western blot of spot infiltration with viral-based vectors. Lanes 1) BioRad Dual Color Protein Ladder; 2) hBChE 1 Unit, non-reducing; 3) PVX, 30 µg TSP, non-reducing; 4) TMV, 30 µg TSP, non-reducing; 5) PVX+TMV, 30 µg TSP, non-reducing; 6) Non-infiltrated tissue, 25 µg TSP, non-reducing; 7) PVX, 30 µg TSP, reducing; 8) TMV, 30 µg TSP, reducing; 9) PVX+TMV, 30 µg TSP, reducing; 10) Non-infiltrated tissue, 25 µg TSP, reducing. Western blot was probed with 1° anti-hBChE polyclonal rabbit antibody and 2° goat anti-rabbit antibody, conjugated to AP. Many background bands are present due to intentional overdevelopment and likely reaction to plant proteins.
An RNA extraction, followed by RT-PCR was performed to determine whether mRNA was present in the tissue post-infiltration. The resulting DNA was run on a 1% agarose gel (Figure 13). The bands at ~1800 bp indicate that BChE mRNA was present in the infiltrated tissue; however, there was no evidence (via
Ellman assay) that active enzyme was produced in the infiltrated N. benthamiana tissue.
56
Figure 14. Electrophoresis gel of BChE cDNA from infiltrated tissue. Lane 1, Invitrogen high mass ladder; lane 2, BChE from plant 1 lane 3, BChE from plant 2 lane 4, BChE from plant 2, lane 5, BChE from plant 2, lane 6 Non-infiltrated plants, lane 7 Non-infiltrated plants
It is not clear why the ICON vector infiltration caused necrosis in the tissue. It was initially thought that the vectors were producing a hypersensitive response (HR) in the ΔFX N. benthamiana plants. However, this did not occur when the binary vectors (BChE-103, BChE-104, BChE-105-1, and BChE-105-2) were infiltrated into the same plants. It was hypothesized that the ICON vectors were producing too high a concentration of BChE for the plant tissue to remain healthy. However, an Ellman assay on the necrotic tissue showed very low amounts of activity, especially when compared to the activity found in plant tissue infiltrated with the BChE binary vectors.
57
3.2.2 Spot infiltrations of Nicotiana benthamiana with binary vectors
Several spot infiltration experiments were initially done using the binary
vectors. In all cases, tissue necrosis did not occur within the 1-7 dpi period. Since
infiltrating expression vectors along with a vector containing the P19 gene has
been shown to enhance transient expression in N. benthamiana (Voinnet et al.
2003), spot infiltrations were subsequently performed using BChE 105-1, with
0.6
0.5
0.4
0.3 hBChE 0.2
405 nm BChE-105-1 0.1 BChE-105-1 + P19 0 Non-in iltrated tissue
-0.1
-0.2 0 0.5 1 1.5 2 2.5 3 3.5 4 Substrate concentration (mM)
Figure 15. Butyrylthiocholine hydrolysis of BChE-105-1, with and without the addition of P19. Fifteen µg TSP of each sample’s plant tissue along with hBChE standards were assayed with the substrate butyrylthiocholine (2.5 nmol/µL) to determine units of BChE/µg TSP. With this information, 0.02 units of the samples and hBChE were assayed with multiple concentrations of butyrylthiocholine (0, 0.25, 0.5, 1.0, 2.0, 3.0, and 4.0 mM) and the absorbance readings from the 5 min mark were used to determine OD/min. hBChE, BChE-105-1, BChE-105-1 + P19, and non-infiltrated tissue were plotted on a graph of absorbance vs substrate concentration (above) to show the differences in the rate of hydrolysis achieved by each.
58
0.6
0.5
0.4
0.3 hBChE BChE-103 + P19 0.2
405 nm BChE-104 + P19 0.1 BChE-105-1 + P19 0 BChE-105-2 + P19
-0.1 Non-in iltrated tissue
-0.2 0 0.5 1 1.5 2 2.5 3 3.5 4 Substrate concentration (mM)
Figure 16 Butyrylthiocholine hydrolysis of BChE-103 + P19, BChE-104 + P19, BChE-105-1 + P19, BChE-105-2 + P19. Twenty-five µg TSP of each sample’s plant tissue along with hBChE standards were assayed as described in Figure 15. hBChE, BChE-103 + P19, BChE-104 + P19, BChE-105-1 + P19, BChE-105-2 + P19, and non-infiltrated tissue were plotted on a graph of absorbance vs substrate concentration (above) to show the differences in the rate of hydrolysis achieved by each.
and without P19. The addition of the P19 vector produced higher expression levels (Figure 15).
To compare all the expression vectors to each other, along with the addition of P19, another spot infiltration experiment was done (Figure 16). With this experiment, the BChE-binary vectors infiltrations were harvested on their optimal harvest days as determined by a previous experiment (not shown). The best harvest times were 5 dpi for BChE-103+P19, 4 dpi for BChE-104+P19, and 6 dpi for BChE-105-1+P19 and BChE-105-2+P19. As with the ICON vector infiltrations, multiple SDS-PAGE and western blots were done with extractions
59
from leaf tissue infiltrated with the binary vectors. Again, no distinct bands were
present on the western blots. Using the data from the Ellman assay, Km and Vmax
were calculated (Table 7).
In hindsight, the substrate concentrations in the spot infiltration Ellman
assay experiments were determined to be too high to accurately calculate the Km
and Vmax values. The substrate concentrations for this assay should be low enough
to produce adequate separation in the plot points of the initial phase, so that an
accurate slope can be formed in order to determine the kinetic values. However,
since this was a preliminary experiment to determine the best construct in terms
of yield, and BChE-105-1 + P19 had the highest expression levels (mg BChE/kg
fresh weight) in this and other experiments (not shown), it was decided to proceed
to whole plant infiltrations using the BChE-105-1 and P19 vectors.
Table 7. Vmax, Km, and yield (mg/kg fresh weight) for BChE derived from spot infiltrations with several binary vectors. Data are from a typical experiment.
Non- hBChE BChE-103 + BChE-104 + BChE-105-1 BChE-105-2 infiltrated (Standard) P19 P19 + P19 + P19 Tissue Vmax (U/mL) 1.60 1.62 0.49 2.05 0.05 0.04
Km (µM) 419 588 257 532 * *
Mg BChE/ N/A 31 8 79 8 * kg Fresh Weight** * Could not be determined, insufficient activity to detect. ** mg BChE/kg fresh weight derived from constant value of 718 U/mg BChE (Weber et al. 2011)
60
3.2.3 Whole plant infiltration of Nicotiana benthamiana with BChE-105-1 + P19
binary vectors
Using the optimal conditions determined from several spot infiltration
events, 6 whole plant infiltration experiments were conducted with BChE-105-1 +
P19. For each experiment between 60 and 100 plants were infiltrated using plants
ranging from 6.5 to 7 weeks of age; the only exception being the 16-Feb-2012
experiment. In this case, the plants were 6 weeks old, and hence smaller. These
experiments showed that whole plant infiltration produces plants with lower
expression levels than when spot infiltration was used (Table 8). This is likely due
to the stress caused to whole plants when they are submerged in the
Agrobacterium solution and placed under vacuum.
Table 8. Whole plant BChE infiltration with binary vectors
Mg BChE/kg Number of Vmax Infiltration Date Harvest Date Km µM Fresh Replicates U/mL Weight*
06-Jan-2012 12-Jan-2012 n=10 1.80 ± 0.17 484 ± 93 26.0 ± 4.2
17-Jan-2012 25-Jan-2012 n=9 0.85 ± 0.13 394 ± 59 14.8 ± 1.1
02-Feb-2012 08-Feb-2012 n=9 0.86 ± 0.02 397 ± 27 17.2 ± 2.3
16-Feb-2012 22-Feb-2012 n=8 1.27 ± 0.51 445 ± 53 7.0 ± 1.2
28-Feb-2012 05-Mar-2012 n=10 1.77 ± 0.10 333 ± 97 13.1 ± 2.6
13-Mar-2012 19-Mar-2012 n=10 1.25 ± 0.10 350 ± 24 3.7 ± 0.4
* mg BChE/kg fresh weight derived from constant value of 718 U/mg BChE (Weber et al. 2011)
61
Km, Vmax, and yield was determined in the same manner as the spot infiltration data, with the exception of lower values for the substrate butyrylthiocholine (0, 0.4, 0.8, 1.2, 1.6, 2.0, 2.4, and 2.8 mM in assay II.
Although these lower values did result in greater separation of the data points, an even lower concentration may have provided more accurate Km and Vmax values.
Despite fluctuations in the expression levels of BChE in planta, the Km values remained relatively consistent. However, they are higher than the levels reported in the literature, i.e., 146 µM by Geyer et al. (2010) in N. benthamiana, 150 µM by Lockridge et al. (1997) in CHO cells, and 185 µM by
Wei et al. (2000) in silkworm.
The low concentration of BChE produced in the infiltration which took place on 16-Feb-2012 (7.0 ± 1.2 mg/kg) may be explained by the size of the plants, as they were smaller than those used in the other infiltration events. The significantly low concentration of BChE produced in the infiltration that took place on 13-Mar-2012 (3.7 ± 0.4 mg/kg) may be explained by high greenhouse temperatures, which reached 35°C (Figure 17) and created visible stress on the plants.
In order to show that the activity observed in the Ellman assay was due to the presence of BChE in the tissue and not chemical hydrolysis of the substrate, plant tissue from infiltrated plants known to contain BChE was boiled for 10 min at 100°C. There was loss of activity (Figure 18).
62
33 31 29 27 25 23 21
Temperature (°C) 19 17 15 04-Jan 09-Jan 14-Jan 19-Jan 24-Jan 29-Jan 03-Feb 08-Feb 13-Feb 18-Feb 23-Feb 28-Feb 04-Mar 09-Mar 14-Mar 19-Mar 24-Mar 29-Mar
Figure 17. Greenhouse temperatures during post-infiltration/pre-harvest growth periods. The average temperature of each day was plotted along with standard deviation bars.
0.6 0.5 0.4 0.3 hBChE 0.2 BChE-105-1 0.1 BChE-105-1 [boiled] Absorbance (nm) 0 Non-in iltrated tissue -0.1 -0.2 0 0.5 1 1.5 2 2.5 3 Substrate concentration (umol)
Figure 18. Butyrylthiocholine hydrolysis of BChE-105-1 + P19, and BChE-105-1 + P19 boiled for 10 min at 100°C to show loss of activity when enzyme is deactivated. Twenty-five µg TSP of each sample’s plant tissue along with hBChE standards were assayed as described in Figure 15, with the exception of the substrate (BTCh) concentration being: 0, 0.4, 0.8, 1.2, 1.6, 2.0, 2.4, and 2.8 mM. hBChE, BChE-105-1 + P19, BChE-1045-1+ P19 boiled, and non-infiltrated tissue were plotted on a graph of absorbance vs substrate concentration (above) to show the differences in the rate of hydrolysis achieved by each.
63
3.2.4 Purification of BChE from transformed N. benthamiana
Approximately 49% of the initial and 73% of precipitated BChE from N.
benthamiana remained after purification, i.e., after completion of the 30 kDa
TFF purification step (Table 9). Fifteen percent of the enzyme was lost during
homogenization and centrifugation. A further 20% loss of BChE occurred
during the ammonium sulfate precipitation; most of the enzyme was left behind
in the pellet. No loss occurred during the TFF 0.5 µm permeate step, however
Table 9. Purification efficiency of BChE-105-1 + P19 expressed in N. benthamiana
U/mL Volumes Total % Recovery % Recovery (mL) Units from precipitated extract Initial extract 1.866 1800 3359 100.00
Homogenized 1.680 1800 3025 90.1 extract Centrifuged 1.659 1729 2869 85.4 extract Precipitated 0.896 2470 2213 65.9 100.0 extract 30% (NH4)2SO4 TFF 0.5 µm 0.985 2260 2227 66.3 100.6 permeate TFF 0.5 µm 0.145 360 52.2 1.6 2.4 retentate TFF 30 kDa 0.089 2360 209.5 6.2 9.5 permeate TFF 30 kDa 5.442 300 1633 48.6 73.7 retentate
there was some loss during the TFF 30 kDa step, with some of the enzyme
likely binding to the membrane. The total recovery of BChE following the two
64
TFF steps was 85.6%, i.e., accounting for BChE activity remaining in TFF 0.5
µm permeate and retentate plus TFF 30 kDa permeate and retentate. Total recovery from the initial extraction step was 56.4%.
The procainamide column was tested for the ability to purify BChE. An enzyme assay run on the flow through and NaCl elutions detected a total of 1.65
U out of the 3.4 U loaded, representing a recovery of 49%. As there was no activity detected in the flowthrough and wash buffers, it is likely that 1.7 U of the amount loaded remained in the column. Alternatively, the 1.7 U may have come off the column when the procainamide regeneration buffer passed through the column, removing bound BChE via competition with the high concentration of unbound solute in the flow through buffer.
In conclusion, the total efficiency of the purification process, i.e., from the initial leaf extraction to completion of procainamide affinity purification, was
24% (0.49 (Table 9) * 0.49 (Table 10) = 0.24.
65
* * * * * * * * 0.4 0.76 0.494 Total units detected (U) detected units Total
1 13 20 20 20 20 20 15 20 20 40 Volume collected (mL) collected Volume
L (U) L µ
in 50 in
* * * * * * * * 0.0247 0.0010 0.0019 Units detected Units detected
. Procainamide colum purification efficiency purification colum . Procainamide
10 Table Table Elution sample Starting Flowthrough buffer phosphate Sodium buffer phosphate Sodium buffer phosphate Sodium 100 mM NaCl 100 mM NaCl 1 M NaCl 1 M NaCl 1 M NaCl 1 M NaCl detect to insufficient activity determined; be not * Could
4
66
5 Conclusions and future directions
Nerve agents are highly toxic compounds that inhibit the essential enzyme
acetylcholinesterase, causing continuous neural stimulation resulting in
mammalian symptoms such as headaches, sweating, salivation, miosis,
tremours, convulsions and respiratory arrest. Although there are treatments that
can be administered upon exposure to nerve agents, they fail to prevent some
symptoms and the physiological damage that occurs from exposure.
Butyrylcholinesterase is a promising prophylactic treatment which could help
save the health and life of individuals exposed to this type of chemical weapon.
This enzyme can be purified from expired human serum, but the extraction only
produces a single putative dose from the serum of about 27 adult humans. Other
organisms have been considered as biofactories of BChE; however, the yield is
relatively low. A single putative dose has been achieved in 5.7 L silkworm
hemolymph (Wei et al. 2000) in 40 L of CHO cell culture (Nachon et al. 2002)
and in 14 g of N. benthamiana TSP (Geyer et al. 2010). There is one exception,
with Huang et al. (2007) producing a high yield of 25 doses per L of goats milk.
This research examined the transient expression of BChE in
glycomodified plants using several expression vectors, and saw the successful
production of recombinant BChE in N. benthamiana when the BChE 105-1
binary vector, along with the P19 post-transcriptional gene silencing vector,
were used. Whole plant infiltration with this expression system produced
recombinant BChE with Km values ranging from 333 to 484 µM and yield
67 ranging from 3.7 to 26.0 mg BChE/kg fresh weight. A purification strategy was developed, thus laying the ground work for large-scale production and purification of BChE. However, before a viable commercial production system can be developed, several issues need to be addressed. For example, the initial losses of BChE during the grinding and homogenization must be addressed, as does the apparent retention of BChE on the procainamide column. Nonetheless, the current efficiencies for extraction and affinity purification are at the low end of being acceptable at an industrial level (i.e. 200 mg BChE/kg fresh weight).
However, it is clear that current yields of BChE per kilogram of fresh plant tissue are not yet high enough for viable commercial extraction. For example, considering the current expression yield of 26 mg BChE/kg fresh weight as well as the purification efficiency, 46,200 kg of infiltrated tissue would be required to provide a single 200 mg dose of BChE to each of the 3000 Canadian soldiers, sailors and air force personnel who are currently on overseas operations
(Department of National Defence 2012). Therefore, the expression levels must be increased from 26 to at least 200 – 400 mg BChE/kg fresh weight.
Future work also must be done to determine how effective plant-produced
BChE is at antidoting NAs. Inhibition studies, both in vitro and in mice, must be completed using purified recombinant BChE produced in N. benthamiana using
BChE-105-1 + P19. This would determine whether or not research can move forward using this expression system to produce BChE for use in humans. For the same reason, glycoanalysis of plant-produced BChE must be conducted on the purified, plant-produced enzyme to ensure that the plant specific glycans
68 have been removed. Furthermore, current work on the glycomodified N. benthamiana plants is focusing on adding sialic acid to the galactose moieties of the plant glycans, furthering the humanization of the plant glycoproteins.
Finally, stable transformation in N. tabacum with the BChE binary vectors would aid in verifying whether the transient or stable expression system is the best expression system for recombinant BChE.
The research of this thesis shows that a transient plant expression system for the production of recombinant BChE is a viable option. Since the extracted enzyme remains active after purification, the focus is now on increasing the levels of expression. Previous in planta protein (antibody) expression in D. J. C.
Hall’s lab has delivered increases from 50 mg protein/kg fresh weight to 200 mg protein/kg fresh weight, and in some cases 800 mg protein/kg fresh weight.
This increase was brought about by placing emphasis on the optimization of growth conditions (temperature and light intensity), infiltration efficiency, and purification methods. With increased expression, and more efficient purification, recombinant BChE produced in planta could provide sufficient quantities to enable prophylactic treatment for nerve agent poisoning.
69
6 Literature cited
Allon, N., L. Raveh, et al. (1998). "Prophylaxis Against Soman Inhalation Toxicity in
Guinea Pigs by Pretreatment Alone with Human Serum Butyrylcholinesterase."
Toxicological Sciences 43(121-128).
Ashani, Y., S. Shapira, et al. (1991). "Butyrylcholinesterase and Acetylcholinesterase
Prophylaxis against Soman Poisoning in Mice." Biochemical Pharmacology
41(1): 37-41.
Blong, R. M., E. Bedows, et al. (1997). "Tetramerization Domain of Human
Butyrylcholinesterase Is at the C-Terminus." Biochem Journal 327: 747-757.
Brown, J. H. and P. Taylor (1996). Muscarinic Receptor Agonists and Antagonists. The
Pharmacological Basis of Therapeutics. J. G. H. a. L. E. Limbird, McGraw-Hill:
141-160.
Chatonnet, A. and O. Lockridge (1989). "Comparison of Butyrylcholinesterase and
Acetylcholinesterase." Biochemical Journal 260: 625-634.
Chawla, H. S. (2007). Introduction to Plant Biotechnology. Enfield (NH), USA
Plymouth, UK, Science Publishers, Inc.
Cokugras, A. N. (2003). "Butyrylcholinesterase- Structure and Physiological
Importance." Turkish Journal of Biochemistry 28(2): 54-61.
70
De Muynck, B., C. Navarre, et al. (2010). "Production of Antibodies in Plants: Status
after Twenty Years." Plant Biotechnol J 8(5): 529-563.
Department of National Defence, G. o. C. (2012). "National Defence and the Canadian
Forces." from http://www.forces.gc.ca/site/acf-apfc/index-eng.asp#d3.
Doctor, B. P. and A. Saxena (2005). "Bioscavengers for the Protection of Humans against
Organophosphate Toxicity." Chem Biol Interact 157-158: 167-171.
Duysen, E. G., C. F. Bartels, et al. (2002). "Wild-Type and A328w Mutant Human
Butyrylcholinesterase Tetramers Expressed in Chinese Hamster Ovary Cells Have
a 16-Hour Half-Life in the Circulation and Protect Mice from Cocaine Toxicity."
J Pharmacol Exp Ther 302(2): 751-758.
Ellman, G. L., K. D. Courtney, et al. (1961). "A New and Rapid Colorimetric
Determination of Acetylcholinesterase Activity." Biochemical Pharmacology 7:
88-95.
Evron, T., B. C. Geyer, et al. (2007). "Plant-Derived Human Acetylcholinesterase-R
Provides Protection from Lethal Organophosphate Poisoning and Its Chronic
Aftermath." FASEB J 21(11): 2961-2969.
Eyer, P., F. Worek, et al. (2003). "Molar Absorption Coefficients for the Reduced Ellman
Reagent- Reassessment." Analytical Biochemistry 312: 224-227.
71
Fernandez, H. L., R. D. Moreno, et al. (1996). "Tetrameric (G4) Acetyicholinesterase-
Structure, Localization, and Physiological Regulation." Journal of
Neurochemistry 66(4): 1335-1346.
Finer, J. J. (2010). Plant Nuclear Transformation. Genetic Modification of Plants. F.
Kempken and C. Jung. Berlin, Heidelberg, Springer-Verlag.
Fukuto, T. R. (1990). "Mechanism of Action of Organophosphorus and Carbamate
Insecticides." Environmental Health Perspectives 87: 245-254.
Garabagi, F., E. Gilbert, et al. (2012). "Utility of the P19 Suppressor of Gene-Silencing
Protein for Production of Therapeutic Antibodies in Nicotiana Expression Hosts."
Plant Biotechnol J: 1-11.
Geyer, B. C., S. P. Fletcher, et al. (2007). "Translational Control of Recombinant Human
Acetylcholinesterase Accumulation in Plants." BMC Biotechnol 7: 27.
Geyer, B. C., L. Kannan, et al. (2010). "Transgenic Plants as a Source for the
Bioscavenging Enzyme, Human Butyrylcholinesterase." Plant Biotechnol J 8(8):
873-886.
Geyer, B. C., L. Kannan, et al. (2010). "Plant-Derived Human Butyrylcholinesterase, but
Not an Organophosphorus-Compound Hydrolyzing Variant Thereof, Protects
Rodents against Nerve Agents." Proceedings of the National Academy of
Sciences.
72
Geyer, B. C., M. Muralidharan, et al. (2005). "Purification of Transgenic Plant-Derived
Recombinant Human Acetylcholinesterase-R." Chem Biol Interact 157-158: 331-
334.
Gleba, Y., V. Klimyuk, et al. (2005). "Magnifection--a New Platform for Expressing
Recombinant Vaccines in Plants." Vaccine 23(17-18): 2042-2048.
Gleba, Y., V. Klimyuk, et al. (2007). "Viral Vectors for the Expression of Proteins in
Plants." Curr Opin Biotechnol 18(2): 134-141.
Gomord, V., A. C. Fitchette, et al. (2010). "Plant-Specific Glycosylation Patterns in the
Context of Therapeutic Protein Production." Plant Biotechnol J 8(5): 564-587.
Grohs, B. M., Y. Niu, et al. (2010). "Plant-Produced Trastuzumab Inhibits the Growth of
Her2 Positive Cancer Cells." J Agric Food Chem 58(18): 10056-10063.
Grunwald, J., D. Marcus, et al. (1997). "Large-Scale Purification and Long-Term
Stability of Human Butyrylcholinesterase- a Potential Bioscavenger Drug."
Journal of Biochemical and Biophysical Methods 34(123-135).
Heim, J., C. Schmidt-Dannert, et al. (1998). "Functional Expression of a Mammalian
Acetylcholinesterase in Pichia Pastoris- Comparison to Acetylcholinesterase,
Expressed and Reconstituted from Escherichia Coli." Biochimica et Biophysica
Acta 1396: 306-319.
Horton, H. R., L. A. Moran, et al. (2006). Principles of Biochemistry. New Jersey,
Pearson Prentice Hall.
73
Hoz, D. D. L., B. P. Doctor, et al. (1986). "A Simplified Procedure for the Purification of
Large Quantities of Fetal Bovine Serum Acetylcholinesterase." Life Sciences 39:
195-199.
Huang, Y. J., Y. Huang, et al. (2007). "Recombinant Human Butyrylcholinesterase from
Milk of Transgenic Animals to Protect against Organophosphate Poisoning." Proc
Natl Acad Sci U S A 104(34): 13603-13608.
Kaplan, D., A. Ordentlich, et al. (2001). " Does "Butyrylization" of Acetylcholinesterase
through Substitution of the Six Divergent Aromatic Amino Acids in the Active
Center Gorge Generate an Enzyme Mimic of Butyrylcholinesterase?"
Biochemistry 40: 7433-7445.
Karg, S. R. and P. T. Kallio (2009). "The Production of Biopharmaceuticals in Plant
Systems." Biotechnol Adv 27(6): 879-894.
Kronman, C., B. Velan, et al. (1992). "Production and Secretion of High Levels of
Recombinant Human Acetylcholinesterase in Cultured Cell Lines-
Microheterogeneity of the Catalytic Subunit." Gene 121: 295-304.
Lallement, G., D. Clarencon, et al. (1997). "Efficacy of Atropine:Pralidoxime:Diazepam
or Atropine:Hi-6:Prodiazepam in Primates Intoxicated by Soman." Pharmacology
Biochemistry and Behavior 56(2): 325-332.
Larrick, J. W. and D. W. Thomas (2001). "Producing Proteins in Transgenic Plants and
Animals." Current Opinion in Biotechnology 12: 411-418.
74
Li, S., D. T. Ip, et al. (2010). "High-Level Expression of Functional Recombinant Human
Butyrylcholinesterase in Silkworm Larvae by Bac-to-Bac System." Chem Biol
Interact 187(1-3): 101-105.
Lockridge, O. (1988). "Structure of Human Serum Cholinesterase." BioEssays 9(4).
Lockridge, O., R. M. Blong, et al. (1997). "A Single Amino Acid Substitution,
Gly117his, Confers Phosphotriesterase (Organophosphorus Acid Anhydride
Hydrolase) Activity on Human Butyrylcholinesterase." Biochemistry 36: 786-
795.
Lockridge, O. and B. N. L. Du (1978). "Comparison of Atypical and Usual Human
Serum Cholinesterase." The Journal of Biological Chemistry 253(2): 361-366.
Ma, X., J. Tan, et al. (2006). "High-Level Secretion and Purification of Recombinant
Acetylcholinesterase from Human Cerebral Tissue in P. Pastoris and
Identification by Chromogenic Reaction." Appl Microbiol Biotechnol 72(2): 316-
322.
Main, A. R., W. G. Soucie, et al. (1974). "The Purification of Cholinesterase from Horse
Serum." Biochem Journal 143: 733-744.
Marillonnet, S., A. Giritch, et al. (2004). "In Planta Engineering of Viral RNA Replicons:
Efficient Assembly by Recombination of DNA Modules Delivered by
Agrobacterium." Proc Natl Acad Sci U S A 101(18): 6852-6857.
75
Marrs, T. C. (1993). "Organophosphate Poisoning." Pharmacology and Therapeutics 58:
51-66.
Marrs, T. C. (2007). Toxicology of Organophosphate Nerve Agents. Chemical Warfare
Agents: Toxicology and Treatment. T. C. Marrs, R. L. Maynard and F. R. Sidell,
John Wiley and Sons, Ltd.
Masson, P., W. Xie, et al. (2001). "Effects of Mutations of Active Site Residues and
Amino Acids Interacting with the Omega Loop on Substrate Activation of
Butyrylcholinesterase." Biochemica et Biophysica Acta 1544(166-176).
Meyers, A. J., B. M. Grohs, et al. (2011). Antibody Production in Planta. Comprehensive
Biotechnology. M.-Y. Murray, Elsevier. 4: 287-300.
Mor, T. S., M. Sternfeld, et al. (2001). "Expression of Recombinant Human
Acetylcholinesterase in Transgenic Tomato Plants." Biotechnology and
Bioengineering 75(3): 259-266.
Nachon, F., Y. Nicolet, et al. (2002). "Engineering of a Monomeric and Low-
Glycosylated Form of Human Butyrylcholinesterase." European Journal of
Biochemistry 269: 630-637.
NRC (1997). Review of Acute Human-Toxicity Estimates for Selected Chemical-
Warfare Agents. N. R. Council. Washington, D.C.
Ohbu, S., A. Yamashina, et al. (1997). "Sarin Poisoning on Tokyo Subway." Southern
Medical Journal 90(6): 587-593.
76
Păcurar, D. I., H. Thordal-Christensen, et al. (2011). "Agrobacterium Tumefaciens: From
Crown Gall Tumors to Genetic Transformation." Physiological and Molecular
Plant Pathology 76(2): 76-81.
Parsons, S., C. Prior, et al. (1993). "Acetylcholine Transport, Storage, and Release."
International Review of Neurobiology 35: 279-390.
Patocka, J., J. Cabal, et al. (2005). "Oxime Reactivation of Acetylcholinesterase Inhibited
by Toxic Phosphorus Esters- in Vitro Kinetics and Thermodynamics." Journal of
Applied Biomedicine 3: 91-99.
Quinn, D. M. (1987). "Acetylcholinesterase- Enzyme Structure, Reaction Dynamics, and
Virtual Transition States." Chemical Reviews 87: 955-979.
Raveh, L., Y. Ashani, et al. (1989). "Acetylcholinesterase Prophylaxis against
Organophosphate Poisoning- Quantitative Correlation between Protection and
Blood-Enzyme Level in Mice." Biochemical Pharmacology 38(3): 529-534.
Raveh, L., E. Grauer, et al. (1997). "The Stoichiometry of Protection against Soman and
VX Toxicity in Monkeys Pretreated with Human Butyrylcholinesterase."
Toxicology and Applied Pharmacology 145: 43-53.
Raveh, L., J. Grunwald, et al. (1993). "Human Butyrylcholinesterase as a General
Prophylactic Antidote for Nerve Agent Toxicity." Biochemical Pharmacology
45(12): 2465-2474.
77
Reutter, S. (1999). "Hazards of Chemical Weapons Release During War- New
Perspectives." Environmental Health Perspectives 107(12): 985-990.
Richter, S., J. Nieveler, et al. (2006). "High Yield Production of a Mutant
Nippostrongylus Brasiliensis Acetylcholinesterase in Pichia Pastoris and Its
Purification." Biotechnol Bioeng 93(5): 1017-1022.
Salvaterra, P. M. (2001). "Acetylcholine." Encyclopedia of Life Sciences: 1-7.
Saxena, A., C. Luo, et al. (2008). "Developing Procedures for the Large-Scale
Purification of Human Serum Butyrylcholinesterase." Protein Expr Purif 61(2):
191-196.
Saxena, A., W. Sun, et al. (2011). "Prophylaxis with Human Serum Butyrylcholinesterase
Protects Guinea Pigs Exposed to Multiple Lethal Doses of Soman or VX."
Biochem Pharmacol 81(1): 164-169.
Shen, T., K. Tai, et al. (2002). "Molecular Dynamics of Acetylcholinesterase." Accounts
of Chemical Research 35(6): 332-340.
Stoger, E., M. Sack, et al. (2005). "Recent Progress in Plantibody Technology." Current
Pharmaceutical Design 11: 2439-2457.
Strasser, R., J. Stadlmann, et al. (2008). "Generation of Glyco-Engineered Nicotiana
Benthamiana for the Production of Monoclonal Antibodies with a Homogeneous
Human-Like N-Glycan Structure." Plant Biotechnol J 6(4): 392-402.
78
Sultatos, L. G. (2006). Interactions of Organophosphorus and Carbamate Compounds
with Cholinesterases. Toxicology of Organophosphate & Carbamate Compounds,
Elsevier Academic Press.
Taylor, P. (1996). Agents Acting at the Neuromuscular Junction and Autonomic Ganglia.
The Pharmacological Basis of Therapeutics. J. G. H. L. E. Limbird, McGraw-
Hill: 177-197.
Tucker, J. B. (2006). War of Nerves: Chemical Warfare from World War I to Al-Qaeda.
New York, Pantheon Books.
Velan, B., C. Kronman, et al. (1991). "Recombinant Human Acetylcholinesterase Is
Secreted from Transiently Transfected 293 Cells as a Soluble Globular Enzyme."
Cellular and Molecular Neurobiology 11(1): 143-156.
Voinnet, O., S. Rivas, et al. (2003). "An Enhanced Transient Expression System in Plants
Based on Supression of Gene Silencing by the P19 Protein of Tomato Bushy
Stunt Virus." The Plant Journal 33: 949-956.
Watson, A., K. Bakshi, et al. (2006). Cholinesterase Inhibitors as Chemical Warfare
Agents: Community Preparedness Guidelines. Toxicology of Organophosphate &
Carbamate Compounds, Elsevier Academic Press.
Weber, A., H. Butterweck, et al. (2011). "Biochemical, Molecular and Preclinical
Characterization of a Double-Virus-Reduced Human Butyrylcholinesterase
Preparation Designed for Clinical Use." Vox Sang 100(3): 285-297.
79
Wei, W.-L., J.-C. Qin, et al. (2000). "High-Level Expression of Human
Butyrylcholinesterase Gene in Bombyx Mori and Biochemical-Pharmacological
Charactersitic Study of Its Product." Biochemical Pharmacology 60: 121-126.
Wolfe, A. D., R. S. Rush, et al. (1987). "Acetylcholinesterase Prophylaxis against
Organophosphate Toxicity." Fundamental and Applied Toxicology 9: 266-270.
Worek, F., H. Thiermann, et al. (2004). "Kinetic Analysis of Interactions between Human
Acetylcholinesterase, Structurally Different Organophosphorus Compounds and
Oximes." Biochem Pharmacol 68(11): 2237-2248.
Zhang, Y., J. Kua, et al. (2002). "Role of the Catlytic Triad and Oxyanion Hole in
Acetylcholinesterase Catalysis- an Ab Initio Qm:Mm Study." Journal of the
American Chemical Society 124: 10572-10577.
80
7 Appendix
7.1 Ellman assay SOP
81
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure
Ellman Assay
Prepared by: Robin Hayward Date Prepared: March 5, 2012 Reviewed by: Erin Gilbert Date Reviewed: April 17, 2012 Approved by: Linda Veldhuis Date Approved: April 25, 2012
Revision No.: 1 Revised by: N/A Date revised: N/A
The following SOP contains four separate sections: I – Ellman Assay I II – Ellman Assay I Calculations III –Ellman Assay II IV – Ellman Assay II Calculations.
Each section contains a detailed procedure with unique reagents and supplies.
I – Ellman Assay I
Introduction
The purpose of this SOP is to provide clear and precise details on how to perform an Ellman Assay to determine the units/µg TSP of Butyrylcholinesterase (BChE) after extraction from plant tissue.
Reagents and Supplies
(as described or the appropriate equivalent)
Materials
• 1x 96 well microtitre plate (CoStar Cat. No. 9018) • 1.5-mL centrifuge tubes (Fisher-Scientific Cat. No. 05-408-130) • 50-µL pipette • 250-µL multichannel pipette • 1x multichannel dish • 20-200-µL pipette tips (Fisher-Scientific Cat. No. 02-681-140) • 1x 50-mL centrifuge tube (VWR Cat. No. 89039-660) • Kimwipes (Kimberly-Clark Cat. No. 34120)
ELLMAN ASSAY 1
82
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure
Solutions and Reagents
• Human butyrylcholinesterase active protein (Abcam Cat. No. ab96367), diluted in 1xPBS to 0.1 U/µL • 0.1 M Sodium phosphate buffer, pH 7.0 • 200 mM Butyrylthiocholine • 10 mM DTNB
Equipment
• Microplate reader (Wallac EnVision 2100 Multilabel Reader, Wallac EnVision Manager Software, Version 1.12)
Procedure
Note: Gloves should be worn while preparing and pipetting samples.
1. Make a BChE standard with purchased enzyme. Keep on ice.
0.1 U/µL hBChE 0.1 M Sodium Non-Infiltrated Phosphate Buffer Plant Tissue pH 7.0 TSP Blank 0 µL Top up to 200 µL 200 µg TSP 0.005 U 0.2 µL Top up to 200 µL 200 µg TSP 0.01 U 0.4 µL Top up to 200 µL 200 µg TSP 0.025 U 1 µL Top up to 200 µL 200 µg TSP 0.050 U 2 µL Top up to 200 µL 200 µg TSP 0.1 U 4 µL Top up to 200 µL 200 µg TSP
Note: Non-infiltrated plant tissue is used to spike purchased BChE to make readings comparable.
2. Prepare samples: Centrifuge leaf tissue extract (10,000 rpm, 1 min), and add 200-µg TSP (determined by BCA Protein Assay, SOP No. 201) of each sample to its own 1.5- mL centrifuge tube. Top up to 200-µL with 0.1 M sodium phosphate buffer, pH 7.0. Keep on ice.
Note: this is to make 4 samples which will contain 50-µg TSP each. Loading will be in triplicate, 4 samples are made to ensure even loading.
3. Vortex and load 50-µL of standard and samples in triplicate on 96 well microtitre plate.
ELLMAN ASSAY 2
83
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure 4. Prepare Ellmans Reagent: Combine 30-mL of 0.1 M sodium phosphate buffer, pH 7.0, 1-mL of 10 mM DTNB, and 400-µL of 200 mM butyrylthiocholine in a 50-mL centrifuge tube. Pour into multichannel dish.
5. Turn microplate reader on, open Wallac EnVision Manager. Select: -Protocols -User Protocols -Ellman Assay -Plate 1
6. Ensure that the absorbance is set to 405 nm and that “Plate Repeat” is set to 21 reads, 60 seconds.
7. Select “Wells Selection” and ensure that “Replicates” are set to 3 and “Next Index” is set to 1.
8. Select UNK-Unknown, and click on wells A1 to C1, A2 to C2 etc., for standard, and F1 to H1, F2 to H2 etc., for samples.
1 2 3 4 5 6 7 8 9 10 11 12 UNK UNK UNK UNK UNK UNK A 1 2 3 4 5 6 UNK UNK UNK UNK UNK UNK B 1 2 3 4 5 6 UNK UNK UNK UNK UNK UNK C 1 2 3 4 5 6 D E UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK F 7 8 9 10 11 12 13 14 15 16 17 18 UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK G 7 8 9 10 11 12 13 14 15 16 17 18 UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK UNK H 7 8 9 10 11 12 13 14 15 16 17 18
9. Ensure microplate tray is open (press “load” button on machine if it is not)
10. Quickly, but accurately, pipette 250-µL of Ellman’s reagent into wells, place microplate in tray, immediately click on “Run”. Microplate reader will read every 60 seconds for 20 minutes.
11. When complete, discard of the plate (in the yellow bag waste), and continue on to Ellman Assay I Calculations.
II – Ellman Assay I Calculations
Introduction
The purpose of this SOP is to provide clear and precise details on how to calculate units/µL TSP of Butyrylcholinesterase (BChE) after extraction from plant tissue
ELLMAN ASSAY 3
84
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure
Supplies
Materials
• Ellman Assay I Data from Section I • Microsoft Excel
Procedure
1. In Wallac EnVision Manager, find the results section under protocols. Locate the Ellman Assay I data and double click on it. An image of the plate with kinetic graphs in each well will appear.
2. Select each well in row A (ie., first row of the standards) and select “Add Curve” .
Note: if absorbance readings for each of the reps are consistent, then you only need to do this for 1 rep. If they are not consistent, then the assay should be repeated.
3. Select “Overlaid Curves”. This will show a graph of 1 rep of the standards. Right click on this image, open Microsoft Word and paste the image in. Save the image and print it.
4. Go back to Wallac EnVision software. Remove curves, then select each well in row F (ie., the first row of the unknown samples) and select “Add Curve”.
Note: if absorbance readings for each of the reps are consistent, then you only need to do this for 1 rep. If they are not consistent, then the assay should be repeated.
5. Select “Overlaid Curves”. This will show a graph of 1 rep of the unknown samples. Right click on this image, open Microsoft Word and paste the image in. Save the image and print it.
6. Go back to Wallac EnVision software. Click on “List”. Copy and paste “Plate Repeat”, “Well”, and “Result” into Excel. Save this excel file as Raw Data.
7. Take a look at the printed graphs. A single time point must be chosen. Select a section of the graph of unknown samples that indicates the initial phase, ie., the early part of the graph where the incline is increasing linearly but not curving or plateauing. To help determine the best point, use a ruler along the line to see if it is curving or not. Select the most appropriate time point (eg., 120 seconds, which is 2 min, which is the 3rd plate read)
ELLMAN ASSAY 4
85
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure
8. Find the time point data in the Raw Data saved from step 6. Average the triplicate absorbance readings for the standard and unknown samples. Subtract the average blank reading from the standard and unknown sample averages. In excel, create a standard curve using your standards, and input the unknown sample values into the resulting equation of the line. Take this number and divide by the number of µg of TSP (ie., 50 µg TSP) to give you U/µg TSP
III – Ellman Assay II
Introduction
The purpose of this SOP is to provide clear and precise details on how to perform an Ellman Assay to determine the km and Vmax of butyrylcholinesterase (BChE) after extraction from plant tissue.
Reagents and Supplies
(as described or the appropriate equivalent)
Materials
• 1x 96 well microtitre plate (CoStar Cat. No. 9018) • 1.5-mL centrifuge tubes (Fisher-Scientific Cat. No. 05-408-130) • 50-µL pipette • 250-µL multichannel pipette • 2x multi-well dishes • 20-200-µL pipette tips (Fisher-Scientific Cat. No. 02-681-140) • 8x 15-mL centrifuge tubes (VWR Cat. No. 89039-668) • Kimwipes (Kimberly-Clark Cat. No. 34120)
ELLMAN ASSAY 5
86
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure Solutions and Reagents
• Human butyrylcholinesterase active protein (Abcam Cat. No. ab96367), diluted in 1xPBS to 0.1 U/µL • 0.1 M Sodium phosphate buffer, pH 7.0 • 250 mM Butyrylthiocholine • 10 mM DTNB
Equipment
• Microplate reader (Wallac EnVision 2100 Multilabel Reader, Wallac EnVision Manager Software, Version 1.12)
Procedure
Note: Gloves should be worn while preparing and pipetting samples.
1. Prepare Ellmans Reagent without butyrylthiocholine (BTCh) (combine 40-mL of 0.1 M sodium phosphate buffer, pH 7.0 and 1.33-mL of 10 mM DTNB). Add BTCh to make 7 different concentrations ranging from 0-0.7 µmol BTCh/well (see chart below).
0.25 M BTCh-Iod Ellmans Reagent 0 µmol/well 0 µL 5000 µL 0.1 µmol/well 8 µL 4992 µL 0.2 µmol/well 16 µL 4984 µL 0.3 µmol/well 24 µL 4976 µL 0.4 µmol/well 32 µL 4968 µL 0.5 µmol/well 40 µL 4960 µL 0.6 µmol/well 48 µL 4952 µL 0.7 µmol/well 56 µL 4944 µL
2. Make 0.02 U BChE with purchased enzyme. Keep on ice.
0.1 U/µL hBChE 0.1 M Sodium Phosphate Buffer pH 7.0 0.02 U BChE 2 µL 498 µL
3. Prepare samples, making enough for 10 wells. Determine the number of U/µL by taking 0.02 U and dividing by the number of U/µg TSP as determined in the Section II. This gives the number of µg of each sample needed for 0.02 U. Using data from the BCA protein assay performed before Section I, divide µg needed by ELLMAN ASSAY 6
87
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure the µg/µL TSP for that sample. This gives the number of µL needed per well. Multiply this number by 10 (to make 10 wells worth) and top up to 500-µL with 0.1 M sodium phosphate buffer, pH 7.0. Keep on ice.
4. Load 50 µL of standard and samples on 96 well microtitre plate.
H G F E D C B A
0.020 U 0.020 U 0.020 U 0.020 U 0.020 U 0.020 U 0.020 U 0.020 U hBChE hBChE hBChE hBChE hBChE hBChE hBChE hBChE 1
Unk 1 Unk 1 Unk 1 Unk 1 Unk 1 Unk 1 Unk 1 Unk 1 2
Unk 2 Unk 2 Unk 2 Unk 2 Unk 2 Unk 2 Unk 2 Unk 2 3
Unk 3 Unk 3 Unk 3 Unk 3 Unk 3 Unk 3 Unk 3 Unk 3 4
Unk 4 Unk 4 Unk 4 Unk 4 Unk 4 Unk 4 Unk 4 Unk 4 5
Unk 5 Unk 5 Unk 5 Unk 5 Unk 5 Unk 5 Unk 5 Unk 5 6
Unk 6 Unk 6 Unk 6 Unk 6 Unk 6 Unk 6 Unk 6 Unk 6 7
Unk 7 Unk 7 Unk 7 Unk 7 Unk 7 Unk 7 Unk 7 Unk 7 8
Unk 8 Unk 8 Unk 8 Unk 8 Unk 8 Unk 8 Unk 8 Unk 8 9
Unk 9 Unk 9 Unk 9 Unk 9 Unk 9 Unk 9 Unk 9 Unk 9 10
Unk Unk Unk Unk Unk Unk Unk Unk 10 10 10 10 10 10 10 10 11
Non- Non- Non- Non- Non- Non- Non- Non- infiltrate infiltrate infiltrate infiltrate infiltrate infiltrate infiltrate infiltrate 12 d Tissue d Tissue d Tissue d Tissue d Tissue d Tissue d Tissue d Tissue
5. Ensure microplate tray is open (press “load” button on machine if it is not)
6. Pour different Ellmans Reagent concentrations into multi-well dishes (0 µmol/well in dish well 1, 0.1 µmol/well in dish well 2, 0.2 µmol/well in dish well 3 etc.)
ELLMAN ASSAY 7
88
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure Note: 2 multiwell dishes will be needed in order to have enough reagent out and ready for pipetting.
7. Quickly, but accurately, pipette 250 µL of Ellman’s reagent into wells (making sure to pipette 0 µmol/well into column H, 0.1 µmol/well into column G, 0.2 µmol/well into column F etc.) Place microplate in tray, immediately click on “Run”. Microplate reader will read every 60 seconds for 20 minutes.
8. When complete, discard of the plate (in the yellow bag waste), and continue on to Ellman Assay I Calculations.
IV – Ellman Assay II Calculations
Introduction
The purpose of this SOP is to provide clear and precise details on how to calculate km and Vmax of butyrylcholinesterase (BChE) after extraction from plant tissue.
Supplies
Materials
• Graph Pad Prism 5 • Ellman Assay II Data from Section III • Microsoft Excel
Procedure
1. In Wallace EnVision Manager, find the results section under protocols. Locate the Ellman Assay II data and double click on it. An image of the plate with kinetic graphs in each well will appear.
2. Select each well in row 1 (ie., the standard) and select “Add Curve”
3. Select “Overlaid Curves”. This will show a graph of the standard. Right click on this image, open Microsoft Word and paste the image in. Save the image and print it. 4. Go back to Wallac EnVision software. Remove curves, then select each well in row 2 (ie, the Unknown 1 sample) and select “Add Curve”.
ELLMAN ASSAY 8
89
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure 5. Select “Overlaid Curves”. This will show a graph of the Unknown 1 sample. Right click on this image, open Microsoft Word and paste the image in. Save the image and print it.
6. Repeat step 5 for all of the unknown samples.
7. Go back to Wallac EnVision software. Click on “List”. Copy and paste “Plate Repeat”, “Well”, and “Result” into Excel. Save this excel file as Raw Data.
8. Take a look at the printed graphs. A single time point must be chosen. Select a section of the graph that indicates the initial phase, ie., the early part of the graph where the incline is increasing linearly but not curving or plateauing. To help determine the best point, use a ruler along the line to see if it is curving or not. Select the most appropriate time point (ex., 120 seconds, which is 2 min, which is the 3rd plate read)
9. Find the time point data in the raw data saved from step 7. Take the absorbance from each standard and sample (and for each substrate concentration) and divide by the time point (ie. number of minutes). Take these numbers and minus the blank (Non-infiltrated tissue, 0 µmol/well substrate concentration). The resulting numbers are the OD/min.
10. Multiply the OD/min by 3.3, to account for the 300 µL total volume in each well
11. Take OD values determined in the previous step, and enter into Graph Pad Prism. A. Open Graph Pad Prism 5 B. Under “New Table and Graph” select “Start with an empty data table” and under “Y” select “Enter and plot a single Y value for each point”. Hit “Create”. C. Under the X column, enter the substrate concentrations (0-0.7 U), under the Y columns enter sample values for subsequent substrate concentrations. D. Under “Insert”, select “New Analysis”, and choose “Non-Linear Regression”. Click “OK”. E. Under “Enzyme Kinetics” select “Michaelis-Menten”. Click “OK”. F. Print Data Tables (Data 1), Results (Nonlin fit of Data 1), and Graphs (Data 1). G. The Vmax values are U/mL and the Km values are µmol/mL. Multiply the Km by 1000 in order to have the values reported as µM.
ELLMAN ASSAY 9
90
J. C. Hall Laboratory SOP No.218-0 Standard Operating Procedure Revision History
Revision Revised By Brief Description of Revision (eg. Formatting, grammar, “added No. another option for protein markers”)
Related SOPs and Appendices
BCA Protein Assay (SOP No. 201) Recipes for Solutions and Reagents (Appendix I)
ELLMAN ASSAY 10
91
92