US 20190029236A1 ( 19) United States (12 ) Patent Application Publication (10 ) Pub. No. : US 2019 /0029236 A1 OFFEN (43 ) Pub . Date : Jan . 31 , 2019

(54 ) METHODS FOR GENDER DETERMINATION C12Q 1/ 6879 (2006 .01 ) OF AVIAN EMBRYOS IN UNHATCHED C12N 15 /90 ( 2006 . 01 ) EGGS AND MEANS THEREOF C12N 9 /02 ( 2006 .01 ) (52 ) U . S . CI. (71 ) Applicant: EGGXYT LTD , Jerusalem (IL ) CPC ...... A01K 67 / 0275 (2013 .01 ) ; C12N 15 / 102 ( 2013 .01 ) ; C120 1 /6879 ( 2013 .01 ) ; A01K ( 72 ) Inventor: Daniel OFFEN , Kfar HaRoe ( IL ) 2227/ 30 ( 2013 .01 ) ; C12N 9 /0069 ( 2013. 01 ) ; A01K 2217 /07 ( 2013 .01 ) ; C12N 15 / 907 ( 21 ) Appl. No. : 15 /996 ,045 ( 2013 .01 ) (22 ) Filed : Jun . 1 , 2018 Related U .S . Application Data (57 ) ABSTRACT (63 ) Continuation - in - part of application No . PCT / IL2016 / The present invention relates to methods of gender deter 051291 , filed on Dec . 1, 2016 . mination and identification in avian subjects . More specifi ( 60 ) Provisional application No. 62/ 262 ,409 , filed on Dec . cally , the invention provides non -invasive methods using 3 , 2015 . transgenic avian animals that comprise at least one reporter gene integrated into at least one gender chromosome Zor W . Publication Classification The transgenic avian animals of the invention are used for (51 ) Int . Ci. gender determination and selection of embryos in unhatched A01K 677027 ( 2006 . 01 ) avian eggs . C12N 15 / 10 ( 2006 .01 ) Specification includes a Sequence Listing .

KYYYYYYYYYY Patent Application Publication Jan . 31 , 2019 Sheet 1 of 3 US 2019 / 0029236 A1

** *BALISERE SSSSSSS Fig . 1A

TXXXXXXXXXA Fig . 1B

Fig . 2A Patent Application Publication Jan . 31 , 2019 Sheet 2 of 3 US 2019 / 0029236 A1

Fig . 2B

WWW

Fig . 3A

Fig . 3B Patent Application Publication Jan . 31 , 2019 Sheet 3 of 3 US 2019 / 0029236 A1

Male Female

-

Fig . 4

Female

ve

. .

. . * NO GMO Fig . 5 US 2019 /0029236 A1 Jan . 31, 2019

METHODS FOR GENDER DETERMINATION bread for meat and the weak or unhealthy females are being OF AVIAN EMBRYOS IN UNHATCHED terminated as well . A method for in - ovo , or embryo sex EGGS AND MEANS THEREOF determination prior to hatching is thus highly desired due to both ethical and economic considerations. FIELD OF THE INVENTION [0021 ] Specifically , visually identifying poultry fertile [0001 ] The present invention relates to methods of gender eggs is important to allow removal of unfertile eggs to save determination and identification in avian subjects . More hatching costs ( by prevention of hatching an unfertile egg ) , specifically , the invention provides non - invasive methods and to lower the bio - security risks involved in the continu and transgenic avian animals for gender determination and ation of the incubation of these contamination -prone unfer selection of embryos in unhatched avian eggs . tile eggs alongside the fertile eggs . [ 0022 ] Visually identifying egg fertility at an early stage of BACKGROUND ART the embryo , while inside the unhatched egg , involves outer [0002 ] References considered to be relevant as back light source candling and can be difficult, virtually impos ground to the presently disclosed subject matter are listed sible in early embryonic stages. An even greater challenge is below : to identify the sex of embryos , and currently there is no [0003 ] WO 2010 / 103111 available method for the discrimination between males and 10004 ] WO 2014 /0296707 females in unhatched eggs that are found fertile . However, 0005 ] U . S . Pat . No . 6 , 244 ,214 identification of fertility at an early embryonic stage and the 10006 ] WO 06124456A2 sex determination of poultry are vital for aviculture, scien 10007 ] US2014069336A tific research , and conservation . The determination of sex in [0008 ] W016005539 young birds by morphological features is extremely chal 0009 ] WO 96 / 39505 lenging for most species. The gender may be determined by [0010 ] WO 97 / 49806 individual vent sexing which involves manually squeezing [ 0011 ] Quansah , E ., Long , J. A ., Donovan , D . M ., Becker, the feces out of the chick , which opens up the chicks ' anal S . C ., Telugu , B ., Foster Frey , J. A ., Urwin , N . 2014 . vent slightly, allowing to see if the chick has a small Sperm -mediated transgenesis in chicken using a Piggy “ bump ” , which would indicate that the chick is a male . Bac transposon system . Poultry Science Association However , this method represents high risk of bird injury and Meeting Abstract. BARC Poster Day . mistakes in sex determination , together with cumbersome [0012 ] Jinek , M ., Chylinski, K ., Fonfara , I. , Hauer , M ., work conducted manually by trained personal. Doudna, J . A ., & Charpentier , E . ( 2012 ) . A programmable [0023 ] Vent sexing or chick sexing is the method of dual- RNA - guided DNA endonuclease in adaptive bacte distinguishing the sex of chicken and other hatchlings, rial immunity Science , 337 (6096 ) , 816 -821 . usually by a trained person called a chick sexer or chicken [ 0013 ] Cong, L . , & Zhang, F . (2015 ) . Genome engineering sexer. Chicken sexing is practiced mostly by large commer using CRISPR - Cas9 system . Chromosomal Mutagenesis , cial hatcheries, who have to know the difference between the 197 -217 . sexes in order to separate them into sex groups, and in order [0014 ] Véron N . , Qu Z ., Kipen P A . , Hirst C E ., Marcelle to take them into different programs, which can include the C . (2015 ). CRISPR mediated somatic cell genome engi growing of one group and culling of the other group because neering in the chicken . Dev . Biol. 407 ( 1 ) :68 - 74 . doi: due to being a sex which does not meet the commercial 10 . 1016 / j. ydbio . 2015. 08 . 007 . Epub 2015 Aug 13 . needs . ( In example , a male hatched from an egg that comes [0015 ] CA2264450 . from an egg layer commercial line of breed . That male will [0016 ] Niu , Y ., B . Shen , Y . Cui, Y . Chen , J. Wang et al ., not have a good meat yield and will not lay eggs ; therefore (2014 ) . Generation of genemodified cynomolgus monkey it will be culled after sexing . After the sexing , the relevant via cash/ rna -mediated gene targeting in one - cell embryos . sex will continue its course to serve his or her purpose while Cell , 156 (4 ): 836 -843 . the other sex or most of it will be culled within days of [0017 ] Hwang , W . Y ., Y . Fu , D . Reyon , M . L . Maeder , S . hatching being irrelevant to egg production . Q . Tsai et al. , ( 2013 ) . Efficient genome editing in zebrafish 10024 ] In farms that produce eggs , males are unwanted , using a CRISPR - Cas system . Nat. Biotechnol. 31 ( 3 ) : and chicks of an unwanted sex are killed almost immediately 227 - 229. to reduce costs to the breeder. Chicks are moved down a [ 0018 ] Nadège , V . , Q . Zhengdong , P . A . S . Kipen , C . E . conveyer belt , where chick sexers separate out the males and Hirst, M . Christophe et al. , ( 2015 ) . CRISPR mediated toss them into a chute where they are usually ground up alive somatic cell genome engineering in the chicken . Dev. in a meat grinder. Biol. 407 (1 ): 68 -74 . [0025 ] Identification and determination of the fertility of [0019 ] Bai, Y ., L . He, P . Li, K . Xu , S . Shao et al. , (2016 ). an egg and the sex of the embryos in eggs prior to their Efficient genome editing in chicken DF - 1 cells using the hatching , will enable the elimination of unfertile eggs, and CRISPR /Cas9 system . G3 (Bethesda ) pii : g3 . 116 .027706 . the unwanted type of embryos while in their eggs, and thus Acknowledgement of the above references herein is not to will immensely reduce incubation costs (which includes the be inferred as meaning that these are in any way relevant to energy and efficiency costs alongside with air pollution and the patentability of the presently disclosed subject matter . energy consumption ) . In addition , chicks ' suffering will cease and pollution from culling will be prevented . An BACKGROUND OF THE INVENTION automated sexing device will additionally result in reduced [0020 ] In the food industry , chicks are culled by billions eggs production costs by eliminating the need for chick on a daily basis via suffocation or grinding . The males are sexers , as well as reduce the size of the hatcheries needed terminated since they are not useful for laying eggs or to be since at early stage 50 % of the eggs will be reduced US 2019 /0029236 A1 Jan . 31, 2019 deducted from the process, thus reducing the costs of SUMMARY OF THE INVENTION hatching these eggs , and later on the need for any elaborate killing procedures . [0037 ] A first aspect of the invention relates to a method [0026 ] In all commercial types of birds intended for breed of gender determination of avian , or avian embryo in an ing , laying , or meat production , there is a need to determine unhatched egg , specifically, a fertilized unhatched egg. In fertility and the sex of the embryo . There are great economic some specific embodiments , the method may comprise the returns; in energy saving , biosecurity risk reduction , garbage step of: disposal, sexing labor costs and sexing errors , culling costs [0038 ] First , in step ( a ), providing or obtaining at least one and disposal, and animal welfare . transgenic avian subject or animal comprising at least one 10027 ] WO 2010 / 103111 describes an invasive method exogenous reporter gene integrated into at least one position comprising a series of steps, among them introducing into or location (also referred to herein as locus ) in at least one the egg a labeled antibody , specifically designed to match a of gender chromosome Z and W . In a second step ( b ) sex - specific antigen on the embryo . obtaining at least one fertilized egg from the transgenic [0028 ] WO 2014 /0296707 describes luminance composi avian subject, specifically animal or of any cells thereof. tion designed to serve as a biomarker for quantifying or [0039 ] The next step ( c ) involves determining in the egg if evaluating efficiency of vaccination being injected into the at least one detectable signal is detected . In more specific embodiments , detection of at least one detectable signal bird ' s egg . No sex determination is described or even hinted indicates the expression of said at least one reporter gene, in this disclosure . In -ovo injection apparatus and detection thereby the presence of the W chromosome or Z chromo methods was disclosed by U . S . Pat. No . 6 , 244 ,214 . some in the avian embryo . [0029 ] WO 06124456A2 discloses invasive methods of 10040 ] In a second aspect , the invention relates to an avian in -ovo sex determining of an avian embryo by determining transgenic animal comprising , in at least one cell thereof, at the presence of an estrogenic steroid compound in a sample least one exogenous reporter gene integrated into at least one of embryonic fluid ( e .g . , allantoic fluid or blood ) from the position or location (also referred to herein as locus ) in at avian egg . Determining the presence of the compound is least one of gender chromosome Z and W . done by measuring analytes in samples obtained from said [0041 ] In yet another aspect, the invention relates to a cell avian egg by competitive immunoassay utilizing fluores comprising at least one exogenous reporter gene integrated cence microscopy. into at least one position or locus in at least one of gender [ 0030 ] Spectroscopic approaches were also described , chromosome Z and W . among them US2014069336A which is based on screening 0042 ]. In yet a further aspect thereof, the invention relates the avian embryo feather color (pre -hatching ) and determin to any egg derived , laid or fertilized by at least one of any ing the sex of the avian embryo , based on the feather color of the transgenic avian subjects or animals of the invention , or W0016005539 which disclose a device obtaining a or by any progeny thereof, any component or any parts shell -specific spectral response to an incident light signal thereof or any product comprising said egg , components or [0031 ] Further genetic approaches for this problem parts thereof. It should be understood that in some embodi include DNA sequencing of DNA samples obtained from ments , such transgenic avian subjects may comprise , in at fertilized eggs for detecting two specific genes located on least one cell thereof, at least one exogenous reporter gene the Z and W chromosomes of birds (WO 96 / 39505 ) , or the integrated into at least one position or location (also referred use of oligonucleotide probes which hybridize to specific to herein as locus ) in at least one of gender chromosome Z sequences of the female W chromosome (WO 97 /49806 ) . and W . These methods are invasive and therefore do not provide a [ 0043 ] In yet a further aspect , the invention provides a kit safe strategy . comprising : [0032 ] The clustered regularly interspaced short palindro [0044 ] ( a ) at least one first nucleic acid sequence com mic repeats (CRISPR )/ CRISPR -associated (Cas ) system is prising at least one nucleic acid sequence encoding at least the state of the art gene editing system , allowing a simple one Cas9 protein and at least one nucleic acid sequence construct design with high success rate ( M . Jinek and J . encoding at least one guide RNA (GRNA ) ; and ( b ) at least Doudna, 2012 ) . one second nucleic acid sequence comprising at least one [0033 ] Niu et al. (2014 ) injected guide RNA (GRNA ) and said reporter gene. Cas9 RNA into monkey oocytes to modify three target genes, and Hwang et al . ( 2013 ) modified the drd3 and gsk3b genes in zebrafish embryos to obtain a two - locus mutant. BRIEF DESCRIPTION OF THE DRAWINGS Cong and Zhang (2015 ) have modified the CRISPR system [0045 ] In order to better understand the subject matter that to edit any gene in living cells . is disclosed herein and to exemplify how it may be carried [ 0034 ] Veron and coworkers ( 2015 ), demonstrated that out in practice , embodiments will now be described , by way expression levels of somatic cells in chicken embryos were of non - limiting example only , with reference to the accom modified by electroporation of CRISPR ORNA plasmids panying drawings, in which : directed against the PAX7 transcription factor (Nadège et al. [0046 ] FIGS . 1A - 1B . Luciferase Reporter Gene Signal 2015 ) , Bai and coworkers edited the PPAR - g , ATP synthase Penetrates the Egg Shell epsilon subunit ( ATPSE ) . 10047 ) Luciferase expressing transgenic mice were [ 00351 Quansah , E . et. al. , disclosed sperm mediated trans injected subcutaneously with luciferin . Ear ( FIG . 1A ) and genesis in chicken using a PiggyBac transposon system . In tail ( FIG . 1B ) are excised 10 min thereafter and incorporated particular , they disclose that aGFP plasmid and Lipo into unfertilized eggs . Eggs were imaged using the bio -space fectamine LTXTM 9LPX ) combination had no effect on photon Imager (Bio space lab , USA ) . viability , mobility or fertility of chicken sperm . [0048 ] FIGS. 2A - 2B . Luciferase Reporter Gene Signal is [0036 ] Thus, effective and non - invasive methods for sex Formed in a Fertilized Egg and Penetrates the Egg Shell identification during the egg stage , prior to the hatching of 100491. Ear (FIG . 2A ) and tail ( FIG . 2B ) , excised from the chick are currently not available . There is therefore a luciferase expressing transgenic mice, were incorporated long - felt need for a method enabling accurate and safe sex into a fertilized carrying a 10 days old chicken embryo . identification of the embryos in unhatched eggs . Luciferin is subsequently injected to induce biolumines US 2019 /0029236 A1 Jan . 31, 2019 cence . Images were taken 10 minutes thereafter using the chromosome of a female transgenic avian , identification of bio - space photon Imager (Bio space lab , USA ) . a detectable signal in the examined egg indicate that the [0050 ] FIGS. 3A - 3B . GFP Reporter Gene Signal is not embryo carries a maternal W chromosome and is therefore Detectable Through the Egg Shell determined as female , thereby providing gender determina [0051 ] Tail from GFP - expressing transgenic mice were tion thereof. incorporated into Chicken embryo ( 10 days ) or placed 10061 ] It should be appreciated that the transgenic avian outside of the shell . Only tail placed outside of the egg shell provided by the invention may be either a female or a male , ( FIG . 3A ) can be observed with GFP fluorescence , whereas as described in more detail herein after. In more specific no signal is detected when placed inside the egg ( FIG . 3B ) embodiments , where the transgenic avian subject is a Images were taken after 5 minutes thereafter using the female , the egg identified by the method of the invention is Maestro 2 .2 Imager (Cambridge Research & Instrumenta laid by the transgenic female avian provided by the inven tion , Inc . USA ). tion . In more specific embodiment, the transgenic female [0052 ] FIG . 4 . Detection of Female Avian Embryo may be fertilized either by a transgenic male or by a wild [ 0053] Luciferase reporter gene ( star ) is incorporated into type avian male . Still further, fertilization may occur either the W chromosome of a female transgenic chicken (hen ) . by mating or by insemination of the transgenic avian female Only female egg that carry the W and Z chromosomes , with sperms obtained from a transgenic or wild type avian provide the reporter gene , specifically , luciferase signal. male . In yet other embodiments , where the transgenic avian [ 0054 FIG . 5 . Detection of Male Avian Embryo is a male , egg identified by the method of the invention may [ 0055 ) Luciferase reporter gene ( star ) is incorporated into be laid by either a wild type or transgenic female mated with the Z chromosomes of female transgenic chicken (hen ) . the transgenic male provided by the invention , or insemi Male embryos are detected via the luciferase signal and nated by any cells thereof, specifically sperm cells that females are free of foreign DNA . comprise the exogenous reporter gene of the invention integrated into the gender chromosomes thereof. DETAILED DESCRIPTION OF THE [0062 ] The invention thus provides a method for detecting INVENTION a gender of an avian embryo within an unhatched fertilized [0056 ] Each day, billions of male chicks are being termi egg . It should be appreciated that the method of the inven nated via suffocation or grinding since they are not useful for tion may be applicable for unhatched eggs of any embryonic laying eggs or to be bread for meat . The ability to determine stage of an avian embryo . the sex of the embryo before hatching is ofhigh importance [0063 ] It should be noted that “ Embryonic development both ethically and financially . In the chicken - the genetic stage or step of avian embryo ” , as used herein refers to the make - up of the sex chromosomes is ZZ for males and ZW stage of day 1 wherein the germinal disc is at the blasto for females . Meaning the W chromosome determines the dermal stage and the segmentation cavity takes on the shape gender of the female . This is unlike humans , in which it is of a dark ring ; the stage of day 2 wherein the first groove the Y from the father that determines the male gender. appears at the center of the blastoderm and the vitelline [0057 ] The invention provides a non - invasive efficient membrane appears ; the stage of day 3 wherein blood circu method for gender determination , using a reporter gene lation starts , the head and trunk can be discerned , as well as integrated in a gender specific chromosomes of transgenic the brain and the cardiac structures which begins to beat; the avian subjects . Expression of this reporter gene in an embryo stage of day 4 wherein the amniotic cavity is developing to of an unhatched egg clearly and accurately identify the surround the embryo and the allantoic vesicle appears ; the gender of said embryo . stage of day 5 wherein the embryo takes a C shape and limbs [0058 ] Thus , a first aspect of the invention relates to a are extending ; the stage of day 6 wherein fingers of the upper method of gender determination and optionally of selection and lower limbs becomes distinct; the stage of day 7 wherein of avian , or avian embryo in an unhatched egg , specifically, the neck clearly separates the head from the body , the beak a fertilized unhatched egg . In some specific embodiments , is formed and the brain progressively enters the cephalic the method may comprise the step of: region ; the stage of day 8 wherein eye pigmentation is [0059 ] First , in step ( a ), providing or obtaining at least one readily visible , the wings and legs are differentiated and the transgenic avian subject or animal comprising at least one external auditory canal is opening; the stage of day 9 exogenous reporter gene integrated into at least one position wherein claws appears and the first feather follicles are or location in at least one of gender chromosome Z and W . budding ; the stage of day 10 wherein the nostrils are present, In a second step ( b ) obtaining at least one fertilized egg from eyelids grow and the egg - tooth appears ; the stage of day 11 the transgenic avian subject, specifically animal or of any wherein the palpebral aperture has an elliptic shape and the cells thereof. embryo has the aspect of a chick ; the stage of day 12 wherein [ 0060 ] The next step ( c ) involves determining in the egg if feather follicles surround the external auditory meatus and at least one detectable signal is detected . In more specific cover the upper eyelid whereas the lower eyelid covers embodiments , detection of at least one detectable signal major part of the cornea ; the stage of day 13 wherein the indicates the expression of the at least one reporter gene , allantois becomes the chorioallantoic membrane while thereby the presence of the W chromosome or Z chromo claws and leg scales becomes apparent; the stage of days 14 some in the avian embryo . Thus , in case the reporter gene to 16 wherein the whole body grows rapidly , vitellus shrink has been integrated into the Z chromosome of a female ing accelerates and the egg white progressively disappears ; transgenic avian , identification of a detectable signal in the the stage of day 17 wherein the renal system produces examined egg indicate that the embryo has a maternal Z urates , the beak points to the air cell and the egg white is chromosome having a reporter gene integrated therein , and fully resorbed ; the stage of day 18 wherein the vitellus the embryo is thereby identified as male . Alternatively , in internalized and the amount of amniotic fluid is reduced ; the case the reporter gene has been integrated into the W stage of day 19 wherein vitellus resorption accelerates and US 2019 /0029236 A1 Jan . 31, 2019 the beak is ready to pierce the inner shell membrane; the nal can be detected directly or only in the presence of a stage of day 20 wherein the vitellus is fully resorbed , the reagent. In some embodiments , detectable response is an umbilicus is closed , the chick pierces the inner shell mem optical signal including , but are not limited to chemilumi brane , breathes in the air cell and is ready to hatch ; the stage nescent groups. of day 21 wherein the chick pierces the shell in a circular [0070 ] It should be appreciated that in some specific way by means of its egg -tooth , extricates itself from the shell embodiments , at least one transgenic avian subject provided in 12 to 18 hours and lets its down dry off . by the method of the invention , may comprise at least two [0064 ] More specifically, the method of the invention may different reporter genes , each reporter gene may be inte be applicable in determining the gender of an avian embryo grated into at least one position or location in one of gender in - ovo , inside the egg , at every stage of the embryonic chromosomeZor W . In case of at least two different reporter developmental process . More specifically , from day 1 , from genes, each of the gender chromosomes may be labeled day 2 , from day 3 , from day 4 , from day 5 , from day 6 , from differently . The evaluation of the detectable signal formed , day 7 , from day 8 , from day 9 , from day 10 , from day 11 , may indicate the gender of the examined embryo . from day 12 , from day 13 , from day 14 , from day 15 , from 10071 ] In yet some specific embodiments , the reporter day 16 , from day 17, from day 18 , from day 19 , from day 20 gene comprised within the transgenic avian of the invention and from day 21 . More specifically , the method of the may be at least one bioluminescence reporter gene . Thus, in invention may be applicable for early detection of the some embodiments the expressed polypeptide is a biolumi embryo 's gender, specifically , from day 1 to day 10 , more nescence protein and accordingly the assay measures the specifically , between days 1 to 5 . levels of light emitted from bioluminescent reaction . [0065 ] As noted above , the method of the invention may [0072 ] The term “ bioluminescence ” refers to the emission be applicable for fertilized unhatched eggs . The term “ fer of light by biological molecules , such as proteins . Biolumi tilized egg ” refers hereinafter to an egg laid by a hen wherein nescence involves a molecular oxygen , an oxygenase , and a the hen has been mated by a rooster within two weeks, luciferase , which acts on a substrate , a luciferin , as will be allowing deposit of male sperm into the female infundibu described in more detail herein after. lum and fertilization event to occur upon release of the ovum [ 0073 ] In more specific embodiments , the reporter gene from the ovary . “ Unhatched egg” as used herein , relates to may be luciferase . The term “ Luciferase ” refers hereinafter an egg containing and embryo (also referred to herein as a to a class of oxidative enzymes that produce biolumines fertile egg ) within a structurally integral (not broken ) shell . cence (photon emission ). The emitted photon can be 100661. The method of the invention is based on determi detected by light sensitive apparatus such as a luminometer nation of a detectable signal formed by a reporter gene or modified optical microscopes . Luciferase can be pro integrated into specific loci of the transgenic avian female or duced through genetic engineering in a variety of organisms male laying the examined egg . mostly for use as a reporter gene . Luciferases occur naturally 10067] The “ Integration of foreign or exogenous DNA / in bacteria , algae, fungi , jellyfish , insects , shrimp, and squid . gene into chromosome” as used herein , refers hereinafter to In bacteria , the genes responsible for the light- emitting a permanent modification of the nucleotide sequence of an reaction ( the lux genes encoded into the lux operon ) have organism chromosome. This modification is further trans been isolated and used extensively in the construction of bio ferred during cell division and if occurring in germinal cell reporters that emit a blue - green light with a maximum lines , it will be transmitted also to offspring . In this case , the intensity at 490 nm . Three variants of lux are available , one integrated reporter gene may be transferred to the embryo that functions at < 30° C ., another at < 37° C . , and a third at within the unhatched egg . The term " exogenous” as used < 45° C . The lux genetic system consists of five genes , luxA , herein , refers to originating from outside an organism that luxB , luxC , luxD , and luxE . Depending on the combination has been introduced into an organism for example by of these genes used , several different types of biolumines transformation or transfection with specifically manipulated cent bioreporters can be constructed . The luciferase protein vectors , viruses or any other vehicle . The integrated exog is a heterodimer formed by the luxA and luxB gene products . enous gene according to certain embodiments , may be a The luxC , luxD , and luxE gene products encode for a reporter gene . The term “ reporter gene” relates to gene reductase , transferase , and synthase respectively , that work which encodes a polypeptide , whose expression can be together in a single complex to generate an aldehyde sub detected in a variety of known assays and wherein the level strate for the bioluminescent reaction . luxAB bioreporters of the detected signal indicates the presence of said reported . contain only the luxA and luxB genes, which are able to [0068 ] As noted above , the exogenous reporter gene may generate the light signal. However, to fully complete the be integrated into the avian gender chromosomes Z or W . light- emitting reaction , the substrate ( long chain aldehyde ) The avian “ gender chromosome Z or W ” as used herein must be supplied to the cell . refers to the chromosomal system that determines the sex of [0074 ] On the other hand , luxCDABE bioreporters contain offspring in chicken wherein males are the homogametic sex all five genes of the lux cassette , thereby allowing for a (ZZ ), while females are the heterogametic sex (ZW ). The completely independent light generating system that presence of the W chromosome in the ovum determines the requires no extraneous additions of substrate nor any exci sex of the offspring while the Z chromosome is known to be tation by an external light source . Due to their rapidity and larger and to possess more genes . ease of use , along with the ability to perform the bioassay 100691. The method of the invention is based on the repetitively in real time and on - line , makes luxCDABE detection of a detectable signal that indicates and reflects the bioreporters extremely attractive . Thus, in certain embodi presence of the reporter gene and thereby the presence of a ments , the method of the invention may use as the reporter specific gender chromosome. “ Detectable signal” refers gene, the luxCDABE bioreporters . hereinafter to a change in that is perceptible either by [0075 ] In yet some further embodiments, the method of observation or instrumentally . Without limitations, the sig - the invention may use as a reporter gene, the luc gene . US 2019 /0029236 A1 Jan . 31, 2019

Firefly luciferase ( luc gene ) catalyzes a reaction that pro of the luxCDABE bioreporters as described above . LuxCD duces visible light in the 550 - 575 nm range . A click -beetle ABE system contain five genes of the lux cassette , thereby luciferase is also available that produces light at a peak allowing for a completely independent light generating closer to 595 nm . Both luciferases require the addition of an system that requires no extraneous additions of substrate nor exogenous substrate (luciferin ) for the light reaction to any excitation by an external light source . occur. [0081 ] In some embodiments , it should be noted that the 10076 ]. It should be appreciated that any of the luciferases detectable signal, specifically , the bioluminescent signal described herein , of any source known in the art , may be may be detected using suitable bioluminescent means . In applicable for the methods and kits of the invention . some embodiments , the detectable signal formed by the [0077 ] In yet some specific embodiments , the luciferase luciferase reporter gene may be detected by light sensitive that may be used by the methods of the invention may be apparatus such as a luminometer or modified optical micro Gaussia princeps luciferase . In yet more specific embodi scopes or Charge Coupled Device (CCD ) , a highly sensitive ments , the luciferase used by the invention may be the photon detector. luciferase encoded by the nucleic acid sequence as disclosed [0082 ] In still further embodiments , the at least one trans by GenBank : AY015993. 1 , having the amino acid sequence genic avian subject or animal provided by the method of the as disclosed by GenBank : AAG54095 . 1 . In yet some further invention may be a female avian subject or animal. In more specific embodiments , the luciferase used by the methods specific embodiments , where the at least one reporter gene and kits of the invention may be encoded by a nucleic acid is integrated into at least one position of female chromosome sequence comprising the sequence as denoted by SEQ ID Z , detection of a detectable signal indicates that the embryo NO . 22 . In yet some further embodiments , such luciferase in the unhatched egg is male . may comprise the amino acid sequence as denoted by SEQ 10083 ] In yet some further embodiments, at least one ID NO . 23 , or any homologs, mutants or derivatives thereof. transgenic avian subject or animal provided by the method [0078 ] In yet some further embodiments , luciferase used of the invention may be a female avian subject or animal. In by the invention may be P . pyralis ( firefly ) luciferase . In some specific embodiments , where the at least one reporter some specific embodiments such luciferase may be the gene is integrated into at least one position of female luciferase encoded by the nucleic acid sequence as disclosed chromosome W , detection of a detectable signal, indicates by GenBank : M15077. 1 , having the amino acid sequence as that the embryo in the unhatched egg is female . disclosed by GenBank : AAA29795 . 1. In yet some further [ 0084 ] In yet some further embodiments , the transgenic specific embodiments , the luciferase used by the methods animal provided by the method of the invention may be a and kits of the invention may be encoded by a nucleic acid male subject having the reporter gene integrated into the Z sequence comprising the sequence as denoted by SEQ ID chromosomes thereof. In such case , a detectable signal NO . 20 . In yet some further embodiments , such luciferase determined in an egg fertilized by such transgenic male or may comprise the amino acid sequence as denoted by SEQ any sperms thereof, indicates that the embryo carries a ID NO . 21, or any homologs, mutants or derivatives thereof. paternal Z chromosome comprising the transgenic reporter 10079 ] As noted above , the luciferase used by the method gene , and is therefore male . In still further embodiments , of the invention may require supplementing additional detection of a detectable signal in an egg laid by a transgenic reagents , specifically , a substrate . female avian fertilized by a transgenic male avian , both [0080 ] Thus, in yet some further embodiments, the method carrying the reporter gene of the invention integrated into may further comprise the step of providing to said egg of the Z chromosomes thereof, may indicate in case of an step ( b ) , at least one of substrate and enzyme compatible to intense signal that the embryo carries two copies of a the bioluminescence reporter gene . It should be noted that reporter gene integrated into the female and male Z chro such substrate or enzymemay be required for the formation mosomes thereof. In case of a less intense signal, the egg of the detectable signal detected at step ( c ) . More specifi may be determined as a female . cally , the method of the invention may comprise the step of [0085 ] As indicated herein before , the method of the providing to the egg of step ( b ) , for example by injection , a invention involves the provision of transgenic avian ani substrate for luciferase . In some specific embodiments , such mals . The preparation of transgenic avian animals , requires substrate may be luciferin . Luciferin , as used herein is a the use of genetic engineering approach that may use generic term for the light- emitting compound found in specific nucleases . organisms that generate bioluminescence . Luciferins typi [0086 ] Thus, in yet more specific embodiments , the at cally undergo an enzyme- catalyzed oxidation and the result least one reporter gene may be integrated into the gender ing excited state intermediate emits light upon decaying to chromosome of the transgenic avian subject or animal its basal state . In yet some further embodiments , the sub provided by the method of the invention using at least one strate luciferin , that is an essential element in formation of programmable engineered nuclease ( PEN ) . The term " pro said detectable signal, is injected to said egg , specifically, grammable engineered nucleases (PEN ) ” as used herein , prior to measurement and determination of said signal , as refers to synthetic enzymes that cut specific DNA sequences, performed in step ( c ) . In some embodiments , the substrate derived from natural occurring nucleases involved in DNA may be injected at day 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , repair of double strand DNA lesions and enabling direct 14 , 15 , 16 , 17 , 18 , 19 , 20 or 21 of embryonal development genome editing. of said avian subject, specifically animal. In yet some further [0087 ] The Clustered Regularly Interspaced Short embodiments , the substrate and/ or further enzyme required Palindromic Repeats ( CRISPR ) Type II system is a bacterial for formation of the detectable signal may be provided to the immune system that has been modified for genome engi fertilized egg as nucleic acid sequence encoding said sub neering . It should be appreciated however that other genome strate and /or enzyme, operably liked to said reporter gene . engineering approaches , like zinc finger nucleases (ZFNs ) or Such specific embodiments may refer for example to the use transcription - activator - like effector nucleases ( TALENs) US 2019 /0029236 A1 Jan . 31, 2019

that relay upon the use of customizable DNA - binding pro - 1 and Cas2 . Cas9 contains at least two nuclease domains, a tein nucleases that require design and generation of specific RuvC - like nuclease domain near the amino terminus and the nuclease -pair for every genomic target may be also appli HNH ( or MorA - like ) nuclease domain in the middle of the cable herein . protein , but the function of these domains remains to be [0088 ] As used herein , CRISPR arrays also known as elucidated . However, as the HNH nuclease domain is abun SPIDRs (Spacer Interspersed Direct Repeats ) constitute a dant in restriction enzymes and possesses endonuclease family of recently described DNA loci that are usually activity responsible for target cleavage. specific to a particular bacterial species . The CRISPR array 10093 ]. Type II systems cleave the pre - crRNA through an is a distinct class of interspersed short sequence repeats unusual mechanism that involves duplex formation between (SSRs ) that were first recognized in E . coli. In subsequent a tracrRNA and part of the repeat in the pre - crRNA ; the first years , similar CRISPR arrays were found in Mycobacterium cleavage in the pre - crRNA processing pathway subse tuberculosis , Haloferax mediterranei, Methanocaldococcus quently occurs in this repeat region . Still further , it should be jannaschii , Thermotoga maritima and other bacteria and noted that type II system comprise at least one of cas9 , casi , archaea . It should be understood that the invention contem cas2 csn2 , and cas4 genes . It should be appreciated that any plates the use of any of the known CRISPR systems, type II CRISPR - Cas systems may be applicable in the particularly and of the CRISPR systems disclosed herein . present invention , specifically , any one of type II -A or B . The CRISPR - Cas system has evolved in prokaryotes to [0094 ] Thus, in yet some further and alternative embodi protect against phage attack and undesired plasmid replica ments , the at least one cas gene used in the methods and kits tion by targeting foreign DNA or RNA . The CRISPR -Cas of the invention may be at least one cas gene of type II system , targets DNA molecules based on short homologous CRISPR system ( either typeII - A or typell - B ) . In more DNA sequences, called spacers that exist between repeats . particular embodiments , at least one cas gene of type II These spacers guide CRISPR -associated (Cas ) proteins to CRISPR system used by the methods and kits of the inven matching (and / or complementary ) sequences within the for tion may be the cas9 gene . It should be appreciated that such eign DNA , called proto -spacers , which are subsequently system may further comprise at least one of cas1, cas2 , csn2 cleaved . The spacers can be rationally designed to target any and cas4 genes . DNA sequence . Moreover, this recognition element may be [ 0095 ] Double - stranded DNA ( dsDNA ) cleavage by Cas9 designed separately to recognize and target any desired is a hallmark of “ type II CRISPR - Gas” immune systems. target. With respect to CRISPR systems, as will be recog The CRISPR - associated protein Cas9 is an RNA - guided nized by those skilled in the art , the structure of a naturally DNA endonuclease that uses RNA :DNA complementarity to occurring CRISPR locus includes a number of short repeat identify target sites for sequence- specific double stranded ing sequences generally referred to as “ repeats ” . The repeats DNA (dsDNA ) cleavage , creating the double strand brakes occur in clusters and are usually regularly spaced by unique (DSBs ) required for the HDR that results in the integration intervening sequences referred to as “ spacers. ” Typically, of the reporter gene into the specific target sequence , for CRISPR repeats vary from about 24 to 47 base pair (bp ) in example , a specific target within the avian gender chromo length and are partially palindromic . The spacers are located somes W and Z . The targeted DNA sequences are specified between two repeats and typically each spacer has unique by the CRISPR array , which is a series of about 30 to 40 bp sequences that are from about 20 or less to 72 or more bp in spacers separated by short palindromic repeats. The array is length . Thus , in certain embodiments the CRISPR spacers transcribed as a pre - crRNA and is processed into shorter used in the sequence encoding at least one gRNA of the crRNAs that associate with the Cas protein complex to target methods and kits of the invention may comprise between 10 complementary DNA sequences known as proto - spacers . to 75 nucleotides ( nt ) each . More specifically , about 10 , 11 , These proto - spacer targets must also have an additional 12 , 13, 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , neighboring sequence known as a proto - spacer adjacent 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41, 42 , 43 , motif (PAM ) that is required for target recognition . After 44 , 45 , 46 , 47 , 48, 49, 50 , 51, 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , binding , a Cas protein complex serves as a DNA endonu 60 , 61, 62 , 63 , 64 , 65 , 66 , 67 , 68 , 69, 70 , 71, 72 , 73, 74 , 75 clease to cut both strands at the target and subsequent DNA or more . In some specific embodiments the spacers comprise degradation occurs via exonuclease activity . about 20 to 25 nucleotides , more specifically , about 20 [0096 ] CRISPR type II system as used herein requires the nucleobases . inclusion of two essential components : a " guide ” RNA [ 0089 In addition to at least one repeat and at least one ( gRNA ) and a non -specific CRISPR -associated endonu spacer , a CRISPR locus also includes a leader sequence and clease (Cas9 ). The gRNA is a short synthetic RNA com optionally , a sequence encoding at least one tracrRNA . The posed of a “ scaffold ” sequence necessary for Cas9 -binding leader sequence typically is an AT- rich sequence of up to 550 and about 20 nucleotide long “ spacer ” or “ targeting " bp directly adjoining the 5 ' end of the first repeat. sequence which defines the genomic target to be modified . [ 0090 ] In more specific embodiments , PEN may be a Thus, one can change the genomic target of Cas9 by simply clustered regularly interspaced short palindromic repeat changing the targeting sequence present in the gRNA . Guide (CRISPR ) type II system . RNA ( GRNA ) , as used herein refers to a synthetic fusion of [0091 ] More specifically , three major types of CRISPR the endogenous bacterial crRNA and tracrRNA , providing Cas system are delineated : Type 1, Type II and Type III. both targeting specificity and scaffolding/ binding ability for [0092 ] The type II CRISPR - Cas systems include the Cas9 nuclease . Also referred to as " single guide RNA” or ‘ HNH ’ - type system (Streptococcus - like ; also known as the “ sgRNA ” . CRISPR was originally employed to “ knock -out ” Nmeni subtype, for Neisseria meningitidis serogroup A str. target genes in various cell types and organisms, butmodi Z2491, or CASS4 ) , in which Cas9 , a single , very large fications to the Cas9 enzyme have extended the application protein , seems to be sufficient for generating crRNA and of CRISPR to “ knock - in ” target genes , selectively activate cleaving the target DNA , in addition to the ubiquitous Cas or repress target genes , purify specific regions of DNA , and US 2019 /0029236 A1 Jan . 31, 2019 even image DNA in live cells using fluorescence micros- or Z , is a result of repair of DSBs caused by Cas9 . In some copy. Furthermore , the ease of generating gRNAs makes specific embodiments , the reporter gene of the invention is CRISPR one of the most scalable genome editing technolo integrated , or knocked - in the target loci by HDR . gies and has been recently utilized for genome- wide screens. [0101 ] The term “ Homology directed repair (HDR ) ” , as [0097 ] The target within the genome to be edited , specifi used herein refers to a mechanism in cells to repair double cally , the specific target loci within the gender chromosomes strand DNA lesions . The most common form of HDR is Z or W , where the reporter gene of the invention is to be homologous recombination . The HDR repair mechanism integrated , should be present immediately upstream of a can only be used by the cell when there is a homologue piece Protospacer Adjacent Motif (PAM ) . of DNA present in the nucleus, mostly in G2 and S phase of [0098 ] The PAM sequence is absolutely necessary for the cell cycle . When the homologue DNA piece is absent , target binding and the exact sequence is dependentupon the another process called non -homologous end joining (NHEJ ) species of Cas9 ( 5 ' NGG 3 ' for Streptococcus pyogenes can take place instead . Programmable engineered nucleases Cas9 ) . In certain embodiments , Cas9 from S . pyogenes is ( PEN ) strategies for genome editing , are based on cell used in the methods and kits of the invention . Nevertheless , activation of the HDR mechanism following specific double it should be appreciated that any known Cas9 may be stranded DNA cleavage . applicable . Non - limiting examples for Cas9 useful in the [0102 ] As discussed previously , Cas9 generates double present disclosure include but are not limited to Streptococ strand breaks (DSBs ) through the combined activity of two cus pyogenes ( SP ) , also indicated herein as SpCas9 , Staphy nuclease domains, RuvC and HNH . The exact amino acid lococcus aureus (SA ) , also indicated herein as SaCas9 , residues within each nuclease domain that are critical for Neisseria meningitidis (NM ), also indicated herein as endonuclease activity are known (D10A for HNH and NmCas9, Streptococcus thermophilus (ST ) , also indicated H840A for RuvC in S . pyogenes Cas9 ) and modified ver herein as StCas9 and Treponema denticola ( TD ), also indi sions of the Cas9 enzyme containing only one active cata cated herein as TdCas9 . In some specific embodiments, the lytic domain ( called “ Cas9 nickase ” ) have been generated . Cas9 of Streptococcus pyogenes M1 GAS , specifically , the Cas9 nickases still bind DNA based on ORNA specificity , but Case of protein id : AAK33936 . 1 , may be applicable in the nickases are only capable of cutting one of the DNA strands, methods and kits of the invention . In some embodiments , the resulting in a “ nick ” , or single strand break , instead of a Cas9 protein may be encoded by the nucleic acid sequence DSB . DNA nicks are rapidly repaired by HDR (homology as denoted by SEQ ID NO . 24 . In further specific embodi directed repair ) using the intact complementary DNA strand ments , the Cas9 protein may comprise the amino acid as the template . Thus , two nickases targeting opposite sequence as denoted by SEQ ID NO . 25 , or any derivatives , strands are required to generate a DSB within the target mutants or variants thereof. Once expressed , the Cas9 pro DNA (often referred to as a " double nick ” or “ dual nickase ” tein and the gRNA , form a riboprotein complex through CRISPR system ) . This requirement dramatically increases interactions between the gRNA “ scaffold ” domain and sur target specificity , since it is unlikely that two off - target nicks face - exposed positively -charged grooves on Cas9. Cas9 will be generated within close enough proximity to cause a undergoes a conformational change upon gRNA binding that DSB . It should be therefore understood , that the invention shifts the molecule from an inactive , non -DNA binding further encompasses the use of the dual nickase approach to conformation , into an active DNA -binding conformation . create a double nick - induced DSB for increasing specificity Importantly , the " spacer ” sequence of the gRNA remains and reducing off -target effects . free to interact with target DNA. The Cas9 - gRNA complex [0103 ] Thus , in certain embodiments , the at least one binds any genomic sequence with a PAM , but the extent to reporter gene may be integrated into the gender chromosome which the gRNA spacer matches the target DNA determines of the transgenic avian subject , specifically animal by whether Cas9 will cut. Once the Cas9- CRNA complex binds homology directed repair (HDR ) mediated by at least one a putative DNA target, a “ seed ” sequence at the 3 ' end of the CRISPR /CRISPR - associated endonuclease 9 ( Cas9 ) system . ORNA targeting sequence begins to anneal to the target f0104 ] In some further embodiments , the ORNA of the kit DNA . If the seed and target DNA sequences match , the of the invention may comprise at least one CRISPR RNA CRNA continues to anneal to the target DNA in a 3 ' to 5 ( crRNA ) and at least one trans- activating crRNA ( tracr direction . RNA ). [ 0099 ] Cas9 will only cleave the target if sufficient homol [0105 ] In some alternative embodiments the kit of the ogy exists between the gRNA spacer and target sequences. invention may comprise nucleic acid sequence encoding the Still further, the Cas9 nuclease has two functional endonu at least one gRNA . Such nucleic acid sequence may com clease domains: RuvC and HNH . Cas9 undergoes a second prise a CRISPR array comprising at least one spacer conformational change upon target binding that positions the sequence that targets and is therefore identical to at least one nuclease domains to cleave opposite strands of the target protospacer in a target genomic DNA sequence . It should be DNA . The end result of Cas9 -mediated DNA cleavage is a note that the nucleic acid sequence further comprises a double strand break (DSB ) within the target DNA that sequence encoding at least one tracrRNA . occurs about 3 to 4 nucleotides upstream of the PAM 10106 ]. In some embodiments the CRISPR array according sequence . to the present disclosure comprises at least one spacer and at [ 0100 ] The resulting DSB may be then repaired by one of least one repeat. In yet another embodiment, the invention two general repair pathways , the efficient but error - prone further encompasses the option of providing a pre -crRNA Non -Homologous End Joining (NHEJ ) pathway and the less that can be processed to several final gRNA products that efficient but high - fidelity Homology Directed Repair (HDR ) may target identical or different targets . pathway . In some embodiments , the insertion that results in [0107 ] In yet some more specific embodiments , the the specific integration of the reporter gene of the invention crRNA comprised within the ORNA of the invention may be to the specific target loci within the gender chromosomes W a single - stranded ribonucleic acid (ssRNA ) sequence US 2019 /0029236 A1 Jan . 31, 2019 complementary to a target genomic DNA sequence. In some RNA ( crRNA ) and a trans activating RNA ( tracrRNA ) . The specific embodiments , the target genomic DNA sequence sequence of the targeting RNA encoded by the CRISPR may be located immediately upstream of a protospacer spacers is not particularly limited , other than by the require adjacent motif (PAM ) sequence and further . ment for it to be directed to ( i. e ., having a segment that is the [0108 ] As indicated herein , the gRNA of the kit of the same as or complementarity to ) a target sequence in avian invention may be complementary, at least in part, to the genomic DNA that is also referred to herein as a " proto target genomic DNA . In certain embodiments , “ Comple spacer ” . Such proto -spacers comprise nucleic acid sequence mentarity ” refers to a relationship between two structures having sufficient complementarity to a targeting RNA each following the lock - and -key principle . In nature encoded by the CRISPR spacers comprised within the complementarity is the base principle of DNA replication nucleic acid sequence encoding the gRNA of the methods and transcription as it is a property shared between two DNA and kits of the invention . or RNA sequences , such that when they are aligned anti - [0114 ] In some embodiments , a crRNA comprises or con parallel to each other , the nucleotide bases at each position sists of 20 , 21, 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31, 32, 33 , in the sequences will be complementary ( e . g ., A and T or U , 34 , 35 , 36 , 37 , 38 , 39 or 40 nt of the spacer (targeting ) C and G ) . sequence followed by 19 - 36 nt of repeat sequence . In [0109 ] As indicated above , the genomic DNA sequence specific and non - limiting embodiments , the targeting spacer targeted by the gRNA of the kit of the invention is located may comprise or consist of a segment that targets any one of immediately upstream to a PAM sequence . In some embodi the genomic DNA sequence for which representative spacer ments, such PAM sequence may be of the nucleic acid sequences are indicated herein . sequence NGG . 0115 ] It should be noted that in some specific embodi [0110 ] In certain embodiments , the PAM sequence ments , the spacers of the CRISPR system of the invention referred to by the invention may comprise N , that is any may encode a targeting guide RNA ( GRNA ). A “ ORNA ” or nucleotide , specifically, any one of Adenine ( A ) , Guanine " targeting RNA ” is an RNA that , when transcribed from the (G ) , Cytosine (C ) or Thymine ( T ). In yet some further portion of the CRISPR system encoding it , comprises at embodiments the PAM sequence according to the invention least one segment of RNA sequence that is identical to (with is composed of A , G , C , or T and two Guanines . the exception of replacing T for U in the case of RNA ) or [0111 ] According to one embodiment, the polynucleotide complementary to (and thus “ targets " ) a DNA sequence in encoding the gRNA of the invention may comprise at least the target genomic DNA . The CRISPR systems of the one spacer and optionally , at least one repeat. In yet some present disclosure may optionally encode more than one further embodiments, the DNA encoding the gRNA of the targeting RNA , and the targeting RNAs be directed to one or invention may comprise at least 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , more target sequences in the genomic DNA . 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , [0116 ] Still further , in some embodiments , the at least one 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , reporter gene may be integrated into a gender chromosome 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , of the transgenic avian subject, specifically animal by co 59 , 60 , 61 , 62 , 63 , 64 , 65 , 66 , 67 , 68 , 69 , 70 , 71, 72 , 73 , 74 , transfecting at least one cell of the avian subject, specifically 75 , 76 , 77 , 78 , 79 , 80 , 81 , 82 , 83 , 84 , 85 , 86 , 87 , 88 , 89 , 90 , animal or at least one cell introduced into the avian subject, 91 , 92, 93 , 94 , 95 , 96 , 97 , 98 , 99 , 100 or more , specifically , specifically animal , with : (a ) at least one first nucleic acid 110 , 120 , 130 , 140 , 150 , 160 , 170 , 180 , 190 , 200 or more sequence comprising at least one nucleic acid sequence spacers . In some embodiments , each spacer is located encoding at least one Cas9 protein and at least one nucleic between two repeats . It should be further understood that the acid sequence encoding at least one guide RNA ( GRNA ) ; spacers of the nucleic acid sequence encoding the gRNA of and (b ) at least one second nucleic acid sequence comprising the invention may be either identical or different spacers . In at least one reporter gene . more embodiments , these spacers may target either an [0117 ] Thus , for the preparation of a transgenic avian identical or different target genomic DNA . In yet some other animal used by the methods of the invention , at least two embodiments , such spacer may target at least 1 , 2 , 3 , 4 , 5 , 6 , nucleic acid molecules should be provided . 7 , 8 , 9 , 10 , 11, 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , [0118 ] As used herein , “ nucleic acids or nucleic acid 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , molecules ” is interchangeable with the term “ polynucleotide 40 , 41, 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , ( s ) ” and it generally refers to any polyribonucleotide or 56 , 57 , 58 , 59 , 60 , 61, 62 , 63 , 64 , 65 , 66 , 67, 68 , 69 , 70 , 71 , poly -deoxyribonucleotide , which may be unmodified RNA 72 , 73 , 74 , 75 , 76 , 77 , 78 , 79 , 80 , 81, 82 , 83 , 84 , 85 , 86 , 87 , or DNA or modified RNA or DNA or any combination 88 , 89 , 90 , 91 , 92 , 93 , 94 , 95 , 96 , 97 , 98 , 99 , 100 or more thereof . “ Nucleic acids” include , without limitation , single target genomic DNA sequence . These target sequences may and double- stranded nucleic acids . As used herein , the term be derived from a single locus or alternatively, from several “ nucleic acid ( s) ” also includes DNAs or RNAs as described target loci . above that contain one or more modified bases . As used [0112 ] As used herein , the term " spacer ” refers to a herein , the term “ oligonucleotide ” is defined as a molecule non - repetitive spacer sequence that is designed to target a comprised of two or more deoxyribonucleotides and / or specific sequence and is located between multiple short ribonucleotides , and preferably more than three . Its exact direct repeats ( i. e ., CRISPR repeats ) of CRISPR arrays . In size will depend upon many factors which in turn , depend some specific embodiments, spacers may comprise between upon the ultimate function and use of the oligonucleotide . about 15 to about 30 nucleotides, specifically , about 15 , 16 , The oligonucleotides may be from about 8 to about 1 , 000 17 , 18 , 19 , 20 , 21 , 22, 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 ormore nucleotides long . More specifically , the oligonucleotide nucleotides. More specifically , about 20 -25 nucleotides. molecule / s used by the kit of the invention may comprise [ 0113 ] The guide or targeting RNA encoded by the any one of 5 , 6 , 7 , 8, 9, 10 , 11 , 12, 13 , 14 , 15 , 16 , 17 , 18 , CRISPR system of the invention may comprise a CRISPR 19 , 20 , 21, 22 , 23 , 24 , 25 , 26 , 27, 28 , 29 , 30 , 35, 40 , 45 , 50 , US 2019 /0029236 A1 Jan . 31, 2019

55 , 60 , 65 , 70 , 75 , 80 , 85 , 90 , 95 , 100 , 200 , 300 , 400 , 500 , [0124 ] It should be appreciated that in some embodiments , 600 , 700 , 800 , 900 , 1000 or more bases in length . at least one of the first and the second nucleic acid sequences [0119 ] Nucleic acid molecules can be composed ofmono provided and used by the methods and kits of the invention mers that are naturally occurring nucleotides ( such as DNA may be constructed and comprised within a vector. “ Vec and RNA ), or analogs of naturally occurring nucleotides tors” or “ Vehicles” , as used herein , encompass vectors such ( e . g . , alpha - enantiomeric forms of naturally -occurring as plasmids , phagemides, viruses, integratable DNA frag nucleotides ) , or modified nucleotides or any combination ments , and other vehicles , which enable the integration of thereof. Herein this term also encompasses a cDNA , i . e . DNA fragments into the genome of the host, or alternatively , complementary or copy DNA produced from an RNA enable expression of genetic elements that are not integrated . Vectors are typically self - replicating DNA or RNA con template by the action of reverse transcriptase (RNA - depen structs containing the desired nucleic acid sequences , and dent DNA polymerase ). operably linked genetic control elements that are recognized [0120 ] In this connection an “ isolated polynucleotide” is a in a suitable host cell and effect the translation of the desired nucleic acid molecule that is separated from the genome of spacers. Generally , the genetic control elements can include an organism . For example , a DNA molecule that encodes the a prokaryotic promoter system or a eukaryotic promoter reporter gene used by the methods and kits of the invention expression control system . Such system typically includes a or any derivatives or homologs thereof, as well as the transcriptional promoter, transcription enhancers to elevate sequences encoding the CRISPR / Cas9 and gRNAs of the the level of RNA expression . Vectors usually contain an methods and kits of the invention , that has been separated from the genomic DNA of a cell is an isolated DNA origin of replication that allows the vector to replicate molecule . Another example of an isolated nucleic acid independently of the host cell. In yet some alternative molecule is a chemically -synthesized nucleic acid molecule embodiments , the expression vectors used by the invention that is not integrated in the genome of an organism . A may comprise elements necessary for integration of the nucleic acid molecule that has been isolated from a particu desired reporter gene of the invention into the avian gender lar species is smaller than the complete DNA molecule of a specific chromosomes W and /or Z . chromosome from that species . In some embodiments , the [0125 ] Accordingly, the term " control and regulatory ele nucleic acid sequences used by the methods and kits of the ments ” includes promoters , terminators and other expression invention , specifically , nucleic acid sequences comprising control elements . Such regulatory elements are described in sequences encoding the Cas9 and ORNA , or alternatively the Goeddel ; [Goeddel ., et al ., Gene Expression Technology : reporter gene of the invention , may be provided constructed Methods in Enzymology 185 , Academic Press, San Diego , within a vector. The invention thus further relates to recom Calif . ( 1990 ) ] . For instance , any of a wide variety of binant DNA constructs comprising the polynucleotides of expression control sequences that control the expression of the invention , and optionally , further additional elements a DNA sequence when operatively linked to it may be used such as promoters , regulatory and control elements , trans in these vectors to express DNA sequences encoding any lation , expression and other signals , operably linked to the desired protein using the method of this invention . nucleic acid sequence of the invention . [0126 ] A vector may additionally include appropriate restriction sites, antibiotic resistance or other markers for [0121 ] As used herein , the terms “ recombinant DNA ” , selection of vector- containing cells . Plasmids are the most " recombinant nucleic acid sequence” or “ recombinant gene ” commonly used form of vector but other forms of vectors refer to a nucleic acid comprising an open reading frame which serve an equivalent function and which are, or encoding one of the CRISPR system of the invention , become, known in the art are suitable for use herein . See , specifically , the CRISPR / Cas9 type II , along with the gRNA e . g . , Pouwels et al. , Cloning Vectors : a Laboratory Manual of the invention that target the Cas9 to specific locus within ( 1985 and supplements ), Elsevier, N . Y .; and Rodriquez, et avian chromosomes 2 and / or W . In yet another embodi al. ( eds. ) Vectors : a Survey of Molecular Cloning Vectors ments, recombinant DNA as used herein further refers to a and their Uses , Buttersworth , Boston , Mass . ( 1988 ) , which nucleic acid comprising an open reading frame encoding the are incorporated herein by reference . reporter gene of the invention , specifically , transgene . [0127 ] To create the transgenic avian animal used by the [0122 ] As referred to herein , by the term “ gene ” or “ trans methods of the invention , an avian cell comprising the gene ” is meant a nucleic acid , either naturally occurring or reporter gene integrated into specific loci within the gender synthetic , which encodes a protein product . The term chromosomes Z or W thereof must be prepared . Such cell “ nucleic acid ” is intended to mean natural and / or synthetic may be prepared by co - transfecting the cell with the first and linear, circular and sequential arrays of nucleotides and second nucleic acid sequences provided by the methods and nucleosides , e . g . , cDNA , genomic DNA (gDNA ) , mRNA , kits of the invention or with any construct comprising the and RNA , oligonucleotides , oligonucleosides, and deriva same. “ Transfection " as used herein is meant the process of tives thereof. inserting genetic material, such as DNA and double stranded [ 0123] The phrase " operatively - linked ” is intended to RNA , into mammalian cells . The insertion of DNA into a mean attached in a manner which allows for transgene cell enables the expression , or production , of proteins using transcription . The term " encoding ” is intended to mean that the cells own machinery . Thus , co - transfection as used the subject nucleic acid may be transcribed and translated herein refers to simultaneous transfection of at least two into either the desired polypeptide or the subject protein in different nucleic acid molecules or any vector comprising an appropriate expression system , e .g ., when the subject the same to each single cell . Still further, the nucleic acid nucleic acid is linked to appropriate control sequences such sequences to be transfected can be transiently expressed for as promoter and enhancer elements in a suitable vector ( e. g ., a short period of time, or become incorporated into the an expression vector ) and when the vector is introduced into genomic DNA , where the change is passed on from cell to an appropriate system or cell . cell as it divides . US 2019 /0029236 A1 Jan . 31, 2019

[0128 ] The invention therefore provides methods for an the reporter gene is under the control of an embryonic in -ovo gender determination of an avian embryo in -ovo promoter , thereby limiting the expression of the transgenic based on expression of a reporter gene , specifically , reporter gene to the embryonal stage , with no expression in luciferase . “ Expression ” generally refers to the process by the adult chick . In such embodiment, the reporter transgene which gene - encoded information is converted into the struc is used and expressed only at the embryonal stage , for tures present and operating in the cell . Therefore, according diagnostic purposes. to the invention “ expression ” of a reporter gene, specifically , [0134 ] More specifically , “ Promoter ” as used herein , may refer to transcription into a polynucleotide , translation refers to a particular region of the DNA that has the ability into a protein , or even posttranslational modification of the to control the expression of the gene which is placed protein . downstream . Thus, “ Promoter specific for gender in chicks ” [ 0129 ] In yet some further specific embodiments , the at refers hereinafter to a promoter that will activate the expres least one reporter gene in the second nucleic acid sequence sion of a gene , only in a specific chick gender ( i . e . male or may be flanked at 5 ' and 3 ' thereof by homologous arms. It female ). Still further , “ Promoter specific for development in should be appreciated that in some embodiments , these arms chicks ” refers to a promoter that will activate the expression are required and therefore facilitate HDR of the reporter gene at the integration site . of a gene, only at specific stages of the chick development. [0130 ] In more specific embodiments , the reporter gene in [0135 ] In some specific embodiments , the at least one the second nucleic acid sequence used by the method of the reporter gene may be inserted and thereby integrated into at invention , may be flanked with two arms that are homolo least one non - coding region of the target gender chromo gous or show homology or identity of about 70 % , 71 % , some. Such approach avoids the disruption of genes that 72 % , 73 % , 74 % , 75 % , 76 % , 77 % , 78 % , 79 % , 80 % , 81 % , may be required for development and maturation of the 82 % , 83 % , 84 % , 85 % , 86 % , 87 % , 88 % , 89 % , 90 % , 91 % , unhatched embryo . 92 % , 93 % , 94 % , 95 % , 96 % , 97 % , 98 % , 99 % or 100 % to at [0136 ] “ Non -coding region ” as used herein , refers to com least one nucleic acid sequence comprised within the target ponents of an organism ' s DNA that do not encode protein loci within the gender chromosomes Z or W , that serves as sequences . Some noncoding DNA region is transcribed into the integration site to facilitate specific integration via HDR . functional non - coding RNA molecules , other functions of In certain embodiments, the target sequence is also referred noncoding DNA regions include the transcriptional and to herein as at least one “ proto - spacer " that is recognized by translational regulation of protein - coding sequences , scaf the “ spacer ” sequences that are part of the gRNA used by the fold attachment regions , origins of DNA replication , cen invention , and provided by the first nucleic acid sequence . tromeres and telomeres. The hypothesized non - functional [0131 ] The term “ Homologous arms” , as used herein portion ( or DNA of unknown function ) has often been refers to HDR templates introduced into specific vectors or referred to as “ junk DNA ” . viruses , used to create specific mutations or insertion of new 10137 ] In some specific embodiments , the at least one elements into a gene , that possess a certain amount of reporter gene may be integrated into at least one site at homology surrounding the target sequence to be modified gender W chromosome. In more specific embodiments , the ( depending on which PEN is used ). In yet some further specific locus in the W chromosome may be location specific embodiments , where CRISPR is used as a PEN , the?? 1022859 - 1024215 . In some specific embodiments , the target arms sequences ( left , upstream and right, downstream ) may locus may comprise the nucleic acid sequence as denoted by comprise between about 10 to 5000 bp , specifically , between SEQ ID NO . 3 . about 50 to 1000 bp , between 100 to 500 , specifically , 50 , [0138 ] In more specific embodiments , the at least one 100, 200 , 300 , 400 , 500 , 600 , 700 , 800 , 900 , 1000bp . GRNA required to target the reporter gene to such specific [0132 ] In yet some further embodiments , the targeting sequence within the gRNA encoded by the first nucleic acid location within the W chromosome may comprises the sequence provided by the methods and kits of the invention , nucleic acid sequence as denoted by any one of SEQ ID NO . also referred to herein as the “ spacer” sequence, exhibits 1 and 2 , these gRNAs are designated herein as gRNA1 and homology or identity of about 70 % , 71 % , 72 % , 73 % , 74 % , ORNA2, respectively. 75 % , 76 % , 77 % , 78 % , 79 % , 80 % , 81 % , 82 % , 83 % , 84 % , 10139 ]. In yet some more specific embodiments, the ORNA 85 % , 86 % , 87 % , 88 % , 89 % , 90 % , 91 % , 92 % , 93 % , 94 % , used by themethod of the invention to prepare the transgenic 95 % , 96 % , 97 % , 98 % , 99 % or 100 % to at least one nucleic avian female may comprise the nucleic acid sequence as acid sequence comprised within the target loci within the denoted by SEQ ID NO . 1 (gRNA1 ) . In such case , the at gender chromosomes Z or W , referred to herein as the least one reporter gene comprised within said second nucleic " proto -spacer ” . acid sequence may be flanked at 5 ' and 3 ' thereof by [0133 ] In some embodiments , the at least one reporter homologous arms comprising the amino acid sequence as gene in the second nucleic acid sequence may be operably denoted by SEO ID NO . 4 and 5 , that facilitate the integra linked to any one of a gender specific promoter, an embryo tion thereof to said specific loci in W chromosome, respec nal specific promoter (for example a -Globin Promoter as tively . It should be appreciated that these arms are also referred in Mason et al. 1996 ) and an inducible promoter ( for referred to herein as left and right arms, respectively . example light- inducible promoters derived from the soybean [0140 ] In yet some alternative embodiments , the gRNA SSU gene claimed into U . S . Pat. No . 5 ,750 , 385 , or derived used for preparing the transgenic avian female of the inven from parsley chalcone synthase CHS promoter as referred in tion may comprise the nucleic acid sequence as denoted by Weisshaar et al . 1991, or an engineered version of EL222, a SEQ ID NO . 2 ( GRNA2) . In such case the at least one bacterial Light -Oxygen - Voltage protein that activates reporter gene comprised within the second nucleic acid expression when illuminated with blue light cited from sequence is flanked at 5 ' and 3 ' thereof by homologous arms Metta -Mena et al . 2014 ). In yet more specific embodiments , comprising the amino acid sequence as denoted by SEQ ID US 2019 /0029236 A1 Jan . 31, 2019

NO . 6 and 7 , respectively . It should be appreciated that these also denoted by SEQ ID NO : 29 , and gRNA11 of Z arms are also referred to herein as left and right arms, chromosome locus chrZ _63364946 _ - 1 , comprising the respectively . nucleic acid sequence CAGTGGGTACTGAAGCTGTG as 10141 ] In yet some further alternative embodiments , the at also denoted by SEQ ID NO : 30 . least one reporter gene used by the method of the invention [0144 ] In yet some further embodiments , for integrating for preparing the transgenic avian animal, may be integrated the reporter gene of the invention into the specific locus into at least one site at gender Z chromosome. In more within the Z chromosome, left arm comprising the nucleic specific embodiments, the specific loci in the Z chromosome acid sequence as denoted by SEQ ID NO . 31, and right arm may be any one of regions 9156874 - 9161874 , as denoted by comprising the nucleic acid sequence as denoted by SEQ ID SEO ID NO : 15 , 27764943 - 27769943 , as denoted by SEQ NO . 32 , may be used to integrate the reporter gene of the ID NO : 16 , 42172748 -42177748 , as denoted by SEQ ID invention to the specific loci directed by gRNA7 of SEQ ID NO : 17 , 63363656 -63368656 , as denoted by SEQ ID NO : 18 NO : 26 . In further embodiments, for integrating the reporter and 78777477 - 78782477 , as denoted by SEQ ID NO : 19 of gene of the invention into the specific locus within the Z Chromosome Z of female chicken . chromosome, left arm comprising the nucleic acid sequence [0142 ] In more specific embodiments , the at least one as denoted by SEQ ID NO . 33 , and right arm comprising the ORNA required to target the reporter gene to such specific nucleic acid sequence as denoted by SEQ ID NO . 34 , may location within the Z chromosome may comprises the be used to integrate the reporter gene of the invention to the nucleic acid sequence as denoted by any one of gRNA3 : specific loci directed by gRNA8 of SEQ ID NO :27 . In still ACAGACCTATGATATGT, as denoted by SEQ ID NO . 11 ; further embodiments , for integrating the reporter gene of the ORNA4 : CGATTATCACTCACAAG , as denoted by SEQ invention into the specific locus within the Z chromosome, ID NO . 12 ; ORNA5 : CTGGTTAGCATGGGGAC , as left arm comprising the nucleic acid sequence as denoted by denoted by SEQ ID NO . 13 ; ORNA6 : GTAAAGAGTCA SEQ ID NO . 35 , and right arm comprising the nucleic acid GATACA , as denoted by SEQ ID NO . 14 . sequence as denoted by SEQ ID NO . 36 , may be used to [0143 ] In yet some further embodiments , for integrating integrate the reporter gene of the invention to the specific the reporter gene of the invention into the specific locus loci directed by CRNAS of SEQ ID NO : 28 . In further within the Z chromosome, left arm comprising the nucleic embodiments , for integrating the reporter gene of the inven acid sequence as denoted by SEQ ID NO . 41 and right arm tion into the specific locus within the Z chromosome, left comprising the nucleic acid sequence as denoted by SEQ ID arm comprising the nucleic acid sequence as denoted by NO . 42 may be used to integrate the reporter gene of the SEQ ID NO . 37 , and right arm comprising the nucleic acid invention to the specific loci directed by gRNA3 of SEQ ID sequence as denoted by SEQ ID NO . 38 , may be used to NO : 11 . In further embodiments , for integrating the reporter integrate the reporter gene of the invention to the specific gene of the invention into the specific locus within the Z loci directed by gRNA10 of SEQ ID NO : 29 . In yet a further chromosome, left arm comprising the nucleic acid sequence embodiment, for integrating the reporter gene of the inven as denoted by SEQ ID NO . 43, and right arm comprising the tion into the specific locus within the Z chromosome, left nucleic acid sequence as denoted by SEQ ID NO . 44 , may arm comprising the nucleic acid sequence as denoted by be used to integrate the reporter gene of the invention to the SEQ ID NO . 39, and right arm comprising the nucleic acid specific loci directed by gRNA4 of SEQ ID NO : 12 . In still sequence as denoted by SEQ ID NO . 40 , may be used to further embodiments , for integrating the reporter gene of the integrate the reporter gene of the invention to the specific invention into the specific locus within the Z chromosome , loci directed by gRNA11 of SEQ ID NO : 30 . left arm comprising the nucleic acid sequence as denoted by [0145 ] When genetic loci of zygote cells of an avian host, SEQ ID NO . 45 , and right arm comprising the nucleic acid have been targeted and /or transfected with exogenous sequence as denoted by SEQ ID NO . 46 , may be used to sequences , specifically , the reporter gene used by the inven integrate the reporter gene of the invention to the specific tion , it may be desirable to use such cells to generate loci directed by ORNA5 of SEQ ID NO : 13 . In some further transgenic animals. For such a procedure , following the embodiments , for integrating the reporter gene of the inven introduction of the targeting construct into the embryonic tion into the specific locus within the Z chromosome , left stem ( ES ) cells , the cells may be plated onto a feeder layer arm comprising the nucleic acid sequence as denoted by in an appropriate medium , for example , DMEM supple SEQ ID NO . 47 , and right arm comprising the nucleic acid mented with growth factors and cytokines, fetal bovine sequence as denoted by SEQ ID NO . 48, may be used to serum and antibiotics . The embryonic stem cells may have integrate the reporter gene of the invention to the specific a single targeted locus (heterozygotic ) or both loci targeted loci directed by gRNA6 of SEQ ID NO : 14 . Further non (homozygotic ) . Cells containing the construct may be limiting examples for gRNA sequences suitable for integra detected by employing a selective medium and after suffi tion into specific loci within the Z chromosome, may include cient time for colonies to grow , colonies may be picked and but are not limited to gRNAZ of Z chromosome locus analyzed for the occurrence of gene targeting . In some chrZ _ 42174515 _ - 1, comprising the nucleic acid sequence specific embodiments , PCR may be applied to verify the GTAATACAGAGCTAAACCAG , as also denoted by SEQ integration of the desired exogenous sequences into the ID NO : 26 , ORNA8 of Z chromosome locus chrZ _ 9157091 _ target loci, using primers within and outside the construct 1 , comprising the nucleic acid sequence ACAGACCTAT sequence . Colonies which show gene targeting may then be GATATGTGAG , as also denoted by SEO ID NO :27 , used for injection into avian embryos. The ES cells can then ORNA9 of Z chromosome locus chrZ _ 27767602 _ - 1 , com be trypsinized and the modified cells can be injected through prising the nucleic acid sequence GAGCTTGTGAGTGA - an opening made in the side of the egg. After sealing the TAATCG , as also denoted by SEQ ID NO : 28 , ORNA10 of eggs , the eggs can be incubated under appropriate conditions Z chromosome locus chrZ _ 78779927 _ 1 , comprising the until hatching . Newly hatched avian can be tested for the nucleic acid sequence GTAAAGAGTCAGATACACAG , as presence of the target construct sequences, for example by US 2019 /0029236 A1 Jan . 31, 2019

examining a biological sample thereof, e . g . , a blood sample . (0152 ] Thus, in a second aspect , the invention relates to an After the avian have reached maturity , they are bred and avian transgenic animal comprising , in at least one cell their progeny may be examined to determine whether the thereof , at least one exogenous reporter gene integrated into exogenous integrated sequences are transmitted through the at least one position or location (also referred to herein as germ line . locus ) in at least one of gender chromosome Z and W . [0146 ] Chimeric avian are generated which are derived in [0153 ] The term " avian ” relates to any species derived part from the modified embryonic stem cells or zygote cells , from birds characterized by feathers, toothless beaked jaws, capable of transmitting the genetic modifications through the the laying of hard - shelled eggs, a high metabolic rate, a germ line . Mating avian strains containing exogenous four -chambered heart, and a lightweight but strong skeleton . sequences , specifically, the reporter gene used by the inven Avian species includes, without limitation , chicken , quail , tion , or portions thereof, with strains in which the avian wild turkey , duck , Gallinacea sp , goose , pheasant and other fowl. type loci, or portions thereof , is restored , should result in The term “ hen ” includes all females of the avian species. A progenies displaying an in -ovo detectable gender . “ transgenic avian ” generally refers to an avian that has had [0147 ] Still further , transgenic avian can also be produced a heterologous DNA sequence , or one or more additional by other methods , some of which are discussed below . DNA sequences normally endogenous to the avian ( collec Among the avian cells suitable for transformation for gen tively referred to herein as “ transgenes " ) chromosomally erating transgenic animals are primordial germ cells (PGC ) , integrated into the germ cells of the avian . As a result of such sperm cells and zygote cells ( including embryonic stem transfer and integration , the transferred sequence may be cells ) . Sperm cells can be transformed with DNA constructs transmitted through germ cells to the offspring of a trans by any suitable method , including electroporation , genic avian . The transgenic avian ( including its progeny ) microparticle bombardment, lipofection and the like . The also have the transgene integrated into the gender chromo somes of somatic cells . sperm can be used for artificial insemination of avian . 10154 ] In some specific embodiments , the at least one Progeny of the inseminated avian can be examined for the transgenic animal of the invention may comprise at least two exogenous sequence as described above . different reporter genes . In such case, each reporter gene [0148 ] Alternatively, primordial germ cells may be iso may be integrated into at least one position or location in one lated from avian eggs, transfected with the exogenous of gender chromosome Z or W . reporter gene of the invention by any appropriate method , [0155 ] In yet some further embodiments , the reporter gene and transferred or inserted into new embryos , where they comprised within the transgenic animal of the invention , can become incorporated into the developing gonads . may be at least one bioluminescence reporter gene. Hatched avian and their progeny can be examined for the (01561 In more specific embodiments , such biolumines exogenous reporter gene sequence as described by the cence reporter gene may comprise or may be luciferase . invention . [0157 ] In certain embodiments , the at least one transgenic [ 0149 ] In yet another approach , dispersed blastodermal avian animal provided by the invention , may be female . In cells isolated from eggs can be transfected by any appro more specific embodiments, the at least one reporter gene in priate means with the exogenous reporter gene sequence , or such transgenic avian female may be integrated into at least portions thereof, integrated to the gender specific chromo one position of the female chromosome Z . somes Z or W , followed by injection into the subgerminal [0158 ] In yet some alternative embodiments , the at least cavity of intact eggs. Hatched avian subjects and their one transgenic avian animal may be female, having at least progeny may be examined for the exogenous reporter gene one reporter gene integrated into at least one position of the as described above . female chromosome W . [0150 ] Chicken primordial germ cells ( PGCs) are the [0159 ] In some specific embodiments , the at least one precursors for ova and spermatozoa . Thus , in some aspects reporter gene may be integrated into the gender chromosome thereof, the invention provides the production of transgenic of the transgenic animal of the invention using at least one chickens via a germline transmission system using PGCs PEN . co - transfected with the reporter gene construct and with the [0160 ] More specifically , such PEN may be in certain CRISPR /Cas9 gRNA construct that directs the integration of embodiments , a CRISPR type II system . the reporter gene into the gender specific chromosomes W [0161 ] In yet more specific embodiments , the at least one and Z . PGCs are sorted and transferred into the bloodstream reporter gene may be integrated into the gender chromosome of 2 . 5 - day recipient embryos for germline transmissionu . of the transgenic avian animal of the invention by HDR [0151 ] Thus , in some specific embodiments , the “ Prepa mediated by at least one CRISPR / Cas9 system . ration of transgenic avian animal” refers to a multi -step [0162 ] In more specific embodiments , the at least one method involving genetic engineering techniques for pro reporter gene may be integrated into a gender chromosome duction of chicken with genomic modifications wherein a ) of the transgenic avian animal of the invention by co Primordial Germ Cells (PGCs ) are isolated from the blood transfecting at least one cell of this avian animal, or at least of two days - old chick embryos ; b ) a transgene construct is one cell that is to be introduced into said avian animal with incorporated into cultured PGCs by using lentiviral system , at least two nucleic acid sequences . More specifically , such Piggybac transposon vectors, TALENS or CRISPR / Cas9 cell may be co - transfected with ( a ) at least one first nucleic techniques ; ( c ) transgenic PGCs are identified and injected acid sequence comprising at least one nucleic acid sequence into the circulatory system of embryos and migrate to the encoding at least one Cas9 protein and at least one nucleic developing gonads; d ) recipient embryos are incubated at acid sequence encoding at least one gRNA , thereby provid 37° C . until hatching ( d ) hatched males are reared to sexual ing a CRISPR mediated integration ; and ( b ) at least one maturity and crossed with wild - type hens ( e ) offspring are second nucleic acid sequence comprising at least one screened to identify those derived from the transgenic PGCs. reporter gene . US 2019 /0029236 A1 Jan . 31, 2019 13

[ 0163 ] In more specific embodiments , the at least one embodiments , such avian transgenic animal may be female reporter gene in the second nucleic acid sequence may be that carry the transgenic reporter gene integrated into the Z flanked at 5 ' and 3 ' thereof by homologous arms. These arms chromosome. In more specific embodiments , the specific exhibit homology to the integration target site within the loci in the Z chromosome may be any one of regions target gender chromosome, thereby facilitating HDR at the 9156874 - 9161874 , as denoted by SEQ ID NO : 15 , integration site . 27764943 - 27769943 , as denoted by SEQ ID NO : 16 , [ 0164 ] In yet more specific embodiments , the at least one 42172748 -42177748 , as denoted by SEQ ID NO : 17 , reporter gene in the second nucleic acid sequence may be operably linked to any one of a gender specific promoter, an 63363656 -63368656 , as denoted by SEQ ID NO : 18 and embryonal specific promoter and an inducible promoter. 78777477 -78782477 , as denoted by SEQ ID NO : 19 of Such promoter should limit the expression of the reporter Chromosome Z of female chicken . gene of the invention to the specific desired gender ( in case [0171 ] In more specific embodiments , the at least one of gender specific promoter ) , the specific embryonic stage gRNA required to target the reporter gene to such specific (embryonic specific promoter ) or specific conditions ( induc location within the Z chromosome may comprises the ible conditions ) . nucleic acid sequence as denoted by any one of gRNA3: [0165 ] In yet some further specific embodiments , the at ACAGACCTATGATATGT, as denoted by SEQ ID NO . 11 ; least one reporter gene comprised within the transgenic ORNA4: CGATTATCACTCACAAG , as denoted by SEQ avian animal of the invention may be integrated into at least ID NO . 12 ; ORNA5: CTGGTTAGCATGGGGAC , as one non - coding region of one of its gender chromosomes. denoted by SEQ ID NO . 13 ; ORNA6 : GTAAAGAGTCA [0166 ] In certain embodiments , the at least one reporter GATACA , as denoted by SEQ ID NO . 14 . gene may be integrated into at least one site at gender W chromosome. In some particular embodiments , the integra [0172 ] In yet some further embodiments , for integrating tion site may be located at locus 1022859 - 1024215 at the W the reporter gene of the invention into the specific locus chromosome, specifically, galGal5 _ dna range of chromo within the Z chromosome, left arm comprising the nucleic some W : 1022859 - 1024215 . In yet some further specific acid sequence as denoted by SEQ ID NO . 41, and right arm embodiments , such loci comprises the nucleic acid sequence comprising the nucleic acid sequence as denoted by SEQ ID as denoted by SEQ ID NO . 3 . NO . 42 , may be used to integrate the reporter gene of the [ 0167 ] For specific integration of the reporter gene of the invention to the specific loci directed by gRNA3 of SEQ ID invention at any position within the loci described above , NO : 11 . In further embodiments , for integrating the reporter specific gRNAs may be required . Therefore , in some par gene of the invention into the specific locus within the Z ticular and non - limiting embodiments, appropriate gRNAs chromosome, left arm comprising the nucleic acid sequence used for the preparation of the transgenic avian animal of the as denoted by SEQ ID NO . 43 , and right arm comprising the invention may comprise the nucleic acid sequence as nucleic acid sequence as denoted by SEQ ID NO . 44 , may denoted by any one of SEQ ID NO . 1 and 2 . In some specific be used to integrate the reporter gene of the invention to the embodiments , these gRNAs are referred to herein as ORNA1 specific loci directed by gRNA4 of SEQ ID NO :12 . In still and gRNA2 , respectively . further embodiments , for integrating the reporter gene of the [0168 ] In some particular embodiments , the transgenic invention into the specific locus within the Z chromosome, avian animal provided by the invention has been prepared left arm comprising the nucleic acid sequence as denoted by using a gRNA1 that comprises the nucleic acid sequence as SEQ ID NO . 45 , and right arm comprising the nucleic acid denoted by SEQ ID NO . 1. To enable integration of the sequence as denoted by SEQ ID NO . 46 , may be used to reporter gene of the invention in such specific location , the integrate the reporter gene of the invention to the specific reporter gene that should be integrated , must carry in certain loci directed by ORNA5 of SEQ ID NO : 13 . In some further embodiments , particular arms facilitating incorporation embodiments , for integrating the reporter gene of the inven thereof in the target integration site directed by the gRNA tion into the specific locus within the Z chromosome, left used . Thus , in some specific embodiments , the at least one arm comprising the nucleic acid sequence as denoted by reporter gene may be comprised within the second nucleic SEQ ID NO . 47 , and right arm comprising the nucleic acid acid sequence , where this reporter gene is flanked at 5 ' and sequence as denoted by SEQ ID NO . 48 , may be used to 3 ' thereof by homologous arms comprising the amino acid integrate the reporter gene of the invention to the specific sequence as denoted by SEQ ID NO . 4 and 5 , respectively . loci directed by ORNA6 of SEQ ID NO : 14 . 10169] In yet some alternative embodiments, the trans [0173 ] Further non - limiting examples for gRNA genic avian animal provided by the invention may be sequences suitable for integration into specific loci within prepared using a gRNA2 that comprises the nucleic acid the Z chromosome, may include but are not limited to sequence as denoted by SEQ ID NO . 2 . In such case , to ORNA7 of Z chromosome locus chrZ _ 42174515 _ - 1 , com enable integration of the reporter gene of the invention at the prising the nucleic acid sequence GTAATACA specific site recognized by said gRNA2 , the at least one GAGCTAAACCAG , as also denoted by SEQ ID NO : 26 , reporter gene comprised within the second nucleic acid ORNA8 of Z chromosome locus chrZ _ 9157091 _ 1 , compris sequence may be according to specific embodiments , ing the nucleic acid sequence ACAGACCTATGATATGT flanked at 5 ' and 3 ' thereof by homologous arms comprising GAG , as also denoted by SEQ ID NO :27 , gRNA9 of Z the amino acid sequence as denoted by SEQ ID NO . 6 and chromosome locus chrZ 27767602 - 1 , comprising the 7 , respectively . nucleic acid sequence GAGCTTGTGAGTGATAATCG , as 10170 ] In yet some further alternative embodiments , the also denoted by SEQ ID NO : 28 , gRNA10 of Z chromosome transgenic avian animal of the invention may comprise at locus chrZ _ 78779927 _ 1 , comprising the nucleic acid least one reporter gene integrated into at least one site at sequence GTAAAGAGTCAGATACACAG , as also denoted gender Z chromosome. In some particular and non - limiting by SEQ ID NO : 29 , and gRNA11 of Z chromosome locus US 2019 /0029236 A1 Jan . 31, 2019 14 chrZ _ 63364946 _ - 1 , comprising the nucleic acid sequence specific embodiments , such bioluminescence reporter gene CAGTGGGTACTGAAGCTGTG as also denoted by SEQ may comprise or may be luciferase. ID NO : 30 . [0181 ] In certain embodiments , the at least one transgenic [0174 ] In yet some further embodiments , for integrating cell provided by the invention , may comprise the at least one the reporter gene of the invention into the specific locus reporter gene integrated into at least one position of at least within the Z chromosome , left arm comprising the nucleic one chromosome Z thereof. It should be noted that in some acid sequence as denoted by SEQ ID NO . 31 , and right arm embodiments such cell may be either a female avian cell or comprising the nucleic acid sequence as denoted by SEQ ID a male avian cell. NO . 32 , may be used to integrate the reporter gene of the 0182 ] In yet some alternative embodiments , the at least invention to the specific loci directed by CRNA7 of SEQ ID one transgenic cell of the invention , may carry at least one NO : 26 . In further embodiments , for integrating the reporter reporter gene integrated into at least one position of chro gene of the invention into the specific locus within the Z mosome W . It should be noted that in some embodiments chromosome, left arm comprising the nucleic acid sequence such cell may be a female avian cell. as denoted by SEQ ID NO . 33, and right arm comprising the 0183 ] In some specific embodiments , the at least one nucleic acid sequence as denoted by SEQ ID NO . 34 , may reporter gene may be integrated into the gender chromosome be used to integrate the reporter gene of the invention to the of the transgenic cell of the invention using at least one PEN . specific loci directed by gRNAS of SEQ ID NO :27 . In still [0184 ] More specifically , such PEN may be in certain further embodiments , for integrating the reporter gene of the embodiments, a CRISPR type II system . invention into the specific locus within the Z chromosome, [0185 ] In yet more specific embodiments , the at least one left arm comprising the nucleic acid sequence as denoted by reporter gene may be integrated into the gender chromosome SEQ ID NO . 35 , and right arm comprising the nucleic acid of the transgenic cell of the invention by HDR mediated by sequence as denoted by SEQ ID NO . 36 , may be used to at least one CRISPR /Cas9 system . integrate the reporter gene of the invention to the specific [0186 ] In yet some further embodiments , the cell provided loci directed by gRNA9 of SEQ ID NO : 28 . In further by the invention may comprise at least one reporter gene embodiments , for integrating the reporter gene of the inven integrated into a gender chromosome of the cell . In more tion into the specific locus within the Z chromosome, left specific embodiments , such specific integration of the arm comprising the nucleic acid sequence as denoted by reporter gene may be enabled by co - transfecting the cell SEQ ID NO . 37 , and right arm comprising the nucleic acid with : ( a ) at least one first nucleic acid sequence comprising sequence as denoted by SEQ ID NO . 38 , may be used to at least one nucleic acid sequence encoding at least one Cas9 integrate the reporter gene of the invention to the specific protein and at least one nucleic acid sequence encoding at loci directed by ORNA10 of SEQ ID NO :29 . In yet a further least one guide RNA ( GRNA ) ; and ( b ) at least one second embodiment, for integrating the reporter gene of the inven nucleic acid sequence comprising at least one said reporter tion into the specific locus within the Z chromosome, left gene . arm comprising the nucleic acid sequence as denoted by [0187 ] In certain embodiments , the at least one reporter SEQ ID NO . 39 , and right arm comprising the nucleic acid gene in the second nucleic acid sequence co - transfected to sequence as denoted by SEQ ID NO . 40 , may be used to the cell of the invention , may be flanked at 5 ' and 3 ' thereof integrate the reporter gene of the invention to the specific by homologous arms for HDR at the integration site . loci directed by gRNA11 of SEQ ID NO : 30 . 10188 ] In yet more specific embodiments , the at least one [ 0175 ] In yet another aspect, the invention relates to a cell reporter gene in the second nucleic acid sequence may be comprising at least one exogenous reporter gene integrated operably linked to any one of a gender specific promoter , an into at least one position or location in at least one of gender embryonal specific promoter and an inducible promoter . chromosome Z and W . Such promoter should limit the expression of the reporter [0176 ] In some specific embodiments , the cell provided by gene of the invention to the specific desired gender ( in case the invention may be an avian cell. of gender specific promoter ) , the specific embryonic stage [0177 ] In some particular embodiments , the avian cell ( embryonic specific promoter ) or specific conditions ( induc provided by the invention may be a primordial germ cell ible conditions) . ( PGC ) . [0189 ] In yet some further specific embodiments , the at 10178 ] The term " germ cells ” refers to an embryonic cell least one reporter gene comprised within the transgenic cell that upon uniting with another germ cells develops into a of the invention may be integrated into at least one non gamete . “ Primordial germ cells ( PGCs) ” , as used herein coding region of one of its gender chromosomes . relates to germline stem cells that serve as progenitors of the [0190 ] In certain embodiments , the at least one reporter gametes and give rise to pluripotent embryonic stem cells . gene may be integrated into at least one site at gender W The cells in the gastrulating embryo that are signaled to chromosome. In some particular embodiments , the integra become PGCs during embryogenesis , migrate into the geni tion site may be located at locus 1022859 - 1024215 at the W tal ridges which becomes the gonads, and differentiate into chromosome, specifically , galGal5 _ dna range of chromo mature gametes . some W : 1022859 - 1024215 . In yet some further specific [ 0179 ] In some specific embodiments , the at least one cell embodiments , such loci comprises the nucleic acid sequence of the invention may comprise at least two different reporter as denoted by SEQ ID NO . 3 . genes . In such case , each reporter gene may be integrated [0191 ] For specific integration of the reporter gene of the into at least one position or location in one of gender invention at any position within the loci described above , chromosome Z or W . specific gRNAs may be required . Therefore , in some par [0180 ] In yet some further embodiments , the reporter gene ticular and non - limiting embodiments , appropriate gRNAS comprised within the transgenic animal of the invention , used for the preparation of the transgenic avian animal of the may be at least one bioluminescence reporter gene . In more invention may comprise the nucleic acid sequence as US 2019 /0029236 A1 Jan . 31, 2019 15 denoted by any one of SEQ ID NO . 1 and 2 . In some specific sequence as denoted by SEQ ID NO . 46 , may be used to embodiments , these gRNAs are referred to herein as gRNA1 integrate the reporter gene of the invention to the specific and gRNA2, respectively . loci directed by gRNA5 of SEQ ID NO : 13 . In some further [ 01921. In some particular embodiments, to target the inte embodiments , for integrating the reporter gene of the inven gration of the reporter gene to chromosome W in the cell tion into the specific locus within the Z chromosome, left provided by the invention , specific gRNAs should be used . arm comprising the nucleic acid sequence as denoted by In further particular embodiments , the gRNA may comprise SEQ ID NO . 47, and right arm comprising the nucleic acid the nucleic acid sequence as denoted by SEQ ID NO . 1 sequence as denoted by SEQ ID NO . 48 , may be used to referred to herein as ORNA1. In such case , the at least one integrate the reporter gene of the invention to the specific reporter gene comprised within the second nucleic acid loci directed by ORNA6 of SEQ ID NO : 14 . Further non sequence , may be flanked at 5 ' and 3 ' thereofby homologous limiting examples for ORNA sequences suitable for integra arms comprising the amino acid sequence as denoted by SEQ ID NO . 4 and 5 , respectively . tion into specific loci within the Z chromosome, may include [0193 ] In yet some further alternative embodiments, the but are not limited to gRNA7 of Z chromosome locus cell provided by the invention may be prepared by using chrZ _42174515 _ - 1 , comprising the nucleic acid sequence ORNA referred to herein as ORNA2. In certain embodiments , GTAATACAGAGCTAAACCAG , as also denoted by SEQ ORNA2 may comprise the nucleic acid sequence as denoted ID NO : 26 , ORNA8 of Z chromosome locus chrZ _ 9157091 _ by SEQ ID NO . 2 . In such specific embodiments , the at least 1 , comprising the nucleic acid sequence ACAGACCTAT one reporter gene comprised within the second nucleic acid GATATGTGAG , as also denoted by SEQ ID NO : 27 , sequence may be flanked at 5 ' and 3 ' thereof by homologous ORNA9 of Z chromosome locus chrZ _ 27767602 _ - 1 , com arms comprising the amino acid sequence as denoted by prising the nucleic acid sequence GAGCTTGTGAGTGA SEQ ID NO . 6 and 7 , respectively . TAATCG , as also denoted by SEQ ID NO : 28 , gRNA10 of [ 0194 ] In yet some further alternative embodiments , the Z chromosome locus chrZ _ 78779927 _ 1 , comprising the cell provided by the invention may be prepared by integrat nucleic acid sequence GTAAAGAGTCAGATACACAG , as ing the at least one reporter gene of the invention into the Z also denoted by SEQ ID NO : 29, and gRNA11 of Z chromosome of the cell . In certain embodiments , for pre chromosome locus chrZ _ 63364946 _ - 1 , comprising the paring the cell of the invention , the at least one reporter gene nucleic acid sequence CAGTGGGTACTGAAGCTGTG as may be integrated into at least one site at gender Z chro also denoted by SEQ ID NO : 30 . mosome. In more specific embodiments , the specific loci in [0197 ] In yet some further embodiments , for integrating the Z chromosome may be any one of regions 9156874 the reporter gene of the invention into the specific locus 9161874 , as denoted by SEQ ID NO : 15 , 27764943 within the Z chromosome, of the cell of the invention , left 27769943 . as denoted by SEO ID NO : 16 , 42172748 arm comprising the nucleic acid sequence as denoted by 42177748 , as denoted by SEQ ID NO : 17 , 63363656 SEQ ID NO . 31 , and right arm comprising the nucleic acid 63368656 , as denoted by SEQ ID NO : 18 and 78777477 sequence as denoted by SEQ ID NO . 32 , may be used to 78782477 , as denoted by SEQ ID NO : 19 of Chromosome Z integrate the reporter gene of the invention to the specific of female chicken . loci directed by RNA7 of SEQ ID NO : 26 . In further [0195 ] In more specific embodiments , the at least one embodiments , for integrating the reporter gene of the inven ORNA required to target the reporter gene to such specific tion into the specific locus within the Z chromosome, left location within the Z chromosome of the cell of the inven arm comprising the nucleic acid sequence as denoted by tion may comprises the nucleic acid sequence as denoted by SEQ ID NO . 33 , and right arm comprising the nucleic acid any one of ORNA3: ACAGACCTATGATATGT, as denoted sequence as denoted by SEQ ID NO . 34 , may be used to by SEQ ID NO . 11 ; gRNA4 : CGATTATCACTCACAAG , as integrate the reporter gene of the invention to the specific denoted by SEQ ID NO . 12 ; ORNA5 : CTGGTTAG loci directed by gRNAS of SEQ ID NO :27 . In still further CATGGGGAC , as denoted by SEQ ID NO . 13 ; ORNA6 : embodiments , for integrating the reporter gene of the inven GTAAAGAGTCAGATACA , as denoted by SEQ ID NO . tion into the specific locus within the Z chromosome, left 14 . arm comprising the nucleic acid sequence as denoted by [0196 ] In yet some further embodiments , for integrating SEQ ID NO . 35 , and right arm comprising the nucleic acid the reporter gene of the invention into the specific locus sequence as denoted by SEQ ID NO . 36 , may be used to within the Z chromosome, left arm comprising the nucleic integrate the reporter gene of the invention to the specific acid sequence as denoted by SEQ ID NO . 41, and right arm loci directed by gRNA9 of SEQ ID NO :28 . In further comprising the nucleic acid sequence as denoted by SEQ ID embodiments , for integrating the reporter gene of the inven NO . 42 , may be used to integrate the reporter gene of the tion into the specific locus within the Z chromosome, left invention to the specific loci directed by gRNA3 of SEQ ID arm comprising the nucleic acid sequence as denoted by NO : 11. In further embodiments , for integrating the reporter SEQ ID NO . 37 , and right arm comprising the nucleic acid gene of the invention into the specific locus within the Z sequence as denoted by SEQ ID NO . 38 , may be used to chromosome, left arm comprising the nucleic acid sequence integrate the reporter gene of the invention to the specific as denoted by SEQ ID NO . 43, and right arm comprising the loci directed by ORNA10 of SEQ ID NO : 29 . In yet a further nucleic acid sequence as denoted by SEQ ID NO . 44 , may embodiment, for integrating the reporter gene of the inven be used to integrate the reporter gene of the invention to the tion into the specific locus within the Z chromosome, left specific loci directed by gRNA4 of SEQ ID NO : 12 . In still arm comprising the nucleic acid sequence as denoted by further embodiments , for integrating the reporter gene of the SEQ ID NO . 39 , and right arm comprising the nucleic acid invention into the specific locus within the Z chromosome, sequence as denoted by SEQ ID NO . 40 , may be used to left arm comprising the nucleic acid sequence as denoted by integrate the reporter gene of the invention to the specific SEQ ID NO . 45 , and right arm comprising the nucleic acid loci directed by gRNA11 of SEQ ID NO :30 . US 2019 /0029236 A1 Jan . 31, 2019 16

[0198 ] In yet some further aspects thereof, the invention comprise the exogenous reporter gene of the invention encompasses any egg derived , laid or fertilized by at least integrated into the gender chromosomes thereof. one of any of the transgenic avian subjects or animals of the [0202 ] As indicated above , the egg / s of the invention may invention , or by any progeny thereof, any component or any be any egg / s laid or fertilized by the transgenic avian parts thereof or any product comprising said egg , compo subjects provided by the invention . In some embodiments , nents or parts thereof. It should be understood that in some the egg / s may be a fertilized egg . In yet some further embodiments , such transgenic avian subjects may comprise, embodiments , the fertilized egg may contain the reporter in at least one cell thereof, at least one exogenous reporter gene of the invention integrated into at least one gender gene integrated into at least one position or location ( also chromosomes thereof. referred to herein as locus ) in at least one of gender [0203 ] In some specific embodiments , the egg / s of the chromosome Z and W . invention may be laid or fertilized by at least one transgenic [0199 ] The term “ egg ” as used herein , encompasses fer animal of the invention that may comprise at least two tilized as well as non - fertilized eggs. More specifically, a different reporter genes . In such case , each reporter gene fertilized egg is the organic vessel containing the zygote may be integrated into at least one position or location in one ( that results from fertilization of an ovum ) , in which an of gender chromosome Z or W . avian embryo develops, at which point the animal hatches . [ 0204 ] In yet some further embodiments , the reporter gene A zygote is a eukaryotic cell formed by a fertilization event comprised within the transgenic animal that either laid or between two gametes , specifically , the ovum and the sperm . fertilized the egg of the invention , may be at least one A non - fertilized egg comprises the ovum , that is the egg cell bioluminescence reporter gene . In more specific embodi (plural ova ), that forms the female gamete ( reproductive ments , such bioluminescence reporter gene may comprise or cell) in oogamous organisms. may be luciferase . [0205 ] In certain embodiments, the at least one transgenic [ 0200 ] At lay, a typical egg weighs around 55 to 60 g and avian animal laid or fertilized the egg of the invention , may consists of three main components (also referred to herein as be female . In more specific embodiments , the at least one parts ) : eggshell (9 - 12 % ) , egg white (60 % ), and yolk (30 reporter gene in such transgenic avian female may be 33 % ) . Whole egg is composed of water (75 % ) , proteins integrated into at least one position of the female chromo ( 12 % ) , lipids ( 12 % ) , and carbohydrates and minerals ( 1 ) . some Z . In some embodiments, a fertilized egg laid by such Proteins present in egg are distributed among the egg white transgenic female avian subject may according to some and yolk , whereas lipids are mainly concentrated in the yolk . embodiments carry the reporter gene integrated to its Z Yolk is covered with the vitelline membrane and mainly chromosome and as such , may carry a male embryo . In some consists of water (50 % ) , protein ( 15 - 17 % ) , lipids (31 - 35 % ) , embodiments , such egg may be referred to herein as a and carbohydrates ( 1 % ). Protein present in egg yolk consists labeled egg or as a transgenic egg . In yet some alternative of lipovitellins ( 36 % ) , livetins ( 38 % ) , phosvitin ( 8 % ) , and embodiment, such fertilized egg may carry a paternal unla low - density lipoproteins (17 % ) . Also , yolk contains 1 % beled Z chromosome and a maternal unlabeled W chromo carotinoides , which makes it yellow in color. Egg white some, and therefore may carry an unlabeled female embryo . mainly consists of water (88 % ) and protein ( 11 % ) , with the In some embodiments , such egg may be referred to herein as remainder consisting of carbohydrates, ash , and trace an unlabeled egg or as a non - transgenic egg ( or WT or amounts of lipids ( 1 % ) . Ovalbumin (54 % ) , ovotransferrin normal egg ). ( 12 % ), ovomucoid ( 11 % ), lysozyme ( 3 . 5 % ) , and ovomucin [0206 ] In yet some alternative embodiments , the at least ( 3 . 5 % ) are considered as the main proteins and avidin one transgenic avian animal laid or fertilized the egg/ s of the ( 0 .05 % ) , cystatin ( 0 . 05 % ) , ovomacroglobulin ( 0 . 5 % ) , ovo invention may be female , having at least one reporter gene flavoprotein ( 0 . 8 % ), ovoglycoprotein ( 1 . 0 % ) , and ovoinhibi integrated into at least one position of the female chromo tor ( 1. 5 % ) are the minor proteins found in egg white . some W . In such case , a fertilized egg laid by such transgenic [0201 ] It should be understood that in some embodiments female avian subject may according to some embodiments any of the egg parts , components , or proteins , specifically, carry the reporter gene integrated to its W chromosome and any of the parts , elements or components disclosed herein as such , may carry a labeled female embryo . In some are part of the invention . It should be appreciated that the embodiments, such egg may be referred to herein as a egg / s of the invention may be laid by any of the transgenic labeled egg or as a transgenic egg . In yet some alternative avian provided herein or by any progenies thereof. Such embodiment , such fertilized egg may carry a paternal unla transgenic avian subject may be either a female or a male . beled z chromosome and a maternal unlabeled z chromo In more specific embodiments , where the transgenic avian some, and therefore may carry an unlabeled male embryo . In subject is a female , the egg / s of the invention may be laid in some embodiments , such egg may be referred to herein as an some embodiments by the transgenic female avian provided unlabeled egg or as a non - transgenic egg ( or WT or normal by the invention . In more specific embodiment, in case the egg ) . egg / s of the invention is a fertilized egg , the transgenic [0207 ] It should be understood that in case of transgenic female may be fertilized either by a transgenic male or by a fertilized eggs, specifically , eggs laid by or fertilized by a wild type avian male . Still further, fertilization may occur transgenic avian subject provided by the invention , that either by mating or by insemination of the transgenic avian carry the reporter gene of the invention integrated into a female with sperms obtained from a transgenic or wild type gender chromosome thereof, in some embodiments the avian male . In yet other embodiments , where the transgenic reporter gene is integrated in the transgenic egg at the same avian is a male , the egg / s provided by the invention may be locus as in the transgenic animal laid or fertilized such egg . laid by either a wild type or transgenic female mated with [0208 ] In some specific embodiments , the at least one the transgenic male provided by the invention , or insemi reporter gene may be integrated into the gender chromosome nated by any cells thereof, specifically sperm cells that of the transgenic animal laid or fertilized the egg of the US 2019 /0029236 A1 Jan . 31, 2019 17 invention using at least one PEN . More specifically , such must carry in certain embodiments , particular arms facili PEN may be in certain embodiments , a CRISPR type II tating incorporation thereof in the target integration site system . directed by the gRNA used . Thus , in some specific embodi [ 0209] In yet more specific embodiments , the at least one ments , the at least one reporter gene may be comprised reporter gene may be integrated into the gender chromosome within the second nucleic acid sequence, where this reporter of the transgenic avian animal laid or fertilized the eggs of gene is flanked at 5 ' and 3 ' thereof by homologous arms the invention by HDR mediated by at least one CRISPR / comprising the amino acid sequence as denoted by SEQ ID Cas9 system . NO . 4 and 5 , respectively . [ 0210 ] In more specific embodiments , the at least one [0217 In yet some alternative embodiments , the trans reporter gene may be integrated into a gender chromosome genic avian animal laid or fertilized the egg of the invention of the transgenic avian animal laid or fertilized the egg / s of may be prepared using a gRNA2 that comprises the nucleic the invention by co - transfecting at least one cell of this avian acid sequence as denoted by SEQ ID NO . 2 . In such case, animal, or at least one cell that is to be introduced into said to enable integration of the reporter gene of the invention at avian animal with at least two nucleic acid sequences. More the specific site recognized by said gRNA2, the at least one specifically, such cell may be co - transfected with ( a ) at least reporter gene comprised within the second nucleic acid one first nucleic acid sequence comprising at least one sequence may be according to specific embodiments , nucleic acid sequence encoding at least one Cas9 protein and flanked at 5 ' and 3 ' thereof by homologous arms comprising at least one nucleic acid sequence encoding at least one the amino acid sequence as denoted by SEQ ID NO . 6 and ORNA , thereby providing a CRISPR mediated integration ; 7 , respectively . and ( b ) at least one second nucleic acid sequence comprising [ 0218 ] In yet some further alternative embodiments , the at least one reporter gene . transgenic avian animal laid or fertilized the egg / s of the [0211 ] In more specific embodiments , the at least one invention may comprise at least one reporter gene integrated reporter gene in the second nucleic acid sequence may be into at least one site at gender Z chromosome. In some flanked at 5 ' and 3 ' thereof by homologous arms. These arms particular and non - limiting embodiments , such avian trans exhibit homology to the integration target site within the genic animal may be female that carry the transgenic target gender chromosome, thereby facilitating HDR at the reporter gene integrated into the Z chromosome. In more integration site . specific embodiments , the specific loci in the Z chromosome [0212 ] In yet more specific embodiments , the at least one may be any one of regions 9156874 - 9161874 , as denoted by reporter gene in the second nucleic acid sequence may be SEO ID NO : 15 , 27764943 - 27769943 , as denoted by SEO operably linked to any one of a gender specific promoter, an ID NO : 16 , 42172748 - 42177748 , as denoted by SEO ID embryonal specific promoter and an inducible promoter. NO : 17 , 63363656 -63368656 , as denoted by SEQ ID NO : 18 Such promoter should limit the expression of the reporter and 78777477 - 78782477 , as denoted by SEQ ID NO : 19 of gene of the invention to the specific desired gender ( in case Chromosome Z of female chicken . of gender specific promoter ) , the specific embryonic stage [ 0219 ] In more specific embodiments , the at least one ( embryonic specific promoter ) or specific conditions ( induc ORNA required to target the reporter gene to such specific ible conditions ) . location within the Z chromosome may comprises the [ 0213] In yet some further specific embodiments , the at nucleic acid sequence as denoted by any one of ORNA3 : least one reporter gene comprised within the transgenic ACAGACCTATGATATGT, as denoted by SEQ ID NO . 11 ; avian animal laid or fertilized the egg/ s of the invention may gRNA4: CGATTATCACTCACAAG , as denoted by SEQ be integrated into at least one non - coding region of one of ID NO . 12 ; ORNA5 : CTGGTTAGCATGGGGAC , as its gender chromosomes . denoted by SEQ ID NO . 13 ; ORNA6 : GTAAAGAGTCA [0214 ] In certain embodiments , the at least one reporter GATACA , as denoted by SEQ ID NO . 14 . gene may be integrated into at least one site at gender W [0220 ] In yet some further embodiments , for integrating chromosome. In some particular embodiments , the integra the reporter gene of the invention into the specific locus tion site may be located at locus 1022859 - 1024215 at the W within the Z chromosome, left arm comprising the nucleic chromosome, specifically , galGal5 _ dna range of chromo acid sequence as denoted by SEQ ID NO . 41 , and right arm some W : 1022859 - 1024215 . In yet some further specific comprising the nucleic acid sequence as denoted by SEQ ID embodiments , such loci comprises the nucleic acid sequence NO . 42 , may be used to integrate the reporter gene of the as denoted by SEQ ID NO . 3 . invention to the specific loci directed by gRNA3 of SEQ ID [0215 ] For specific integration of the reporter gene of the NO : 11 . In further embodiments, for integrating the reporter invention at any position within the loci described above , gene of the invention into the specific locus within the Z specific gRNAs may be required . Therefore, in some par chromosome, left arm comprising the nucleic acid sequence ticular and non - limiting embodiments, appropriate gRNAS as denoted by SEQ ID NO . 43 , and right arm comprising the used for the preparation of the transgenic avian animal laid nucleic acid sequence as denoted by SEQ ID NO . 44 , may or fertilized the eggs of the invention may comprise the be used to integrate the reporter gene of the invention to the nucleic acid sequence as denoted by any one of SEQ ID NO . specific loci directed by gRNA4 of SEQ ID NO : 12 . In still 1 and 2 . In some specific embodiments, these gRNAs are further embodiments, for integrating the reporter gene of the referred to herein as gRNA1 and gRNA2, respectively . invention into the specific locus within the Z chromosome, [ 0216 ] In some particular embodiments , the transgenic left arm comprising the nucleic acid sequence as denoted by avian animal laid or fertilized the eggs of the invention has SEQ ID NO . 45 , and right arm comprising the nucleic acid been prepared using a gRNA1 that comprises the nucleic sequence as denoted by SEQ ID NO . 46 , may be used to acid sequence as denoted by SEQ ID NO . 1 . To enable integrate the reporter gene of the invention to the specific integration of the reporter gene of the invention in such loci directed by gRNA5 of SEQ ID NO : 13 . In some further specific location , the reporter gene that should be integrated , embodiments , for integrating the reporter gene of the inven US 2019 /0029236 A1 Jan . 31, 2019 tion into the specific locus within the Z chromosome, left a fertilized or a non - fertilized egg. In some particular arm comprising the nucleic acid sequence as denoted by embodiments , when selection of female egg laying avian SEQ ID NO . 47 , and right arm comprising the nucleic acid subject is desired , a transgenic avian female that contains the sequence as denoted by SEQ ID NO . 48 , may be used to reporter gene of the invention integrated into its Z gender integrate the reporter gene of the invention to the specific chromosome thereof may be used . A fertilized egg laid by loci directed by gRNA6 of SEQ ID NO : 14 . such transgenic avian female ( fertilized either by a WT or by [ 0221] Further non - limiting examples for gRNA a transgenic avian male ) may be determined by the method sequences suitable for integration into specific loci within of the invention as containing a female embryo if no the Z chromosome, may include but are not limited to detectable signal of the reporter gene is detected ( in other ORNA7 of Z chromosome locus chrZ _ 42174515 _ - 1 , com words, the Z chromosome of such embryo is a paternal Z prising the nucleic acid sequence GTAATACA chromosome) . Such egg may be further incubated and a GAGCTAAACCAG , as also denoted by SEQ ID NO : 26 , female egg - laying avian subject may be successfully ORNA8 of Z chromosome locus chrZ _ 9157091 _ 1 , compris hatched and developed . It should be appreciated that such ing the nucleic acid sequence ACAGACCTATGATATGT female avian subject is considered by the invention as a GAG , as also denoted by SEQ ID NO : 27 , gRNA9 of Z progeny of the transgenic avian subjects provided by the chromosome locus chrZ _ 27767602 _ - 1 , comprising the invention , and therefore, the present invention further nucleic acid sequence GAGCTTGTGAGTGATAATCG , as encompasses any egg produced by such egg - laying hen and also denoted by SEQ ID NO :28 , ORNA10 of Z chromosome any components, parts and products thereof. It should be locus chrZ _ 78779927 _ 1 , comprising the nucleic acid understood that such egg may be either fertilized or non sequence GTAAAGAGTCAGATACACAG , as also denoted fertilized eggs. In yet some further alternative embodi by SEQ ID NO : 29 , and gRNA11 of Z chromosome locus ments , in case of a male embryo progeny of such fertiliza chrZ 63364946 _ - 1 , comprising the nucleic acid sequence tion ( a male that carry a maternal Z chromosome having the CAGTGGGTACTGAAGCTGTG as also denoted by SEQ reporter gene of the invention integrated therein ) , any eggs ID NO : 30 . laid by a hen fertilized by such male progeny , is also [ 0222] In yet some further embodiments in accordance encompassed by the present invention , as well as any with the invention , for integrating the reporter gene of the components , products and uses thereof. Still further, any invention into the specific locus within the Z chromosome, progeny hatched from an egg laid by a transgenic female left arm comprising the nucleic acid sequence as denoted by avian subject that carry the reporter gene of the invention SEQ ID NO . 31, and right arm comprising the nucleic acid integrated into its W chromosome thereof ( either a male that sequence as denoted by SEQ ID NO . 32 , may be used to carry two unlabeled Z chromosomes, or a female that carry integrate the reporter gene of the invention to the specific the maternal labeled W chromosome) are considered herein loci directed by gRNA7 of SEQ ID NO : 26 . In further as progenies of the transgenic avian subjects of the invention embodiments , for integrating the reporter gene of the inven and as such , any egg / s laid by such avian subjects or tion into the specific locus within the Z chromosome, left fertilized by such progenies , may be also encompassed by arm comprising the nucleic acid sequence as denoted by the invention , as well as any parts , components and products SEQ ID NO . 33 , and right arm comprising the nucleic acid thereof . Similarly, in some further embodiments , when a sequence as denoted by SEQ ID NO . 34 , may be used to transgenic avian subject used is a male having the reporter integrate the reporter gene of the invention to the specific gene integrated into at least one Z chromosome thereof, any loci directed by gRNA8 of SEQ ID NO : 27 . In still further egg laid by a female progeny, or fertilized by a male progeny embodiments , for integrating the reporter gene of the inven of such transgenic male, is also encompassed by the inven tion into the specific locus within the Z chromosome, left tion . arm comprising the nucleic acid sequence as denoted by [0224 ] Still further, it should be noted that the present SEQ ID NO . 35 , and right arm comprising the nucleic acid invention further encompasses any egg product or any sequence as denoted by SEQ ID NO . 36 , may be used to product that contains or prepared using the eggs of the integrate the reporter gene of the invention to the specific invention or any components thereof ( e . g ., egg parts , spe loci directed by gRNA9 of SEQ ID NO : 28 . In further cifically , egg shell, membrane , white and yolk , as well as any embodiments , for integrating the reporter gene of the inven proteins , lipids or any substances comprised therein ) , or tion into the specific locus within the Z chromosome, left prepared by a process involving or using any of the eggs of arm comprising the nucleic acid sequence as denoted by the invention or any components thereof. The term " egg SEQ ID NO . 37 , and right arm comprising the nucleic acid products ” refers to any product / s obtained from eggs, from sequence as denoted by SEQ ID NO . 38 , may be used to their different components or blends, once the shell and integrate the reporter gene of the invention to the specific membranes have been removed and that are destined for loci directed by gRNA10 of SEQ ID NO : 29 . In yet a further human consumption or any other use described herein . This embodiment, for integrating the reporter gene of the inven term includes eggs that are removed from their shells for tion into the specific locus within the Z chromosome, left processing and convenience , for commercial , foodservice , arm comprising the nucleic acid sequence as denoted by and home use . These products can be classified as refriger SEQ ID NO . 39, and right arm comprising the nucleic acid ated liquid , frozen , and dried products . sequence as denoted by SEQ ID NO . 40 , may be used to [0225 ] They can be partially complemented by other food integrate the reporter gene of the invention to the specific products or additives and can be found solid , concentrated , loci directed by gRNA11 of SEQ ID NO : 30 . liquid , dried , crystallized , frozen , deep - frozen or coagulated . [0223 ] Still further , in some embodiments , the egg/ s of the [0226 ] The possibilities in the use of egg products in invention may be laid by a progeny of any of the transgenic accordance with the invention , are varied due to the techno avian subjects provided by the invention . In accordance with functional properties that they provide . Such properties may such embodiments , the egg/ s of the invention may be either include foaming , emulsifying, and a unique color and flavor , US 2019 /0029236 A1 Jan . 31, 2019 which are important in several industrial products and tions . Liposomes, fatty droplets found in eggs, are used as a processes , to name but a few , Confectionery , Bakery , Pastry , controlled delivery mechanism for various drugs Immuno Dairy products , Ice creams, Drinks, Baby food , Creams and globulin yolk ( IGY ) , a simple egg -yolk protein which has soups , Mayonnaise and sauces , Pasta , Ready cooked meals , immunological properties, may be used as an anti -human Delicatessen , Pet food , Fish farming food , Cosmetic prod rotavirus (HRV ) antibody in food products . Phosvitin , a ucts , Glues ( specifically , albumin ), Tannery , pains, Pharma phosphoprotein found in egg yolk , provides antioxidant ceutical Industry . Still further , egg components and parts benefits in food products. Choline, a B vitamin combined may also display useful properties and any uses thereof is with lecithin in egg yolk , is important in brain development also encompassed by the invention . More specifically , egg and is used to treat certain liver disorders . Eggs are one of yolk and components thereof, may exhibit variety of prop the best food sources of choline. Ovolecithin , a phospholipid erties such as , Flavouring, Colouring (by Xanthophyllis) , found in egg yolk , has a high proportion of phosphatidy Emulsifier capacity (by Lecithin , Lipoproteins LDL ) , choline and contains fatty acids — such as arachidonic acid Coagulant and binding substance (by Lipoproteins LDL and (AA ) and docosahexanoic acid (DHA ), which have been other proteins ), Antioxidant (Phosvitin ) , Pharmaceutical shown to improve visual activity in infants and to improve uses ( IgY , Cholesterol , Sialic acid ). Egg white and its main fatty - acid status . Egg lecithin has both emulsifying and protein , albumen may display Frother capacity , foam stabi antioxidant properties and , beyond its usefulness in keeping lizer (Lysozyme , Egg albumen ), Anticrystallization ( Egg the oil and vinegar of mayonnaise in suspension , it ' s used mucin , Egg mucoid ) , Coagulant and binding substance (by chiefly in medicine. Shell -membrane protein is being used Egg Albumin , Conalbumin ), Preservatives (Lysozyme , Con experimentally to grow human skin fibroblasts ( connective albumin ) , Rheological properties and Pharmaceutical prop tissue cells ) for severe -bum victims and in cosmetics. erties . [0231 ] In yet some further embodiments , the invention [ 0227] In some embodiments , any of the eggs of the further provides the use of egg shells prepared from any of invention as disclosed herein or any component, element the eggs of the invention , as a dietary source of calcium for part or product thereof may be used for cosmetic applica humans and other mammals . In further embodiments , these tions. More specifically , egg white produced from the eggs egg shells may be used as a powdered , purified product in of the invention may be used as a facial products , skin care , fortification of breads and confectioneries, fruit drinks , hair care and in lotions . Egg yolks produces from any of the crackers , condiments . Egg shell calcium in accordance with eggs of the invention may be used in shampoos , conditioners the invention may be also used as oral phosphate binder in and soaps. Cholesterol, lecithin and some of the egg 's fatty low phosphate diets for e . g. patients suffering from renal acids may be used in skin care products , such as revitalizers , failure . make - up foundations and lipstick . [0232 ] Still further, in some embodiments thereof, the [ 0228 ] In yet some further embodiments , the eggs of the invention provides the use of any protein or substance invention may be used in animal feed . The excellent nutri separated and / or purified from any of the eggs of the tion of eggs enhances various pet foods . Egg white may be invention or from any element or component thereof . More used as a protein reference in feeding laboratory animals . specifically, such separated proteins can be used in food and Eggshells produced from the eggs of the invention may be pharmaceutical industry as is or after enzymatic modifica dried , crushed and used to fed to laying hens as a rich tions. In some embodiments , ovotransferrin that may be calcium source and high - quality protein source (from egg separated from any of the eggs of the invention , may be used white left inside the shells ) . as a metal transporter, antimicrobial, or anticancer agent , [0229 ] In yet some further embodiments , any of the eggs whereas lysozyme may be mainly used as a food preserva of the invention as disclosed herein or any component, tive , and ovalbumin may be used as a nutrient supplement . element part or product thereof may be used for medical and Ovomucoid may be used to as an anticancer agent and pharmaceutical application . More specifically, fertile eggs ovomucin as a tumor suppression agent . Hydrolyzed pep provided by the invention may be used to manufacture tides from these proteins may be also used for anticancer, vaccines ( including influenza shots ) , as a source of purified metal binding , and antioxidant activities . Therefore, sepa protein and as an aid in the preservation of bull semen for ration of egg white proteins from any of the eggs of the artificial insemination . invention and the productions of bioactive peptides from egg [0230 ] Still further in some embodiments , any of the eggs white proteins are all are encompassed by the present of the invention as disclosed herein or any component, invention . In yet some more specific embodiments , element part or product thereof may be used for nutraceu lysozyme that may be separated from any of the eggs of the tical application . More specifically , particular components invention , may be used as a bacteriolytic protein . Lysozyme purified and prepared from the eggs of the invention may be has the capability of controlling foodborne pathogens such specifically applicable , in different products and processes. as Listeria monocytogens and Clostridium botulinum , which For example , lysozyme, an egg white protein , may be used are considered as the major pathogens in the food industry . as a food preservative and as an antimicrobial agent in Lysozyme effectively controls toxin formation by pharmaceutical products . Avidin that is an egg white protein Clostridium botulinum in fish , poultry , and some vegetables . and biotin that is a vitamin found in egg white and , to a much Lysozyme also display antiviral, anti - inflammatory , and greater extent, in egg yolk , may be prepared and purified therapeutic effects . In yet some further embodiments , from any of the eggs of the invention . Avidin -biotin tech lysozyme that may be separated from any of the eggs of the nology in accordance with the invention may be used in invention , may be used in food as a preservative (e . g. , various medical diagnostic applications such as immuno kimuchi pickles , sushi, Chinese noodles , cheese , and wine assay , histopathology and gene probes. Sialic acid , an amido production ). In yet some further embodiments , Ovotransfer acid , that may be purified from any of the eggs of the rin that may be separated from any of the eggs of the invention , has been shown to inhibit certain stomach infec invention , have a strong antimicrobial activity , and therefore US 2019 /0029236 A1 Jan . 31, 2019 may be used to improve the safety of foods . In yet some 78777477 -78782477 , as denoted by SEQ ID NO : 19 of further embodiments , Ovomucin , that may be separated Chromosome Z of female chicken . from any of the eggs of the invention , display a strong [0241 ] Thus, in more specific embodiments , the first antimicrobial effect against food poisoning bacteria and nucleic acid sequence of the kit of the invention may therefore may be used in food industry as a food preserva comprise a gRNA , being the at least one of gRNA3 : tive . Also , it has a good emulsifying and forming charac ACAGACCTATGATATGT, as denoted by SEQ ID NO . 11 ; teristics that are essential and therefore applicable in the ORNA4 : CGATTATCACTCACAAG , as denoted by SEQ bakery industry . Still further , Ovotransferrin that may be ID NO . 12 ; ORNA5: CTGGTTAGCATGGGGAC , as separated from any of the eggs of the invention , can bind denoted by SEQ ID NO . 13 ; ORNA6 : GTAAAGAGTCA iron and easily releases the bound iron and as such , may be GATACA , as denoted by SEQ ID NO . 14 . used as a source of iron supplementation for humans . [0242 ] In further embodiments , the at least one reporter [ 0233] In yet a further aspect, the invention provides a kit gene comprised within the second nucleic acid sequence of comprising : the kit of the invention , may be flanked at 5 ' and 3 ' thereof [0234 ] ( a ) at least one first nucleic acid sequence com by homologous arms comprising the amino acid sequence as prising at least one nucleic acid sequence encoding at least denoted by any one of SER ID NO . 41- 48 . More specifi one Cas9 protein and at least one nucleic acid sequence cally, for integrating the reporter gene of the invention into encoding at least one guide RNA ( GRNA) ; and ( b ) at least the specific locus within the Z chromosome, left arm com one second nucleic acid sequence comprising at least one prising the nucleic acid sequence as denoted by SEQ ID NO . said reporter gene . 41, and right arm comprising the nucleic acid sequence as [0235 ] In some embodiments , the at least one reporter denoted by SEQ ID NO . 42 , may be used to integrate the gene in the second nucleic acid sequence comprised within reporter gene of the invention to the specific loci directed by the kit of the invention , may be flanked at 5 ' and 3 ' thereof ORNA3 of SEO ID NO : 11 . In further embodiments, for by homologous arms for HDR at the integration site . integrating the reporter gene of the invention into the specific locus within the Z chromosome, left arm comprising (0236 ] In yet some further specific embodiments, the at the nucleic acid sequence as denoted by SEQ ID NO . 43 , and least one reporter gene in the second nucleic acid sequence right arm comprising the nucleic acid sequence as denoted of the kit of the invention may be operably linked to any one by SEQ ID NO . 44 , may be used to integrate the reporter of a gender specific promoter , an embryonic specific pro gene of the invention to the specific loci directed by gRNA4 moter and an inducible promoter. of SEO ID NO : 12 . In still further embodiments, for inte 102371. In certain embodiments , the at least one reporter grating the reporter gene of the invention into the specific gene may be integrated into at least one non - coding region locus within the Z chromosome, left arm comprising the of the gender chromosome, specifically , to chromosome W . nucleic acid sequence as denoted by SEQ ID NO . 45, and In such case , the first nucleic acid sequence of the kit of the right arm comprising the nucleic acid sequence as denoted invention may encode at least one gRNA comprising the by SEQ ID NO . 46 , may be used to integrate the reporter nucleic acid sequence as denoted by any one of SEQ ID NO . gene of the invention to the specific loci directed by ORNA5 1 and 2 , also referred to herein as gRNA1 and gRNA2, of SEQ ID NO : 13 . In some further embodiments , for respectively . integrating the reporter gene of the invention into the [0238 ] In some specific embodiments , the first nucleic specific locus within the Z chromosome, left arm comprising acid sequence of the kit of the invention may comprise a the nucleic acid sequence as denoted by SEQ ID NO . 47 , and ORNA , being gRNA1 . In some embodiments , such gRNA1 right arm comprising the nucleic acid sequence as denoted may comprise the nucleic acid sequence as denoted by SEQ by SEQ ID NO . 48 , may be used to integrate the reporter ID NO . 1 . In such case , the reporter gene comprised within gene of the invention to the specific loci directed by ORNA6 said second nucleic acid sequence of the kit of the invention , of SEQ ID NO : 14 . may be flanked at 5' and 3 ' thereof by homologous arms [0243 ] Further non -limiting examples of the first nucleic comprising the amino acid sequence as denoted by SEQ ID acid sequence of the kit of the invention may comprise a NO . 4 and 5 , respectively . ORNA , being the at least one of gRNA7 of Z chromosome [0239 ] In yet some further alternative embodiments, the locus chrZ _ 42174515 _ - 1 , comprising the nucleic acid kit of the invention may comprise in the first nucleic acid sequence GTAATACAGAGCTAAACCAG , as also denoted sequence thereof, a sequence encoding gRNA2. In some by SEQ ID NO : 26 , gRNAs of Z chromosome locus chrZ specific embodiments , such sequence encodes the nucleic 9157091 _ 1 , comprising the nucleic acid sequence ACA acid sequence as denoted by SEQ ID NO . 2 . In yet some GACCTATGATATGTGAG , as also denoted by SEQ ID further embodiments , the least one reporter gene comprised NO :27 , CRNAI of Z chromosome locus chrZ _ 27767602 _ - 1 , within the second nucleic acid sequence of the kit of the comprising the nucleic acid sequence GAGCTTGTGAGT invention , may be flanked at 5 ' and 3 ' thereof by homologous GATAATCG , as also denoted by SEQ ID NO : 28 , gRNA10 arms comprising the amino acid sequence as denoted by of Z chromosome locus chrZ _ 78779927 _ 1 , comprising the SEQ ID NO . 6 and 7 , respectively . nucleic acid sequence GTAAAGAGTCAGATACACAG , as [0240 ] In yet some further alternative embodiments , the at also denoted by SEQ ID NO : 29, and gRNA11 of Z least one reporter gene may be integrated into at least one chromosome locus chrZ _ 63364946 _ - 1 , comprising the site at gender Z chromosome. In more specific embodi nucleic acid sequence CAGTGGGTACTGAAGCTGTG as ments, the specific loci in the Z chromosomemay be any one also denoted by SEQ ID NO : 30 . of regions 9156874 - 9161874 , as denoted by SEQ ID NO : 15 , [0244 ] In further embodiments , the at least one reporter 27764943 -27769943 , as denoted by SEQ ID NO : 16 , gene comprised within the second nucleic acid sequence of 42172748 -42177748 , as denoted by SEQ ID NO :17 , the kit of the invention , may be flanked at 5 ' and 3 ' thereof 63363656 -63368656 , as denoted by SEQ ID NO :18 and by homologous arms comprising the amino acid sequence as US 2019 /0029236 A1 Jan . 31, 2019 21 denoted by any one of SEQ ID NO . 31 to 40 . More sequence is the only nucleotide present, but that it is specifically , for integrating the reporter gene of the invention essentially free (about 90 -95 % pure ) of non -nucleotide into the specific locus within the Z chromosome, left arm material naturally associated with it , and thus is distin comprising the nucleic acid sequence as denoted by SEQ ID guished from isolated chromosomes . NO . 31, and right arm comprising the nucleic acid sequence [0250 ] All scientific and technical terms used herein have as denoted by SEQ ID NO . 32 , may be used to integrate the meanings commonly used in the art unless otherwise speci reporter gene of the invention to the specific loci directed by fied . The definitions provided herein are to facilitate under ORNA7 of SEQ ID NO : 26 . In further embodiments , for standing of certain terms used frequently herein and are not integrating the reporter gene of the invention into the meant to limit the scope of the present disclosure . specific locus within the Z chromosome, left arm comprising [0251 ] Before specific aspects and embodiments of the the nucleic acid sequence as denoted by SEQ ID NO . 33 , and invention are described in detail, it is to be understood that right arm comprising the nucleic acid sequence as denoted this invention is not limited to particular methods, and by SEQ ID NO . 34 , may be used to integrate the reporter experimental conditions described , as such methods and gene of the invention to the specific loci directed by gRNAS conditions may vary . It is also to be understood that the of SEQ ID NO :27 . In still further embodiments , for inte terminology used herein is for the purpose of describing grating the reporter gene of the invention into the specific particular embodiments only, and is not intended to be locus within the Z chromosome, left arm comprising the limiting , since the scope of the present invention will be nucleic acid sequence as denoted by SEQ ID NO . 35 , and limited only by the appended claims. right arm comprising the nucleic acid sequence as denoted [0252 ] As used in this specification and the appended by SEQ ID NO . 36 , may be used to integrate the reporter claims , the singular forms “ a ” , “ an ” , and “ the” include plural gene of the invention to the specific loci directed by ORNA9 references unless the context clearly dictates otherwise . of SEQ ID NO : 28 . In further embodiments, for integrating Thus for example , references to " a method ” includes one or the reporter gene of the invention into the specific locus more methods, and / or steps of the type described herein within the Z chromosome, left arm comprising the nucleic and /or which will become apparent to those persons skilled acid sequence as denoted by SEQ ID NO . 37 , and right arm in the art upon reading this disclosure and so forth . comprising the nucleic acid sequence as denoted by SEQ ID [0253 ] Unless defined otherwise , all technical and scien NO . 38 , may be used to integrate the reporter gene of the tific terms used herein have the same meaning as commonly invention to the specific loci directed by gRNA10 of SEQ ID understood by one of ordinary skill in the art to which this NO : 29 . In yet a further embodiment , for integrating the invention belongs. Although any methods and materials reporter gene of the invention into the specific locus within similar or equivalent to those described herein can be used the Z chromosome, left arm comprising the nucleic acid in the practice or testing of the present invention , the sequence as denoted by SEQ ID NO . 39 , and right arm preferred methods and materials are now described . comprising the nucleic acid sequence as denoted by SEQ ID [0254 ] Throughout this specification and the claims which NO . 40, may be used to integrate the reporter gene of the follow , unless the context requires otherwise, the word invention to the specific loci directed by ORNA11 of SEQ ID " comprise ” , and variations such as “ comprises ” and “ com NO : 30 . prising ” , will be understood to imply the inclusion of a [0245 ] In some embodiments , the reporter gene comprised stated integer or step or group of integers or steps but not the within the second nucleic acid sequence of the kit of the exclusion of any other integer or step or group of integers or invention may be at least one bioluminescence reporter steps. More specifically , the terms “ comprises ” , “ compris gene. ing ” , “ includes ” , “ including ” , “ having " and their conjugates 10246 ] In yet some further embodiments , the kit of the mean “ including but not limited to ” . This term encompasses invention may be suitable for use in the preparation of a the terms “ consisting of” and “ consisting essentially of" . transgenic avian animal comprising at least one exogenous The phrase " consisting essentially ” of means that the com reporter gene integrated into at least one position or location position or method may include additional ingredients and / in at least one of gender chromosome Z and W . or steps, but only if the additional ingredients and / or steps do 10247 ] In some embodiments, the method of the invention not materially alter the basic and novel characteristics of the may use any of the kits of the invention as described herein . claimed composition or method . [ 0248 ] Still further , it must be appreciated that the kits of [0255 ] The term “ about” as used herein indicates values the invention may further comprise any reagent, buffer , that may deviate up to 1 % , more specifically 5 % , more media or material required for the preparation of the trans specifically 10 % , more specifically 15 % , and in some cases genic avian animals of the invention . The kit of the invention up to 20 % higher or lower than the value referred to , the may further comprise instructions as well as containers for deviation range including integer values, and , if applicable , the different components thereof. non - integer values as well , constituting a continuous range . [0249 ] It should be appreciated that in certain embodi As used herein the term “ about ” refers to + 10 % . ments , the oligonucleotide/ s or polynucleotide/ s used by the [0256 ] It should be noted that various embodiments of this kit / s and method / s of the invention are isolated and /or invention may be presented in a range format. It should be purified molecules . As used herein , " isolated " or " purified " understood that the description in range format is merely for when used in reference to a nucleic acid means that a convenience and brevity and should not be construed as an naturally occurring sequence has been removed from its inflexible limitation on the scope of the invention . Accord normal cellular ( e . g . , chromosomal) environment or is syn ingly , the description of a range should be considered to thesized in a non - natural environment ( e . g . , artificially syn - have specifically disclosed all the possible sub ranges as thesized ) . Thus, an “ isolated ” or “ purified ” sequence may be well as individual numerical values within that range . For in a cell - free solution or placed in a different cellular example , description of a range such as from 1 to 6 should environment. The term “ purified ” does not imply that the be considered to have specifically disclosed sub ranges such US 2019 /0029236 A1 Jan . 31, 2019 as from 1 to 3 , from 1 to 4 , from 1 to 5 , from 2 to 4 , from EXAMPLES 2 to 6 , from 3 to 6 etc . , as well as individual numbers within 102631 Without further elaboration , it is believed that one that range , for example , 1 , 2 , 3 , 4 , 5 , and 6 . This applies skilled in the art can , using the preceding description , utilize regardless of the breadth of the range . Whenever a numerical the present invention to its fullest extent . The following range is indicated herein , it is meant to include any cited preferred specific embodiments are , therefore , to be con numeral ( fractional or integral) within the indicated range . strued as merely illustrative , and not limitative of the The phrases “ ranging/ ranges between ” a first indicate num claimed invention in any way . ber and a second indicate number and “ ranging/ ranges from ” [0264 ] Standard molecular biology protocols known in the a first indicate number “ to ” a second indicate number are art not specifically described herein are generally followed used herein interchangeably and are meant to include the essentially as in Sambrook et al. , Molecular cloning : A first and second indicated numbers and all the fractional and laboratory manual, Cold Springs Harbor Laboratory , New integral numerals there between . York ( 1989, 1992 ), and in Ausubel et al . , Current Protocols in Molecular Biology , John Wiley and Sons , Baltimore , Md . [0257 ] The following examples are put forth so as to ( 1988 ) . provide those of ordinary skill in the art with a complete [0265 ] Reagents disclosure and description of how to make and use the 10266 ) Animals : methods and compositions of the invention , and are not 10267] Commercial White Leghorn chickens are obtained intended to limit the scope of what the inventors regard as from Hendrix ISA , and Minnesota . their invention . Efforts have been made to ensure accuracy 10268 ] Marker Line chickens are from the Pacific Agri with respect to numbers used ( e . g ., amounts , temperature , Food Research Centre , Agassiz , British Columbia , Canada . etc . ) but some experimental errors and deviations should be [ 0269 ] Transgenic mice CAG - luc - eGFP are from The accounted for. Unless indicated otherwise , parts are parts by Jackson Laboratory ( catalogue number L2G85 ) . weight , molecular weight is average molecular weight , [0270 ] Transgenic mice C57BL / 6 - Tg (CAG - EGFP ) 10sb / J temperature is in degrees Centigrade, and pressure is at or are from The Jackson Laboratory ( catalogue number near atmospheric . 00329 ). [ 0258 ] The examples are representative of techniques [0271 ] Animal experiments were done in strict accordance employed by the inventors in carrying out aspects of the to IACUC approved protocols and under supervision of the present invention . It should be appreciated that while these Crystal Bioscience IACUC committee ensuring that no techniques are exemplary of preferred embodiments for the animal suffers from illness nor dies during the course of the practice of the invention , those of skill in the art, in light of experiments. the present disclosure, will recognize that numerous modi [0272 ] Vectors: fications can be made without departing from the spirit and [0273 ] Cas9 SmartNucleaseTM All- in - one tagged vectors intended scope of the invention . is ordered from System Bioscience Inc . , catalogue number CAS8 / 9xx series . [0259 ] It is appreciated that certain features of the inven [0274 ] PCMV- Gluc 2 vector is ordered from New England tion , which are , for clarity , described in the context of Biolabs Inc ., catalogue number N8081S . separate embodiments ,may also be provided in combination [0275 ) Cell Lines : in a single embodiment . Conversely , various features of the [ 0276 ] Female cells are of Gallus gallus, chicken T lym invention , which are , for brevity , described in the context of phocyte cells . a single embodiment, may also be provided separately or in [0277 ] Male cells are of Gallus gallus, chicken Liver, any suitable sub combination or as suitable in any other ordered from ATCC® Number: CRL -2118TM . described embodiment of the invention . Certain features [0278 ] Primordial Germ Cell (PGC ) line . described in the context of various embodiments are not to [0279 ] Experimental Procedures be considered essential features of those embodiments , [0280 ) Reporter Gene Bioluminescence Detection unless the embodiment is inoperative without those ele Through the Egg Shell ments . [0281 ] D -Luciferin (Sigma - Aldrich Co . LLC , Israel , cata [ 0260 ] Various embodiments and aspects of the present logue number 2591- 17 -5 ) is dissolved at room temperature invention as delineated hereinabove and as claimed in the in DPBS to a final concentration of 15 mg/mL . claims section below find experimental support in the fol 0282 ] An amount of 0 . 1 ml of luciferin or saline solution lowing examples . (negative control) is injected subcutaneously in the loose skin around the neck and shoulder area of transgenic [ 0261 ] Disclosed and described , it is to be understood that luciferase - expressing mice. Ear and tail are excised after 10 this invention is not limited to the particular examples, min and introduced into Chicken embryo ( 10 days ) . methods steps, and compositions disclosed herein as such [0283 ] Alternatively , excised ear and tail from transgenic methods steps and compositions may vary somewhat. It is luciferase -expressing transgenic mice is incorporated into also to be understood that the terminology used herein is the Chicken embryo prior to direct injection to the egg of 0 . 1 used for the purpose of describing particular embodiments ml of luciferin or saline solution . only and not intended to be limiting since the scope of the [ 0284 ] Bioluminescence is observed by using Bio - space present invention will be limited only by the appended photon Imager (Bio space lab , USA ) . claims and equivalents thereof. [0285 ] Restriction - Free (RF ) Cloning [0262 ] It must be noted that, as used in this specification [0286 ] The insertion of gRNAs into Cas9 -SmartNucle and the appended claims, the singular forms “ a ” , “ an ” and aseTM vector is performed by applying the Restriction Free “ the” include plural referents unless the content clearly method (Peleg Y et al. , 2010 ) . Primers are ordered from dictates otherwise . Sigma- Genosys (Rehovot , Israel) and subsequent RF reac US 2019 /0029236 A1 Jan . 31, 2019 tions were carried out using Phusion polymerase ( Thermo denoted by SEQ ID NO : 20 ; encoding the amino acid Scientific , Hudson , N . H ., USA ). Plasmid purification is sequence as denoted by SEQ ID NO :21 )and green fluores carried out using theMEGAspin kit and DNA -spin plasmid cent protein ( eGFP ) , were first employed . DNA purification kit , respectively ( Intron Biotechnology [0296 ] For observation of luciferase activity , in FIG . 1 Biotechnology, Daejoen , South Korea ) . luciferin was injected subcutaneously to luciferase -express [0287 ] Cell Culture ing transgenic mice , tails and ears were then excised and [0288 ] PGCs are grown in KO -DMEM (Life Technolo introduced through a 5 mm hole in the egg shell of an gies ) , of which 40 % is preconditioned on buffalo rat liver unfertilized egg . As shown in the figure , the luciferase cells (BRL , ATCC ) , and supplemented with 7 . 5 % fetal detectable signal is clearly observed in tail and ear samples bovine serum (Hyclone ) , 2 . 5 % irradiated chicken serum , 1x ( FIGS . 1A , 1B ) through the egg shell. The inventors there non - essential amino acids, 2 mM glutamine , 1 mM sodium fore next examined the feasibility of inducing luciferase pyruvate, 0 . 1 mMß- mercaptoethanol (all from Life Tech reaction in - ovo . Therefore , ears and tails of luciferase nologies ), 4 ng /ml recombinant human fibroblast growth expressing transgenic mice were excised , introduced factor, 6 ng /ml recombinant mouse stem cell factor ( both through a hole into a fertilized egg that carry a 10 - days old from R & D Systems) and grow on an irradiated feeder layer chicken embryo and luciferin was subsequently injected . As of BRL cells . The cells are passaged 3 times per week onto clearly shown in FIGS . 2A and 2B , an in - ovo luciferase fresh feeder layers . reaction successfully resulted in a detectable signal that was [0289 ] Transfection able to penetrate the egg shell . [ 0290 ] For stable transfectant targeting of the above- men [02971 On the other hand , similar experiments performed tioned loci of chromosomes W or Z , 15 ug of vector using GFP as the reporter gene , clearly indicated that GFP containing gRNA and 15 ug of circular luciferase - containing signal is not detectable following incorporation of tails and vector were added to 5x10 cells and brought to volume of ears of GFP - expressing transgenic mice into Chicken 100 ul with V -buffer ( lonza , Walkersville ) . The cell suspen sion is transferred to a 2 mm cuvette and subjected to 8 embryo as seen in FIG . 3 . square wave pulses of 350 volts/ 100 usec (BTX 830 elec [0298 ] Luciferase reporter gene , specifically , firefly troporator) . Cells are then plated with Neomycin - resistant luciferase ( comprising the amino acid sequence as denoted irradiated BRLs and seeded in a 48 - well plate at a density of by SEQ ID NO . 21, encoded by the nucleic acid sequence as 10 % cells per well . After 3 days , 40ug /ml Neomycin is added denoted by SEQ ID NO : 20 ) was thus further selected for to select for cells with a stable integration of luciferase incorporation into sex chromosomes W and Z . reporter gene . [0299 ] FIG . 4 represents a schematic illustration of the [0291 ] Preparation of Transgenic Chickens method of the invention for identification of embryo 's [0292 ] Concentrated vehicle (that may be either lentivirus gender in -ovo . More specifically , a transgenic avian female at a titer of about 107 MOI) or plasmid DNA ) is injected to hen containing a gender specific chromosome ( W ) with the 25 embryos in new laid eggs. Injections are carried out luciferase reporter gene integrated therein is provided . In weekly three injections. The injected embryos hatch 3 weeks eggs laid by said hen , expression of the reporter gene after injection . These are GO birds Immediately after hatch , observed by a detectable signal indicates that the embryo the DNA is extracted from CAM samples of the hatched carry the W gender chromosome and is therefore female . chicks and detection of the presence /absence of vector DNA This enables the selection for continued incubation of male is carried out by semi- quantitative PCR . Blood sample GO while females that carry the reporter gene are discarded . chicks at 2 - 3 weeks of age and repeat PCR screen . GO birds This selection is probably more relevant for Poultry . are raised to sexual maturity , 16 - 20 weeks for males , 20 - 24 [0300 ] FIG . 5 schematically presents yet a further alter weeks for females . Cockerels are tested for semen produc native that facilitates determination of male embryo , in - ovo . tion from approximately 16 weeks. More specifically , the provision of transgenic female chick [ 0293] Hens are inseminated , fertile eggs collected daily . ens carrying the gender specific z chromosome with a The G1 chicks are hatch 3 weeks later and each individual reporter gene integrated therein , results in female embryos chick wing banded and a chick chorioallantoic membrane ( that received the maternal wild type W chromosome) (CAM ) sample taken from the shell . Extract DNA from without reporter gene or male embryos (that received the CAM samples and carry out PCR screen for presence of maternal labeled Z chromosome) expressing the transgenic transgene , predicted to be single copy level. Repeat screen luciferase gene . to confirm and sex chicks on DNA from blood sample 2 - 3 weeks later. Example 2 [ 0294 ] At a few weeks of age a blood sample is taken from G1 birds to prepare genomic DNA for PCR analysis . G1 Design of Guide RNAs Vector birds are used for breeding G2 . [0301 ] In order to incorporate the luciferase reporter gene into the gender chromosomes W or Z , the CRISPR /Cas9 Example 1 mediated HDR method is selected . Relevant gRNA sites are then sought from both gender chromosomes. Selection of Reporter Gene for Visual Gender [ 0302 ] The region 1022859 - 1024215 of Chromosome W Identification in Poultry of female chicken , comprising the nucleic acid sequence as [0295 ] In order to demonstrate the feasibility of visually denoted by SEQ ID NO . 3 , is analyzed for guide RNA identify gender of in -ovo poultry , the use of bioluminescent design . Two guide RNAs are selected , synthesized and as compared to fluorescent reporter genes was evaluated . cloned separately into the Cas9 SmartNuclease vector con Therefore , transgenic mice expressing reporter genes such t aining the wild type Cas9 nuclease (Horizon ) by Restriction as firefly luciferase (having a nucleic acid sequence as free cloning protocol: GRNA1 : GCACTAGGAACCAGCA US 2019 /0029236 A1 Jan . 31, 2019 24

GCAG , as denoted by SEQ ID NO . 1 and ORNA2: GTAGC NO . 5 are provided . For cloning using the gRNA2 , “ Left CCCAAGAGGGCTAGG , as denoted by SEQ ID NO . 2 . arm ” comprising the nucleic acid sequence as denoted by [ 0303] The predicted parameters of these two gRNAs are SEQ ID NO . 6 , and the “ Right arm ” comprising the nucleic presented in Table 1 : acid sequence as denoted by SEQ ID NO . 7 are provided . [0310 ] Still further , a “ left arm ” for the region upstream to TABLE 1 the CMV -promoter comprises the nucleic acid sequence as ORNA parameters ORNA1 ORNA2 denoted by SEQ ID NO . 8 , and a “ right arm ” for the region SgRNA designer 0 . 506 0 . 63 downstream the Neomycin -resistance , may comprise the sscore 0 . 8677 0 . 5323 nucleic acid sequence as denoted by SEQ ID NO . 9 , or SEQ SORNA scorer 94 . 8 99 . 9 ID NO . 10 for the region downstream the polyA site . For the female Z chromosome, the Luciferase reporter gene may be [0304 ] The regions 9156874 - 9161874 , as denoted by SEQ cloned for using either the gRNA3, as denoted by SEQ ID ID NO : 15 , 27764943 - 27769943 , as denoted by SEQ ID NO . 11 , gRNA4 : as denoted by SEQ ID NO . 12 , gRNA5 , NO : 16 , 42172748 -42177748 , as denoted by SEQ ID NO : 17 , as denoted by SEQ ID NO . 13 , gRNA6 , as denoted by SEQ 63363656 -63368656 , as denoted by SEQ ID NO :18 and ID NO . 14 . 78777477 -78782477 , as denoted by SEQ ID NO : 19 of [0311 ] For cloning using the gRNA3, “ Left arm ” com Chromosome Z of female chicken are analyzed for guide prising the nucleic acid sequence as denoted by SEQ ID NO . RNA design . Four guide RNAs are selected , synthesized and 41, and the " Right arm ” comprising the nucleic acid cloned separately into the Cas9 SmartNuclease vector con sequence as denoted by SEQ ID NO . 42 are provided . For taining the wild type Cas9 nuclease (Horizon ) by Restriction cloning using the gRNA4, “ Left arm ” comprising the free cloning protocol: ORNA3 : ACAGACCTATGATATGT, nucleic acid sequence as denoted by SEQ ID NO . 43 , and the as denoted by SEQ ID NO . 11 ; GRNA4: CGATTATCACT “ Right arm ” comprising the nucleic acid sequence as CACAAG , as denoted by SEQ ID NO . 12 ; ORNA5: CTG denoted by SEQ ID NO . 44 are provided . For cloning using GTTAGCATGGGGAC , as denoted by SEQ ID NO . 13 ; the gRNA5 , “ Left arm ” comprising the nucleic acid ORNA6 : GTAAAGAGTCAGATACA , as denoted by SEQ sequence as denoted by SEQ ID NO . 45 , and the “ Right ID NO . 14 . arm ” comprising the nucleic acid sequence as denoted by [0305 ] Further non - limiting examples for ORNA SEQ ID NO . 46 are provided. For cloning using the gRNA6 , sequences suitable for integration into specific loci within " Left arm ” comprising the nucleic acid sequence as denoted the Z chromosome, may include but are not limited to by SEQ ID NO . 47 , and the “ Right arm ” comprising the ORNA7 of Z chromosome locus chrZ _ 42174515 _ - 1, com nucleic acid sequence as denoted by SEQ ID NO . 48 are prising the nucleic acid sequence GTAATACA provided . In yet some further embodiments , for integrating GAGCTAAACCAG , as also denoted by SEQ ID NO : 26 , the reporter gene of the invention into the specific locus ORNA8 of Z chromosome locus chrZ _ 9157091 _ 1 , compris within the Z chromosome, left arm comprising the nucleic ing the nucleic acid sequence ACAGACCTATGATATGT acid sequence as denoted by SEQ ID NO . 31, and right arm GAG , as also denoted by SEQ ID NO : 27 , gRNA9 of Z comprising the nucleic acid sequence as denoted by SEQ ID chromosome locus chrz _ 27767602 _ - 1 , comprising the NO . 32 , may be used to integrate the reporter gene of the nucleic acid sequence GAGCTTGTGAGTGATAATCG , as invention to the specific loci directed by gRNA7 of SEQ ID also denoted by SEQ ID NO :28 , gRNA10 of Z chromosome NO : 26 . In further embodiments , for integrating the reporter locus chrZ _ 78779927 _ 1 , comprising the nucleic acid gene of the invention into the specific locus within the Z sequence GTAAAGAGTCAGATACACAG , as also denoted chromosome, left arm comprising the nucleic acid sequence by SEQ ID NO : 29 , and gRNA11 of Z chromosome locus as denoted by SEQ ID NO . 33 , and right arm comprising the chrZ _63364946 _ - 1 , comprising the nucleic acid sequence nucleic acid sequence as denoted by SEQ ID NO . 34 , may CAGTGGGTACTGAAGCTGTG as also denoted by SEQ be used to integrate the reporter gene of the invention to the ID NO : 30 . specific loci directed by gRNA8 of SEQ ID NO : 27 . In still [0306 ] These gRNAs have few predicted off- target sites , further embodiments , for integrating the reporter gene of the none of which were in known coding sequences . invention into the specific locus within the Z chromosome , left arm comprising the nucleic acid sequence as denoted by Example 3 SEQ ID NO . 35 , and right arm comprising the nucleic acid [ 0307 ] Design of Luciferase Targeting Vector sequence as denoted by SEQ ID NO . 36 , may be used to [0308 ] Flanking sequences homological of the appropriate integrate the reporter gene of the invention to the specific flanking sequences indicated above of female W chromo loci directed by gRNA9 of SEQ ID NO : 28 . In further some or of the female Z chromosome loci, are introduced embodiments , for integrating the reporter gene of the inven into the luciferase -expressing vector upstream to the CMV tion into the specific locus within the Z chromosome, left promoter and downstream the Neomycin -resistance or alter arm comprising the nucleic acid sequence as denoted by natively downstream the polyA site (ordered synthetic DNA , SEQ ID NO . 37 , and right arm comprising the nucleic acid Integrated DNA Technologies , Inc ., USA ). sequence as denoted by SEQ ID NO . 38 , may be used to [ 0309] For the female W chromosome, the reporter gene , integrate the reporter gene of the invention to the specific specifically Luciferase may be cloned for using either the loci directed by ORNA10 of SEQ ID NO : 29 . In yet a further Guide 1 ( gRNA1) , as denoted by SEQ ID NO . 1 or Guide embodiment, for integrating the reporter gene of the inven 2 ( gRNA2 ) : as denoted by SEQ ID NO . 2 . For cloning using tion into the specific locus within the Z chromosome , left the gRNAL, “ Left arm ” comprising the nucleic acid arm comprising the nucleic acid sequence as denoted by sequence as denoted by SEQ ID NO . 4 , and the “ Right arm ” . SEQ ID NO . 39 , and right arm comprising the nucleic acid comprising the nucleic acid sequence as denoted by SEQ ID sequence as denoted by SEQ ID NO . 40 , may be used to US 2019 /0029236 A1 Jan . 31, 2019 25 integrate the reporter gene of the invention to the specific for the luciferase integration by PCR . Confirmed clones are loci directed by gRNA11 of SEQ ID NO : 30 . injected into recipient chicken embryos at Stage 14 - 16 (H & H ). The injected embryos are transferred to surrogate Example 4 shells and incubated until hatch at 37° C . The sex of the chicks is determined after hatch by PCR for the W - chromo some . Germline Transmission of CRISPR - Treated Cells [0313 ] Female and Male chimeras are grown to sexual 0312 ] The two above described vectors, specifically, the maturity and bred to wild type male and female chickens . ORNA /Cas9 and the reporter - gene vectors are co - transfected Hatched chicks are evaluated for the expression of to PGCs as detailed in experimental procedures. After stable luciferase , and the germline progeny are confirmed by PCR clones are identified , the cells are expanded and confirmed to carry targeted luciferase .

SEQUENCE LISTING

< 160 > NUMBER OF SEQ ID NOS : 48 < 210 > SEQ ID NO 1 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : ? 3 > OTHER INFORMATION : Guide 1 for W chromosome < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 1 gcactaggaa ccagcagcag

V< 210 > SEQ ID NO 2 V< 211 > LENGTH : 20 V< 212 > TYPE : DNA V< 213 > ORGANISM : Artificial Sequence V< 220 > FEATURE : V< 223 > OTHER INFORMATION : Guide 2 for w chromosome V< 220 > FEATURE :

V MOMO 221 > NAME / KEY : misc _ feature V< 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 2 gtagccccaa gagggctagg 20

< 210 > SEQ ID NO 3 211 > LENGTH : 1460 2 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 3 tcgggctaac attagacccg ttgtgtctta atcctgccgt cgggtataca tatactaaaa 60 gaacctcctt tccctcctat aaatcggagc gagacaaggc attctttttt tattattatt 120 ttggttgcct gcccatcaga tgtaatgaaa gttgcacagg gtagggctaa gaaggtaaag 180 gagttaaatt cccccgggag gttagagatt ccctgtattg tggttgcctg cccattagac 240 gtaacaaaag ttgtgaaggg taggactaag gatccaggta aagaggttag tcccccaggg 300 ttagagtccc tcctcagaag taaatgtaaa acataaccac ggtaattgtc gttgagtgcg 360 cttgtttgat tgttaattgt ttgtgctgtt attgtatgct gattgtttgt gttgttatta 420 tacaaagagc tcacatgcat cgttaaaatg ggcattggat cacctagggg tgagggaatt 480 ttgaaaaagt cacttttggg ctgtgtttta agtcattgga aagaaatagc tggatcccct 540 ggtggggttg cacagaagga tgatttaagt acgatggatg cctttgaggc aggcactagg 600 US 2019 /0029236 A1 Jan . 31, 2019

- continued aaccagcagc agtggcagat ttgtgatcat ggaaagaatt ggtgggagca tacggcacca 660 ggactcagat aagatagcta gotaaggtga tgaattgtag atggtgtcag ataacgaaag 720 aagaaaaaca aatgtaataa agtgttaaat gccaatatgt tttttataat gaggcaatat 780 cctgaatggc attagtgtgg gatcaatttg goccagatga ccctctgatt ttaatggtag 840 aaaatgataa gagagagagg gagaaaggaa gagagtgtaa aacgtgttgt tcagcatgta 900 gtattggact gagatgcttc aagcgaaaca agaatgagca ggaggaggat ttagagatge 960 tagtagcccc aagagggcta gggggcctca aaatcatgga acccaactcc ctggagtaga 1020 agggtcaggt aatgagtcca aaagagggac tataggaacc atgccagta a cagagaggac 1080 tcacagccag catagggtcg tgctgtaagc cctgttgagg cagttggaaa tgacagttcg 1140 gtagtagtta aggtaccctt ttaaattaca gatttaaaca tttggaaagc agctgctggo 1200 agctaccgtg atgatcctaa acgggtagct aatgcttttg aaatgatgat taaaactcag 1260 gaactggata ggaaagatat ggaatttatt atgcacatgt tgtttgatag tacagaaaaa 1320 taaatgattc actagaccac acggacccaa gtggaggatc aggtaatggc aggggttttg 1380 cttggatgta atgctggaaa ggacaagagt cctttcctgt cctggggagg atttagaggt 1440 ggttagacct tggggaggag 1460

< 210 > SEQ ID NO 4 < 211 > LENGTH : 592 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223OWN > OTHER INFORMATION : For cloning using the GRNA1 , W chromosome , " Left arm " V< 220 > FEATURE :

? V< 221 > NAME / KEY : misc _ feature ? V< 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 4 tcgggctaac attagacccg ttgtgtctta atcctgccgt cgggtataca tatactaaaa 60 gaacctcctt tccctcctat aaatcggagc gagacaaggc attctttttt tattattatt 120 ttggttgcct gcccatcaga tgtaatgaaa gttgcacagg gtagggctaa gaaggtaaag 180 gagttaaatt cccccgggag gttagagatt ccctgtattg tggttgcctg cccattagac 240 gtaacaaaag ttgtgaaggg taggactaag gatccaggta aagaggttag tcccccaggg 300 ttagagtccc tcctcagaag taaatgtaaa acataaccac ggtaattgtc gttgagtgcg 360 cttgtttgat tgttaattgt ttgtgctgtt attgtatgct gattgtttgt gttgttatta 420 tacaaagagc tcacatgcat cgttaaaatg ggcattggat cacctagggg tgagggaatt 480 ttgaaaaagt cacttttggg ctgtgtttta agtcattgga aagaaatagc tggatcccct 540 ggtggggttg cacagaagga tgatttaagt acgatggatg cctttgaggc ag 592

< 210 > SEQ ID NO 5 < 211 > LENGTH : 848 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : For cloning using the GRNA1 , W chromosome , " Right arm " < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 23 > OTHER INFORMATION : Synthetic US 2019 /0029236 A1 Jan . 31, 2019 27

- continued

< 400 > SEQUENCE : 5 tggcagattt gtgatcatgg aaagaattgg tgggagcata cggcaccagg actcagataa 60 gatagctagc taaggtgatg aattgtagat ggtgtcagat aacgaaagaa gaaaaacaaa 120 tgtaataaag tgttaaatgc caatatgttt tttataatga ggcaatatcc tgaatggcat 180 tagtgtggga tcaatttggc ccagatgacc ctctgatttt aatggtagaa aatgataaga 240 gagagaggga gaaaggaaga gagtgtaaaa cgtgttgttc agcatgtagt attggactga 300 gatgcttcaa gcgaaacaag aatgagcagg aggaggattt agagatgcta gtagccccaa 360 gagggctagg gggcctcaaa atcatggaac ccaactccct ggagtagaag ggtcaggtaa 420 tgagtccaaa agagggacta taggaaccat gccagtaaca gagaggactc acagccagca 480 tagggtcgtg ctgtaagccc tgttgaggca gttggaaatg acagttcggt agtagttaag 540 gtaccctttt aaattacaga tttaaacatt tggaaagcag ctgctggcag ctaccgtgat 600 gatcctaaac gggtagctaa tgcttttgaa atgatgatta aaactcagga actggatagg 660 aaagatatgg aatttattat gcacatgttg tttgatagta cagaaaaata aatgattcac 720 tagaccacac ggacccaagt ggaggatcag gtaatggcag gggttttgct tggatgtaat 780 gctggaaagg acaagagtcc tttcctgtcc tggggaggat ttagaggtgg ttagaccttg 840 gggaggag 848

< 210 > SEO ID NO 6 < 211 > LENGTH : 962 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : 223 > OTHER INFORMATION : For cloning using the qRNA2 , W chromosome , " Left arm " < 220 > FEATURE : < 221 > NAME / KEY : misc feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 6 tcgggctaac attagacccg ttgtgtctta atcctgccgt cgggtataca tatactaaaa 60 gaacctcctt tccctcctat aaatcggage gagacaaggc attctttttt tattattatt 120 ttggttgcct gcccatcaga tgtaatgaaa gttgcacagg gtagggctaa gaaggtaaag 180 gagttaaatt cccccgggag gttagagatt ccctgtattg tggttgcctg cccattagac 240 gtaacaaaag ttgtgaaggg taggactaag gatccaggta aagaggttag tcccccaggg 300 ttagagtccc tcctcagaag taaatgtaaa acataaccac ggtaattgtc gttgagtgcg 360 cttgtttgat tgttaattgt ttgtgctgtt attgtatgct gattgtttgt gttgttatta 420 tacaaagagc tcacatgcat cgttaaaatg ggcattggat cacctagggg tgagggaatt 480 ttgaaaaagt cacttttggg ctgtgtttta agtcattgga aagaaatagc tggatcccct 540 ggtggggttg cacagaagga tgatttaagt acgatggatg cctttgaggc aggcactagg 600 aaccagcagc agtggcagat ttgtgatcat ggaaagaatt ggtgggagca tacggcacca 660 ggactcagat aagatagcta gctaaggtga tgaattgtag atggtgtcag ataacgaaag 720 aagaaaaaca aatgtaataa agtgttaaat gccaatatgt tttttataat gaggcaatat 780 cctgaatggc attagtgtgg gatcaatttg gcccagatga ccctctgatt ttaatggtag 840 aaaatgataa gagagagagg gagaaaggaa gagagtgtaa aacgtgttgt tcagcatgta 900 US 2019 /0029236 A1 Jan . 31, 2019 28

- continued gtattggact gagatgcttc aagcgaaaca agaatgagca ggaggaggat ttagagatgc 960 ta 962

< 210 > SEQ ID NO 7 V< 211 > LENGTH : 478 < 212 > TYPE : DNA V 13 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : For cloning using the GRNA2 , W chromosome , " Right arm " < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 7 gggcctcaaa atcatggaac ccaactccct ggagtagaag ggtcaggtaa tgagtccaaa 60 agagggacta taggaaccat gccagtaaca gagaggactc acagccagca tagggtcgtg 120 ctgtaagccc tgttgaggca gttggaaatg acagttcggt agtagttaag gtaccctttt 180 aaattacaga tttaaacatt tggaaagcag ctgctggcag ctaccgtgat gatcctaaac 240 gggtagctaa tgcttttgaa atgatgatta aaactcagga actggatagg aaagatatgg 300 aatttattat gcacatgttg tttgatagta cagaaaaata aatgattcac tagaccacac 360 ggacccaagt ggaggatcag gtaatggcag gggttttgct tggatgtaat gctggaaagg 420 acaagagtcc tttcctgtcc tggggaggat ttagaggtgg ttagaccttg gggaggag 478

< 210 > SEQ ID NO 8 < 211 > LENGTH : 669 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : A " left arm " for the region upstream to the NNEPE CMV - promoter < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 8 aggcaaggct tgaccgacaa ttgcatgaag tcgggctaac attagacccg ttgtgtctta 60 atcctgccgt cgggtataca tatactaaaa gaacctcctt tccctcctat aaatcggage 120 gagacaaggc attctttttt tattattatt ttggttgcct gcccatcaga tgtaatgaaa 180 gttgcacagg gtagggctaa gaaggtaaag gagttaaatt cccccgggag gttagagatt 240 ccctgtattg tggttgcctg cccattagac gtaacaaaag ttgtgaaggg taggactaag 300 gatccaggta aagaggttag tcccccaggg ttagagtccc tcctcagaag taaatgtaaa 360 acataaccac ggtaattgtc gttgagtgcg cttgtttgat tgttaattgt ttgtgctgtt 420 attgtatgct gattgtttgt gttgttatta tacaaagagc tcacatgcat cgttaaaatg 480 ggcattggat cacctagggg tgagggaatt ttgaaaaagt cacttttggg ctgtgtttta 540 agtcattgga aagaaatagc tggatcccct ggtggggttg cacagaagga tgatttaagt 600 acgatggatg cctttgaggc aggcactagg aaccagcagc gatgtacggg ccagatatac 660 gcgttgaca 669

< 210 > SEQ ID NO 9 < 211 > LENGTH : 911 US 2019 /0029236 A1 Jan . 31, 2019

- continued < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : A " right arm " for the region downstream the Neomycin - resistance < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 9 ttctatcgcc ttcttgacga gttcttctga cagtggcaga tttgtgatca tggaaagaat 60 tggtgggagc atacggcacc aggactcaga taagatagct agctaaggtg atgaattgta 120 gatggtgtca gataacgaaa gaagaaaaac aaatgtaata aagtgttaaa tgccaatatg 180 ttttttataa tgaggcaata tcctgaatgg cattagtgtg ggatcaattt ggcccagatg 240 accctctgat tttaatggta gaaaatgata agagagagag ggagaaagga agagagtgta 300 aaacgtgttg ttcagcatgt agtattggac tgagatgctt caagcgaaac aagaatgage 360 aggaggagga tttagagatg ctagtagccc caagagggct agggggcctc aaaatcatgg 420 aacccaactc cctggagtag aagggtcagg taatgagtcc aaaagaggga ctataggaac 480 catgccagta acagagagga ctcacagcca gcatagggtc gtgctgtaag ccctgttgag 540 gcagttggaa atgacagttc ggtagtagtt aaggtaccct tttaaattac agatttaaac 600 atttggaaag cagctgctgg cagctaccgt gatgatccta aacgggtagc taatgctttt 660 gaaatgatga ttaaaactca ggaactggat aggaaagata tggaatttat tatgcacatg 720 ttgtttgata gtacagaaaa ataaatgatt cactagacca cacggaccca agtggaggat 780 caggtaatgg caggggtttt gottggatgt aatgctggaa aggacaagag tcctttcctg 840 tcctggggag gatttagagg tggttagacc ttggggagga gggttegaaa tgaccgacca 900 agcgacgccc a 911

< 210 > SEQ ID NO 10 < 211 > LENGTH : 911 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : A " right arm " for the region downstream the polyA site < 220 > FEATURE : 21 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 10 atctgtgtgt tggttttttg tgtgtctaga cagtggcaga tttgtgatca tggaaagaat 60 tggtgggagc atacggcacc aggactcaga taagatagct agctaaggtg atgaattgta 120 gatggtgtca gataacgaaa gaagaaaaac aaatgtaata aagtgttaaa tgccaatatg 180 ttttttataa tgaggcaata tcctgaatgg cattagtgtg ggatcaattt ggcccagatgagatg 240 accctctgat tttaatggta gaaaatgata agagagagag ggagaaagga agagagtgta 300 aaacgtgttg ttcagcatgt agtattggac tgagatgctt caagcgaaac aagaatgagc 360 aggaggagga tttagagatg ctagtagccc caagagggct agggggcctc aaaatcatgg 420 aacccaactc cctggagtag aagggtcagg taatgagtcc aaaagaggga ctataggaac 480 catgccagta acagagagga ctcacagcca gcatagggtc gtgctgtaag ccctgttgag 540 gcagttggaa atgacagttc ggtagtagtt aaggt accct tttaaattac agatttaaac 600 US 2019 /0029236 A1 Jan . 31, 2019 30

- continued atttggaaag cagctgctgg cagctaccgt gatgatccta aacgggtagc taatgctttt 660 gaaatgatga ttaaaactca ggaactggat aggaaagata tggaatttat tatgcacatg 720 ttgtttgata gtacagaaaa ataaatgatt cactagacca cacggaccca agtggaggat 780 caggtaatgg caggggtttt gottggatgt aatgctggaa aggacaagag tcctttcctg 840 tcctggggag gatttagagg tggttagacc ttggggagga gcaagtaaga tgcttttctg 900 tgctgcaata g 911

< 210 > SEQ ID NO 11 < 211 > LENGTH : 17 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Guide 3 for z chromosome < 220 > FEATURE : 1 > NAME / KEY : misc _ feature 3 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 11 acagacctat gatatgt 17

< 210 > SEQ ID NO 12 < 211 > LENGTH : 17 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Guide 4 for z chromosome < 220???? > FEATURE : < 221OM > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 12 cgattatcac tcacaag 17

< 210 > SEQ ID NO 13 < 211 > LENGTH : 17 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Guide 5 for z chromosome < 220NNNNNEPP > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 13 ctggttagca tggggac 17

< 210 > SEO ID NO 14 < 211 > LENGTH : 17 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Guide 6 for z chromosome < 220 > FEATURE : < 221 > NAME /KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 14 gtaaagagtc agataca 17

< 210 > SEQ ID NO 15 < 211 > LENGTH : 4980 US 2019 /0029236 A1 Jan . 31, 2019 31

- continued < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 15 cctgcaggac atgtggacac tctgccaggt actgggggag gatcccctcc actgctccct 60 gggagatggc aaacatctag agagggacac tgcagggatg ctgcatgaac acctccagcc 120 ttctgcaggc tgtgatgggg tcagggctga aggtcaacac aagcaatgac tgcttgctga 180 caatgtgggc attgccgacc acagacctat gatatgtgag tggtgagtgg ggccaggaga 240 gcaggacagg agtgtggact cggaggcgcg ggcagaggag gtagctcaga gcatgagata 300 tattcgccag gtgtcagtgg acttctggca gtgcatactg cagagagott tggttgctgg 360 ccatctggat gatgacaaaa tctcagecac agaccatgtg ggttggaaga gtcctcagga 420 gatcaccttt ccacctcctg ctaaagcaca ttccctacag tatgtttcac atgacaccgt 480 gctggcagat ttttaatatc atcagagaat gacactocat atcctctctg ggcagccttt 540 ttcagtgctc tgtcacccac aaagtaaagt atttgctcat gttctaatgg aacttcctat 600 gttctagttt gtgaccattg aaccttgttc tgtcactgga cagtgctgaa ggagcctggc 660 cctatccact tgactcccac actttacata tttacaagca togataagac ccccctcagt 720 cttctccaga ctagatagcc ccaggtctcc caaccattcc ttttatggga gatgcttcag 780 gcccctcatc acctctgtgg ccctctgctg gactgcctgc agtagttcca ggtttttttt 840 tttgaactgg ggagcccaga acttgacacg gtattccaga tgtggcctca ccagcgcaga 900 ggagagggga aggctcacct ccctcgacct ggtggccatg ttttttttaa cagacctcag 960 gataccactg gccttcttgg cccaagggca cactgctggc tcatggccca tgggttggct 1020 tccaggactc tcaggtcctt ctccgtagag ctcctctcaa gcaggacaac cctcagcctg 1080 tactgatgtg tgcggtgcgg ttattcctcc ccacgtgcaa gactctacat ctgccattgt 1140 taaatctcat aagcttcctc tctgcccaac tctccactgt gtacgggcct tagtgaatgg 1200 cagcacagac ttctggtgtg aggatagcat tcagaacaag ctgctgtacc ttcccagtca 1260 cagaggtgag ggtgactggc ttgtactttc ccagctttgc cttcttgccc ttttggaaga 1320 ctggagcgac attggccttc tggaggaaac ggtcctcagg cacccctcct gttctccatg 1380 acctttgaaa gatgatcgag agcaccttgg cagtcacttc toccagctcc ttcagcacgc 1440 atgagtgcat cccgccagtg cccatggatt tgtgttcatt gaattagcct aggtgacctc 1500 tgatcagatc cttcttgacc aaggggaaga cttcctttcc ccaggttctt atctccaggg 1560 cctgggattc ccaaggggca atcttagcag gaaaggatga agtaaaggag gtgtgcagtt 1620 acagtgcttt catggtgtcc tccattactc caatgaggtc acccacctca ttcagcagca 1680 gacatacatt ctcccagtct tcctttttct actgccatac taaagtagtc cttcatgttg 1740 tccttgactg aaggtcacco aacttgattt ccagtgagcc ttagcattcc ttgtagcatt 1800 catgcatgtc ctgacaacat tcctattttc ttcccaagtg gccagagaccttttccacac 1860 tccagaggct ttgttcttcc attactgcct ttccatgage ttcttgctca tctctgcagg 1920 tctcatgcca cctttgcccg atttcttagt cttagagatg caccgatott gaatttggaa 1980 gaagtggtgc ttgaatgaca accagctctc ttggtccccc ttgctttcca aagctctaac2040 ccatggaatg cctccatgta tgtctgtgaa gaggtcaaag tcagctctcc tgaagtcgtg 2100 US 2019 /0029236 A1 Jan . 31, 2019 32

- continued gttgcaatcc tacaaactgc ctgatttctc ccatgggaga tcccgaactc cactatctca 2160 cagtcactgc actcaaggct tcccccagcc ttcacatccc cagctacagg aagagaagag 2220 gctcgaggct acttgcagct gtctgcggaa ggcttctcca gottcctcct cttcatcagg 2280 cggcctgttg taaacaccca caacagcgtc acccatcata gcctgtccct tagtcctcac 2340 ccataaactt tctactcatt catcatgcat cccttggcag agctctgtac attccagctg 2400 ttccctcaca taaagagcaa ctccaccacc tcacaccgac gtctgtctgt cctaaaaagt 2460 acagagccat ccctgagagc attccagtca tgcgagctgc cccaccacgt ccctctgctg 2520 atcgcactga gatcgcggcc ctacgaccat ccatggatct atgactcttc ctgtttactc 2580 cccgcactgt gtgtgatgtt acacaggcac ttcagagaag aaaagagagc acaggatgcc 2640 gatttccctt ggcaggaccc caggggccgc acgcagcccc cacctctatc agcaggtctg 2700 agcaggactg gagctgcagg cagagcacag ctcagccctg agacacctcc atgctgcctc 2760 ctgcacagcc tcggccccac agcccccggg aaggagagca cgggtggggt gccgggagcc 2820 acgctgcgct ctgacacact gcgtgtcccc tgctcccagc gcgagctgca gggcccgtgc 2880 aggaacgagc tgggccccaa cgtgaccctc ggccccggtc actgctgaac gacagcgttc 2940 agctctccag gctgcaaaga gcgagccgtg aaatggagca acacgcggga ttcccgggtg 3000 tgaattccta aacggattcg aaggtgccca acaggcagcc actgcgtccg cagctgtgct 3060 tcggtacctg gagacccgcg agcccgtctg ttcccaccag cctccagcag ccggtgctcg 3120 cggatcaaaa gaccgccgtg aaggccgcag ggccgtccct gggacggagc gccgcccgct 3180 tccgccgcca gccgcggctc cgccctcccc gccgagctga cgctggcago gcgcagagcg 3240 cggagoggag ccgcggcgct ttccggcggc agcgcccgca cggggctcgc cgagggccgc 3300 gcagagcgct gtgcccggcg ggccgcgtcg ccgctccggc ggcaccgcga ttccggcacg 3360 gagcgcaacg agcgcccgct gcccggctgc aggacgcggt cggggccaca ccgcggcggg 3420 gccgcagcct gccttccgcg ggaccgcacg tccggcctcc ccgaatttgg ccccgcagcc 3480 cccgggctgt caccgtgctg tcaccgtgcc gttcacggtt tacgggctgg ttcggcccgg 3540 ttcggcccgg ttccgtgact ggcgggacag agggattogt ggatccgcgc ctccgggaag 3600 ggaaacggga ccccgaataa ttaaaaacag cggccacgat ctgaggggtt acaaatgtac 3660 taaaacgtac taaaaacaaa cagctgctta acacctccta ttccaaaggc ccatcgacac 3720 cccttggcac cctcaaagta tccccttctg aggtaatggg taccaagaat gcacggagcc 3780 cctgggccag tcacagcagg gtgcttttgc cagtctgtac cggtgaggcc tatttcggcc 3840 acaaacacag tcaattcttg ggaaccccca ttcaccccat gaatataagt tgattctgtc 3900 ccttggtgac tcgagggcgt gacagtgcac tgtgcaccag ggtccaccag ggcctcgtat 3960 tcctgaggtt ctgatgtgcc acaccacgaa cccacacggt tcaatacact ccatcatcct 4020 ttccccccat ggtgggggca gggtccctct atttgttacc tctgtcgttc ttagagcggt 4080 toccatgtcc tgcagcaatg ggagcgatca cctctttggg gattaatctt ggtggttaat 4140 ctgccttgta attattttac ctgtgcttga aaatgcccct ccaggtgaaa gcaaactgca 4200 gcctgcattc tgtggccaaa ggaatggaaa agaaggcgtt agcaatgcca gtggtggcat 4260 accacttggc ttcttttgac tccagttcat actggagttc taacatgtcc agaacagcag 4320 cgctcagtgggggtgtgact tcattctggc catggtagtc tactgtcagc ctccattctg 4380 US 2019 /0029236 A1 Jan . 31, 2019 33

- continued cactggcttt atgcactgga gcacagggct tatggggagc ggcggaggga gctgggatgg 4440 ttcagtctgc agatgaggag gctcagggga gaccttattg ctctctgtaa ctccatgaag 4500 ggaggttgta gtgagctggg ggtcggtctc ttctctcatg tgactagtgg taggactaga 4560 gggaatggcc tccagttgca gcaggggaga ttcaggctgg atgttaggaa atgggctgga 4620 gtgggctgcc cggggaggtg gtggagtcac cgaccctgga ggtgctcaag gaatgtttag 4680 acaccgtgtt tagggacatg gtatagtgag aactgttggt gatgggtgga cagttgggct 4740 ggatgatott gtaggtcttt ttaaagcttg gtgattcttt gattcgataa gtgcaaagtg 4800 ttgcatttgg gtcagagcaa tctcacgggt gtgcacaggc tgggagaaga actcctggga 4860 gaagaagaga gcagccctgc agagaaggac ttgacatgaa agacttaacg tcagccagac 4920 tccctctgct ctgccctcat gagcctctcc tactctgtaa aggtttgggc ccccagcaca 4980

< 210 > SEQ ID NO 16 < 211 > LENGTH : 4980 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223NNAP > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 16 aggagtggct tctgaggctg gaaacaaggt gctcccctct tgtcaaacag ccaattccat 60 ctagctccaa cccatcctcc actggccaaa gotgagccca tcgctgatgg tgatagcatc 120 tgtaatagca tctcagaaag gctaaaagca ctgcgcagca gctgagagaa aagagtgagg 180 gaaaatggga cagaaacagc tctgcagccctcagaggcaa tgcagaggag aggcaggagg 240 tgctccaggc atggagcatt agtttcttgc agtccaggag ttacaggtga tggtgcaggc 300 tctgtgcagc ccagtgatga ctgtttcagg atccatgctg cagcctgtgc cagagccagg 360 ggataggett ggctgcttag tgcaggacgt ggagagccca tgctgagtgc aagctcccaa 420 aaggctagga cagaacaggt gtagtggagt agatcttgta ctgtggagca gtcttttcct 480 ggaggactaa cctgtgaaga ggaggactgc gctgaagcgg ttcatgaaga atgaaacctt 540 gtgggaggga ccccacactg aaaaaggaga aaaccacgat gaggaaggag cagcagagag 600 ctccccagcc ctgtgtgcac toccaggaga gaaggaagta gaaaacgtgg gaatgtgcag 660 gtgtaaagct gagtctggga aaaaggtggg ggtggaataa aggtattttt agtcctatac 720 ctttctcatc aacctacttt aattgtagat tggccataaa ttaaatgttt tccccaggtc 780 aagtctgttt cttgcttgtg atggtggatg atctccctgt cctcatccca atcctgaagc 840 tatttcatca tatattctct ccctgccctg tttcaggaca gggagtgcaa gcagtttggc 900 agccagacga ggttaaccca gcaccagagg tttagtcaca tgcaagtgag agctattgcc 960 tcaacttaaa tgggagaaaa cattttagca ggttgagtct caccttgttt atccagatta 1020 tacagccatg ccagcacatg ggctgcatgc agcctggccc aacccatcct ctagccaccc 1080 cctgccccat actgaaaatg cagcggctct gccctgccaa gctgccaagc ctggctccag 1140 gcactcaccc attgcttaca aacaacaaaa cgtcagcgtg tgagcgcgcc ctgtgagctg 1200 caactggcat ggggagggca cagtcagcac aaatacatga cctgcaaatt ttcacatgga 1260 atgtatggag ttgcaatcag atactcagct caaaaaattt aatcatggct ccttacctgt 1320 ctttttttta acctttctct tagctcagag aggtatacct cacttcacaa tcatgccgta 1380 US 2019 /0029236 A1 Jan . 31, 2019 34

- continued ttcatgtcat tgctttctgg cagtacgtac gtttgtgaac agctgttttc aagggtgatg 1440 cacaggaaga gtaaaatttc attaaaaaat ctccaaggag cacatggaga gctcactcag 1500 aagcctcacc gctgccactg aacaagactg atgcattagt ttcatgaaat caaggctatg 1560 tgtcccactg gtttcattat tttgttactc tttctttaaa acaaaaaaat tgttttattg 1620 cttatataca tcaactatgt tgttatatat tttccaaagg ccgctccaaa agtaatgcct 1680 cctgtttcat totgttggcc caccgtgtca gaggcagatg gtggtacggc agtagagatg 1740 gaaccttccc accaatattc cattacatgt toccatgtga tagacagcag cagatgggca 1800 ctctgacaga atggtatctg acatggaagc gtggatggag caaagttgtg tcactgaatt 1860 cctccataag gaaatgagca cccactaaca ttcactgatg cttgctgaac atttctggag 1920 accaaacagt ggatgtgagc acagtgaggt ggtgggtggt gcatttcagc agtggtgaca 1980 atgacgttgg gtcacctctg ctggtgcagg ttttgatgag tgcagcctgt gaggtcttgt 2040 tcatcaatgg agaaaatgca caactaatgg tggtgactgc tgaaaaatag tgttttgtag 2100 ctgagaattt tctctgtcaa acagtgctaa ttgtgctctt tgtatctgtt gtagtttcca 2160 tgggaataaa taggaggcat tacttgcaga ctgacctaca tatatgtggc cccaggcaag 2220 tcaacagctg tacgaaaagt ccatgcttcc tcattataaa cggaggaaaa aaagttgttt 2280 acagctgtaa tgggattata aaaggcaaat ggggatagta cagtggtgag aaccagatct 2340 atgaaggaaa agccctaaga aaaagagagt gcacagatac tcttaaccat ctaataactg 2400 tttcctccat cctacagctc agagttaaga cttacagagg actctagtac ttagtaagat 2460 gaatacgagc taatagtggc aaaaataatc ccagtgcctc aacactgacc tgggaaaaag 2520 gggcatgtat agaccttctg atattgtgat gctgtgtttg tacacttatt atctacattt 2580 tcagaaatta ggttaaactt cagaaaactg aagatctcca gggcttgtag cagaccctga 2640 ccaccagact ggtccccgat tatcactcac aagctctcaa accgattgtg gctgtttctc 2700 agaggcaact ctttgcgctc tagcccctct ataacatggg gcaacttccc ctgccccacc 2760 ttcccttcct gtatcttctg aaaagcttgt agccctcaat tgtcacgctc cagccatatg 2820 aatcatccca ccacgtccct gtgttcacaa ttaccttcta gtcttctaat tgcaccatgg 2880 cttccaattc ctcctgttta tcacccacgt tgcatccatt gatgtagagg cacttcagtc 2940 gggctatcag caatgttacc acctgtgagg agccctcttg agatctttta ggacaattta 3000 gaggttttcc ccactgtttc ctaaaattac agcattccct gtcccttctt agtgatatag 3060 aactccatcc ccttccacca tcaaacctag cttaagctct ggtaaatgat ccagccagtc 3120 tgottcccaa aactcttgct cagttgcatt ctatctgatg cctacatgcc caacaccttc 3180 aaggcctgtc caagatcata gaacacaaag gottgatcat gacaacatcc atgcagccaa 3240 tcattcacat gacccattcc tctcctcctt tccaggtccc aacggccaac tgagagttgt 3300 gctctgagct cttcagtgtc cttccgaggg atgtaaagtc ccttttaatg ttctgcattt 3360 tctttgtcac agccttctga gacccaactt gaatgtggag gagtggagag taatcatccc 3420 gctctgatta tcagatacat tagcctcttc ttggcacctc tggcagacag aagacttccc 3480 tggagagatt acctggatga taactggggg cctcagtgcc tcacagcage aagtccccag 3540 ttactaagac tctacacctc tttggtggcg ctagttctga tgtagttctt cagttgotta 3600 acatgottgt tgtttcccaa gatttgactgctatctgcac cctccctttc ttccagcccc 3660 US 2019 /0029236 A1 Jan . 31, 2019 35

- continued agagccttat atcatgagct gagaacattc tgtgttcaaa atacaagaca catttatgca 3720 atttogtatt ctctacccat atttttgtga tagaaattag ggctacttat ttcccatagt 3780 gatttccatg ctgcctacca ggttctaagt caggtcaccc toccagcttc ttccaaacca 3840 tgctcaggag tgcatcaaat cacacgcaga cccaaggaaa aaatgtacca aacaatatta 3900 ccacgcatge aaactcctca gtagctctgt cccatatgct acaattaggt ctgtataggc 3960 ttgttagatc ttgtctactt gattagtgtt ttccagcagg cctacaatcc aacctaaact 4020 gaacagacat taaagacatg tttcactaat acaaaacaac tccacctagt tcaacagtct 4080 gctcttttgt gtatggtacc tgaaactctt ctgttcactg aacttatccc aacatttttc 4140 ctcctaatgc atactttttc tagacgtgat gtgaaagtac agtgttatac cctggtgctg 4200 cattaatttg cataaccaca qcacacaaag cataatcata acacacaaaq qoctcctata 4260 aaaacatctg cttaaagtca taggtcactt atttattctc cctctagtta tgtaccagaa 4320 tgatgtatgt taataaataa tagattatta aatccatcaa aaattaggga agagctctag 4380 cacaaaggca aagcaaagaa gotttgaaga agtgcaagta aaatgaatta tttccaaaca 4440 actagcttct cactgtccca ctaagaacaa agactattct tatgcactgc tgtccttaaa 4500 attatcagct gctttgtgtt tatttcatgg agtaacacat gcaatatttt ttacaagaaa 4560 taagaaacca cagcagcaga agacgaatct gottttattg aacgcagaaa tagatggaca 4620 ctgaaacaac agaagtttct accatgtttt gctgctgtga gagcaaatct gctgttgato 4680 aactattagt tttgaaaagt atatgcaact ctgctatcaa ctccttcccc acatcacatc 4740 tcgtttcaag gagaaccttc ctgtccaggc aactagccag ggattttaat tttaacattt 4800 gctatctcag ataatctttt aatatttcta ggccgtgcac ataacccaca tagccctaac 4860 tccagatgtt cccagcatca cttagcagta gttccacttg aagcataaat acagcactgg 4920 cacaacaaat gaagacaatt caagcacgcc tttaacaagc atacagaaca tacagtttta 4980

< 210 > SEQ ID NO 17 < 211 > LENGTH : 4980 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 17 acaaattaaa tgtattttct cttgatacta ttttgattat aagctattaa cttgatttgt 60 aaaagcaccg atattatggt taatgtatgt atggtaactg ttgagtcaca gcctgaacct 120 ctgattgacc acctgcggaa aggtctgggt gagccctggg agcacaggca aaaacaattc 180 agttgtgcaa ctggaaggcc tctcttagac ctcatttaag ggctgactgt cactggggaa 240 ggatctgatt ctggagatcc cttattggtg aagctttccc ctgcaaacct agaatcttct 300 gatgcaagtg agcaatcttc ttcccttccc tagcagctct ctgttgcacc agtccttcca 360 tccttgcacc tttgttgtaa tgottttccc atggcattga totgtccagt tgctacagtg 420 tagaaacaag aaagtgtttt ctcaaaacat tatacatgct tactatcaga tcttacttaa 480 cattgataag aagtacacct ttcattacaa cagtgaacgg ataggcagca agcattcaga 540 acaatgaaaa agatctgcgt tctattgtaa agcaaacaaa ggtgatgacg gaacgtttat 600 ttgagataca ggcaccatag tacaagatat caaagaggaa ttaattcaac cctcccaaca 660 US 2019 /0029236 A1 Jan . 31, 2019 36

- continued acagttggga aaaaaaaagg ataagctgag gaatgcagcc ttctccgatt tttactctgg 720 tgccggaagg aggaggagga gcgggggaaa acccagcgga ctcagactgc atacgcactc 780 toggaagtac ctctgaggcg gggtgagagg aagggtggat ctaggctccc cccgctccac 840 acactcacgt gctcgtgtac tggttcaggc tgtgacttgg caactcctct acatctatco 900 atctagttag actcaacaag accatcgtga ttcaggagtc tgaagatgct taactctctc 960 agaacgtcta gttctcctgg cctggtaaat gctatgtttc toatactgcc tctctgaaga 1020 atgcttcgaa tgcttctagt gatgctctaa agttctaaac agaaaaatct ggagacagtt 1080 ctggtcttta gatagaaaaa atgccaacat gccaaaggat ggttacatcc ttcaagcaac 1140 cttgttgcat gctgtacaat agactcatgt aataacttag ccgtagtcat cgtatctctt 1200 atttacctgt togttattac attttcctgg tactgcttta tatttagtca gttgtccttt 1260 taagacaaat tttttggtgt gtgctaatag gcagttacca aatgttctag agggagggaa 1320 tataat cagt gagtatgtag atgtatatag atgtataacc agtaagtata cagagaagtt 1380 agggtggtct tttgagagca tatagctgga aagattatca catgggaaaa ggtaatcaga 1440 aataaatgga aaaatgctca ccagtgtcat aggctcacaa gaaaactccc caaggagcaa 1500 tctccagtaa cagacccttc ctcagtggca gtcagccctt aaatggcatc taggagaggt 1560 gtagccaggc accacccctt ctgtcacata ggtgaattgc cttcagctgt gctcctgcag 1620 ctgactcagt gttcacctca ggtgatcaat cagaggtcca gaccatgatt caacatttcc 1680 catgcggagg gagatgaaac aagactgtca tctcatcttc tgaagctgat aggagaatgg 1740 ttacaataag taggtcccct tocactggtt tagctctgta ttactcagtt taaaacttta 1800 tgtagttaat ggagttocat agaatcacat cgctggaaaa tgtatgtgat agctataccc 1860 aaaaagtgac acagcatcac agcctctacc aggtcctctg cctccagaca ggaccttgag 1920 ctgtgtgatc cctttgggat gtttctgttt aagacagggg acacttacac attaggaaac 1980 tggagtcatg tcggtggagg agaaagtggc tgtagaaaag gtaacggaca agaaatccct 2040 cactggotta gctgtaaagg t?agaggaaa atcatcttct gttctccata cacatctcct 2100 gtaattaggc acctgtgccc tttaaaaaag taaagtaatc aaagagtcat ttggtgaaaa 2160 tagaagccaa acagttacaa aatttagtta atattcaaag acaaaacaac tctggttcca 2220 aatataaaac cctttgtgta aacactgegg gaaggtgcca aagagccacc tacacaaaga 2280 gatgccacag agtaatttgc gtaccccaac aataggatca tatatgggca aaccaaaaga 2340 ccaacaaaga ccccttgcaa taatcccttg attggcagaa gcaagtgcag cgttagattt 2400 agtatgtgtg acaattctga gaataggaag gaatttcact gaaactgtgt gaagatttgt 2460 atgttaaata catataatga gggttattta gctctggggt gtgcatgcta tgtggagaga 2520 tccccatgtg cccagcactg caatagacta atgtcagctt tttaaaccat catttggttt 2580 gaagagttta ttatgatttt cagaaacaga attatgtatt cagtgtctgt acattcttac 2640 aagcctgctg ttctgtacac atgaaaaagc tacttatggt gcaaatcagt atagagaagc 2700 agttttgaca tacagtggtc atgactgggt gatctgctgt cagaaggtaa gacactggta 2760 tacagaattg caaacgtgag atgaagacct caagtgcaac tctgtcatca taccacttct 2820 cttgctatta tctattcagt gtttgttcta aatattcagg cagaaggett ggtttcacat 2880 caggtgttac atttaagtat tctttgccca ttttttgctg tttgtatgtg taacttcaga 2940 US 2019 /0029236 A1 Jan . 31, 2019 37

- continued ttctcacatt gactgtgtag tgtaaatttg caaatagatg taacagcttc tctttaacat 3000 cccataccaa acttttaatc actttcaatcaatqttqqaa atctgcagta cataaatttt 3060 attttgattc attattcaga gaatcagaga aataaggact tttttagagg tttatgttta 3120 ttttagaaaa tataaataaa tcttgtatac atagatttcc aactagtaaa atttttaget 3180 atcgctgtag catttctatg aggagtttta ctttttactg tctcttatga aacttagtgg 3240 aaacaaagct aggtttcata aaacgtctaa tctcatattc atctctctcc aaaatatggt 3300 gaccttcaaa acaagaacag tttgcttatg taaacatttc ttacattgta ttctattaca 3360 ttatcatatt catgaagata ctttagaatt ttgttgctgt tagttctgtt gtgactggct 3420 gottttctca gottaagagc tctgcagaag tgatgataat atatattctc tttgctgagt 3480 tacaggaatt tcctgctttc ctctactgta cgttggagcc caggagatca gatccaacta 3540 ccagaatttt atatagctct ttgtgatcag tccttcctta gttgctgtta ttcctattga 3600 tgcaaaccta tttatggtgt attaaatgaa gaagatataa tgaggacagt ctaataatca 3660 aagttttttt ctgcagccag tagtacaggt agggtgacat gccttgcata aacagatcca 3720 gatgaaaggt gtgggtgagg caataagtct tcaggccctg ggctaaggca ggacctgttt 3780 tgtttcatga gatatgccta ggcctctcta tagacagggg gagatgtcag agaattctga 3840 agcatcagca gaggctatct tggttttcag gccctgtgct aagtatgaga ggaagttgag 3900 aacagataat gtgtgcaaca aagttagcaa catgcttttt caaaacagag gaaacgatcc 3960 ataaatactg gaacagaaca acctcacaga aatcactgac tgtccctttg ctggccatgg 4020 catcctgaag gttgtgctgg tagcactcat tgggttgctg tagctgataa ggcagtgcaa 4080 ggacattggg tctgcacctg ctatgaacag gcactggggc ctccaggagc tgctggtatt 4140 agtcatgggc atcagaggtg aagaaggcac ttgtagttct cacagctctg gcactgaccg 4200 atatttctgc tgtagttaat gggattattt gcatgtagtc aacagtttac aggctgattt 4260 ggctctgctc cgcaactagc aggacagagg gacccacaga tccatgtcct ggaaggggat 4320 aagggaaaag gatagagaga tgggcctaaa acaaaacaga agcaacgatc tgaggataaa 4380 caaagtaatt tactaaataa gatagtggaa tgcatgataa cacactatag tacaacataa 4440 tgcaatgtaa ttagaactgg agctaataaa tcaaatataa agagagtgtc tgaaagccaa 4500 aggccttact ctaatgctgt gatgagatgg cacccacaaa agagacgagc cagatgattg 4560 aaagggatgt atggtggtct accaaggcct gttatctgtt tgccctgagc agaaatgata 4620 gcagaacagc aaacagtcct ctggggaatg tagtagttct tctcttctgg gacaggtagc 4680 tggacctaga gcattaactc tttaaccccc agtacactac atgatgttat gatgtggaat 4740 accaataacc aaacatcata aaaccatgac atagtcttat gtcgctgtgt tgtaactgga 4800 agctgaggat ctccactcag tatttctgct gaatgaagca gatctttcag ttgaaggaga 4860 ccaacttaat catccacttc caacccctta ctatggacag gttcaccgtt cactagatca 4920 agctgcccag ggccccatcc aacctagcct tgaatgcctc cagggatgag gcatccacca 4980

< 210 > SEO ID NO 18 < 211 > LENGTH : 4980 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : 3 > OTHER INFORMATION : Synthetic US 2019 /0029236 A1 Jan . 31, 2019 38

- continued

< 400 > SEQUENCE : 18 gaaaatctct gccactgatt gttttgcagc ttagttgtct agttattcgt gagatgttga 60 ttcaaacctt tgctcagatc aggcacagaa gcagtgctga actttgtttt tccgtagcct 120 tgctagtgtt gtaactgctg tcttagtgaa aacctgctta tttgcatccc cttcccaact 180 ttgggaaagt tgctgtctgt gattccagaa ttaggactcc ctcggttgca acatgactca 240 gattttcaga ccttggcttc agaggcacag tggtctttgg tgcagagaaa aatgaggctg 300 agaagaccag ggccatgatg agtgaggaag atgcaacaga acaagataga gaagagggaa 360 gagtttttta ggagctccac cagacatact gtagaagcag tgtagatgca cagtaccagt 420 aatgtactcc agccaaccac tcggtgaaga cccatgaaaa cotaatgagg ttcagtaagg 480 ccaagtgcag ggtgctgtac ttgggtcggg gcaatcccag gtatttatac aaactagggg 540 aagatctcct tgagagcagc cctgcagaga aggacttggg ggtcctggtg gatgagaagc 600 tggacgtgag ccagcagtgt gcacctgcag cccggaaggc caactgtgtt ctgggctgca 660 ttaaagaagg ggtgaccagc agggagaggg aggtgattgt ccccctctac tcagctcttg 720 tgaggcccca tctggagtac tgcatccagg cctggagccc ccagtacagg aaggacgtgg 780 agctcttgga gcgggtccag aggaagacca ctaagatgat cagagggctg gagcacctct 840 cctatgagga aaggttgagg gaactgtcct tgtttagctt agagaagaga aggcttcagg 900 gaaacctcag tgcagctttc cagtacttgg aaggagcaca taaacaggaa ggggaatggo 960 tgtttacgag ggtggatagt gacaggataa gggggaatgg ttttaaactg agacgggaga 1020 gttttaggtt agatattagg aggaagtttt tcacacagag ggtggtgacg cactggaaca 1080 ggttgcccaa ggaggttgtg gatgccccat ccctggaggc attcaaggcc aggctggatg 1140 tggctctggg cagcctgctc tggtggctgg caaccctcca catagcaggg gggttgaaac 1200 tgcgtgatca ttgtagtctt tttcaaccca ggccattcta tgattccatg aagactctgt 1260 aaggacocca atgccatcag ctgtccccac agcttcagta cocactgcca ccacattttt 1320 actgagatag gtagtttggt agccttcctc ccatcttgga taggggaggg ttaactgctg 1380 gcatttttgt tctttcctgc aatatgtgtt ttctgcatgc attctctttt cacccaaaat 1440 tttaatgtgg acggactttg aggatattct gcatctgccc aatatttctt acagcctcac 1500 atctactgat ttatgcacag tatcttatat ataatgtata ttatattatg tatattatge 1560 actgaatcac atctactgtg tatgcacagt aacttctcct atggtactgt aagcccagaa 1620 atcccagata tgtcactaca acgtgtctgc tatgtattgc ttctgtgaga cacagatgtg 1680 ataatcagag gctgtacaca gtagaaatgc atacatatcc tactgtgaaa tctctgaaat 1740 ctagccttaa tcttggaaca gaaatgaata tggtgacatc ttgatctgat agaattggtt 1800 gccagtagca cagctgtaat catccatgat atgaatcaaa ccaagcacag gtaaacaggt 1860 gagagaaatc atgaacaatt acatgcaaac ggaccagcta aaatgtgttt gtttgttgtt 1920 tttttttttt caggtgattc ttgattacag taagatcaga agctgctaca ttagcagacc 1980 agccactgca ctcaaggctg tgattcacag cttgcagacc tgacagcagt tctgtggaag 2040 aggcaggtcc ctgtcaacca gtttaatcaa taaatcagtc tcgtgtacac aaataatgtt 2100 atcctgcacc actgctggtg ttacactatt tcacccaagt ttatcaccag caaactgagt 2160 cttatcgttc ctactgtgct ttgcttttct tgcttagcaa aacatatcag aaaggttttc 2220 US 2019 /0029236 A1 Jan . 31, 2019 39

- continued agttaaaaaa aaaaaaaaaa aaaaaggatt atactgcagc catcaaagag ttctgttaaa 2280 gaagttgtgg ttcatattct tttcaagttc tgaagacaat ?tgacaatag aggagatgag 2340 ggtttagtgg aggtaaatgg agctgtttct gaaagtaggg caccgtcgtg aggtaatctc 2400 accactagat gttgctgtaa gcatgatgag gggagaagct ggagcacaaa aggtgtaaac 2460 ccaatggttg atcatgcgca ctcggacaga ggaaatcttc aaaatgggaa agttagettt 2520 gaactgattt ggtgggttcc cattaaaaat gggggactta ctgccttatt gtctttatgt 2580 acccatttgg gggatagatg ccatacagaa acaccagagc ttacggtgtg aattcattgc 2640 acatcttatt agatcaacaa aatggaataa aagaatacag aagattacta ctccattggg 2700 catgtggacg ttttacaggc ctggataaat tagatcttaa aaacaaacaa acaaacaaac 2760 aaaaaaactc cttgcaaaga taatgttatg taatattagt tgcaagaagt aagcaaacac 2820 acagaactgg gagcagaagc aaagcactaa gttattaaag caagttgcac attttgagtt 2880 gcattttgcc actggtttta taaacatgtt tagcatgtct ggtcagaatt tgggcaccag 2940 gatgctttta agatgtctgt ctatggaacc tgtcagtgct caagaataac ttctgttatt 3000 tggatgctgc accaaagaat tcagaggaag acgagccaag ccagacgtta tcatagtcac 3060 tagtaaagtg gttctaagcc taattaagac atgtcagaac tatgtgttgt gcaaccaaat 3120 cctccaaaag agaaatcaga ggtgaacttg tgcaataaat atagaagaca cgtaaatcct 3180 gaggcagtta gctaaccata tgaagccaat catacctgac tgctggacgc aggagactga 3240 accttacaga ccctggagaa tcactgtttg gcctagttag gcctgaatgg aatttaccaa 3300 gattcatgac tttaacatgg atcaggtgca aagaaaagaa ggctcagtta gttcctacag 3360 gctaccagat ctttttccac ctctgctcag cctggagctg tgggctctac ctgcccctga 3420 agtgaagtgg catcaactgc aacacttttt gcagaggcaa aaatcatcaa gtcgtgcctc 3480 tgcattttaa ggtgatggat tocaagagat agattccaaa cccaacactg agattcctct 3540 ggtgatgcag atgactgett actgggatcc ttctctctct atagcctaat cccatgcago 3600 accaaaagtt gggcacctga atactatcta tcttcctcca tctgacctct gctgctggct 3660 catcacgcat ggctcctgag cctgacagag ccatggggaa agacatggcc tgaccttttc 3720 agacagcacg acttcctcca gtgtgctgca ctaacgacaa tattaaaaat aacactgcag 3780 gaaaacatgc tgttttctag caggctggag gaaaaaaaag gtgttcaagg tgagactcta 3840 taagatcact ctttccaaac acagcagtta actcttttct cacttgaagc tgaaattcat 3900 cttcagtagg tgacggttac aagcagctct ccaccggtaa gtgaaagttt gctgggtttt 3960 tttcaggcac ttcaagacac gaaggtaatt gctgcaacac cttcctagct cttcctgagt 4020 actcagccca aagctacact cttcagggct actctcctag cacggctctc tgtaattagc 4080 ctggctttct aacttatgaa ttaacgctgc agctactcaa cagggcagct ttgcagctat 4140 gaactttatg catacacttt ttattctggg tggtacaaat tcattgctaa gaaatcttat 4200 aaactctatg gaacactttt aaaagcctac atgtgattaa aaacaaaaaa acaaaaaaca 4260 ctgatatcac atgctatatt ctctagaaaa gagtattttg gaaacaattg taattcacag 4320 ctcaggagaa agagcaattg ttttcctttg tgctggagct ggaattctat gcagtataaa 4380 tacagatgtc caaacaaact cattaaatgg tagtcatagc aaatggagga aaaaaaaagg 4440 gggggggggg gggaactgaa gacactgaag aaattctgct gaaattcatg gagctgcaac 4500 US 2019 /0029236 A1 Jan . 31, 2019 40

- continued aagaattgat attgattact tcaccatatt ccgctctaat taactagcac aacactgact 4560 gttgtgaaaa caagcatgtg atttgaccca ataagtgttt cttttagtaa ccaaaaccaa 4620 acaacaacaa accttctggc tgaccagatg gaggataaat tctaacctga tcattctgac 4680 acaaatgagg aattatgtag gttggaactg cattccaaag caaagcatgt ttttggetta 4740 gttgaacaca cagaattcat ttttcttgct gattcttgta actaagggca ggtatgaatt 4800 ggttccctta aaagaagtcc ccagaagcca tggtcctcaa caagtcttct cagattagca 4860 aggatgaacg actgagaaat caaaacccaa attcagatct aagagccttc aacagatttg 4920 ctaaatgaaa ctagcaaata ctgtagaagt taacttgatt ttgaaataaa acaggatttc 4980

< 210 > SEQ ID NO 19 < 211 > LENGTH : 4980 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 19 aaaggagttt cttgcctgaa accccttaag attttgtgta ttgttgttgc cctggtttca 60 gctgggacag gactgatatc cttcacagta tctggtatga tgctgtgttt tggttttagg 120 agaaaaccag tgctgatggc acaccgaggt tgtagttgcg actgagcagt gctgcacaga 180 gccaaggatg tttcagctgc ccacactggc cttcctctaa gggggtgtga gggcacatgg 240 agctggaggg aaccaaaggg gtattccaca ccatatgtca ctgagcaaag acattgctgc 300 ccaggcagag aatacagtgg tagaaatacg tcacataggt goccatctac cccagaactg 360 ggccagcgaa gaacatcaga acaacaagca tgcgaatcag gctgctcaga ttgatgtggc 420 tcaggtagat ctcaactgtc aactgtcacc cataaaatgg atgagacagg agcaaggcct 480 gcctgtccaa actgaccttg gggccccggg cacagctgct cccgagcaag gagaggcaga 540 gaattgtgga ggaaaccctc ttccacctag ctccaagggt gcacgctcaa tgcttggatg 600 aagattcaag ttctcaatga agaactgcat tcaaagacat ctttggaggt gacccagact 660 gcctctggga tgaatccaga acaaacagaa tcttcccagc aacacctttg tttatcatac 720 acgttcagaa atgcagtgcc tgcctggtat ttttttaaac tcatcacaga ggaatctctg 780 agtggagcag aggagtgttt cctcttgctt ttttcttccc cctttctgta agaaatgcat 840 atgccagttt ccccctaaat gttttcaaac tccaaattgt ttcctgctgg tgacattctc 900 ctctccagca ctgcctacac cccagctgcg tctgatagga aaagcaccca gtaccatgct 960 ggcatggcat ggtcagtgac acccactggt tagcatgggg acaaactgcc agagcagagg 1020 gctgctgaaa cgccgagtgc caactgacac tgttcagctg acagcctcac gagagtgctg 1080 cgagggttaa gtgaggcaac aaaatacaag tactcaaaaa tagaatggaa tggaatggaa 1140 taacagaggg aatggggaac aggctgcagt gagaaggaaa cccccgtgca ccgaccaacc 1200 cgctcccagt agcctggtcc ctaccttgcc ccactccagc agctccacga ggtactcgaa 1260 gtgcccatgt ccggccatcc ccagcatggc acagctgtca cctgggagca gcgggggtcc 1320 ggcaggcatc gccggcaccc acagcctggg ctgggctgag gatgggcttg gtgggcagct 1380 gggtgctgcc gtggcagctg agtgccgtcg tgcaggtggg ctcggtgctc tctgcagccc 1440 acggctcggg acccgtggtg ggcatactgc tgggcaaggg gacggctcgg atgtgcatcc 1500 US 2019 /0029236 A1 Jan . 31, 2019

- continued cagagcaggg tgcatgatgt gtgcgcagcg gcacacagca gcgcacttgt ccccgaggca 1560 ccacccggtc tgatgaaatt ccaggttttg tttaagatga aaatgcatgt gggcatacat 1620 ttgcacatga gaacacctgc taatgaaaca cacagagttg tatgtgcagt ctccctggct 1680 ggtggcatgt ctgtgggggc agttaggcag gaagaaaagc tccaccatct gtttctgtgt 1740 cccgggottg gtgctgccac tagagatggg atgcacacag catgcctgcg tgctgccgag 1800 gcagctcagt acctgctgct gggggagagc agccctcagg gagctgctgc aaagaccccg 1860 tgggatggct ggtgaacagt gctggagaca tggcagatgt cgcacccctg ctccacacca 1920 ccctccgctg cagctgcctg cacgatgcca tttcagcgtg ccacggcttg tttcttcctc 1980 ttgcagtctc aggttgccgc agcagcagct gcctgaggtc tggtggcaaa gggcagagca 2040 cccagcccac tgctctccat gagtgagcgg gtagggggca cgccgtgctt cgcttctggt 2100 atcgggtggc ctgtggagca catcacccct ggacagtgaa aacatgtcaa agggtgtttt 2160 ataacagtat agcatatccc tttgaggctg aatttcctga gottatggat atggtagtaa 2220 tgctatacca ggctctctct gcaggttgct cactgaaaca atataccctt tctttctcaa 2280 gaaatgggac tcatgaatag ctaccaggcc tttctgctac tagatactgt agaattacat 2340 atatcagatg gotcattaat cacatagctt gttattggga cagaggcagg ttttcagcat 2400 ttcccacact gottttctgc aaatggatta ggagtaaaga gtcagataca caggggacca 2460 tcactcactt cctaggccat gcttogtagt ttaactccat gcaaggtatt ttcttgctct 2520 gatctaactc tagatcacta aatggcactt gtgcaggaca cttttccact gtcattttgg 2580 ggggtagaag tgtggt caga gccagggagg cttgcagggc ccacaccagc tgtggcccaa 2640 gcagctgctg tacaatggct gtatggcagt atcgatgtga acttcctgat aataaacaga 2700 actcagcagc aaataaaccc agattgttct gatcagtaac gagaggctgt gcaaaaagct 2760 gagaaatgta cagcccttcc tgctcaccac tacagccctt catgcagcgg cctgctgcac 2820 tagggcctgc ttggccagag gcagggctgc agcttgagat acgcagcacc cagtacccca 2880 gcaggctgcc atgtgcttct gtcaggccat gaattgcaca agttggtata gttttataca 2940 gtgtcatgca gaagcacaac tcttaccttg gcacactgat atggaaagca aagtgtaaag 3000 gaactgtatg tttcttggct tgtgagttcc attggttctc ccaggacagc agtgacagct 3060 ctagattttc tggttgatct cttccatcta agtttttact tctgaataca tctgtgcago 3120 aaagcctgat gotttttttt ttccccctcc cctgggatog tgaaatatta ttttcccato 3180 tccataatac agatgatcca ctcaaacatg catcctcagt cgcagtcctc agaagggcct 3240 tttcccacca tacacctaca cgctacacca gactttattg gtcaccatgc cttgagggat 3300 tctgcctaac acaggcacac aggaagggct gataccagta attcattgct gaggagagaa 3360 ggggcacttc ttttatagta gagccacaga atcaccagga ttggaaaaca cctccaagat 3420 catccaatcc aaccacccac ctaccaccag tatttcccac taaaccatgc cccttggtac 3480 cacatctaaa agcatcttct gcaccttcac agcttcattg cctttctcag gacgtgctcc 3540 agggccttgg tgtctttctt gtattgagtg gcccaaaatt gaacacaata ctcgaggtgc 3600 agcttcacca aagctgagtg cagaggggtg atcacctcta ctaggccttg ttttacccct 3660 tccccctgca tacctagttt aaagcccttt cagcgagccc taccagctcc tgggctagga 3720 tccatttccc cctttaagag aggtgaaacc cacccgcagg catcaggcca ggcactgagt 3780 US 2019 /0029236 A1 Jan . 31, 2019

- continued taaactgctc catcagctaa ccaccccaat gccctgatgt cccttctgat agtcctcagg 3840 cttctctcag cgacttcatc actgccagcc tgagctatcc gtaatggata acaaccagag 3900 ggctgaacca gactagggag tctcctggta atgtccctaa gtaatgaatt catgggggaa 3960 atggatctgt gcagatgcac tgccatctca cagggctcaa ctgtcacaga cagttgtcac 4020 aaaccagagc agcagagaga gcagcaaagg agatatcata aatagtggaa aagggtgcca 4080 gtgtttgtta ttgactgctt cactgtgtgt ttggaaatca caaagaaaac aacaaaaaaa 4140 ccccacagaa tacacatttc caagcatgca tgcttcaggt aaggactgcg gcccgcttta 4200 attcccctgg aagcgtccag aggcctacac acaaatcagg ccacaacaaa caggttccgt 4260 gcaagcagtt tgtgagttgt atgaaaatag ctttcttcca taaagcgtgg cattgatggg 4320 aactgttact agcagatgaa aatctgccat gcacgacacc cttaatggtt ggagtggttc 4380 gactgagttt tgcattcctc attctgatgg atgctggcaa aaccaagatc acccaacacg 4440 taacactgaa tatagctcac caacagcaac gagccacacc agatactgag gcatctccaa 4500 ggctacgtct ggtggaaaga agagacagtc tcaccctgca gtgcaaaagc atcagggctt 4560 ctgcgtaagg tttattgatc ccaaagatag gcaagttaat attcatcagt ttaatagaca 4620 ggtactcaca ttactggaga tggcatgcca ggagagcctc toccaagtgc tcactgccag 4680 tggcagccgg ccagtgcaca gcttcttggt gctgtggcca tctatataac agaaggaagc 4740 aattaagcat cacctatcaa gataagcaag atcattcaaa gagaataagg gtacttggtt 4800 agagctgcag agcacttcct cacgaatgag tttcttccag ctacatgcag atgttacagg 4860 cagtttgctt gtgttctagg gataacacaa acccctcctc atgggctagc tgcctgctca 4920 ggctgtggtc tgtatttttg cacgtgcact gctagccttt acttcacatt tccctttact 4980

< 210 > SEQ ID NO 20 < 211 > LENGTH : 1653 < 212 > TYPE : DNA 13 > ORGANISM : Photinus pyralis < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : luciferase gene ( cds ) GenBank : M15077 . 1 < 400 > SEQUENCE : 20 atggaagacg ccaaaaacat aaagaaaggc ccggcgccat tctatcctct agaggatgga 60 accgctggag agcaactgca taaggctatg aagagatacg ccctggttcc tggaacaatt 120 gcttttacag atgcacatat cgaggtgaac atcacgtacg cggaatactt cgaaatgtcc 180 gttcggttgg cagaagctat gaaacgatat gggctgaata caaatcacag aatcgtcgta 240 tgcagtgaaa actctcttca attctttatg ccggtgttgg gcgcgttatt tatcggagtt 300 gcagttgcgc ccgcgaacga catttataat gaacgtgaat tgctcaacag tatgaacatt 360 tcgcagccta ccgtagtgtt tgtttccaaa aaggggttgc aaaaaatttt gaacgtgcaa 420 aaaaaattac caataatcca gaaaattatt atcatggatt ctaaaacgga ttaccaggga 480 tttcagtcga tgtacacgtt cgtcacatct catctacctc ccggttttaa tgaatacgat 540 tttgtaccag agtcctttga tcgtgacaaa acaattgcac tgataatgaa ttcctctgga 600 tctactgggt tacctaaggg tgtggccctt ccgcatagaa ctgcctgcgt cagattctcg 660 catgccagag atcctatttt tggcaatcaa atcattccgg atactgcgat tttaagtgtt 720 US 2019 /0029236 A1 Jan . 31, 2019 43

- continued gttccattcc atcacggttt tggaatgttt actacactcg gatatttgat atgtggattt 780 cgagtcgtct taatgtatag atttgaagaa gagctgtttt tacgatccct tcaggattac 840 aaaattcaaa gtgcgttgct agtaccaacc ctattttcat tcttcgccaa aagcactctg 900 attgacaaat acgatttatc taatttacac gaaattgctt ctgggggcgc acctctttcg 960 aaagaagtcg gggaagcggt tgcaaaacgc ttccatcttc cagggatacg acaaggatat 1020 gggctcactg agactacatc agctattctg attacacccg agggggatga taaaccgggc 1080 gcggtcggta aagttgttcc attttttgaa gcgaaggttg tggatctgga taccgggaaa 1140 acgctgggcg ttaatcagag aggcgaatta tgtgtcagag gacctatgat tatgtccggt 1200 tatgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg getacattct 1260 ggagacatag cttactggga cgaagacgaa cacttcttca tagttgaccg cttgaagtct 1320 ttaattaaat acaaaggata tcaggtggcc cccgctgaat tggaatcgat attgttacaa 1380 caccccaaca tcttcgacgc gggcgtggca ggtcttcccg acgatgacgc cggtgaactt 1440 cccgccgccg ttgttgtttt ggagcacgga aagacgatga cggaaaaaga gatcgtggat 1500 tacgtcgcca gtcaagtaac aaccgcgaaa aagttgcgcg gaggagttgt gtttgtggac 1560 gaagtaccga aaggtcttac cggaaaactc gacgcaagaa aaatcagaga gatcctcata 1620 aaggccaaga agggcggaaa gtccaaattg taa 1653

< 210 > SEQ ID NO 21 < 211 > LENGTH : 550 < 212 > TYPE : PRT < 213H > ORGANISM : Photinus pyralis < 220 > FEATURE : < 221NMOM > NAME / KEY : misc feature < 223 > OTHER INFORMATION : luciferase protein GenBank : AAA29795 . 1 < 400 > SEQUENCE : 21 Met Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro

Leu Glu Asp Gly Thr Ala Gly Glu Gin Leu His Lys Ala Met Lys Arg 30 Tyr Ala Leu Val Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile Glu

Val Asn Ile Thr Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg Leu Ala

Glu Ala Met Lys Arg Tyr Gly Leu Asn Thr Asn His Arg Ile Val Val 65 Cys Ser Glu Asn Ser Leu Gin Phe Phe Met Pro Val Leu Gly Ala Leu

Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg 110

Glu Leu Leu Asn Ser Met Asn Ile Ser Gin Pro Thr Val Val Phe Val

Ser Lys Lys Gly Leu Gin Lys Ile Leu Asn Val Gin Lys Lys Leu Pro

Ile Ile Gin Lys Ile Ile Ile Met Asp Ser Lys Thr Asp Tyr Gin Gly 145 Phe Gln Ser Met Tyr Thr Phe Val Thr ser His Leu Pro Pro Gly Phe US 2019 /0029236 A1 Jan . 31, 2019 44

- continued Asn Glu Tyr Asp Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile 190 Ala Leu Ile Met Asn Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val 195 Ala Leu Pro His Arg Thr Ala Cys Val Arg Phe Ser His Ala Arg Asp 215

Pro Ile Phe Gly Asn Gin Ile Ile Pro Asp Thr Ala Ile Leu Ser Val 225 230 Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr Leu 255 Ile Cys Gly Phe Arg Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu 270 Phe Leu Arq Ser Leu Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val 275 Pro Thr Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr 295 Asp Leu Ser Asn Leu His Glu Ile Ala Ser Gly Gly Ala Pro Leu Ser 305 310 Lys Glu Val Gly Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile 335 Arg Gin Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu Ile Thr 350 Pro Glu Gly Asp Asp Lys Pro Gly Ala Val Gly Lys Val Val Pro Phe 355 Phe Glu Ala Lys Val Val Asp Leu Asp Thr Gly Lys Thr Leu Gly Val 375 Asn Gin Arg Gly Glu Leu Cys Val Arg Gly Pro Met Ile Met Ser Gly 385 390 Tyr Val Asn Asn Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly 415 Trp Leu His Ser Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe 430 Phe Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gin 435

Val Ala Pro Ala Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile 455 Phe Asp Ala Gly Val Ala Gly Leu Pro Asp Asp Asp Ala Gly Glu Leu 465 470 Pro Ala Ala Val Val Val Leu Glu His Gly Lys Thr Met Thr Glu Lys 495 Glu Ile Val Asp Tyr Val Ala Ser Gin Val Thr Thr Ala Lys Lys Leu 510 Arg Gly Gly Val Val Phe Val Asp Glu Val Pro Lys Gly Leu Thr Gly 515 Lys Leu Asp Ala Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys 535 540 Gly Gly Lys Ser Lys Leu 545 550

< 210 > SEQ ID NO 22 < 211 > LENGTH : 558 < 212 > TYPE : DNA US 2019 /0029236 A1 Jan . 31, 2019 45

- continued < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 220 > FEATURE : < 221 > NAME /KEY : misc _ feature < 223 > OTHER INFORMATION : Gaussia princeps luciferase GenBank : AY015993 . 1 < 400 > SEQUENCE : 22 atgggagtga aagttctttt tgcccttatt tgtattgctg tggccgaggc caaaccaact 60 gaaaacaatg aagatttcaa cattgtagct gtagctagca actttgctac aacggatctc 120 gatgctgacc gtggtaaatt gcccggaaaa aaattaccac ttgaggtact caaagaaatg 180 gaagccaatg ctaggaaagc tggctgcact aggggatgtc tgatatgcct gtcacacatc 240 aagtgtacac ccaaaatgaa gaagtttatc ccaggaagat gocacaccta tgaaggagac 300 aaagaaagtg cacagggagg aataggagag gctattgttg acattcctga aattcctggg 360 tttaaggatt tggaacccat ggaacaattc attgcacaag ttgacctatg tgtagactgc 420 acaactggat gcctcaaagg tcttgccaat gtgcaatgtt ctgatttact caagaaatgg 480 ctgccacaaa gatgtgcaac ttttgctago aaaattcaag gccaagtgga caaaataaag 540 ggtgccggtg gtgattaa 558

< 210 > SEQ ID NO 23 < 211 > LENGTH : 185 < 212 > TYPE : PRT < 213 > ORGANISM : Gaussia princeps < 220N > FEATURE : < 221 > NAME / KEY : misc _ feature < 223N > OTHER INFORMATION : luciferase GenBank : AAG54095 . 1 < 400 > SEQUENCE : 23 Met Gly Val Lys Val Leu Phe Ala Leu Ile Cys Ile Ala Val Ala Glu

Ala Lys Pro Thr Glu Asn Asn Glu Asp Phe Asn Ile Val Ala Val Ala

Ser Asn Phe Ala Thr Thr Asp Leu Asp Ala Asp Arg Gly Lys Leu Pro 35 40 Gly Lys Lys Leu Pro Leu Glu Val Leu Lys Glu Met Glu Ala Asn Ala Arg Lys Ala Gly Cys Thr Arg Gly Cys Leu Ile Cys Leu Ser His Ile 65 70 Lys Cys Thr Pro Lys Met Lys Lys Phe Ile Pro Gly Arg Cys His Thr Tyr Glu Gly Asp Lys Glu Ser Ala Gin Gly Gly Ile Gly Glu Ala Ile

Val Asp Ile Pro Glu Ile Pro Gly Phe Lys Asp Leu Glu Pro Met Glu 115 120 Gin Phe Ile Ala Gin Val Asp Leu Cys Val Asp Cys Thr Thr Gly Cys

Leu Lys Gly Leu Ala Asn Val Gin Cys Ser Asp Leu Leu Lys Lys Trp 145 150 Leu Pro Gin Arg Cys Ala Thr Phe Ala Ser Lys Ile Gin Gly Gin Val 175 Asp Lys Ile Lys Gly Ala Gly Gly Asp US 2019 /0029236 A1 Jan . 31, 2019 46

- continued

< 210 > SEQ ID NO 24 < 211 > LENGTH : 4107 < 212 > TYPE : DNA < 213 > ORGANISM : Streptococcus pyogenes < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : M1 GAS Cas9 protein id : AAK33936 . 1 < 400 > SEQUENCE : 24 atggataaga aatactcaat aggettagat atcggcacaa atagcgtcgg atgggcggtg 60 atcactgatg aatataaggt tccgtctaaa aagttcaagg ttctgggaaa tacagaccgc 120 cacagtatca aaaaaaatct tataggggct cttttatttg acagtggaga gacagcggaa 180 gcgactcgtc tcaaacggac agctcgtaga aggtatacac gtcggaagaa togtatttgt 240 tatctacagg agattttttc aaatgagatg gcgaaagtag atgatagttt ctttcatcgaatcga 300 cttgaagagt cttttttggt ggaagaagac aagaagcatg aacgtcatcc tatttttgga 360 aatatagtag atgaagttgc ttatcatgag aaatatccaa ctatctatca tctgegaaaa 420 aaattggtag attctactga taaagcggat ttgcgcttaa tctatttggc cttagcgcat 480 atgattaagt ttcgtggtca ttttttgatt gagggagatt taaatcctga taatagtgat 540 gtggacaaac tatttatcca gttggtacaa acctacaatc aattatttga agaaaaccct 600 attaacgcaa gtggagtaga tgctaaagcg attctttctg cacgattgag taaatcaaga 660 cgattagaaa atctcattgc tcagctcccc ggtgagaaga aaaatggctt atttgggaat 720 ctcattgott tgtcattggg tttgacccct aattttaaat caaattttga tttggcagaa 780 gatgctaaat tacagctttc aaaagatact tacgatgatg atttagataa tttattggcg 840 caaattggag atcaatatge tgatttgttt ttggcagcta agaatttatc agatgctatt 900 ttactttcag atatcctaag agtaaatact gaaataacta aggctcccct atcagcttca 960 atgattaaac gctacgatga acatcatcaa gacttgactc ttttaaaagc tttagttega 1020 caacaacttc cagaaaagta taaagaaatc ttttttgatcaatcaaaaaa cggatatgca 1080 ggttatattg atgggggagc tagccaagaa gaattttata aatttatcaa accaatttta 1140 gaaaaaatgg atggtactga ggaattattg gtgaaactaa atcgtgaaga tttgctgcgc 1200 aagcaacgga cctttgacaa cggctctatt ccccatcaaa ttcacttggg tgagctgcat 1260 gctattttga gaagacaaga agacttttat ccatttttaa aagacaatcg tgagaagatt 1320 gaaaaaatct tgacttttcg aattccttat tatgttggtc cattggcgcg tggcaatagt 1380 cgttttgcat ggatgactcg gaagtctgaa gaaacaatta ccccatggaa ttttgaagaa 1440 gttgtcgata aaggtgcttc agctcaatca tttattgaac gcatgacaaa ctttgataaa 1500 aatcttccaa atgaaaaagt actaccaaaa catagtttgc tttatgagta ttttacggtt 1560 tataacgaat tgacaaaggt caaatatgtt actgaaggaa tgcgaaaacc agcatttctt 1620 tcaggtgaac agaagaaagc cattgttgat ttactcttca aaacaaatcg aaaagtaacc 1680 gttaagcaat taaaagaaga ttatttcaaa aaaatagaat gttttgatag tgttgaaatt 1740 tcaggagttg aagatagatt taatgcttca ttaggtacct accatgattt gctaaaaatt 1800 attaaagata aagatttttt ggataatgaa gaaaatgaag atatcttaga ggatattgtt 1860 ttaacattga cottatttga agatagggag atgattgagg aaagacttaa aacatatgct 1920 cacctctttg atgataaggt gatgaaacag cttaaacgtc gccgttatac tggttgggga 1980 US 2019 /0029236 A1 Jan . 31, 2019 47

- continued cgtttgtctc gaaaattgat taatggtatt agggataagc aatctggcaa aacaatatta 2040 gattttttga aatcagatgg ttttgccaat cgcaatttta tgcagctgat ccatgatgat 2100 agtttgacat ttaaagaaga cattcaaaaa gcacaagtgt ctggacaagg cgatagttta 2160 catgaacata ttgcaaattt agctggtagc cctgctatta aaaaaggtat tttacagact 2220 gtaaaagttg ttgatgaatt ggtcaaagta atggggcggc ataagccaga aaatatcgtt 2280 attgaaatgg cacgtgaaaa tcagacaact caaaagggcc agaaaaattc gcgagagcgt 2340 atgaaacgaa tcgaagaagg tatcaaagaa ttaggaagtc agattcttaa agagcatcct 2400 qttqaaaata ctcaattqca aaatqaaaaq ctctatctct attatctcca aaatqqaaqa 2460 gacatgtatg tggaccaaga attagatatt aatcgtttaa gtgattatga tgtcgatcac 2520 attgttccac aaagtttcct taaagacgat tcaatagaca ataaggtctt aacgcgttct 2580 gataaaaatc gtggtaaatc ggataacgtt ccaagtgaag aagtagtcaa aaagatgaaa 2640 aactattgga gacaacttct aaacgccaag ttaatcactcaacgtaagtt tgataattta 2700 acgaaagctg aacgtggagg tttgagtgaa cttgataaag ctggttttat caaacgccaa 2760 ttggttgaaa ctcgccaaat cactaagcat gtggcacaaa ttttggatag tcgcatgaat acta aatacg atgaaaatga taaacttatt cgagaggtta aagtgattac cttaaaatet 2880 aaattagttt ctgacttccg aaaagatttc caattctata aagtacgtga gattaacaat 2940 taccatcatg cccatgatgc gtatctaaat gccgtcgttg gaactgcttt gattaagaaa 3000 tatccaaaac ttgaatcgga gtttgtctat ggtgattata aagtttatga tgttcgtaaa 3060 atgattgcta agtctgagca agaaataggc aaagcaaccg caaaatattt cttttactct 3120 aatatcatga acttcttcaa aacagaaatt acacttgcaa atggagagat tcgcaaacgc 3180 cctctaatcg aaactaatgg ggaaactgga gaaattgtct gggataaagg gcgagatttt 3240 gccacagtgc gcaaagtatt gtccatgccc caagtcaata ttgtcaagaa aacagaagta 3300 cagacaggcg gattctccaa ggagtcaatt ttaccaaaaa gaaattcgga caagcttatt 3360 gctcgtaaaa aagactggga tccaaaaaaa tatggtggtt ttgatagtcc aacggtagct 3420 tattcagtcc tagtggttgc taaggtggaa aaagggaaat cgaagaagtt aaaatccgtt 3480 aaagagttac tagggatcac aattatggaa agaagttcct ttgaaaaaaa tccgattgac 3540 tttttagaag ctaaaggata taaggaagtt aaaaaagact taatcattaa actacctaaa 3600 tatagtcttt ttgagttaga aaacggtcgt aaacggatgc tggctagtgc cggagaatta 3660 caaaaaggaa atgagctggc tctgccaagc aaatatgtga attttttata tttagctagt 3720 cattatgaaa agttgaaggg tagtccagaa gataacgaac aaaaacaatt gtttgtggag 3780 cagcataagc attatttaga tgagattatt gagcaaatca gtgaattttc taagcgtgtt 3840 attttagcag atgccaattt agataaagtt cttagtgcat ataacaaaca tagagacaaa 3900 ccaatacgtg aacaagcaga aaatattatt catttattta cgttgacgaa tottggaget 3960 cccgctgctt ttaaatattt tgatacaaca attgatcgta aacgatatac gtctacaaaa 4020 gaagttttag atgccactct tatccatcaa tccatcactg gtctttatga aacacgcatt 4080 gatttgagtc agctaggagg tgactga 4107

< 210 > SEQ ID NO 25 < 211 > LENGTH : 1368 US 2019 /0029236 A1 Jan . 31, 2019 48

- continued < 212 > TYPE : PRT < 213 > ORGANISM : Streptococcus pyogenes < 220 > FEATURE : < 221 > NAME /KEY : misc _ feature 223 > OTHER INFORMATION : M1 GAS Cas9 protein idid : AAK33936AAK33936 . 1 < 400 > SEQUENCE : 25 Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val

Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 35 40 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 75

Tyr Leu Gin Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser

Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 105 110 His Glu Arq His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp

Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 155 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro

Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gin Leu Val Gin Thr Tyr 185 190 Asn Gin Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn

Leu Ile Ala Gin Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 235 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gin Leu Ser Lys Asp Thr Tyr Asp 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gin Ile Gly Asp Gin Tyr Ala Asp 275 280 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp

Ile Leu Arq Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 315 Met Ile Lys Arg Tyr Asp Glu His His Gin Asp Leu Thr Leu Leu Lys

Ala Leu Val Arg Gin Gin Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 345 350 Asp Gin Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 US 2019 /0029236 A1 Jan . 31, 2019 49

- continued

Gin Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 395 Lys Gin Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gin Ile His Leu 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gin Glu Asp Phe Tyr Pro Phe 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 475 Val Val Asp Lys Gly Ala Ser Ala Gin Ser Phe Ile Glu Arg Met Thr 495

Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 505 510

Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515 520 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gin Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 555 Val Lys Gin Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 570 575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 585 590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr

Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 635 His Leu Phe Asp Asp Lys Val Met Lys Gin Leu Lys Arg Arg Arg Tyr 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 665 670 Lys Gin Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680

Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe

Lys Glu Asp Ile Gin Lys Ala Gin Val Ser Gly Gin Gly Asp Ser Leu 705 715 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 730 735

Ile Leu Gin Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 745 750

Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 Pro Glu Asn Ile Val760 Ile Glu Met Ala US 2019 /0029236 A1 Jan . 31, 2019 50

- continued Thr Thr Gin Lys Gly Gin Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gin Ile Leu Lys Glu His Pro 785 790 800 Val Glu Asn Thr Gin Leu Gin Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 810 815 Gin Asn Gly Arg Asp Met Tyr Val Asp Gin Glu Leu Asp Ile Asn Arg 825 830 Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gin Ser Phe Leu Lys 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 880 Asn Tyr Trp Arg Gin Leu Leu Asn Ala Lys Leu Ile Thr Gin Arg Lys 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 905 910 Lys Ala Gly Phe Ile Lys Arg Gin Leu Val Glu Thr Arg Gin Ile Thr 920 925 Lys His Val Ala Gin Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 945 950 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gin Phe Tyr Lys Val Arg 970 975 Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 985 990 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala 1010 1015 1020

Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe 1025 1030 Lys Ala The Ala La1035 , Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1040 1045 1050

Asn Gly Glu Ile Arg Lys Ara Pro Leu Ile Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val Leu Ser Met Pro Gin Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu Val Gin Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105 1110 Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120 1125 Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser US 2019 /0029236 A1 Jan . 31, 2019 51

- continued 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly 1205 1210 1215 Glu Leu Gin Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gin Lys Gin Leu Phe Val Glu Gin His Lys 1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gin Ile Ser Glu Phe Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gin Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320 Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335 Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gin Ser Ile Thr 1340 1345 1350 Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gin Leu Gly Gly Asp 1355 1360 1365

< 210 > SEQ ID NO 26 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : ORNA7 for z chromosome locus chrz _ 42174515 _ - 1 < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 26 gtaatacaga gctaaaccag 20

< 210 > SEQ ID NO 27 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223????OWOWNE > OTHER INFORMATION : ORNA8 for z chromosome locus chrz _ 9157091 _ 1 220 > FEATURE : 21 > NAME / KEY : misc feature < NNNN223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 27 acagacctat gatatgtgag 20

< 210 > SEQ ID NO 28 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence US 2019 /0029236 A1 Jan . 31, 2019

- continued < 220 > FEATURE : OTHER INFORMATION : CRNA9 for Z chromosome locus chrz _ 27767602 _ - 1 < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 28 gagcttgtga gtgataatcg 20

< 210 > SEQ ID NO 29 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence FEATURE : < 223 > OTHER INFORMATION : ORNA10 for z chromosome locus chrz _ 78779927 _ 1 < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 29 gtaaagagtc agatacacag 20

< 210 > SEQ ID NO 30 < 211 > LENGTH : 20 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence FEATURE : < 223 > OTHER INFORMATION : ORNA11 for z chromosome locus chrz _ 63364946 _ - 1 < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 30 cagtgggtac tgaagctgtg 20

< 210 > SEQ ID NO 31 < 211 > LENGTH : 1012 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Left arm for CRNA7 integration to Chromosome z ZNF367 _ HABP4 _ ENSGALG00000012629 _ ENSGALG00000012628 _ chrz _ 42174515 _ - 1 < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 31 gtgaacggat aggcagcaag cattcagaac aatgaaaaag atctgcgtto tattgtaaag 60 caaacaaagg tgatgacgga acgtttattt gagatacagg caccatagta caagatatca 120 aagaggaatt aattcaaccc tcccaacaac agttgggaaa aaaaaaggat aagctgagga 180 atgcagcctt ctccgatttt tactctggtg ccggaaggag gaggaggagc gggggaaaac 240 ccagcggact cagactgcat acgcactctc ggaagtacct ctgaggcggg gtgagaggaa 300 gggtggatct aggctccccc cgctccacac actcacgtgc tcgtgtactg gttcaggctg 360 tgacttggca actcctctac atctatccat ctagttagac tcaacaagac catcgtgatt 420 caggagtctg aagatgotta actctctcag aacgtctagt tctcctggcc tggtaaatgc 480 tatgtttctc atactgcctc tctgaagaat gottcgaatg cttctagtga tgctctaaag 540 ttctaaacag aaaaatctgg agacagttct ggtctttaga tagaaaaaat gccaacatgo 600 caaaggatgg ttacatcctt caagcaacct tgttgcatgc tgtacaatag actcatgtaa 660 US 2019 /0029236 A1 Jan . 31, 2019 53

- continued taacttagcc gtagtcatcg tatctcttat ttacctgttc gttattacat tttcctggta 720 ctgctttata tttagtcagt tgtcctttta agacaaattt tttggtgtgt gctaataggc 780 agttaccaaa tgttctagag ggagggaata taatcagtga gtatgtagat gtatatagat 840 gtataaccag taagtataca gagaagttag ggtggtcttt tgagagcata tagctggaaa 900 gattatcaca tgggaaaagg taatcagaaa taaatggaaa aatgctcacc agtgtcatag 960 getcacaaga aaactcccca aggagcaatc tocagtaaca gacccttcct ca 1012

< 210 > SEQ ID NO 32 < 211 > LENGTH : 1023 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 32 gtcatgtcgg tggaggagaa agtggctgta gaaaaggtaa cggacaagaa atccctcact 60 ggcttagctg taaaggtcag aggaaaatca tcttctgttc tocatacaca tctcctgtaa 120 ttaggcacct gtgcccttta aaaaagtaaa gtaatcaaag agtcatttgg tgaaaataga 180 agccaaacag ttacaaaatt tagttaatat tcaaagacaa aacaactctg gttccaaata 240 taaaaccctt tgtgtaaaca ctgcgggaag gtgccaaaga gccacctaca caaagagatg 300 ccacagagta atttgcgtac cccaacaata ggatcatata tgggcaaacc aaaagaccaa 360 caaagacccc ttgcaataat cccttgattg gcagaagcaa gtgcagcgtt agatttagta 420 tgtgtgacaa ttctgagaat aggaaggaat ttcactgaaa ctgtgtgaag atttgtatgt 480 taaatacata taatgagggt tatttagctc tggggtgtgc atgctatgtg gagagatccc 540 catgtgccca gcactgcaat agactaatgt cagcttttta aaccatcatt tggtttgaag 600 agtttattat gattttcaga aacagaatta tgtattcagt gtctgtacat tottacaagc 660 ctgctgttct gtacacatga aaaagctact tatggtgcaa atcagtatag agaagcagtt 720 ttgacataca gtggtcatga ctgggtgatc tgctgtcaga aggtaagaca ctggtataca 780 gaattgcaaa cgtgagatga agacctcaag tgcaactctg tcatcatacc acttctcttg 840 ctattatcta ttcagtgttt gttctaaata ttcaggcaga aggcttggtt tcacatcagg 900 tgttacattt aagtattctt tgcccatttt ttgctgtttg tatgtgtaac ttcagattct 960 cacattgact gtgtagtgta aatttgcaaa tagatgtaac agcttctctt taacatccca 1020 tgc 1023

< 210 > SEO ID NO 33 < 211 > LENGTH : 1014 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220wnwo > FEATURE : < 223???? > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 33 ctctgcatgg tcacaacggc cccaacagcctcccatcccg atgtcaccaa tcagttcact 60 attactggtg agcaaccagt ccagcactgc atccccctgg tggggctgtc tgttacgtgg 120 ctcaggaagt tatcctcagt gcattccagg tgctcctgga tcgcctgtag ctcaccgtgc 180 tacttttcca gcaggtgtca gggtggtaga agtcccccag caggacgaga gcctgcgatt 240 US 2019 /0029236 A1 Jan . 31, 2019 54

- continued

gtgacagctt ctgtagctgg agggagaatg cttcatcaac aggctccgct tgatcagtgt 300 ccctgtactg ataccacaag gettcttttg ctgctcccat cttaactctc accccatcgt 360 ggtgttatac gtgcataaca tcatgcagtg cactaagagt taaagagtta atgctccagt 420 tccgtcgatt gtcaataatt ccaggtgtac ctttctcaga agagaagaac tacaaatccc 480 ttaagatctt actgttocat tttcattctc cattcagaag gaaaggtaaa actgcagtgt 540 gtgctcccta gcattagagt aatttctccc ttagctcgtt gccaccattt tgtttttagg 600 cccacctcct taccttttcc ctacacccct cctgtgtctc tgagacgtgg gtccatgggt 660 ccctcaacca tagtagacac aaactcagat caaaccaagc cagagctttg acaaccccta 720 agctttcagc ttactcaggg ttgctctgca gggactgctc ttcacactct attccttcct 780 tgatatagag ggcaatgtct cctctcctcc ttccttacct gtccctcctc atctgcctgt 840 tgctgtcagt ggccacactt cagccatggg aatcatccca ccctgctttt gtgaaggaaa 900 ctacattatg gttctcaggt agcacagtgg cttccatcac ctcctgtttg cttcccaagc 960 tgtgtgtgtt ggtgtagagg cacttcagct gggcagctga agaactggac gcac 1014

< 210 > SEQ ID NO 34 < 211 > LENGTH : 1032 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 34 cacctttcca cctcctgcta aagcacattc cctacagtat gtttcacatg acaccgtgct 60 ggcagatttt taatatcatc agagaatgac actccatatc ctctctgggc agcctttttc 120 agtgctctgt cacccacaaa gtaaagtatt tgctcatgtt ctaatggaac ttcctatgtt 180 ctagtttgtg accattgaac cttgttctgt cactggacag tgctgaagga gcctggccct 240 atccacttga ctcccacact ttacatattt acaagcatcg ataagacccc cctcagtctt 300 ctccagacta gatagcccca ggtctcccaa ccattccttt tatgggagat gcttcaggcc 360 cctcatcacc tctgtggccc tctgctggac tgcctgcagt agttccaggt tttttttttt 420 gaactgggga gcccagaact tgacacggta ttccagatgt ggcctcacca gcgcagagga 480 gaggggaagg ctcacctccc tcgacctggt ggccatgttt tttttaacag acctcaggat 540 accactggcc ttcttggccc aagggcacac tgctggctca tggcccatgg gttggcttcc 600 aggactctca ggtccttctc cgtagagctc ctctcaagca ggacaaccct cagcctgtac 660 tgatgtgtgc ggtgcggtta ttcctcccca cgtgcaagac tctacatctg ccattgttaa 720 atctcataag cttcctctct gcccaactct ccactgtgta cgggccttag tgaatggcag 780 cacagacttc tggtgtgagg atagcattca gaacaagctg ctgtaccttc ccagt cacag 840 aggtgagggt gactggcttg tactttccca gotttgcctt cttgcccttt tggaagactg 900 gagcgacatt ggccttctgg aggaaacggt cctcaggcac ccctcctgtt ctccatgacc 960 tttgaaagat gatcgagagc accttggcag tcacttctgc cagctccttc agcacgcatg1020 agtgcatccc gc 1032

< 210 > SEQ ID NO 35 < 211 > LENGTH : 1025 US 2019 /0029236 A1 Jan . 31, 2019 55

- continued < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223MOM > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 35 gcagtacgta cgtttgtgaa cagctgtttt caagggtgat gcacaggaag agtaaaattt 60 cattaaaaaa tctccaagga gcacatggag agctcactca gaagcctcac cgctgccact 120 gaacaagact gatgcattag tttcatgaaa tcaaggctat gtgtcccact ggtttcatta 180 ttttgttact ctttctttaa aacaaaaaaa ttgttttatt gottatatac atcaactatg 240 ttgttatata ttttccaaag gccgctccaa aagtaatgcc tcctgtttca ttctgttggc 300 ccaccgtgtc agaggcagat ggtggtacgg cagtagagat ggaaccttcc caccaatatt 360 ccattacatg ttgccatgtg atagacagca gcagatgggc actctgacag aatggtatct 420 gacatggaag cgtggatgga gcaaagttgt gtcactgaat tcctccataa ggaaatgagc 480 acccactaac attcactgat gottgctgaa catttctgga gaccaaacag tggatgtgag 540 cacagtgagg tggtgggtgg tgcatttcag cagtggtgac aatgacgttg ggtcacctct 600 gctggtgcag gttttgatga gtgcagcctg tgaggtcttg ttcatcaatg gagaaaatgo 660 acaactaatg gtggtgactg ctgaaaaata gtgttttgta gctgagaatt ttctctgtca 720 aacagtgcta attgtgctct ttgtatctgt tgtagtttcc atgggaataa ataggaggca 780 ttacttgcag actgacctac atatatgtgg ccccaggcaa gtcaacagct gtacgaaaag 840 tccatgcttc ctcattataa acggaggaaa aaaagttgtt tacagctgta atgggattat 900 aaaaggcaaa tggggatagt acagtggtga gaaccagatc tatgaaggaa aagccctaag 960 aaaaaqagag tacacagata ctcttaacca tetaataact qtttcctcca toetacagct 1020 cagag 1025

< 210 > SEQ ID NO 36 V< 211 > LENGTH : 1040 V< 212 > TYPE : DNA V< 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 36 tggcttccaa ttcctcctgt ttatcaccca cgttgcatcc attgatgtag aggcacttca 60 gtcgggctat cagcaatgtt accacctgtg aggagccctc ttgagatott ttaggacaat 120 ttagaggttt tccccactgt ttcctaaaat tacagcattc cctgtccctt cttagtgata 180 tagaactcca tccccttcca ccatcaaacc tagcttaagc tctggtaaat gatccagcca 240 gtctgcttcc caaaactctt gctcagttgc attctatctg atgcctacat gcccaacacc 300 ttcaaggcct gtccaagatc atagaacaca aaggcttgat catgacaaca tocatgcagc 360 caatcattca catgacccat tcctctcctc ctttccaggt cccaacggcc aactgagagt 420 tgtgctctga gctcttcagt gtccttccga gggatgtaaa gtccctttta atgttctgca 480 ttttctttgt cacagccttc tgagacccaa cttgaatgtg gaggagtgga gagtaatcat 540 cccgctctga ttatcagata cattagcctc ttcttggcac ctctggcaga cagaagactt 600 ccctggagag attacctgga tgataactgg gggcctcagt gcctcacagc agcaagtccc 660 cagttactaa gactctacac ctctttggtg gcgctagttc tgatgtagtt cttcagttgc 720 US 2019 /0029236 A1 Jan . 31, 2019 56

- continued ttaacatgct tgttgtttcc caagatttga ctgctatctg caccctccct ttcttccagc 780 cccagagcct tatatcatga gctgagaaca ttctgtgttc aaaatacaag acacatttat 840 gcaatttcut attctctacc catatttttg tgatagaaat tagggctact tatttcccat . 900 agtgatttcc atgctgccta ccaggttcta agtcaggtca ccctgccagc ttcttccaaa 960 ccatgctcag gagtgcatca aatcacacgc agacccaagg aaaaaatgta ccaaacaata 1020 ttaccacgca tacaaactcc 1040

< 210 > SEQ ID NO 37 < 211 > LENGTH : 1024 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 37 ctaccttgcc ccactccagc agctccacga ggt actcgaa gtgcccatgt ccggccatcc 60 ccagcatggc acagctgtca cctgggagca gcgggggtcc ggcaggcatc gccggcaccc 120 acagcctggg ctgggctgag gatgggcttg gtgggcagct gggtgctgcc gtggcagctg 180 agtgccgtcg tgcaggtggg ctcggtgctc tctgcagccc acggctcggg acccgtggtg 240 ggcatactgc tgggcaaggg gacggctcgg atgtgcatcc cagagcaggg tgcatgatgt 300 gtgcgcagcg gcacacagca gcgcacttgt ccccgaggca ccacccggtc tgatgaaatt 360 ccaggttttg tttaagatga aaatgcatgt gggcatacat ttgcacatga gaacacctgc 420 taatgaaaca cacagagttg tatgtgcagt ctccctggct ggtggcatgt ctgtgggggc 480 agttaggcag gaagaaaagc tccaccatct gtttctgtgt cccgggcttg gtgctgccac 540 tagagatggg atgcacacag catgcctgcg tgctgccgag gcagctcagt acctgctgct 600 gggggagagc agccctcagg gagctgctgc aaagaccccg tgggatggct ggtgaacagt 660 gctggagaca tggcagatgt cgcacccctg ctccacacca ccctccgctg cagctgcctg 720 cacgatgcca tttcagcgtg ccacggcttg tttcttcctc ttgcagtctc aggttgccgc 780 agcagcagct gcctgaggtc tggtggcaaa gggcagagca cccagcccac tgctctccat 840 gagtgagcgg gtagggggca cgccgtgctt cgcttctggt atcgggtggc ctgtggagca 900 catcacccct ggacagtgaa aacatgtcaa agggtgtttt ataacagtat agcatatccc 960 tttgaggctg aatttcctga gottatggat atggtagtaa tgctatacca ggctctctct 1020 gcag 1024

< 210 > SEO ID NO 38 < 211 > LENGTH : 1022 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220wnwo > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 38 cagctgctgt acaatggctg tatggcagta tcgatgtgaa cttcctgata ataaacagaa ctcagcagca aataaaccca gattgttctg atcagtaacg agaggctgtg caaaaagctg 120 agaaatgtac agcccttcct gotcaccact acagcccttc atgcagcggc ctgctgcact 180 agggcctgct tggccagagg cagggctgca gottgagata cgcagcaccc agtaccccag 240 US 2019 /0029236 A1 Jan . 31, 2019 57

- continued caggctgcca tgtgcttctg tcaggccatg aattgcacaa gttggtatag ttttatacag 300 tgtcatgcag aagcacaact cttaccttgg cacactgata tggaaagcaa agtgtaaagg 360 aactgtatgt ttcttggctt gtgagttcca ttggttctcc caggacagca gtgacagctc 420 tagattttct ggttgatctc ttccatctaa gtttttactt ctgaatacat ctgtgcagca 480 aagcctgatg cttttttttt tccccctccc ctgggat cgt gaaatattat tttcccatct 540 ccataataca gatgatccac tcaaacatgc atcctcagtc gcagtcctca gaagggcctt 600 ttcccaccat acacctacac gctacaccag actttattgg tcaccatgcc ttgagggatt 660 ctgcctaaca caggcacaca ggaagggctg ataccagtaa ttcattgctg aggagagaag 720 gggcacttct tttatagtag agccacagaa tcaccaggat tggaaaacac ctccaagatc 780 atccaatcca accacccacc taccaccagt atttcccact aaaccatgcc ccttggtacc 840 acatctaaaa gcatcttctg caccttcaca gcttcattgc ctttctcagg acgtgctcca 900 gggccttggt gtctttcttg tattgagtgg cccaaaattg aacacaatac tcgaggtgca 960 gcttcaccaa agctgagtgc agaggggtga tcacctctac taggccttgt tttacccctt 1020 Cc 1022

< 210 > SEQ ID NO 39 < 211 > LENGTH : 1003 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 39 gggttgaaac tgcgtgatca ttgtagtctt tttcaaccca ggccattcta tgattccatg 60 aagactctgt aaggacocca atgccatcag ctgtccccac agcttcagta cccactgcca 120 ccacattttt actgagatag gtagtttggt agccttcctc ccatcttgga taggggaggg 180 ttaactgctg gcatttttgt tctttcctgc aatatgtgtt ttctgcatgc attctctttt 240 cacccaaaat tttaatgtgg acggactttg aggatattct gcatctgccc aatatttctt 300 acagcctcac atctactgat ttatgcacag tatcttatat ataatgtata ttatattatg 360 tatattatgc actgaatcac atctactgtg tatgcacagt aacttctcct atggtactgt 420 aagcccagaa atcccagata tgtcactaca acgtgtctgc tatgtattgc ttctgtgaga 480 cacagatgtg ataatcagag gctgtacaca gtagaaatgc atacatatcc tactgtgaaa 540 tctctgaaat ctagccttaa tcttggaaca gaaatgaata tggtgacatc ttgatctgat 600 agaattggtt gccagtagca cagctgtaat catccatgat atgaatcaaa ccaagcacag 660 gtaaacaggt gagagaaatc atgaacaatt acatgcaaac ggaccagcta aaatgtgttt 720 gtttgttgtt tttttttttt caggtgattc ttgattacag taagatcaga agctgctaca 780 ttagcagacc agccactgca ctcaaggctg tgattcacag cttgcagacc tgacagcagt 840 tctgtggaag aggcaggtcc ctgtcaacca gtttaatcaa taaatcagtc tcgtgtacac 900 aaataatgtt atcctgcacc actgctggtg ttacactatt tcacccaagt ttatcaccag 960 caaactgagt cttatcgttc ctactgtgct ttgcttttct tgo 1003

< 210 > SEQ ID NO 40 < 211 > LENGTH : 1003 US 2019 /0029236 A1 Jan . 31, 2019 58

- continued < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223MOM > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 40 cagaaacacc agagcttacg gtgtgaattc attgcacatc ttattagatc aacaaaatgg 60 aataaaagaa tacagaagat tactactcca ttgggcatgt ggacgtttta caggcctgga 120 taaattagat cttaaaaaca aacaaacaaa caaacaaaaa aactccttgc aaagataatg 180 ttatgtaata ttagttgcaa gaagtaagca aacacacaga actgggagca gaagcaaagc 240 actaagttat taaagcaagt tgcacatttt gagttgcatt ttgccactgg ttttataaac 300 atgtttagca tgtctggtca gaatttgggc accaggatgc ttttaagatg tctgtctatg 360 gaacctgtca gtgctcaaga ataacttctg ttatttggat gctgcaccaa agaattcaga 420 ggaagacgag ccaagccaga cgttatcata gtcactagta aagtggttct aagcctaatt 480 aagacatgtc agaactatgt gttgtgcaac caaatcctcc aaaagagaaa tcagaggtga 540 acttgtgcaa taaatataga agacacgtaa atcctgaggc agttagctaa ccatatgaag 600 ccaatcatac ctgactgctg gacgcaggag actgaacctt acagaccctg gagaatcact 660 gtttggccta gttaggcctg aatggaattt accaagattc atgactttaa catggatcag 720 gtgcaaagaa aagaaggctc agttagttcc tacaggctac cagatctttt tccacctctg 780 ctcagcctgg agctgtgggc tctacctgcc cctgaagtga agtggcatca actgcaacac 840 tttttgcaga ggcaaaaatc atcaagtcgt gcctctgcat tttaaggtga tggattccaa 900 gagatagatt ccaaacccaa cactgagatt cctctggtga tgcagatgac tgcttactgg 960 gatccttctc tctctatagc ctaatcccat gcagcaccaa aag 1003

< 210 > SEQ ID NO 41 < 211 > LENGTH : 200 < 212 > TYPE : DNA 13 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : For cloning using the GRNA3, z chromosome , " Left arm " < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 41 cctgcaggac atgtggacac tctgccaggt actgggggag gatcccctcc actgctccct 60 gggagatggc aaacatctag agagggacac tgcagggatg ctgcatgaac acctccagcc 120 ttctgcaggc tgtgatgggg tcagggctga aggtcaacac aagcaatgac tgcttgctga 180 caatgtgggc attgccgacc 200

< 210 > SEQ ID NO 42 < 211 > LENGTH : 258 < 212M > TYPE : DNA < 213??? > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : For cloning using the RNA3 , Z chromosome , " Right arm " < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 42 US 2019 /0029236 A1 Jan . 31, 2019 59

- continued tggtgagtgg ggccaggaga gcaggacagg agtgtggact cggaggcgcg ggcagaggag 60 gtagctcaga gcatgagata tattcgccag gtgtcagtgg acttctggca gtgcatactg 120 cagagagctt tggttgctgg ccatctggat gatgacaaaa tctcagccac agaccatgtg 180 ggttggaaga gtcctcagga gatcaccttt ccacctcctg ctaaagcaca ttccctacag 240 tatgtttcac atgacacc 258

< 210 > SEQ ID NO 43 < 211 > LENGTH : 436 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220M??? > FEATURE : < 223 > OTHER INFORMATION : For cloning using the gRNA4 , z chromosome, " Left arm " < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 43 tcaacagctg tacgaaaagt ccatgcttcc tcattataaa cggaggaaaa aaagttgttt 60 acagctgtaa tgggattata aaaggcaaat ggggatagta cagtggtgag aaccagatct 120 atgaaggaaa agccctaaga aaaagagagt gcacagatac tcttaaccat ctaataactg 180 tttcctccat cctacagctc agagttaaga cttacagagg actctagtac ttagtaagat 240 gaatacgagc taatagtggc aaaaataatc ccagtgcctc aacactgacc tgggaaaaag 300 gggcatgtat agaccttctg atattgtgat gctgtgtttg tacacttatt atctacattt 360 tcagaaatta ggttaaactt cagaaaactg aagatctcca gggcttgtag cagaccctga 420 ccaccagact ggtccc 436

< 210 > SEQ ID NO 44 < 211 > LENGTH : 521 < 212 > TYPE : DNA 13 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : For cloning using the GRNA4 , z chromosome , " Right arm " < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 44 tcaaaccgat tgtggctgtt tctcagaggo aactctttgc gctctagccc ctctataaca 60 tggggcaact tcccctgccc caccttccct tcctgtatct tctgaaaagc ttgtagccct 120 caattgtcac gctccagcca tatgaatcat cccaccacgt ccctgtgttc acaattacct 180 tctaqtcttc taattqcacc atqgcttcca attcctccta tttatcacco acqttqcato 240 cattgatgta gaggcacttc agtcgggcta tcagcaatgt taccacctgt gaggagccct 300 cttgagatct tttaggacaa tttagaggtt ttccccactg tttcctaaaa ttacagcatt 360 ccctgtccct tcttagtgat atagaactcc atccccttcc accatcaaac ctagottaag 420 ctctggtaaa tgatocagcc agtctgcttc ccaaaactct tgctcagttg cattctatct 480 gatgcctaca tgcccaacac cttcaaggcc tgtccaagat c 521

< 210 > SEQ ID NO 45 < 211 > LENGTH : 505 US 2019 /0029236 A1 Jan . 31, 2019

- continued < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : For cloning using the GRNA5 , z chromosome, " Left arm " < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 45 gcctgtccaa actgaccttg gggccccggg cacagctgct cccgagcaag gagaggcaga 60 gaattgtgga ggaaaccctc ttccacctag ctccaagggt gcacgctcaa tgcttggatg 120 aagattcaag ttctcaatga agaactgcat tcaaagacat ctttggaggt gacccagact 180 gcctctggga tgaatccaga acaaacagaa tcttcccagc aacacctttg tttatcatac 240 acgttcagaa atgcagtgcc tgcctggtat ttttttaaac tcatcacaga ggaatctctg 300 agtggagcag aggagtgttt cctcttgctt ttttcttccc cctttctgta agaaatgcat 360 atgccagttt ccccctaaat gttttcaaac tccaaattgt ttcctgctgg tgacattctc 420 ctctccagca ctgcctacac cccagctgcg tutgatagga aaagcaccca gtaccatgct 480 ggcatggcat ggtcagtgac accca 505

< 210 > SEQ ID NO 46 < 211 > LENGTH : 599 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : For cloning using the gRNA5 , z chromosome , " Right arm " < 220 > FEATURE : < 221 > NAME / KEY : misc feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 46 ctgccagagc agagggctgc tgaaacgccg agtgccaact gacactgttc agctgacagc 60 ctcacgagag tgctgcgagg gttaagtgag gcaacaaaat acaagtactc aaaaatagaa 120 tggaatggaa tggaataaca gagggaatgg ggaacaggct gcagtgagaa ggaaaccccc 180 gtgcaccgac caacccgctc ccagtagcct ggtccctacc ttgccccact ccagcagctc 240 cacgaggtac tcgaagtgcc catgtccggc catccccagc atggcacagc tgtcacctgg 300 gagcagcggg ggtccggcag gcatcgccgg cacccacagc ctgggctggg ctgaggatgg 360 gottggtggg cagctgggtg ctgccgtggc agctgagtgc cgtcgtgcag gtgggctcgg 420 tgctctctgc agcccacggc tcgggacccg tggtgggcat actgctgggc aaggggacgg 480 ctcggatgtg catcccagag cagggtgcat gatgtgtgcg cagcggcaca cagcagcgca 540 cttgtccccg aggcaccacc cggtctgatg aaattccagg ttttgtttaa gatgaaaat 599

< 210 > SEQ ID NO 47 V< 211 > LENGTH : 453 V< 212 > TYPE : DNA V< 213 > ORGANISM : Artificial Sequence V< 220 > FEATURE : V< 223 > OTHER INFORMATION : For cloning using the RNA6 , Z chromosome , " Left arm " < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 47 US 2019 /0029236 A1 Jan . 31, 2019

- continued ttgcagtctc aggttgccgc agcagcagct gcctgaggtc tggtggcaaa gggcagagca cccagcccac tgctctccat gagtgagcgg gtagggggca cgccgtgctt cgcttctggt 120 atcgggtggc ctgtggagca catcacccct ggacagtgaa aacatgtcaa agggtgtttt 180 ataacagtat agcatatccc tttgaggctg aatttcctga gottatggat atggtagtaa 240 tgctatacca ggctctctct gcaggttgct cactgaaaca atataccctt tctttctcaa 300 gaaatgggac tcatgaatag ctaccaggcc tttctgctac tagatactgt agaattacat 360 atatcagatg gctcattaat cacatagott gttattggga cagaggcagg ttttcagcat 420 ttcccacact gottttctgc aaatggatta gga 453

< 210 > SEQ ID NO 48 < 211 > LENGTH : 439 < 212 > TYPE : DNA < 213 > ORGANISM : Artificial Sequence < 220 > FEATURE : < 223 > OTHER INFORMATION : For cloning using the ORNA6 , z chromosome , " Right arm " < 220 > FEATURE : < 221 > NAME / KEY : misc feature < 223 > OTHER INFORMATION : Synthetic < 400 > SEQUENCE : 48 gggaccatca ctcacttcct aggccatgct tcgtagttta actccatgca aggtattttc 60 ttgctctgat ctaactctag atcactaaat ggcacttgtg caggacactt ttocactgtc 120 attttggggg gtagaagtgt ggtcagagcc agggaggott gcagggcoca caccagctgt 180 ggcccaagca gctgctgtac aatggctgta tggcagtatc gatgtgaact tcctgataat 240 aaacagaact cagcagcaaa taaacccaga ttgttctgat cagtaacgag aggctgtgca 300 aaaagctgag aaatgtacag cccttcctgc tcaccactac agcccttcat gcagcggcct 360 gctgcactag ggcctgottg gccagaggca gggctgcagc ttgagatacg cagcacccag 420 taccccagca ggctgccat 439

1 . A method of gender determination of avian fertilized 5 . The method according to claim 1 , wherein said at least unhatched egg , the method comprising the step of: one transgenic avian subject is a female avian animal, and : ( a ) providing or obtaining at least one transgenic avian ( a ) wherein said at least one reporter gene is integrated animal comprising at least one exogenous reporter gene into at least one position of female chromosome Z , integrated into at least one position or location in at thereby detection of a detectable signal indicates that least one of gender chromosome Z and W ; said embryo in said unhatched egg is a male ; or ( b ) obtaining at least one fertilized egg from said trans ( b ) wherein said at least one reporter gene is integrated genic avian subject , or of any cells thereof; into at least one position of female chromosome W , ( c ) determining in said egg if at least one detectable signal thereby detection of a detectable signal, indicates that is detected , wherein detection of said at least one said embryo in said unhatched egg is female. detectable signal indicates the expression of said at 6 . The method according to claim 1 , wherein said at least least one reporter gene, thereby the presence of said W one reporter gene is integrated into said gender chromosome chromosome or Z chromosome in said avian embryo . of said transgenic avian subject using at least one program 2 . The method according to claim 1, wherein said reporter mable engineered nuclease (PEN ) , and wherein said PEN is gene is at least one bioluminescence reporter gene . a clustered regularly interspaced short palindromic repeat 3 . The method according to claim 2 , wherein said reporter (CRISPR ) type II system . gene is luciferase . 7 . The method according to claim 6 , wherein said at least 4 . The method according to claim 3 , wherein said method one reporter gene is integrated into said gender chromosome further comprises the step of providing to said egg of step of said transgenic avian animal by homology directed repair ( b ) , at least one of substrate and enzyme compatible to said (HDR ) mediated by at least one CRISPR /CRISPR - associ bioluminescence reporter gene , for formation of said detect ated endonuclease 9 (Cas9 ) system , and wherein said at least able signal detected at step (c ) . one reporter gene is integrated into a gender chromosomeof US 2019 /0029236 A1 Jan . 31, 2019 62 said transgenic avian animal by co - transfecting at least one 14 . The transgenic animal according to claim 9 , wherein cell of said avian animal or at least one cell introduced into said at least one reporter gene is integrated into : said avian animal, with : ( a ) at least one site at gender W chromosome locus ( a ) at least one first nucleic acid sequence comprising at 1022859 - 1024215 ; or least one nucleic acid sequence encoding at least one ( b ) at least one site at gender Z chromosome locus Cas9 protein and at least one nucleic acid sequence 42172748 - 42177748 . encoding at least one guide RNA ( GRNA ) ; and 15 . A cell comprising at least one exogenous reporter gene ( b ) at least one second nucleic acid sequence comprising integrated into at least one locus in at least one of gender at least one said reporter gene . 8 . The method according to claim 7 , wherein said at least chromosome Z and W . one reporter gene is integrated into : 16 . The cell according to claim 15 , wherein said cell is an ( a ) at least one site at gender W chromosome locus avian cell , and wherein said avian cell is a primordial germ 1022859 - 1024215 ; or cell (PGC ) . ( b ) at least one site at gender Z chromosome locus 17. The cell according to claim 15 , wherein said at least 42172748 -42177748 . one reporter gene is luciferase , and wherein said reporter 9 . An avian transgenic animal comprising at least one gene is integrated into : exogenous reporter gene integrated into at least one locus in ( a ) at least one site at gender W chromosome locus at least one of gender chromosome Z and W . 1022859 - 1024215 ; or 10 . The transgenic animal according to claim 9 , wherein ( b ) at least one site at gender Z chromosome locus said reporter gene is at least one bioluminescence reporter 42172748 - 42177748 . gene . 18 . An egg derived , laid or fertilized by at least one 11 . The transgenic animal according to claim 10 , wherein transgenic avian subject or by any progeny thereof, any said reporter gene is luciferase . component or any parts thereof or any product comprising 12. The transgenic animal according to claim 9 , wherein said egg , components or parts thereof, wherein said at least said at least one transgenic avian animal is a female , and : one transgenic avian subject comprises , in at least one cell ( a ) wherein said at least one reporter gene is integrated thereof, at least one exogenous reporter gene integrated into into at least one position of female chromosome Z ; or at least one position in at least one of gender chromosome ( b ) wherein said at least one reporter gene is integrated Z and W . into at least one position of female chromosome W . 19 . The egg according to claim 18 , wherein said at least 13 . The transgenic animal according to claim 9 , wherein one transgenic avian animal is a female , and : said at least one reporter gene is integrated into said gender ( a ) wherein said at least one reporter gene is integrated chromosome of said transgenic avian animal by HDR medi into at least one position of female chromosome Z ; or ated by at least one CRISPR /Cas9 system , and wherein said ( b ) wherein said at least one reporter gene is integrated at least one reporter gene is integrated into a gender chro into at least one position of female chromosome W . mosome of said transgenic avian subject, specifically animal by co - transfecting at least one cell of said avian animal or at 20 . A kit comprising : least one cell introduced into said avian animal: ( a ) at least one first nucleic acid sequence comprising at ( a ) at least one first nucleic acid sequence comprising at least one nucleic acid sequence encoding at least one least one nucleic acid sequence encoding at least one Cas9 protein and at least one nucleic acid sequence Cas9 protein and at least one nucleic acid sequence encoding at least one guide RNA (GRNA ); and encoding at least one gRNA ; and ( b ) at least one second nucleic acid sequence comprising ( b ) at least one second nucleic acid sequence comprising at least one said reporter gene . at least one said reporter gene .