Resolving the Pygmy Borers (Curculionidae: Scolytinae: Cryphalini)

RESOLVING THE PYGMY BORERS (CURCULIONIDAE: SCOLYTINAE: CRYPHALINI)

ANDREW J. JOHNSON

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2017

To my parents

ACKNOWLEDGMENTS

This work would not be possible without a network of collaborators, including

Bjarte Jordal, Miloš Knížek, Thomas Atkinson, Anthony Cognato, Sarah Smith, Emily

Moriaty Lemmon, Alan Lemmon, Randy Ploetz and Roger Beaver who provided specimens, assistance and advice.

Max Barclay (BMNH), Harald Schillhammer (NHMW) and Natalia Vandenberg

(USNM), Paul Skelly and Kate Fairbanks (FSCA) provided assistance and access to museum specimens including type material. Makail Mandalstam, Matt Kasson, Ching-

Shan Lin, Sangwook Park, Zvi Mendel, Paul Kendra and Francisco Infante provided many specimens critical for this study. Hagus Tarno and Karinda (Universitas

Brawyjaya, Malang, Indonesia) assisted with fieldwork.

Lab members, particularly Craig Bateman, Caroline Storer, Martin Kostovcik, Li

You, Yin-Tse Huang, Sedonia Steininger, Demian Gomez, Paige Carlson, Zachary

Nolen, Conrad Gillett and James Skelton, for providing specimens, advice, support and a productive working environment.

Committee members, Matt Gitzendanner, Marc Branham, Jason Smith,

Fernando Vega and Jiri Hulcr provided valuable advice and comments for this dissertation.

Funding was provided by National Science Foundation, the Florida Forest

Service, Florida Department of Agriculture – Division of Plant Industry, USDA forest

Service, USDA Farm Bill section 100007, and by the School of Forest Resources and

Conservation. Additional support was provided by Dr. Duane McKenna, University of

Memphis.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 10

LIST OF FIGURES ...... 11

ABSTRACT ...... 14

CHAPTER

1 INTRODUCTION ...... 16

Background ...... 16 Aims and Goals ...... 17 A Review of Cryphalini in America North of Mexico ...... 17 Resolving the Pestiferous Hypocryphalus, Global Pests of Mango and Fig ..... 17 Using Phylogenomics to Explore the Evolutionary Innovations of Bark and Ambrosia Beetles ...... 18

2 A REVIEW AND IDENTIFICATION GUIDE OF THE PYGMY BORERS (SCOLYTINAE: CRYPHALINI) OF AMERICA NORTH OF MEXICO...... 19

Introduction to Chapter 2 ...... 19 Introduction to Ecology and Biology of Cryphalini ...... 19 Publication and Species Description History ...... 20 Materials and Methods for Chapter 2 ...... 21 Morphology of North American Cryphalini Genera ...... 22 Frons ...... 22 Eye ...... 22 Antennae ...... 23 Pronotum ...... 24 Elytra ...... 24 Legs ...... 25 Phylogenetics and Systematics of Cryphalini ...... 26 Key to Cryphalini Genera of North America ...... 27 Cryphalus Erichson, 1836 ...... 28 Diagnosis ...... 28 Biology and Ecology ...... 29 Notes ...... 29 Key to Species ...... 30 Cryphalus pubescens Hopkins, 1915 ...... 30 Cryphalus rubentis Hopkins, 1915 ...... 31 Cryphalus ruficollis Hopkins, 1915 ...... 31 Cryptocarenus Eggers, 1937 ...... 32

Diagnosis ...... 32 Remarks ...... 33 Distribution ...... 33 Biology and Ecology ...... 33 Key to Species ...... 33 Cryptocarenus diadematus Eggers, 1937 ...... 34 Cryptocarenus heveae (Hagedorn, 1912) ...... 34 Cryptocarenus seriatus Eggers, 1933 ...... 35 Ernoporicus Berger, 1917 ...... 35 Remarks ...... 35 Ernoporicus kanawhae (Hopkins, 1915) ...... 35 Hypocryphalus Hopkins, 1915 ...... 36 Diagnosis ...... 36 Remarks ...... 36 Distribution ...... 36 Biology and Ecology ...... 37 Key to Species ...... 37 Hypocryphalus mangiferae (Stebbing, 1914) ...... 37 Hypocryphalus sp. “1422”...... 38 Hypothenemus Westwood, 1834 ...... 38 Diagnosis ...... 38 Distribution ...... 39 Biology and Ecology ...... 39 Identification to Species...... 40 Key to Species ...... 41 Hypothenemus areccae (Hornung, 1842) ...... 45 Hypothenemus birmanus (Eichhoff, 1878) ...... 46 Hypothenemus brunneus (Hopkins, 1915) ...... 48 Hypothenemus californicus Hopkins, 1915...... 49 Hypothenemus columbi Hopkins, 1915 ...... 50 Hypothenemus crudiae (Panzer, 1791) ...... 50 Hypothenemus dissimilis (Zimmermann, 1868) ...... 51 Hypothenemus distinctus Wood 1954 ...... 52 Hypothenemus erectus LeConte, 1876 ...... 52 Hypothenemus eruditus Westwood, 1836 ...... 53 Hypothenemus gossypii (Hopkins, 1915) ...... 56 Hypothenemus hirsutus (Wood 1954) ...... 57 Hypothenemus interstitialis (Hopkins, 1915) ...... 57 Hypothenemus javanus (Eggers, 1908) ...... 58 Hypothenemus sparsus Hopkins, 1915 ...... 59 Hypothenemus miles (LeConte, 1878) ...... 59 Hypothenemus obscurus (Fabricius, 1801) ...... 60 Hypothenemus piaparolinae Johnson, Atkinson and Hulcr, 2016 ...... 61 Hypothenemus parvistriatus Wood, 2007 ...... 61 Hypothenemus pubescens Hopkins, 1915 ...... 62 Hypothenemus rotundicollis (Eichhoff, 1878) ...... 63

Hypothenemus setosus (Eichhoff, 1867) ...... 63 Hypothenemus subterrestris Johnson, Atkinson and Hulcr, 2016 ...... 64 Hypothenemus seriatus (Eichhoff, 1872) ...... 64 Hypothenemus squamosus (Hopkins, 1915) ...... 65 Procryphalus Hopkins, 1915 ...... 66 Diagnosis ...... 66 Remarks ...... 66 Key to Species: (Modified from Wood 1982) ...... 67 Procryphalus mucronatus (LeConte, 1879) ...... 67 Procryphalus utahensis Hopkins, 1915 ...... 67 Scolytogenes Eichhoff, 1978 ...... 68 Remarks ...... 68 Scolytogenes jalapae (Letzner, 1844) ...... 68 Trischidias Hopkins, 1915 ...... 69 Diagnosis ...... 69 Biology and Ecology ...... 69 Remarks ...... 70 Distribution ...... 70 Key to Species ...... 70 Trischidias atomus (Hopkins, 1915) ...... 71 Trischidias exiguus Wood, 1986 ...... 71 Trischidias georgiae Hopkins, 1915 ...... 72 Trischidias minutissimus Wood, 1954 ...... 72 Trischidias striatus Atkinson, 1993 ...... 72 Trypophloeus Fairmaire, 1868 ...... 73 Diagnosis ...... 73 Biology and Ecology ...... 73 Key to Species (Adapted from Wood 1982) ...... 74 Trypophloeus populi Hopkins, 1915 ...... 74 Trypophloeus salicis Hopkins, 1915 ...... 75 Trypophloeus striatulus (Mannerheim, 1853) ...... 75 Trypophloeus thatcheri (Wood, 1954) ...... 76 Discussion for Chapter 2 ...... 76

3 RESOLUTION OF A MANGO AND FIG IDENTITY CRISIS ...... 110

Introduction to Chapter 3 ...... 110 Aims and Goals for Chapter 3 ...... 113 Materials and Methods for Chapter 3 ...... 114 Results ...... 117 Phylogenetic Tree of Cryphalus and Hypocryphalus ...... 117 Taxonomic Changes ...... 118 Hypocryphalus dilutus (Eichhoff, 1878a), stat. rev...... 118 Hypocryphalus discretus (Eichhoff, 1878a), stat. rev...... 119 Hypocryphalus mangiferae (Stebbing, 1914), stat. rev...... 120 Hypocryphalus robustus (Eichhoff, 1872) ...... 120 Diversity Within the Hypocryphalus mangiferae Clade ...... 121

Diversity Within the Hypocryphalus dilutus Clade ...... 121 Hypocryphalus sp. “1422”, an Unidentified Species in Florida ...... 122 New Records and Widespread Misidentification of Hypocryphalus dilutus..... 122 The Mesofemoral Spine—a Unique Character of Hypocryphalus dilutus ...... 122 Discussion for Chapter 3 ...... 123 Conclusions for Chapter 3 ...... 128

4 PHYLOGENOMICS REVEALS REPEATED EVOLUTIONARY ORIGINS OF MATING SYSTEMS AND FUNGUS FARMING IN BARK BEETLES ...... 136

Introduction to Chapter 4 ...... 136 Background ...... 136 The Pygmy Borers: Cryphalini ...... 138 Evolutionary Innovations ...... 139 Apparent Haplo-diploidy and Inbreeding ...... 139 Fungus Farming ...... 140 Host Specificity and Super-generalism ...... 141 Materials and Methods for Chapter 4 ...... 142 Trait Inference ...... 142 Genomic Data Sources ...... 143 Bioinformatics Pipeline ...... 144 Results for Chapter 4 ...... 149 Bark Beetle Relationships Resolved ...... 149 Tree Verification Based on Individual Gene Trees ...... 150 Evolution of Apparent Haplo-diploidy ...... 151 Evolution of Fungus Farming ...... 151 Evolution of Host Generalism ...... 152 Correlation of Traits ...... 152 Discussion for Chapter 4 ...... 153 Strengths and Weaknesses of the AHE Pipeline ...... 153 Bark beetle Relationships Resolved ...... 154 Evolution of Apparent Haplo-diploidy ...... 156 Evolution of Fungus Farming ...... 158 Evolution of Host Generalism ...... 159 Conclusions for Chapter 4 ...... 160

5 RESOLVING THE CRYPHALINI: CONCLUSIONS ...... 165

Enabling Identification ...... 165 Resolving the Convoluted Taxonomy ...... 165 Determining the Pest of Mango and Fig...... 166 Understanding the Evolution of Cryphalini and Other Scolytinae ...... 166 Outlook to Resolve Cryphalini ...... 166

APPENDIX

A SUPPLEMENTARY TABLE A ...... 168

B SUPPLEMENTARY FIGURES FOR CHAPTER 3 ...... 171

C SUPPLEMENTARY TABLE C ...... 179

D SUPPLEMENTARY FIGURE D ...... 182

LIST OF REFERENCES ...... 183

BIOGRAPHICAL SKETCH ...... 195

LIST OF TABLES

Table page

3-1 Primers used in this study...... 129

3-2 Summary of morphological difference between three Hypocryphalus species present in the Americas...... 130

4-1 External data sources ...... 161

4-2 Testing of conflicting phylogenetic hypotheses...... 162

4-3 Correlation analyses...... 162

A-1 Material examined for Chapter 3...... 168

C-1 Material examined for Chapter 4...... 179

LIST OF FIGURES

Figure page

2-1 Annotated diagram of important Cryphalini characters...... 77

2-2 Labelled diagram showing antennal morphology...... 78

2-3 Eyes and Antennae of North American Cryphalini...... 79

2-4 Sketch showing the raised line on the lateral margins of the pronotum ...... 80

2-5 Sketch showing the differences in setae between Cryphalini genera...... 81

2-6 Sketch showing the differences in the third tarsal segment for distinguishing between some Cryphaline genera...... 81

2-7 Sketch showing the difference between the antennae of Cryphalus (left) and Hypocryphalus (right) ...... 82

2-8 Frontal photographs showing distribution of marginal asperities ...... 82

2-9 Lateral photographs of North American Cryphalus species...... 83

2-10 Dorsal photographs of North American Cryphalus species...... 84

2-11 Lateral photographs of North American Cryptocarenus species...... 85

2-12 Dorsal and frontal photographs of North American Cryptocarenus...... 86

2-13 Lateral photograph of the holotype, and only known specimen of Ernoporicus kanawhae...... 87

2-14 Dorsal photographs of Hypocryphalus from North America...... 88

2-15 Dorsal photographs of Hypocryphalus from North America...... 88

2-16 Example of a typical gallery of the genus, containing larvae, pupae and adults of Hypothenemus interstitialis...... 89

2-17 Sketch to show difference between the asperities of Hypothenemus ...... 89

2-18 Sketch to show variation in the profile of the frons (setae on frons omitted)...... 90

2-19 Lateral photographs of Hypothenemus species...... 91

2-20 Dorsal photographs of Hypothenemus species...... 92

2-21 Frontal photographs of Hypothenemus species...... 93

2-22 Lateral photographs of Hypothenemus species...... 94

2-23 Dorsal photographs of Hypothenemus species...... 94

2-24 Lateral photographs of Hypothenemus species...... 95

2-25 Dorsal photographs of Hypothenemus species...... 96

2-26 Lateral photographs of specimens identified as Hypothenemus eruditus ...... 97

2-27 Dorsal photographs of specimens identified as Hypothenemus eruditus ...... 98

2-28 Lateral photographs of Hypothenemus species...... 99

2-29 Dorsal photographs of Hypothenemus species...... 99

2-30 Lateral photographs of Hypothenemus species...... 100

2-31 Dorsal photographs of Hypothenemus species...... 100

2-32 Lateral photographs of Hypothenemus species...... 101

2-33 Dorsal photographs of Hypothenemus species...... 102

2-34 Lateral photographs of Procryphalus species...... 103

2-35 Dorsal photographs of Procryphalus species...... 103

2-36 Ventral photograph of Scolytogenes jalapae...... 104

2-37 Lateral photographs of Scolytogenes jalapae...... 105

2-38 Dorsal photographs of Scolytogenes jalapae...... 105

2-39 Lateral photographs of Trischidias species...... 106

2-40 Dorsal photographs of Trischidias species...... 107

2-41 Lateral photographs of Trypophloeus species...... 108

2-42 Dorsal photographs of Trypophloeus species...... 109

3-1 Phylogenetic tree inferred by ExaBayes using concatenated genes ...... 131

3-2 Dorsal and lateral view of a Hypocryphalus dilutus (female) collected from Ficus carica from Israel ...... 132

3-3 Dorsal and lateral view of a Hypocryphalus mangiferae (female) from Honduras ...... 133

3-4 Dorsal and lateral view of a Hypocryphalus sp. “1422” (male) from Taiwan (China) ...... 134

3-5 The anterior face of the proleg and mesoleg of a male Hypocryphalus dilutus 135

4-1 Phylogenetic tree estimated via Bayesian inference using 114 276 bp DNA sequence data from 251 protein coding genes...... 164

B-1 Dorsal and lateral photographs of the sole syntype of Hypocryphalus dilutus (Eichhoff, 1878a) ...... 171

B-2 Dorsal and lateral photographs of the lectotype of Hypocryphalus mangiferae (Stebbing, 1914)...... 172

B-3 Lateral and dorsal photographs of specimen 46 (Hypocryphalus dilutus)...... 173

B-4 Lateral and dorsal photographs of specimen 49 (Hypocryphalus dilutus)...... 174

B-5 Lateral and dorsal photographs of specimen 51 (Hypocryphalus dilutus) ...... 175

B-6 Lateral and dorsal photographs of specimen 56 (Hypocryphalus mangiferae). 176

B-7 Lateral and dorsal photographs of specimen 45 (Hypocryphalus mangiferae). 177

B-8 Lateral and dorsal photographs of specimen 47 (Hypocryphalus sp. “1422”) ... 178

D-1 Nodal support of tree topology by individual genes...... 182

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

RESOLVING THE PYGMY BORERS (CURCULIONIDAE: SCOLYTINAE: CRYPHALINI)

Andrew J. Johnson

December 2017

Chair: Jiri Hulcr Major: Forest Resources and Conservation

The pygmy borers (Curculionidae: Scolytinae: Cryphalini) are one of the most divers and leas studied group of bark beetles. They contain several species considered pests, yet are challending to identify.

Three complimentary goals are addressed. First, the species in North America are poorly known. Identification resources available are outdated, with several species newly arrived or described in the US, and several names wich are now no longer used.

A comprehensive review of the 46 species present in America north of Mexico species with a key to all species, photographs of all species, and notes facilitating accurate identification.

Second, the species in the genus Hypocryphalus are known to be significant pests of mango and fig, but the species have received little systematic and taxonomic attention. The following taxonomic changes are proposed: Hypocryphalus mangiferae

(Stebbing, 1914), stat. rev.; Hypocryphalus dilutus (Eichhoff, 1878a), stat. rev. (=

Cryphalus dilutus Eichhoff, 1878b, syn. n.); Hypocryphalus discretus (Eichhoff, 1878a), stat. rev. (= Cryphalus discretus Eichhoff, 1878b, syn. n.; Cryphalus scabricollis

Eichhoff, 1878b, syn. n.; Cryphalus brevisetosus Schedl, 1943, syn. n.). The pest of

mango trees in Oman, Pakistan, Bangladesh and Mexico, and putatively the vector of the pathogen responsible for mango wilt, is Hypocryphalus dilutus. The pest of figs in the Mediterranean is also H. dilutus, but a distinct genetic lineage. The globally distributed but seemingly harmless mango bark beetle is H. mangiferae.

Third, evolution of Scolytinae, especially Cryphalini, is hampered without a robust phylogeny. Using a combination of anchored hybrid enrichment, shallow genomes and transcriptomes, a 114 276 bp of nucleotide alignment allowed us to infer a phylogeny of

Scolytinae with a special focus on the species rich tribe Cryphalini and related groups.

We confirm that key innovations including mating systems and fungus farming evolved repeatedly across bark beetles. Cryphalini sensu str. is part of a clade containing

Hypothenemus, Cryphalus, Trypophloeus and Xyloterini. Stegomerus and

Cryptocarenus are part of a clade containing all Corthylini. Several other genera, including Ernoporus and Scolytogenes, make up an unrelated clade. Members of

Cryphalini genera are also particularly intermixed; especially between Cryphalus and

Hypocryphalus, and among Ernoporus, Ptilopodius and Scolytogenes.

CHAPTER 1 INTRODUCTION

Background

One of the most diverse and economically significant groups of insects are the bark and ambrosia beetles. They are ubiquitous in forests worldwide, playing a significant role in decomposition of woody vegetation. They are also can lead to environmental catastrophes. Examples include the red bay ambrosia beetle, which from a single female in just 11 years, they and their fungi have killed nearly half a billion red bay trees, the northern pine beetle destroys tens of millions of hectares of forest, and the elm beetle which, with Dutch elm disease, devastated with treescapes of forests, parks and cities over Europe and north America.

The pygmy borers (Species in the Tribe Cryphalini) are a megadiverse group which accounts for about 711 of the 5800 known bark and ambrosia beetles (Wood,

1992). They are found on every continent from beyond the tree line in the arctic, to equatorial rainforests. The species diversity is also reflected by a diversity of habits, some specializing in the phloem of dead and dying woody twigs, some in the pith, while others have evolved the symbiotic relationship with ambrosia fungi as seen in other bark beetle tribes. Some are specialists, some are highly polyphagous, with one species,

Hypothenemus eruditus, has over 500 hosts recorded (Wood 2007). The most economically important species are those which have switched to feeding on seeds.

The coffee berry borer causes half a billion dollars’ worth of damage each year. Other species are also a serious pest of nuts. There are also species that are known vectors of disease, Hypocryphalus, which spreads mango wilt and mango sudden decline.

Despite the diversity in habits, number of species and economic significance, the understanding and resources available are poor and in complete; Wood (1992, 2007) covered all the described species in north, central and South America. These are, however, difficult to follow and require specific knowledge of the group to be used successfully. In the old world, the majority of species can only be identified with comparisons to type material, typically in a foreign museum, which is infeasible for most researchers and institutions. This also means most new species arriving into the US are not routinely identifiable, and consequentially, often get ignored.

Aims and Goals

This dissertation aims to understand and resolve the notoriously difficult group of bark beetles known as Cryphalini.

There are three main pressing issues which will be addressed:

A Review of Cryphalini in America North of Mexico

The local species, (i.e. in USA, and specifically Florida) are poorly characterized.

With a constant influx of invasive species, it is important to be able to identify what is known already and enable effective management of invasive species. Also, largely though the other activities achieved while undertaking this project, current literature is dated and does not reflect current classification, with a number of new species (Wood

2007, Johnson et al. 2016a) and taxonomic changes (Chapter 3).

Resolving the Pestiferous Hypocryphalus, Global Pests of Mango and Fig

Bark beetles in the genus Hypocryphalus have been implicated as pests of mango and fig, yet have been very poorly studied. The taxonomy has a confusing history, and does not compliment observations by the author. This project uses

molecular and morphological techniques to resolve the identity crisis of these pest species, which lead to several taxonomic changes (Johnson et al, in review).

Using Phylogenomics to Explore the Evolutionary Innovations of Bark and Ambrosia Beetles

Scolytinae have a diverse array of evolutionary innovations. Using a combination of Anchored hybrid enrichment, shallow transcriptomes and shallow genomes, the most extensive phylogeny to date was constructed to understand the evolution of apparent haplo-diploidy, fungus farming and generalism.

CHAPTER 2 A REVIEW AND IDENTIFICATION GUIDE OF THE PYGMY BORERS (SCOLYTINAE: CRYPHALINI) OF AMERICA NORTH OF MEXICO.

Introduction to Chapter 2

Introduction to Ecology and Biology of Cryphalini

The pygmy borers (Curculionidae: Scolytinae: Cryphalini) are ubiquitous in forests worldwide. Their minute size and secretive habits have made them notoriously difficult to study. They are none-the-less important, thriving in dead and dying trees and even implicated with tree die-offs. They are some of the commonest bark beetles, particularly in urban environments, but with the poorest resources for identification.

Bark and ambrosia beetles are successful invaders. Of the 564 species present in the United States (Atkinson 2017), 58 are probably introduced (Haack and Rabaglia

2013). Where they establish, they can become dominant members of the community

(Grégoire et al. 2001), alter forest plant communities (Spiegel and Leege 2013) and have a large economic impact. Cryphalini in particular are some of the most successful invaders, especially the genera Hypothenemus Westwood, 1834 and Hypocryphalus

Hopkins, 1915, which there are many interceptions each year (Haack and Rabaglia

2013). Hypocryphalus in particular is of great concern, since H. dilutus, a known pest species with a wide distribution, is not yet present in the US (see Chapter 3).

Even though some bark and ambrosia beetles have devastating effects when introduced, the majority are harmless. However, the ability to identify what is already present enables identification of new arrivals, and facilitates further work to understand bark and ambrosia beetle communities. In most studies, Cryphalini in particular are only identified to genus, or eliminated entirely (Hulcr et al. 2007b).

This guide was put together with the aim to summarize and review the species of

Cryphalini in America north of Mexico, and provide updated identification resources and a complete set of photographs of all species known.

Publication and Species Description History

The Cryphalini have received very little attention. The last extensive review was in 1954 (Wood 1954). Beyond that, they have also been included in major monographs with slight modifications.

The tribe Cryphalini was reviewed by Hopkins (1915) with descriptions of many genera. This was in a much broader sense as a subfamily “Cryphalinae”, including several other tribes. This, however, was the foundation of many of the currently recognized genera and species, especially for North American fauna. Sixteen of the forty-six currently recognized species were described.

Hopkins principally used antennal characters to decipher genera, in particular, the arrangement of sutures, septa and funicular segments.

The next major contribution to the classification of North American Cryphalini was the PhD thesis of Wood (1954). Here, Wood thoroughly synthesized current understanding and classifications, and synonymized the majority of the described species, bringing order to the chaos. Before Wood’s review was completed, 91 species had been described by others. Of those, Wood synonymized 52, and 9 new species were described. This was also the first review to introduce attempt an evolutionary interpretation of the diversity of Cryphalini, identifying putative ancestral characters and behaviors. Whilst the review was, by far, the best attempt at the time at synthesizing the diversity, it would be an incomplete and confusing resource today. Several genera were

re-arranged, several species since synonymized, and an error in the identification of one of the most common species has been clarified.

Wood became the most prominent of bark beetle systematists, later synthesizing a monograph of the entirety of Scolytine fauna of the North and Central Americas

(Wood 1982) and South America (Wood 2007). This greatly improved the understanding of the Cryphalini, with dichotomous keys for identification of all the known

Scolytinae of the areas, and followed almost entirely the same classification scheme as followed today. However, the Cryphalini, self admittedly, needed further work.

Since Hopkins’ (1915) review of North American Cryphalini, a total of ten

Cryphalini have been described since, of which five are still recognized (Wood 1982,

Atkinson 1993, Wood 2007, Johnson et al. 2016a), plus two species newly recorded in

North America (Deyrup 1987, Chapter 3)

Materials and Methods for Chapter 2

The material used for this review was from several sources. Most type material was provided by United States National Museum of Natural History, Washington D.C.,

USA. (USNM) and the British Museum of Natural History, London, UK (BMNH).

Extensive non-type material was provided by the Florida State Collection of

Arthropods, Gainesville, FL, USA (FSCA), Texas A & M University (TAMU), and the

University of Florida Forest Entomology collection (UFFE). There are also many recently collected specimens by the author plus the generous contributions of several other collectors, now deposited at UFFE.

All included photographs except two were taken by AJJ, and each are a composite of up to 100 separate images, integrated using image-stacking software

(Helicon Focus; Kozub et al. 2016), and in some cases where the specimen did not fit in

the field of view, multiple composite images were themselves merged using Photoshop

CS2 (Photoshop 2005).

Characters were selected by visual comparison of point-mounted specimens, aided by characters used in identification resources (Wood 1982, 1986, 2007)

Characters not visible from a typical point mounted specimen were avoided since the goal of this review to enable easy identification rather than phylogeny reconstruction.

Taxonomy is based primarily on Wood and Bright’s catalog (Wood and Bright 1992) and subsequent updates (Bright and Skidmore 1997, 2002, Bright 2014), and the catalogue to genera by Alonso-Zarazaga and Lyle (2009).

Terminology loosely follows Wood (Wood 1982, 1986, 2007). Most terms are illustrated in Figure 2-1, or described below.

Morphology of North American Cryphalini Genera

Frons

Cryphalini have considerable variation of structures on the frons, but not as elaborate as those found in some Pityophthorini and Micracidini. The majority of species have a simple convex frons. Some species in the Genus Hypocryphalus Hopkins, 1915 have a sexually dimorphic frons, with a transverse ridge on males (Chapter 3). For the genera Cryptocarenus Eggers, 1937 and Hypothenemus Westwood, 1834, the sculpturing of the frons is not sexually dimorphic, but provides useful characters for species level identification.

Eye

The shape of the eye in Cryphalini can vary from entire and elongate to short with a deep emargination, and is often consistent within genera. No Cryphalini (sensu

Wood 1986) have a completely divided eye. For Hypothenemus and Trischidias

Hopkins, 1915, whilst most specimens have an emarginated eye, some, more often for smaller specimens, have a weak or absent emargination, including the specimen used to describe the diagnostic characters of the genus Trischidias.

Antennae

The antennal characters have formed the basis of current classification of

Cryphalini, with most of the North American species being identifiable to genus with the antennae alone. There are several key variable characters present in the antennae. The scape is similar for all North American species, and does not have elaborate vestiture or a triangular appearance. The funicle (including the pedicel, in consensus with most

Scolytine literature) has a maximum of five segments. The number of segments differentiates Cryphalus Erichson, 1836 and Hypocryphalus. In some species of

Hypothenemus, the number of funicle segments of females can vary within a species, and the smaller males usually have one fewer. This character may be difficult to delimit, especially for small specimens. This can be further complicated by annulations and/or incomplete funicle segments.

The antennal club has several key characters. Dead specimens typically have the antennae contracted to the side of the head, and the characters described here are those that are visible and outward facing (usually ventral facing in life). The overall shape varies from near circular and flat (e.g. Hypocryphalus) to elongate and cylindrical

(e.g. Trypophloeus Fairmaire, 1868). There are up to three sutures, which are usually marked by setae, which are reduced or absent in some genera. The shape of the sutures can be recurved, straight or procurved (Figure 2-3), which is generally consistent within genera for North American species. For some genera, there is also a

septum, which is an internal structure visible as a dark line, usually found alongside the first antennal suture.

Pronotum

All Cryphalini have a prominent pronotum which extends over the head, making the head apparently downward facing. The pronotum is covered in asperities formed by protruding edges of punctures, which may appear as conical spines or curved scoops.

Most genera have prominent asperities (spines) on the anterior margin of the pronotum, apart from American Scolytogenes which instead have a row of asperities in a ‘V’ shape, just above the margin (see Figure 2-8). The number and arrangement of asperities on the anterior margin is a useful and easy character, although frequently specimens are found with fewer or more asperities than described, or ambiguous smaller asperities. The number of asperities on the pronotal declivity is also useful for differentiating some species (e.g. Figure 2-17).

An important generic level difference is the presence of a carina along the dorsal posterior and lateral margins of the pronotum (Figure 2-4), useful for differentiating some genera such as Cryphalus and Trypophloeus. This character is sometimes not apparent in very small specimens, or specimens with coarse surface sculpting around the dorso-lateral regions.

The setae on the lateral regions of the pronotum may be bifurcating in Cryphalus or Hypocryphalus, but not in any other North American genera.

Elytra

The overall shape of the elytra of nearly all Cryphalini species is broadly convex.

Trypophloeus and Cryphalus have slightly elevated dorso-lateral regions of the elytra, whereas Cryptocarenus have their first elytral striae depressed. When viewed laterally,

some Hypothenemus species have a weak anterior declivity before the straight elytral disc. The transition to the posterior declivity in all North American species is indistinct.

All species have a declivity which is entirely convex, except for Hypothenemus hirsutus,

H. squamosus and H. piaparolinae, which are flared at the base.

For most Cryphalini, the apex of the elytron is slightly raised relative to the venter, which serves as a useful character for differentiation from some similar bark beetles in the tribes Pityophthorini and Micracidini.

The vestiture of the elytra can be comprised of multiple types of setae. The strial setae arise before the strial punctures, and are always present, and always hair-like.

The interstrial bristles are in prominent rows between the striae, and are often flattened to be scale-like or spatula-like. The interstrial ground vestiture is the most variable type.

In some genera, the ground setae carpet the whole elytra, whereas in other genera they are usually sparse or absent. They may be in ordered rows flanking the striae, or completely intermixed.

Legs

The legs offer some useful characters for differentiating Cryphalini genera. For

Cryphalus, Hypocryphalus, Scolytogenes, Procryphalus and Ernoporicus, the mesocoxae are moderately separated, whereas in Hypothenemus, Cryptocarenus,

Trischidias and Trypophloeus, they are very narrowly separated.

The hind tibia of Hypothenemus, Trischidias and Cryptocarenus are narrow with a greatly reduced number of socketed denticles, whilst other genera typically have denticles over at least the apical third.

The third tarsal segments, especially visible in the hind tarsi, are typically expanded in all Cryphalini species. For Cryphalus and Hypocryphalus, these are

expanded laterally, to form two lobes, from between which the fourth tarsi arise. For the other genera, the tarsi are expanded beneath the forth tarsi (see Figure 2-6).

Phylogenetics and Systematics of Cryphalini

Cryphalini are notoriously difficult to classify and identify, probably due to the limited number of informative characters. Wood (1954) presented hypotheses of ancestral morphological and ecological character states present in some of the modern groups. Of the few differentiating characters between the genera and species of

Cryphalini, many of these represent the losses of structures rather than modifications or novel variations. Consequently, any phylogenetic inference from these external morphological characters may be unreliable and misleading, since convergence is particularly likely.

Wood’s interpretation of classification also does not necessarily reflect the strict phylogenetic monophyly of described groups, with several groups which he thought were paraphyletic. For example, Wood (1954) described Trischidias as “Obviously derived from Hypothenemus”, yet still recognized them as separate genera.

More recently, during the preparation of this manuscript, molecular phylogenetic analyses have cast doubt on the tribal classification of Cryphalini genera, finding deep divergence between genera, which are paraphyletic or even polyphyletic. Phylogenetic and phylogenomic analyses strongly show that the genus Cryptocarenus nested among the genus Araptus (Corthylini: Pityophthorina)(Gohli et al. 2017, Chapter 3) the genera

Cryphalus and Hypocryphalus are intermixed (Johnson et al, in review, Johnson et al, in prep), and Xyloterini (which contains Trypodendron and Xyloterinus present in North

America) is nested among several Cryphalini genera, termed Cryphalini sensu stricta

(containing Cryphalus, Hypocryphalus, Hypothenemus and Trypophloeus). For the purpose of this publication Cryphalini will be considered sensu Wood (Wood 1986).

Key to Cryphalini Genera of North America

The following key is intended for known North American species, and the characters are not necessarily diagnostic for all Cryphalini outside of North America.

1a) Posterior and lateral margins of pronotum marked with fine carina (Figure 2-4). Widely distributed from tropical to subarctic regions, on a wide range of hosts ...... 2

1b) Posterior and lateral margins of pronotum rounded (Figure 2-4). Temperate to subarctic distribution, on broadleaf trees ...... 7

2a) Split setae present on lateral sides of pronotum (Figure 2-5). Third tarsal segment bi-lobed (Figure 2-6). Antennae with clear sutures but no indication of a septum. Eye always emarginated. Elytra uniformly covered with short, flattened and pointed scales ...... 3

2b) All setae on lateral side of pronotum are simple and hair-like, not split (Figure 2-5) (Although minute split setae may be present along the anterior margin). Third tarsal segment not bi-lobed (Figure 2-6). Eye entire or emarginated. Elytral vestiture variable ...... 4

3a) Antennal funicle four segmented, club with recurved sutures (Figure 2-7). From conifers in temperate regions ...... Cryphalus

3b) Antennal funicle five segmented, antennal club flattened and near circular with procurved sutures (Figure 2-7), from subtropical regions in South East USA ...... Hypocryphalus

4a) Antennal club with weak procurved sutures barely marked by setae, plus a septum on the posterior side. Eye long an entire. Mesocoxae widely separated. Elytral declivity rounded, near vertical, asperities on pronotum do not follow anterior margin (Instead, in a “V” shaped row, (Figure 2-8)). Males and females similar ...... Scolytogenes

4b) Antennal club with horizontal or procurved sutures. Eye emarginated (though emargination may be very weak in small species). Mesocoxae narrowly separated by less than width of each mesocoxae. When viewed laterally, the declivity apex usually not vertical (Except some Cryptocarenus). A row of two to ten asperities on the anterior margin of the pronotum. Males, if present, are smaller, flightless and often deformed...... 5

5a) Antennae without septum, and weakly visible sutures marked by lines of setae. Antennal funicle always 5 segmented. All vestiture on elytra sparse. Interstrial

bristles are spatula shaped, wider at their end, and rounded. Antennal funicle with 5 funicle segments. Always six or more marginal asperities. Always larger than 1.4 mm. Usually orange-brown in color ...... Cryptocarenus

5b) Antennae may have a partial septum. Antennae with sutures, usually clearly marked with setae. The first suture is straight. Elytra usually with prominent interstrial vestiture (exceptions: Hypothenemus piaparolinae, which is smaller than 1.2 mm). Antennal funicle with 3 to 5 segments. 2-10 marginal asperities. Size from 0.6 to 2.5 mm. Color variable...... 6

6a) Antennae with septum (except H. distinctus and H. piaparolinae), 0.7 to 2.5 mm, frons can be concave or convex. One to ten marginal asperities .... Hypothenemus

6b) Antennae without septum, all species are minute (Females are 0.6 to 1.1 mm). Two to four marginal asperities ...... Trischidias

7a) Eye emarginated, less than twice as long as wide, antennae with 5 funicle segments, antennal club elongate with three recurved sutures marked by setae. On Alnus, Populus and Salix ...... Trypophloeus

7b) Eye entire, more than twice as long as wide...... 8

8a) Antennal club flattened and round. Temperate Eastern North America. Host not known, likely Tilia ...... Ernoporicus

8b) Antennal club elongate with a horizontal septum. Broadly distributed in West to Alaska, and in temperate Eastern US ...... Procryphalus

Cryphalus Erichson, 1836

Diagnosis

For native North American species, the frons is flat to convex (occasionally weakly concave in some individuals). The eye is clearly emarginated, the antennae has four funicular segments, and a slightly elongate club with three recurved sutures. There is a carina marking the posterior and lateral edge of the pronotum. The interstrial ground vestiture is dense, with abundant multi-dentate scales. The interstrial bristles are not flattened. There are split setae on the episternum and lateral regions of the pronotum.

The third tarsal segments are bi-lobed.

Males can be distinguished from females by the emarginated seventh ventrite and the visible eighth ventrite (when viewed ventrally), which is not visible for the females.

This genus can be distinguished from North American Hypocryphalus by the number of funicle segments (four in Cryphalus, five in Hypocryphalus), and the shape of the antennal sutures (recurved in Cryphalus, procurved in Hypocryphalus). Cryphalus genus can be distinguished from Trypophloeus by the number of funicle segments (Four in Cryphalus, five in Trypophloeus), the presence of the raised line at the posterior and lateral margins of the pronotum (Present in Cryphalus), and the bi-lobed third tarsal segment (Figure 2-6).

Biology and Ecology

All North American species make irregular cave-like galleries in the bark of dead or dying conifers. They are all monogamous, and the larvae are solitary, emerging through their own exit holes.

All species, plus almost all of their synonyms, were described in a single paper by Hopkins (1915). A few subspecies and species have been described and subsequently synonymized since.

Very little is known of the biology of North American Cryphalus species. A fir- feeding species from Europe was found to usually be in association with the fungi

Geosmithia and Ophiostoma, but not consistently and of unknown causality (Jankowiak and Kolařík 2010).

Notes

Cryphalus is very speciose with a predominantly old-world distribution. There is a dubious distinction between this genus and Hypocryphalus primarily based on the

number of antennal funicular segments. However, the two genera present can be clearly differentiated for all North American species.

Identification to species level can be difficult because Cryphalus rubentis appears to be intermediate in many of the variable characters, which seem to overlap with both species. Furthermore, Cryphalus ruficollis from eastern or western North America differ in several indistinct characters which has led to the description of two species (now subspecies).

Key to Species

1a) Interstrial bristles on declivity short and barely visible, less than half of the distance between strial rows on declivity. Marginal asperities are semicircular and typically partially contiguous, and the median four are of a similar size ...... Cryphalus ruficollis

1b) Interstrial bristles on declivity visible, longer than the interstrial ground vestiture or half the distance between strial rows on declivity. The median pair (or three) marginal asperities are rounded-triangular shaped, not contiguous, and larger than the outer marginal asperities ...... 2

2a) Interstrial bristles on declivity very long and prominent, longer than the distance between rows. Lateral regions of the pronotum with shallow, contiguous punctures ...... Cryphalus pubescens

2b) Interstrial bristles on declivity moderately long, but not longer than distance between rows. Lateral regions of the pronotum with deep, non-contiguous punctures ...... Cryphalus rubentis

Cryphalus pubescens Hopkins, 1915

Synonymy. Cryphalus subconcentralis Hopkins, 1915.

Diagnosis. Interstrial bristles are long and clearly visible across the elytra.

Lateral regions of the pronotum are deeply punctured, with punctures often contiguous.

This species can be distinguished from the similar C. rubentis by the longer interstrial bristles on the declivity. The distribution of the two species does not overlap;

C. pubescens is known exclusively from the west, and C. rubentis is known exclusively from the east.

This species can be distinguished from C. ruficollis by the much longer interstrial bristles, which are near absent or weak in C. ruficollis, especially on the declivity.

Cryphalus rubentis Hopkins, 1915

Diagnosis. This species can be distinguished from C. pubescens by the shorter interstrial bristles on the declivity, and the more rounded apex of the pronotum. It can be distinguished from C. ruficollis by the larger asperities on the pronotum, and the interstrial bristles which are longer than half the distance between the strial rows.

Remarks. This species is very similar to Cryphalus ruficollis and may not be consistently distinguishable. A molecular study (Chapter 3) found very little genetic difference between these species.

Cryphalus ruficollis Hopkins, 1915

Subspecies. Cryphalus ruficollis ruficollis Hopkins, 1915; Cryphalus ruficollis fraseri Hopkins, 1915.

Synonymy. Cryphalus approximatus Hopkins, 1915; Cryphalus balsameus

Hopkins, 1915; Cryphalus fraseri Hopkins, 1915; Cryphalus amabilis Chamberlin, 1917;

Cryphalus grandis Chamberlin, 1917; Cryphalus canadensis Chamberlin, 1918;

Cryphalus mainensis Blackman, 1922; Taenioglyptes ruficollis coloradensis Wood,

1954.

Diagnosis. The pronotum is rounded. The marginal asperities are small, of an equal size, and usually contiguous or even partially fused. Asperities on the declivity are often (but not always) in loosely contiguous rows. Cryphalus ruficollis is distinguished from C. pubescens by the roughly equally sized marginal asperities, the smaller

asperities on the pronotum, and the greatly reduced interstrial bristles which are barely visible on the declivity. Cryphalus rubentis is more similar, but still tending to have larger asperities on the pronotum and longer interstrial bristles on the declivity when compared to C. ruficollis.

Remarks. Two subspecies are recognized, Cryphalus ruficollis ruficollis and C. ruficollis fraseri, described primarily on the differences in visibility of the elytral striae, which are much more distinct in C. ruficollis ruficollis. There is also a stark difference in host and distribution, with C. ruficollis fraseri found in Eastern North America, whereas

C. ruficollis ruficollis is known from the West. There is also no recorded overlap in host.

However, this may reflect host distribution and a lack of sampling. Wood (1982) noted that they may not be distinct over their range, and that not enough material was available to assess their distinctiveness.

This species was collected in traps baited with various pheromones by Werner and Holsten (1984), with the highest numbers caught in traps baited with Frontalin and

Sulcatol.

Cryptocarenus Eggers, 1937

Diagnosis

The eye is large and emarginated, sometimes sinuate on its posterior side, and sometimes more than twice as long as wide.

The anterior margin of the pronotum is armed with six or more asperities, plus many more on the anterior slope of the pronotum. The frons may be convex to concave, but never with elaborate vestiture.

The antennal club never has a septum, and only weakly-visible, procurved sutures. The antennal scape is not widened and never has extensive vestiture. There

are some exceptional Hypothenemus which have antennae more similar to

Cryptocarenus but can be distinguished by their much smaller size and fewer marginal asperities.

There are morphologically similar North American bark beetles in the tribe

Pityophthorini, particularly Pseudopityophthorus asper ulus (LeConte, 1868) and species in the genus Pityophthorus Eichhoff, 1864. These other most easily distinguished by the antennae, which are not at all septate in Cryptocarenus.

Remarks

Cryptocarenus is likely to be phylogenetically nested in Pityophthorina

(Corthylini) based on two independent molecular studies (Gohli et al. 2017, Chapter 4).

Distribution

This genus is restricted to the subtropical and tropical Americas, plus one species introduced to West Africa. In North America, the genus is recorded in Florida,

Georgia and Texas (Atkinson 2017), and it is likely to be in other Gulf states.

Biology and Ecology

Cryptocarenus appears to have similar habits to Hypothenemus. Galleries are started by single foundresses, and males are smaller, weaker and unable to fly. There are very few available specimens of males available for study, and they seem to show reduced morphology, so they will be omitted from the identification keys and descriptions. The species present are typically found in the pith of twigs and vines, with maturing larvae and beetles living socially in the parental gallery.

Key to Species

1a) Frons convex without central tubercle. Ten or more marginal asperities, typically 14. Larger than 2.2 mm ...... Cryptocarenus diadematus

1b) Frons either weakly convex to concave with at least a central tubercle or vertical carina. Six to nine (rarely ten) marginal asperities. Smaller than 2.5 mm...... 2

2a) Frons weakly concave or convex, with a central tubercle/vertical carina. Less than 1.9 mm in length ...... Cryptocarenus heveae

2b) Frons concave with five tubercles or vertical carina along the top edge of the transverse carina, with the central one larger. More than 1.9 mm in length ...... Cryptocarenus seriatus

Cryptocarenus diadematus Eggers, 1937

Diagnosis. This is one of the largest bark beetles in the tribe Cryphalini, ranging from 2.3 to 3.0 mm (Wood 2007). The frons is entirely convex without a central tubercle.

This species typically has 14 to 16 marginal asperities. Asperities on the pronotal declivity are small. The mature color is typically orange-red to red-brown.

This species is distinguished from other North American Cryptocarenus by the combination of a larger size, by the numerous marginal asperities (Typically 14 to 16

(Wood 1982)), and by the convex frons.

Remarks. This species is rarely encountered, only known from a few records in

South Florida.

Cryptocarenus heveae (Hagedorn, 1912)

Synonymy. Stephanoderes heveae Hagedorn, 1912; Cryptocarenus caraibicus

Eggers, 1937; Cryptocarenus punctifrons Schedl, 1939; Tachyderes parvus Blackman,

1943; Miocryphalus brasiliensis Schedl, 1951; Cryptocarenus porosus Wood, 1954;

Cryptocarenus acaciae Schedl, 1958.

Diagnosis. This is the smallest of the three North American Cryptocarenus species, with a length of approximately 1.4 to 1.8 mm (Wood, 2007). It can be distinguished from C. seriatus by the smaller size, and the frons which is flat or weakly

concave with just a single tubercle for C. heveae. This species often matures to a darker color than C. seriatus, but this is not a reliable character for identification.

Cryptocarenus seriatus Eggers, 1933

Synonymy. Cryptocarenus adustus Eggers, 1933; Cryptocarenus bolivianus

Eggers, 1943; Tachyderes floridensis Blackman, 1943.

Diagnosis. This species can be distinguished from C. diadematus by the smaller size and the concave frons. This species can be distinguished from C. heveae by the larger size and the more distinctly concave frons. There are usually five tubercles marking the top edge of the concavity.

Size. 1.8 to 2.4 mm (Wood 2007).

Ernoporicus Berger, 1917

Remarks

Ernoporicus in North America is represented from a single specimen of a single species, and may represent an unestablished exotic. It can be distinguished from

Scolytogenes by its rounded lateral margins of the pronotum (Scolytogenes has a carina) and the procurved sutures on the antennae without a septum (A septum is present in Scolytogenes). Most species in this genus are known from hardwood, temperate tree species.

Ernoporicus kanawhae (Hopkins, 1915)

Synonymy. Ernoporus kanawhae Hopkins, 1915.

Diagnosis. Ernoporicus kanawhae can be distinguished from Scolytogenes jalapae by the rounded lateral margins of the pronotum, the presence of marginal asperities, and the antennae without a septum.

Remarks. This species is only known from the holotype, collected in Kanawha

State forest, West Virginia. Both Hopkins (1915) and Wood (1982) noted the close similarity between the type and Ernoporicus caucasicus (Lindemann, 1876), a Eurasian species known from Tilia.

Hypocryphalus Hopkins, 1915

Diagnosis

Species in North America have an emarginated eye, abundant scale-like ground vestiture on the elytra, split setae on the episternum and lateral regions of the pronotum, and bi-lobed third tarsal segments. The antennae have five funicular segments, with an almost circular club, with procurved sutures.

Hypocryphalus is differentiated from the very similar Cryphalus based on the antennae. The funicle has five segments, and the sutures are procurved. Contrary to

Wood (2007), the third tarsal segment, particularly in the hind legs, is not cylindrical, but bi-lobed in both species, although often not as profoundly as in Cryphalus.

Remarks

The male frons is a useful character to differentiate the two species in North

America. The males can be identified by the setae on the protibiae, which are long and curved, and the emarginated 7th ventrite and visible 8th ventrite (although this is not always apparent in specimens of H. mangiferae).

Distribution

All species are tropical and sub-tropical, native to Africa, Asia and Oceania, with several introduced species found in the tropical and sub-tropical Americas, including south-eastern USA.

Biology and Ecology

Species are monogamous and the larvae are solitary after the first instar.

Key to Species

1a) Setae on pronotal disc entirely hair-like. Males without a transverse ridge on the frons ...... Hypocryphalus mangiferae

1b) Setae on pronotal disc entirely scale-like. Males with a transverse ridge on the frons ...... Hypocryphalus sp. “1422”

Hypocryphalus mangiferae (Stebbing, 1914)

Synonymy. Cryphalus inops Eichhoff, 1872; Hypothenemus griseus Blackburn,

1885; Cryphalus mangiferae Stebbing, 1914; Cryphalus mimicus Schedl, 1942;

Hypocryphalus opacus Schedl, 1942; Cryphalus subcylindricus Schedl, 1942.

Size. 1.6 to 1.9 mm (Wood 2007).

Diagnosis. Hypocryphalus mangiferae can easily be distinguished from the other

Hypocryphalus species based on the setae on the pronotal disc, which are entirely hair like. They also differ in shape (Hypocryphalus sp. “1422” being oval shaped, H. mangiferae being quadrate), the interstrial bristles, and the structure of the male frons

(Hypocryphalus sp. “1422” males having a transverse ridge above the level of the eyes, whereas H. mangiferae males have a simple convex frons).

Remarks. Cryphalus robustus Eichhoff, 1872 has been labelled as a junior synonym (Wood 2007) and a senior synonym (Pullen et al. 2014) of this species, but has recently been reinstated as a separate species (see Chapter 3). The type locality of

C. robustus is recorded as “North America”, yet no specific locality is known and no specimens have been collected beyond the type series collected nearly 150 years ago.

The presence of this species in North America is considered dubious (Wood and Bright

1992, Chapter 3) and not listed in this review.

Hypocryphalus sp. “1422”

Diagnosis. This species can be distinguished from H. mangiferae by the presence of flattened setae on the pronotal disc (hair-like in H. mangiferae), the shorter interstrial bristles, and the presence of a transverse ridge in males.

Remarks. This non-native species was first recorded in Pensacola, Florida, in

2012 (K. Fairbanks, FSCA, pers. com.). The origins and ecology of this species are unknown, since it is only known from trapped specimens. Genetically similar specimens have been collected in Asia on paper mulberry (Chapter 3) which is abundant in the trapping area.

Hypothenemus Westwood, 1834

Diagnosis

Hypothenemus can be distinguished from other North American Cryphalini by the following characters. The antennal club has sutures, the first being partially septate (for most species, but see notes below). The eye is emarginated, sometimes weak or not apparent in smaller species. The mesocoxae are narrowly separated. The majority of species are have conspicuous flattened setae in rows, with little ground vestiture, except at the elytral apex.

There are two exceptional species found in North America, Hypothenemus distinctus and Hypothenemus piaparolinae (Figure 2-22), which are minute and lack a septum, showing characters like Hypothenemus, Cryptocarenus, Trischidias and the poorly known South American genus Periocryphalus Wood, 1971. These four genera are differentiated mostly by the absence of characters, and it is possible that

Hypothenemus is paraphyletic with respect to some other genera. The exact placement and relationship between these genera and species are not clear, and for this review they will continue to be classified under Hypothenemus.

Hypothenemus can be distinguished from species in the genus Trischidias by the smaller size of Trischidias, the antennal club which always lacks a septum in Trischidias

Distribution

Hypothenemus have a worldwide in tropical and sub-tropical environments, as well as warm temperate regions. Most species are restricted to south and South-

Eastern US, with just two species known from Western US.

Biology and Ecology

Hypothenemus are some of the most common bark beetles. The host range of some Hypothenemus is spectacular, with species being collected on hundreds of plant species from dozens of plant families.

Two morphologically similar species do appear to be specialists—Hypothenemus pubescens in only known from costal grasses, and H. parvistriatus is known only from a fern. Hypothenemus are also frequently collected in traps, particularly those with lures targeting non-specialist Scolytines, such as ethanol.

All Hypothenemus species have males which have greatly reduced wings, smaller eyes, smaller body length a generally deformed appearance. For the two studied pest species, H. hampei and H. obscurus, this is known to be due to functional haplo-diploidy, specifically pseudo-arrhenotoky (Vega et al. 2015a). This is presumably the case for all other Hypothenemus species. Males are thought to spend all their life in their parental gallery, mating with their sisters. However, males are occasionally found in traps, sometimes in large numbers (Johnson et al. 2016b).

The life history of Hypothenemus, particularly mating before dispersal and living in an incredible host range, allows them to easily colonize new areas, since only a single female is required to start a population. They are also very frequently found on imported material. Hypothenemus were the most intercepted genus of all Scolytinae between 1985 and 2000 (Haack, 2001). Consequently, there are many species in North

America which are probably exotic. Differentiating exotic Hypothenemus from native ones may be difficult since many are long established, and the native fauna is still poorly known. However, the species suggested to be exotic, as described here, are presumed exotic based on distribution of that species, as well as morphologically similar species. For example, there are few species morphologically like H. javanus in the

Americas, but there are many over Africa and Asia.

Identification to Species

Hypothenemus is the most speciose genus of Cryphalini, and its species are particularly challenging to identify. Particular characters useful for identification are size, sculpturing of the frons, size and distribution of asperities on the pronotum, and the surface microscupturing and vestiture of the pronotum and elytra. Worldwide the species diversity is vast, and the number of characters limited. Character matrices show the variation is saturated and does not show a clear discernible phylogenetic pattern alone (Johnson, unpublished). Furthermore, the saturation of characters could lead to many cryptic species, because many of the combinations of characters are already occupied by one species, another lineage could converge into the same combination of characters. This is especially likely if many of the characters are losses of visible features, e.g. simplification of the frons, or the absence of interstrial ground vestiture, for which multiple instances of losses are often indistinguishable. Lastly, identification is

confused further by aberrant specimens, which differ from the discrete character states used in species identification.

The few molecular studies including Hypothenemus hint at the vast complexities of the group. The coffee berry borer, Hypothenemus hampei, had COI (partial

Cytochrome oxidase I gene) variation as high as 11.8%, (Gauthier, 2010), whereas H. eruditus from a single host and single locality in Panama had COI variation as high as

20.1% (Kambestad, 2011), which suggests deep divergence of lineages at levels which are far beyond that expected of a single species. Delimiting species within

Hypothenemus has been challenging and inconsistent among taxonomists, and will remain so until much more exhaustive studies of the biology and genetics of the species is known.

Hypothenemus has a remarkable number of synonyms, and this is especially true of the North American species. If there are cryptic species, it is likely that many of them will already have been taxonomically described, but the ability to assign them would be extremely challenging because the type specimens have degraded morphologically and genetically.

Despite this difficulty, this review will attempt to guide the identification of species to the existent classification, with the addition of two species. The key below attempts to account for the considerable variation in many species which would otherwise be misidentified with currently available literature.

The photographs of the species are grouped an accordance to the key.

Key to Species

1a) Always larger than 1.4 mm. Median pair of marginal asperities are prominent and much larger than any others (if present). Interstrial ground vestiture always present, especially on the posterior declivity of elytra. Slight anterior declivity of elytra, all

deep bodied with robust appearance (All species photographed in Figure 2-19, Figure 2-20 and Figure 2-21). Frons always convex...... 2

1b) Mostly smaller species, 0.7 to 1.8 mm. Marginal pair of marginal asperities equal or larger than others (if present). Presence of interstrial ground vestiture variable, in some cases within species. Most do not have an anterior elytral declivity (exceptions: H interstitialis & H. squamosus, which always lack interstrial ground vestiture). Variable body shape. Frons is either concave or convex ...... 6

2a) Twenty or more asperities on anterior declivity of pronotum (Figure 2-17, A). Four marginal asperities, the other two smaller. Interstrial bristles always flattened with rounded tips. Area of head behind eyes is does not have striations. Known from Central and South Florida ...... Hypothenemus birmanus

2b) Less than twenty asperities on anterior declivity of pronotum (Figure 2-17, B). Two or four marginal asperities, if four, the outer two are much smaller or minute. Interstrial bristles flattened with square or rounded tips, or hair like and pointed. If visible, the head has striate surface texture above and behind the level of the eyes. Broadly ranging across US and likely in south east Canada ...... 3

3a) Interstrial bristles hair like with pointed tips (interstrial ground vestiture may be flattened ...... 4

3b) Interstrial bristled flattened with rounded or square tips ...... 5

4a) Elytral declivity entirely convex, not flared at the apex. Widely distributed across southern and eastern United States ...... Hypothenemus dissimilis

4b) Declivity flared at the apex. Limited to South Florida ...... Hypothenemus hirsutus

5a) Anterior margin of pronotum with two marginal asperities, not flanked by two small asperities ...... Hypothenemus rotundicollis

5b) Four marginal asperities, the flanking two much smaller .... Hypothenemus erectus

6a) Median pair (or single) marginal asperities larger than others. Total length 0.7-1.2 mm. Interstrial ground vestiture is always absent. Frons always convex with no distinct sculpturing. All species rarely collected and appear not attracted to traps (All species photographed in Figure 2-22) ...... 7

6b) Four or more marginal asperities of similar size (although inner pair may be reduced or absent for H. brunneus and H. gossypii). Total length 1.0-1.8 mm. Interstrial ground vestiture present or absent. Frons concave or convex. Common to rare, most are attracted to ethanol baited traps ...... 10

7a) Body stout, 2.1 times as long as wide. Flattened Interstrial bristles on elytral disc, at least as dense along rows as the strial setae. Pronotum and elytra black when mature...... Hypothenemus sparsus

7b) Body elongate, more than 2.3 times as long as wide. Interstrial bristles variable. Mature color variable ...... 8

8a) One single, very prominent marginal asperity, usually flanked by much smaller asperities...... Hypothenemus miles

8b) Two prominent median marginal asperities, sometimes flanked with smaller asperities, which together project from the pronotum ...... 9

9a) Interstrial bristles flattened, apex of elytra rounded...... Hypothenemus distinctus

9b) Interstrial bristles hair like, apex of elytra weakly flared ...... Hypothenemus piaparolinae

10a) Frons with transverse carina, and sometimes concave (Figure 2-18, A, B, C and D) (All species photographed in Figure 2-24 and Figure 2-25) ...... 11

10b) Frons convex without any transverse carina. (note, Hypothenemus crudiae may appear to have a concave frons laterally, but that is from a tubercle rather than a transverse carina) ...... 15

11a) Carina low on frons (Figure 2-18, A.) 1.0-1.2 mm. Little or no interstrial ground vestiture. Usually bicolored ...... Hypothenemus columbi

11b) Carina at level of eyes. 1.2-1.9 mm. Interstrial ground vestiture variable. Color variable ...... 12

12a) 1.2-1.4 mm. Frons with protruding carina and weakly concave frons. Pronotum closely micropunctate. Interstrial and strial rows often slightly confused. No interstrial ground vestiture lying flat on the declivity ...... Hypothenemus brunneus

12b) 1.2-1.9 mm. Carina of frons not protruding. Interstrial ground vestiture dagger-like and lies flat pointing towards apex of elytra ...... 13

13a) Less than 25 asperities on pronotal declivity, and typically 4 marginal asperities. 1.4-1.9 mm. Stout shape, less than 2.3 times as long as wide. Pronotum usually lighter in color than elytra ...... Hypothenemus javanus

13b) More than 25 asperities on pronotal declivity, and 4 to 10 marginal asperities. 1.2- 1.9 mm. Slender shape, more than 2.3 times as long as wide. Pronotum and elytra of a similar color ...... 14

14a) 1.2-1.4 mm ...... Hypothenemus areccae

14b) 1.6-1.9 mm ...... Hypothenemus setosus

15a) 1.0 to 1.6 mm (Mostly smaller than 1.4 mm). Interstrial ground vestiture present, as dagger shaped setae pointing towards apex, especially around the apex (sparse in

Hypothenemus californicus, H. gossypii and sometimes sparse or, rarely, absent in H. eruditus and H. pubescens) ...... 16

15b) 1.3 to 1.8 mm (mostly equal or larger than 1.4 mm). Interstrial ground vestiture absent or very sparse (All photographed in Figure 2-32 and Figure 2-33) ...... 21

16a) Eye smaller, usually less than 6 ommatidia wide at the point of the emargination 17

16b) Eye similar to most other Hypothenemus, at least 6 ommatidia wide at the point of emargination ...... 19

17a) Interstrial bristles on elytra are approximately as wide as long. Matures yellow- brown ...... Hypothenemus pubescens

17b) Interstrial bristles on elytra longer than wide. Matures black ...... 18

18a) Elytral punctures small, less than a fifth of the distance between the strial rows, giving the elytra very smooth and shiny appearance Hypothenemus parvistriatus

18b) Elytral punctures large, typically one third or one half of the distance between strial rows...... Hypothenemus subterrestris

19a) 1.0 to 1.3 mm (Some specimens larger, see notes). Asperities on pronotum less than twice as long as wide. Interstrial ground vestiture variable. Strial and interstrial rows linier. Bicolored or uniformly colored. Median marginal asperities usually close or contiguous. (Photographed in Figure 2-26 and Figure 2-27) ...... Hypothenemus eruditus

19b) 1.3 to 1.4 mm. Asperities on pronotum at least twice as long as wide. Interstrial ground vestiture sparse and not denser at apex of elytra. Strial and interstrial rows slightly confused. Pronotum orange to brown, elytra dark brown or black when mature. Median marginal asperities widely spaced or absent (Photographed in Figure 2-28 and

Figure 2-29) ...... 20

20a) Median marginal asperities present (The four most median asperities are approximately evenly spaced) ...... Hypothenemus californicus

20b) Median marginal asperities absent (The gap between the two most median asperities remaining is much wider than between others) ...... Hypothenemus gossypii

21a) Interstrial bristles on elytral declivity more than three times longer than interstrial bristles on elytral disc. Weak anterior elytral declivity present. Usually just four marginal asperities with the median pair slightly larger than others, sometimes with additional smaller asperities ...... 22

21b) Interstrial bristles on elytral declivity less than three times longer than interstrial bristles on elytral disc. No anterior elytral declivity present. Four to six marginal asperities which are mostly of a similar size (occasional smaller flanking asperities) ...... 23

22a) Declivity broadly rounded. Broadly distributed over SE USA, south to central Florida ...... Hypothenemus interstitialis

22b) Declivity abrupt and slightly flattened. Restricted to South Florida ...... Hypothenemus squamosus.

23a) A conical, broad tubercle present on the frons at the level of the top of eyes. Typically 1.6 mm...... Hypothenemus crudiae

23b) Frons without broad tubercle. Most specimens are 1.4 mm, but range from 1.2 to 1.7 mm ...... 24

24a) Pronotum and elytra entirely micropunctate, with no areas smooth and shining. There are a small number of inconspicuous dagger-like setae (interstrial ground vestiture) near the apex of the elytra, lying flat and pointing apically. Interstrial bristles are mostly about four times as long as wide, shorter on the elytral disc. When viewed laterally, the declivity is slightly longer than the elytral disc. This species is known mostly from live or dead seeds. Restricted to South Florida...... Hypothenemus obscurus

24b) Pronotum and elytra variable ranging from smooth and shining to micropunctate, but usually with at least some areas smooth and shining. Interstrial ground vestiture is always absent. Interstrial bristles are variable, mostly about four times as long as wide, and shorter on the elytral disc. When viewed laterally, the declivity is of a similar size or slightly shorter than the elytral disc. Fount mostly on dead twigs but occasionally on fruit and seeds. Widespread in Southern and Eastern USA...... Hypothenemus seriatus

Hypothenemus areccae (Hornung, 1842)

Synonymy. Bostrichus areccae Hornung, 1842; Stephanoderes obscurus

Eichhoff, 1872; Stephanoderes depressus Eichhoff, 1878; Hypothenemus vafer

Blandford, 1898; Stephanoderes fungicola Eggers, 1908; Stephanoderes polyphagus

Eggers, 1924; Stephanoderes hispidus Eggers, 1925; Hypothenemus heterolepsis

Costa Lima, 1928; Hypothenemus capitalis Beeson, 1935; Stephanoderes bambesanus

Eggers, 1940; Hypothenemus eupolyphagus Beeson, 1940; Stephanoderes subvestitus

Eggers, 1940; Stephanoderes martiniquensis Eggers, 1941; Hypothenemus oahuensis

Schedl, 1941; Hypothenemus subglabratus Schedl, 1942; Hypothenemus bauhaniae

Schedl, 1950; Stephanoderes occidentalis Schedl, 1954.

Size. 1.2 to 1.4 mm (Wood, 2007).

Diagnosis. Hypothenemus areccae specimens are small, elongate, with a concave frons. In Southeast Asia, this species seems particularly variable, with specimens ranging from bicolored with no interstrial ground vestiture, to a solid yellow- brown, with dense ground vestiture at the apex of the elytra. All specimens collected in

North America have a pronotum of a similar color to the elytra, and dense interstrial ground vestiture around the apex of the elytra.

This species is dubiously distinguished from H. setosus by its smaller size. Wood describes the interstrial bristles to be shorter in specimens of H. setosus, but there are many specimens which do not fit this description. The North American representatives of these two species look remarkably similar, more so than other examples collected in

Africa and Asia. Hypothenemus javanus is also similar to H. areccae, but much larger and a less elongate body. Hypothenemus columbi is smaller, and has a lower concavity of the frons.

Remarks. All North American records are from South Florida. This species is very broadly distributed across the tropics.

Hypothenemus birmanus (Eichhoff, 1878)

Synonymy. Stephanoderes birmanus (Eichhoff, 1878); Triarmocerus birmanus

Eichhoff, 1878; Hypothenemus maculicollis Sharp, 1879; Hypothenemus peritus

Blandford, 1894; Hypothenemus farinosus Blandford, 1904; Hypothenemus validus valens Sampson, 1914; Stephanoderes perkinsi Hopkins, 1915; Stephanoderes psidii

Hopkins, 1915; Stephanoderes sterculiae Hopkins, 1915; Stephanoderes alter Eggers,

1923; Stephanoderes uter Eggers, 1923; Stephanoderes nibarani Beeson, 1933;

Stephanoderes ampliatus Eggers, 1936; Stephanoderes pacificus Beeson, 1940;

Stephanoderes castaneus Wood, 1954; Stylolentus dubius Schedl, 1971.

Size. North American specimens range from 1.5 to 1.8 mm, larger ones are known from elsewhere.

Diagnosis. This species can be distinguished from other North American

Hypothenemus by the large median marginal asperities flanked by a smaller pair, the number of asperities on the anterior declivity of the pronotum (15 to 25) (Figure 2-17).

The declivity has dense setae, with interstrial ground vestiture in rows between the strial and interstrial rows.

Hypothenemus birmanus has been previously confused with H. erectus, but can easily be distinguished by the number of asperities on the pronotum (Figure 2-17).

Occasionally specimens have three or just two marginal asperities, leading to confusion with H. rotundicollis.

If visible, the cuticle of the frons above the eyes is very weakly, if at all, striate in

H. birmanus, and distinctly striate for the similar North American species.

All specimens observed from North America have a short antennal funicle, with just three segments, easily distinguishing it from other similar species which always have five. Elsewhere, however, H. birmanus have variable numbers, even between antennae on one specimen.

Remarks. The range of H. birmanus is not known to overlap with H. erectus and

H. rotundicollis, limited to South and Central Florida, whereas H. erectus and H.

rotundicollis extend broadly over the South East and South of USA. It is a non-native species which is common in South East Asia, and introduced to tropical areas worldwide.

Hypothenemus brunneus (Hopkins, 1915)

Synonymy. Stephanoderes brunneus Hopkins, 1915; Stephanoderes frontalis

Hopkins, 1915; Hypothenemus cryphalomorphus Schedl, 1939; Stephanoderes bituberculatus Eggers, 1940.

Size. 1.3 to 1.45 mm (Wood 2007).

Diagnosis. This species can be distinguished from other North American

Hypothenemus by its frons, which has an elevated transverse carina which is barely concave below. The striae and interstriae are not in clear rows, with some erect setae intermixed, especially on the declivity. There is little or no interstrial ground vestiture which lies flat along the elytra. The pronotum has fine, contiguous punctures. The arrangement of marginal asperities is variable, typically just two widely spaced asperities (which seems to be from the loss of the two median asperities). Its overall color is usually the same for the pronotum and elytra, brown, and translucent (the folded wings are usually visible in females).

Males are variable, sometimes as large as females, but with a smaller eye, much longer interstrial ground vestiture, and vestigial wings. The males have been collected outside of galleries in large numbers (Johnson et al. 2016b).

This species can be distinguished from the similar H. javanus by the structure on the frons, which for H. javanus, is clearly concave and without an elevated transverse ridge, whereas H. brunneus is clearly concave with an elevated ridge, most visible when viewed laterally. The pronotum of H. javanus is smooth or lattice-like, with widely

spaced punctures, whereas H. brunneus is micropunctate (i.e. with contiguous fine surface punctures). The setae on the elytra also differ, with H. javanus having neat rows of strial setae and interstrial bristles, with dagger-like ground vestiture at the apex of the elytra.

Hypothenemus californicus Hopkins, 1915

Synonymy. Hypothenemus californicus triciti Hopkins, 1915; Hypothenemus californicus californicus Hopkins, 1915; Hypothenemus triciti Hopkins, 1915;

Hypothenemus thoracicus Hopkins, 1916; Stephanoderes zeae Schedl, 1973.

Size. 1.0 to 1.4 mm (Wood 1982), Mostly 1.3 mm.

Diagnosis. Hypothenemus californicus can be distinguished from all other North

American Hypothenemus species by the combination of its size, entirely convex frons, the prominent marginal asperities which are at least twice as long as wide, with the median four of a similar distance apart. The body shape is elongated, and is usually bicolored with darker elytra, maturing dark brown or black. The elytral surface is shining.

For most specimens, the interstrial and strial rows are slightly confused (i.e. not in perfect rows). The interstrial bristles are white or blond, and dagger-like interstrial ground vestiture is present, more concentrated on the apex of the elytra.

Hypothenemus californicus can be distinguished from the dubiously distinct H. gossypii by the marginal asperities, for which the median pair are absent, meaning the remaining visible median pair to be widely separated. For other North American

Hypothenemus species, such as H. brunneus, this character is variable.

This species can be distinguished from the similar H. eruditus by the size and the much larger asperities, although occasionally ambiguous specimens are found.

Remarks. Most records come from the pith of non-woody material, such as vines and grasses.

Hypothenemus columbi Hopkins, 1915

Synonymy. Hypothenemus abdominalis Hopkins, 1915; Hypothenemus amplipennis Hopkins, 1915; Hypothenemus brunneipennis Hopkins, 1915;

Hypothenemus rufopalliatus Hopkins, 1915.

Size. 1.0 to 1.2 mm.

Diagnosis. This species can be distinguished from the similar H. areccae by the smaller size, and the concavity of the frons, which is below the level of the eyes in H. columbi and much higher, approximately level with the eyes of H. areccae. The interstrial ground vestiture is absent or very sparse in H. columbi, and present in specimens of H. areccae collected in North America.

While this species is distinguished from H. eruditus by the presence of the concavity in the frons, some specimens of H. eruditus look remarkably similar otherwise, sometimes even with a weak tubercle on the frons.

All specimens observed, including the type of the species, are bicolored, with an orange pronotum and darker elytra. In many other North American Hypothenemus species, this is a variable and unreliable character.

Hypothenemus crudiae (Panzer, 1791)

Synonymy. Bostrichus crudiae Panzer 1791; Cryphalus mucronifer Wollaston,

1867; Cryphalus hispidulus LeConte, 1868; Hypothenemus nanus Hagedorn, 1909;

Stephanoderes brasiliensis Hopkins, 1915; Stephanoderes differens Hopkins, 1915;

Stephanoderes guatemalensis Hopkins, 1915; Stephanoderes lecontei Hopkins, 1915;

Stephanoderes paraguayensis Hopkins, 1915; Stephanoderes trinitatis Hopkins, 1915;

Stephanoderes fallax Costa Lima, 1924; Stephanoderes largipennis Piza Junior, 1924;

Stephanoderes polyphagus Costa Lima, 1924; Stephanoderes uniseriatus Eggers,

1924; Stephanoderes hivaoea Beeson, 1935; Stephanoderes lebronneci Beeson, 1935;

Stephanoderes hawaiiensis Schedl, 1941.

Size. 1.4 to 1.6 mm (Wood 1982).

Diagnosis. Hypothenemus crudiae is similar and sometimes difficult to distinguish from H. seriatus. It is primarily distinguished by the sculpturing on the frons,

H. seriatus is typically flat or convex, whereas H. crudiae has a tubercle, which may be distinct or a slightly conical, elevated region of the frons (Figure 2-18). This species is also more robust and usually larger than H. seriatus, and the interstrial bristles appear more densely distributed.

Remarks. Hypothenemus crudiae is broadly recorded across South East USA, but the majority of the specimens which best fit this species are from central and south

Florida. This species is frequently found entering fruits (Johnson, unpublished).

Hypothenemus dissimilis (Zimmermann, 1868)

Synonymy. Crypturgus dissimilis Zimmermann, 1868; Stephanoderes chapuisii

Eichhoff, 1872

Size.1.8 to 2.35 mm.

Diagnosis. This species can be distinguished from most Hypothenemus by its large size, having only two marginal asperities and few asperities on the pronotal declivity, and having interstrial bristles on the elytra being pointed rather than flattened.

The interstrial ground vestiture is much shorter than the interstrial bristles, and scale-like and dense on the declivity. Some specimens look remarkably similar to H. rotundicollis, except the differences in vestiture.

Hypothenemus dissimilis can be distinguished from the similar H. hirsutus by the elytral declivity profile; when the specimen is viewed laterally the declivity is entirely convex in H. dissimilis, and flared at the apex in H. hirsutus. They also differ in vestiture, which H. hirsutus having coarser, longer interstrial bristles on the declivity, and less interstrial ground vestiture. The range of H. hirsutus is also limited to only South Florida.

Remarks. This is a common, widespread species, with a broad range in Eastern

North America, from South Florida, to far north as Michigan, and may extend into

Ontario, Canada.

Hypothenemus distinctus Wood 1954

Size. 0.8 to 0.9 mm.

Diagnosis. Hypothenemus distinctus is distinguished from other Hypothenemus by its minute size, the presence of just two marginal asperities, the absence of interstrial ground vestiture, the absence of an antennal septum, and the short scale like vestiture.

It is distinguished from the similar H. piaparolinae by the scale-like interstrial bristles, by the rounded elytral apex (which is slightly flared in H. piaparolinae), and by the smaller size.

This species is only known from a few widely scattered records in south, southeast and central USA.

Hypothenemus erectus LeConte, 1876

Synonymy. Stephanoderes erectus (LeConte, 1876); Hypothenemus validus

Blandford, 1904; Stephanoderes brunneicollis Hopkins, 1915; Stephanoderes cubensis

Hopkins, 1915; Stephanoderes puncticollis Hopkins, 1915; Stephanoderes discedens

Schedl, 1950.

Size. 1.9 to 2.3 mm.

Diagnosis. Hypothenemus erectus can be distinguished from other North

American Hypothenemus based on size, the number of marginal asperities (four, with the outer pair small), and having very few asperities on the anterior declivity of the pronotum, typically approximately 12 (see Figure 2-17).

Hypothenemus erectus can be distinguished from H. birmanus based on the few asperities on the anterior declivity of the pronotum, the striate surface texture of the head behind the eyes, and the more broadly rounded declivity. Hypothenemus erectus also always has five antennal funicle segments, whereas North American specimens of

H. birmanus have just three.

Specimens of H. erectus are very similar and dubiously distinct from H. rotundicollis, distinguished by the presence of an outer pair of marginal asperities, and a larger size. The range of these species within North America is almost identical, and the distinguishing character can be variable within other Hypothenemus species.

Remarks. The treatment of H. erectus in previous identification guides is confusing. Wood (1982 and 2007) emphasized the similarity between this species and

H. birmanus and did not mention some key differences such as the distinctly different size and number of marginal asperities. Furthermore, the photograph accompanying the description (Wood, 2007) did not match the appearance of specimens of H. erectus from North America, including the lectotype.

Hypothenemus eruditus Westwood, 1836

Synonymy. Cryphalus aspericollis Wollaston, 1860; Bostrichus boieldieui Perroud, 1864; Cryphalus obscurus Ferrari, 1867; Stephanoderes ehlersii Eichhoff, 1878; Stephanoderes germari Eichhoff, 1878; Stephanoderes myrmedon Eichhoff, 1878; Stephanopodius communis Schaufuss, 1891;

Hypothenemus insularis Perkins, 1900; Cryphalus tectonae Stebbing, 1903; Cryphalus basjoo Niisima, 1910; Cryphalus striatopunctatus Lea, 1910; Cryphalus tantillus Lea,

1910; Hypothenemus tuberculosus Hagedorn, 1912; Hypothenemus asiminae Hopkins,

1915; Hypothenemus bradfordi Hopkins, 1915; Stephanoderes elongatus Hopkins,

1915; Stephanoderes evonymi Hopkins, 1915; Hypothenemus ferrugineus Hopkins,

1915; Stephanoderes flavicollis Hopkins, 1915; Hypothenemus flavipes Hopkins, 1915;

Hypothenemus flavosquamosus Hopkins, 1915; Hypothenemus hamamelidis Hopkins,

1915; Hypothenemus heathi Hopkins, 1915; Hypothenemus koebelei Hopkins, 1915;

Hypothenemus lineatifrons Hopkins, 1915; Hypothenemus mali Hopkins, 1915;

Hypothenemus myristicae Hopkins, 1915; Hypothenemus nigricollis Hopkins, 1915;

Hypothenemus nigripennis Hopkins, 1915; Hypothenemus parvus Hopkins, 1915;

Hypothenemus pruni Hopkins, 1915; Hypothenemus punctifrons Hopkins, 1915;

Hypothenemus punctipennis Hopkins, 1915; Stephanoderes pygmaeus Hopkins, 1915;

Hypothenemus rumseyi Hopkins, 1915; Hypothenemus sacchari Hopkins, 1915;

Cosmoderes schwarzii Hopkins, 1915; Stephanoderes subconcentralis Hopkins, 1915;

Hypothenemus tenuis Hopkins, 1915; Stephanoderes unicolor Hopkins, 1915;

Hypothenemus webbi Hopkins, 1915; Hypothenemus bicolor Eggers, 1919;

Hypothenemus ehlersi rotroui Peyerimhoff, 1919; Hypothenemus juglandis Blackman,

1922; Hypothenemus pusillus Eggers, 1927; Hypothenemus intersetosus Eggers, 1928;

Stephanoderes gracilis Eggers, 1929; Hypothenemus lezhavai Pjatinsky, 1929;

Hypothenemus citri Ebling, 1935; Hypothenemus erythrinae Eggers, 1936;

Hypothenemus argentinensis Schedl, 1939; Hypothenemus bicolor Schedl, 1939;

Hypothenemus cylindricus Schedl, 1939; Hypothenemus asaroensis Beeson, 1940;

Hypothenemus dubiosus Schedl, 1940; Stephanoderes subcylindricus Eggers, 1940;

Hypothenemus mauiensis Schedl, 1941; Hypothenemus glabratus Schedl, 1942;

Archeophalus ealensis Eggers, 1944; Stephanopodius nanulus Schedl, 1949;

Hypothenemus parilis Schedl, 1951; Hypothenemus hirtipennis Schedl, 1952;

Hypothenemus longipilis Schedl, 1952; Stephanoderes obscuriceps Schedl, 1952;

Stephanoderes tigrensis Schedl, 1952; Hypothenemus glabratellus Schedl, 1953;

Hypothenemus cylindripennis Schedl, 1957; Hypothenemus parcilus Schedl, 1957;

Hypothenemus vianai Schedl, 1958; Hypothenemus mesoleius Schedl, 1959;

Hypothenemus minutulus Schedl, 1972; Cryphalus minutus Schedl, 1978.

Size. 1.0 to 1.2 mm (sometimes larger, see notes below).

Diagnosis. There are few specific characters which diagnose Hypothenemus eruditus. They are identified mostly by a lack of distinctive characters. The frons is entirely convex, although may have a weak tubercle in the center. The anterior margin of the pronotum usually has six asperities, with the central pair usually being close but not much larger than the other asperities. The body is elongate, more than 2.2 times longer than wide.

This species can be distinguished from H. columbi and H. areccae by sculpturing of the frons, which is strongly concave in H. areccae, weakly concave for H. columbi, and convex (occasionally with a tubercle) on specimens of H. eruditus.

This species is distinguished from H. distinctus, H. piaparolinae and Trischidias spp. by the marginal asperities, which the median pair are or a similar size to other marginal asperities in eruditus, compared to the median pair being larger than others asperities in the listed species.

This species can be distinguished from H. pubescens, H. subterrestris and H. parvistriatus by the longer body shape, although for some specimens, this is not clear.

The elytra may be smooth to rugose, and usually has deep punctures. The interstrial ground vestiture is variable, with some specimens having dense dagger like setae near the apex, and others having almost none.

Remarks. This is an extremely widespread and common species with an incredible worldwide distribution. There is some evidence to suggest that it is comprised of many, difficult to distinguish species, but with some informative characters

(Kambestad et al. 2017). The apparent ecological diversity and abundance of this species may be simply the inability to delimit a complex of morphologically similar species. Resolving this though traditional taxonomic means is an incredibly difficult task, with 73 synonyms, often represented by old specimens with morphological or molecular characters lost.

A series of larger specimens which most closely resemble H. eruditus was collected in Gainesville, Florida, which were approximately 1.3 to 1.5 mm. However, upon comparing the specimens to hundreds of others, no distinct morphotype could be delimited.

Hypothenemus gossypii (Hopkins, 1915)

Synonymy. Stephanoderes gossypii Hopkins, 1915; Hypothenemus beameri

Wood, 1954.

Diagnosis. Hypothenemus gossypii can be readily distinguished from other

Hypothenemus by the size, convex frons, and widely spaced median marginal asperities. This is dubiously distinct from H. californicus, as described above.

Hypothenemus hirsutus (Wood 1954)

Synonymy. Stephanoderes hirsutus Wood, 1954

Diagnosis. This species is distinguished from other Hypothenemus by the combination of long, pointed interstrial bristles with flattened interstrial ground vestiture, and a flared elytral apex. This species is most similar to H. dissimilis, the differences are described above.

Remarks. Hypothenemus hirsutus has a very limited recorded range in extreme

South Florida and the Keys.

Hypothenemus interstitialis (Hopkins, 1915)

Synonymy. Stephanoderes approximatus Hopkins, 1915; Stephanoderes flavescens Hopkins, 1915; Stephanoderes interpunctus Hopkins, 1915; Stephanoderes interstitialis Hopkins, 1915; Stephanoderes obliquus Hopkins, 1915; Stephanoderes opacipennis Hopkins, 1915; Stephanoderes quadridentatus Hopkins, 1915.

Size. 1.4 to 1.8 mm.

Diagnosis. This widespread species usually has four marginal asperities

(sometimes six). The pronotum has a finely micropunctate surface texture, and is usually slightly lighter in color compared to the elytra. There is a slight anterior declivity to the elytra, and the posterior declivity is broadly rounded. The interstrial bristles on the elytral disc are flattened and scale like. On the declivity, the interstrial bristles are long and narrow (without a distinct transition). There is no interstrial ground vestiture.

This species can be distinguished by the similar H. seriatus and H. obscurus by the larger size, by the deeper body, and by the much longer interstrial bristles on the declivity. Hypothenemus squamosus is similar and H. interstitialis can be distinguished from H. squamosus by the more broadly rounded declivity, and by the narrower setae.

Remarks. This species is mostly found in recently dead thin twigs and small branches.

This species has been grouped with H. seriatus in the identification guide due to overlap with many characters. However, there are several characters, such as the anterior elytral declivity, and slightly larger median pair of asperities, which suggest that these may be more closely related to species such as H. rotundicollis and H. dissimilis.

Hypothenemus javanus (Eggers, 1908)

Synonymy; Stephanoderes javanus Eggers, 1908; Stephanoderes obesus

Hopkins, 1915; Stephanoderes philippenensis Hopkins, 1915; Stephanoderes bananensis Eggers 1922; Stephanoderes kalshoveni Schedl, 1939; Stephanoderes subagnatus Eggers, 1940; Stephanoderes pistor Schedl, 1951; Stephanoderes prosper

Schedl, 1951.

Size. 1.4 to 1.8 mm.

Diagnosis. This large, robust species is likely an introduced exotic from Africa

(Wood 1977). It can be distinguished from all other North American Hypothenemus by the structure of the frons (concave with an abrupt, but not elevated, transverse carina), by the size and broad shape (approximately 2.2 times as long as wide), and by the presence of dagger like interstrial ground vestiture near the apex of the elytra.

This species is most likely to be confused with H. brunneus. See notes for distinguishing these species under H. brunneus.

Hypothenemus areccae and H. setosus can share a similar structure of the frons, but differ by their smaller size (although one exceptionally large specimens determined as H. setosus was 1.8 mm), the number of marginal asperities (typically just four in H.

javanus) and the number of asperities on the pronotal declivity (Typically less than 25 for H. javanus, and more than 25 for H. areccae and H. setosus).

Hypothenemus sparsus Hopkins, 1915

Synonymy. Hypothenemus similis Hopkins, 1915; Stephanoderes tridentatus

Hopkins, 1915.

Size. 1.1 to 1.3 mm.

Diagnosis. This species is particularly stout, approximately 2.1 times as long as wide (Wood, 1982). It can be recognized by its stout appearance, small size, having two large median marginal asperities, usually flanked by a smaller pair. There is no interstrial ground vestiture.

Wood describes this species as almost identical to H. pubescens, for which the reason is not clear. The interstrial bristles are much longer than H. pubescens, and the declivity occupies more than half the length of the elytra (viewed laterally), and the median marginal asperities of H. sparsus are much larger than the others, not like H. pubescens.

This species closely resembles Trischidias georgiae, and can be distinguished by the more prominent outer pair of marginal asperities (barely visible or absent in T. georgiae), the smaller interstrial punctures and the much longer interstrial vestiture.

From the specimens observed, it is not clear whether the antennae have a septum.

Remarks. This species in currently only known from a few records in Texas and nearby areas in Mexico.

Hypothenemus miles (LeConte, 1878)

Diagnosis. This distinctive species can be clearly recognized by the single prominent marginal asperity, often flanked by two or more smaller marginal asperities.

The pronotum is finely micropunctate. The scales on the elytra are mostly about as long as wide and appear widely spaced. There is no interstrial ground vestiture.

It can be distinguished from all other species by its unique large marginal asperity and its long body-shape. All specimens observed are completely dark brown or black.

Hypothenemus obscurus (Fabricius, 1801)

Synonymy: Stephanoderes obscurus (Fabricius, 1801); Hylesinus obscurus

Fabricius, 1801; Stephanoderes asperulus Eichhoff, 1872; Stephanoderes cassiae

Eichhoff, 1878; Hypothenemus kunnemanni Reitter, 1902; Stephanoderes moschatae

Schaufuss, 1905; Stephanoderes buscki Hopkins, 1915; Stephanoderes rufescens

Hopkins, 1915; Stephanoderes amazonicus Eggers, 1934; Hypothenemus emarginatus

Schedl, 1942.

Size. 1.4 to 1.7 mm, most specimens from North America are 1.4 to 1.5 mm.

Diagnosis. Distinguished from the similar H. seriatus by the entirely micropunctate elytral texture, the presence of a small number of interstrial bristles, the slightly broader declivity, and the longer, narrower interstrial bristles. Often this species has four marginal asperities, sometimes six. Many specimens have a narrow groove on the frons, but this is absent in some specimens (Vega et al. 2015a).

Remarks. This species is most often found on seeds and fruits in tropical regions. They are a significant pest of Macadamia nuts in Hawaii. In the US, they are not known as a pest, but will attack ornamental palm seeds. They are widely distributed, probably exported from the Americas (Wood 2007).

Confusingly, these have been known as the “apple-twig beetle” (ESA common name database, http://www.entsoc.org/common-names), despite never being found on

any part of Malus spp, and known almost exclusively from seeds and fruits, not twigs.

They have also been termed, more appropriately, as the “tropical nut borer”.

Hypothenemus piaparolinae Johnson, Atkinson and Hulcr, 2016

Size. 1.0 mm.

Diagnosis. Hypothenemus piaparolinae can easily be distinguished from all other Hypothenemus by the entirely hair-like vestiture on the elytra. The interstrial bristles are sparse and hair like, and the interstrial ground vestiture is completely absent. The antennae also lack a septum and the antennal sutures are barely visible.

This species is most like H. distinctus, differing by the interstrial bristles, by the shape of the declivity, and by the size.

This species has mostly been collected in humid forests nearby to lakes and large rivers, and has been found inhabiting the xylem of fungus infested twigs (Johnson et al. 2016a).

Hypothenemus parvistriatus Wood, 2007

Size. 1.2 mm, 2.2 times as long as wide (Wood 2007).

Diagnosis. Hypothenemus parvistriatus can be distinguished from other North

American Hypothenemus by the combination of the small eye, broadly rounded elytra, very small strial punctures, and smooth shiny elytral surface. The interstrial bristles are narrow and erect, and the interstrial ground vestiture is restricted to the apex, and particularly dense.

Remarks. This species is only known from a large fern species, plus flight intercept traps.

Hypothenemus pubescens Hopkins, 1915

Synonymy. Stephanoderes opacifrons Hopkins, 1915; Hypothenemus subelongatus Hopkins, 1915; Hypothenemus minutissimus Schedl, 1952.

Size. 1.0 to 1.1 mm.

Diagnosis. This species can be distinguished from Hypothenemus eruditus by its shorter, stouter body, and usually by the number of marginal asperities, typically four on H. pubescens and six on H. eruditus. The interstrial bristles on most specimens of H. eruditus are also at least twice as long as wide.

This species can be distinguished from H. parvistriatus by the interstrial bristles which are typically as long as wide in pubescens, and over three times as long as wide for specimens of H. parvistriatus.

In some cases, H. pubescens may be confused with Trischidias based on the small size, stout appearance and very short scales. This species, like most

Hypothenemus, have a septum on the antennae. The marginal asperities are also of a similar size (The median pair are not distinctly larger, as with some Hypothenemus and all Trischidias). Most Trischidias also have a much larger, less steep declivity, which, viewed laterally, occupies over half the length of the elytra. Lastly, Trischidias never have interstrial ground vestiture, whereas H. pubescens have at least some near the apex of the elytra.

Remarks. This species has almost been exclusively collected from coastal grasses in South East USA, and may represent one of very few obligate grass-feeding

Scolytine species. This, however, is based on very few records of H. pubescens.

The holotype of this species has dense interstrial ground vestiture at the apex of the elytra, but most other specimens identified by Wood, from the same environment

and locations, lacked this character, with the ground vestiture comprised of very few setae. It is unclear whether this is a genuinely variable character.

Hypothenemus rotundicollis (Eichhoff, 1878)

Synonymy. Stephanoderes rotundicollis Eichhoff, 1878; Stephanoderes sculpturatus Eichhoff, 1878; Stephanoderes quercus Hopkins, 1915.

Diagnosis. Hypothenemus rotundicollis can be easily identified by the two marginal asperities, the small number of asperities on the pronotal declivity, the flattened interstrial bristles, and the presence of interstrial ground vestiture. The cuticle above and behind the level of eyes is also striate. The antennal funicle has five segments. This species is superficially similar to H. birmanus, and can be distinguished by the asperities on the pronotum (Figure 2-17).

This species is very similar and dubiously distinct from H. erectus, and can be distinguished by the number of marginal asperities (see notes under H. erectus).

Hypothenemus setosus (Eichhoff, 1867)

Synonymy. Hypoborus setosus Eichhoff, 1867; Stephanoderes congonus

Hagedorn, 1912.

Size. 1.4 to 1.7 mm, 2.4 times as long as wide (Wood 2007).

Diagnosis. Hypothenemus setosus is recognized by its size, slender body shape, concave frons, number of marginal asperities, and interstrial ground vestiture at the apex of the elytra.

This species is similar and not always distinct from to H. areccae, distinguished primarily on size. See the notes for H. areccae. Hypothenemus javanus is also similar, but much larger with a more robust body shape.

Remarks. An unusually large specimen (Figure 2-24) matching all diagnostic characters except the much larger size was found in Florida, suggesting that the size is variable or there could be other similar species in North America.

Hypothenemus setosus was previously erroneously listed as being described in

1868 (Wood 1982, Wood and Bright 1992, Wood 2007).

Hypothenemus subterrestris Johnson, Atkinson and Hulcr, 2016

Size. 1.3 mm.

Diagnosis. Hypothenemus subterrestris can be distinguished from other North

American Hypothenemus by the small eye, large strial punctures on the elytra,

Interstrial bristles which are about twice as long as wide, and dense dagger-like interstrial ground vestiture at the apex of the elytra.

Remarks. This species is widespread, although has not been recorded from any host material. All samples are from leaf litter, soil, and even deer dung samples, giving the name indicating the apparent sub-terrestrial habits.

Hypothenemus seriatus (Eichhoff, 1872)

Synonymy. Stephanoderes pulverulentus Eichhoff, 1872; Stephanoderes seriatus Eichhoff, 1872; Stephanoderes vulgaris Schaufuss, 1897; Stephanoderes ficus

Hopkins, 1915; Stephanoderes fiebrigi Hopkins, 1915; Stephanoderes floridensis

Hopkins, 1915; Stephanoderes georgiae Hopkins, 1915; Stephanoderes lucasi Hopkins,

1915; Stephanoderes minutus Hopkins, 1915; Stephanoderes niger Hopkins, 1915;

Stephanoderes nitidipennis Hopkins, 1915; Stephanoderes nitidulus Hopkins, 1915;

Stephanoderes pecanis Hopkins, 1915; Stephanoderes pini Hopkins, 1915;

Stephanoderes salicis Hopkins, 1915; Stephanoderes soltaui Hopkins, 1915;

Stephanoderes subopacicollis Hopkins, 1915; Stephanoderes tamarindi Hopkins, 1915;

Stephanoderes texanus Hopkins, 1915; Stephanoderes virentis Hopkins, 1915;

Hypothenemus robustus Blackman, 1922; Hypothenemus cassavaensis Schedl, 1938;

Stephanoderes hawaiensis Schedl, 1941; Stephanoderes darwinensis Schedl, 1942;

Stephanoderes striatulus Schedl, 1942; Hypothenemus marovoayi Schedl, 1953;

Stephanoderes andersoni Wood, 1954; Stephanoderes liquidambarae Wood, 1954;

Stephanoderes asperatus Schedl, 1967.

Size. 1.3 to 1.6 mm (Wood, 1982).

Diagnosis. This commonly encountered species can be recognized by the entirely convex frons, six roughly equal sized marginal asperities, and completely absent interstrial ground vestiture. There is usually at least part of the elytra which has a smooth, shining texture.

Specimens of Hypothenemus seriatus may be confused with H. crudiae, which is larger, broader and has a tubercle on the frons. Occasionally specimens lacking the tubercle are found, with a large size and otherwise much more similar to H. crudiae.

Hypothenemus obscurus is also similar, and differs from H. seriatus by having entirely micropunctate texture, a slightly shallower declivity, and a tendency to have only four marginal asperities.

Remarks. While H. seriatus is most commonly encountered in twigs, it is also known from fruits and seeds (Vega et al. 2015a). In all cases when this has been observed by the author, the seeds or fruits have been visibly degraded before the gallery is made.

Hypothenemus squamosus (Hopkins, 1915)

Synonymy. Stephanoderes squamosus Hopkins, 1915.

Size.1.5 mm (Hopkins 1915).

Diagnosis. This species is most easily recognized by its shape. Viewed laterally, the declivity is large and almost straight. The frons is entirely convex. The anterior margin of the pronotum typically has four marginal asperities. The pronotum is densely micropunctate. The elytra have a slight anterior declivity, and is deep overall. Viewed laterally, the declivity is large and almost straight or flared. The setae are flattened and prominent, each being particularly thick and light colored.

This species can be distinguished from the similar H. seriatus and H. interstitialis by the shape of the declivity, which is not entirely convex in H. squamosus. The setae on the declivity of H. interstitialis are also more erect and narrow, whereas the setae of

H. squamosus are still distinctly widened and ribbon-like.

Procryphalus Hopkins, 1915

Diagnosis

The eye is long and slightly sinuate. The antennae have five funicle segments, and a long antennal club, which has a septate, horizontal first suture. The overall body shape is long, more than 2.5 times as long as wide, with an angular anterior margin when viewed dorsally. Setae are not bifurcating on the metepisternum.

Procryphalus is distinguished from Trypophloeus by the long, entire eye

(emarginated in Trypophloeus) and the antennae which have one clear septum

(elongate with sutures but no septum in Trypophloeus).

Remarks

Procryphalus have a Holarctic distribution with two species occurring in North

America. The two species present in North America are remarkably similar, and primarily distinguished by size, plant host and a few subtle differences in surface sculpturing of the frons and elytra, and may not be easily distinguished for all

specimens. Many of the diagnostic characters may be an allometric relation to size rather than strictly diagnostic to species.

Key to Species: (Modified from Wood 1982)

1a) 1.8-2.2 mm, found on Populus sp. Frons with deep punctures. Interstrial bristles and ground vestiture with small punctures, giving a rugose surface texture to the elytra. Interstrial ground vestiture forms indistinct rows between striae and interstriae ...... Procryphalus mucronatus

1b) 1.5-1.7mm, found on Salix sp. Frons with shallow punctures. Interstrial bristles and ground vestiture more sparse, with weak punctures, giving a more glossy texture of the elytra. Interstrial ground vestiture does not form indistinct rows between striae and interstriae ...... Procryphalus utahensis

Procryphalus mucronatus (LeConte, 1879)

Synonymy. Cryphalus mucronatus LeConte, 1879; Procryphalus idahoensis

Hopkins, 1915; Procryphalus populi Hopkins, 1915.

Diagnosis: See key and notes for the genus.

Host: Salicaceae: Populus tremuloides (Atkinson, 2015)

Distribution: Procryphalus mucronatus is distributed broadly over Western North

America, from Southern Arizona and New Mexico to Alaska (Atkinson, 2015).

Procryphalus utahensis Hopkins, 1915

Synonymy. Procryphalus aceris Hopkins, 1915; Procryphalus salicis Hopkins,

1915.

Diagnosis. See key and remarks for the genus.

Host: Salicaceae: Salix spp. (Atkinson 2015).

Distribution: Most records are from north-western USA, with a single record in

Eastern Canada and Alaska. Presumably they are widespread across Canada.

Scolytogenes Eichhoff, 1978

Remarks

Scolytogenes has a tropical and sub-tropical distribution, with a single species present in USA. This is one of the most morphologically diverse genera of Cryphalini, the notes on morphology below do not apply to all species.

All the host records in the Americas suggest these are specialists of

Convolvulaceae (Particularly Ipomea), although elsewhere there are many species feeding on a much broader range of plants.

Scolytogenes jalapae (Letzner, 1844)

Synonymy. Cryphalomorphus jalapae (Letzner, 1844); Bostrichus jalapae

Letzner, 1844; Ernoporides floridensis Hopkins, 1915; Ernoporides knabi Hopkins,

1915; Hypothenemus ritchiei Sampson, 1918; Cryphalomorphus carabaicus Schedl,

1951; Cryphalomorphus minutissimus Schedl, 1951; Cryphalomorphus subtriatus

Schedl, 1952; Cryphalomorphus alienus Schedl, 1976.

Size 1.1 to 1.8 mm (Wood 2007), typically 1.2 to 1.4 mm.

Diagnosis. This species can be distinguished from other North American

Cryphalini by the combination of a long and entire eye, an a circular, flattened antennal club with a septum on the posterior half, asperities arranged in a ‘V’ shape (not arranged following anterior edge of pronotum), widely spaced mesocoxae, a near vertical declivity and a groove along most of the posterior face of the metatibia.

This is the only North American Cryphaline which does not have a prominent row of marginal asperities. However, on the posterior margin of the last ventral segment, the margin appears strongly sclerotized, with several small asperities (Figure 2-36), which may serve the same function as the marginal asperities seen in many other Cryphalini.

The setae on elytra variable between specimens, which previously lead to the distinction of this species and it’s junior synonym, S. knabi (synonymy by Wood 2007).

Remarks. This species is widely distributed from southern and south-eastern

USA, across Central America, plus fewer records in South America, and Japan. Wood speculated that these could have a SW pacific origin (Wood and Bright 1992, Wood

2007), although the presence of several similar species in Central America, and the few records elsewhere do not support this, thus will be considered native to the region.

Trischidias Hopkins, 1915

Diagnosis

Trischidias can be distinguished from other North American Cryphalini based on their minute size, a raised line on the lateral and posterior side of pronotum, antennae with sutures but no septum, abundant interstrial bristles which for most species are very broad.

This genus was described by Hopkins based on the eye shape and antennal characters. However, in many specimens, including specimens of the generic type,

Trischidias georgiae, the eye is clearly emarginated. Furthermore, Hopkins described another species as “Hypothenemus atomus”, which clearly had the same characters as the type species. Lastly, several Hypothenemus species share similar characters, such as the lack of septum, small size, and complete lack of interstrial ground vestiture (See

H. sparsus, H. miles, H. distinctus and H. piaparolinae, photographed in Figure 2-22 and Figure 2-23).

Biology and Ecology

Trischidias are minute, and are some of the smallest of all Scolytinae. They are also scarcely found; several species are only known from less than 10 specimens.

Trischidias are collected from material with visible fungal decay, and apparently not attracted to conventional traps. They have been recorded under the bark in black fruiting bodies (Deyrup 1987).

Remarks

Trischidias was previously presumed as feminine genus name, but later recognized as masculine by Alonso-Zarazaga & Lyal (2009). Therefore, most species were widely described as feminine (i.e. Trischidias atoma, T. exigua, T. minutissima and

T. striata) and later changed.

Distribution

In North America, this genus is restricted to southern and south-eastern United

States. Elsewhere, there are scattered records across the Americas south to Brazil, plus one species found in West Africa. There are also records from Taiwan, presumably introduced. Their minute size, aversion to traps and secretive habits suggest the number of records does not reflect the abundance of this species, but more the distribution of persistent Scolytine collectors.

Key to Species

1a) Two to four marginal asperities. The median pair is much larger (at least twice as long) than others, if present ...... 2

1b) Four to six marginal asperities, the median pair slightly larger than the others (less than twice as long) ...... 4

2a) Interstrial bristles narrow, almost hair like ...... Trischidias exiguus

2b) Interstrial bristles scale like, as wide as long ...... 3

3a) 0.6 to 0.8mm. Interstrial bristles on declivity of interstriae 2 in single row ...... Trischidias minutissimus

3b) 1.1 2 mm. Interstrial bristles on declivity of interstriae 2 congested, arranged alternately on two rows...... Trischidias georgiae

4a) Interstrial bristles on the declivity of a similar length to those on the elytral disc...... Trischidias atomus

4b) Interstrial bristles on the declivity of a similar length to those on the elytral disc...... Trischidias striatus

Trischidias atomus (Hopkins, 1915)

Synonymy. Trischidias atoma (Hopkins, 1915); Hypothenemus atomus Hopkins,

1915; Hypothenemus impressifrons Hopkins, 1915; Hypothenemus marylandicae

Hopkins, 1915; Hypothenemus robiniae Hopkins, 1915; Hypothenemus toxicodendri

Hopkins, 1915; Ernoporus nigrina Schedl, 1967.

Size. 0.8 to 1.0 mm.

Diagnosis. Specimens can be distinguished from other Trischidias species by the combination of having at least four marginal asperities, the interstrial bristles which are about as long as wide, and of a similar size on the declivity as on the elytral disc.

Compared to specimens of other Trischidias, T. atomus are the most slender in body shape. This species may be confused with Hypothenemus eruditus and H. pubescens, but can be distinguished because T. atomus lacks the antennal septum, always lacks interstrial ground vestiture, and has two larger median asperities.

Remarks. This is the most frequently collected and widely distributed of the

Trischidias species, being recorded widely over eastern USA, from Texas to South

Florida, extending northwards to Michigan.

Trischidias exiguus Wood, 1986

Synonymy. Trischidias exigua Wood, 1986.

Size. 0.8 to 0.9 mm.

Diagnosis. This species is easily distinguished from other Trischidias by the slender interstrial bristles which are typically six to eight times long as wide. Some

Hypothenemus males may have roughly the same proportions and vestiture, and can be easily distinguished by the smaller eye and vestigial wings.

Distribution. Known from South Florida (Deyrup 1987).

Trischidias georgiae Hopkins, 1915

Size. 1.1 mm.

Diagnosis. Trischidias georgiae can be distinguished from other Trischidias by the size, by having only two marginal asperities, by the interstrial setae which are not in single rows, by the wide interstrial bristles which are about as wide as long, and by the strial punctures, which are larger at the elytral base, becoming smaller towards the declivity.

Remarks. This is a rarely collected species with little known about the biology.

Besides occasional records from traps, they have only been collected on one occasion, which was under the thick bark of freshly fallen oak branches (Deyrup, pers. com.).

Trischidias minutissimus Wood, 1954

Synonymy. Trischidias minutissima Wood, 1954.

Size. 0.65 to 0.80 mm.

Remarks. Trischidias minutissimus can be distinguished from other Trischidias based on the size, by the two marginal asperities, and by the the very wide interstrial bristles which are in straight rows.

Distribution. South and Central Florida.

Trischidias striatus Atkinson, 1993

Synonymy. Trischidias striata Atkinson, 1993

Size. 0.60 to 0.80 mm.

Diagnosis. Trischidias striatus is the smallest of the North American Cryphalini.

It can be distinguished from other Trischidias species based on having four marginal asperities, and interstrial bristles which are much longer on the elytral declivity than on the elytral disc. This species also has distinctly raised margins of minute interstrial punctures on the declivity, giving the appearance of a spiny texture.

Trypophloeus Fairmaire, 1868

Diagnosis

Trypophloeus can be distinguished from other North American Cryphalini by the antennae without a septum with recurved sutures, which is long and pointed at its apex.

It may be collected among Procryphalus which look superficially similar, but can easily be distinguished by the eye shape, which is emarginated and not more than twice as long as wide, ant the antennae, which have a horizontal septum. Some species have one to four small, sharp spines on the declivity, which is unique among North American

Cryphalini.

Biology and Ecology

Trypophloeus are primarily found on Salix and Populus (both Salicaceae), depending on species. There are also occasional records from Alnus (Betulaceae). It is unclear whether the specimens collected from Alnus only utilize the host for hibernation or complete their lifecycle on their host.

Adults are known to lay a clutch of eggs which are clustered, and begin feeding socially in the parental gallery for the first instar only, after which they distribute outwards and complete their development solitarily (for T. granulatus and T. populi,

Furniss (2004), plus pers. obs. by AJJ (2014) ).

Trypophloeus populi attacks the living bark of unhealthy trees, significantly contributing to its decline (Petty 1977). A species in China is thought to be particularly damaging for Populus, it has been suggested that they quickly lead to the death of the tree (Cao et al. 2003).

Key to Species (Adapted from Wood 1982)

1a) Punctures on elytral disc prominent. Interstrial ground vestiture on anterior half of elytral disc either hair like or much sparser than the rest of the elytra. Found Salix or Alnus ...... 2

1b) Punctures on elytral disc indistinct. Interstrial ground vestiture on anterior half of elytral disc flattened and scale like, and of a similar density as on the elytral declivity. Found on Populus ...... 3

2a) Interstrial ground vestiture on elytra hair like. No spines on the declivity at the apical end of interstriae four ...... Trypophloeus striatulus

2b) Interstrial ground vestiture on elytra flattened and pointed. One to four spines on the declivity at the end of interstriae four ...... Trypophloeus salicis

3a) 1.7 to 2.1 mm. Tubercles on the end of interstriae four are wider than long ...... Trypophloeus populi

3b) 1.5 to 1.9 mm. Tubercles on the end of interstriae four are longer than wide ...... Trypophloeus thatcheri

Trypophloeus populi Hopkins, 1915

Size. 1.7 to 2.1 mm (Wood 1982).

Diagnosis. Trypophloeus populi can be distinguished from other North American

Trypophloeus based on the size, the presence of flattened interstrial ground vestiture distributed over the whole elytra, and the spines on the end of interstriae 4 which are wider than long.

Remarks. This species is associated with Sudden Aspen Decline (Marchetti et al. 2011), attacking living, unhealthy bark and hastening the death of the (Petty 1977).

This species is often found alongside Procryphalus mucronatus, and frequently intermixed in collections.

Distribution. This species is broadly distributed over North America with most of the records from western North America, and fewer in the northeastern North America.

Host. Populus sp.

Trypophloeus salicis Hopkins, 1915

Synonymy. Trypophloeus concentralis Hopkins, 1915.

Size. 1.5 to 1.7 mm (Wood 1982).

Diagnosis. Trypophloeus salicis is the only member of its genus in North

America to have interstrial ground vestiture which is sparse or even absent at the basal

(i.e. anterior) half of the elytral disc. The pronotum usually has six marginal asperities, the outermost being much smaller. The interstrial ground vestiture is flattened, and reduced towards the base of the elytra. There are one to four pairs of spines on the declivity, barely protruding from the ground vestiture.

Host. Salix sp.

Trypophloeus striatulus (Mannerheim, 1853)

Synonymy. Cryphalus striatulus Mannerheim, 1853; Trypophloeus nitidus

Swaine, 1912; Trypophloeus punctipennis Hopkins, 1915.

Size. 1.6 to 2.0 mm (Wood 1982).

Diagnosis. This species can be distinguished from all other Trypophloeus by the entirely hair-like interstrial ground vestiture.

Distribution. From Utah, to Minnesota, to Alaska (Furniss 2004). This species is the most northerly known bark beetle in North America, occurring even beyond the tree line (Furniss 2013).

Host. The primary host is Salix alaxensis (Furniss 2004), but there are several records from Alnus, and a single record from Populus trichocarpa (www.barkbeetles.info accessed 2015).

Remarks. Adults emerge in late summer, and overwinter in solitary hibernation chambers. This species may bore into live tissue to build the hibernation chamber. They are also often found alongside Cytospora sp, possibly preferentially attacking infected areas (Furniss 2004).

Trypophloeus thatcheri (Wood, 1954)

Size. 1.5 to 1.9 mm (Wood 1982).

Diagnosis. This species is dubiously distinguished from T. populi based on the smaller size and presence of one to four sharp spines on the declivity. Many specimens, however, are somewhat intermediate without a clear distinction between the species.

Host. Populus sp.

Discussion for Chapter 2

The pygmy borers (Cryphalini) have always been a challenge to identify. This review has summarized the 46 species known in the US and Canada, provided photographs and remarks for each species.

There are several cases where this review has cast doubt on the current nomenclature; particularly between similar species (e.g. Hypothenemus erectus and H. rotundicollis, Trypophloeus populi and T. thatcheri), placement within genera (e.g.

Hypothenemus sparsus showing similarity to Trischidias), or potential cryptic diversity within the US (e.g. Hypothenemus eruditus, H. setosus). Acknowledging such issues is frequently avoided but critically important for people hoping to make correct identifications. However, resolving the issues is beyond the scope of the study.

Figure 2-1. Annotated diagram of important Cryphalini characters. Specimen illustrated is Hypothenemus birmanus (Eichhoff, 1878).

Figure 2-2. Labelled diagram showing antennal morphology (Hypothenemus birmanus).

Figure 2-3. Eyes and Antennae of North American Cryphalini. A) Cryphalus pubescens B) Hypocryphalus mangiferae, C) Cryptocarenus seriatus, D) Hypothenemus seriatus, E) Hypothenemus piaparolinae, F) Trischidias atomus, G) Procryphalus mucronatus, H) Scolytogenes jalapae. Photos courtesy of author.

Figure 2-4. Sketch showing the raised line on the lateral margins of the pronotum: A) Present; B) Absent.

Figure 2-5. Sketch showing the differences in setae between Cryphalini genera. A) Some split setae present. B) Split setae absent.

Figure 2-6. Sketch showing the differences in the third tarsal segment for distinguishing between some Cryphaline genera.

Figure 2-7. Sketch showing the difference between the antennae of Cryphalus (left) and Hypocryphalus (right)

Figure 2-8. Frontal photographs showing distribution of marginal asperities in A) Cryptocarenus seriatus, B) Hypothenemus piaparolinae, C) Hypothenemus pubescens, D) Scolytogenes jalapae. A, B and C have asperities on the margin (slightly projected in B), whereas for D, the row of asperities does not follow the margin. Photos courtesy of author.

Figure 2-9. Lateral photographs of North American Cryphalus species. A) Cryphalus rubentis, B) C. rubentis, C) C. ruficollis, D) C. ruficollis, E) C. pubescens and F) C. pubescens. Photos courtesy of author.

Figure 2-10. Dorsal photographs of North American Cryphalus species. A) Cryphalus rubentis, B) C. rubentis, C) C. ruficollis, D) C. ruficollis, E) C. pubescens and F) C. pubescens. Photos courtesy of author.

Figure 2-11. Lateral photographs of North American Cryptocarenus species. A) Cryptocarenus diadematus, B) C. diadematus, C) C. heveae, D) C. heveae, E) C. seriatus and F) C. seriatus. Photos courtesy of author.

Figure 2-12. Dorsal and frontal photographs of North American Cryptocarenus. Frontal photographs are not to scale. A) Cryptocarenus diadematus, B) C. heveae, C) C. seriatus, D) C. diadematus, E) C. heveae and F) C. seriatus. Photos courtesy of author.

Figure 2-13. Lateral photograph of the holotype, and only known specimen of Ernoporicus kanawhae. Photos courtesy of the Smithsonian Institute, photograph taken by Tania Litwak, USDA SEL.

Figure 2-14. Dorsal photographs of Hypocryphalus from North America. A). Hypocryphalus mangiferae, B) H. mangiferae, C) H. sp. “1422”. D) H. sp. “1422”. Photos courtesy of author.

Figure 2-15. Dorsal photographs of Hypocryphalus from North America. A). Hypocryphalus mangiferae, B) H. mangiferae, C) H. sp. “1422”. D) H. sp. “1422”. Photos courtesy of author.

Figure 2-16. Example of a typical gallery of the genus, containing larvae, pupae and adults of Hypothenemus interstitialis. Photos courtesy of author.

Figure 2-17. Sketch to show difference between the asperities of Hypothenemus birmanus (left) and H. rotundicollis (right).

Figure 2-18. Sketch to show variation in the profile of the frons (setae on frons omitted). A) Frons with abrupt concavity below the level of the eyes (H. columbi). B) Weakly concave, with abrupt, elevated carina (H. brunneus). C) Concavity in line with level of eyes and abrupt carina (H. javanus, some H. setosus and some H. areccae). D) Frons concave with a rounded carina (some H. setosus and some H. areccae) E) Frons convex with central tubercle (H. crudiae). F) Frons entirely convex, no distinct sculpturing (e.g. H. seriatus, H. dissimilis, H. eruditus, etc.).

Figure 2-19. Lateral photographs of Hypothenemus species. A) Hypothenemus birmanus, B) H. birmanus, C) H. birmanus, D) H. erectus, E) H. rotundicollis, F) H. rotundicollis, G) H. dissimilis, and H) H. hirsutus. Photos courtesy of author.

Figure 2-20. Dorsal photographs of Hypothenemus species. A) Hypothenemus birmanus, B) H. birmanus, C) H. birmanus, D) H. erectus, E) H. rotundicollis, F) H. rotundicollis, G) H. dissimilis, and H) H. hirsutus. Photos courtesy of author.

Figure 2-21. Frontal photographs of Hypothenemus species. A) Hypothenemus birmanus, B) H. birmanus, C) H. birmanus, D) H. erectus, E) H. rotundicollis, F) H. rotundicollis, G) H. dissimilis, and H) H. hirsutus. Photos are no to scale. Photos courtesy of author.

Figure 2-22. Lateral photographs of Hypothenemus species. A) Hypothenemus sparsus, B) H. distinctus, C) H. miles and D) H. piaparolinae (HOLOTYPE). Photos courtesy of author

Figure 2-23. Dorsal photographs of Hypothenemus species. A) Hypothenemus sparsus, B) H. distinctus, C) H. miles and D) H. piaparolinae (HOLOTYPE). Photos courtesy of author.

Figure 2-24. Lateral photographs of Hypothenemus species. A) Hypothenemus columbi, B) H. columbi ("Allotype"), C) H. areccae, D) H. areccae, E) H. setosus, F) H. sp. undetermined, G) H. brunneus and H) H. javanus. Photos courtesy of author.

Figure 2-25. Dorsal photographs of Hypothenemus species. A) Hypothenemus columbi, B) H. columbi ("Allotype"), C) H. areccae, D) H. areccae, E) H. setosus, F) H. sp. undetermined, G) H. brunneus and H) H. javanus. Photos courtesy of author.

Figure 2-26. Lateral photographs of specimens identified as Hypothenemus eruditus showing morphological variation. (A-G), H) undetermined Hypothenemus sp. Photos courtesy of author.

Figure 2-27. Dorsal photographs of specimens identified as Hypothenemus eruditus showing morphological variation. (A-G), H) undetermined Hypothenemus sp. Photos courtesy of author.

Figure 2-28. Lateral photographs of Hypothenemus species. A) Hypothenemus californicus (undesignated specimen from type series), B) H. californicus, and C) H. gossypii (syntype of synonym, H. beameri). Photos courtesy of author.

Figure 2-29. Dorsal photographs of Hypothenemus species. A) Hypothenemus californicus (undesignated specimen from type series), B) H. californicus, and C) H. gossypii (syntype of synonym, H. beameri). Photos courtesy of author.

Figure 2-30. Lateral photographs of Hypothenemus species. A) Hypothenemus pubescens, B) H. parvistriatus (undesignated specimen from type series) and C) H. subterrestris (Holotype). Photos courtesy of author.

Figure 2-31. Dorsal photographs of Hypothenemus species. A) Hypothenemus pubescens, B) H. parvistriatus (undesignated specimen from type series) and C) H. subterrestris (Holotype). Photos courtesy of author.

100

Figure 2-32. Lateral photographs of Hypothenemus species. A) Hypothenemus interstitialis, B) H. squamosus, C) H. crudiae, D) H. crudiae, E) H. seriatus and F) H. obscurus. Photos courtesy of author.

101

Figure 2-33. Dorsal photographs of Hypothenemus species. A) Hypothenemus interstitialis, B) H. squamosus, C) H. crudiae, D) H. crudiae, E) H. seriatus and F) H. obscurus. Photos courtesy of author.

102

Figure 2-34. Lateral photographs of Procryphalus species. A) Procryphalus mucronatus and B) P. utahensis. Photos courtesy of author.

Figure 2-35. Dorsal photographs of Procryphalus species. A) Procryphalus mucronatus and B) P. utahensis. Photos courtesy of author.

103

Figure 2-36. Ventral photograph of Scolytogenes jalapae showing the widely spaced mesocoxae and highly sclerotized apical margin of the elytra. Photos courtesy of author.

104

Figure 2-37. Lateral photographs of Scolytogenes jalapae. A) Mature adult, and B) teneral adult. Photos courtesy of author.

Figure 2-38. Dorsal photographs of Scolytogenes jalapae. A) Mature adult, and B) teneral adult. Photos courtesy of author.

105

Figure 2-39. Lateral photographs of Trischidias species. A) Trischidias atomus, B) T exiguus, C) T. georgiae, D) T. minutissimus, E) T. striatus and F) T. striatus (paratype). Photos courtesy of author.

106

Figure 2-40. Dorsal photographs of Trischidias species. A) Trischidias atomus, B) T exiguus, C) T. georgiae, D) T. minutissimus, E) T. striatus and F) T. striatus (paratype). Photos courtesy of author.

107

Figure 2-41. Lateral photographs of Trypophloeus species. A) Trypophloeus populi, B) T. populi, C) T. salicis, D) T. salicis, E) T. granulatus F) T. striatulus (Photo by Clare McLellan. source: McLellan, C.(2012) Bark beetle (Trypophloeus striatulus) Updated on 9/28/2012 12:12:55 PM Available online: PaDIL - http://www.padil.gov.au.) G) T. thatcheri and H) T. thatcheri. Unless stated otherwise, all photos courtesy of author.

108

Figure 2-42. Dorsal photographs of Trypophloeus species. A) Trypophloeus populi, B) T. populi, C) T. salicis, D) T. salicis, E) T. granulatus F) T. striatulus (Photo by Clare McLellan. source: McLellan, C.(2012) Bark beetle (Trypophloeus striatulus) Updated on 9/28/2012 12:12:55 PM Available online: PaDIL - http://www.padil.gov.au.) G) T. thatcheri and H) T. thatcheri. Unless stated otherwise, all photos courtesy of author.

109

CHAPTER 3 RESOLUTION OF A MANGO AND FIG IDENTITY CRISIS

Introduction to Chapter 3

Hypocryphalus Hopkins, 1915 and Cryphalus Erichson, 1836 (Curculionidae:

Scolytinae: Cryphalini) are minute bark beetles with 49 and 197 described species, respectively (Alonso-Zarazaga and Lyal 2009). Several have recently emerged as notable pests of various tree commodities, including mango, Mangifera indica

(Anacardiaceae) (Al Adawi et al. 2013a), fig, Ficus carica (Moraceae) (Faccoli et al.

2016), pines, Pinus spp. (Pinaceae) (Yang 2000) and mulberry, Morus spp. (Moraceae)

(Gao 2006). The impacts stem from the combination of human-assisted spread of these species to non-native areas, their encounters with hosts stressed by intense cultivation or unfavorable climatic conditions, and the interesting habit of some Cryphalus and

Hypocryphalus to bore under the bark of branches of trees that are still living, at the interface of live and dead tissues. This results in the incremental decline of trees that would otherwise recover, as well as the introduction of tree pathogens into living tissues.

The increasing impacts resulted not only in a proliferation of literature on the pest species, but also revealed uncertainty about their taxonomic identity. Both genera belong in Cryphalini, the pygmy borers, which are notorious for being among the more difficult taxa to identify among all bark beetles. The genus Hypocryphalus is the epitome of challenging identification, and there are currently no resources that would enable non-specialists to identify individual species. Additionally, the phylogenetic and morphological justification for the genus itself is dubious. Phylogenies involving

110

hundreds of genes found Cryphalus and Margadillius Hopkins, 1915 to be intermixed with Hypocryphalus (Johnson et al., unpublished data).

Hypocryphalus has been reported as a pest of mango, currently as

“Hypocryphalus robustus (Eichhoff, 1872)” but more widely as “Hypocryphalus mangiferae (Stebbing, 1914)”. The minute bark beetle colonizes dead or dying twigs and branches of mango trees and by itself does not cause much damage. It is, however, recognized as a pest because it has been reported as a vector of lethal mango pathogens in the Ceratocystis fimbriata species complex (sensu lato, s.l.)

(Ribiero 1980, Al Adawi et al. 2013a). The beetle is widespread and known from all tropical regions except New Guinea (Wood and Bright 1992).

Ceratocystis fimbriata s.l. is a widely distributed plant pathogen. It causes lethal wilt diseases of mango, known as seca in Brazil (Abrahão and Wegmuller 1969, Ribiero

1980, Galdino et al. 2016), and sudden decline or sudden death in Oman and Pakistan

(Van Wyk et al. 2007, Masood et al. 2008). A contemporary view is that Ceratocystis fimbriata sensu stricto is a pathogen of sweet potato (Ipomea batatas), whereas other members of the Ceratocystis fimbriata species complex, defined primarily with DNA sequences, cause diseases on other host species. For example, the mango pathogen in

Oman was described as Ceratocystis manginecans (Van Wyk et al. 2007), whereas two species from affected mango trees in Brazil were described as Ceratocystis mangivora and Ceratocystis mangicola (Van Wyk et al. 2011). Hereafter, we refer to these mango diseases, collectively, as mango wilt.

Mango is among the world’s most important fruit crops. Global production was ca. 45 million metric tons in 2014 (FAOStat, 2017). Mango has been grown in Florida

111

since the 1800s, and the state is a secondary center of diversity; in fact, many of the world’s most important commercial cultivars originated there (Knight et al. 2009). Even though production in Florida declined after fruit began to be imported from Latin

America into the US, a significant mango industry remains in the southern tip of the state (2.1 million USD per year). However, imports to the US from other countries are more significant (over 600 million USD per year).

Although mango wilt is not present in Florida (Galdino et al. 2016), a mango- associated Hypocryphalus species is common (Atkinson 2017). The disease is particularly destructive in Brazil and Oman, was recently reported from China (Zhang et al. 2017), and threatens mango production elsewhere. It is therefore a biosecurity issue, and the identity of this group of Hypocryphalus morphospecies needs to be resolved.

The other major crop afflicted by Hypocryphalus is the common fig, Ficus carica

(Moraceae). The beetle was largely unknown until recently. Hypocryphalus was first reported in Malta in 1991, where it devastated fig plantations, causing 70% loss of trees

(S. Cutajar, pers. com.). Issues with Hypocryphalus affecting figs have also recently been reported from southern Italy (Faccoli et al. 2016). This species was determined as

“Hypocryphalus scabricollis (Eichhoff, 1978)”. The name is not settled, however, since the specimens do not match the named species directly, but reportedly match the types of one of its synonymized species (Mifsud and Knížek 2009).

Hypocryphalus and Cryphalus species are typically restricted to a single host family, with the exception of single records of a few that are poorly known. In this respect, the Hypocryphalus species recorded from fig is unique among Hypocryphalus because it has been collected from at least eight host families. However, given past

112

taxonomic ambiguity, it is unclear whether the diverse host range is merely an unresolved beetle identity, or whether “H. scabricollis” is truly polyphagous.

In recent years, several unidentified Hypocryphalus were collected repeatedly from multiple sites in north Florida during routine bark beetle sampling by the USDA

Cooperative Agricultural Pest Surveys (CAPS, Katherine Fairbanks, pers. comm.).

Tentatively identified as Hypocryphalus “sp1422”, their morphology matched the published, albeit simple, descriptions of H. scabricollis (Eichhoff 1878b, Mifsud and

Knížek 2009), and the specimens collected have a close resemblance to the photos presented by Mifsud and Knížek (2009) and SEM photos presented by Faccoli et al.

(2016). An establishment of a fig pest in the US would represent a threat to fig production. Figs, Ficus carica, are a widely grown fruit throughout the southern US, and especially in California where the fig industry is valued at over 21 million USD per year.

Other Ficus spp. are also widely grown as ornamental foliage plants, particularly in south Florida and costal California.

Aims and Goals for Chapter 3

The goal of this work was to clarify the current taxonomic status of the most pestiferous Hypocryphalus from mango and fig. We aimed to aggregate representative samples from around the world, to infer relationships between these representatives using morphological and DNA characters, and to interpret species identity of the pests in the context of global biogeography and host use.

The main underlying question in this work is whether the putative Hypocryphalus species are morphologically cryptic species complexes, or examples of inadequate systematic attention. Bark beetle classification does not readily allow the use of a standard set of morphological and molecular diagnostic characters (Cognato 2006,

113

Hulcr et al. 2015). However, these difficulties may be specific to species that reproduce via inbreeding, where species identity is not maintained as it is in outcrossing species.

Although morphological characters in bark beetles are often inconspicuous, they are present and, with appropriate assessment, phylogenetically informative morphological characters can be found (Hulcr et al. 2007a, Hulcr et al. 2015). Likewise, many taxa may be delimited by molecular markers when these markers are applied at appropriate levels of resolution (Cognato and Sun 2007, Stouthamer et al. 2017).

Materials and Methods for Chapter 3

Hypocryphalus from around the world were selected for morphological analysis, with a focus on specimens collected from Mangifera indica (18 collections from 15 countries) and Ficus carica (three collections from three countries). Trap-collected specimens which are morphologically similar to the specimens on mango and fig were also included. Specimen collection and repository information is presented in Appendix

A. We also included molecular and morphological observations of voucher specimens from Al-Adawi et al. (2013a), plus morphological observations of pinned vouchers from

Masood et al. (2009) and Masood and Saeed (2012).

Relevant type specimens were observed in museum collections, notably: The

Natural History Museum, London, United Kingdom (BMNH); Natural History Museum,

Vienna, Austria (NHMW); Royal Belgian Institute of Natural Sciences, Brussels, Belgium

(IRSNB) and United States National Museum of Natural History, Washington D.C., USA

(USNM). Type material for the following described species were examined (with repository acronym in parentheses): six syntypes of Cryphalus robustus Eichhoff, 1872

(IRSNB (5), BMNH (1)); the holotype of Cryphalus inops Eichhoff, 1872 (IRSNB); the lectotype and three paralectotypes of Cryphalus mangiferae Stebbing, 1914 (BMNH);

114

the holotype of Hypothenemus griseus Blackburn, 1885 (BMNH); the single known syntype of Cryphalus dilutus Eichhoff, 1878a (NHMW), the single known syntype of

Cryphalus discretus Eichhoff, 1878a (NHMW), the lectotype of Cryphalus brevisetosus

Schedl, 1943 (NHMW), and four specimens of Cryphalus ficus Schedl nomen nudum

(NHMW). Additional specimens were observed in the following collections: Florida State

Collection of Arthropods, Gainesville, Florida, USA (FSCA); University of Florida Forest

Entomology collection, Gainesville, FL, USA (UFFE); Collection Knížek Prague,

Czechia. (CKP); University museum of Bergen, Norway (ZMBN); Centro de

Entomologica y Acarologia, Mexico (CEAM) and L. Kirkendall’s private collection,

Bergen, Norway.

Specimens were observed though a stereo microscope (Olympus SZX16) and photographed with a DSLR camera (Canon Rebel T3i) mounted on a compound microscope (Olympus BX53 with 5x, 10x and 20x fluorite objectives). Characters, with emphasis on those which were observed to be variable within the selected samples from mango and fig, were recorded for observed specimens prior to extraction. Most characters were illustrated as differences between species groups of Cryphalus in Tsai and Li (Tsai and Li 1963) and described using terminology used by in previous literature

(Wood 1982, 2007), although not specifically for Cryphalus and Hypocryphalus.

Characters, character states and references (if present) are scored in Appendix A. Four unambiguous characters are mapped on the phylogeny (Figure 3-1) and diagnostic characters, including additional characters noted in Appendix A, are summarized in

Table 3-2.

115

DNA was extracted partially destructively or destructively with Qiagen DNeasy extraction kit (USA). Phylogenetic markers, cytochrome oxidase I mtDNA (COI) and

28S rDNA (28S), were PCR-amplified using Takara ExTaq (Japan) with primers listed in

Table 3-1, and sequenced at the University of Florida Interdisciplinary Center for

Biotechnology Research, Genewiz (USA), or Eurofins (USA). Resultant reads were trimmed to error probability of less than 0.01, and aligned using Geneious (Kearse et al.

2012). All resultant nucleotide sequences were deposited in NCBI GenBank

(MG051082-MG051185). Additional sequences for Hypocryphalus, Cryphalus and outgroup taxa were taken from BOLD (http://www.boldsystems.org/). The sequence accession and collection information for all specimens used in the phylogeny are presented in Appendix A. Specimens used were deposited as vouchers in the University of Florida Forest Entomology Collection (UFFE), except those which were destructively samples, for which their immediate kin were vouchered and/or photographs included as vouchers in Figure 3-2, Figure 3-3, Figure 3-4 and Figure 3-5, and photographs in

Appendix B.

All sequences were aligned with MAFFT (Katoh and Standley 2013) using default global alignment settings (“G-INS-I”) and COI was manually checked for frame shifts and characteristics of pseudogenes. The alignments for COI were trimmed to regions represented by more than half the taxa to minimize the amount of missing data. The

DNA sequence matrix was partitioned into three partitions (COI, 1st and 2nd codon, COI

3rd codon and 28S). The final alignment is deposited in Dryad (doi:10.5061/dryad.f4ts3).

Trees were inferred using Bayesian framework, using ExaBayes v1.5 (Aberer et al. 2014), which was run for approximately 12 million generations (average standard

116

deviation of split frequencies < 1%). Bootstrap support was calculated using RAxML v8.2.3 (Stamatakis 2014) to generate and infer 500 bootstrapped alignments with maximum likelihood, using the same partitioning scheme. To test for incongruence between the two markers, a phylogeny was inferred for each gene alone. Because no strongly supported incongruent clades were found, only the combined analysis was used. The eleven outgroup taxa included are listed in Table A-1.

Results

Phylogenetic Tree of Cryphalus and Hypocryphalus

The phylogenetic tree (Figure 3-1) has revealed that the mango-specific bark beetles described worldwide are two very different, easily distinguished clades. One clade contains vectors of at least one of the mango wilt pathogens, Ceratocystis manginecans, as well as a distinct genotype that devastates fig in the Mediterranean.

The other clade matches the type series of Cryphalus mangiferae, and is genetically diverse, particularly in Asia, but it is morphologically homogeneous.

Hypocryphalus (sensu Wood, 1986) is polyphyletic, forming at least six clades interspersed with Cryphalus. The two focal Hypocryphalus species are both sister to a

Cryphalus species. While most nodes have a high posterior probability, bootstrap support of the key nodes is low. However, no alternative topology in the bootstrapped alignments had fewer clades of Hypocryphalus, or would invalidate any of the results and conclusions of the study.

The morphological differences identified do show phylogenetic signal, although most characters are not unique to any particular clade, with the exception of the mesofemoral spine (described below). Closely related species tend to share the same host, but host use is not monophyletic across the phylogeny.

117

Taxonomic Changes

Species in the genera Hypocryphalus and Cryphalus are clearly intermixed.

Taxonomic reassessment of these two genera is therefore needed, but is beyond the scope of this paper given the large number of species in each genus (49 and 197 respectively (Alonso-Zarazaga and Lyal 2009)). Their taxonomy is further complicated by nine potential secondary homonyms, the likely inclusion of the genus Margadillius

(Wood and Bright 1992, Johnson et al. unpublished) which would add six more secondary homonyms, and several misplaced type specimens (Johnson, unpublished data. ). The number of funicle segments, the only difference between the two genera suggested by Wood (1986), is not monophyletic. This character was also difficult to score, and appears to be variable within species.

The results of molecular and morphological analyses do allow us to resolve the identity of the pestiferous Hypocryphalus species feeding on fig and mango.

Additionally, scoring eight diagnostic characters on type material (Table A-1) identified several important taxonomic changes needed to resolve the identity of Hypocryphalus species found on mango and fig.

Hypocryphalus dilutus (Eichhoff, 1878a), stat. rev.

Cryphalus dilutus Eichhoff, 1878a; Cryphalus dilutus Eichhoff, 1878b syn. n.

The syntype of Hypocryphalus dilutus differs clearly from the syntype of C. discretus, the lectotype of C. brevisetosus, as well as specimens determined to be C. scabricollis in by Eggers or Schedl, by the lack the mesofemoral spine (Figure 3-5), as well as the relative size of the pronotal disc (i.e. the pronotal summit is close to the base of the pronotum). The syntype of H. dilutus does match the specimens labelled as

“Cryphalus ficus” (manuscript name, Schedl collection, NHMW), as well as specimens

118

from Malta, Tunisia, India, United Arab Emirates, Pakistan and specimens in this study from Mexico, Oman, Bangladesh, Italy and Israel. The diagnostic characters identified from the males (Table 2) are visible on the holotype. We also correct the reference for the description, which was published earlier in the same year. The second description is treated as a junior synonym, based on conclusions made by Beaver (1998) and Alonso-

Zarazaga and Lyal (2009). Based on the observations above, the name Hypocryphalus dilutus (Eichhoff, 1878a) is resurrected. We also note that all specimens, including the syntype, are much larger than originally described (“1—1.3 mm”); the single remaining syntype is 1.67 mm, and non-type specimens range from 1.41 mm to 1.82 mm.

Hypocryphalus discretus (Eichhoff, 1878a), stat. rev.

Cryphalus discretus Eichhoff, 1878a ; Cryphalus discretus Eichhoff, 1878b, syn. n.; Cryphalus scabricollis Eichhoff, 1878b, syn. n.; Cryphalus brevisetosus Schedl,

1943 , syn. n.

The specimens determined to be this species clearly differ from H. dilutus by the pronotal disc (H. dilutus containing scale like setae, compared to H. discretus, C. scabricollis and C. brevisetosus which have only slightly flattened setae with pointed tips) and by the absence of the mesofemoral spine (Absent in the type of H. discretus, which is a male and the mesofemur is clearly visible). The name H. scabricollis

(Eichhoff, 1878b), as well as C. discretus Eichhoff, 1878b are now considered junior synonyms because the descriptions by Eichhoff (1878a), which include only C. discretus and C. dilutus, precede the description by Eichhoff (1878b) cited in Wood and

Bright’s (1992) catalog. We also found minor differences between specimens previously determined as Cryphalus discretus and C. scabricollis: C. discretus specimens seemed to have smaller asperities and a taller body shape than specimens of C. scabricollis.

119

However, insufficient material was available for extensive review, and taxonomic changes among these are beyond the scope of the study.

Hypocryphalus mangiferae (Stebbing, 1914), stat. rev.

Cryphalus mangiferae Stebbing, 1914; Cryphalus inops Eichhoff, 1872, syn.;

Hypothenemus griseus Blackburn, 1885, syn.; Hypocryphalus mangiferae Eggers,

1928, syn.; Cryphalus subcylindricus Schedl, 1942, syn.; Cryphalus mimicus Schedl,

1942 , syn.; Hypocryphalus opacus Schedl 1942, syn.

The syntype series of H. robustus does not conform to the morphology of the lectotype and paralectotypes of Cryphalus mangiferae Stebbing, 1914, the holotype of

Cryphalus inops Eichhoff, 1872, the holotype of Hypothenemus griseus Blackburn,

1885, or any of the specimens included in the molecular study. The two sets of specimens differ by the following characters (listed as H. mangiferae vs. H. robustus); by the shape of the pronotum (anteriorly constricted vs. broadly rounded), by the density and shape of marginal asperities (higher than wide vs. wider than high and almost contiguous), by the long setae on interstriae 1 (slightly flattened with rounded tips vs. hair like with pointed tips), by the distribution of interstrial ground vestiture (distinctly absent along the rows of the striae vs. distributed evenly) and the shape of the interstrial ground vestiture (with a single point, and much longer than wide vs. tridentate and about as wide as long).

For these reasons, the name Hypocryphalus robustus is not conspecific (and thus not a senior synonym of) Hypocryphalus mangiferae, and Hypocryphalus mangiferae is reinstated as a valid name.

Hypocryphalus robustus (Eichhoff, 1872)

Cryphalus robustus Eichhoff, 1872

120

Hypocryphalus robustus is recognized as a valid species without any junior synonyms based on the differences described above. Even though the antennal funicle has four segments, the species is not transferred back to the genus Cryphalus becasue of the difficulties found coding the character, and the dubious distinction between the two genera.

Diversity Within the Hypocryphalus mangiferae Clade

The relatively large genetic diversity within the Hypocryphalus mangiferae clade suggests that the morphology-based species may include additional cryptic or nearly cryptic species. The congruence between the nuclear and mitochondrial molecular markers suggests that these are true clades evolving independently. Most of the genetic diversity is in Asia; all samples from elsewhere are from a closely related clade, which suggests a single Asian origin of a global diaspora. The lack of morphological variation limits the ability to place the holotype in a particular clade. Additionally, sample size per collection site is too low to enable the variation to be characterized. Thus, placing the types and synonym types of H. mangiferae in a particular clade within the complex is beyond the scope of the study.

Diversity Within the Hypocryphalus dilutus Clade

There were two clear phylogenetic clades, genetically divergent based on the respective mango and fig hosts (Figure 3-1), which could not be distinguished morphologically. Genetic differences in the mango-feeding clade consistently distinguished the Mexican samples from those from Oman and Bangladesh, but the fig- feeding clade had little variation. Since morphological differences were not identified, it is unclear which clade is represented by the single remaining syntype, collected in

Myanmar.

121

Hypocryphalus sp. “1422”, an Unidentified Species in Florida

The specimens collected from multiple sites near Pensacola, Florida, as well as other specimens from China (including Hainan Island and Taiwan) are morphologically and genetically very similar and appear to represent a species, yet did not correspond to Hypocryphalus dilutus, or any other species studied here. Females of this species and H. dilutus are not distinguishable based on the morphological traits observed, but there are several diagnostic differences between males (Table 3-2), and the species are divergent genetically. Most specimens were not collected from plant material, so their host range is uncertain. The single recorded host, paper mulberry (Broussonetia papyrifera), however, is present and common throughout its known geographic range.

New Records and Widespread Misidentification of Hypocryphalus dilutus

Hypocryphalus dilutus is recorded for the first time on mango, and for the first time in Mexico, Oman and Pakistan. At all four locations where Hypocryphalus dilutus has been collected from mango, all have been misidentified as H. mangiferae.

Specimens from Pakistan and Oman represent vouchers for studies involving the beetles as vectors of Ceratocystis manginecans, determined as H. mangiferae (Masood et al. 2009, Al Adawi et al. 2013a). In Mexico, the species has been collected from three distant locations, including collections as far back as 1982. These specimens were previously recorded as H. mangiferae (Atkinson, www.barkbeetles.info, prior to 2016) since their first record from this country in 1982. On Ficus, Hypocryphalus dilutus is also recorded for the first time in Israel and China.

The Mesofemoral Spine—a Unique Character of Hypocryphalus dilutus

Hypocryphalus dilutus has a unique character not described or observed in any other Hypocryphalus species, or even any other scolytine. The males have a sharp, true

122

(non-socketed) spine on the proximal face of the mesofemur (Figure 3-5, B). Females do not have the spine. It is visible in the type, but overlooked in the description of the species and subsequent taxonomic work.

Discussion for Chapter 3

Species of Cryphalus and Hypocryphalus have emerged as serious pests in multiple areas of the world and in several tree commodities. At least one of them,

Hypocryphalus dilutus, spreads Ceratocystis manginecans, which causes mango wilt in

Oman. Unfortunately, in most publications on the vector of this pathogen it was not clear which species was actually investigated because no vouchers were reported (e.g.

Deadman et al. 2007, Masood et al. 2010, Iqbal and Saeed 2012). We have examined specimens from two of the principal sites where mango wilt occurs, and have determined that they are H. dilutus. As we clarify here, there has been widespread misidentification, and the principal vector of the mango wilt pathogen, Ceratocystis fimbriata s.l., is probably H. dilutus. Specimens of H. dilutus have been recorded from mango, misidentified as H. mangiferae. We found no evidence that H. mangiferae functions as a vector of this pathogen.

Clarifying the taxonomic identity of the vector species is a significant development in understanding the pathogen responsible for mango wilt. Ceratocystis manginecans is also recorded from Acacia mangium, Prosopis cineraria and Dalbergia sissoo (Tarigan et al. 2011, Al Adawi et al. 2013b), which are all in the family Fabaceae.

Hypocryphalus mangiferae is specialized to Mangifera spp., whereas H. dilutus may be at least partly polyphagous. Wood and Bright (1992) reported several Fabaceae species amongst the hosts of their H. scrabricollis species concept, which included H. dilutus.

Should H. dilutus be genuinely polyphagous, the species may act as a possible vector

123

to several host species, and management of mango wilt may have to consider local reservoirs of the vector and pathogen outside mango plantations.

The taxonomic changes give some resolve to a convoluted taxonomic history of

Hypocryphalus mangiferae. It was first described as Cryphalus inops Eichhoff, 1872 from Guadaloupe, then as Hypothenemus griseus Blackburn, 1885 from a specimen from Hawaii, and then as Cryphalus mangiferae Stebbing, 1914 from specimens from

India. Wood later discovered the synonymy and successfully petitioned to get special priority for Cryphalus mangiferae due to its use in literature, and the poor condition of the types of the other species (Wood 1984, ICZN 1986). At that time, Wood did not see specimens of Cryphalus robustus Eichhoff, 1872 described on the same page as C. inops. Only later, after seeing the types, Wood (2007) inferred them as the same and synonymized H. robustus with H. mangiferae, despite the fact that H. robustus should get priority. Pullen et al. (2014) noticed and described the complex history, pointing out that Wood’s later synonymy was invalid because Wood’s (1984) petition did not specifically address Hypocryphalus robustus, and the name Hypocryphalus robustus maintained priority over H. mangiferae. This name was used in publications (Olivier-

Espejel et al. 2016), but H. mangiferae also continued to be in used to the present (e.g.

Ploetz et al. 2013, Galdino et al. 2017). Since observation of the type series has revealed that they are different (contrary to Wood’s conclusions), the subjective synonymy of the species by Wood (2007) with the priority corrected by Pullen et al.

(2014) is rejected and they are now treated as separate species.

Similarly, the taxonomic history of Hypocryphalus dilutus is also complex.

Eichhoff originally described Cryphalus discretus, and C. dilutus (1878a), then again

124

more explicitly as part of a monograph (1878b) including Cryphalus scabricollis. Wood considered the latter the original description, but Beaver (1998) and Alonso-Zarazaga and Lyal (2009) noted that the earlier publication should get priority, but without correcting the issues around the aforementioned species. Wood (1989) believed these primary types were lost in Hamburg during WWII, but Wood inferred from Beeson’s homotypes of the three species that all were the same species. The name scabricollis was selected “because it is more descriptive of the species” (Wood 1989), even though

C. dilutus and C. discretus are presented earlier in the publication (Eichhoff 1878b), and the two other species were described earlier. Mifsud and Knizek (2009) later assessed a redescribed male of C. scabricollis (labeled as an allotype) and single syntypes of C. discretus and C. dilutus (presumably taken from Hamburg during WWII, see Wood and

Bright, 1992), and commented how they differ, suggesting the specimens from Malta closely resemble the morphologically distinct C. dilutus. Lastly, the species was moved to the genus Hypocryphalus based on the conventional distinction of the two genera

(Mifsud and Knížek 2009), with Hypocryphalus having putatively five funicle segments, and Cryphalus having only four (Wood 1986). Now that specimens have been thoroughly compared with extensive type material as well as fresh specimens highlighting morphological differences, the taxonomic confusion is resolved. This resolve is timely, with the discovery that H. dilutus is the likely pest of mango as well as fig in the Mediterranean.

Despite our limited sampling, we have found interesting patterns of occurrence that have profound biosecurity implications. For example, the mango-specific clade of

H. dilutus less widespread than H. mangiferae, even if it seems to be a more aggressive

125

pest and is responsible for the spread of mango wilt. H. dilutus is not yet recorded from many mango growing areas, including Florida and Australia, which may explain the absence of mango wilt in these areas. Whether an absence of H. dilutus in Indonesia and Vietnam is responsible for an absence of mango wilt in these countries should be studied, as the pathogen C. manginecans seriously impacts Acacia plantations in both countries. Similarly, the fig-associated clade of Hypocryphalus dilutus is not yet present in many fig-growing areas, particularly the western US, Spain and Australia. Yet the likelihood of introduction remains high: a live specimen of H. dilutus from China was intercepted at a port in the US (Seattle APHIS PPQ, WA, 2013, Unpublished). This was not a rare event, between 1984 and 2008 there were 115 separate interceptions of undetermined Hypocryphalus specimens in the US (Haack and Rabaglia 2013), most commonly from India, where H. dilutus has been confirmed. At this time, no population is known to have established in the US. Despite their damage potential, we do not know of any Cryphalus and Hypocryphalus bark beetles that are currently included on any

‘pest watch lists’ known to us (e.g., CAPS, 2017).

Our results are also informative from an ecological perspective. Most Cryphalus and Hypocryphalus are host specialists (Wood and Bright 1992). Before this revision,

Hypocryphalus scabricollis was considered a rare polyphagous exception. However, we have found that this is at least partly due to inappropriate synonymy of clearly different species. Similarly, while H. dilutus feeds on at least two host families, the two populations are actually differentiated genetically. It remains unclear whether the genetic diversity represents separate species, and whether the other putatively

126

polyphagous species (e.g. C. exiguus Blandford, 1894, C. sylvicola Perkins, 1900) are also assemblages of cryptic monophages.

From a management and quarantine perspective, it may be practical to treat the two host-specialized clades of H. dilutus as distinct phylogenetic species. Additional morphological characters may be discovered in, for example, the proventriculus and genitalia, which have been used to differentiate externally similar Cryphalus in China

(Tsai and Li 1963). However, the reliability of these characters has not been verified with independent markers or ecological traits. Such measures could be particularly useful for differentiating Hypocryphalus dilutus from the morphologically similar species

“sp1422” in cases where a male or sequence information is not available for identification.

During studies on mango wilt in Brazil, Ribiero (1980) reported that

Hypocryphalus mangiferae (potentially misidentified specimens of H. dilutus) was the primary vector of Ceratocystis fimbriata s.l.; he reported that it was the only scolytine found in both diseased and healthy trees. In olfactometer tests, Hypocryphalus mangiferae was attracted to cultures of Ceratocystis fimbriata s.l., and larvae of the insect were raised to adulthood on the fungus (Ribiero 1980). How H. dilutus functions as a vector is unclear. However, it may contaminate its body with Ceratocystis manginecans while feeding in diseased trees and subsequently disseminate the pathogen to healthy trees (Ploetz et al. 2013). The identity of the pathogen killing stressed figs in Malta and Sicily is unknown, as is the vector-mediated etiology of fig mortality.

127

The genetic diversity among Hypocryphalus mangiferae identified here is remarkable, much greater than seen between, for example, certain clades of Cryphalus species included in the phylogeny. Whether the H. mangiferae lineages should be considered different species, in an evolutionary or management context, is unclear, especially given the small number of collections relative to the enormous genetic diversity. At almost every sample location in Asia, we found a genetically distinct population. Outside of Asia, the native range of Mangifera spp. (Mukherjee 1972), the situation is reversed, and the genotypes are remarkably similar (although not identical).

Why have other lineages not spread? Do different genotypes behave differently, and should they be of quarantine interest? In this regard, our hypothesis that H. mangiferae is not a vector of the Certatocystis pathogens, needs to be further tested.

The taxonomy of Cryphalus and Hypocryphalus is still in need of further work.

Few characters are described to distinguish the genera, namely the procurved antennal sutures (Wood 1986, Mifsud and Knížek 2009) and number of funicular segments

(Hopkins 1915, Wood 1986). The characters are not phylogenetically supported, with some specimens not matching these characters. The number of funicle segments was difficult to measure due to the minute size of the character, and may even vary within the two densely sampled species.

Conclusions for Chapter 3

This investigation has not only resolved the pressing taxonomic identity of the pests of figs and the vector of mango wilt, but also reveals a lack of careful study of the biology of the species. Our examination has resolved the confusion over the identity of commodity-specific Hypocryphalus, and has exposed issues with the current understanding of the beetles, and the roles they play in diseases such as mango wilt.

128

This study opens the door for the future studies of bark beetle-vectored pathogens and their global spread. The principal problem that currently prevents more extensive study of these vectors is that most researchers do not voucher their specimens. To understand the association between tree diseases, fungal pathogens, beetle vectors, and their spread around the world, we strongly recommend that specimens are routinely preserved for future genetic and metagenomic studies.

Table 3-1. Primers used in this study. The two new primers were based on alignments across Scolytinae, but was not reliable and only used for six samples. Primer name Sequence Reference 28S_A4285R CCTGACTTCGTCCTGACCAGGC Sequeira et al., 2000 28S_S3690F GAGAGTTMAASAGTACGTGAAAC Sequeira et al., 2000 COI-LepF1 ATTCAACCAATCATAAAGATATTGG Hebert et al., 2004 COI-LepR1 TAAACTTCTGGATGTCCAAAAAATCA Hebert et al., 2004 AJJ_ScolCOI_25-f TCWACHAAYCAYAAAGAYATTGGAAC This study AJJ_ScolCOI_939-r TTAATTCCDGTDGGDACWGC This study

129

Table 3-2. Summary of morphological difference between three Hypocryphalus species present in the Americas. Hypocryphalus Hypocryphalus Species Hypocryphalus dilutus mangiferae sp1422 Mangifera indica, Ficus Recorded carica, F. retusa, F. Broussonetia Mangifera indica hosts microcarpa, Ficus papyrifera bengalensis. USA (Florida, Hawaii), Mexico, Brazil, Guadaloupe, St Kitts, Malta, Italy, Tunisia, UAE, Taiwan(China), Costa Rica, Vietnam, Confirmed Oman, India, Pakistan, China (Fujian prov. Taiwan, China, Distribution Bangladesh, Mexico, and Hainan island), Indonesia, Australia, China USA (Florida) Malaysia, Bangladesh, Singapore, Thailand, Cameroon, Uganda. Mixture of hair-like Mixture of hair-like and and scale-like Setae on All hair-like, more than scale-like (scale-like less (scale-like less than pronotum twice as long as wide than twice as long as twice as long as wide) wide) Procurved sutures, the Procurved sutures, all Procurved sutures, last suture more Antennae of a similar shape and all of a similar shape procurved and further distance apart and distance apart away from the others Males without carina. Males with Males with horizontal Both sexes with horizontal carina carina above level of asciculations above level of eyes. Frons eyes. Frons surface converging at the Frons surface texture without episoma, sometimes texture without aciculations. weakly concave. aciculations. Gular region of Gular region with Gular region with males with glabrous Gular region normally spaced normally spaced vestiture patch surrounded by vestiture setae Males with large Males with small sickle Males with spatulate sickle shaped setae Protibia and shaped setae at the setae along distal edge of along distal edge of tarsi of males distal end of the protibial and 1st, 2nd and protibial and 1st, 2nd protibia 3rd tarsi and 3rd tarsi Males with mesofemoral Simple in both Mesofemur Simple in both sexes spine on the proximal sexes face, nearer to the apex.

130

Figure 3-1. Phylogenetic tree inferred by ExaBayes using concatenated genes COI and 28S. Numbers above nodes indicate bootstrap support (from trees estimated in RAxML), numbers below indicate posterior probability. Host information is inferred through collection information of the specimens included, other specimens deposited in UFFE collection, and information from Wood and Bright (1992).

131

Figure 3-2. Dorsal and lateral view of a Hypocryphalus dilutus (female) collected from Ficus carica from Israel (specimen 53 on tree). Photos courtesy of author.

132

Figure 3-3. Dorsal and lateral view of a Hypocryphalus mangiferae (female) from Honduras (specimen 42 on tree). Photos courtesy of author.

133

Figure 3-4. Dorsal and lateral view of a Hypocryphalus sp. “1422” (male) from Taiwan (China) (specimen 75 on tree). Photos courtesy of author.

134

Figure 3-5. The anterior face of the proleg and mesoleg of a male Hypocryphalus dilutus (specimen 21 on tree). The mesofemoral spine is a unique character of H. dilutus. A) Protibia with spatula shaped setae. B) Mesotibia with spine. Photograph taken at approx. 200x magnification. Photos courtesy of author.

135

CHAPTER 4 PHYLOGENOMICS REVEALS REPEATED EVOLUTIONARY ORIGINS OF MATING SYSTEMS AND FUNGUS FARMING IN BARK BEETLES

Introduction to Chapter 4

Background

Understanding organismal life histories rely on the integration of the biology of extant species with the reconstruction of their evolutionary past. Bark and ambrosia beetles (Coleoptera, Curculionidae, Scolytinae) are an example of a group where such integration is long overdue. They display a diversity of genetic, ecological and behavioral strategies that rival those present in entire insect orders. Bark and ambrosia beetle species are also ecologically and economically important. Many destructive species are the harbingers of anthropogenic global change in forest ecosystems and industries, facilitated by a warming climate, non-native species introductions and unnatural management (Hulcr et al. 2015). Their economic importance has led to the accumulation of extensive research literature, which can now be mined for biological data (Wood and Bright 1992). Bark and ambrosia beetles are also becoming prominent as genomic models: two of the first four published beetle genomes were Scolytinae

(Keeling et al. 2013, Vega et al. 2015b). In this work, we build on the availability of biological information and genetic resources for bark and ambrosia beetles and present a uniquely comprehensive assessment of the nature and evolution of bark beetle life histories.

Scolytinae (>6,000 species) abound with unique features, but understanding their evolution has been hampered by the absence of a robust phylogeny. Traditional morphology-based classification is not reliable for making evolutionary inferences. The subcortical (below-bark) lifestyle has imposed significant constraints on the morphology

136

of bark and ambrosia beetles, and has led to the convergent evolution of many morphological characters (Hulcr et al. 2007a, Hulcr et al. 2015). Entire unrelated tribes were mistakenly grouped due to convergent morphological characters, mating system, or their fungus farming habits (e.g. Xyloterini, Xyleborini, and Premnobius (Wood

1982)). Only with the advent of molecular systematic analyses, it has been shown that these groups are not related and that all the similarities are examples of impressive convergence (Normark et al. 1999, Farrell et al. 2001, Cognato 2013).

To understand the evolutionary history of bark and ambrosia beetles, a well- resolved tribal-level phylogeny is needed. Recent attempts have recovered the placement of Scolytinae within weevils (family Curculionidae) using molecular phylogenetic data from mitochondrial genomes (Gillett et al. 2014) and multi-marker nuclear DNA sequence data sets (McKenna et al. 2009, McKenna 2011, McKenna et al.

2015) but the analyses lacked broad sampling across Scolytinae. Conversely, analyses that include larger numbers of Scolytinae have relied on relatively few traditional DNA markers, and typically recover large polytomies (Jordal and Cognato 2012) and/or poorly supported relationships between tribes of Scolytinae (Gohli et al. 2017).

The present study had three complementary goals. First, we aimed to develop and test a robust phylogenomic pipeline to infer phylogenetic relationships of bark and ambrosia beetles. Second, we applied this pipeline to several of the most diverse components of bark and ambrosia beetle classification, including Cryphalini, Corthylini and Xyleborini. These tribes alone comprise more than half of all species of Scolytinae

(Hulcr et al. 2015). They have often been considered the “advanced” bark and ambrosia beetles and have been variously grouped together by traditional taxonomists (Hopkins

137

1915, Wood 1986). Third, we used the resulting well-resolved phylogeny to infer the evolution of the diverse ecological, genetic and reproductive strategies observed across

Scolytinae, with emphasis on Cryphalini and related groups whose natural history traits are especially variable (Kirkendall 1983). The third analysis was focused on traits that had previously been proposed as key evolutionary innovations underlying the species diversity and ecological success of Scolytinae (Gohli et al. 2017). These traits include: apparent haplo-diploidy, fungus farming, and host generalism (Gohli et al. 2017).

The Pygmy Borers: Cryphalini

We densely sampled the pygmy borers, Cryphalini sensu Wood (1986). This tribe contains 25 genera and hundreds of species with unusually diverse habits and considerable economic and ecological importance. The group is a suitable phylogenetic model for the remainder of the bark and ambrosia beetles: Cryphalini include species that represent a diversity of behavioral and ecological traits observed in other

Scolytinae, and preliminary taxonomic and phylogenetic assessment suggests that these traits have evolved multiple times within the tribe.

The tribe Cryphalini has also been the most formidable taxonomic challenge within Scolytinae. It is traditionally defined by only two putative morphological characters: the posterior end of the metepisternum covered by the elytra, and no more than five antennal funicle segments (Wood 1986). However, many Cryphalini species are not compatible with this combination of characters (Johnson, unpublished) and likewise, these characters occur in other tribes. Current phylogenetic evidence (Jordal and Cognato 2012, Gohli et al. 2017) suggests that Cryphalini may be comprised of at least three separate clades, and contains species belonging to other tribes, including

Xyloterini and Diamerini. The abovementioned phylogenies share spurious results, such

138

as the inclusion of morphologically entirely different genera (e.g. Carphoborus, tribe

Polygraphini) with genera of Cryphalini, and deep polyphyly of several genera strongly indicated to be monophyletic on the basis of other data. In summary, it remains unclear whether Cryphalini currently represents a monophyletic group, and the phylogenetic relation between genera.

Evolutionary Innovations

Scolytinae in general and Cryphalini in particular possess many notable evolutionary innovations. Some of these traits have been hypothesized to be the engine

“driving” the ecological and taxonomic diversification and apparent evolutionary success of bark and ambrosia beetles (Farrell et al. 2001, Gohli et al. 2017).

Apparent Haplo-diploidy and Inbreeding

The subfamily Scolytinae contains examples of several different genetic systems and breeding habits. A remarkable example is apparent haplo-diploidy; the males are dwarfed, flightless, often do not leave the parental gallery, and usually mate with their female siblings. In the most species-rich tribe, the Xyleborini, true haplo-diploidy has tentatively been confirmed by production of male only broods from virgin females (5 species from 3 genera) and though karyotyping (2 species) (Kirkendall 1993). For the genus Coccotrypes, haplo-diploidy has been inferred by production of male broods from virgin females (Herfs 1950, Ueda 1997) and flow cytometry (Jordal, unpublished). In the

Cryphalini genus Hypothenemus, haplo-diploidy is only apparent, known as pseudo- arrhenotoky, or paternal genome elimination: males are functionally haploid, but still possess a condensed, inactive paternal set of chromosomes (Borsa and Kjellbergt

1996). Many other genera of Scolytinae display the same symptoms of male dwarfism, but it is not known if these are examples of haplo-diploidy, pseudo-arrhenotoky, or some

139

other mechanism. Examples include, Ozopemon, Sueus, Cryptocarenus, Trischidias,

Periocryphalus, Premnobius and Xyloterinus.

Bark and ambrosia beetle literature refers to this collection of traits variously as

“consanguineous polygyny” (Wood 1986), “inbreeding polygyny” (Kirkendall 1983),

“sibling mating” (Jordal and Cognato 2012) or “permanent inbreeding” (Gohli et al.

2017). However, these terms should be used cautiously. There is genetic evidence for outcrossing in Xylosandrus (Keller et al. 2011, Storer et al. 2017) and Coccotrypes dactyliperda (Holzman et al. 2009), as well as evidence for males searching for non- sibling mating opportunities in Hypothenemus (Johnson et al. 2016b), Euwallacea

(Cooperband et al. 2016), Xylosandrus (Johnson, unpublished) and Coccotrypes

(Kirkendall, unpublished, Johnson, unpublished). Conversely, some known diplo-diploid species live communally and inbreed even though males have functional wings and eyes and can migrate (Fraser et al. 2014). In recognition of this uncertainty, we use the term “apparent haplo-diploidy” in our character coding, and the coding of this character in our phylogenetic analyses should be viewed as preliminary.

One of our target groups, the Cryphalini, includes genera which exhibit male dwarfism and inbreeding: Cryptocarenus, Hypothenemus, Trischidias and the poorly documented Periocryphalus. These genera have been assumed to comprise a single evolutionary lineage, partly based on these ecological habits (Wood 1954), but the assumption of monophyly was contradicted by Gohli et al. (2017).

Fungus Farming

Interactions between Scolytinae and fungi undoubtedly contributed to the success of Scolytinae in forests worldwide. The interactions observed between

Scolytinae and their host fungi range from antagonistic to commensal, asymmetrical,

140

beneficial, and mutualistic. Dependence on fungi varies widely among the phloem- infesting Scolytinae (Harrington 2005), while most xylem-inhabiting species of

Scolytinae are strictly dependent on fungi. The farming of nutritional fungi in xylem, termed “ambrosia symbiosis”, evolved many times among unrelated Scolytinae groups

(Jordal and Cognato 2012), both xylem- and phloem-inhabiting, and converged on a relatively uniform phenotype, in terms of gross morphology the presence of mycangia, the fungus-transport organ (reviewed in Hulcr and Stelinski 2017), and the behavior.

Phloem-inhabiting mycetophagous bark beetles are usually excluded from the definition of true ambrosia beetles following a forest entomology tradition (e.g. Gohli et al. 2017) but because they farm fungi and have evolved mycangia, they are classified as fungus farmers here (e.g. Pityoborus spp., Dendroctonus spp.). Many additional beetles are known to have mycangia, but their ecology is not known; an unidentified

Cryphalus species from New Guinea (Jordal, unpublished), an unidentified

Pityophthorina from French Guiana (Johnson, unpublished), and several Neotropical

Hypothenemus (Schedl 1961, Beaver 1986, Wood 2007).

Cryphalini also engage with fungi in diverse ways. Members of the genus

Trischidias and some Hypothenemus colonize fungus-infested decaying wood (Deyrup

1987), and at least two Hypothenemus species are recorded as able to farm ambrosia fungi and also possess mycangia (H. concolor by Schedl (1961), and H. curtipennis, by

Beaver (1986)).

Host Specificity and Super-generalism

Host specificity of most insect herbivores follows a continuum from reliance on a single host to indiscriminate feeding (Novotny et al. 2002). In Scolytinae, the distribution of feeding habits is less continuous (Hulcr et al. 2007b, Novotny et al. 2010). Species

141

ingesting tree tissues, such as most bark inhabiting species, are typically monophages or oligophages, able to develop within only one species, within multiple species in a genus or within a single plant family, a situation similar to that observed in other phytophagous (plant-feeding) beetles. Scolytine species farming and ingesting fungi, the ambrosia beetles, will often be found on a much broader range of hosts, irrespective of their taxonomic identity (Beaver 1979, Hulcr et al. 2007b). Many bark beetle species, however, deviate from this trend. Even though they ingest plant tissue, they feed on dozens of plant families. In Cryphalini, for example, the species Hypothenemus eruditus was recorded from 63 different plant families (Atkinson 2017). Whether the “super- generalists” (Wood 2007) are an evolutionary intermediate to fungus farming, or an unrelated condition, is unknown, and requires assessment in a phylogenetic framework.

Materials and Methods for Chapter 4

Trait Inference

Ecological and genetic traits were inferred from a combination of literature searches (Wood 1982, Kirkendall 1983, Beaver et al. 1989, Wood 2007, Atkinson

2017), and direct observations in the field. The evolutionary innovations were reduced to three binary characters: Apparent haplo-diploidy versus regular diplo-diploidy, fungus farming versus plant tissue feeding, and host plant generalists versus host plant specialists.

Species recorded with apparent haplo-diploidy were scored based on seven biological features (Supplementary Table 4-1). Fungus farming was inferred based on the presence of mycangia and obvious fungal growth on the walls of larval galleries.

The placement of a gallery in xylem or phloem was recorded (Supplementary Table 4-

1), but not considered decisive for fungus farming. Host specificity data were based on

142

an extensive literature search and explicit count of records from plant families; specialists included species feeding on fewer than three plant families. This cutoff was chosen as a convenient point on the distinctly bimodal distribution of specializations – most bark and ambrosia beetles feed on one family, or are polyphagous. Taxa were selected to capture the variation in these traits, with an emphasis placed on certain species-rich groups, namely the tribe Cryphalini.

Genomic Data Sources

The new sequences used for molecular phylogenetics came from three sources:

Anchored hybrid enrichment (AHE). DNA from 119 individuals (summarized in

Table C-1) were obtained by preparing whole DNA extracts. Each specimen was photographed, then crushed whole, and DNA was extracted using the OmniPrep genomic DNA extraction kit (G-biosciences, USA). Photographs of all specimens are available at www.ambrosiasymbiosis.com and deposited in Dryad. Barcoded libraries were prepared, then enriched using biotinylated probes (Haddad et al. 2017, Shin et al. unpublished), targeting 941 loci for 642 genes (hereafter referred to as “target genes”).

These were then pooled and sequenced over four separate batches on a HiSeq 3000

(Florida State University, Tallahassee, Florida, USA), giving paired 150bp reads with a target insert size of 500bp. Four samples were discarded and repeated due to apparently failed library preparation or high levels of contamination.

Shallow transcriptomes. RNA was extracted from seven individuals (Appendix B-

1) with the RNAqueous RNA extraction kit (New England Biosciences Ltd.) and libraries were prepared using the NEB RNAseq library prep kit with dual indexed barcodes. Each

RNA library had approximately 1/25 of a pooled Illumina NextSeq high output run (150 x

2) (ICBR, University of Florida, Florida, USA).

143

Shallow genomes. Genomic DNA from two individuals (Table 4-1) was extracted using the OmniPrep DNA extraction kit (G biosciences Ltd). Libraries were prepared using the low input NEB library prep kit (New England Bioscience Ltd.), with a target of

4/25 of a pooled run on an Illumina NextSeq high output run (150 x 2) (ICBR, University of Florida).

Existing published genomes and transcriptomes were downloaded from sources summarized in Table 4-1. The genome for Dendroctonus ponderosae (Keeling et al.

2013) was modified to break up scaffolds by removing long stretches of ambiguous bases connecting the scaffolds, which greatly improved speed of further steps for searching and annotation. The transcriptome of Tomicus yunnanensis (Zhu et al. 2012) was initially included but subsequently removed due to unexpected level of sequence heterogeneity, likely a consequence of sequencing pooled genetically divergent individuals.

Bioinformatics Pipeline

All analyses were implemented on the High-Performance computer system at the

University of Florida (HiPerGator 2.0). The methods described below were written as bash and Python 3 scripts for repeatability, and are available with the supplementary files. All methods are deterministic based on the methods used, with minimal manual adjustments beyond initial organization of data sources, manual annotation of mitochondrial reference genes, and checking and eliminating apparently erroneous prepared intermediate references.

Assembly and reference preparation. For each library, all reads were evaluated to remove low quality regions of sequences, short sequences and stray sequencing adapters, using Trimmomatic (Bolger et al. 2014). RNAseq samples and

144

AHE samples were separately assembled using Bridger (Chang et al. 2015) with a minimum kmer coverage of 20 and 10 respectively. Two shallow genomes were assembled using Soapdenovo2 (Luo et al., 2012), with parameter guidance by kmergenie (Chikhi and Medvedev 2013).

Orthology and homology of the 642 target genes were evaluated using an all- against-all BLAST search; Genes for which potential paralogs were recovered (defined by similarity of two peptide sequences, observed in Tribolium or Scolytinae samples), were identified and eliminated using Usearch (Edgar 2010) and custom Python scripts.

Of the surviving target genes, reference sequences from transcriptomic samples were prepared using Usearch, Exonerate (Slater and Birney 2005) and custom Python scripts.

Extraction and annotation of target genes. Contigs of putative homologs in all

AHE assemblies and shallow genomes were gathered and annotated based on the peptide sequence of the references (using Usearch, exonerate and custom bash and python scripts). Introns were excluded from further analyses, and exons were concatenated where appropriate.

All annotated sequences for each gene were assessed for contamination. We gathered for each gene, the number of other samples with identical copies, non- identical copies in the same sample, and number of copies of the other sample, as well as information from all other genes. This information was then used to predict and eliminate sequences that were likely to be contamination, or sequences that could not be ruled out as contamination in known contaminated samples (Using Usearch and custom python scripts).

145

Sequences alignment. Surviving sequences were aligned by their peptide sequence, connected if appropriate, and filtered to remove highly divergent, likely poorly aligned individual sequences, using

MAFFT (Katoh and Standley 2013), EMBOSS distmat (Rice et al. 2000), and a custom python script similar to TranslatorX (Abascal et al. 2010). Gene trees were made for manual validation of methods using RAxML v8.2.3 (Stamatakis 2014).

Alignments were reduced by deleting regions which were represented by less than 60% of the taxa, minimizing the number of missing characters thus the computational load when inferring phylogenies. All genes were concatenated, and the third codon position was discarded, following empirical evidence by Breinholt and Kawahara (2013).

Phylogenetic inference. Phylogenetic trees were inferred using Bayesian techniques (Exabayes v1.5; Aberer et al., 2014), partitioned by genome source (i.e., mitochondrial versus nuclear), with two independent runs of four chains each, run for a minimum of 2.5 million generations, which was sufficient time for convergence (standard deviation of split frequencies < 0.5%), sufficient effective sample sizes (>500, checked using Tracer; Rambaut et al., 2015), and sufficient topological convergence (using

RWTY; Warren et al., 2017). A majority tree was made (following 25% burn in). This was repeated using a maximum likelihood strategy with RAxML, which yielded similar topology for the best scoring tree (n=100 repeats), except the placement of the root branch. One thousand bootstrapped alignments were generated and their phylogenies inferred with RAxML, using the same methodology, although fewer independent tree searches per bootstrap (N=10).

146

Trees were rooted with members of the Scolytini, as an a priori outgroup. This morphologically distinct tribe is frequently found in molecular phylogenies to be distant from all other Scolytinae, and has even been suggested as a separate weevil lineage

(Gillett et al. 2014, Shin et al. unpublished). The use of an additional nearby

Curculionidae outgroup was avoided due to uncertain relationships between Scolytinae and other Curculionidae (Gillett et al. 2014, Shin et al. unpublished).

To verify that there is not an alternative topology consistently recovered in some of the gene trees, the individual gene trees made in RAxML were compared to the final topology using Phyparts (Smith et al. 2015).

Testing taxonomic hypotheses. Following phylogenetic construction, hypotheses of species relationships that were published previously and conflicted with the relationships presented here were tested using three metrics: (1) the proportion of sampled posterior output trees in which the hypothesis is supported in the sampled

Bayesian trees, (2) proportion of the same in the bootstrapped alignment trees, and (3) a comparison of the likelihoods of the tree presented and constrained ML tree built in

RAxML, using the Shimodaira-Hasegawa test (implemented in RAxML) to test if the conflicting hypotheses are significantly worse than the tree presented. The sources and overview of the topological hypotheses are presented in Table 4-2. Constrained trees did not include genera not included/mentioned by the source. Miocryphalus pennatus and Cosmoderes imitatrix were not included in constraints because their current placement in the respective genera is erroneous. The former is known to be genetically and morphologically very similar to Cosmoderes madagascarensis Schedl (Gohli et al.

2017) and bears no resemblance to any Miocryphalus, and Cosmoderes imitatrix bears

147

no similarity to other Cosmoderes. Dubious generic placements by K. Schedl, as in these two cases, are a known phenomenon in scolytine taxonomy (Hulcr and Cognato

2013). This is a conservative approach, since inclusion as their current generic assignment suggests, yielded significantly worse constrained trees for all taxonomy- based hypotheses.

Ancestral State Reconstruction and Character State Correlation Analysis.

The evolution of the three key ecological traits, (breeding system, fungus farming and host breadth) were investigated on taxa where all three states were known.

The correlation between the three traits was investigated using Pagel’s test for correlation between the pairs of traits using Mesquite V3.2 (Maddison and Maddison

2017). This analysis tests the hypothesis that two traits, for example fungus farming and haplo-diploidy, evolve more often together than independently in the history of bark beetles. An asymmetrical model of rate evolution was used (irreversible rates were not used based on the advice of Pagel (1994), who suggested inevitably higher confidence based on a posteriori observations). Pagel’s test can lead to false positive results

(Maddison and FitzJohn 2014), fortunately these are uncommon in trees with multiple origins of each character state, such as the one estimated here.

States on ancestral nodes and on taxa with missing values were calculated using the re-rooting method of Yang et al (1995), and implemented in the R package Phytools

(Revell 2011). This method allows ambiguous character states of taxa to be predicted

(root and ambiguous tips were initially coded with a prior of 0.5).

148

Results for Chapter 4

Bark Beetle Relationships Resolved

We present the first robust and well supported phylogeny of bark beetles with a focus on Cryphalini (Figure 4-1). The phylogeny suggests that many groupings in the current taxonomic classification of Scolytinae do not reflect true evolutionary relationships. Among the clades with the highest diversity, only Xyleborini are monophyletic; Corthylini are paraphyletic and Cryphalini are highly polyphyletic. The largest Cryphalini clade, including the type genus Cryphalus has the tribe Xyloterini nested within. Furthermore, there are two Cryphalini genera in a clade containing the

Corthylini, and six genera of Cryphalini formed a distantly related clade, provisionally termed the Ernoporus clade. Trees constrained to retain the monophyly of Cryphalini were significantly worse than the relationships presented.

Among the major clades of Cryphalini, the genera are also highly polyphyletic.

Hypocryphalus, Margadillius and Cryphalus species are intermixed. Among the

Ernoporus clade, species of Ernoporicus, Scolytogenes and Ptilopodius are highly intermixed. The fungus-farming Xyloterini have evolved from within the Cryphalini clade, sister to the genus Coriacephilus. This clade was found to be sister to the genera

Hypothenemus, Trypophloeus and Cosmoderes, contradicting the topologies found in previous molecular studies. However, that traditional topology was also recovered during the Bayesian search and in the bootstrapped alignments, and was not significantly worse. Therefore, the specific hypothesis of Xyloterini [and Coriacephilus] sister to the Cryphalus group cannot be rejected.

The major Cryphalini + Xyloterini clade is sister to a clade containing

Strombophorus, Hapalogenius and Xyloctonini, corroborating the results of Jordal and

149

Cognato (2012). The large tribe Corthylini is monophyletic only with inclusion of the genus Cryptocarenus, which is currently classified within the tribe Cryphalini. Within

Corthylini, the fungus-farming Corthylina are also monophyletic, while the phloem- feeding Pityophthorina are paraphyletic.

Dryocoetini, specifically the genus Coccotrypes, are paraphyletic with respect to the mega-diverse clade of Xyleborini. Among the strictly fungus-farming Xyleborini, there is a strongly supported group containing the monophyletic Xylosandrus and several other genera with a mesothoracic mycangium.

Our sampling of other tribes was not as comprehensive, but still provides a basis for re-evaluation of many current taxonomic groups. Most tribes are supported, with the exception of the following: Phloeotribus (Phloeotribini) and Chramesus (Phloeosinini) are sister taxa, and the clade they form is sister to the clade that includes Scolytodes, corroborating the poorly supported topology of Jordal and Cognato (2012).

Hyorrhynchini, represented here by Sueus, are sister to the genus Sphaerotrypes

(currently in Diamerini); both share completely divided eyes. Carphoborus and

Polygraphus were recovered as sister taxa, which supports traditional morphological classification but was not recovered in previous molecular phylogenies. Both aforementioned clades show extensive divergence and low support.

Tree Verification Based on Individual Gene Trees

All individual gene trees, for each node on the presented phylogeny, were assessed for concordance to ensure that some genes do not consistently support an alternative hypothesis, presented as an annotated cladogram in Appendix C-2. Most nodes were supported with the presented topology being the most common, although not necessarily with the majority of the potentially informative genes. There were three

150

notable exceptions; Araptus sp. “Vismia” was sometimes recovered nested among

Cryptocarenus instead of closely related to it; Ptilopodius spp. 2026 and 2027 were sometimes sister to, rather than nested among the species determined as Ernoporicus; and Cnestus mutilatus was recovered, in some topologies, to be sister to all other

Xyleborini and Coccotrypes.

Evolution of Apparent Haplo-diploidy

The results of our phylogenetic analyses suggest there are at least six origins of the apparent haplo-diploid phenotype among the included taxa. It is unlikely that any of these patterns are a consequence of secondary loss of the habit (all ancestral nodes with < 0.95 probability); in all cases the most recent common ancestor is predicted to be diplo-diploid and reproduces by regular outbreeding.

Cryptocarenus represents a newly inferred independent origin of the condition.

The paraphyletic relationship with Araptus is notable, since some members or the genus are recorded as being inbreeding (Kirkendall 1983).

Evolution of Fungus Farming

We found 11 monophyletic groups of fungus-farming Scolytinae. Our analysis included 13 of the 22 putative ‘independent associations’ between beetle clades and major fungal clades (Hulcr and Stelinski 2017), suggesting that the majority of beetle- fungus associations arise de novo. Where multiple ‘independent associations’ exist within a fungus farming clade, only one was paraphyletic (Gnathotrichus &

Monarthrum), suggesting that a beetle clade which was already ambrosial adopted a new fungus. Among the Xyleborini, where sub-clades are associated with different fungal groups, we found no evidence of any of the associations being ancestral to

151

others. The phloem-dwelling fungus farming Scolytinae (phloeomycetophages) are widely dispersed across the tree, and are not related to xylomycetophagous taxa.

We confirm a strong pattern of asymmetrical evolutionary association between clades of ambrosia beetles and their fungal mutualists. Most clades of ambrosia beetles are associated primarily with a single genus of fungus, while fungal genera can associate with multiple beetle clades.

The monophyly of Corthylina (including Gnathotrichus) suggests that the apparent independent evolution of this genus indicated by the tree published by Gohli et al. (2017) is not supported. Also, contradictory to Gohli et al (2017), Sueus and

Dactylipalpus were not found to be monophyletic, suggesting that the two evolved fungus farming independently.

Evolution of Host Generalism

The phylogeny includes eleven clades of the species defined as super- generalists, i.e. species not limited by plant taxon identity at the family level. The finding that Cryptocarenus is unrelated to Hypothenemus identifies another independent example of the super-generalist habit. Ancestral state reconstruction suggests the polyphagous habit is derived, and the specialist habit is ancestral. A single example of a reversal to monophagy is observed in Hypothenemus hampei, a coffee seed feeder.

Additional examples of specialist species being nested among generalist genera are known within Corthylini and Xyleborini, but they were not included in the dataset.

Correlation of Traits

The various evolutionary innovations identified here show a correlation in their occurrences in the tree. All traits, especially mating system and host specificity, appear significantly correlated when analyzed using Pagel’s test for correlation of binary traits.

152

For example, the majority of clades that feed on broad host ranges are also apparently haplo-diploid. Only mating system and host specificity are correlated when analyzed using pairwise comparisons. Equally interesting are cases where no correlation appears. Fungus farming does not correlate with broad host range – many scolytine clades are able to use numerous substrates unaided by fungi. Likewise, although mating system variability and host range are significantly correlated, the mechanisms remain unknown, and many haplo-diploid bark beetles exist with narrow host ranges.

Discussion for Chapter 4

Strengths and Weaknesses of the AHE Pipeline

Previous attempts at inferring the phylogeny of Scolytinae strongly contradicted morphological classification (Jordal and Cognato 2012, Gohli et al. 2017), but were largely unresolved for the deepest nodes. The tree presented here provides higher support, undoubtedly linked to the increased number of loci included, and, despite limitations on the number and phylogenetic breadth, of included taxa.

The methods for paralog detection used are repeatable, scalable, and largely automated. Genes used by Gohli et al. (2017, particularly EF-1a) are known to be problematic, and have known paralogs (Jordal 2002), which would have been automatically excluded from the analysis used here.

Nevertheless, generating large quantities of sequences for phylogenetic exploration has challenges which may impact conclusions. Pooled, high throughput sequencing is challenged by assignment of reads to their non-intended libraries. This may be from errors during the Illumina sequencing runs (UF ICBR, pers. comm.) or systematic errors in automated library preparation (contamination of barcodes in the liquid handling process). These issues were addressed in the pipeline used, and there

153

is no evidence of mis-barcoded sequences being used in the phylogeny. However, elimination of cross-barcoded sample led to fewer samples being included in the analysis than intended, and fewer sequences per sample, which may have reduced the topology support.

The eventual alignments of many of the genes were short, limiting the ability to analyze individual gene trees. This was reflected by mangy gene trees no being concordant with the tree from the concatenated alignment. In three cases, the gene trees supported a particular gene tree more often that the one presented, which casts doubt on those specific relationships. For the placement of the undetermined Araptus sp. and undetermined Ptilopodius sp., this changes the conclusions little since the biology of these species are not known, and could suggest that the characters used in the identification are not reliable characters for the genera. The uncertain placement of

Cnestus mutilatus is not explained, since its placement in the phylogeny is widely supported by morphological characters, and may be a symptom of undiagnosed contamination.

Bark beetle Relationships Resolved

The phylogeny recovered herein highlights the lack of congruence between current morphology-based scolytine classification and their actual evolutionary history/relationships. This is especially true of Cryphalini, the most densely sampled tribe. This should be no surprise, since the diagnostic characters of Cryphalini are poorly defined, typically due to a lack of distinguishing characters. The few described synapomorphies (Hopkins 1915, Wood 1986) are unreliable, and exceptions within and outside of Cryphalini are common.

154

The genus-level classification within Cryphalini is also in need of a complete revision. The genera of Cryphalini were originally described and diagnosed using (in most cases) characters of the antennae. For example, Hypocryphalus and Cryphalus are defined as differing by a single funicle segment, which is generally an unreliable character and our topology confirms that these genera are not monophyletic. It is clear that the current definitions of genera are not necessarily indicative of actual relationships in this group, and that taxonomic changes are needed. Taxonomic reclassification considering the present phylogeny has been initiated.

The clades recovered for Crypahlini are corroborated by some morphological characters. In particular, species in the Clade containing Cryphalus, Hypothenemus,

Trypophloeus, Cosmoderes, Coriacephilus and Xyloterini all have emarginated eyes (for

Xyloterini this is extreme to the point that they are divided), and all of the species in the

Ernoporus clade have elongate, entire eyes. More specifically, the clade containing

Ernoporus tiliae, Ernocladius corpulentus and Cosmoderes imitatrix appear to have a similarly stout body shape (except the antennae, presumably used for genus designation), and are all known exclusively from the plant Family Malvaceae.

Cryptocarenus, currently recognized as a cryphaline genus, is robustly nested among Corthylini, specifically within the diverse and understudied genus Araptus. This placement is supported by the character of the presence of an oblique locking groove in the absence of an interlocking spine, overlooked by S. L. Wood who described it as a unique character for the tribe (Wood 1978). The genera Stegomerus and Dendroterus lack this character, suggesting that it had evolved within the clade, and is a synapomorphy for a subclade. The sub-tribe Corthylina is nested among Pityophthorina.

155

Additionally, both Stegomerus and Cryptocarenus have a broadly emarginated eye and near vertical apex of the elytra, which is typical of Corthylini.

The paraphyly of Dryocoetini with respect to Xyleborini has been demonstrated before (Normark et al. 1999, Jordal and Cognato 2012) but the relationship to

Coccotrypes was poorly resolved. Normark et al. (1999) and Cognato et al. (2011) recovered Xyleborini as paraphyletic with respect to this genus (when re-rooted appropriately), but with very low nodal support. Our results confirm the suggestion by

Kirkendall (1993) that Xyleborini is derived from a Coccotrypes ancestor, as the genus is currently described. This produces a challenge reconciling traditional hierarchical classification with monophyly, since an entire tribe is nested among a single genus.

Within Xyleborini, the genus Xylosandrus is monophyletic. This is contrary to previous studies focusing on the relationships of Xylosandrus (Dole et al. 2010). While our taxon sampling was much more limited, all the major lineages of Xylosandrus discovered by Dole et al. (2010) were included, as well as genera which were found to be nested among them. This supports a single origin of the large mesothoracic mycangium and mutualism with Ambrosiella fungi in tribe Xyleborini (Mayers et al.

2015).

Evolution of Apparent Haplo-diploidy

Apparent haplo-diploidy is rare among Coleoptera, yet in Scolytinae it has evolved at least six times. The discovery that Cryptocarenus is not related to

Hypothenemus/Trischidias (both likely pseudo-arrhenotokous), indicates a separate origin of this habit, contrary to the hypothetical sister relationship proposed by Wood

(1954). The limited information from the undetermined “Corthylini sp. Pronotal

Mycangia” (Johnson, unpublished), particularly lone females, one of which had eggs,

156

suggests there is another tentative origin pending more ecological observations. Some

Scolytinae species show combinations of traits that can be hypothesized as intermediate steps towards the inbreeding haplo-diploidy syndrome. For example, some

Dendroctonus species regularly inbreed but their males are as large as females and perfectly capable of dispersal (Francke-Grossmann). There is, however, no case where such an “intermediate” state is known in a species or clade sister to an apparent haplo- diploid clade. Therefore, we cannot confirm the hypothesis that communal breeding and inbreeding is an evolutionary predisposition towards apparent haplo-diploidy.

The presence of apparent haplo-diploidy among extant scolytine groups is correlated with the presence of fungus-farming (this work, and Gohli et al., 2017). Six of the seven apparently haplo-diploid lineages contain fungus farming taxa, in two cases all the contained species are haplo-diploid fungus farmers. However, while the occurrences of two features are correlated, their origins appear asynchronous. For some tribes, the apparent haplo-diploidy preceded fungus farming (e.g. Xyleborini among Dryocoetini/Xyleborini, Hypothenemus dolosus among

Hypothenemus/Trischidias, and evidently Cryptocarenus (Johnson, unpublished)). In others, fungus farming preceded apparent haplo-diploidy (e.g. Xyloterinus among

Xyloterini, the unknown Pityophthorina among Pityoborus, and likely Bothrosternus among fungus farming Bothrosternini and Sueus among the fungus farming

Hyorrhynchini).

Several additional scolytine species were reported to display signs of apparent haplo-diploidy or inbreeding, including species in the genera Araptus, Periocryphalus,

Bothrosternus, Margadillius and Ptilopodius (Kirkendall 1983). The former three were

157

not available for use, but may add up to three origins of the genetic system. The latter two are misdiagnosed species of Hypothenemus (Johnson, unpublished).

Sex determination systems of bark beetles have only been studied in a few species in the Coccotrypes/Xyleborini clade and in the genus Hypothenemus, and remain unknown in most other groups. Haplo-diploidy does not necessarily cause all the traits of the apparent haplo-diploid phenotype, and may be misdiagnosed. Apparent haplo-diploidy has also been linked to increased speciation rates among Scolytinae

(Gohli et al. 2017), but the existence of species-poor haplo-diploid groups suggests that the acceleration may not be universal. More detailed information for individual species, coupled with the phylogeny presented here, would shed further light into the evolution of apparent haplo-diploidy.

Evolution of Fungus Farming

Eleven clades of fungus farming beetles are predicted from the dataset. All except one of the described associations of beetles and specific fungi (sensu Hulcr and

Stelinski 2017) are monophyletic. This suggest that all but one origin of the capacity to farm fungi in the beetles could be unique. Most lineages have also evolved a new type of mycangium, and many have evolved specificity to only one or a few fungal groups, often also evolved de novo. Therefore, future research on coevolution between scolytine beetles and their associated fungi should not be focused on the entire subfamily Scolytinae, but on individual clades.

The group containing Anisandrus, Cnestus, Diuncus, Eccoptopterus and

Xylosandrus was found to be monophyletic, contradicting some recent phylogenies focusing on the group (Dole et al. 2010, Cognato et al. 2011) and complementing others

(Jordal 2002, Gohli et al. 2017). This conforms to the morphology and symbiotic

158

association of beetles in this clade, all of which possess a large mesonotal mycangium and are highly specific to their symbiotic fungus, Ambrosiella sp. (Mayers et al. 2015).

Among Xyleborini clades with different fungal farming systems, there is no specific evidence of one symbiosis being ancestral to another. This is corroborated by

(Gohli et al. 2017). The most recent common ancestor of Xyleborini is predicted to be fungus farming, but we do not understand if, how, and when any transitions between fungal symbiont and mycangia location occurred. It remains a viable hypothesis that the different associations are independently evolved in a series of Coccotrypes-like ancestors. Only 12 of the 27 Xyleborini genera have any known information about their symbionts. A broader understanding of the symbiosis and the phylogeny of Xyleborini will be needed to resolve the evolution within this group.

Evolution of Host Generalism

Most origins of bark beetle polyphagy coincide with some degree of reliance on fungi. Of the eleven polyphagous clades, seven contain fungus farming species, and six of those are exclusively mycetophagous. Several taxa included appear to be polyphagous without feeding on fungi. Interestingly, while the polyphagous species included in our phylogeny do not farm fungi, other species in the same genera do: i)

Two Hypothenemus species have been recorded farming fungi (H. concolor and H. curtipennis), ii) fungus-lined galleries of Cryptocarenus sp. have been observed

(Johnson, unpublished), and iii) a fungus farming Cnesinus is known (Wood 1982,

Kolařík and Kirkendall 2010, Jordal unpublished). The habit of generalism precedes fungus farming in many cases, and these genera listed above are mostly pith-feeding.

Therefore, while mycophagy has often been proposed as the predecessor of polyphagy

(Beaver, 1979), future work should also test the opposite hypothesis: evolution of bark

159

beetles towards polyphagy facilitates the capacity to feed on fungi, and a subsequent switch to fungi as the sole nutrition.

Unlike inbreeding and fungus farming, the evolution towards polyphagy does include examples of reversal back to specialization. Within the Hypothenemus clade where most species colonize dozens of plant families, H. hampei has specialized in

Coffea spp. seeds. Several species within the fungus farming polyphagous tribe

Xyleborini also specialize on tree genera or families, such as Xyleborus pubescens and

X. glabratus (not included in the phylogeny). The genus Coccotrypes contains a mixture of species known from a single host plant species to those collected from dozens of plant families. The number of taxa in each of these clades is not sufficient to explore the finer scale specialist-generalist patterns.

Conclusions for Chapter 4

The new phylogeny and its strong support allow us to reconstruct the evolutionary history of the bark beetle radiation with certainty not available in the results from previous studies. While the numbers of origins of individual features have not changed substantially since Jordal and Cognato (2012) and Gohli et al. (2017), our confidence in the number and direction of evolutionary events is new. Most importantly, we provide a new path forward towards a robust reclassification of some of the most diverse and important groups of bark beetles, particularly the Cryphalini which had been intractable until now.

By far, the largest limitation to the study of the evolution of bark beetles is the lack of precise, published information on their behavior and ecology. The apparent complexity of the evolutionary history of Scolytinae leaves many unanswered questions, even in ecologically and economically important groups. Several of the unique,

160

independently evolved innovations are represented here by only undescribed species with no published notes on their biology and ecology. While we applaud the recent advances in evolutionary inference, we urge researchers to continue studies on the organism’s natural history.

Table 4-1. External data sources Species Data type Repository and accession Reference Tribolium Annotated reference http://metazoa.ensembl.org/ castaneum genome Tribolium_castaneum/Info/In dex Dendroctonus Annotated genome http://metazoa.ensembl.org/ (Keeling et al. ponderosae (CDS only used) Dendroctonus_ponderosae/I 2013) nfo/Index Dendroctonus Unannotated assembly http://metazoa.ensembl.org/ (Keeling et al. ponderosae Dendroctonus_ponderosae/I 2013) nfo/Index Hypothenemus RNA seq unassembled Accession: SRX1150002 (Vega et al. hampei reads 2015b) Ips typographus Assembled transcripts Adult antennae. ERR169822 (Andersson et ERR169829. GACR01 al. 2013) Ips pini EST Accession: CB407466.1- (Eigenheer et CB409136.1 al. 2003) Dendroctonus 454 sequencing of Accession: SRX037651, Kelly, frontalis Dendroctonus frontalis SRX037652, SRX037653, unpublished? EST project SRX037654, SRX037655, Xylosandrus Assemblies Unreleased, in prep. McKenna et al. crassiusculus Euwallacea sp RNA seq unassembled Accession: PRJNA260703 Ranger, PSHB reads SRX698946 released 2015- 09-03 Tomicus RNA seq unassembled Accession: DRX011941 (Zhu et al. yunnanensis reads 2012)

161

Table 4-2. Testing of conflicting phylogenetic hypotheses. Taxonomic hypothesis % Occurrence % Occurrence Constrained tree (references describing/using in Bayesian in Significantly the hypothesis in inference bootstrapped worse? (S-H perentheses) alignments test) (a) Monophyletic tribe Cryphalini sensu Wood 1986 (Wood 1986, Wood 0.0 0.0 Yes (p<0.01) and Bright 1992, Alonso- Zarazaga and Lyal 2009) (b) Monophyletic Hypocryphalus and monophyletic Cryphalus 0.0 0.0 Yes (p<0.01) (Wood 1986, Wood and Bright 1992) (c) Trypophloeus sister to Carphoborus (Gohli et al. 0.0 0.0 Yes (p<0.01) 2017). (d) Xyloterini sister to Cryphalus and Hypocryphalus (Jordal and 9.0 34.0 No Cognato 2012, Hulcr et al. 2015, Gohli et al. 2017). (e) Hypothenemus and Cosmoderes sister to 0.0 0.0 Yes (p<0.01) Corthylini + Cryptocarenus (Gohli et al. 2017). (f) Ernoporus group (Ernoporus, Ernoporicus, Scolytogenes and 0.0 0.0 Yes (p<0.01) Ptilopodius) sister to Micracidini (Gohli et al. 2017). (g) Corthylina paraphyletic with respect to Gnathotrichus 0.0 1.0 Yes (p<0.05) (Gohli et al. 2017).

Table 4-3. Correlation analyses. Correlated traits Pagel’s test 1000 Pairwise comparisons simulations (p) (p) Mating system and fungus farming 0.031 0.0625 Mating system and host breadth 0.000 0.015625 Fungus farming and host breadth 0.033 0.0625

162

163

Figure 4-1. Phylogenetic tree estimated via Bayesian inference using 114 276 bp DNA sequence data from 251 protein coding genes. Numbers above nodes represent bootstrap support in maximum likelihood analyses, numbers below represent posterior probabilities. Full circles represent presence (colored) or absence (white) of evolutionary innovations, apparent haplo-diploidy, fungus farming and generalism. Color scheme follows Gohli et al (2017). Pie charts represent predicted characters, based on the ancestral state reconstruction. Colored boxes represent examples of the evolutionary innovations, Photos courtesy of author unless indicated otherwise). Apparent haplo-diploidy: A) Coccotrypes distinctus (Dryocoetini); B) Premnobius cavipennis (Ipini); C) Hypothenemus eruditus (Crypahlini); D) Sueus niisimai (Hyorrhynchini). Fungus farming: A) Xyloterinus politus (Xyloterini) (Photo courtesy of You Li); B) Corthylus sp. (Corthylini) (Photo courtesy of Jiri Hulcr) C) Cnestus mutilatus (Xyleborini) (Photo courtesy of Craig Bateman); D) Ambrosiodmus rubricollis (Xyleborini) (Photo courtesy of You Li); E) Premnobius cavipennis (Ipini) (Photo courtesy of You Li); F) Sueus niisimai (Hyorrhynchini) (Photo courtesy of You Li). Host generalist; Cryptocarenus heveae (Cryphalini).

164

CHAPTER 5 RESOLVING THE CRYPHALINI: CONCLUSIONS

Enabling Identification

Cryphalini are some of the most challenging of bark and ambrosia beetles

(Curculionidae: Scolytinae) to identify, despite being of great economic importance. By reviewing the species found in North America, this is now much easier. This includes new species and records which are not included in any identification resources, or, if they are, are not in a complete set specific to North America. For example, while most of the Hypothenemus reviewed in Chapter 2 are included in Wood’s monograph (2007), this also includes a vast number of species from Central and South America.

Consequently, the key is 49 species, only 23 of which are in America North of Mexico.

Furthermore, there are mistakes identified in that key, which would lead to the misdiagnosis of several species (Johnson et al. 2016a, Chapter 2).

The review of the species has highlighted issues with current delimitation of species, and has revealed areas which warrant further study to stabilize the identity of bark and ambrosia beetles in North America.

Resolving the Convoluted Taxonomy

The minute size and lack of easy characters, has made Cryphalini particularly difficult though history, especially without the genetic techniques, powerful microscopes and photography easily attainable today. With just two species studied (Chapter 3,

Hypocryphalus dilutus and H. mangiferae), numerous taxonomic changes were needed to resolve their names. The two species, however, are not exceptional in a taxonomic sense. There are still numerous issues unresolved, as well as a chaotic organization of genera (Chapter 4).

165

Determining the Pest of Mango and Fig

Hypocryphalus dilutus was discovered to be a pest of both mango and fig. In fig, it was only recently recognized as a former senior synonym, H. scabricollis. In mango, despite dozens of publications on the beetle, it was widely known as another, widespread and apparently harmless species. This discovery has profound implications for the management of devastating diseases such as mango wilt and the unknown pathogen killing figs, and will likely be the catalyst for further research into the interaction between the beetle and pathogen responsible for mango wilt.

Understanding the Evolution of Cryphalini and Other Scolytinae

Scolytines have a remarkable evolutionary history. Using anchored phylogenomics, we confirm the complex evolution of many traits such as mating systems, fungus farming and extreme polyphagy. The phylogeny, the most robust of bark beetles to date, also revealed the strong discordance between taxonomic groups and phylogenetic groups, especially among Cryphalini.

Outlook to Resolve Cryphalini

Throughout this study, it has been found that the classification and taxonomy of the whole tribe Cryphalini is chaotic and confusing. Species level issues have been identified in Chapter 2 and Chapter 3, and these have only been partly resolved, prioritizing resolving pest species. Chapters 3 and 4 also reveal the chaos at the generic level, with many genera not representing monophyletic groups, and the tribe itself representing several lineages.

Furthermore, the fact that nearly half of the Cryphalini specimens included in the phylogeny of Chapter 4 were not identifiable to species, despite comparing specimens to types at all the major museums, reveals that the diversity may be much higher.

166

However, with already 711 known species, resolving the taxonomy is a formidable task.

The taxonomic complexity described in Chapter 3 is not exceptional. Additionally, merging genera such as Cryphalus, Hypocryphalus and Margadillius will create 13 secondary homonyms. A systematic review of genera is needed to resolve the group, which would involve a thorough review of current names, genetic information, and morphological information from specimens including types.

167

APPENDIX A SUPPLEMENTARY TABLE A

Table A-1. Material examined for Chapter 3.

168

Table A-1. Continued.

169

Table A-1. Continued.

170

APPENDIX B SUPPLEMENTARY FIGURES FOR CHAPTER 3

Figure B-1. Dorsal and lateral photographs of the sole syntype of Hypocryphalus dilutus (Eichhoff, 1878a). Photos courtesy of author.

171

Figure B-2. Dorsal and lateral photographs of the lectotype of Hypocryphalus mangiferae (Stebbing, 1914). Photos courtesy of author.

172

Figure B-3. Lateral and dorsal photographs of specimen 46 (Hypocryphalus dilutus). Photos courtesy of author.

173

Figure B-4. Lateral and dorsal photographs of specimen 49 (Hypocryphalus dilutus). Photos courtesy of author.

174

Figure B-5. Lateral and dorsal photographs of specimen 51 (Hypocryphalus dilutus). Photos courtesy of author.

175

Figure B-6. Lateral and dorsal photographs of specimen 56 (Hypocryphalus mangiferae). Photos courtesy of author.

176

Figure B-7. Lateral and dorsal photographs of specimen 45 (Hypocryphalus mangiferae). Photos courtesy of author.

177

Figure B-8. Lateral and dorsal photographs of specimen 47 (Hypocryphalus sp. “1422”) Photos courtesy of author.

178

APPENDIX C SUPPLEMENTARY TABLE C

Table C-1. Material examined for Chapter 4.

179

Table C-1. Continued.

180

Table C-1. Continued.

181

APPENDIX D SUPPLEMENTARY FIGURE D

Figure D-1. Nodal support of tree topology by individual genes. Blue represents gene trees which support the topology. Green represents topologies in gene trees which are the most common conflicting topology for that node. Red represents all other conflicting topology for the node. Grey represents insufficient information at the node.

182

LIST OF REFERENCES

Abascal, F., R. Zardoya, and M. J. Telford. 2010. TranslatorX: multiple alignment of nucleotide sequences guided by amino acid translations. Nucleic acids research: gkq291.

Aberer, A. J., K. Kobert, and A. Stamatakis. 2014. ExaBayes: Massively Parallel Bayesian Tree Inference for the Whole-Genome Era. Molecular Biology and Evolution 31: 2553-2556.

Abrahão, J., and O. Wegmuller. 1969. Criação do inseto Hypocryphalus mangiferae em culturas puras de Ceratocystis fimbriata. Anais da II reunião anual da Sociedade Brasileira de Fitopatologia.

Al Adawi, A. O., R. M. Al Jabri, M. L. Deadman, I. Barnes, B. Wingfield, and M. J. Wingfield. 2013a. The mango sudden decline pathogen, Ceratocystis manginecans, is vectored by Hypocryphalus mangiferae (Coleoptera: Scolytinae) in Oman. European Journal of Plant Pathology 135: 243-251.

Al Adawi, A. O., I. Barnes, I. A. Khan, A. M. Al Subhi, A. A. Al Jahwari, M. L. Deadman, B. D. Wingfield, and M. J. Wingfield. 2013b. Ceratocystis manginecans associated with a serious wilt disease of two native legume trees in Oman and Pakistan. Australasian Plant Pathology 42: 179-193.

Alonso-Zarazaga, M. A., and C. H. Lyal. 2009. A catalogue of family and genus group names in Scolytinae and Platypodinae with nomenclatural remarks (Coleoptera: Curculionidae). Zootaxa 2258: 112-127.

Andersson, M. N., E. Grosse-Wilde, C. I. Keeling, J. M. Bengtsson, M. M. S. Yuen, M. Li, Y. Hillbur, J. Bohlmann, B. S. Hansson, and F. Schlyter. 2013. Antennal transcriptome analysis of the chemosensory gene families in the tree killing bark beetles, Ips typographus and Dendroctonus ponderosae (Coleoptera: Curculionidae: Scolytinae). BMC Genomics 14: 198.

Atkinson, T. H. 1993. A new species of Trischidias (Coleoptera: Scolytidae) from southern Florida with a key to the species of the southeastern United States. Florida Entomologist: 416-423.

Atkinson, T. H. 2017. Bark and ambrosia beetles (http://www.barkbeetles.info/). Beaver, R. 1998. New synonymy, new combinations and taxonomic notes on Scolytidae and Platypodidae (Insecta: Coleoptera), vol. 100B.

Beaver, R. A. 1979. Host specificity of temperate and tropical animals. Nature 281: 139-141.

183

Beaver, R. A. 1986. The taxonomy, mycangia and biology of Hypothenemus curtipennis (Schedl), the first known cryphaline ambrosia beetle (Coleoptera: Scolytidae). Insect Systematics & Evolution 17: 131-135.

Beaver, R. A., N. Wilding, N. Collins, P. Hammond, and J. Webber. 1989. Insect- fungus relationships in the bark and ambrosia beetles. Insect-fungus interactions: 121-143.

Blackburn, T., and D. Sharp. 1885. Memoirs of the Coleoptera of the Hawaiian Islands. Scientific Transactions of the Royal Dublin Society 2: 119-289, 300+ pl IV-V.

Blandford, W. F. H. 1894. The Rhynchophorous Coleoptera of Japan: Part 3. Scolytidae, Entomological society of London.

Bolger, A. M., M. Lohse, and B. Usadel. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114-2120.

Borsa, P., and F. Kjellbergt. 1996. Experimental evidence for pseudo-arrhenotoky in Hypothenemus hampei (Coleoptera: Scolytidae). Heredity 76: 130-135.

Breinholt, J. W., and A. Y. Kawahara. 2013. Phylotranscriptomics: Saturated Third Codon Positions Radically Influence the Estimation of Trees Based on Next-Gen Data. Genome Biology and Evolution 5: 2082-2092.

Bright, D. E. 2014. A Catalog of Scolytidae and Platypodidae (Coleoptera), Supplement 3 (2000-2010), with notes on subfamily and tribal reclassifications.

Bright, D. E., and R. E. Skidmore. 1997. Catalog of Scolytidae and Platypodidae (Coleoptera), Supplement 1 (1990-1994). NRC Research Press.

Bright, D. E., and R. E. Skidmore. 2002. A Catalog of Scolytidae and Platypodidae (Coleoptera).: Supplement 2 (1995-1999), NRC Research Press.

Cao, Y., Z. Luo, S. Wang, and P. Zhang. 2003. Bionomics and control of Trypophloeus klimeschi. Kunchong zhishi 41: 36-38.

Chikhi, R., and P. Medvedev. 2013. Informed and automated k-mer size selection for genome assembly. Bioinformatics 30: 31-37.

Cognato, A. I. 2006. Standard Percent DNA Sequence Difference for Insects Does Not Predict Species Boundaries. Journal of Economic Entomology 99: 1037-1045.

Cognato, A. I. 2013. Molecular phylogeny and taxonomic review of Premnobiini Browne, 1962 (Coleoptera: Curculionidae: Scolytinae). Frontiers in Ecology and Evolution 1: 1.

184

Cognato, A. I., and J. H. Sun. 2007. DNA based cladograms augment the discovery of a new Ips species from China (Coleoptera: Curculionidae: Scolytinae). Cladistics 23: 539-551.

Cognato, A. I., J. Hulcr, S. A. Dole, and B. H. Jordal. 2011. Phylogeny of haplo– diploid, fungus‐growing ambrosia beetles (Curculionidae: Scolytinae: Xyleborini) inferred from molecular and morphological data. Zoologica Scripta 40: 174-186.

Coopertive Agricultural Pest Survey (CAPS) 2017. Priority Pest List for 2017 Commodity and Taxonomic Surveys.

Cooperband, M. F., R. Stouthamer, D. Carrillo, A. Eskalen, T. Thibault, A. A. Cossé, L. A. Castrillo, J. D. Vandenberg, and P. F. Rugman‐Jones. 2016. Biology of two members of the Euwallacea fornicatus species complex (Coleoptera: Curculionidae: Scolytinae), recently invasive in the USA, reared on an ambrosia beetle artificial diet. Agricultural and Forest Entomology 18: 223- 237.

Deadman, M., A. Al Adawi, R. Al-Yahyai, and M. Wingfield. Year. Published. Ceratocystis wilt of mango in Oman, pp. 28-30. In, Proceedings of the International Symposium on Prospects of Horticultural Industry in Pakistan, 2007.

Deyrup, M. 1987. Trischidias exigua Wood, new to the United States, with notes on the biology of the genus (Coleoptera: Scolytidae). The Coleopterists' Bulletin: 339- 343.

Dole, S. A., B. H. Jordal, and A. I. Cognato. 2010. Polyphyly of Xylosandrus Reitter inferred from nuclear and mitochondrial genes (Coleoptera: Curculionidae: Scolytinae). Molecular Phylogenetics and Evolution 54: 773-782.

Edgar, R. C. 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26: 2460-2461.

Eggers, H. 1928. Ipidae (Coleoptera) da America do Sul. Archivos do Instituto Biologico de Defesa Agricola e Animal 1: 83-99.

Eichhoff, W. J. 1878a. Neue oder noch unbeschriebene Tomicinen. Entomologische Zeitung, Stettin 39: 383-392.

Eichhoff, W. J. 1878b. Ratio, descriptio, emendatio eorum Tomicinorum qui sunt in Dr medic. Chapuisii et autoris ipsius collectionibus et quos praeterea recognovit scriptor. Mémoires de la Société Royale des Sciences de Liège.: 1-532.

Eigenheer, A. L., C. I. Keeling, S. Young, and C. Tittiger. 2003. Comparison of gene representation in midguts from two phytophagous insects, Bombyx mori and Ips pini, using expressed sequence tags. Gene 316: 127-136.

185

Erichson, W. F. 1836. Systematische auseinandersetzung der familie der borkenkäfer (Bostrichidae). Archiv für Naturgeschichte 2: 45-65.

Faccoli, M., G. Campo, G. Perrotta, and D. Rassati. 2016. Two newly introduced tropical bark and ambrosia beetles (Coleoptera: Curculionidae, Scolytinae) damaging figs (Ficus carica) in southern Italy. Zootaxa 4138: 189.

Farrell, B. D., A. S. Sequeira, B. C. O'Meara, B. B. Normark, J. H. Chung, and B. H. Jordal. 2001. The evolution of agriculture in beetles (Curculionidae: Scolytinae and Platypodinae). Evolution 55: 2011-2027.

Francke-Grossmann, H. 1950. Die Gefährdung der Sitkafichte durch Rotfäule (Fomes annosus Fr.) und Riesenbastkafer (Dendroctomus micans Kug.) in Aufforstungsrevieren Achleswigs. 773-780.

Fraser, C. I., O. Brahy, P. Mardulyn, L. Dohet, F. Mayer, and J.-C. Grégoire. 2014. Flying the nest: male dispersal and multiple paternity enables extrafamilial matings for the invasive bark beetle Dendroctonus micans. Heredity 113: 327- 333.

Furniss, M. M. 2004. Biology of Trypophloeus striatulus (Coleoptera: Scolytidae) in feltleaf willow in interior Alaska. Environmental entomology 33: 21-27.

Furniss, M. M. 2013. Northernmost Occurrence of Bark Beetles and Their Hosts in the Nearctic. American Entomologist 59: 144-149.

Galdino, T. V. d. S., S. Kumar, L. S. S. Oliveira, A. C. Alfenas, L. G. Neven, A. M. Al- Sadi, and M. C. Picanço. 2016. Mapping Global Potential Risk of Mango Sudden Decline Disease Caused by Ceratocystis fimbriata. PLOS ONE 11: e0159450.

Galdino, T. V. d. S., D. d. O. Ferreira, P. A. Santana Júnior, L. d. P. Arcanjo, E. A. Queiroz, R. A. Sarmento, and M. C. Picanço. 2017. The Role of the Beetle Hypocryphalus mangiferae (Coleoptera: Curculionidae) in the Spatiotemporal Dynamics of Mango Wilt. Journal of Economic Entomology.

Gao, S. 2006. Incidence, Damage and Control of Cryphalus exignus. North Sericulture 27: 47-48.

Gillett, C. P. D. T., A. Crampton-Platt, M. J. T. N. Timmermans, B. H. Jordal, B. C. Emerson, and A. P. Vogler. 2014. Bulk De Novo Mitogenome Assembly from Pooled Total DNA Elucidates the Phylogeny of Weevils (Coleoptera: Curculionoidea). Molecular Biology and Evolution 31: 2223-2237.

186

Gohli, J., L. R. Kirkendall, S. M. Smith, A. I. Cognato, J. Hulcr, and B. H. Jordal. 2017. Biological factors contributing to bark and ambrosia beetle species diversification. Evolution.

Grégoire, J.-C., F. Piel, M. De Proft, and M. Gilbert. 2001. Spatial distribution of ambrosia-beetle catches: a possibly useful knowledge to improve mass-trapping. Integrated pest management reviews 6: 237-242.

Haack, R. A., and R. J. Rabaglia. 2013. Exotic bark and ambrosia beetles in the USA: potential and current invaders.

Haddad, S., S. Shin, A. R. Lemmon, E. M. Lemmon, P. Svacha, B. Farrell, A. ŚLipiŃSki, D. Windsor, and D. D. McKenna. 2017. Anchored hybrid enrichment provides new insights into the phylogeny and evolution of longhorned beetles (Cerambycidae). Systematic Entomology.

Harrington, T. C. 2005. Ecology and evolution of mycophagous bark beetles and their fungal partners. Insect-fungal associations: ecology and evolution 1: 22.

Herfs, A. 1950. Studien an dem Steinnussborkenkafer Coccotrypes tanganus Eggers, 2 Die Soziologie. Hofchen-Briefe fur Wissenschaft und Praxis 3: 3-31.

Holzman, J. P., A. J. Bohonak, L. R. Kirkendall, D. Gottlieb, A. R. Harari, and S. T. Kelley. 2009. Inbreeding variability and population structure in the invasive haplodiploid palm‐seed borer (Coccotrypes dactyliperda). Journal of evolutionary biology 22: 1076-1087.

Hopkins, A. D. 1915. Classification of the Cryphalinae with descriptions of new genera and species, US Government Printing Office.

Hulcr, J., and A. I. Cognato. 2013. Xyleborini of New Guinea, a Taxonomic Monograph (Coleoptera: Curculionidae: Scolytinae), Entomological Society of America.

Hulcr, J., and L. L. Stelinski. 2017. The Ambrosia Symbiosis: From Evolutionary Ecology to Practical Management. Annual Review of Entomology 62: 285-303.

Hulcr, J., S. A. Dole, R. A. Beaver, and A. I. Cognato. 2007a. Cladistic review of generic taxonomic characters in Xyleborina (Coleoptera: Curculionidae: Scolytinae). Systematic Entomology 32: 568-584.

Hulcr, J., M. Mogia, B. Isua, and V. Novotny. 2007b. Host specificity of ambrosia and bark beetles (Col., Curculionidae: Scolytinae and Platypodinae) in a New Guinea rainforest. Ecological Entomology 32: 762-772.

Hulcr, J., T. H. Atkinson, A. I. Cognato, B. H. Jordal, and D. D. McKenna. 2015. Morphology, Taxonomy, and Phylogenetics of Bark Beetles, pp. 41-84. In F. E.

187

Vega and R. W. Hofstetter (eds.), Bark Beetles: biology and ecology of native and invasive species. Elsevier.

International Commission on Zoological Nomenclature (ICZN) 1986. Opinion 1408. Hypocryphalus mangiferae (Stebbing, 1914) given nomenclatural precedence over Cryphalus inops Eichhoff, 1872 and Hypothenemus griseus Blackburn, 1885 (Insecta: Coleoptera). pp. 245–246, Bulletin of Zoological Nomenclature.

Iqbal, N., and S. Saeed. 2012. Isolation of mango quick decline fungi from mango bark beetle, Hypocryphalus mangiferae S.(Coleoptera: Scolytidae). JAPS, Journal of Animal and Plant Sciences 22: 644-648.

Jankowiak, R., and M. Kolařík. 2010. Fungi associated with the fir bark beetle Cryphalus piceae in Poland. Forest Pathology 40: 133-144.

Johnson, A. J., T. H. Atkinson, and J. Hulcr. 2016a. Two remarkable new species of Hypothenemus Westwood (Curculionidae: Scolytinae) from Southeastern USA. Zootaxa 4200: 417-425.

Johnson, A. J., P. E. Kendra, J. Skelton, and J. Hulcr. 2016b. Species diversity, phenology, and temporal flight patterns of Hypothenemus pygmy borers (Coleoptera: Curculionidae: Scolytinae) in South Florida. Environmental entomology: nvw039.

Jordal, B. H. 2002. Elongation Factor 1 α resolves the monophyly of the haplodiploid ambrosia beetles Xyleborini (Coleoptera: Curculionidae). Insect molecular biology 11: 453-465.

Jordal, B. H., and A. I. Cognato. 2012. Molecular phylogeny of bark and ambrosia beetles reveals multiple origins of fungus farming during periods of global warming. BMC Evolutionary Biology 12: 133.

Kambestad, M., L. R. Kirkendall, I. L. Knutsen, and B. H. Jordal. 2017. Cryptic and pseudo-cryptic diversity in the world’s most common bark beetle— Hypothenemus eruditus. Organisms Diversity & Evolution.

Katoh, K., and D. M. Standley. 2013. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Molecular Biology and Evolution 30: 772-780.

Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, S. Markowitz, C. Duran, T. Thierer, B. Ashton, P. Meintjes, and A. Drummond. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647-1649.

188

Keeling, C. I., M. M. S. Yuen, N. Y. Liao, T. R. Docking, S. K. Chan, G. A. Taylor, D. L. Palmquist, S. D. Jackman, A. Nguyen, and M. Li. 2013. Draft genome of the mountain pine beetle, Dendroctonus ponderosae Hopkins, a major forest pest. Genome biology 14: R27.

Keller, L., K. Peer, C. Bernasconi, M. Taborsky, and D. M. Shuker. 2011. Inbreeding and selection on sex ratio in the bark beetle Xylosandrus germanus. BMC evolutionary biology 11: 359.

Kirkendall, L. R. 1983. The evolution of mating systems in bark and ambrosia beetles (Coleoptera: Scolytidae and Platypodidae). Zoological journal of the Linnean Society 77: 293-352.

Kirkendall, L. R. 1993. Ecology and evolution of biased sex ratios in bark and ambrosia beetles.

Knight, R. J., R. J. Campbell, and I. Maguire. 2009. Important mango cultivars and their descriptors, pp. 42-66. In R. E. Litz (ed.), The mango: botany, production and uses. CABI, Wallingford, UK.

Kolařík, M., and L. R. Kirkendall. 2010. Evidence for a new lineage of primary ambrosia fungi in Geosmithia Pitt (Ascomycota: Hypocreales). Fungal Biology 114: 676-689.

Kozub, D., V. Khmelik, Y. Shapoval, V. Chentsov, S. Yatsenko, B. Litovchenko, and V. Starykh. 2016. Helicon Focus Software V6. (available at http://www.heliconsoft.com).

Maddison, W. P., and R. G. FitzJohn. 2014. The Unsolved Challenge to Phylogenetic Correlation Tests for Categorical Characters. Systematic Biology 64: 127-136.

Maddison, W. P., and D. R. Maddison 2017. Mesquite: a modular system for evolutionary analysis. Version 3.2 computer program, version By Maddison, W. P., and D. R. Maddison.

Marchetti, S. B., J. J. Worrall, and T. Eager. 2011. Secondary insects and diseases contribute to sudden aspen decline in southwestern Colorado, USA. Canadian Journal of Forest Research 41: 2315-2325.

Masood, A., and S. Saeed. 2012. Bark beetle, Hypocryphalus mangiferae Stebbing (Coleoptera: Curculionidae: Scolytinae) is a vector of mango sudden death disease in Pakistan. Pakistan Journal of Botany 44: 813-820.

Masood, A., S. Saeed, and A. Sajjad. 2008. Characterization and damage patterns of different bark beetle species associated with mango sudden death syndrome in Punjab, Pakistan. Pakistan Entomologist 30: 163-168.

189

Masood, A., S. Saeed, A. Sajjad, and M. Ali. 2009. Life cycle and biology of mango bark beetle, Hypocryphalus mangiferae (Stebbing), a possible vector of mango sudden death disease in Pakistan. Pakistan Journal of Zoology 41: 281-288.

Masood, A., S. Saeed, N. Erbilgin, and Y. Jung Kwon. 2010. Role of stressed mango host conditions in attraction of and colonization by the mango bark beetle Hypocryphalus mangiferae Stebbing (Coleoptera: Curculionidae: Scolytinae) and in the symptom development of quick decline of mango trees in Pakistan. Entomological Research 40: 316-327.

Mayers, C. G., D. L. McNew, T. C. Harrington, R. A. Roeper, S. W. Fraedrich, P. H. W. Biedermann, L. A. Castrillo, and S. E. Reed. 2015. Three genera in the Ceratocystidaceae are the respective symbionts of three independent lineages of ambrosia beetles with large, complex mycangia. Fungal Biology 119: 1075-1092.

McKenna, D. D. 2011. Temporal lags and overlap in the diversification of weevils and flowering plants: recent advances and prospects for additional resolution. American Entomologist 57: 54-55.

McKenna, D. D., A. S. Sequeira, A. E. Marvaldi, and B. D. Farrell. 2009. Temporal lags and overlap in the diversification of weevils and flowering plants. Proceedings of the National Academy of Sciences 106: 7083-7088.

McKenna, D. D., A. L. Wild, K. Kanda, C. L. Bellamy, R. G. Beutel, M. S. Caterino, C. W. Farnum, D. C. Hawks, M. A. Ivie, and M. L. Jameson. 2015. The beetle tree of life reveals that Coleoptera survived end‐Permian mass extinction to diversify during the Cretaceous terrestrial revolution. Systematic Entomology 40: 835-880.

Mifsud, D., and M. Knížek. 2009. The bark beetles (Coleoptera: Scolytidae) of the Maltese Islands (Central Mediterranean). Bulletin of the Entomological Society of Malta 2: 25-52.

Mukherjee, S. K. 1972. Origin of mango (Mangifera indica). Economic Botany 26: 260- 264.

Normark, B. B., B. H. Jordal, and B. D. Farrell. 1999. Origin of a haplodiploid beetle lineage. Proceedings of the Royal Society B: Biological Sciences 266: 2253.

Novotny, V., Y. Basset, S. E. Miller, G. D. Weiblen, B. Bremer, L. Cizek, and P. Drozd. 2002. Low host specificity of herbivorous insects in a tropical forest. Nature 416: 841-844.

190

Novotny, V., S. E. Miller, L. Baje, S. Balagawi, Y. Basset, L. Cizek, K. J. Craft, F. Dem, R. A. I. Drew, J. Hulcr, J. Leps, O. T. Lewis, R. Pokon, A. J. A. Stewart, G. Allan Samuelson, and G. D. Weiblen. 2010. Guild-specific patterns of species richness and host specialization in plant-herbivore food webs from a tropical forest. Journal of Animal Ecology 79: 1193-1203.

Olivier-Espejel, S., B. P. Hurley, and J. Garnas. 2016. Assessment of beetle diversity, community composition and potential threats to forestry using kairomone-baited traps. Bulletin of Entomological Research 107: 106-117.

Pagel, M. 1994. Detecting correlated evolution on phylogenies: a general method for the comparative analysis of discrete characters. Proceedings of the Royal Society of London B: Biological Sciences 255: 37-45.

Perkins, R. C. L. 1900. Coleoptera Rhynchophora: Scolytidae. Fauna Hawaiiensis 2: 173-182.

Petty, J. L. 1977. Bionomics of two aspen bark beetles, Trypophloeus populi and Procryphalus mucronatus (Coleoptera: Scolytidae). The Great Basin Naturalist: 105-127.

Photoshop, C. S. 2005. Adobe® Photoshop® CS2. Adobe System Incorpored: USA. Ploetz, R. C., J. Hulcr, M. J. Wingfield, and Z. W. de Beer. 2013. Destructive tree diseases associated with ambrosia and bark beetles: black swan events in tree pathology? Plant Disease 97: 856-872.

Pullen, K. R., D. Jennings, and R. G. Oberprieler. 2014. Annotated catalogue of Australian weevils (Coleoptera: Curculionoidea). Zootaxa 3896: 1.

Rambaut, A., M. A. Suchard, D. Xie, and A. J. Drummond 2015. Tracer v1.6, Available from http://tree.bio.ed.ac.uk/software/tracer/ computer program, version By Rambaut, A., M. A. Suchard, D. Xie, and A. J. Drummond.

Revell, L. J. 2011. phytools: an R package for phylogenetic comparative biology (and other things). Methods in Ecology and Evolution 3: 217-223.

Ribiero, I. 1980. Seca de mangueira. Agentes causais e estudio da molesta. Resúmenes del I Simpósio Brasiliero sobre a cultura de mangueira. Sociedad Brasileira de Fruticultura, Jaboticabal, Brasil.

Rice, P., I. Longden, and A. Bleasby. 2000. EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics 16: 276-277.

Schedl, K. E. 1942. Neue Scolytidae aus Java. 76 Beitrag. Tijdschrift voor Entomologie 85: 1-49.

191

Schedl, K. E. 1943. Fauna Philippinensis, VII. 78 Beitrag. Entomologische Blätter. 39: 34-41.

Schedl, K. E. 1961. Scolytidae und Platypodidae Afrikas. Band 1 (part). Familie Scolytidae. Revista de Entomologia de Moçambique 4: 335-742.

Shin, S., S. Haddad, A. Aitken, B. D. Farrell, E. Moriarty Lemmon, A. Lemmon, A. Marvaldi, R. Oberprieler, and D. D. McKenna. In press. Hybrid enrichment yields new and robust insights into the phylogeny and evolution of weevils (Superfamily Curculionoidea). Molecular Biology & Evolution.

Slater, G. S. C., and E. Birney. 2005. Automated generation of heuristics for biological sequence comparison. BMC bioinformatics 6: 31.

Smith, S. A., M. J. Moore, J. W. Brown, and Y. Yang. 2015. Analysis of phylogenomic datasets reveals conflict, concordance, and gene duplications with examples from animals and plants. BMC evolutionary biology 15: 150.

Spiegel, K. S., and L. M. Leege. 2013. Impacts of laurel wilt disease on redbay (Persea borbonia (L.) Spreng.) population structure and forest communities in the coastal plain of Georgia, USA. Biological Invasions 15: 2467-2487.

Stamatakis, A. 2014. RAxML version 8: a tool for phylogenetic analysis and post- analysis of large phylogenies. Bioinformatics 30: 1312-1313.

Stebbing, E. P. 1914. Indian forest insects of economic importance. Coleoptera., Printed by Eyre & Spottiswoode, ltd., London.

Storer, C., A. Payton, S. McDaniel, B. Jordal, and J. Hulcr. 2017. Cryptic genetic variation in an inbreeding and cosmopolitan pest, Xylosandrus crassiusculus, revealed using ddRADseq. Ecology and Evolution in press.

Stouthamer, R., P. Rugman-Jones, P. Q. Thu, A. Eskalen, T. Thibault, J. Hulcr, L.- J. Wang, B. H. Jordal, C.-Y. Chen, M. Cooperband, C.-S. Lin, N. Kamata, S.- S. Lu, H. Masuya, Z. Mendel, R. Rabaglia, S. Sanguansub, H.-H. Shih, W. Sittichaya, and S. Zong. 2017. Tracing the origin of a cryptic invader: phylogeography of the Euwallacea fornicatus (Coleoptera: Curculionidae: Scolytinae) species complex. Agricultural and Forest Entomology.

Tarigan, M., J. Roux, M. Van Wyk, B. Tjahjono, and M. J. Wingfield. 2011. A new wilt and die-back disease of Acacia mangium associated with Ceratocystis manginecans and C. acaciivora sp. nov. in Indonesia. South African Journal of Botany 77: 292-304.

192

Tsai, P., and C. Li. 1963. Research on the Chinese bark beetles of the genus Cryphalus Er. with descrip tions of new species. Acta Entomologica Sinica 12: 597-624.

Ueda, A. 1997. Brood development of an inbreeding spermatophagous scolytid beetle, Coccotrypes graniceps (Eichhoff)(Coleoptera: Scolytidae). Japanese Journal of Entomology 65: 677-687. Van Wyk, M., B. D. Wingfield, A. O. Al-Adawi, C. J. Rossetto, M. F. Ito, and M. J. Wingfield. 2011. Two new Ceratocystis species associated with mango disease in Brazil. Mycotaxon 117: 381-404.

Van Wyk, M., A. O. Al Adawi, I. A. Khan, M. L. Deadman, A. A. Al Jahwari, B. D. Wingfield, R. Ploetz, and M. J. Wingfield. 2007. Ceratocystis manginecans sp. nov., causal agent of a destructive mango wilt disease in Oman and Pakistan. Fungal Diversity 27: 213-230.

Vega, F. E., F. Infante, and A. J. Johnson. 2015a. The genus Hypothenemus, with emphasis on H. hampei, the coffee berry borer. Bark beetles: Biology and ecology of native and invasive species. Academic Press, San Diego, CA: 427- 494.

Vega, F. E., S. M. Brown, H. Chen, E. Shen, M. B. Nair, J. A. Ceja-Navarro, E. L. Brodie, F. Infante, P. F. Dowd, and A. Pain. 2015b. Draft genome of the most devastating insect pest of coffee worldwide: the coffee berry borer, Hypothenemus hampei. Scientific reports 5: 12525.

Warren, D. L., A. J. Geneva, and R. Lanfear. 2017. RWTY (R We There Yet): An R package for examining convergence of Bayesian phylogenetic analyses. Molecular biology and evolution 34: 1016-1020.

Wood, S. L. 1954. A revision of North American Cryphalini (Scolytidae: Coleoptera). The university of Kansas Science Bulletin 36, Pt 2: 959-1089. Wood, S. L. 1978. A reclassification of the subfamilies and tribes of Scolytidae (Coleoptera). 14.

Wood, S. L. 1982. The bark and ambrosia beetles of North and Central America (Coleoptera: Scolytidae), a taxonomic monograph. Great Basin Naturalist Memoirs 6: 1-1356.

Wood, S. L. 1984. Hypocryphalus mangiferae (Stebbing, 1914),(Insecta, Coleoptera): proposed conservation under the plenary powers. ZN (S.) 2142. Bulletin of zoological nomenclature 41: 189-190.

Wood, S. L. 1986. A reclassification of the genera of Scolytidae (Coleoptera). Great Basin Naturalist Memoirs 10: 2.

193

Wood, S. L. 1989. Nomenclatural changes and new species of Scolytidae (Coleoptera),. Great Basin Naturalist Memoirs, 49: 167-185.

Wood, S. L. 2007. Bark and ambrosia beetles of south America (coleoptera, scolytidae), Monte L. Bean Life Science Museum, Provo, Utah.

Wood, S. L., and D. E. Bright. 1992. A catalog of Scolytidae and Platypodidae (Coleoptera), Part 2: Taxonomic Index. Vols. A and B. Brigham Young University. Great Basin Naturalist Memoirs 13: 1553.

Yang, Y. 2000. Cryphalus tabulaeformis Tsai et Li-A new pest on Pinus tabulaeformis. Forest Pest and Disease 19: 22-23.

Yang, Z., S. Kumar, and M. Nei. 1995. A new method of inference of ancestral nucleotide and amino acid sequences. Genetics 141: 1641-1650.

Zhang, Z. P., Q. Li, L. X. Luo, J. Q. Li, and J. J. Hao. 2017. First Report of Mango Wilt Caused by Ceratocystis fimbriata in Mangifera indica in China. Plant Disease 101: 1042-1042.

Zhu, J.-Y., N. Zhao, and B. Yang. 2012. Global transcriptome profiling of the pine shoot beetle, Tomicus yunnanensis (Coleoptera: Scolytinae). PloS one 7: e32291.

194

BIOGRAPHICAL SKETCH

Andrew Johnson received a bachelor’s degree in zoology in 2010, at the

University of Manchester. He then took the interest further, attaining a master’s in entomology at Imperial College, London. His interests led to pursuit of further research in biology, ecology and conservation. In 2017, he received his PhD in forest resources and conservation at the University of Florida with Dr Jiri Hulcr. He applied his interest in entomology to an enigmatic and important group of bark beetles, Cryphalini. His work at the University of Florida has significantly increased the understanding of the biology of this group. With field work in Florida, French Guiana, Indonesia and Papua New

Guinea, he has developed an appreciation for the multiple applications of his research in evolutionary biology and controlling significant bark beetle pest species.

195