Regulation of Expression through Gut Microbiota-Dependent DNA Methylation in Colonic Epithelial Cells Downloaded from Kyoko Takahashi, Yutaka Sugi, Kou Nakano, Tetsuro Kobayakawa, Yusuke Nakanishi, Masato Tsuda, Akira Hosono and Shuichi Kaminogawa

ImmunoHorizons 2020, 4 (4) 178-190 http://www.immunohorizons.org/ doi: https://doi.org/10.4049/immunohorizons.1900086 http://www.immunohorizons.org/ http://www.immunohorizons.org/content/4/4/178 This information is current as of September 30, 2021.

Supplementary http://www.immunohorizons.org/content/suppl/2020/04/14/4.4.178.DCSupp Material lemental References This article cites 40 articles, 11 of which you can access for free at: by guest on September 30, 2021 http://www.immunohorizons.org/content/4/4/178.full#ref-list-1 by guest on September 30, 2021 Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://www.immunohorizons.org/alerts

ImmunoHorizons is an open access journal published by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. ISSN 2573-7732. RESEARCH ARTICLE

Innate Immunity

Regulation of Gene Expression through Gut Microbiota- Dependent DNA Methylation in Colonic Epithelial Cells

Kyoko Takahashi, Yutaka Sugi, Kou Nakano, Tetsuro Kobayakawa, Yusuke Nakanishi, Masato Tsuda, Akira Hosono, and Shuichi Kaminogawa College of Bioresource Sciences, Nihon University, Fujisawa-shi, Kanagawa 252-0880, Japan Downloaded from

ABSTRACT A huge number of commensal inhabit the intestine, which is equipped with the largest immune system in the body. Recently, http://www.immunohorizons.org/ the regulation of various physiological functions of the host by these bacteria has attracted attention. In this study, the effects of commensal bacteria on gene expression in colonic epithelial cells (CoECs) were investigated with focus on regulation of DNA methylation. RNA sequencing analyses of CoECs from conventional, germ-free, and MyD882/2 mice indicated that, out of the affected by commensal bacteria, those downregulated in a MyD88-independent manner were most frequently observed. Furthermore, when the 59 regions of genes downregulated by commensal bacteria in CoECs were captured using a customized array and immunoprecipitated with the anti-methyl cytosine Ab, a certain population of these genes was found to be highly methylated. Comprehensive analysis of DNA methylation in the 59 regions of genes in CoECs from conventional and germ-free mice upon pull- down assay with methyl-CpG–binding domain 2 directly demonstrated that DNA methylation in these regions was influenced by commensal bacteria. Actually, commensal bacteria were shown to control expression of Aldh1a1, which encodes a retinoic acid–producing enzyme and plays an important role in the maintenance of intestinal homeostasis via DNA methylation in the by guest on September 30, 2021 overlapping 59 region of Tmem267 and 3110070M22Rik genes in CoECs. Collectively, it can be concluded that regulation of DNA methylation in the 59 regions of a specific population of genes in CoECs acts as a mechanism by which commensal bacteria have physiological effects on the host. ImmunoHorizons, 2020, 4: 178–190.

INTRODUCTION it is difficult to determine whether such differences in gut microbiota are the cause or the result of these diseases, studies The significance of gut microbiota in the maintenance of health have demonstrated that change in microbiota or specificbacteria has recently attracted considerable attention, as increasing evidence is actually involved in the onset, pathogenesis, and prevention of demonstrates that the gut microbiota regulates various physiolog- the diseases (10–12). Therefore, many efforts have been made to ical functions of the host (1–4). In accordance with this, it has been prevent the onset or alleviate the symptoms of the diseases by shown that dysbiosis of the intestinal ecosystem is correlated with intervention to the gut microbiota (13–17). a wide variety of diseases, including inflammatory bowel disease, As the intestine is equipped with the largest immune system allergy, cancer, autism, and metabolic syndrome (3, 5–9). Although in the body, it is considered that commensal bacteria affect the

Received for publication October 11, 2019. Accepted for publication March 17, 2020. Address correspondence and reprint requests to: Dr. Kyoko Takahashi, Department of Applied Biological Science, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa-shi, Kanagawa 252-0880, Japan. E-mail address: [email protected] The sequences presented in this article have been submitted to DNA Data Bank of Japan Sequence Read Archive (https://www.ddbj.nig.ac.jp/dra) under accession numbers DRA008905, DRA008906, and DRA008907. This study was supported in part by grants from the Japan Society for the Promotion of Science (KAKENHI 17K07801) and Nagase Science and Technology Foundation (to K.T.). Abbreviations used in this article: CoEC, colonic epithelial cell; CV, conventional; DDBJ, DNA Data Bank of Japan; GF, germ-free; IEC, intestinal epithelial cell; IP, immunoprecipitation; LMD, laser microdissection; MBD2, methyl-CpG–binding domain protein 2; NGS, next-generation sequencing; qRT-PCR, quantitative RT-PCR; Reg3, regenerating islet-derived 3; RNAi, RNA interference; RNA-seq, RNA sequencing; SCFA, short chain fatty acid; SIEC, small IEC; TE, Tris–EDTA; WT, wild-type. The online version of this article contains supplemental material. This article is distributed under the terms of the CC BY 4.0 Unported license. Copyright © 2020 The Authors

178 https://doi.org/10.4049/immunohorizons.1900086

ImmunoHorizons is published by The American Association of Immunologists, Inc. ImmunoHorizons EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS 179 development and function of the intestinal immune system, par- by the Nihon University Animal Care and Use Committee and ticularly in the period immediately after birth when the immune conducted in accordance with their guidelines. system is in the process of maturation (18–20). Moreover, specific mechanisms might be required to establish andmaintainsymbiosis IEC preparation with commensal bacteria in the intestine considering that com- Small IECs (SIECs) and CoECs were prepared from the whole mensal bacteria are immunologically recognized as foreign Ags but smallintestine and the whole colonof mice, respectively.Epithelial are not excluded completely. Although induction of immune reac- cell preparation was performed as described previously (25). After tionsinvolvesinflammation, inflammatory reactions are strictly removing Peyer patches, the tissues were cut into 2–3-mm pieces controlled at low physiological levels in the intestine despite such a andwashedinHBSSsupplementedwith1mMDTTand0.5mM large amount of bacterial Ags. Actually, excessive inflammation is EDTA accompanied by shaking. The tissues were then treated often observed in diseases associated with dysbiosis. Interestingly, with dispase (BD Biosciences, Franklin Lakes, NJ) to collect intestinal bacteria themselves contribute to this regulation by single-cell suspensions. Lymphocytes were depleted by MACS affecting host cells; however, the precise molecular mechanisms using Dynabeads M-450 Streptavidin (Invitrogen, Thermo Fisher remain to be elucidated. Scientific) and biotin-conjugated anti-CD45 Ab (eBioscience, San Based on this context, elucidation of the physiological effects of Diego, CA). Downloaded from commensal bacteria on host cells becomes key evidence to clarify the role of commensal bacteria in intestinal homeostasis. For this Cell culture purpose, the effects of commensal bacteria on gene expression in The mouse IEC line CMT-93 developed from rectal carcinoma intestinal epithelial cells (IECs) covering the intestinal mucosa and was purchased from DS Pharma Biomedical (Osaka, Japan) and the underlying regulatory mechanisms were investigated in this cultured in DMEM supplemented with 10% (v/v) FBS (Biowest, http://www.immunohorizons.org/ study. IECs form a front line of defense by separating the intestinal Nuaillé, France), 100 U/ml penicillin, 100 mg/ml streptomycin, tract from the internal milieu and are usually exposed to commen- and 5 3 1025 M 2-ME at 37°C in a humidified incubator with sal bacteria inhabiting the intestinal tract. Therefore, commensal 5% CO2. bacteria have a great impact on gene expression in IECs. In addition, it has been shown that commensal bacteria confer RNA sequencing epigenetic effects to specific genes in IECs (21–23). DNA meth- Total RNA was prepared from SIECs and CoECs of WT-CV, ylation, as well as posttranslational histone modifications and MyD882/2-CV, and WT-GF mice by pooling from six to eight mice noncoding RNA, are important mechanisms mediating epigenetic per group using the High Pure RNA Isolation Kit (Roche, Basel, regulation of gene expression. We previously reported that DNA Switzerland). RNA sequencing (RNA-seq) was performed by methylation of the gene encoding TLR4, an innate immune INFOBIO (Tokyo, Japan). Briefly, mRNA was extracted, reverse by guest on September 30, 2021 receptor that recognizes LPS of Gram-negative bacteria, in colonic transcribed, treated with restriction enzyme NlaIII, and ligated epithelial cells (CoECs) is induced by commensal bacteria (23). As with adaptor sequences. The library was prepared by processing stimulation with LPS through TLR4 induces strong inflammatory the tag with EcoP15I and analyzed using Genome Analyzer IIx reactions, stringent control of TLR4 gene expression is required to (Illumina, San Diego, CA). DNA sequences originated from the prevent excessive inflammation and thereby maintain homeostasis library were extracted from the resulting reads, and CATG in the intestinal ecosystem; this means that commensal bacteria sequence was added to the 59 ends. The acquired tags (26 bp from themselves contribute to establish the symbiotic relationship with the 59 end) were then mapped to Mus musculus mRNA reference the host in the intestine. Although it has been shown that com- sequences (National Center for Biotechnology Information mensal bacteria have potential effects on gene expression and RefSeq; ftp://ftp.ncbi.nlm.nih.gov/refseq/M_musculus/mRNA_ modulate DNA methylation of specificgenes,itremainstobe Prot/) using Maq 0.7.1 (Wellcome Trust Sanger Institute). To clarified for majority of genes how the change in DNA methylation comparemRNAexpressionamongCV,MyD88,andGFmice,tag by commensal bacteria is involved in transcriptional regulation. In numbers obtained for each gene were corrected to the total this study, the effects of commensal bacteria on gene expression numbers of tags obtained (22,577,586, 21,832,965, and 24,226,181 and DNA methylation in IECs were analyzed comprehensively to for CV, GF, and MyD882/2, respectively). If these corrected determine their relationship. values differed by more than 3-fold between CV and GF mice, except for genes with unquantifiable or low expression to which only one digit tags were mapped in both CV and GF mice, the MATERIALS AND METHODS expression of the corresponding gene was considered to be affected by commensal bacteria. MyD88 dependency for regu- Mice lation of these genes by commensal bacteria was determined if Wild-type (WT) and MyD882/2 BALB/c mice were purchased the values from results of MyD882/2 mice were close to those of from CLEA Japan (Tokyo, Japan) and Oriental BioService (Kyoto, CV or GF mice. Next-generation sequencing (NGS) data have Japan), respectively. Mice were bred under conventional (CV) or been deposited in the DNA Data Bank of Japan (DDBJ) germ-free (GF) conditions as described previously (24). Female Sequence Read Archive (https://www.ddbj.nig.ac.jp/dra) under mice were used at 9–13 wk of age. All experiments were approved accession number DRA008906.

https://doi.org/10.4049/immunohorizons.1900086 180 EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS ImmunoHorizons

Quantitative RT-PCR DNA. Sequences of the synthetic oligonucleotides used as PCR For the quantitative analysis of mRNA expression, total RNA was primers are as follows: 59-GGTGGAGAGTTGAGGTTTTTTGTG- prepared from cells using the High Pure RNA Isolation Kit 39 (forward) and 59-CCCCTAACCCAAACTACCTTCATC-39 (re- (Roche). Total RNA was then reverse-transcribed using Super- verse). PCR products were cloned into the pCR2.1 vector, and Script IV Reverse Transcriptase (Invitrogen, Thermo Fisher nucleotide sequences of 16–17 independent clones were analyzed.

Scientific) and oligo(dT)20 primers (Invitrogen, Thermo Fisher Scientific). SYBR Green I Master reagent (Roche) was used to RNA interference quantify cDNA by real-time PCR using LightCycler 480 (Roche) To construct plasmids for RNA interference (RNAi) against with the cycling condition of 95°C for 10 s, 58°C for 10 s, and 72°C Tmem267 and 3110070M22Rik RNAi, synthetic oligo DNA listed for 12 s. The relative expression of each gene was calculated from below was respectively annealed by denaturing at 95°C for 4 min the calibration curve created using a dilution series of standard and subsequently cooling: Tmem267 forward, 59-TGCTG samples followed by normalization to that of Gapdh.Specific TACATCAGGAATGAGCACAGGGTTTTGGCCACTGACTGA amplification of each gene was confirmed by melting curve CCCTGTGCTTTCCTGATGTA-39; Tmem267 reverse, 59-CCT analysis. Information on primers is provided in Supplemental GTACATCAGGAAAGCACAGGGTCAGTCAGTGGCCAAAACC Table I. CTGTGCTCATTCCTGATGTAC-39; 3110070M22Rik RNAi Downloaded from forward, 59-TGCTGTCATGATCCAGCCTTGAACTTGTTTT Methyl-CpG–binding domain protein 2 pull-down assay GGCCACTGACTGACAAGTTCAACTGGATCATGA-39;and Genomic DNA was prepared from CoECs of CV or GF mice by 3110070M22Rik reverse, 59-CCTGTCATGATCCAGTTGAAC pooling from two independent experiments (six to seven mice per TTGTCAGTCAGTGGCCAAAACAAGTTCAAGGCTGGATC experiment) and fragmented by nebulization (N 0.23 MPa, 6 min) ATGAC-39

2 http://www.immunohorizons.org/ in shearing buffer (Tris–EDTA [TE; pH 8], 10% glycerol). Sheared Double-stranded oligo DNA thus obtained was introduced into DNA was end repaired, followed by dA-tailing and adaptor ligation the pCDNA6.2-GW/EmGFP-miR vector, respectively, using the using the NEBNext DNA Sample Prep Master Mix Set (New BLOCK-iT PolII miR RNAi Expression Vector Kit (Invitrogen, England Biolabs, Ipswich, MA) according to the manufacturer’s Thermo Fisher Scientific). Resulting clones or the negative control instructions. DNA fragments obtained were electrophoresed on plasmid provided with the kit were introduced into CMT-93 cells agarose gel, cut out from the gel for purification using a Gel using the X-tremeGene HP Reagent (Roche). After selecting Extraction Kit (QIAGEN, Hilden, Germany). Then, methylated transfected cells with 4 mg/ml blasticidin for 10–14 d, total RNA DNA fragments were precipitated with methyl-CpG–binding was prepared for quantitative RT-PCR (qRT-PCR) analysis. domain protein 2 (MBD2)–coupled beads using the MethylMiner Methylated DNA Enrichment Kit (Applied Biosystems, Thermo Western blotting by guest on September 30, 2021 Fisher Scientific), as described in the protocol supplied by the Cells were washed with ice-cold PBS and incubated on ice for manufacturer. DNA fragments collected were amplified by PCR 30mininthelysisbuffer (20 mM Tris [pH 7.5], 150 mM NaCl, using adaptersequencesas primersaccordingto the user’s guide of 1mMEDTA,60mMn-octyl-b-D-glucoside, and 1% Nonidet P-40) the NimbleGen SeqCap EZ Library SR (Roche). The library thus supplemented with protease inhibitor mixture (Nacalai Tesque, prepared was analyzed using HiSeq 2000 (Illumina) to acquire Kyoto, Japan). After centrifugation at 4°C, 20,000 3 g,for10min, 101-bp single-end reads at INFOBIO. Identified reads were the supernatants were collected. The protein content of the lysates mapped to the mouse genome (mm10) using the Burrows– was measured using the BCA Protein Assay Kit (Pierce, Thermo Wheeler Aligner (version 0.6.2-r126) and then annotated to the Fisher Scientific), and equal amounts of protein were analyzed by regions near the transcription start site of each gene (from nt 21000 immunoblotting using anti-ALDH1A1 (ab52492; Abcam, Cam- to +501 on both the same and the opposite strands; nucleotide bridge, U.K.) and anti–b- (ab49900; Abcam) Abs. numbers are counted from the transcription start site as +1). Extracted reads were compared quantitatively between CV and Laser microdissection GF mice. NGS data have been deposited in the DDBJ Sequence Small intestine and colon were surgically excised from mice. Small Read Archive (https://www.ddbj.nig.ac.jp/dra) under accession intestines were divided into five piecesofequal length, and the first number DRA008905. (proximal), the third (medial), and the fifth (distal) parts were used for further experiments. Luminal content was gently washed out Bisulfite sequencing with Ca2+-andMg2+-free Hanks’ balanced salt solution (Sigma- Genomic DNA was prepared from cells using a PureLink Genomic Aldrich, St. Louis, MO) containing 5% FBS and was replaced with DNA Mini Kit (Invitrogen, Thermo Fisher Scientific), and meth- SCEM-L1 embedding medium (Section-lab, Hiroshima, Japan). ylation status of CpG motifs was analyzed as follows. Genomic Tissues were then embedded in SCEM-L1 and cut into 16-mm DNA (1 mg) was denatured with 6 N NaOH and modified by the sections using the HM550 cryostat (Thermo Fisher Scientific). bisulfite conversion reaction using a BisulFast DNA modification Tissue sections were fixed with ethanol and stained with kit (TOYOBO, Osaka, Japan). The 388-bp 59 region (nt 2102/+286; toluidine blue. Laser microdissection (LMD) was performed using nucleotide numbers are counted from the transcription start site as LMD7000 (Leica Microsystems) to capture segments including +1.) of the Tmem267 gene was amplified by PCR from the modified IECs at upper (apical) and bottom (basolateral) portions of villi (as

https://doi.org/10.4049/immunohorizons.1900086 ImmunoHorizons EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS 181 shown in Supplemental Fig. 1). Total RNA was prepared from colon, the effect of commensal bacteria on gene expression in collected tissue segments of approximately equal total area using CoECs was first examined comprehensively. For this purpose, RNeasy Micro Kit (QIAGEN) for quantification of Aldh1a1 mRNA expression in CoECs was compared among WT mice bred expression by qRT-PCR. under CV and GF conditions and MyD882/2 mice bred under CV condition (described as CV, GF, and MyD882/2, respectively) by Sequence capture assay RNA-seq. The numbers of genes showing more than three-fold A customized array with DNA sequences covering the nt 21000/ difference in expression between CV and GF mice are summarized +501 regions of genes showed ,1/3expressioninCoECsofCV in Table I. MyD88 dependency for up- and downregulation by mice than that seen in those of GF mice by RNA-seq was designed commensal bacteria is also specified in Table I based on whether and manufactured by Roche (relevant genes are listed in gene expression in MyD882/2 mice is similar to that in CV or GF Supplemental Table II). Genomic DNA was prepared from CoECs mice. We found that the number of genes downregulated by of CV mice by pooling from two independent experiments (four commensals was larger than those upregulated by commensals mice per experiment). Shearing, end repairing, dA tailing, adaptor (644 and 388, respectively). Interestingly,of the upregulatedgenes, ligation, and purification were carried out as described above. DNA MyD88-dependent regulation was predominant (261/388), whereas, fragments were hybridized onto the customized array. Hybridiza- of the downregulated genes, MyD88-independent regulation was Downloaded from tion, washing, and collection of hybridized DNA fragments were predominant (517/644). performed using the SeqCap EZ Reagent (Roche) according to the manufacturer’s instructions. Collected DNA fragments were Genes encoding antimicrobial peptides, cytokines, and denatured at 95°C for 5 min and then mixed with the anti–5- chemokines are differently regulated by commensal bacteria methylcytosine Ab (clone 33D3; Abcam) at 4°C overnight with in SIECs and CoECs http://www.immunohorizons.org/ rotation in immunoprecipitation (IP) buffer (10 mM Tris-HCl [pH Tables II and III respectively show representative genes that were 8], 150 mM NaCl, 1 mM EDTA, and 0.05% Triton X-100) in the upregulated and downregulated by commensals as seen in the presence of random 20-mer DNA. Ab-bound DNA was then mixed RNA-seq results from CoECs. For example, expression of genes with salmon sperm DNA–treated protein G Dynabeads (Invitro- encoding antimicrobial peptides such as regenerating islet-derived gen, Thermo Fisher Scientific) at 4°C for 2 h with rotation. After 3 (Reg3) and a- were markedly affected by commensal five washes with the IP buffer and a subsequent wash with TE, bacteria. Notably, expression of Reg3b and Reg3g was induced immunoprecipitated DNA was eluted in TE (pH 8) supplemented by commensals in a MyD88-dependent manner. In contrast, with 0.25% SDS and 500 mg/ml proteinase K at 55°C for 2 h and several a-, including 5, 20, 1, and 24, were downregulated was purified using the MinElute Reaction Cleanup Kit (QIAGEN). by commensals; the former two were suppressed in a MyD88- TheeluentsandinputcontrolbeforeIPwereamplified by PCR independent manner, and in contrast, the latter two were sup- by guest on September 30, 2021 using adapter sequences as primers and were purified with the pressed in a MyD88-dependent manner. MinElute Reaction Cleanup Kit in the presence of random 20-mer Next, the expression of a-Defensin 1, a-Defensin 5,andReg3b in DNA as described in the NimbleGen SeqCap EZ Library SR User’s SIECs and CoECs of CV, GF, and MyD882/2 mice were quantified Guide. Libraries obtained were subjected to NGS to acquire 50-bp, by qRT-PCR (Fig. 1A). Results from CoECs were similar to those single-end reads using HiSeq 2000 (Illumina) at INFOBIO. obtained by RNA-seq. However, expression patterns were Identified reads were mapped to the mouse genome (mm9) using different between SIECs and CoECs; a-Defensin 1 and 5 showed Maq (version 0.7.1) and then annotated to nt 21000/+501 regions lower expression in CoECs of CV mice than in those of GF mice, of genes whose expression was ,1/3 in CoECs of CV mice than in but they were expressed at higher levels in SIECs of CV mice than those of GF mice. NGS data have been deposited in the DDBJ in those of GF mice. In addition, the suppression of a-Defensin 1 by Sequence Read Archive (https://www.ddbj.nig.ac.jp/dra) under commensal bacteria in CoECs was MyD88 dependent, whereas accession number DRA008907.

Statistics TABLE I. Up- and downregulated genes in CoECs by commensals ff Di erences between two or more groups were analyzed by two- Upregulation Downregulation tailed Student t test or one-way ANOVA followed by Dunnett test (CV . GF) (CV , GF) or Tukey test, respectively. A p value ,0.05 was considered MyD88 119 517 statistically significant. independent Intermediate 8 11 MyD88 dependent 261 116 RESULTS Total 388 644 Gene expression was systematically analyzed by RNA-seq using RNA prepared from CoECs of CV, GF, and MyD882/2 mice. Numbers of genes expressed Commensal bacteria regulate gene expression in IECs in more than 3.0-fold (upregulation by commensal bacteria) or ,1/3 (down- both MyD88-dependent and -independent manners regulation by commensal bacteria) in CV mice than in GF mice are shown. MyD88 dependency was considered based on whether the gene expression in As IECs receive the stimulation from commensal bacteria at the MyD882/2 mice is closer to that in CV mice (MyD88 independent) or GF mice front line and more than 99% of the intestinal bacteria inhabit the (MyD88 dependent) or just middle of these (intermediate).

https://doi.org/10.4049/immunohorizons.1900086 182 EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS ImmunoHorizons

TABLE II. Genes induced by commensals in CoECs obtained from CoECs of CV and GF mice were pulled down using Gene CV GF MyD882/2 MBD2-coupled beads and analyzed by NGS to compare CpG MyD88-independent methylation in the 59 regions of genes between these mice. The Delta-like non-canonical Notch 126 4 83 reads mapped to the region from nt 21000 to nt +501 were ligand 1 (Dlk1) extracted and compared between CV and GF mice for each gene ATP/GTP binding protein-like 2 107 8 78 (Fig. 2). Out of 30,395 transcription start sites, 23 and 453 sites (Agbl2) showed more than 2.0-fold and 1.5-fold change in the annotation Angiogenin, RNase A family, 2773 269 43,569 frequency between CoECs from CV and GF mice, respectively member 4 (Ang4) Gasdermin C4 (Gsdmc4) 3240 408 4102 (Table IV). These included both types of genes methylated at Phospholipase A2, group IIA (Pla2g2a) 285 49 544 higher and lower levels in CoECs of CV mice than in those of GF Phospholipase A2, group III (Pla2g3) 148 34 116 mice. The results directly demonstrated that commensal bacteria TGF, b 1(Tgfb1)681456affectDNAmethylationinthe59 regions of specific genes. NO synthase 2, inducible (Nos2)461289 Solute carrier family 30, member 10 1080 287 940 (Slc30a10) Aldh1a1 expression is regulated by commensal bacteria in Downloaded from MyD88-dependent CoECs via DNA methylation of Tmem267 and Regenerating islet-derived 3 b 25,426 2111 1908 3110070M22Rik genes (Reg3b) The 59 regions of Tmem267 and 3110070M22Rik encoding a Regenerating islet-derived 3 g 71 2 0 transmembrane protein 267 and a noncoding RNA, respectively, (Reg3g) showedhighermethylationinCVmicethaninGFmice(TableV). Chemokine (C-X-C motif) ligand 1 908 252 239 These genes are closely located on different DNA strands of (Cxcl1) http://www.immunohorizons.org/ TNF (Tnf) 707 145 164 13 in mice as shown Fig. 3A. Methylation frequencies IL-17C (Il17c)39312of CpG motifs present inthe overlapping59 region of these genes in Fucosyltransferase 2 (Fut2) 1199 340 569 CoECs from CV and GF mice were further analyzed by bisulfite Cytochrome P450, family 3, subfamily 290 11 64 sequencing. Similar to the results of the MBD2 pull-down assay, a, polypeptide 44 (Cyp3a44) methylation frequency was significantly higher in CV mice than in Cytochrome P450, family 2, subfamily 33,206 4752 10,046 GF mice (Fig. 3B, 3C). In accordance with these results, gene c, polypeptide 55 (Cyp2c55) Aquaporin 4 (Aqp4) 5745 862 1128 Carbonyl reductase 2 (Cbr2) 533 87 232 TABLE III. Genes suppressed by commensals in CoECs Chloride intracellular channel 6 98 13 30 2/2 (Clic6) Gene CV GF MyD88 Representatives of genes induced by commensals in CoECs in MyD88- MyD88-independent by guest on September 30, 2021 independent (upper) and -dependent (lower) manner. Numbers of reads Defensin a5(Defa5) 0 143 0 mapped to each corresponding gene in CV, GF, and MyD882/2 are shown Defensin a20 (Defa20) 0 47 0 accordingly. Values are corrected by the total reads obtained for each sample. C-C chemokine ligand 25 (Ccl25) 125 934 150 C-C chemokine ligand 11 (Ccl11) 7 45 20 Amylase 2a (Amy2a2, 3, 4) 93 1025 9 that of a-Defensin 5 was MyD88 independent. As a-defensin is Sucrase-isomaltase (Sis) 25 868 36 (a-glucosidase) mainly produced in the epithelium of the small intestine, which Solute carrier family 2 member 5 47 158 15 contains Paneth cells, the expression levels of a-Defensin 1 and (Slc2a5) (fructose transporter) 5 were much higher in SIECs than in CoECs, whereas the Apolipoprotein A-I (Apoa1) 2 146 4 expression of Reg3b was almost comparable in these cells. Fatty acid binding protein 4 (Fabp4) 17 129 3 Expression of genes encoding some chemokines such as CCL25, Carboxypeptidase A1 (Cpa1) 4 92 0 CCL11, and CXCL1 and cytokines such as TGF-b1, TNF, and IL- Cytochrome P450 (Cyp4b1) 724 2322 670 ff Adenylate cyclase 9 (Adcy9) 34 132 65 17C were also a ected by commensals (Tables II, III). When the IL-22R (Il22ra1)103819 expression of Ccl25 and Cxcl1 in SIECs and CoECs was quantified Calcium/calmodulin-dependent 0120 by qRT-PCR (Fig. 1B), the effect of commensal bacteria on the II a (Camk2a) expression of these chemokine genes was not found to be as MyD88-dependent significant in SIECs as compared with that seen in CoECs. Defensin a1(Defa1) 8 1321 873 Defensin a24 (Defa24) 8 1341 873 Adenosine A1R (Adora1) 7 39 80 Commensal bacteria affect DNA methylation in the Inositol 1,4,5-trisphosphate 3-kinase 13 47 31 59 regions of specific genes in CoECs A(Itpka) We previously reported that commensal bacteria induce DNA Folate receptor 1 (Folr1) 1 12 9 + + methylation of the gene encoding TLR4, which acts as a sensor for H -K -ATPase (Atp12a) 793 2479 2373 Gram-negative bacteria, in CoECs (23). Thus, we focused on DNA Representatives of genes suppressed by commensals in CoECs in MyD88- independent (upper) and -dependent (lower) manner. Numbers of reads methylation as a mechanism underlying the regulation of gene mapped to each corresponding gene in CV, GF, and MyD882/2 are shown expression by commensal bacteria. Genomic DNA fragments accordingly. Values are corrected by the total reads obtained for each sample.

https://doi.org/10.4049/immunohorizons.1900086 ImmunoHorizons EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS 183 Downloaded from http://www.immunohorizons.org/ by guest on September 30, 2021

FIGURE 1. Gut microbiota differently regulates antimicrobial peptide and chemokine expression in SIECs and CoECs. Total RNA was prepared from SIECs and CoECs of CV, GF, and MyD882/2 mice to quantify mRNA expression of antimicrobial peptides (A) and chemokines (B) by qRT-PCR. Values are normalized using GAPDH mRNA levels and expressed as percentages relative to their expression in SIECs of CV mice. Results are expressed as mean 6 SD of four to five independent experiments. Five or six mice were used for each experiment. *p , 0.05, **p , 0.01, ***p , 0.005, ****p , 0.001, *****p , 0.0005 by Tukey test.

https://doi.org/10.4049/immunohorizons.1900086 184 EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS ImmunoHorizons expression of both Tmem267 and 3110070M22Rik was found to be TABLE IV. Effect of commensals on DNA methylation in the 59 regions lower in CV mice than in GF mice (Fig. 3D). of genes in CoECs As the function of Tmem267 is unknown, the effect of No. of Genes Tmem267 knockdown by RNAi in a CoEC line CMT-93 was .1.5-Fold change 453 analyzed. As shown in Fig. 4A, it was confirmed that expression of .2.0-Fold change 23 Tmem267 and 3110070M22Rik was significantly suppressed by Genomic DNA fragments of CoECs from CV and GF mice were pulled down using MBD2-coupled beads and analyzed by NGS. Values represent numbers of each corresponding RNAi.In addition, unexpectedly,RNAi against genes with indicated quantitative differences in the reads mapped to their 59 3110070M22Rik also caused decreased expression of Tmem267. region between CV and GF mice. The effect of RNAi against Tmem267 or 3110070M22Rik on expression of various genes in IECs was then analyzed. Suppression of Tmem267 markedly decreased the expression of of Tmem267 and 3110070M22Rik expression via DNA methylation Aldh1a1 encoding RALDH1, an enzyme mediating the conversion of 59 regions of these genes. Furthermore, Aldh1a1 expression of retinal, derived from vitamin A, to retinoic acid, whereas it did tended to be lower in the distal small intestine and colon, which are not affect tight junction-related (Occuldin and Zo-1), inhabited by a large number of commensal bacteria, than in the pattern recognition receptors (Tlr2 and Tlr4), and negative proximal and medial small intestine. However, because this Downloaded from regulator of TLR signaling (Tollip) (Fig. 4B, Supplemental Fig. 2). tendency was observed in both CV and GF mice, additional factors In addition, suppression of 3110070M22Rik similarly caused a other than the commensal bacteria, such as food components in decrease in Aldh1a1 expression. RALDH1 protein expression was the upper small intestine, could also influence the expression of also significantly decreased by knockdown of Tmem267 and Aldh1a1. In addition, Aldh1a1 expression was tended to be higher in 3110070M22Rik (Fig. 4C). apical portions than in basolateral portions of the villus epithelium, http://www.immunohorizons.org/ The expression of Aldh1a1 in the epithelium from various particularly in the proximal small intestine. intestinal regions including proximal, medial, and distal small intestine and colon of CV and GF mice was further analyzed by A part of the 59 regions of genes suppressed by commensal LMD, followed by RNA extraction and qRT-PCR (Fig. 4D). bacteria is highly methylated Aldh1a1 expression was lower in the epithelial tissues of CV mice As specific gene expression seemed to be regulated by DNA than in those of GF mice in all intestinal portions. These results methylation in the 59 region in CoECs, we examined the methyl- indicated that commensal bacteria suppress Aldh1a1 expression in ation status in the 59 regions of the 644 genes downregulated to the intestinal epithelium in vivo, probably through the suppression ,1/3 by commensals, as shown in Table I. For this analysis, genomicDNAfragmentsfromCoECsofCVmicewerehybridized using an array with sequences in the 59 regions (nt 21000/

10 by guest on September 30, 2021 +501) of 562 out of 644 genes whose transcription start sites could be identified. The captured DNA fragments were then immuno- precipitated with the anti–5-methylcytosine Ab and analyzed by NGS. Figure 5 shows frequencies of the reads mapped to the nt 21000/+501regionofeach target generelativetothe total number 1 of reads before (input) and after IP. Reads that were mapped to the nt 21000/+501 region were detected for 510 out of 562 genes after IP, indicating that these genes were possibly methylated. Moreover, reads were mapped with high frequency to some spe- cific genes in IP sample, whereas remarkable difference in their frequency was not observed among the genes in input sample, ratio of annotation frequency of frequency ratio CV) annotation (GF vs. 0.1 fi 1 showing that speci c genes among those downregulated by 692 2765 3456 4147 1383 2074 4838 5529 6220 6911 7602 8293 8984 9675 29714 11748 15203 15894 16585 17276 20040 20731 21422 22113 23495 25568 26259 29023 10366 11057 12439 13130 13821 14512 17967 18658 19349 22804 24186 24877 26950 27641 28332 commensals in CoECs were highly methylated. In contrast, as 1 30395 reads that were mapped to 35 genes were obtained from the input Genes sample, but not from the IP sample, these genes were judged to be FIGURE 2. Gut microbiota alters DNA methylation frequencies in the unmethylated. Reads mapped to the remaining 17 genes were not 59 regions of genes. detected in input sample. To compare the DNA methylation patterns, genomic DNA was pre- Representative genes showing relatively high levels of meth- pared from CoECs of CV and GF mice by pooling from two in- ylation are indicated in Table VI. These include genes related to dependent experiments (six to seven mice per experiment). Genomic the cytoskeleton (Fgd1, Gas7,andMark4)andapoptosis(Tnfrsf25). DNA fragments were pulled down using MBD2-coupled beads and In addition, Table VII summarizes the methylation status in the 59 analyzed by NGS. Identified reads were annotated to 1.5-kb regions region of the 20 genes listed in Table III. Out of these 20 genes, six near the transcription start site (nt 21000/+501) of each gene. The ratio genes showed relatively higher levels of methylation, nine were of annotated read number of GF mice relative to that of CV mice is possibly methylated, and one was not methylated detectably. shown for each gene. Among the six highly methylated genes, Ccl11 encoding the C-C

https://doi.org/10.4049/immunohorizons.1900086 ImmunoHorizons EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS 185 Downloaded from http://www.immunohorizons.org/

FIGURE 3. Gut microbiota suppresses expression of Tmem267 and 3110070M22Rik genes through induction of DNA methylation in their overlapping 59 region. (A) Positional relationship of Tmem267 and 3110070M22Rik genes on chromosome 13. (B and C) Genomic DNA was prepared from CoECs of CV and GF mice by pooling from two independent experiments (five to six mice per experiment), respectively. Methylation of 27 CpG motifs in the 59 region of Tmem267 and 3110070M22Rik genes was analyzed by the bisulfite reaction. Analysis was performed for 16–17 independent clones. In (B), filled and open circles present methylated and unmethylated motifs, respectively, and clones are arranged in order of their methylation frequency. Data are summarized in (C) as mean 6 SD of methylated CpG motifs for the total 27 motifs in the region. (D) Total RNA was prepared from CoECs of CV and GF mice to analyze expression of Tmem267 and 3110070M22Rik by qRT-PCR. Results are expressed as mean 6 SD of seven independent experiments. Each experiment was conducted using five to six mice per group. *p , 0.05, **p , 0. 005 by two-tailed Student t test. by guest on September 30, 2021 chemokine ligand 11, which recruits eosinophils; Folr1 encoding Next, we focused on the genes categorized as unmethylated and folate receptor a, which is known to be overexpressed in various methylated by this assay. Out of the 35 unmethylated genes, data of epithelial-derived cancers including colorectal cancer; and methylation in GF and CV mice were obtained for 25 genes by Slc2a5 encoding a fructose transporter were included. The MBD2 pull-down assay. When the GF versus CV ratio of methyl- DNA fragments corresponding to the 59 regions of the remaining ation levels were compared between these 25 genes and the top 25 four genes were not detected in the input sample and were methylated genes selected in descending order of IP versus input therefore considered not efficiently collected by the sequence ratios of read count percentages, they were significantly different capture array. (p , 0.05). The average ratios of GF to CV were 1.06 for the genes Further, methylation levels in the 59 region of the genes analyzed categorized as unmethylated and 0.964 for the genes categorized as in this assay were compared between GF and CV mice by linking the methylated. Taken together, these results indicate that for a part of data of MBD2 pull-down assay. The average ratio of methylation the gene population analyzed, DNA methylation is induced by levels in GF mice to that in CV mice was 1.01 for the entire gene commensal bacteria in the 59 regions, showing that induction of population analyzed in this assay. Thus, it can be inferred that no DNA methylation is one mechanism by which commensal bacteria difference was found in the methylation levels between these mice. mediate the downregulation of genes in CoECs.

TABLE V. Comparison of DNA methylation in the 59 region of Tmem267 and 3110070M22Rik genes in CoECs between CV and GF mice CV Strand GF Strand Same Opposite Total Same Opposite Total Tmem267 301 240 541 97 88 185 3110070M22Rik 240 298 538 86 96 182 Results for the MBD2 pull-down analysis showing DNA methylation in the 59 region (nt 21000/+501) of Tmem267 and 3110070M22Rik in CoECs from CV and GF mice are summarized. The numbers of reads mapped respectively to the same and the opposite strand as the gene, and those of the total are shown.

https://doi.org/10.4049/immunohorizons.1900086 186 EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS ImmunoHorizons Downloaded from http://www.immunohorizons.org/ by guest on September 30, 2021

FIGURE 4. Tmem267 induces expression of Aldh1a1, which produces retinoic acid, an immunomodulator in the intestine, in CoECs. The mouse IEC line CMT-93 was transfected with Tmem267 or 3110070MRik small interfering RNA (siRNA) expression vector. After selection of transfected cells with blasticidin for 10–14 d, cells were collected for qRT-PCR and Western blotting analyses. (A) To confirm the effect of RNAi, expression of Tmem267 or 3110070MRik in transfected cells was quantified. Results are expressed as mean 6 SD of three independent experiments. (B) The effect of RNAi for Tmem267 and 3110070MRik on Aldh1a1 mRNA expression was analyzed by qRT-PCR. Results are expressed as mean 6 SD of three independent experiments. (C) The effect of RNAi for Tmem267 and 3110070MRik on RALDH1 protein expression was analyzed by Western blotting. Representative blots of an experiment performed in duplicate (left) and the mean 6 SD of the relative band (Continued)

https://doi.org/10.4049/immunohorizons.1900086 ImmunoHorizons EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS 187 Downloaded from

FIGURE 5. A part of gene population downregulated by commensals is methylated at relatively high levels in their 59 regions. Genomic DNA was prepared from CoECs of CV mice by pooling from two independent experiments (four mice per experiment). The genomic DNA fragments corresponding to the sequences in nt 21000/+501 regions of 562 genes that were downregulated by commensals were captured using a customized array, immunoprecipitated with the anti-methylcytosine Ab, and analyzed by NGS. Frequencies of the reads mapped to each target http://www.immunohorizons.org/ gene relative to the total number of reads before (input, red) and after (IP, blue) IP are shown.

DISCUSSION molecules such as apolipoprotein and fatty acid binding protein were also found to be downregulated in CoECs by commensals in a Comprehensive analysis of mRNA expression in CoECs by MyD88-independent manner (Table III), indicating that com- comparison of results from CV and GF mice showed that a greater mensal bacteria might affect immune and inflammatory responses number of genes was downregulated by commensal bacteria than and also metabolism of the host through the regulation of gene those upregulated by them. In addition, a large proportion of the expression in IECs. As digestion and absorption mainly occur in the small intestine rather than the colon, regulation of these genes downregulated genes was suppressed by commensals in a MyD88- by guest on September 30, 2021 independent manner (Table I). These results suggest that the in the small intestine needs to be analyzed. Other types of regu- expression of a large number of genes in CoECs is suppressed by lation by commensal bacteria than MyD88-independent down- commensal bacteria through their metabolites rather than their regulation of genes might also contribute to intestinal homeostasis. cellular constituents. In fact, the expression of a-Defensin 5 in For example, MyD88-dependent induction of fucosyltransferase 2 CoECs was suppressed by commensal bacteria almost completely (Fut2) in CoECs was observed (Table II) as previously reported in a MyD88-independent manner (Fig. 1), indicating that bacterial (26). Fut2 fucosylates glycans on the surface of the intestinal metabolites suppress expression of this gene in CoECs. In- epithelium and is known to serve as an attachment receptor and terestingly, it was shown that the expression of a-Defensin 5 gene a nutrient source for specific bacteria, suggesting its role in was upregulated by commensals through their constituents in establishing intestinal symbiosis and preventing diseases (27–30). SIECs (Fig. 1). Given that commensal bacteria are found in greater The DNA methylation status of a specificpopulationofgenes abundance in the colon as compared with the small intestine and was shown to be altered by gut microbiota. For instance, commen- the composition of microbiota differs between these intestinal sal bacteria-induced methylation of CpG motifs in the overlapping portions, CoECs and SIECs might have different regulatory 59 region of Tmem267 and 3110070M22Rik suppressed the mechanisms for genes that encode key molecules involved in host expression of these genes (Fig. 3). Furthermore, these genes were defense and immune responses. found to regulate the expression of RALDH1; this is the first report, In addition to immune-related genes, those encoding enzymes to our knowledge, showing the function of Tmem267 in IECs. of the digestive system including amylase, glucosidase, and car- The mechanism by which this transmembrane protein regu- boxypeptidase, fructose transporter, and lipid metabolism-related lates Aldh1a1 expression is yet to be elucidated. Suppression of

intensities normalized to b-actin from three independent experiments (right) are shown. (D) Tissue sections of apical (a) and basolateral (b) portions of villus epithelia of proximal (Pro), medial (Med), and distal (Dis) small intestine and colon (Co) were collected from CV (n =4,open bars) and GF (n = 4, filled bars) mice by LMD and pooled so that the total area was almost equal. Total RNA was extracted from the pooled tissue sections of each intestinal portion to analyze Aldh1a1 mRNA expression by qRT-PCR. *p , 0.05, **p , 0.01 by Dunnett test.

https://doi.org/10.4049/immunohorizons.1900086 188 EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS ImmunoHorizons

TABLE VI. Representative genes with relatively high levels of DNA some suppressive transcription factors. These findings suggest that methylation in their 59 region commensal bacteria contribute to intestinal homeostasis via DNA Gene Input (%) IP (%) methylation of specific genes in CoECs of the host. Thus, commen- FYVE, RhoGEF, and PH domain 0.117 1.448 sal bacteria maintain intestinal symbiosis by themselves through containing 1 (Fgd1) epigenetic control of a specific population of genes in CoECs, which TNFR superfamily, member 25 0.325 3.325 might act as a mechanism supporting the intestinal ecosystem. (Tnfrsf25) Only a few studies within the recent 1–2yhavecomprehensively Growth arrest specific 7 (Gas7) 0.358 2.378 MAP/microtubule affinity-regulating 0.183 1.021 analyzed the status of DNA methylation in IECs in combination ff kinase 4 (Mark4) with mRNA expression. Howell et al. (38) evaluated di erences in Secreted and transmembrane 1A 0.316 1.476 DNA methylation and transcription patterns in IECs between (Sectm1a) inflammatory bowel diseasepatients and controlsbygenome-wide Src-like adaptor 2 (Sla2) 0.291 1.270 DNA methylation and transcriptome analyses. They found that Genomic DNA fragments corresponding to the 59 regions of genes down- IECs from inflammatory bowel disease children before treatment regulated by commensals were captured using a customized array and then immunoprecipitated with anti-methylcytosine Ab. Representative genes with showed alternations in DNA methylation and transcription and Downloaded from relatively high levels of DNA methylation are listed with percentage of reads suggested that it might explain variations in disease outcomes and obtained relative to the total reads for the input and IP samples. thus might be used as prognostic biomarkers. The correlation between clinical outcome and DNA methylation, or transcription, was analyzed not in combination, but separately in their study. 3110070M22Rik upon RNAi decreased not only the expression of In contrast, methylome and transcriptome analyses of SIECs from 3110070M22Rik but also, surprisingly, that of Tmem267 (Fig. 4). CV and GF mice were performed to examine changes during post- http://www.immunohorizons.org/ Although it isnot clear why suppressionof 3110070M22Rik leads to natal development (39). The results showed the presence of both the decrease in Tmem267 expression, the effect of RNAi for microbiota-dependent and -independent processes and further 3110070M22Rik on Aldh1a1 expression is probably caused by the helped to identify 126 genomic loci at which microbiota-dependent suppression of Tmem267 expression. Many studies have focused on RALDH2 expressed in dendritic cells and found that retinoic acid produced by this enzyme plays a crucial key role in IgA TABLE VII. DNA methylation status in the 59 regions of genes production, T cell homing, and regulatory T cell induction in the downregulated by commensal bacteria intestine (31–33). In contrast, however, it has been also suggested Gene Input (%) IP (%) that RALDH1, which is highly expressed in IECs, also affects the Relatively high methylation intestinal immune system because retinoic acid produced from Adenylate cyclase 9 (Adcy9) 0.2331 0.6520 Carboxypeptidase A1 (Cpa1) 0.2081 0.5687 by guest on September 30, 2021 IECs was shown to be important for dendritic cell conditioning C-C chemokine ligand 11 (Ccl11) 0.4162 0.9115 (34, 35). It is considered that gut microbiota epigenetically controls Folate receptor 1 (Folr1) 0.2081 0.4215 specific host genes, Tmem267 and 3110070M22Rik, and thereby Solute carrier family 2 member 5 0.1748 0.2822 regulate RALDH1 expression in CoECs to control the concentra- (Slc2a5) tion of retinoic acid, a key immunomodulator in the intestine. Calcium/calmodulin-dependent 0.3912 0.6104 Interestingly, dietary fiber and short chain fatty acids (SCFAs) protein kinase II a (Camk2a) Possible methylation were shown to increase the expression of Aldh1a1 in SIECs (36). In IL-22R (Il22ra1) 0.2913 0.1760 particular, the effect was observed specifically in the proximal C-C chemokine ligand 25 (Ccl25) 0.1665 0.0856 SIECs, not in CoECs, although gut microbiota is known to produce Inositol 1,4,5-trisphosphate 3-kinase 0.1665 0.0353 SCFAs by metabolizing dietary fiber mainly in the colon. Aldh1a1 A(Itpka) expression in IECs was lower in CV mice than in GF mice in our Apolipoprotein A-I (Apoa1) 0.2913 0.0463 Defensin a5 (Defa5) 0.0250 0.0035 study, indicating that gut microbiota might affect Aldh1a1 Cytochrome P450 (Cyp4b1) 0.3246 0.0401 expression through both SCFA- and Tmem267-mediated manners Fatty acid binding protein 4 (Fabp4) 0.1332 0.0057 differently in SIEC and CoECs. Recently, Grizotte-Lake et al. (37) H+-K+-ATPase (Atp12a) 0.3163 0.0054 reported that commensal bacteria suppress retinoic acid synthesis Defensin a24 (Defa24) 0.0666 0.0005 by IECs to control IL-22 activity and prevent dysbiosis. They Methylation Not Detected Adenosine A1R (Adora1) 0.2580 — showed that expression of Rdh7, another enzyme involved in the Results obtained from sequence capture NGS analysis for the status of retinoic acid synthesis, is suppressed by commensals, suggesting methylation in the 59 region of the genes downregulated by commensals that commensal bacteria regulate expression of multiple enzymes (listed in Table III) are summarized. Percentage of reads obtained relative to the involved in vitamin A metabolism in IECs. total reads for the IP sample [IP (%)] and the input sample [Input (%)] is shown. Relatively high methylation indicates that the proportion of reads relative to the Focusing on the population of genes, whose expression was total reads for the IP sample was higher than that for the input sample; possible downregulated to ,1/3-fold by commensals, a part of these genes methylation indicates that reads were obtained for the IP sample, but the was shown to be actually methylated (Fig. 5, Tables VI, VII). The proportion of the reads relative to the total reads for the IP sample was not higher than that for the input sample; and methylation not detected indicates remaining genes might be suppressed by commensals through that reads were obtained for the input sample but were not obtained for the IP mechanisms other than DNA methylation, such as the binding of sample. —, not detected.

https://doi.org/10.4049/immunohorizons.1900086 ImmunoHorizons EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS 189 alternation of DNA methylation and transcription were both 5. Lo Presti, A., F. Zorzi, F. Del Chierico, A. Altomare, S. Cocca, A. Avola, detected. In our study, integratedanalysisofDNAmethylation F. De Biasio, A. Russo, E. Cella, S. Reddel, et al. 2019. Fecal and fi and transcription by focusing on DNA methylation profiles around mucosal microbiota pro ling in irritable bowel syndrome and in- flammatory bowel disease. Front. Microbiol. 10: 1655. the transcription start sites of genes in CoECs, several genes 6. Herrera, S., J. Martı´nez-Sanz, and S. Serrano-Villar. 2019. HIV, can- encoding key molecules for the maintenance of intestinal homeo- cer, and the microbiota: common pathways influencing different stasis such as cytoskeleton-related molecules, chemokine, receptor, diseases. Front. Immunol. 10: 1466. and transporter were identified as those regulated by microbiota 7. Sudo, N. 2019. Role of gut microbiota in brain function and stress- – through DNA methylation (Tables VI, VII). Interestingly, it was related pathology. Biosci. Microbiota Food Health 38: 75 80. reported that genomic DNA in CoECs of GF mice was hyper- 8. Tilg, H., N. Zmora, T. E. Adolph, and E. Elinav. 2020. The intestinal microbiota fuelling metabolic inflammation. Nat. Rev. Immunol. 20: methylated as compared with that of CV mice (40). Although 40–54. significant difference in methylation frequencies was not observed 9. Vatanen, T., E. A. Franzosa, R. Schwager, S. Tripathi, T. D. Arthur, in regions around the transcription start sites (Fig. 2), and a greater K. Vehik, A.˚ Lernmark, W. A. Hagopian, M. J. Rewers, J. X. She, et al. number of genes were expressed at lower levels in CoECs of CV 2018. The human gut microbiome in early-onset type 1 diabetes from – micethaninthoseofGFmice(TableI),howthegenome-wide the TEDDY study. Nature 562: 589 594.

10. Tanoue, T., S. Morita, D. R. Plichta, A. N. Skelly, W. Suda, Y. Sugiura, Downloaded from methylation status, including that of the regions apart from the S. Narushima, H. Vlamakis, I. Motoo, K. Sugita, et al. 2019. A defined transcription start sites, affectsthefunctionofIECsisyettobe commensal consortium elicits CD8 T cells and anti-cancer immunity. elucidated. Our experiments focusingonDNAmethylationinthe Nature 565: 600–605. 59regions of genes and mRNA expression in CoECs from CV and GF 11. Torres, J., J. Hu, A. Seki, C. Eisele, N. Nair, R. Huang, L. Tarassishin, mice show that modulation of DNA methylation in the 59 regions of B. Jharap, J. Cote-Daigneault, Q. Mao, et al. 2020. Infants born to mothers with IBD present with altered gut microbiome that transfers host genes by commensal bacteria, as well as their metabolites, act abnormalities of the adaptive immune system to germ-free mice. Gut http://www.immunohorizons.org/ as one mechanism for the regulation of gene expression in IECs. 69: 42–51. However, we cannot completely exclude the possibility that the 12. Liao, L., K. M. Schneider, E. J. C. Galvez, M. Frissen, H. U. Marschall, difference of irradiated and nonirradiated diet between the GF H. Su, M. Hatting, A. Wahlstrom,¨ J. Haybaeck, P. Puchas, et al. 2019. and CV mice, respectively, affects the status of DNA methylation or Intestinal dysbiosis augments liver disease progression via NLRP3 in a – gene expression. Further analyses will clarify detailed molecular murine model of primary sclerosing cholangitis. Gut 68: 1477 1492. ff 13. Allegretti, J. R., B. H. Mullish, C. Kelly, and M. Fischer. 2019. The mechanisms that explain how gut microbiota a ects physiological evolution of the use of faecal microbiota transplantation and emerging functions of the host by regulating gene expression in IECs via therapeutic indications. Lancet 394: 420–431. DNA methylation, which leads to the establishment of targets and 14. Sanders, M. E., D. J. Merenstein, G. Reid, G. R. Gibson, and strategies for preventing diseases by interference with intestinal R. A. Rastall. 2019. Probiotics and prebiotics in intestinal health and ecosystems. disease: from biology to the clinic. [Published erratum appears in 2019 Nat. Rev. Gastroenterol. Hepatol. 16: 642] Nat. Rev. Gastroenterol. by guest on September 30, 2021 Hepatol. 16: 605–616. DISCLOSURE 15. Zhu, W., M. G. Winter, M. X. Byndloss, L. Spiga, B. A. Duerkop, E. R. Hughes, L. Buttner,¨ E. de Lima Romão, C. L. Behrendt, C. A. Lopez, et al. 2018. Precision editing of the gut microbiota The authors have no financial conflicts of interest. ameliorates colitis. Nature 553: 208–211. 16. Depommier, C., A. Everard, C. Druart, H. Plovier, M. Van Hul, S. Vieira-Silva, G. Falony, J. Raes, D. Maiter, N. M. Delzenne, et al. ACKNOWLEDGMENTS 2019. Supplementation with Akkermansia muciniphila in overweight and obese human volunteers: a proof-of-concept exploratory study. Nat. Med. 25: 1096–1103. We are very grateful to Dr. Ametani and Dr. Yurino (INFOBIO Co., Ltd.) for kind discussion of the NGS data analysis. 17. Zhu, W., N. Miyata, M. G. Winter, A. Arenales, E. R. Hughes, L. Spiga, J. Kim, L. Sifuentes-Dominguez, P. Starokadomskyy, P. Gopal, et al. 2019. Editing of the gut microbiota reduces carcinogenesis in mouse REFERENCES models of colitis-associated colorectal cancer. J. Exp. Med. 216: 2378–2393. 18. Selma-Royo, M., M. Tarrazo,´ I. Garcı´a-Mantrana, C. Gomez-Gallego,´ 1. Parker, A., S. Fonseca, and S. R. Carding. 2020. Gut microbes and S. Salminen, and M. C. Collado. 2019. Shaping microbiota during the metabolites as modulators of blood-brain barrier integrity and brain first 1000 days of life. Adv. Exp. Med. Biol. 1125: 3–24. – health. Gut Microbes 11: 135 157. 19. Pronovost, G. N., and E. Y. Hsiao. 2019. Perinatal interactions between 2. Zaiss, M. M., R. M. Jones, G. Schett, and R. Pacifici. 2019. The gut- the microbiome, immunity, and neurodevelopment. Immunity 50: bone axis: how bacterial metabolites bridge the distance. J. Clin. In- 18–36. vest. 129: 3018–3028. 20. Cerdo,´ T., E. Diéguez, and C. Campoy. 2019. Early nutrition and gut 3. Stephen-Victor, E., and T. A. Chatila. 2019. Regulation of oral immune microbiome: interrelationship between bacterial metabolism, immune tolerance by the microbiome in food allergy. Curr. Opin. Immunol. 60: system, brain structure, and neurodevelopment. Am. J. Physiol. 141–147. Endocrinol. Metab. 317: E617–E630. 4. Ducarmon, Q. R., R. D. Zwittink, B. V. H. Hornung, W. van Schaik, 21. Woo, V., E. M. Eshleman, T. Rice, J. Whitt, B. A. Vallance, and V. B. Young, and E. J. Kuijper. 2019. Gut microbiota and colonization T. Alenghat. 2019. Microbiota inhibit epithelial pathogen adherence resistance against bacterial enteric infection. Microbiol. Mol. Biol. Rev. by epigenetically regulating C-type lectin expression. Front. Immunol. 83: e00007-19. 10: 928.

https://doi.org/10.4049/immunohorizons.1900086 190 EPIGENETIC EFFECT OF COMMENSALS ON COLONIC EPITHELIAL CELLS ImmunoHorizons

22. Martin-Gallausiaux, C., P. Larraufie, A. Jarry, F. Béguet-Crespel, 32. Iwata, M., A. Hirakiyama, Y. Eshima, H. Kagechika, C. Kato, and L. Marinelli, F. Ledue, F. Reimann, H. M. Blottiere,` and N. Lapaque. S. Y. Song. 2004. Retinoic acid imprints gut-homing specificity on 2018. Butyrate produced by commensal bacteria down-regulates T cells. Immunity 21: 527–538. indolamine 2,3-dioxygenase 1 (IDO-1) expression via a dual mecha- 33. Coombes, J. L., K. R. Siddiqui, C. V. Arancibia-Carcamo,´ J. Hall, nism in human intestinal epithelial cells. Front. Immunol. 9: 2838. C. M. Sun, Y. Belkaid, and F. Powrie. 2007. A functionally specialized 23. Takahashi, K., Y. Sugi, K. Nakano, M. Tsuda, K. Kurihara, A. Hosono, population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells and S. Kaminogawa. 2011. Epigenetic control of the host gene by via a TGF-beta and retinoic acid-dependent mechanism. J. Exp. Med. commensal bacteria in large intestinal epithelial cells. J. Biol. Chem. 204: 1757–1764. – 286: 35755 35762. 34. Edele, F., R. Molenaar, D. Gutle,¨ J. C. Dudda, T. Jakob, B. Homey, 24. Nakata, K., Y. Sugi, H. Narabayashi, T. Kobayakawa, Y. Nakanishi, R. Mebius, M. Hornef, and S. F. Martin. 2008. Cutting edge: in- M. Tsuda, A. Hosono, S. Kaminogawa, S. Hanazawa, and K. Takahashi. structive role of peripheral tissue cells in the imprinting of T cell 2017. Commensal microbiota-induced microRNA modulates intestinal homing receptor patterns. J. Immunol. 181: 3745–3749. epithelial permeability through the small GTPase ARF4. J. Biol. Chem. 35. Iliev, I. D., E. Mileti, G. Matteoli, M. Chieppa, and M. Rescigno. 2009. – 292: 15426 15433. Intestinal epithelial cells promote colitis-protective regulatory T-cell 25. Sugi, Y., K. Takahashi, K. Kurihara, K. Nakata, H. Narabayashi, differentiation through dendritic cell conditioning. Mucosal Immunol. Y. Hamamoto, M. Suzuki, M. Tsuda, S. Hanazawa, A. Hosono, and S. 2: 340–350. Kaminogawa. 2016. Post-transcriptional regulation of Toll-interacting 36. Goverse, G., R. Molenaar, L. Macia, J. Tan, M. N. Erkelens, T. Konijn, Downloaded from protein in the intestinal epithelium. PLoS One 11: e0164858. M. Knippenberg, E. C. Cook, D. Hanekamp, M. Veldhoen, et al. 2017. 26. Meng, D., D. S. Newburg, C. Young, A. Baker, S. L. Tonkonogy, Diet-derived short chain fatty acids stimulate intestinal epithelial cells R. B. Sartor, W. A. Walker, and N. N. Nanthakumar. 2007. Bacterial to induce mucosal tolerogenic dendritic cells. J. Immunol. 198: 2172– symbionts induce a FUT2-dependent fucosylated niche on colonic 2181. epithelium via ERK and JNK signaling. Am. J. Physiol. Gastrointest. Liver Physiol. 293: G780–G787. 37. Grizotte-Lake, M., G. Zhong, K. Duncan, J. Kirkwood, N. Iyer, I. Smolenski, N. Isoherranen, and S. Vaishnava. 2018. Commensals

27. Nanthakumar, N. N., D. Meng, and D. S. Newburg. 2013. Glucocorti- http://www.immunohorizons.org/ coids and microbiota regulate ontogeny of intestinal fucosyltransfer- suppress intestinal epithelial cell retinoic acid synthesis to regulate ase 2 requisite for gut homeostasis. Glycobiology 23: 1131–1141. interleukin-22 activity and prevent microbial dysbiosis. Immunity 49: – 28. Goto, Y., T. Obata, J. Kunisawa, S. Sato, I. I. Ivanov, A. Lamichhane, 1103 1115.e6. N. Takeyama, M. Kamioka, M. Sakamoto, T. Matsuki, et al. 2014. 38. Howell, K. J., J. Kraiczy, K. M. Nayak, M. Gasparetto, A. Ross, C. Lee, Innate lymphoid cells regulate intestinal epithelial cell glycosylation. T. N. Mak, B. K. Koo, N. Kumar, T. Lawley, et al. 2018. DNA meth- Science 345: 1254009. ylation and transcription patterns in intestinal epithelial cells from fl ff 29. Pickard, J. M., C. F. Maurice, M. A. Kinnebrew, M. C. Abt, pediatric patients with in ammatory bowel diseases di erentiate D. Schenten, T. V. Golovkina, S. R. Bogatyrev, R. F. Ismagilov, disease subtypes and associate with outcome. Gastroenterology 154: – E. G. Pamer, P. J. Turnbaugh, and A. V. Chervonsky. 2014. Rapid 585 598. fucosylation of intestinal epithelium sustains host-commensal sym- 39. Pan, W. H., F. Sommer, M. Falk-Paulsen, T. Ulas, P. Best, A. Fazio, biosis in sickness. Nature 514: 638–641. P. Kachroo, A. Luzius, M. Jentzsch, A. Rehman, et al. 2018. Exposure 30. Omata, Y., R. Aoki, A. Aoki-Yoshida, K. Hiemori, A. Toyoda, to the gut microbiota drives distinct methylome and transcriptome by guest on September 30, 2021 H. Tateno, C. Suzuki, and Y. Takayama. 2018. Reduced fucosylation in changes in intestinal epithelial cells during postnatal development. the distal intestinal epithelium of mice subjected to chronic social Genome Med. 10: 27. defeat stress. Sci. Rep. 8: 13199. 40. Poupeau, A., C. Garde, K. Sulek, K. Citirikkaya, J. T. Treebak, 31. Mora, J. R., M. Iwata, B. Eksteen, S. Y. Song, T. Junt, B. Senman, M.Arumugam,D.Simar,L.E.Olofsson,F.Backhed,¨ and R. Barres.` 2019. K. L. Otipoby, A. Yokota, H. Takeuchi, P. Ricciardi-Castagnoli, et al. Genes controlling the activation of natural killer lymphocytes are 2006. Generation of gut-homing IgA-secreting B cells by intestinal epigenetically remodeled in intestinal cells from germ-free mice. dendritic cells. Science 314: 1157–1160. FASEB J. 33: 2719–2731.

https://doi.org/10.4049/immunohorizons.1900086 Supplemental Table 1. Nucleotide sequences of the primers used for qPCR.

Gene Primer sequence α-Defensin 1 Forward: 5’-AGAGGAATCGTTGAGAGATCTGG-3’ Reverse: 5’-GTACTCATGTTCGTCTTGTCCTC-3’ α-Defensin 5 Forward: 5’-TGAAGAATTGTCAAAAAAGCTGA-3’ Reverse: 5’-AGCCGATGGTTGTCATATCTTTG-3’ Reg3β Forward: 5’-GGGAATGGAGTAACAATGACGTGA-3’ Reverse: 5’-AGACAAATTCGGGATGTTTGCTGT-3’ Ccl25 Forward: 5’-TAGGTCATCCCAGGATGGTGATG-3’ Reverse: 5’-CTTCCTCATACATGCTGAGACGTT-3’ Cxcl1 Forward: 5’-GGAGGCTGTGTTTGTATGTCTTG-3’ Reverse: 5’-TGTAACAGTCCTTTGAACGTCTCT-3’ Tmem267 Forward: 5’-TAGCCGACAGACTTCTTCGGTTTC-3’ Reverse: 5’-TCAAAGCGGCCTGTAAAGATAGGG-3’ 3110070M22Rik Forward: 5’-TGCCCCACACTCAATCAGCATCA-3’ Reverse: 5’-GCCCTTCAGTAAAGGAGCTCCTCT-3’ Aldh1a1 Forward: 5’-GCTGTGGGAATACCGTGGTT-3’ Reverse: 5’-GATCCAGTGAAGGCCACCTTG-3’ Gapdh Forward: 5’-TGAACGGGAAGCTCACTGG-3’ Reverse: 5’-TCCACCACCCTGTTGCTGTA-3’

A

B

Supplemental Figure 1. Epithelial tissue collection by LMD. Apical (A) and basolateral (B) portions of villus epithelium were collected by LMD. Zo-1 Occludin 1.2 1.4 1.0 1.2 0.8 1.0 Gapdh

Gapdh 0.8 0.6 / 0.6 1 / - 0.4 0.4 Zo 0.2 0.2

0.0 Occludin 0.0

Aldh1a1 Tollip 1.2 1.2 1.0 1.0 0.8 0.8 Gapdh

0.6 Gapdh 0.6 / 0.4 0.4 0.2 0.2 Tollip

Aldh1a1/ 0.0 0.0

1.2 Tlr4 1.2 Tlr2 1.0 1.0 0.8 0.8

0.6 Gapdh 0.6 0.4 0.4 Tlr2/

Tlr4 / Gapdh 0.2 0.2 0.0 0.0 cont cont M22Rik M22Rik 3110070 3110070 Tmem267 Tmem267

Supplemental Figure 2. Effect of RNAi for Tmem267 or 3110070M22Rik on various gene expression in IECs. The mouse IEC line CMT-93 was transfected with Tmem267 or 3110070MRik siRNA expression vector. After selection with blasticidine, total RNA was prepared from the transfected cells to analyze the expression of indicated genes by qRT-PCR. Results are expressed as mean ± SD of duplicate experiments.