Conserved Microsatellite Markers of High Cross-Species Utility for Flying

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Conservation Genet Resour (2015) 7:599–603 DOI 10.1007/s12686-015-0439-1 MICROSATELLITE LETTERS Conserved microsatellite markers of high cross-species utility for flying, ground and tree squirrels Salisa Jumpa • Deborah A. Dawson • Gavin J. Horsburgh • Catherine Walton Received: 23 January 2015 / Accepted: 14 February 2015 / Published online: 26 February 2015 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract Many squirrel species around the world are Many forest taxa, including squirrels, are becoming in- threatened by forest loss and fragmentation. To facilitate creasingly endangered due to the effects of forest loss and studies of squirrel biodiversity, particularly of flying fragmentation (Sodhi et al. 2010). This is particularly true in squirrels in Southeast Asia, we identified Hylopetes, Southeast Asia that has the highest rates of forest loss Menetes, Glaucomys and Sciurus squirrel microsatellite worldwide (Sodhi et al. 2004). In Southeast Asia, squirrel sequences with homologs in a second squirrel species species vary in IUCN status from Critically Endangered (e.g. (Spermophilus tridecemlineatus), designed 40 consensus Biswamoyopterus biswasi (the Namdapha Flying Squirrel) markers and tested three squirrel species. When tested in in northeast India) to Least Concern (http://www.iucnredlist. four individuals per species, 26 markers were variable in org/details/2816/0). However the risks are certainly under- Hylopetes phayrei, 25 markers in H. lepidus and 25 estimated as true species diversity remains unknown and markers in Menetes berdmorei. Eleven markers were se- many taxa are classified by the IUCN as Data Deficient. It is lected from 14 that were polymorphic in all three species. important to note that even though some species are listed as Cross-species utility was confirmed for these 11 markers in Least Concern they actually face significant threats. For seven additional squirrel species, including: the flying example, two of our study species: Hylopetes lepidus (the squirrels H. phayrei, H. lepidus, H. spadiceus and Petau- Grey-cheeked Flying Squirrel); and Hylopetes phayrei rista petaurista; a ground squirrel, M. berdmorei; and the (Phayre’s Flying Squirrel), are hunted extensively and sold tree squirrels, Callosciurus caniceps and C. finlaysoni. The in food markets throughout Thailand (SJ personal observa- other markers that were variable in one or multiple species tion), despite being officially protected under the Preserva- are also useful for those specific species. tion and Protection of Wildlife Act of B.E. 2535 (1992) (http://www.forest.go.th). Here we developed conserved Keywords Enhanced cross-species utility Á Sciuridae Á microsatellite markers to facilitate conservation genetics Simple tandem repeat (STR) Á Squirrel Á Thailand studies in a broad range of squirrel taxa but particularly flying squirrels of the genus Hylopetes from Indochina. Genomic DNA was extracted from ear clips using a phenol–chloroform extraction method. Microsatellite-en- Electronic supplementary material The online version of this article (doi:10.1007/s12686-015-0439-1) contains supplementary riched genomic libraries were constructed separately fol- material, which is available to authorized users. lowing Armour et al. (1994) using one adult female from each of three species: the flying squirrels: H. phayrei and & S. Jumpa Á C. Walton ( ) H. lepidus; and the Indochinese Ground Squirrel, Menetes Faculty of Life Sciences, University of Manchester, Michael Smith Building, Oxford Road, Manchester M13 9PT, UK berdmorei, all sampled in Thailand. From these we gen- e-mail: [email protected] erated 89, 85 and 91 unique microsatellite sequences (EMBL accession numbers LN650709–650973), respec- S. Jumpa Á D. A. Dawson Á G. J. Horsburgh tively. Microsatellite sequences were available from Gen- NERC Biomolecular Analysis Facility, Department of Animal and Plant Sciences, University of Sheffield, Western Bank, Bank for five other squirrel species: Glaucomys sabrinus, Sheffield, South Yorkshire S10 2TN, UK G. volans, Sciurus lis, S. niger and S. vulgaris. 123 600 123 Table 1 Characterization of eleven conserved microsatellite markers in three squirrel species a 0 0 Locus Locus source species, Repeat Primer sequence 5 –3 Primer PCR Exp. Species Obs. allele KHO HE pHWE Estimated EMBL accession number motif. Tm Ta allele and n size range null allele and clone name (°C) (°C) size tested in species frequency (bp) Hlep26 Hylopetes lepidus; LN650734, (CA)16 F:[6FAM]AAGGTGGTCATCAGTTTCATTG 58.96 59 341 HL.8 284–294 6 0.88 0.84 0.43 ND PHS33_46D09 R:AGTGAATCAGAGTGAGCGATG 58.04 HP 28 284–291 6 0.64 0.63 0.75 -0.02 MB 28 307–336 10 0.75 0.84 0.24 0.05 Hlep59 Hylopetes lepidus; LN650767, (GT)11 F:[6FAM]AATAAATGCTGCTGAAACAAACTC 58.93 59 297 HL 8 272–300 5 0.63 0.71 0.61 ND PHS33_46H07 (GA)21 R:GCTGTGCATTAGCCTCAAAG 58.68 HP 28 277–300 11 0.73 0.88 0.07 0.09 MB 28 313–329 7 0.82 0.82 0.30 -0.01 Hlep72 Hylopetes lepidus; LN650780, (GT)14 F:[6FAM]GCCAAACCACTGCTATCC 56.60 55 243 HL 8 233–257 5 0.38 0.71 0.02 ND PHS33_53C10 R:GKGRTAATCCTAGCCACTTG 54.83 HP 28 235–243 6 0.75 0.71 0.96 -0.04 (t,g) MB 28 234–261 11 0.89 0.84 0.93 -0.05 Hlep80 Hylopetes lepidus; LN650788, (TG)20 F:[HEX]AATACTKAATGSAATGTGTGCAA 59.40 55 289 HL 8 288–290 3 0.50 0.66 0.38 ND PHS33_53F04 R:CTTCCATCAGCTCGGTCA (g,g) HP 28 270–295 14 0.89 0.88 0.46 -0.02 58.36 MB 28 268–281 8 0.68 0.84 0.08 0.09 Hph17 Hylopetes phayrei; LN650810, (CT)2 F:[HEX]GAGTCCAKKGCCAAAKGAGA 62.50 59 205 HL 8 172–176 4 0.50 0.44 1.00 ND WP11_43C04 (TA)2 R:AGCCTGGAAACTAGGACAGTG (t,g,g) HP 28 158–185 15 0.86 0.91 0.76 0.02 (CA)11 58.47 MB 28 157–168 6 0.61 0.58 0.50 -0.02 (T)4 Hph46 Hylopetes phayrei; LN650839, (GT)15 F:[6FAM]GGAATAAAGGAACTCAAATGCTTC 59.55 59 170 HL 8 150–153 3 0.50 0.69 0.70 ND WP11_43G11 R:CCTTGTAAGTATCCTGCAATTGTG 59.95 HP 28 138–152 10 0.54 0.83 0.00* 0.21 MB 28 148–164 5 0.79 0.77 0.89 -0.03 Hph55 Hylopetes phayrei; LN650848, (AC)18 F:[6FAM]CACTCTGGACCTGCCACAT 59.68 59 174 HL 8 159–169 5 0.63 0.53 1.00 ND WP11_43H11 R:GATGCTGAGGTTGGAATTTCTT 59.60 HP 28 167–172 15 0.86 0.90 0.08 0.01 Conservation Genet Resour (2015) 7:599–603 MB 28 168–176 5 0.71 0.68 0.37 -0.03 Hph89 Hylopetes phayrei; LN650882, (AC)4 F:[HEX]GTTCACAGGTATGCTAATGCTG 57.48 55 173 HL 8 175–181 4 0.88 0.68 0.48 ND WP11_51H12 (A)3 R:TATCAGATTCTGAAGCAGAGG 54.77 HP 28 166–179 5 0.21 0.23 0.24 0.08 (CA)9 MB 28 180–201 7 0.89 0.78 0.56 -0.08 (AC)2 GLSA22 Glaucomys sabrinus; FJ755453 (CA)15 F:[HEX]CCTGARWATRATGCATGTGG 59.92 59 179 HL 8 174–184 5 0.88 0.83 0.13 ND R:AGAGTAGGCTGTTCCTTTGAGG (a,a,g) HP 28 179–189 8 0.82 0.86 0.06 0.01 59.05 MB 28 162–221 19 0.52 0.96 0.00* 0.28 GLSA48 Glaucomys sabrinus; FJ755454 (CA)10 F:[6FAM]CTGCTGCAGYRACTTCCTGT 59.21 55 224 HL 8 209–213 4 0.88 0.74 1.00 ND (CG)6 R:GAGTGGGCTCTCAGGTTGA (t,g) HP 28 201–213 7 0.71 0.69 0.78 -0.03 (CA)6 58.90 MB 28 211–215 5 0.54 0.56 0.69 0.00 Conservation Genet Resour (2015) 7:599–603 601 We followed the approach of Dawson et al. (2010)to identify conserved microsatellite sequences and create markers of high cross-species utility. We created a con- 0.04 ; n, number - null allele frequency sensus sequence by aligning the newly isolated squirrel microsatellite sequences and/or other online squirrel se- HWE Estimated quences (Hylopetes/Menetes/Glaucomys/Sciurus) against p their homologue in the thirteen-lined ground squirrel gen- E H ome (Spermophilus tridecemlineatus; http://www.ensembl. Menetes berdmorei org/Spermophilus_tridecemlineatus/index.html). Primer O = sets were designed for 40 microsatellite loci based on these rackets indicate the bases present in MB KH consensus sequences using PRIMER3 v0.4.0 (avoiding bases mismatching between species, when possible). Each primer set matched S. tridecemlineatus and one of the other eight squirrel species cited above (the ‘‘source’’ species) Obs. allele size range in species with a maximum of three degenerate bases per primer (three per primer set) and a maximum of one base mis- Hylopetes phayrei, = matching S. tridecemlineatus. The optimal difference be- MB 28 159–168 9 0.61 0.80 0.03 0.13 Species and n tested HP tween the forward and reverse primer melting temperatures was set to 0.5 °C (maximum 4 °C; Table 1). The 40 conserved microsatellite markers were tested in Exp. allele size (bp) our primary study species H. phayrei, H. lepidus and M. berdmorei (using four individuals per species). Twenty-six HWE, probability of Hardy–Weinberg equilibrium C) a ° p PCR T ( markers were variable in H. phayrei, 25 markers in H. lepidus Hylopetes lepidus, = and 25 markers in M. berdmorei (Supplementary Table 2). C) ° ( Fourteen loci amplified and were polymorphic in all three Primer Tm Spermophilus tridecemlineatus species (Supplementary Table 2). Primer sets designed from comparisons of the thirteen-lined ground squirrel with the flying squirrels (Hylopetes) amplified in more species than those designed from comparisons between the two ground squirrel species, M.
Recommended publications
  • Phylogenies of Flying Squirrels (Pteromyinae)

    Phylogenies of Flying Squirrels (Pteromyinae)

    Journal of Mammalian Evolution, Vol. 9, No. 1/2, June 2002 (© 2002) Phylogenies of Flying Squirrels (Pteromyinae) Richard W. Thorington, Jr.,'''* Diane Pitassy,^ and Sharon A. Jansa^ The phylogeny of flying squirrels was assessed, based on analyses of 80 morphological characters. Three published hypotheses were tested with constraint trees and compared with trees based on heuristic searches, all using PAUP*. Analyses were conducted on unordered data, on ordered data (Wagner), and on ordered data using Dollo parsimony. Compared with trees based on heuristic searches, the McKenna (1962) constraint trees were consistently the longsst, requiring 8-11 more steps. The Mein (1970) constraint trees were shorter, requiring five to seven steps more than the unconstrained trees, and the Thorington and Darrow (20(X)) constraint trees were shorter yet, zero to one step longer than the corresponding unconstrained tree. In each of the constraint trees, some of the constrained nodes had poor character support. The heuristic trees provided best character support for three groups, but they did not resolve the basal trichotomy between a Glaucomys group of six genera, a Petaurista group of four genera, and a Trogopterus group of four genera. The inclusion of the small northern Eurasian flying squirrel, Pteminys, in the Peiaiiiisia group of giant South Asian flying squirrels is an unexpected hypothesis. Another novel hypothesis is the inclusion of the genus Aemmys, large animals from the Sunda Shelf, with the Trogopterus group of smaller "complex-toothed flying squirrels" from mainland Malaysia and southeast Asia. We explore the implications of this study for future analysis of molecular data and for past and future interpretations of the fossil record.
  • New Species of Flying Squirrel from Southwest China Added to the Rarest and 'Most Wanted' 18 July 2019

    New Species of Flying Squirrel from Southwest China Added to the Rarest and 'Most Wanted' 18 July 2019

    New species of flying squirrel from Southwest China added to the rarest and 'most wanted' 18 July 2019 recorded since its original description in 1981 and was already listed as one of the top 25 "most wanted" species in the world by the Global Wildlife Conservation. However, a closer look at the specimen from KIZ made it clear that the squirrel exhibited a colouration, as well as skull and teeth anatomy, distinct from any of the previously known species in the genus. Subsequently, joined by his colleagues from China (Xuelong Jiang, Xueyou Li, Fei Li, Ming Jiang, Wei Zhao and Wenyu Song) and Stephen Jackson from Australia, the team of Quan Li conducted a new field survey. Thus, they successfully obtained Newly described flying squirrel species another specimen and, additionally, recorded Biswamoyopterus gaoligongensis. Credit: Kadoorie observations of two other flying squirrels. As a Farm & Botanic Garden result, they included a third member to the enigmatic genus: Biswamoyopterus gaoligongensis, also referred to as the Mount Gaoligong flying squirrel. This new to science Described in 1981, the genus Biswamoyopterus is species was described in a paper published in the regarded as the most mysterious and rarest open-access journal ZooKeys. amongst all flying squirrels. It comprises two large (1.4-1.8 kg) species endemic to southern Asia: the Namdapha flying squirrel (India) and the Laotian giant flying squirrel (Lao PDR). Each is only known from a single specimen discovered in 1981 and 2013, respectively. Recently, in 2018, a specimen identifiable as Biswamoyopterus was unexpectedly found in the collections of the Kunming Institute of Zoology (KIZ), Chinese Academy of Sciences by in-house expert Quan Li.
  • An Assessment of Wildlife Use by Northern Laos Nationals

    An Assessment of Wildlife Use by Northern Laos Nationals

    animals Article An Assessment of Wildlife Use by Northern Laos Nationals Elizabeth Oneita Davis * and Jenny Anne Glikman San Diego Zoo Institute for Conservation Research, 15600 San Pasqual Valley Rd, Escondido, CA 92026, USA; [email protected] * Correspondence: [email protected] Received: 17 March 2020; Accepted: 8 April 2020; Published: 15 April 2020 Simple Summary: Although unsustainable wildlife consumption is a leading threat to biodiversity in Southeast Asia, there is still a notable lack of research around the issue, particularly into which animals may be “on the horizon” of impending conservation concern. Using semistructured interviews, we investigated the consumption of wildlife in northern Laos, with a focus on the use of wildlife for medicinal purposes. Bear bile was the most popular product, but serow bile was second in popularity and used for similar ailments. In light of these results, and considering the vulnerability of both bear and serow populations in the wild, greater concern needs to be taken to reduce demand for these products, before this demand becomes a significant conservation challenge. Abstract: Unsustainable wildlife trade is a well-publicized area of international concern in Laos. Historically rich in both ethnic and biological diversity, Laos has emerged in recent years as a nexus for cross-border trade in floral and faunal wildlife, including endangered and threatened species. However, there has been little sustained research into the scale and scope of consumption of wildlife by Laos nationals themselves. Here, we conducted 100 semistructured interviews to gain a snapshot of consumption of wildlife in northern Laos, where international and in some cases illegal wildlife trade is known to occur.
  • Namdapha National Park and Tiger Reserve

    Namdapha National Park and Tiger Reserve

    Landscape InItIatIve for the far eastern hImaLaya GBPNIHE Namdapha National Park and Tiger Reserve Namdapha National Park and Tiger Reserve is the world’s northernmost tropical rainforest with the highest species richness among all protected ~935 ~505 Other diversity 2(i) areas in India. It is spread over 1985 sq. km of dense forests in eastern species of flowering plants species of birds Arunachal Pradesh and borders the Hponkanrazi Wildlife Sanctuary (includes monocots and dicots) Total reptiles: 60 and Hukaung Valley Tiger Reserve in Myanmar. It has some of the last Total amphibians: 37 remaining rainforests in northeast India and contains the last large tracts of lowland Dipterocarp forests in Southeast Asia. The PA and its fringe Total fishes: 75 areas have rich cultural diversity, with many tribal groups residing there, Total butterflies: 313 including the Singhpo, Tangsa, Tutsa, Lisu, and Chakma. EN EN CR CR CR Total insects: 495 Hollong Ward’s paphiopedilum Agarwood (Dipterocarpus retusus) (Paphiopedilum wardii) (Aquilaria malaccensis) White-bellied heron Slender-billed vulture (Ardea insignis) (Gyps tenuirostris) Threats • Establishment of tea gardens Declared a An ecological Several Over 150 and coffee estates national park and hotspot with species of rare timber • Logging and development a tiger reserve one Important wren-babblers species2(i) Mt. Dapha bum EN projects under Project Bird Area (IBA)3 recorded CR • Poaching and illegal wildlife Tiger in 1983 Pallas’s fish eagle (Haliaeetus leucoryphus) Indian vulture trade Gyps
  • The Role and Impact of Zootaxa in Mammalogy in Its First 20 Years

    The Role and Impact of Zootaxa in Mammalogy in Its First 20 Years

    Zootaxa 4979 (1): 070–094 ISSN 1175-5326 (print edition) https://www.mapress.com/j/zt/ Review ZOOTAXA Copyright © 2021 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4979.1.10 http://zoobank.org/urn:lsid:zoobank.org:pub:15620BC4-B989-4A98-84D0-019707FF0197 The role and impact of Zootaxa in mammalogy in its first 20 years PEDRO CORDEIRO-ESTRELA¹, ANDERSON FEIJÓ², PHILIPPE GAUBERT³, MARCELO WEKSLER4, LIONEL HAUTIER5,6, PAÚL M. VELAZCO7,8, PABLO TETA9, PIERRE-HENRI FABRE5,6, GERALDINE 10 11 VERON & JANET K. BRAUN 1Laboratório de Mamíferos, Departamento de Sistemática e Ecologia, Centro de Ciências Exatas e da Natureza, Universidade Federal da Paraíba, Campus I, João Pessoa, PB, Brazil. [email protected]; https://orcid.org/0000-0003-3383-571X 2Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Chaoyang District, Beijing, China. [email protected]; http://orcid.org/0000-0002-4643-2293 3Laboratoire Évolution & Diversité Biologique, Université Toulouse III Paul Sabatier, 118 route de Narbonne – Bât. 4R1, 31062 Toulouse cedex 9, France. [email protected]; https://orcid.org/0000-0002-1375-9935 4Departamento de Vertebrados, Museu Nacional, Universidade Federal do Rio de Janeiro, 20940-040 Rio de Janeiro, RJ, Brazil. [email protected]; https://orcid.org/0000-0001-8111-4779 5Institut des Sciences de l’Evolution (ISEM, UMR 5554 CNRS-IRD-UM), Université de Montpellier, Place E. Bataillon - CC 064 - 34095, Montpellier Cedex 5, France. [email protected]; https://orcid.org/0000-0001-8701-5421 [email protected]; https://orcid.org/0000-0002-3414-5625 6Mammal Section, Department of Life Sciences, The Natural History Museum, SW7 5DB London, United Kingdom 7Department of Mammalogy, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024, USA.
  • Download Article (PDF)

    Download Article (PDF)

    OCCASION P PER No. 297 Records of the Zoological Survey of ndia Li t of valid Rodent taxa (Class: Ma malia, Order: Rodentia) from Indian Subcontinent includ· g Myanmar M.S. PRAD AN AND S.S. TALMALE ZOOLOGIC L SURVEY OF I ' DIA OCCASIONAL PAPER No. 297 RECORDS OF THE ZOOLOGICAL SURVEY OF INDIA List of valid Rodent taxa (Class: Mammalia, Order: Rodentia) from Indian Subcontinent including Myanmar M.S. PRADHANI AND S.S. TALMALE2 Zoological Survey of India Western Regional Centre, Vidyanagar, Sector 29, Rawet Road PCNTDA Post, Pune, Maharashtra 411 044 Email: [email protected][email protected] Edited by the Director, Zoological Survey of India, Kolkata ~m Zoological Survey of India Kolkata CITATION Pradhan, M.S. and Talmale, S.S. 2009. List of valid Rodent taxa (Class : Mammalia; Order : Rodentia) from Indian Subcontinent including Myanmar, Rec. zool. Surv. India, Gcc. Paper No. 297 : 1-239. (Published by the Director, Zool. Surv. India, Kolkata) Published : October, 2009 ISBN J78-81-8171-224-0 t; Gnv!. of India, 2009 ALL RIGHTS RESERVED • No Part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise without the prior permission of the publisher. • This book is sold subject to the condition that it shall not, by way of trade, be lent, resold, hired out or otherwise disposed off without the publisher's consent, in a form of binding or cover other than that in which, it is published. • The correct price of this publication is the price printed on this page.
  • 1 Checklist of Indian Mammals FINAL.Pmd

    1 Checklist of Indian Mammals FINAL.Pmd

    CHECKLIST OF INDIAN MAMMALS REVISED AND UPDATED 2008 417 species in 48 families Taxonomy and nomenclature as per Wilson & Reeder (2005) I. ORDER: PROBOSCIDEA 1) Family: Elephantidae (Elephants) 1. Elephas maximus Linnaeus, 1758 Asian Elephant - I, SR, N, BH, BA, M, SE II. ORDER: SIRENIA 2) Family: Dugongidae (Dugong) 2. Dugong dugon (Müller, 1776) Dugong - I, PK(?), SR, M, BA, SE, P, ET, AU - Tropical coastal waters of Indian and W Pacific Ocean III. ORDER: SCANDENTIA 3) Family: Tupaiidae (Treeshrews) 3. Anathana ellioti (Waterhouse, 1850) Madras Treeshrew - I (EN) 4. Tupaia belangeri (Wagner, 1841) Northern Treeshrew - I, N, M, BA, SE, P 5. Tupaia nicobarica (Zelebor, 1869) Nicobar Treeshrew- I (EN) IV. ORDER: PRIMATES SUBORDER: STREPSIRRHINI 4) Family: Lorisidae (Lorises) 6. Loris lydekkerianus Cabrera, 1908 Gray Slender Loris - I, SR 7. Nycticebus bengalensis (Lacépède, 1800) Bengal Slow Loris - I, M, BA, SE, P SUBORDER: HAPLORRHINI 5) Family: Cercopithecidae (Old World monkeys) Subfamily: Cercopithecinae (Macaques) 8. Macaca arctoides (I. Geoffroy, 1831) Stump-tailed Macaque - I, SE, P 9. Macaca assamensis Mc Clelland, 1840 Assam Macaque - I, N, SE, P 10. Macaca fascicularis (Raffles, 1821) Crab-eating Macaque - I, M, SE 11. Macaca leonina (Blyth, 1863) Northern Pig-tailed Macaque - I, M, BA, SE, P 12. Macaca mulatta (Zimmermann, 1780) Rhesus Macaque - I, AF, PK, SE, P 13. Macaca munzala Sinha, Datta, Madhusudan and Mishra, 2005 Arunachal Macaque - I (EN) 14. Macaca radiata (É. Geoffroy, 1812) Bonnet Macaque - I (EN) 15. Macaca silenus (Linnaeus, 1758) Lion-tailed Macaque - I (EN) Subfamily: Colobinae (Langurs and Leaf-monkeys) 16. Semnopithecus ajax (Pocock, 1928) Kashmir Gray Langur - I, PK 17.
  • A Global-Scale Evaluation of Mammalian Exposure and Vulnerability to Anthropogenic Climate Change

    A Global-Scale Evaluation of Mammalian Exposure and Vulnerability to Anthropogenic Climate Change

    A Global-Scale Evaluation of Mammalian Exposure and Vulnerability to Anthropogenic Climate Change Tanya L. Graham A Thesis in The Department of Geography, Planning and Environment Presented in Partial Fulfillment of the Requirements for the Degree of Master of Science (Geography, Urban and Environmental Studies) at Concordia University Montreal, Quebec, Canada March 2018 © Tanya L. Graham, 2018 Abstract A Global-Scale Evaluation of Mammalian Exposure and Vulnerability to Anthropogenic Climate Change Tanya L. Graham There is considerable evidence demonstrating that anthropogenic climate change is impacting species living in the wild. The vulnerability of a given species to such change may be understood as a combination of the magnitude of climate change to which the species is exposed, the sensitivity of the species to changes in climate, and the capacity of the species to adapt to climatic change. I used species distributions and estimates of expected changes in local temperatures per teratonne of carbon emissions to assess the exposure of terrestrial mammal species to human-induced climate change. I evaluated species vulnerability to climate change by combining expected local temperature changes with species conservation status, using the latter as a proxy for species sensitivity and adaptive capacity to climate change. I also performed a global-scale analysis to identify hotspots of mammalian vulnerability to climate change using expected temperature changes, species richness and average species threat level for each km2 across the globe. The average expected change in local annual average temperature for terrestrial mammal species is 1.85 oC/TtC. Highest temperature changes are expected for species living in high northern latitudes, while smaller changes are expected for species living in tropical locations.
  • (Mammalia, Sciuridae) in Lao PDR Daosavanh SANAMXAY

    (Mammalia, Sciuridae) in Lao PDR Daosavanh SANAMXAY

    (様式7) Title of dissertation Systematic Study of Flying Squirrels (Mammalia, Sciuridae) in Lao PDR RONPAKU Fellow Name Daosavanh SANAMXAY Position Lecturer ID No. R11708 Department Faculty of Environmental Sciences Institution National University of Laos Nationality Lao PDR Japanese Advisor Name Masaharu MOTOKAWA Position Professor Institution Kyoto University Background The family Sciuridae is the second largest group of the order Rodentia consisting of 292 species and 60 genera. The tribe Pteromyini (flying squirrels) currently involves 15 genera of 52 species. The molecular data have supported the flying squirrels are monophyly with a sister group to the tribe Sciurini (tree squirrels). Flying squirrels occur in North America and Eurasia, but absent from the Australian region, South America, Africa, and the polar regions. The species richness hotspot of distribution of flying squirrel occurs in the Oriental region; however, the research effort is disproportionate to this pattern. The geographic variation in pelage colour of flying squirrel is considerable but there is no comprehensive description or revision. Lao PDR is located in the area of high diversity of flying squirrel, but the taxonomy and diversity studies are very rare. The most recent report in the country was summarized six species: Petaurista philippensis, P. elegans, Belomys pearsonii, Hylopetes alboniger, H. phayrei, and H. spadiceus. However, the authors mentioned that P. philippensis is highly variable in pelage colour across its wide range. As well small flying squirrels have been seen regularly in deciduous and degraded evergreen forests; but scattered records from many other areas, including evergreen forests, presumably involve several taxa. Thus, in this present study the taxonomy and diversity of flying squirrel is conducted.
  • Microscopic Hair Characteristics of Namdhapa Flying Squirrel

    Microscopic Hair Characteristics of Namdhapa Flying Squirrel

    Journal of Entomology and Zoology Studies 2017; 5(3): 363-364 E-ISSN: 2320-7078 P-ISSN: 2349-6800 Microscopic hair characteristics of Namdhapa JEZS 2017; 5(3): 363-364 © 2017 JEZS Flying Squirrel Biswamoyopterus biswasi Saha, Received: 22-03-2017 Accepted: 23-04-2017 1981 (Sciuridae: Rodentia: Mammalia) Manokaran Kamalakannan Zoological Survey of India, M-Block, New Alipore, Kolkata, Manokaran Kamalakannan India Abstract The microscopic characteristics of dorsal guard hairs of the Namdhapa flying squirrel Biswamoyopterus biswasi were examined using the optical light microscope at the Zoological Survey of India during May 2016. The unique microscopic characteristics such as ‘multicellular’ and ‘multiserial ladder’, the structure of medulla and ‘biconvex’, shape of the cross-section of dorsal guard hair determines the species identity of B. biswasi. The high-resolution photo-micrographs and key characteristics of hair presented here can be used as an appropriate reference for species identification. Keywords: Biswamoyopterus biswasi, hair characteristics, dorsal guard hair, multicellular, biconvex 1. Introduction The Namdhapa flying squirrel Biswamoyopterus biswasi has been classified as a ‘Critically Endangered’ species as per the IUCN Red List of Threatened Species (2016-3), as the occurrence of this species is very less in its range [7]. This squirrel was described on basis of a single holotype specimen by S.S. Saha, the scientist of the Zoological Survey of India, India during 1981. The species is endemic to the Namdhapa National Park, Arunachal Pradesh, India; large sized squirrel having thick and soft pelage; the crown is violet -grey in colour; there is a faint orange- rufous tint on the patagium and the underparts are characteristically white in colour; pelage morocco red grizzled with white above [1].
  • Oldest Skeleton of a Fossil Flying Squirrel Casts New Light on The

    Oldest Skeleton of a Fossil Flying Squirrel Casts New Light on The

    RESEARCH ARTICLE Oldest skeleton of a fossil flying squirrel casts new light on the phylogeny of the group Isaac Casanovas-Vilar1*, Joan Garcia-Porta2, Josep Fortuny1,3,O´ scar Sanisidro4, Je´ roˆ me Prieto5,6, Marina Querejeta7, Sergio Lla´ cer1, Josep M Robles1, Federico Bernardini8,9, David M Alba1 1Institut Catala` de Paleontologia Miquel Crusafont, Universitat Auto`noma de Barcelona, Barcelona, Spain; 2Centre de Recerca Ecolo`gica i Aplicacions Forestals, Universitat Auto`noma de Barcelona, Barcelona, Spain; 3Centre de Recherches sur les Pale´oenvironnements et la Pale´obiodiversite´, Muse´um national d’Histoire naturelle, Paris, France; 4Biodiversity Institute, University of Kansas, Lawrence, United States; 5Department fu¨ r Geo- und Umweltwissenschaften, Pala¨ ontologie, Ludwig-Maximilians-Universita¨ t Mu¨ nchen, Munich, Germany; 6Bayerische Staatssammlung fu¨ r Pala¨ ontologie und Geologie, Munich, Germany; 7Bavarian State Collection of Zoology, Munich, Germany; 8Centro Fermi, Museo Storico della Fisica e Centro Studi e Ricerche Enrico Fermi, Roma, Italy; 9Multidisciplinary Laboratory, The ‘Abdus Salam’ International Centre for Theoretical Physics, Trieste, Italy Abstract Flying squirrels are the only group of gliding mammals with a remarkable diversity and wide geographical range. However, their evolutionary story is not well known. Thus far, identification of extinct flying squirrels has been exclusively based on dental features, which, contrary to certain postcranial characters, are not unique to them. Therefore, fossils attributed to this clade may indeed belong to other squirrel groups. Here we report the oldest fossil skeleton of a flying squirrel (11.6 Ma) that displays the gliding-related diagnostic features shared by extant forms and allows for a recalibration of the divergence time between tree and flying squirrels.
  • Rediscovery of Biswamoyopterus (Mammalia: Rodentia: Sciuridae: Pteromyini) in Asia, with the Description of a New Species from Lao PDR

    Rediscovery of Biswamoyopterus (Mammalia: Rodentia: Sciuridae: Pteromyini) in Asia, with the Description of a New Species from Lao PDR

    Zootaxa 3686 (4): 471–481 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2013 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3686.4.5 http://zoobank.org/urn:lsid:zoobank.org:pub:8597B7A3-060C-4E61-A036-09C1EB351DE8 Rediscovery of Biswamoyopterus (Mammalia: Rodentia: Sciuridae: Pteromyini) in Asia, with the description of a new species from Lao PDR DAOSAVANH SANAMXAY1,2,5, BOUNSAVANE DOUANGBOUBPHA1,2, SARA BUMRUNGSRI2, SYSOUPHANH XAYAVONG1, VILAKHAN XAYAPHET1, CHUTAMAS SATASOOK2,3 & PAUL J.J. BATES4 1Faculty of Environmental Sciences, National University of Laos, Dong Dok Campus, P.O. Box: 7322, Xaythany District, Vientiane Capital, LAO PDR 2Department of Biology, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla 90112, THAILAND 3Princess Maha Chakri Sirindhorn Natural History Museum, Prince of Songkla University, Hat Yai, Songkhla 90112,Thailand 4Harrison Institute, Centre for Systematics and Biodiversity Research, Bowerwood House, St. Botolph’s Road, Sevenoaks, Kent, TN13 3AQ, GREAT BRITAIN 5Corresponding author. E-mail: [email protected] Abstract A new species of the flying squirrel genus Biswamoyopterus is described from Lao PDR. It is based on a single specimen collected from a local food market at Ban Thongnami, Pak Kading District, Bolikhamxai Province. The new taxon shows close affinities to Biswamoyopterus biswasi, which is only known from the holotype collected in 1981, 1250 km from the current locality, in Arunachal Pradesh, Northeast India. However, it differs substantially in pelage colour, most particularly on the ventral surfaces of the body, patagia, tail membrane, and tail. The single specimen was found in an area of central Lao PDR, which is characterised by its extensive limestone karst formations and which is home to other rare endemic ro- dents, including the Kha-nyou (Laonastes aenigmamus) and the Lao limestone rat (Saxatilomys paulinae).