Disease Risk–Associated Genetic Variants in STAT1 and STAT4

Disease Risk−Associated Genetic Variants in STAT1 and STAT4 Function in a Complementary Manner to Increase Pattern-Recognition Receptor−Induced This information is current as Outcomes in Human Macrophages of September 25, 2021. Matija Hedl, Rui Sun and Clara Abraham J Immunol published online 13 July 2020 http://www.jimmunol.org/content/early/2020/07/11/jimmun ol.1901112 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2020/07/10/jimmunol.190111

Material 2.DCSupplemental http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

by guest on September 25, 2021 • Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2020 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published July 13, 2020, doi:10.4049/jimmunol.1901112 The Journal of Immunology

Disease Risk–Associated Genetic Variants in STAT1 and STAT4 Function in a Complementary Manner to Increase Pattern-Recognition Receptor–Induced Outcomes in Human Macrophages

Matija Hedl, Rui Sun, and Clara Abraham

STAT proteins can regulate both pro- and anti-inflammatory cytokine signaling. Therefore, identifying consequences of modu- lating expression of a given STAT is ultimately critical for determining its potential as a therapeutic target and for defining the mechanisms through which immune-mediated disease variants in STAT genes contribute to disease pathogenesis. Genetic variants in the STAT1/STAT4 region are associated with multiple immune-mediated diseases, including inflammatory bowel disease (IBD). These diseases are characterized by dysregulated cytokine secretion in response to pattern-recognition receptor (PRR) stimula- Downloaded from tion. We found that the common IBD-associated rs1517352 C risk allele increased both STAT1 and STAT4 expression in human monocyte-derived macrophages (MDMs). We therefore hypothesized that the STAT1/STAT4 variant might regulate PRR-initiated responses in a complementary and cooperative manner because of the important role of autocrine/paracrine cytokines in mod- ulating PRR-initiated signaling. STAT1 and STAT4 were required for PRR- and live bacterial-induced secretion of multiple cytokines. These outcomes were particularly dependent on PRR-initiated autocrine/paracrine IL-12–induced STAT4 activation http://www.jimmunol.org/ to generate IFN-g, with autocrine IFN-g then signaling through STAT1. STAT1 and STAT4 also promoted bacterial-induced cytokines in intestinal myeloid cells and PRR-enhanced antimicrobial pathways in MDMs. Importantly, MDMs from rs1517352 C IBD risk allele carriers demonstrated increased TLR4-, IFN-g– and IL-12–induced STAT1 and STAT4 phosphorylation and cytokine secretion and increased TLR4-enhanced antimicrobial pathways. Taken together, STAT1 and STAT4 expression is coregulated by a shared genetic region, and STAT1/STAT4-immune disease–associated variants modulate IFN-g– and IL-12– associated outcomes, and in turn, PRR-induced outcomes, highlighting that these genes cooperate to regulate pathways relevant to disease pathogenesis. The Journal of Immunology, 2020, 205: 000–000.

roper responses to microbial products detected by pattern- proinflammatory and anti-inflammatory cytokines. As such, it is by guest on September 25, 2021 recognition receptors (PRRs) on myeloid cells are critical critical to clearly define the distinct contributions of each of these P for immune homeostasis at mucosal surfaces such as the family members to this cytokine balance. Furthermore, mouse and intestine. A key PRR-induced response is cytokine secretion, and human cells can show significant differences in inflammatory this cytokine secretion can, in turn, dramatically amplify the initial pathways (2), such it is important to understand how these STAT response to microbial products (1). Consistently, one of the hall- proteins regulate outcomes in human myeloid-derived cells. Ge- marks of immune-mediated diseases, including inflammatory netic variants in these genes can help elucidate consequences of bowel disease (IBD), is dysregulated responses to and/or pro- this regulation. duction of cytokines (1). STAT proteins are critical for mediating Common genetic variants in the STAT1/STAT4 region confer responses to cytokines, such that the JAK-STAT pathway is being altered susceptibility to IBD (3) and systemic lupus erythematosus actively investigated as a therapeutic target in immune-mediated (SLE) (4). STAT1 and STAT4 can complement each other as diseases. However, an important challenge in targeting these regulators of cytokine-induced outcomes. STAT1 mediates type I pathways is that these proteins can mediate responses to both IFN– and IFN-g–initiated signaling, and STAT4 can mediate signaling by type I IFNs and IL-12 and is required for IL-12– induced IFN-g (5). STAT1 has been reported to promote TLR- Department of Internal Medicine, Yale University, New Haven, CT 06520 induced outcomes in mouse macrophages (6); the role of STAT4 ORCID: 0000-0003-4054-1365 (R.S.). in PRR-initiated responses in human macrophages has not been Received for publication September 12, 2019. Accepted for publication June 8, 2020. clearly defined. Genetic associations in each STAT1 and STAT4 This work was supported by National Institutes of Health Grants R01DK099097 and have focused predominantly on rare coding mutations. As such, R01DK106593 and an ASPIRE Inflammatory Bowel Disease Pfizer Research Award. two rare coding variants resulting in defective STAT1 function Address correspondence and reprint requests to Dr. Clara Abraham, Department of result in decreased IFN-a– and IFN-g–initiated responses; infant Internal Medicine, Section of Digestive Diseases, 333 Cedar Street (LMP 1080), New carriers of these mutations can develop severe mycobacterial and Haven, CT 06520. E-mail address: [email protected] viral infections (7). In contrast, rare coding gain-of-function STAT1 The online version of this article contains supplemental material. mutations associated with STAT1 hyperactivation in T cells lead to Abbreviations used in this article: AIEC, adherent-invasive Escherichia coli; IBD, inflammatory bowel disease; MDM, monocyte-derived macrophage; MOI, multiplic- excessive IFN-g signaling, resulting in impaired Th17 immunity ity of infection; poly(I:C), polyinosinic-polycytidylic acid; PRR, pattern-recognition and chronic mucocutaneous candidiasis (8). Consistent with its role receptor; RNS, reactive nitrogen species; ROS, reactive oxygen species; siRNA, in type I IFN and IL-12 signaling, a STAT4 gain-of-function intronic small interfering RNA; SLE, systemic lupus erythematosus. polymorphism associated with SLE results in increased IFN-a re- Copyright Ó 2020 by The American Association of Immunologists, Inc. 0022-1767/20/$37.50 sponses in human PBMCs (9). To our knowledge, how common

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1901112 2 STAT1 AND STAT4 POLYMORPHISMS MODULATE PRR-INDUCED OUTCOMES

IBD-associated genetic variants in the STAT1/STAT4 region reg- Intestinal lamina propria cell isolation ulate myeloid cell outcomes has not been defined. Intestinal lamina propria cells were isolated from colonic resection The common rs1517352 polymorphism located in an intronic specimens from uninvolved intestine in non-IBD patients undergoing region of STAT4 and upstream of STAT1 is associated with IBD (3) surgery for diverticular disease or colon cancer as in Ref. 11. Briefly, and SLE (4). The C risk allele has a frequency ranging from 0.33 intestinal resections were washed and then digested (RPMI containing to 0.40 in European ancestry individuals per the Single Nucleotide 0.2 mM EDTA, 2-ME) in a 37˚C shaker to remove epithelial cells. Epithelial cells and intraepithelial lymphocytes were discarded, and Polymorphism Database. How this common polymorphism con- intestines were washed, cut into 1-mm2 pieces, and incubated in a tributes to risk is incompletely defined. One study found that the C buffer consisting of RPMI, 75 mg/ml collagenase type VIII, DNase risk allele is part of a haplotype associated with increased STAT4 (MilliporeSigma), and HEPES for 45 min in a 37˚C shaker. The cells expression in human osteoblasts and lymphoblasts and increased were filtered through a 40-mm filter, selected on a Ficoll gradient, washed, and then used in studies. anti-dsDNA in SLE patients (10). How this polymorphism regulates STAT4 protein expression, STAT4 activation, or Transfection of small interfering RNA STAT4-dependent cytokine secretion, including to PRR stim- One hundred nanomolar scrambled or ON-TARGETplus or siGENOME ulation, is not clear. Furthermore, STAT1 is located ∼50 kb SMARTpool small interfering RNA (siRNA) against STAT1, STAT4, from this polymorphism, and it is unclear if rs1517352 mod- STAT3, JAK1, TYK2, IL12RB2, IFNGR1, IFNAR, IL10RA, ERK, p38, ulates STAT1 expression or STAT1-dependent outcomes. The JNK, or NEMO (Dharmacon, Lafayette, CO) (four pooled siRNAs for each coregulation of these two STAT proteins from a common ge- gene) was transfected into myeloid cells using Amaxa nucleofector technology (Lonza). netic variant would have implications for how these STAT proteins might cooperate with each other in immune responses. Downloaded from We therefore asked how STAT1 and STAT4 regulate PRR- initiated outcomes in human monocyte-derived macrophages (MDMs), given the importance of macrophages in immune- mediated diseases, and how the common immune-mediated disease–associated STAT1/STAT4 region polymorphism mod-

ulates these outcomes. http://www.jimmunol.org/ In this study, using primary human MDMs, we found that STAT1 and STAT4 were required for optimal signaling and cytokine secretion following stimulation of a broad range of PRRs and with live bacteria. Mechanisms contributing to STAT1- and STAT4- dependent PRR-initiated cytokine regulation included cooperative autocrine IFNGR and IL-12R signaling, respectively. STAT1 and STAT4 also promoted cytokine secretion by intestinal myeloid cells following Salmonella Typhimurium coculture and induction of antimicrobial pathways following PRR stimulation of by guest on September 25, 2021 myeloid cells. MDMs from disease-associated rs1517352 C risk allele carriers in the STAT1/STAT4 region demonstrated higher expression levels of both STAT1 and STAT4, as well as increased PRR-, IFN-g–, and IL-12–induced STAT1 and STAT4 activation and downstream outcomes. Taken together, we identify that STAT1 and STAT4 regulate PRR-induced outcomes, identify mechanisms leading to these outcomes, and determine consequences for STAT1/STAT4 region immune disease–associated variants in PRR-and cytokine-induced outcomes, highlighting the importance of these pathways in immune homeostasis.

Materials and Methods Myeloid cell isolation Human cell studies were conducted as approved by the institutional re- view board at Yale University. Cells were genotyped for the rs1517352 variant by TaqMan (Life Technologies, Grand Island, NY). Monocytes were puriﬁed from human PBMCs by adhesion and cultured with M-CSF (10 ng/ml) (Shenandoah Technology, Warwick, PA) for 7 d for MDM differentiation. Myeloid cell stimulation Human MDMs were treated with lipid A (Peptides International, Louisville, KY), Pam3Cys (EMD Millipore, Billerica, MA), polyinosinic-polycytidylic acid [poly(I:C)], CpG DNA (Invivogen, San Diego, CA), IL-12, IFN-g FIGURE 1. MDMs from rs1517352 CC disease risk carriers secrete (R&D Systems, Minneapolis, MN), IFN-a (Biovision, Milpitas, CA), or increased levels of PRR-induced cytokines relative to AA carrier MDMs. Salmonella enterica cocultured with serovar Typhimurium at multiplicity Human MDMs from rs1517352 CC, CA, and AA carriers (n = 10 per of infection (MOI) 10:1. Supernatants were assayed for IL-6, IL-10, TNF, A IL-1b, IFN-g (BD Biosciences), IL-12 (eBioscience, San Diego, CA), or genotype) were treated for 24 h with the indicated doses of ( ) lipid B IFN-a (BioLegend) by ELISA. In some cases, cells were pretreated with A (TLR4 ligand), or ( ) Pam3Cys (TLR2), poly(I:C) (TLR3), or CpG 5 mg/ml ﬂudarabine (STAT1 inhibitor), 150 mM lisofylline (STAT4 in- DNA (TLR9). Cytokine secretion + SEM. One-way ANOVA with 2 hibitor) (Cayman Chemical Company), Upadacitinib (JAK1 inhibitor), or Tukey posttest. *p , 0.05, **p , 0.01, ***p , 0.001, †p , 1 3 10 4, BMS-986165 (TYK2 inhibitor) (MedChemExpress). ††p , 1 3 1025. The Journal of Immunology 3

Phosphoprotein and total protein detection Cells were washed, lysed with 1% Triton X-100, and plated on Mac- Conkey or Luria-Bertani agar. Cell surface or intracellular proteins (permeabilized cells) were detected by flow cytometry with fluorophore-labeled Abs to phospho-ERK, phospho- Statistical analysis p38, phospho-JNK, phospho-IkBa, phospho-STAT1, phospho-STAT4, phospho-JAK1, phospho-JAK2, phospho-TYK2 (Cell Signaling Technol- Significance was assessed using two-tailed Student t test. A one-way ogy, Danvers, MA), STAT1, STAT4, IL-10RA, LC3b, and NOS2 (Santa ANOVA with Tukey posttest or t test with Bonferroni–Holm correction Cruz Biotechnology, Santa Cruz, CA). was applied as appropriate for multiple comparisons. To keep cytokines on same axis, a multiplier was applied for the lower cytokine levels of IFN-a mRNA expression analysis and IFN-g as shown in figure keys. A p value ,0.05 was considered significant. Lines over adjacent bars indicate identical p values for these Following stimulation, total RNA was isolated, reverse transcribed, and bars. quantitative PCR performed as in Ref. 12 on the ABI Prism 7000 (Applied Biosystems). Each sample was run in duplicates and normalized to GAPDH. Primers sequences as per Supplemental Table I. Results MDMs from rs1517352 C risk carriers in the STAT1/STAT4 Intracellular reactive oxygen species measurement region demonstrate increased PRR-induced cytokine secretion Intracellular reactive oxygen species (ROS) production was measured by flow and increased STAT1 and STAT4 expression and activation cytometry using 10 mM cell-permeant 2’,7’-dichlorodihydrofluorescein PRRs on myeloid-derived cells are critical for recognition and diacetate (H2DCFDA) (Invitrogen). responses to microbes by the host, and these responses are es- Bacterial entry sential for intestinal immune homeostasis (1); PRR-induced sig-

naling and cytokine secretion are dramatically regulated by autocrine/ Downloaded from Macrophages were cocultured with 2.5 3 107/ml E. coli-FTIC bioparticles (Molecular Probes) or 5 3 107 CFU/ml live bacteria S. Typhimurium–GFP paracrine cytokines. We therefore assessed if the rs1517352 (kindly provided by Jorge E. Galan) for 20 min. Cell surface fluorescence polymorphism in the STAT1/STAT4 region associated with IBD (3) was quenched with 0.25 mg/ml trypan blue for 1 min, and after 4% regulates PRR-induced cytokine secretion in MDMs. We exam- paraformaldehyde fixation cells were analyzed by flow cytometry. ined the PRR TLR4 using the ligand lipid A and measured IL-12 Intracellular bacterial clearance secretion. MDMs from disease-associated rs1517352 CC carriers

secreted higher levels of IL-12 upon lipid A treatment (Fig. 1A). http://www.jimmunol.org/ HumanMDMswereinfectedwithadherent-invasiveEscherichia coli (AIEC) (strain LF82; a generous gift from Dr. E. Mizoguchi) or Salmonella enterica We observed similar results when examining IFN-g secretion serovar Typhimurium at 10:1 MOI for 20 min, washed with PBS, and (Supplemental Fig. 1A). We also examined the anti-inﬂammatory incubated in HBSS medium with 20 mg/ml gentamicin for a total of 2 h. cytokine IL-10 and found it underwent similar regulation (Fig. 1A), by guest on September 25, 2021

FIGURE 2. MDMs from rs1517352 C disease risk carriers express higher levels of STAT1 and STAT4 and show increased TLR4-induced STAT1 and STAT4 activation relative to A carriers. (A–D) Human MDMs from rs1517352 CC, CA, and AA carriers were assessed for the following: (A) STAT1 and (B) STAT4 mRNA expression (n = 10 per genotype) or (C)STAT1 and (D) STAT4 protein expression with (left) representative flow cytometry and mean fluorescence intensity (MFI) values shown and (right) summarized data (n = 8 per genotype). (E and F) MDMs from rs1517352 CC, CA, and AA carriers (n = 10 per genotype) were treated for 30 min with 0.1 mg/ml lipid A. Fold (E) STAT1 and (F) STAT4 phosphorylation was assessed with representative flow cytometry and summarized data. Mean + SEM. One-way ANOVA with Tukey posttest. *p , 0.05, **p , 0.01, ***p , 0.001, †p , 1 3 1024, ††p , 1 3 1025. 4 STAT1 AND STAT4 POLYMORPHISMS MODULATE PRR-INDUCED OUTCOMES indicating that the rs1517352 polymorphism similarly regulates and increased PRR-induced STAT1 and STAT4 activation and pro- and anti-inflammatory cytokines. We observed similar genotype- cytokine secretion relative to A carriers. dependent cytokine regulation at more than one dose of lipid A treatment (Fig. 1A, Supplemental Fig.1A).Giventhebroadrangeof STAT1 and STAT4 are required for optimal PRR-induced PRRs to which cells are exposed to in intestinal tissues, we also cytokine secretion from MDMs examined TLR2-, TLR3- and TLR9-induced cytokine secretion and Given the rs1517352 genotype–dependent modulation of STAT1 found a similar rs1517352 genotype–dependent regulation (Fig. 1B, and STAT4 expression (Fig. 2) and of PRR-induced cytokines Supplemental Fig. 1B). (Fig. 1), we directly assessed if STAT1 and STAT4 regulate PRR- The rs1517352 polymorphism is located in an intronic region of induced cytokine secretion in human MDMs. Upon effective STAT4, and a previous study found rs1517352 to be part of a knockdown of STAT1 and STAT4 (Supplemental Fig. 2A) and haplotype that regulates STAT4 mRNA expression (10). However, ensuring cell viability was intact under these knockdown condi- given that the STAT1 gene is in close proximity to STAT4, and that tions (Supplemental Fig. 2B), we examined cytokine secretion both these proteins can regulate cytokine signaling (5), we asked if following TLR4 stimulation. As we surmised that the ability of this polymorphism modulates PRR-induced cytokines through STAT1 and STAT4 to regulate PRR-induced outcomes would regulating the expression of these two genes as well as possibly be through autocrine/paracrine cytokine loops, we examined other genes in the region. The coregulation of STAT1 and STAT4 select cytokines that signal in response to or are regulated by might allow for these genes to cooperate through complementary STAT1 and STAT4, including IL-6, IL-12, IFN-g, and IFN-a (5). functions. We first assessed if either STAT1 or STAT4 expression As pro- and anti-inflammatory cytokines can be differentially was regulated upon TLR4 stimulation. Neither STAT1 nor STAT4 regulated, we also examined the anti-inflammatory cytokine IL- Downloaded from mRNA (Supplemental Fig. 1C) nor protein (Supplemental Fig. 10. Both STAT1 and STAT4 knockdown led to a reduction in 1D) expression was altered upon TLR4 stimulation. Consistent TLR4-induced secretion of these cytokines (Fig. 3A). Relative to with the prior report (10), MDMs from CC carriers showed in- individual knockdown of these STAT proteins, combined STAT1 creased STAT4 mRNA expression compared with A carriers (Fig. and STAT4 knockdown showed a stronger decrease in the cyto- 2B). Importantly, CC carrier MDMs also showed increased STAT1 kines examined (Fig. 3A). In contrast, knockdown of multiple

mRNA expression compared with A carriers (Fig. 2A). Expression other genes in the STAT1/STAT4 region (Supplemental Fig. 2C) http://www.jimmunol.org/ of additional detected genes located ∼500 kb on each side of did not affect TLR4-induced cytokine secretion (Supplemental the polymorphism was not regulated by rs1517352 genotype Fig. 2D). To establish the contribution of STAT1 and STAT4 to (Supplemental Fig. 1E, 1F). We confirmed rs1517352 genotype– TLR4-induced cytokines through an independent approach, we dependent regulation of STAT1 (Fig. 2C) and STAT4 (Fig. 2D) used a STAT1 inhibitor (fludarabine) (13) and a STAT4 inhibitor protein expression. Consistent with upregulated protein expression (lisofylline) (14–16), alone and in combination. Regulation was and PRR-induced cytokines, rs1517352 C carrier MDMs dem- similar to that observed with the knockdown approach (Fig. 3B). onstrated increased TLR4-induced STAT1 (Fig. 2E) and STAT4 We verified specificity of each inhibitor relative to other STAT (Fig. 2F) activation relative to A carriers. Taken together, MDMs family members (Supplemental Fig. 2E). Cell viability was intact from immune-mediated disease–associated rs1517352 C carriers with inhibitor usage (Supplemental Fig. 2F). The regulation of cy- by guest on September 25, 2021 show increased STAT1 and STAT4 mRNA and protein expression tokine secretion by STAT1 and STAT4 was also observed upon

FIGURE 3. STAT1 and STAT4 are required for optimal secretion of cytokines in MDMs upon stimulation through a broad range of PRRs. (A, C, and D) Human MDMs were transfected with scrambled siRNA or with STAT1 or STAT4 siRNA, alone or in combination, and then treated for 24 h with the following: (A) 0.1 mg/ml lipid A (TLR4) (n = 6, similar results seen in an independent n = 8), (C)10mg/ml Pam3Cys (TLR2), 100 mg/ml poly(I:C) (TLR3), or 10 mg/ml CpG DNA (TLR9) (n = 6, similar results seen in an independent n = 8), or (D) S. Typhimurium (n = 6). (B) MDMs were pretreated for 1 h with a STAT1 inhibitor (fludarabine) or a STAT4 inhibitor (lisofylline), alone or in combination, or with vehicle (DMSO) and then with 0.1 mg/ ml lipid A for 24 h (n = 4). (A–D) Mean cytokine secretion + SEM. Significance is shown compared with stimulated, scrambled siRNA–transfected cells or stimulated, vehicle control-treated cells. t test with Bonferroni–Holm correction. **p , 0.01, ***p , 0.001, †p , 1 3 1024, ††p , 1 3 1025. scr, scrambled; Tx, treatment. The Journal of Immunology 5 stimulation of additional PRRs, including TLR2, TLR3, and TLR9 (Fig. 3C). Moreover, with knockdown of STAT1 and STAT4, secretion of both pro- and anti-inflammatory cytokines was reduced upon coculture of MDMswiththelivebacteria S. Typhimurium (Fig. 3D). Taken together, these data demonstrate that STAT1 and STAT4 are required for secretion of cytokines upon stimulation of a broad range of PRRs and with live bacteria. Autocrine IFN-g and IL-12 are required for optimal PRR-induced cytokine secretion from MDMs Given the regulation of PRR-induced cytokines by STAT1 and STAT4, we hypothesized that the autocrine/paracrine IFN-g, IFN-a, and IL-12 produced during PRR stimulation (Fig. 3), and which signal through STAT1 and STAT4 (5), respectively, would cooperate as mechanisms amplifying secretion of additional cytokines through these STAT family members upon PRR stimulation. We therefore knocked down receptors required for IFN-g,

IFN-a, and IL-12 signaling (Supplemental Fig. 3A), ensured cell Downloaded from survival was intact (Supplemental Fig. 3B), and measured cytokine secretion. A decrease in the expression of either IFN-gR1 or IL-12Rb2 dramatically reduced TLR4-induced cytokine secretion, whereas knockdown of IFNAR did not affect this cytokine secretion (Fig. 4). We ensured functional efﬁcacy of the

IFNAR knockdown as it prevented IFN-a–induced cytokines http://www.jimmunol.org/ (Supplemental Fig. 3C). These data suggest that although IFN-a induces cytokines from human MDMs and is produced upon TLR4 stimulation, autocrine IFN-a is not necessary for TLR4- induced cytokines. We also examined if various other cytokines reported to signal through either STAT1 or STAT4 might be contributing in an autocrine/paracrine manner to TLR4-induced cytokines by knocking down either the cytokines or their respective receptors (Supplemental Fig. 3D). These autocrine/ paracrine cytokines either did not contribute (Supplemental Fig. by guest on September 25, 2021 3E, left) or did not contribute to the same degree (Supplemental Fig. 3E, right) as did IFN-g and IL-12 to TLR4-induced cytokines. Taken together, both IFN-g and IL-12 feedback in an autocrine/ paracrine manner to promote PRR-induced cytokines. We will, therefore, focus on IFN-g and IL-12 autocrine/paracrine signaling in the studies that follow. IFN-g and IL-12 signal through STAT1 and STAT4, respectively, and this activation is required for secretion of FIGURE 4. Autocrine/paracrine IL-12 and IFN-g secretion promotes additional cytokines in human MDMs TLR4-induced cytokine secretion. Human MDMs (n = 6, similar results in an additional six donors) were transfected with scrambled, IFNGR1, Given the important role for autocrine IFN-g and IL-12 in TLR4- IFNAR, or IL-12Rb2 siRNA and then treated with 0.1 mg/ml lipid A for induced cytokines (Fig 4), we sought to more clearly define if 24 h. Mean cytokine secretion + SEM. Significance is shown compared these cytokines functioned in an autocrine/paracrine manner to with scrambled siRNA–transfected, lipid A–treated cells. ***p , 0.001, regulate TLR4-induced STAT1 and STAT4 activation. We there- †p , 1 3 1024. scr, scrambled; Tx, treatment. fore first assessed the relative activation of these STAT family members by IFN-g and IL-12 treatment in human MDMs. IFN-g preferentially activated STAT1, and IL-12 preferentially activated dependency was observed with type I IFNs, we examined IFN-a– STAT4 (Fig. 5A). Consistent with this, upon knockdown of induced cytokines and found a similar dependency on STAT1, but IFNGR1 in MDMs to prevent autocrine/paracrine IFN-g signal- not STAT4 (Fig. 5C). In contrast, both STAT4 and STAT1 ing, lipid A–induced STAT1 activation was significantly reduced, knockdown decreased IL-12–induced cytokine secretion, although whereas lipid A–induced STAT4 activation was less affected the reduction was generally greater with STAT4 knockdown (Fig. 5B). With IL-12Rb2 knockdown to prevent IL-12 autocrine/ (Fig. 5C). These data suggest that the STAT4-dependent IL-12– paracrine signaling, lipid A–induced STAT4 activation was re- induced IFN-g then acts in an autocrine/paracrine manner duced to a greater degree than was STAT1 activation (Fig. 5B). to signal through STAT1, such that both STAT1 and STAT4 co- Given the preferential STAT1 and STAT4 activation by IFN-g and operate in a complementary manner to mediate IL-12–induced IL-12, respectively, we next sought to determine how each of these cytokine secretion in MDMs. Finally, given that with PRR stim- STAT members, in turn, regulated IFN-g– and IL-12–induced ulation, early STAT1 and STAT4 signaling depended on autocrine cytokine secretion. Optimal IFN-g–induced cytokine secretion IFN-g and IL-12, respectively, we assessed if IFN-g and IL-12 required STAT1 in MDMs, whereas STAT4 was minimally re- were secreted early after lipid A treatment. As autocrine/paracrine quired (Fig. 5C). To determine if a similar selective STAT1 cytokines are consumed, which can make the low levels of 6 STAT1 AND STAT4 POLYMORPHISMS MODULATE PRR-INDUCED OUTCOMES Downloaded from

FIGURE 5. IFN-g and IL-12 activate STAT1 and STAT4, respectively, and this activation contributes to subsequent cytokine secretion. (A) Human MDMs (n = 6; similar results in an additional six donors) were treated with 10 ng/ml IFN-g or 10 ng/ml IL-12 for 60 min. Fold STAT1 and STAT4 phosphorylation. 0.1 mg/ml lipid A is shown as a control. (B)MDMs(n = 4) were transfected with scrambled, IFNGR1, or IL-12Rb2 siRNA, and then treated with 0.1 mg/ml lipid A for 30 min. Fold STAT1 and STAT4 phosphorylation. (C) MDMs were transfected with scrambled, STAT1, or STAT4 siRNA. Cells were then treated with 10 ng/ml IFN-g,IFN-a, or IL-12 for 24 h. Cytokine secretion (n = 8; similar results in an additional eight donors). 2 Mean + SEM. Significance with t test in (A) and with Bonferroni–Holm correction in (B)and(C). *p , 0.05, **p , 0.01, ***p , 0.001, †p , 1 3 10 4, http://www.jimmunol.org/ ††p , 1 3 1025. scr, scrambled; Tx, treatment. cytokines present at early time points difficult to detect, we used intestinal tissues (18). We therefore next assessed if STAT1 and neutralizing Abs to the respective receptors to minimize this STAT4 regulate cytokine secretion by human intestinal myeloid consumption. Low levels of both IFN-g and IL-12 were observed cells upon microbial exposure. Intestinal myeloid-derived cells in the supernatant 15 min after lipid A treatment (Supplemental secrete very low levels of cytokines upon microbial ligand expo- Fig. 3F). Consistent with this early protein secretion, blocking sure compared with peripheral myeloid cells (19, 20), but live S. transcription with actinomycin did not affect the early, low levels Typhimurium coculture induces cytokines in intestinal myeloid- by guest on September 25, 2021 of these cytokines in supernatants (Supplemental Fig. 3F); the derived cells (21, 22). We used the STAT1 and STAT4 inhibitors actinomycin was effective as accumulation of cytokines at 24 h described in Fig. 3B and Supplemental Fig. 2E, 2F. Intestinal was impaired (data not shown). Taken together, autocrine IFN-g myeloid cells cocultured with S. Typhimurium secreted reduced and IL-12 signaling promote TLR4-induced STAT1 and STAT4 levels of IL-1b and IL-8 following both STAT1 and STAT4 inhibition activation, respectively, and this activation in turn is required for (Fig. 7). Reduction was more pronounced with combined inhibition optimal secretion of additional TLR4-induced cytokines. of these pathways (Fig. 7). We confirmed that S. Typhimurium– induced IL-1b and IL-8 secretion was reduced in peripheral MDMs IFN-g and IL-12 treatment results in a low level of MAPK and upon STAT1 and STAT4 inhibition (Fig. 7). Taken together, NF-kB signaling in MDMs STAT1 and STAT4 are required for cytokine secretion in human in- Autocrine/paracrine IFN-g and IL-12 were required for optimal testinal myeloid cells following coculture with live S. Typhimurium. levels of TLR4-induced cytokine secretion (Fig. 4), but STAT1 or STAT4 knockdown only partially reduced secretion of additional The rs1517352 variant in the STAT1/STAT4 region modulates cytokines upon IFN-g and IL-12 treatment (Fig. 5) or upon PRR IFN-g– and IL-12–induced signaling and cytokines stimulation (Fig. 3). We therefore hypothesized that IFN-g and Given the increased TLR4-induced STAT1 and STAT4 activation in IL-12 signal through other pathways in addition to STAT1 and rs1517352 CC risk carrier MDMs (Fig. 2E, 2F), and the role of STAT4, which then contribute to PRR-induced cytokine secretion. autocrine/paracrine IFN-g and IL-12 in TLR4-induced cytokines Given the important role of MAPK and NF-kB pathways in PRR- (Fig. 4), we assessed if MDMs from rs1517352 CC risk carriers induced cytokines (17), we examined these pathways. Both IFN-g also show increased IFN-g–induced STAT1 activation and IL-12– and IL-12 induced ERK, p38, JNK, and IkBa activation in MDMs induced STAT4 activation relative to AA carriers. We found this to (Fig. 6A). Consistently, knockdown of each of these signaling be the case (Fig. 8A). Consistently, rs1517352 CC risk carrier pathways (Supplemental Fig. 3G) resulted in a partial decrease MDMs demonstrated increased IFN-g– and IL-12–induced cyto- IFN-g– and IL-12–induced cytokine secretion (Fig. 6B). Cell via- kines relative to AA carriers (Fig. 8B). MDMs from heterozygote bility was intact under these knockdown conditions (Supplemental carriers generally showed intermediate results (Fig. 8). Therefore, Fig. 3H). Taken together, in addition to STAT1 and STAT4, MAPK MDMs from immune-mediated disease–associated rs1517352 CC and NF-kB pathways are also required for optimal IFN-g2 and risk carriers show increased IFN-g– and IL-12–induced STAT1 and IL-12–induced cytokine secretion. STAT4 activation and cytokine secretion relative to AA carriers. STAT1 and STAT4 are required for S. Typhimurium–induced STAT1 and STAT4 regulate TLR4-induced cytokines in a cytokines in human intestinal myeloid cells manner distinct to JAK members or STAT3 The rs1517352 variant in the STAT1/STAT4 region is associated STATs can mediate signaling to both proinflammatory and anti- with IBD (3), a disease characterized by dysregulated cytokines in inflammatory cytokines. STAT3 is a key protein for IL-10 signaling, The Journal of Immunology 7 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 6. IL-12 and IFN-g activate MAPK and NF-kB pathways. (A) MDMs (n = 6, similar results in an additional six donors) were treated with 10 ng/ml IFN-g or 10 ng/ml IL-12 for 30 min. (Left) Representative flow cytometry of phosphoproteins with mean fluorescence intensity (MFI) values shown. (Right) Summary of fold phosphorylation of MAPKs and IkBa.(B) MDMs (n = 6, similar results in an additional eight donors) were transfected with scrambled or the indicated siRNA. Cells were treated with 10 ng/ml IFN-g or 10 ng/ml IL-12 for 24 h. Cytokine secretion. Mean + SEM. Significance is shown compared with cytokine-treated, scrambled siRNA–transfected cells. *p , 0.05, **p , 0.01, ***p , 0.001, †p , 1 3 1024, ††p , 1 3 1025. scr, scrambled; Tx, treatment. and we and others have found that with STAT3 deletion in signaling (27). Therefore, JAK1 and TYK2 do not phenocopy myeloid cells PRR-induced proinflammatory cytokines can STAT1 and STAT4 regulation, despite the overlap in mediating in fact increase in the context of reduced negative feedback IFN-g and IL-12 responses. We confirmed the differential regu- from anti-inflammatory molecules (23, 24). In contrast, with lation by JAK1 and TYK2 through an alternative approach using STAT1 and STAT4 knockdown, we have found that TLR4- inhibitors. Upadacitinib is a JAK1 inhibitor that is an effective induced proinflammatory cytokines are decreased despite treatment for rheumatoid arthritis (28, 29) and is being investi- the reduction in IL-10 secretion, suggesting that STAT1 and gated as a therapy for various other immune-mediated diseases, STAT4 play a more important role in regulating inflammatory including ulcerative colitis (30) and Crohn disease (31) which cytokines. Consistently, preventing autocrine IL-10 negative recently showed efficacy in Phase 2 trials. We confirmed pro- feedback through effectively knocking down IL-10RA gressive reduction in JAK1 phosphorylation with increasing (Supplemental Fig. 4A) in STAT1-/STAT4-deficient MDMs Upadacitinib doses (Fig. 9B). At higher doses, Upadacitinib can resulted in a dramatic increase in proinflammatory cytokines also inhibit JAK2; we observed slight reduction in TLR4-induced (Fig. 9A). JAK2 activation at the highest selected dose of Upadacitinib We had found that TLR4-induced autocrine IFN-g and IL-12 (Fig. 9B). BMS-986165 is a TYK2 inhibitor that is similarly being signal through STAT1 and STAT4, respectively. With respect to investigated in various immune-mediated diseases. We confirmed upstream JAKs, IFN-g preferentially signals through JAK1 and progressive reduction in TYK2 phosphorylation with increas- IL-12 preferentially signals through TYK2; note that these JAK ing BMS-986165 doses (Fig. 9D). At higher doses, BMS- family members mediate signaling to a wide range of cytokines. 986165 can also inhibit JAK1; we observed slight reduction We and others have previously reported that with deletion of the in TLR4-induced JAK1 activation at the highest selected dose upstream JAK members in myeloid cells, PRR-induced proin- of BMS-986165 (Fig. 9D). Cell viability was intact with both flammatory cytokines, in fact, increase in the context of reduced these inhibitors (Supplemental Fig. 4B). With lower doses of negative feedback from anti-inflammatory molecules (25–27). We each of these inhibitors, both TLR4-induced proinflammatory and had found that this outcome depends on the threshold of JAK anti-inflammatory cytokines decreased (Fig. 9C, 9E). However, at 8 STAT1 AND STAT4 POLYMORPHISMS MODULATE PRR-INDUCED OUTCOMES Downloaded from http://www.jimmunol.org/

FIGURE 7. STAT1 and STAT4 promote S. Typhimurium–induced cytokine secretion in human intestinal myeloid cells. Human intestinal myeloid cells (n = 6 donors) or peripheral MDMs (n = 6 donors) were preincubated for 1 h with either fludarabine (STAT1 inhibitor) or lisofylline (STAT4 inhibitor), alone or in combination, and then cocultured with S. Typhimurium (S. Typhim) at MOI 10:1 for 24 h. Cytokine secretion + SEM. Significance with t test with Bonferroni–Holm correction. ***p , 0.001, †p , 1 3 1024, ††p , 1 3 1025. Inh, inhibitor. by guest on September 25, 2021 higher levels of JAK1 and TYK2 inhibition, proinflammatory cytokines increased, whereas IL-10 progressively decreased (Fig. 9C, 9E). Consistent with these results, upon knockdown of JAK1 and TYK2 using siRNA (Supplemental Fig. 4C, 4D), we observed increased proinflammatory cytokines in the context of reduced IL-10 secretion (Fig. 9F). We also confirmed a similar recipro- FIGURE 8. MDMs from rs1517352 CC disease risk carriers dem- cal pattern of regulation with STAT3 knockdown (Fig. 9F, onstrate increased IFN-g– and IL-12–induced signaling and cytokines Supplemental Fig. 4C, 4D). We further confirmed relative se- relative to AA carrier MDMs. (A) Human MDMs from rs1517352 CC, lectively for IFN-g–induced signaling through JAK1 (Fig. 9C) CA, and AA carriers were treated with 10 ng/ml IFN-g or 10 ng/ml and IL-12–induced signaling through TYK2 (Fig. 9E). Inter- IL-12. (A) Fold STAT1 and STAT4 phosphorylation at 60 min (n =8 estingly, in contrast to PRR stimulation, when stimulating with per genotype). (B) Cytokine secretion at 24 h (n = 12 per genotype). either IFN-g or IL-12, higher levels of inhibition of these Mean + SEM. Significance with one-way ANOVA with Tukey posttest. *p , 0.05, **p , 0.01, ***p , 0.001, †p , 1 3 1024, ††p , JAK family members did not lead to reciprocal regulation of 2 1 3 10 5. proinflammatory and anti-inflammatory cytokines (Fig. 9C, 9E). Therefore, JAK family members and STAT3 demonstrate a pattern of TLR-induced cytokine regulation in human macro- of S. Typhimurium–GFP in MDMs under baseline conditions phages wherein once expression/activity falls below a thresh- (Supplemental Fig. 4E). Similar results were observed with old, proinflammatory cytokines increase in the context of a uptake of E. coli bioparticles (Supplemental Fig. 4E). Cells in progressive reduction in anti-inflammatory cytokines; this is the intestinal environment are continuously exposed to microbial distinct to the pattern of regulation observed with STAT1 and products, and we (32) and others (33, 34) have found that pro- STAT4. longed PRR stimulation can enhance antimicrobial pathways. We therefore examined MDMs after chronic PRR stimulation. STAT1 and STAT4 promote TLR4-induced bacterial uptake We confirmed increased bacterial uptake after treatment of Macrophages play a key role in bacterial clearance. As IFN-g and MDMs with lipid A for 48 h (Fig. 10). STAT1 and STAT4 IL-12 can promote antimicrobial pathways in macrophages, we were required for this TLR4-enhanced bacterial uptake (Fig. next assessed the role of STAT1 and STAT4 in mediating anti- 10), and they cooperated in this process (Fig. 10). Prolonged microbial outcomes. The initial step in bacterial clearance re- IFN-g and IL-12 treatment also increased bacterial uptake (Fig. quires uptake of bacteria. STAT1 or STAT4 knockdown, either 10). IFN-g–enhanced bacterial uptake required STAT1, but not alone or in combination, did not alter the low level of uptake STAT4 (Fig. 10). In contrast, IL-12–enhanced bacterial uptake The Journal of Immunology 9 Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 9. JAK1 and TYK2 regulate TLR4-induced cytokines in a manner distinct to STAT1 and STAT4. (A) MDMs were transfected with scrambled, STAT1 and STAT4, or IL10RA (to block autocrine IL-10), alone or in combination, and then treated with 0.1 mg/ml lipid A for 24 h. Cytokine secretion (n =6).(B–E) MDMs were pretreated with vehicle (DMSO) or the indicated doses of either (B and C) Upadacitinib (Upa; JAK1 inhibitor) or (D and E) BMS-986165 (BMS; TYK2 inhibitor) for 1 h. (B and D) Fold induction of the indicated phosphoproteins with 0.1 mg/ml lipid A for 15 min (n = 5; similar results in an additional n = 4) (earlier time point assessed to minimize signaling through autocrine/paracrine cytokine loops). (C and E) Cells were treated with 0.1 mg/ml lipid A or 10 ng/ml IFN-g or IL-12. Cytokines at 24 h (n = 6; similar results in an additional n =4forlipid A). (F) MDMs were transfected with scrambled, JAK1, TYK2, or STAT3 siRNA, and then treated with 0.1 mg/ml lipid A for 24 h. Cytokine secretion (n = 6). Mean + SEM. Significance is to scrambled siRNA–transfected, lipid A–treated cells for (F), to vehicle and cytokine- or lipid A–treated cells in (C) and (E), or as indicated. t test for (A) combined with Bonferroni–Holm correction for (B)–(F). *p , 0.05, **p , 0.01, ***p , 0.001, †p , 1 3 1024. scr, scrambled; Tx, treatment. required both STAT1 and STAT4 (Fig. 10), consistent with the Furthermore, upon TLR4 stimulation, despite the reduced uptake STAT4-dependent, IL-12–induced IFN-g secretion, which then of bacteria in STAT1- and STAT4-deficient MDMs (Fig. 10), both feeds back to activate STAT1 (Fig. 5), in particular under these STAT1- and STAT4-deficient MDMs were less able to clear the prolonged treatment conditions. Taken together, STAT1 and STAT4 lower levels of bacteria that had been taken up (Fig. 11B). STAT1 promote TLR4-, IFN-g–, and IL-12–induced bacterial uptake. and STAT4 cooperated in mediating this intracellular bacterial clearance (Fig. 11B). Prolonged IFN-g treatment similarly in- STAT1 and STAT4 are required for TLR4-enhanced creased bacterial clearance, and this required STAT1 (Fig. 11B), bacterial clearance whereas IL-12–enhanced intracellular bacterial clearance required We next assessed if STAT1 and STAT4 regulate clearance of in- both STAT1 and STAT4 (Fig. 11B). tracellular bacteria in macrophages. In untreated MDMs, knockdown To assess mechanisms mediating STAT1- and STAT4-dependent of STAT1 and STAT4 led to reduced clearance of S. Typhimurium intracellular bacterial clearance, we considered antimicrobial (Fig. 11A). Similar results were observed with AIEC (Fig. 11A), pathways that these signaling proteins might be promoting. We first which are increased in the ilea of Crohn disease patients (35). assessed ROS given the important role ROS production plays in 10 STAT1 AND STAT4 POLYMORPHISMS MODULATE PRR-INDUCED OUTCOMES

FIGURE 10. STAT1 and STAT4 are required for optimal TLR4-induced bacterial uptake. MDMs were transfected with scrambled siRNA or with STAT1 or STAT4 siRNA, alone or in combination (comb). Cells were then treated for 48 h with 0.1 mg/ml lipid A, 10 ng/ml IFN-g, or 10 ng/ml IL-12. Uptake of S. Typhimurium–GFP or E. coli–FITC was assessed (n = 10 from two independent experiments) as per Materials and Methods. Representative ﬂow cytometry and summary graphs. Mean ﬂuorescence intensity (MFI) + SEM. t test with Bonferroni–Holm correction. ***p , 0.001, †p , 1 3 1024, †† 25

p , 1 3 10 . NT, no treatment; scr, scrambled; Tx, treatment. Downloaded from

mediating bacterial clearance (1). The low level of ROS in un- RNS, autophagy, and intracellular bacterial clearance in human treated macrophages was not regulated by STAT1 or STAT4 (data MDMs. not shown). However, upon TLR4 stimulation, both STAT1 and MDMs from rs1517352 C risk carriers in the STAT1/STAT4 STAT4, and particularly in combination, were required for http://www.jimmunol.org/ ROS production in MDMs (Fig. 12A). Reactive nitrogen region demonstrate increased microbial-induced cytokines and species (RNS) can also contribute to bacterial clearance, and a TLR4-induced antimicrobial pathways combination of ROS and RNS pathways is central in main- We next assessed if human MDMs from rs1517352 C IBD risk taining homeostasis in the intestinal mucosa (36). Both carriers in the STAT1/STAT4 region that show increased STAT1 STAT1andSTAT4wererequiredforTLR4-inducedNOS2 and STAT4 expression and TLR-induced cytokines might be at an expression in MDMs (Fig. 12B). Autophagy is another key advantage with respect to induction of antibacterial mechanisms. bacterial clearance mechanism induced with PRR stimula- We first assessed S. Typhimurium–induced proinflammatory tion (37), and polymorphisms in the autophagy-associated (TNF, IL-1b) and anti-inflammatory (IL-10) cytokines and found gene ATG16L1 confer altered susceptibility to Crohn disease that similar to TLR stimulation, MDMs from rs1517352 C IBD by guest on September 25, 2021 (3). STAT1 and STAT4, particularly in combination, were risk carriers showed increased S. Typhimurium–induced cytokine required for TLR4-induced expression of the autophagy marker secretion compared AA carriers (Fig. 13A). In addition to the LC3II (Fig. 12C). Moreover, STAT1 was required for IFN-g in- previously examined cytokines (Fig. 1), TLR4-induced TNF and duction, and both STAT1 and STAT4 were required for IL-12 IL-1b were also increased in MDMs from rs1517352 C IBD risk induction of each of these antimicrobial pathways. Taken to- carriers (Fig. 13B). We further found that TLR4-enhanced uptake gether, STAT1 and STAT4 are required for TLR4-induced ROS, of S. Typhimurium and E. coli bioparticles was increased in

FIGURE 11. STAT1 and STAT4 are required for optimal intracellular bacterial clearance. MDMs were transfected with scrambled siRNA or with STAT1 or STAT4 siRNA, alone or in combination (comb). Cells were then (A) left untreated (n =6)or(B) treated with 0.1 mg/ml lipid A, 10 ng/ml IFN-g, or 10 ng/ml IL-12 for 48 h (n = 6; similar results in an additional n = 4). Intracellular bacterial clearance. Mean CFU + SEM. Signiﬁcance with t test with Bonferroni–Holm correction. **p , 0.01, ***p , 0.001, †p , 1 3 1024, ††p , 1 3 1025. scr, scrambled; Tx, treatment. The Journal of Immunology 11

FIGURE 12. STAT1 and STAT4 promote TLR4- induced antimicrobial pathways. MDMs were transfected with scrambled siRNA or with STAT1 or STAT4 siRNA, alone or in combination (comb). Cells were then left untreated or treated with 0.1 mg/ml lipid A, 10 ng/ml IFN-g or 10 ng/ml IL-12 for 48 h (n = 6) and assessed by flow cytometry for the following: (A) ROS production, (B) NOS2 expression, or (C)LC3II expression. Representative flow cytometry and summary graphs (mean fluorescence intensity [MFI]). Mean + SEM. Significance with t test with Bonferroni– Holm correction. ***p , 0.001, †p , 1 3 1024, ††p , 1 3 1025. NT, no treatment; scr, scrambled; Tx, Downloaded from treatment. http://www.jimmunol.org/

MDMs from rs1517352 C IBD risk carriers compared with AA bacterial-, IFN-g– and IL-12–induced cytokines and TLR- carriers (Fig. 14). Finally, rs1517352 C IBD risk MDMs demon- induced antimicrobial pathways in MDMs compared with A strated increased TLR4-induced ROS (Fig. 15A), RNS (Fig. 15B), carrier MDMs. We find that IL-12 preferentially activates and autophagy (Fig. 15C), and in turn, increased intracellular STAT4, and STAT4 is required for optimal levels of IL-12– clearance of Enterococcus faecalis, AIEC, and S. Typhimurium induced IFN-g secretion, with IFN-g preferentially activating (Fig. 15D) compared with AA carriers. Therefore, MDMs from STAT1 to mediate secretion of a range of cytokines. There- by guest on September 25, 2021 rs1517352 C IBD risk carriers more effectively induce antimi- fore, STAT1 and STAT4 are coregulated from from a common crobial pathway responses. genetic locus and then cooperate functionally in a complementary manner. We further determine that IFN-g–and Discussion IL-12–mediated cytokine secretion in human myeloid cells In this study, we identify that STAT1 and STAT4 are required for requires not only STAT1 and STAT4 signaling but is also optimal secretion of multiple cytokines upon stimulation of a dependent on MAPK and NF-kB pathways. Moreover, we find broad range of PRRs and by live bacteria in human MDMs, that STAT1 and STAT4 are required for cytokine secretion and we establish that autocrine/paracrine IFN-g and IL-12 by intestinal myeloid cells following live S. Typhimurium are mechanisms contributing to these outcomes. We further coculture. Taken together, this study elucidates mechanisms identify that STAT1 and STAT4 are required for optimal TLR-, for how immune disease–associated polymorphisms in the IFN-g– and IL-12–enhanced uptake and clearance of bacteria. STAT1/STAT4 region modulate cytokine secretion and anti- Importantly, the rs1517352 C variant in the STAT1/STAT4 re- microbial pathways in macrophages; STAT1 and STAT4 are gion conferring increased risk for IBD (3) increases expression coregulated in expression and then cooperate to regulate out- andactivationofbothSTAT1andSTAT4,andenhancesTLR-, comes, thereby highlighting a previously undefined interaction of

FIGURE 13. MDMs from rs1517352 CC disease risk carriers secrete increased levels of S. Typhimurium–induced cytokines relative to AA carrier MDMs. Human MDMs from rs1517352 CC, CA, and AA carriers (n = 10 per genotype) were treated for 24 h with (A) S. Typhimurium or (B) 0.1 mg/ml lipid A. Cytokine secretion + SEM. Signiﬁcance with one-way ANOVAwith Tukey posttest. *p , 0.05, **p , 0.01, ***p , 0.001, †p , 1 3 1024, ††p , 1 3 1025. Tx, treatment. 12 STAT1 AND STAT4 POLYMORPHISMS MODULATE PRR-INDUCED OUTCOMES

responses highlight potential benefits for inhibiting this pathway in IBD patients. The specific mechanism through which the rs1517352 variant, or potentially a variant in linkage dis- equilibrium with rs1517352, modulates gene expression is not known. rs1517352 is within a region that might serve as a binding site for aae-miR-11901, although this would need to be tested experimentally. Of note, these findings highlight that the STAT1 and STAT4 pathways do not demonstrate a threshold of signaling in innate immune cells below which one observes a reciprocal inflammatory outcome wherein proinflammatory cytokines increase as anti-inflammatory cytokines decrease, as has been observed with JAK inhibition (27) or with STAT3 deficiency (23); we confirm the distinct regulation of JAK and STAT3 pathways in the current study. Therefore, despite the ability of STAT1 and STAT4 to regulate both inflammatory and anti-inflammatory mediators in myeloid cells in response to FIGURE 14. MDMs from rs1517352 CC disease risk carriers demon- microbial products, the dominant effect is that on inflammatory strate increased bacterial uptake relative to AA carrier MDMs. Human mediators. MDMs from rs1517352 CC, CA, and AA carriers (n = 10 per genotype) Downloaded from were left untreated or treated for 48 h with 0.1 mg/ml lipid A, and then Polymorphisms in the JAK/STAT pathway, including JAK2, assessed for bacterial uptake. (Left) Representative flow cytometry with TYK2, STAT3, STAT5, STAT1, and STAT4, have been associated mean fluorescence intensity (MFI). (Right) Summary of S. Typhimurium with multiple immune-mediated diseases, including IBD (3), in- or E. coli uptake. Mean + SEM. Significance with one-way ANOVA with dicating that this pathway has a central role in mediating immune Tukey posttest. *p , 0.05, **p , 0.01, †p , 1 3 1024, ††p , 1 3 1025. homeostasis. Consistent with this, JAK pathway inhibitors have NT, no treatment; Tx, treatment. been shown to be effective in treatment of rheumatoid arthritis,

psoriasis, and ulcerative colitis (42, 43). The challenge in designing http://www.jimmunol.org/ therapies targeting these pathways is understanding how different STAT1 and STAT4 in the immune response (Supplemental JAK/STAT members affect signaling and outcomes by specific Fig. 4F). PRRs and cytokines, how these outcomes vary in different cell Both the STAT1 and STAT4 pathways are elevated in IBD types, and at what threshold of signaling various JAKs and STATs patients (38–40). Studies examining experimental models of decrease or increase specific outcomes (5, 27). Our study identifies colitis have found that transgenic STAT4 expression can pro- roles and mechanisms through which STAT1-andSTAT4-immune mote inflammatory CD4+ T cell responses (41). Consistent with disease–associated polymorphisms regulate signaling, cytokine se- these animal studies, our findings show that the rs1517352 C cretion, and antimicrobial pathways in myeloid cells, provides variant in the STAT1/STAT4 region–conferring–increased risk further clarification on how these genes might contribute to immune by guest on September 25, 2021 for IBD leads to increased expression of both STAT1 and homeostasis and disease pathogenesis, and identifies these pathways STAT4 and, in turn, increased PRR-induced signaling and cy- as potential beneficial targets in immune-mediated diseases. tokines in human macrophages. Conversely, individuals with STAT1/STAT4 variantsleadingtoreducedSTAT1andSTAT4 Disclosures expression and activation and reduced inflammatory innate The authors have no financial conflicts of interest.

FIGURE 15. MDMs from rs1517352 CC disease risk carriers demonstrate increased intracellular bacterial clearance relative to AA carrier MDMs. Human MDMs from rs1517352 CC, CA, and AA carriers (n =10 per genotype) were left untreated or treated for 48 h with 0.1 mg/ml lipid A. (A)ROS production. (B) NOS2 expression. (C) LC3II expression. Representative flow cytometry and summary graphs (mean fluorescence intensity [MFI]). (D) Intracellular bacterial clearance (CFU). Mean + SEM. Significance with one- way ANOVA with Tukey posttest. *p , 0.05, **p , 0.01, ***p , 0.001, †p , 1 3 1024, ††p , 1 3 1025. NT, no treatment; Tx, treatment. The Journal of Immunology 13

References 24. Hedl, M., R. Sun, C. Huang, and C. Abraham. 2019. STAT3 and STAT5 signaling thresholds determine distinct regulation for innate receptor-induced in- 1. Abraham, C., and R. Medzhitov. 2011. Interactions between the host innate flammatory cytokines, and STAT3/ STAT5 disease variants modulate these immune system and microbes in inflammatory bowel disease. Gastroenterology outcomes. J. Immunol. 203: 3325–3338. 140: 1729–1737. 25. Pattison, M. J., K. F. Mackenzie, and J. S. Arthur. 2012. Inhibition of JAKs in 2. Seok, J., H. S. Warren, A. G. Cuenca, M. N. Mindrinos, H. V. Baker, W. Xu, macrophages increases lipopolysaccharide-induced cytokine production by D. R. Richards, G. P. McDonald-Smith, H. Gao, L. Hennessy, et al; Inflammation blocking IL-10-mediated feedback. J. Immunol. 189: 2784–2792. and Host Response to Injury, Large Scale Collaborative Research Program. 26. Wang, H., J. Brown, S. Gao, S. Liang, R. Jotwani, H. Zhou, J. Suttles, 2013. Genomic responses in mouse models poorly mimic human inflammatory D. A. Scott, and R. J. Lamont. 2013. The role of JAK-3 in regulating TLR- diseases. Proc. Natl. Acad. Sci. USA 110: 3507–3512. mediated inflammatory cytokine production in innate immune cells. J. Immunol. 3. Jostins, L., S. Ripke, R. K. Weersma, R. H. Duerr, D. P. McGovern, K. Y. Hui, 191: 1164–1174. J. C. Lee, L. P. Schumm, Y. Sharma, C. A. Anderson, et al; International IBD 27. Hedl, M., D. D. Proctor, and C. Abraham. 2016. JAK2 disease-risk variants are gain Genetics Consortium (IIBDGC). 2012. Host-microbe interactions have shaped of function and JAK signaling threshold determines innate receptor-induced the genetic architecture of inflammatory bowel disease. Nature 491: 119–124. proinflammatory cytokine secretion in macrophages. J. Immunol. 197: 3695–3704. 4. Abelson, A. K., A. M. Delgado-Vega, S. V. Kozyrev, E. Sańchez, R. Vela´zquez- 28. Burmester, G. R., J. M. Kremer, F. Van den Bosch, A. Kivitz, L. Bessette, Y. Li, Cruz, N. Eriksson, J. Wojcik, M. V. Linga Reddy, G. Lima, S. D’Alfonso, et al; Y. Zhou, A. A. Othman, A. L. Pangan, and H. S. Camp. 2018. Safety and efficacy AADEA group. 2009. STAT4 associates with systemic lupus erythematosus of upadacitinib in patients with rheumatoid arthritis and inadequate response through two independent effects that correlate with gene expression and act to conventional synthetic disease-modifying anti-rheumatic drugs (SELECT- additively with IRF5 to increase risk. Ann. Rheum. Dis. 68: 1746–1753. NEXT): a randomised, double-blind, placebo-controlled phase 3 trial. Lancet 5. O’Shea, J. J., D. M. Schwartz, A. V. Villarino, M. Gadina, I. B. McInnes, and 391: 2503–2512. A. Laurence. 2015. The JAK-STAT pathway: impact on human disease and 29. Genovese, M. C., R. Fleischmann, B. Combe, S. Hall, A. Rubbert-Roth, therapeutic intervention. Annu. Rev. Med. 66: 311–328. 6. Luu, K., C. J. Greenhill, A. Majoros, T. Decker, B. J. Jenkins, and A. Mansell. Y. Zhang, Y. Zhou, M. F. Mohamed, S. Meerwein, and A. L. Pangan. 2018. 2014. STAT1 plays a role in TLR signal transduction and inflammatory re- Safety and efficacy of upadacitinib in patients with active rheumatoid arthritis sponses. Immunol. Cell Biol. 92: 761–769. refractory to biologic disease-modifying anti-rheumatic drugs (SELECT- BEYOND): a double-blind, randomised controlled phase 3 trial. Lancet 391: 7. Dupuis, S., E. Jouanguy, S. Al-Hajjar, C. Fieschi, I. Z. Al-Mohsen, S. Al-Jumaah, Downloaded from K. Yang, A. Chapgier, C. Eidenschenk, P. Eid, et al. 2003. Impaired response to 2513–2524. interferon-alpha/beta and lethal viral disease in human STAT1 deficiency. Nat. 30. Sandborn, W. J., S. Ghosh, J. Panes, S. Schreiber, G. D’Haens, S. Tanida, Genet. 33: 388–391. J. Siffledeen, J. Enejosa, W. Zhou, A. A. Othman, et al. 2020. Efficacy of upa- 8. Liu, L., S. Okada, X. F. Kong, A. Y. Kreins, S. Cypowyj, A. Abhyankar, dacitinib in a randomized trial of patients with active ulcerative colitis. Gas- J. Toubiana, Y. Itan, M. Audry, P. Nitschke, et al. 2011. Gain-of-function human troenterology 158: 2139–2149.e14. STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous 31. Sandborn, W. J., B. G. Feagan, E. V. Loftus, Jr., L. Peyrin-Biroulet, G. Van candidiasis. J. Exp. Med. 208: 1635–1648. Assche, G. D’Haens, S. Schreiber, J. F. Colombel, J. D. Lewis, S. Ghosh, et al. 9. Kariuki, S. N., K. A. Kirou, E. J. MacDermott, L. Barillas-Arias, M. K. Crow, 2020. Efficacy and safety of upadacitinib in a randomized trial of patients with and T. B. Niewold. 2009. Cutting edge: autoimmune disease risk variant Crohn’s disease. Gastroenterology 158: 2123–2138.e8. http://www.jimmunol.org/ of STAT4 confers increased sensitivity to IFN-alpha in lupus patients in vivo. 32. Lahiri, A., and C. Abraham. 2014. Activation of pattern recognition receptors J. Immunol. 182: 34–38. up-regulates metallothioneins, thereby increasing intracellular accumulation of 10. Sigurdsson, S., G. Nordmark, S. Garnier, E. Grundberg, T. Kwan, O. Nilsson, zinc, autophagy, and bacterial clearance by macrophages. Gastroenterology 147: M. L. Eloranta, I. Gunnarsson, E. Svenungsson, G. Sturfelt, et al. 2008. A risk 835–846. haplotype of STAT4 for systemic lupus erythematosus is over-expressed, cor- 33. Foster, S. L., D. C. Hargreaves, and R. Medzhitov. 2007. Gene-specific control of relates with anti-dsDNA and shows additive effects with two risk alleles of IRF5. inflammation by TLR-induced chromatin modifications. [Published erratum Hum. Mol. Genet. 17: 2868–2876. appears in 2008 Nature 451: 102.] Nature 447: 972–978. 11. Hedl, M., A. Lahiri, K. Ning, J. H. Cho, and C. Abraham. 2014. Pattern recognition 34. West, A. P., I. E. Brodsky, C. Rahner, D. K. Woo, H. Erdjument-Bromage, receptor signaling in human dendritic cells is enhanced by ICOS ligand and P. Tempst, M. C. Walsh, Y. Choi, G. S. Shadel, and S. Ghosh. 2011. TLR sig- modulated by the Crohn’s disease ICOSLG risk allele. Immunity 40: 734–746. nalling augments macrophage bactericidal activity through mitochondrial ROS. 12. Hedl, M., J. Yan, and C. Abraham. 2016. IRF5 and IRF5 disease-risk variants Nature 472: 476–480. increase glycolysis and human M1 macrophage polarization by regulating 35. Darfeuille-Michaud, A., J. Boudeau, P. Bulois, C. Neut, A. L. Glasser, by guest on September 25, 2021 proximal signaling and Akt2 activation. Cell Rep. 16: 2442–2455. N. Barnich, M. A. Bringer, A. Swidsinski, L. Beaugerie, and J. F. Colombel. 13. Frank, D. A., S. Mahajan, and J. Ritz. 1999. Fludarabine-induced immunosup- 2004. High prevalence of adherent-invasive Escherichia coli associated with pression is associated with inhibition of STAT1 signaling. Nat. Med. 5: 444–447. ileal mucosa in Crohn’s disease. Gastroenterology 127: 412–421. 14. Yang, Z., M. Chen, L. B. Fialkow, J. D. Ellett, R. Wu, and J. L. Nadler. 2003. 36. Shiloh, M. U., J. D. MacMicking, S. Nicholson, J. E. Brause, S. Potter, Inhibition of STAT4 activation by lisofylline is associated with the protection of M. Marino, F. Fang, M. Dinauer, and C. Nathan. 1999. Phenotype of mice and autoimmune diabetes. Ann. N. Y. Acad. Sci. 1005: 409–411. macrophages deficient in both phagocyte oxidase and inducible nitric oxide 15. Coon, M. E., M. Diegel, N. Leshinsky, and S. J. Klaus. 1999. Selective phar- synthase. Immunity 10: 29–38. macologic inhibition of murine and human IL-12-dependent Th1 differentiation 37. Sanjuan, M. A., C. P. Dillon, S. W. Tait, S. Moshiach, F. Dorsey, S. Connell, and IL-12 signaling. J. Immunol. 163: 6567–6574. M. Komatsu, K. Tanaka, J. L. Cleveland, S. Withoff, and D. R. Green. 2007. 16. Chen, M., Z. Yang, R. Wu, and J. L. Nadler. 2002. Lisofylline, a novel antiin- Toll-like receptor signalling in macrophages links the autophagy pathway to flammatory agent, protects pancreatic beta-cells from proinflammatory cytokine phagocytosis. Nature 450: 1253–1257. damage by promoting mitochondrial metabolism. Endocrinology 143: 2341–2348. 38. Mudter, J., B. Weigmann, B. Bartsch, R. Kiesslich, D. Strand, P. R. Galle, 17. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat. Rev. Immunol. H. A. Lehr, J. Schmidt, and M. F. Neurath. 2005. Activation pattern of signal 4: 499–511. transducers and activators of transcription (STAT) factors in inflammatory bowel 18. Abraham, C., and J. H. Cho. 2009. Inflammatory bowel disease. N. Engl. J. Med. diseases. Am. J. Gastroenterol. 100: 64–72. 361: 2066–2078. 39. Giles, E. M., T. J. Sanders, N. E. McCarthy, J. Lung, M. Pathak, 19. Hedl, M., J. Li, J. H. Cho, and C. Abraham. 2007. Chronic stimulation of Nod2 T. T. MacDonald, J. O. Lindsay, and A. J. Stagg. 2017. Regulation of human mediates tolerance to bacterial products. Proc. Natl. Acad. Sci. USA 104: intestinal T-cell responses by type 1 interferon-STAT1 signaling is disrupted in 19440–19445. inflammatory bowel disease. Mucosal Immunol. 10: 184–193. 20. Smythies, L. E., M. Sellers, R. H. Clements, M. Mosteller-Barnum, G. Meng, 40. Schreiber, S., P. Rosenstiel, J. Hampe, S. Nikolaus, B. Groessner, A. Schottelius, W. H. Benjamin, J. M. Orenstein, and P. D. Smith. 2005. Human intestinal T. Ku¨hbacher, J. Ha¨mling, U. R. Fo¨lsch, and D. Seegert. 2002. Activation of macrophages display profound inflammatory anergy despite avid phagocytic and signal transducer and activator of transcription (STAT) 1 in human chronic in- bacteriocidal activity. J. Clin. Invest. 115: 66–75. flammatory bowel disease. Gut 51: 379–385. 21. Franchi, L., N. Kamada, Y. Nakamura,A.Burberry,P.Kuffa,S.Suzuki, 41. Wirtz, S., S. Finotto, S. Kanzler, A. W. Lohse, M. Blessing, H. A. Lehr, M. H. Shaw, Y. G. Kim, and G. Nuń˜ez. 2012. NLRC4-driven production of P. R. Galle, and M. F. Neurath. 1999. Cutting edge: chronic intestinal inflam- IL-1b discriminates between pathogenic and commensal bacteria and pro- mation in STAT-4 transgenic mice: characterization of disease and adoptive motes host intestinal defense. Nat. Immunol. 13: 449–456. transfer by TNF- plus IFN-gamma-producing CD4+ T cells that respond to 22. Hedl, M., and C. Abraham. 2012. Nod2-induced autocrine interleukin-1 alters bacterial antigens. J. Immunol. 162: 1884–1888. signaling by ERK and p38 to differentially regulate secretion of inflammatory 42. Sandborn, W. J., S. Ghosh, J. Panes, I. Vranic, C. Su, S. Rousell, and cytokines. Gastroenterology 143: 1530–1543. W. Niezychowski, Study A3921063 Investigators. 2012. Tofacitinib, an oral 23. Takeda, K., B. E. Clausen, T. Kaisho, T. Tsujimura, N. Terada, I. Fo¨rster, and Janus kinase inhibitor, in active ulcerative colitis. N. Engl. J. Med. 367: 616–624. S. Akira. 1999. Enhanced Th1 activity and development of chronic enterocolitis 43. O’Shea, J. J., and R. Plenge. 2012. JAK and STAT signaling molecules in in mice devoid of Stat3 in macrophages and neutrophils. Immunity 10: 39–49. immunoregulation and immune-mediated disease. Immunity 36: 542–550. Supplementary Figure 1 rs1517352 † †† lipid A †† Pam3Cys Poly(I:C) †† CpG A B ** ** 1200 ** CC 1200 1200 1000 * * CA ** ** * AA 800 *** 800 * 800 800 ** 600 400 400 400 400 IFNγ (pg/ml) IFNγ (pg/ml) 200 200 200 200 0 0 0 0 lipid A (μg/ml) 0 0.01 0.1 lipid A (μg/ml) 0 1 10 0 10 100 0 1 10

C STAT1 D 1.2 30 0.8 5 5 5 5 20 s t 31 32 29 34 Isotype n 0.4 u STAT1 o 10 c

STAT1 (MFI) l Fold ∆ mRNA l e

0 C 0 STAT1 1.2 STAT4 40 4 4 0.8 4 4 30 s Isotype t 43 38 n 39 36 20

STAT4 u

0.4 o c

l 10 l STAT4 (MFI) Fold ∆ mRNA e

0 C 0 lipid A (h) 0 2 4 8 STAT4 lipid A (h) 0 4 8 24 lipid A (h) 0 4 8 24

SLC40A1ASNSD1ANKAROSGEPL1ORMDL1PMS1 MSTNC2orf88HIBCH INPP1 MFSD6 NAB1GLS STAT1 STAT4 MYO1BNABP1 SDPR TMEFF2 Chr2 rs1517352 CC rs1517352 CA F AA SLC40A1 ASNSD1 ANKAR OSGEPL1 ORMDL1 PMS1 MSTN C2orf88 HIBCH 5e-5 8e-4 1e-5 8e-6 8e-6 6e-4 6e-4 4e-5 4e-5 6e-4 8e-6 6e-5 6e-6 6e-6 3e-5 6e-6 3e-5 4e-4 4e-4 4e-4 4e-6 4e-6 2e-5 4e-6 4e-5 2e-5 mRNA 2e-4 1e-5 2e-4 2e-6 2e-4 1e-5 2e-6 2e-6 0 0 0 0 0 0 0 0 0

INPP1 MFSD6 NAB1 GLS MYO1B NABP1 SDPR TMEFF2 8e-4 8e-6 8e-4 6e-4 8e-6 8e-6 8e-6 6e-4 6e-6 6e-4 2e-4 4e-4 6e-6 6e-6 6e-6 4e-4 4e-6 4e-4 4e-6 4e-6 4e-6

mRNA 2e-4 1e-4 2e-4 2e-6 2e-4 2e-6 2e-6 2e-6 0 0 0 0 0 0 0 0

Supplementary Figure 1. The rs1517352 variant in the STAT1/STAT4 region does not regulate mRNA expression of multiple genes in the region. (A) Cells in Figure 1A were assessed for IFNγ secretion. (B) Cells in Figure 1B were assessed for IFNγ secretion. Significance with one-way ANOVA with Tukey’s post-test. (C-D) MDMs were treated with 0.1µg/ml lipid A for the indicated times: (C) Fold mRNA (n=6; similar results in an additional n=4). (D) STAT1 and STAT4 protein expression per flow cytometry. Representative flow cytometry with mean fluorescence intensity (MFI) values and summary of MFI (n=4; similar results in an additional n=4). (E) Representation of genes within ~500kb from rs1517352. To enable viewing of the genes in the region, gene positions are not drawn to scale. (F) MDMs from rs1517352 CC, CA, and AA carriers (n=8/genotype) were assessed for mRNA expression of the indicated genes (expressed as change in CT values normalized to GAPDH and represented as a linear scale). Mean + SEM. *, p<0.05; **, p<0.01; ***, p<0.001; †, p<1x10-4; ††, p<1x10-5. Supplementary Figure 2

50 A 50 E ** ** F 40 6 ** 3 40 3 30 30 4 2 2 100 20 20 in p-STAT1 in p-STAT2 in p-STAT3 80 † ∆ 2 *** ∆ 1 ∆ 1 STAT1 (MFI) 10 *** STAT4 (MFI) 10 60 *** Fold Fold 0 0 Fold 0 0 0 40 siRNA * scr scr 6 ** 6 ** 20 NS STAT1 STAT4

2 % annexin V+ cells B 100 0 4 4 Tx - lipid A UV 80

in p-STAT4 in p-STAT5 in p-STAT6 Fludara + + † ** 1 ∆ 2 ∆ 2 ∆ 60 LSF + + Fold 40 Fold 0 0 Fold 0 Fludara (STAT1) + + + 20 NS LSF (STAT4) + + + % annexin V+ cells 0 Tx (15min) - lipid A - lipid A - lipid A siRNA UV scr STAT1STAT4 C SLC40A1 ASNSD1 ANKAR OSGEPL1 ORMDL1 PMS1 MSTN C2orf88 HIBCH INPP1 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 † † † † † † Fold ∆ RNA 0.2 0.2 *** 0.2 0.2 0.2 *** 0.2 0.2 0.2 0.2 *** 0.2 *** 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

siRNA scr scr scr scr scr scr scr scr scr scr PMS1 MSTN HIBCH INPP1 ASNSD1 ANKAR C2orf88 SLC40A1 OSGEPL1 ORMDL1 MFSD6 NAB1 GLS STAT1 STAT4 MYO1B NABP1 SDPR TMEFF2 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.8 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.6 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 † † † † † † † Fold ∆ RNA 0.2 *** 0.2 0.2 0.2 0.2 0.2 *** 0.2 0.2 0.2 IL6 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 siRNA IL12 scr scr scr scr scr scr scr scr scr GLS NAB1 IFNγ x(0.7) MFSD6 STAT1 STAT4 NABP1 SDPR D MYO1B TMEFF2 IFNα x(0.4) IL10 1600

1200

800

cytokines (pg/ml) 400

siRNA scr GLS PMS1 NAB1 SDPR MSTN HIBCH INPP1 MFSD6 NABP1 ASNSD1 ANKAR C2orf88 MYO1B TMEFF2 SLC40A1 OSGEPL1ORMDL1 Tx - lipid A Supplementary Figure 2. Multiple genes in the rs1517352 region do not regulate TLR4-induced cytokines. (A-D) MDMs were transfected with scrambled or the indicated siRNAs. (A) STAT1 and STAT4 protein expression was assessed by flow cytometry. Summarized data for MFI (n=6). (B) Cell death was assessed by annexin V staining (n=4). UV stimulation at 50-100 J/m2 was used as a positive control. (C) Fold mRNA expression (n=4). (D) MDMs were treated with 0.1µg/ml lipid A for 24h. Cytokine secretion (n=4). (E-F) MDMs were pre-incubated with fludarabine (fludara; STAT1 inhibitor) or lisofylline (LSF; STAT4 inhibitor) for 1h and then treated with 0.1µg/ml lipid A. (E) Fold phospho-STAT proteins by flow cytometry at 15min (assessed early to minimize signaling through additional autocrine/paracrine loops) (n=4). (F) Cell death was assessed by annexin V staining at 24h (n=4; similar results in an additional 4 donors). 50-100 J/m2 UV-treated cells served as a positive control. Mean + SEM. NS, not significant; scr, scrambled; Tx, treatment. *, p<0.05; **, p<0.05; ***, p<0.001; †, p<1x10-4. Supplementary Figure 3 B 100 A Isotype Isotype Isotype 80 scr siRNA scr siRNA scr siRNA IFNGR1 siRNA IFNAR siRNA IL12Rβ2 siRNA 60 *** H 3 4 4 40 100 27 34 48 80 s s s 20 t t t NS n n n 8 15

8 % annexin V+ cells u u u 60 *** o o

o 0 c c c

l l l l l UV l 2 40

e β e siRNA e scr C C C IFNAR 20 NS IFNγR1 IFNAR IL12Rβ2 IL12R IFNGR1

C % annexin V+ cells 50 IL6 0 30 600 UV 30 IL12 siRNA 40 scr p38 IL10 ERK JNK 20 20 30 400 NEMO 2 (MFI) *** *** β 20 10 10 *** 200 IFNAR (MFI)

IFN γ R1 (MFI) 10 IL12R *** cytokines (pg/ml) 0 0 0 0 ** siRNA 2 scr scr scr β siRNA scr scr IFNAR IFNAR Tx - IFNα IFNGR1 IL12R D LIFR OSMR EGFR PDGFRA IL2R IL9R IL21R IL27 IL28RA IL31RA EB13 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0

0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 ∆ mRNA ** † † † *** *** †† *** ** *** *** Fold 0 0 0 0 0 0 0 0 0 0 0

siRNA scr scr scr scr scr scr scr scr scr scr scr LIFR IL2R IL9R IL21R IL27 EB13 OSMR EGFR IL28RA IL31RA PDGFRA IL6 IL12 IL10 E † F † † † † 1400 1400 *** *** ***† *** *** ** ** ** ** ** †† 1200 1200 50 80 1000 1000 40 60 800 800 30 40 600 600 20 20 IL12 (pg/ml) 400 400 IFN γ (pg/ml) 10

cytokines (pg/ml) 200 200 0 0 0 0 αIFNGR + + αIL12Rβ2 + + actino actino siRNA + + scr scr scr scr IL27 LIFR IL2R IL9RIL21R EBI3 Tx (15min) - lipid A Tx (15min) - lipid A OSMREGFR IL28RAIL31RA PDGFRA G Tx - lipid A - lipid A Isotype Isotype Isotype Isotype scr siRNA scr siRNA scr siRNA scr siRNA ERK siRNA p38 siRNA JNK siRNA NEMO siRNA 50 40 30 40 5 5 40 5 s 30 s s 5 s 30 t t t t 43

n 42 n 30 n 35 20 n

u u 47 u u

o 20 o o o 20

c 12 c c † c 13 20 9 13 l *** l l l *** l l *** l 10 l p38 (MFI) JNK (MFI) e e e e ERK (MFI) 10 10

10 NEMO (MFI) C C C C 0 0 0 0 ERK p38 JNK NEMO siRNA siRNA siRNA siRNA scr scr scr scr ERK p38 JNK NEMO Supplementary Figure 3. Various autocrine/paracrine cytokines do not promote TLR4-induced cytokine secretion. (A-E) MDMs were transfected with scrambled or the indicated siRNA. (A) Expression of IFNγR1, IFNAR and IL12Rβ2 by flow cytometry (n=4; similar results in an additional 4 donors). (B) Cell death was assessed by annexin V staining (n=4). 50-100 J/m2 UV-treated cells served as a positive control. (C) Cells were treated with 10ng/ml IFNα for 24h. Cytokine secretion (n=4). (D) Fold mRNA expression (n=4). (E) Cells were treated with 0.1µg/ml lipid A for 24h. Cytokine secretion (n=6). (F) MDMs were pre-incubated with neutralizing anti-IFNγR1 or anti-IL12Rβ2 (R&D Systems) for 1h + 10µg/ml actinomycin D (to prevent transcription) and then treated with 0.1µg/ml lipid A. Cytokine secretion at 15min. (G-H) MDMs were transfected with scrambled or the indicated siRNA. (G) Protein expression assessed by flow cytometry with mean fluorescence intensity (MFI) shown (n=4). (H) Cell death was assessed by annexin V staining (n=4). 50-100 J/m2 UV-treated cells served as a positive control. (see upper right corner). NS, not significant; scr, scrambled; Tx, treatment. **, p<0.01; ***, p<0.001; †, p<1x10-4; ††, p<1x10-5. Supplementary Figure 4

A isotype C isotype isotype isotype scr siRNA scr siRNA scr siRNA scr siRNA IL10RA siRNA JAK1 siRNA TYK2 siRNA STAT3 siRNA 50 100 7 100 3 7 4 26 20 47 40 80 80

s 102 s s t s t t t 87 14 60 n

n 30 n

n 60

u 34 †† u u u † †† o

o 22 o o 10 20 40 ** c 40 c c

l 7

l l l l l l JAK1 (MFI) l TYK2 (MFI) 20 10 e 20 e IL10RA (MFI) e STAT3 (MFI) e C C C C 0 0 0 0 IL10RA siRNA scr JAK1 siRNA scr TYK2 siRNA scr STAT3 siRNA scr JAK1 IL10RA TYK2 STAT3

B D E UPTAKE

100 100 15 100 80 80 12 † 80 9 60 *** 60 60 *** 6 40 40 40 NS NS 3 20 20 20 NS % annexin V+ cells % annexin V+ cells 0 0 0 (MFI) S . Typhim-GFP

% annexin V+ cells 0 Upa(nM) - - 43 75 BMS(nM) - - siRNA 100 200 0.1 0.4 0.5 1.0 scr 12 JAK1TYK2 Tx lipid A UV Tx lipid A UV STAT3UV (MFI) 8

IFNγ 4 F TLR

E. coli- FITC 0

siRNA scr Comb. Cytokines STAT1STAT4 IL6, IL12, IFNγ, IFNα, IL10 IL12 IFNγ Bacterial P STAT4 P uptake Cytosol STAT1

ROS { Antimicrobial pathways RNS Autophagy { - Nucleus STAT1 STAT4

Supplementary Figure 4. Model of STAT1/STAT4 regulation of TLR-initiated outcomes. (A, C) MDMs were transfected with scrambled or the indicated siRNA. Expression of each target protein was assessed by flow cytometry (MFI) (antibodies to IL10RA [Santa Cruz Biotechnology] [n=4]; or JAK1 [Santa Cruz Biotechnology], TYK2, STAT3 [Cell Signaling Technology] [n=6; similar results in an additional n=4]). (B) MDMs were pre-treated with vehicle or the indicated doses of either upadacitinib (JAK1 inhibitor) or BMS-986165 (TYK2 inhibitor) for 1h, and then treated with 0.1µg/ml lipid A for 24h. Cell death as assessed by annexin V+ cells (n=4). 50-100 J/m2 UV-treated cells served as a positive control. (D) MDMs were transfected with scrambled or the indicated siRNA. Cell death as assessed by annexin V+ cells (n=4). 50-100 J/m2 UV-treated cells served as a positive control. (E) MDMs were transfected with scrambled, or STAT1 or STAT4 siRNA, alone or in combination (comb). Bacterial uptake was assessed (MFI) (n=8; similar results in an additional n=6). Mean + SEM. NS, not significant; scr, scrambled; Tx, treatment. **, p<0.01; ***, p<0.001; †, p<1x10-4; ††, p<1x10-5. (F) Model of STAT1/STAT4 regulation of PRR-induced outcomes. STAT1 and STAT4 expression is co-regulated by a common gene regulatory region (including by the IBD-associated rs1517352 variant) in human MDMs. Upon TLR stimulation, early IL12 secretion acts in an autocrine manner to preferentially activate STAT4 which leads to IFNγ secretion. Autocrine IFNγ, in turn, preferentially activates STAT1. These STAT proteins then cooperate to regulate the secretion of a broad range of cytokines from MDMs. They further promote various antimicrobial mechanisms, including TLR-induced bacterial uptake, ROS, RNS and autophagy pathways, and in turn, intracellular bacterial clearance. MDMs from rs1517352 C IBD-risk carriers have increased STAT1 and STAT4 expression, which results in their cooperation to increase TLR-, IFNγ- and IL12-induced STAT1 and STAT4 activation and thereby increase broad cytokine secretion and antimicrobial pathways. Gene Primer Sequences Supplementary Table 1 5' CCGTGGCACTGCATACAATC 3' STAT1 5' ACCATGCCGAATTCCCAAAG 3' 5' TGCTTTCCCTTGGCGTTTTG 3' STAT4 5' GCTGCCTCCCAGTCTTGATT 3' 5' GATCCTTGGCCGACTACCTG 3' SLC40A1 5' CACATCCGATCTCCCCAAGT 3' 5' GTGGTGGATGAACTTTCTAACCT 3' ASNSD1 5' ACAGAACAACAAATGCCACACAT 3' 5' AAACACTGGTGGGACTTCCTT 3' ANKAR 5' CGGTGCTCCTTCCCTCTTTTA 3' 5' TCTTCACTAAGCATGCCGCT 3' OSGEPL1 5' GATAATTCCTTCCACTTGGGCG 3' 5' GCCTGAGGGCGTGTATCC 3' ORMDL1 5' CTCGAGCCAGTGTGTCAAGT 3' 5' GCAGGAAGCTGCTCTGTTAAA 3' PMS1 5' ACAACACTGACCACCGAAGT 3' 5' ACTTGACATGAACCCAGGCA 3' MSTN 5' AAACGGATTCAGCCCATCTTCT 3' 5' GGCAGCTGGACTGCACTT 3' C2orf88 5' TTTACACAACACGTTGCCCG 3' 5' GAATCCGCCCTAGTCCGTTC 3' HIBCH 5' CGACGCCTGGAGGAAATAGT 3' 5' TCACGTGTGTGTGGAGATCG 3' INPP1 5' GAGCAGCACAAGAGTCCCAT 3' 5' CCTGGAGAATGCCTGGACTG 3' MFSD6 5' CGGCTGCACTGAGGTAAGAA 3' 5' TGGGGCCCCTGTATTAAAAGC 3' NAB1 5' CCGGGGCCCTAAACCTATTT 3' 5' GGAAGCCTGCAAAGTAAACCC 3' GLS 5' CCAAAGTGCAGTGCTTCATCC 3' 5' GTGGAGGCAGTACCAGAGC 3' MYO1B 5' CATGGTCTCCAGCTCGCC 3' 5' CGCGCCTGTCCCAATATGA 3' NABP1 5' TTGGTCACGCGTCCTATCTC 3' 5' CCAGAACGCGGTTAGGAAGT 3' SDPR 5' CAGGACTGGCAGAGGTTCAG 3' 5' ATACGTTGTTCCCGGTCCTG 3' TMEFF2 5' GGGGCATTTCCTTGTGATGC 3' 5' GCAGGGGATGGCAAGATA 3' LIFR 5' AACTGAACCCCTGTCGTTCC 3' 5' ACTCCATGGTGAAGGAAAAATGA 3' OSMR 5' TCCACTGGAAATCACCGAGC 3' 5' TTGCCGCAAAGTGTGTAACG 3' EGFR 5' CGATGGACGGGATCTTAGGC 3' 5’ AAGAGATCATTGGAGGCCGTG 3’ PDGFRA 5’ GCTCTGGGAAACTTCTCCTCC 3' 5' TCGTCCTGGGACAACCAATG 3' IL2RA 5' TGGGACTCCTGAACTGGGAA 3' 5' ATCAGGCTGAGGGTCTTTGC 3' IL9R 5' TATAAGCCAGGTCACCCCGA 3' 5' AGCTCTTTGGGAAGAGACGC 3' IL21R 5' CTGGTCTTGCCAGGTAAGGG 3' 5’ CAGACGGCAGGCGACCTT 3’ IL27 5’ GGCAGGTGAGATTCCGCAAAG 3’ 5’ CTCCCAGAACTTCAGCGTGT 3’ IL28RA 5’ CGCGTCCCTTGAACTTGTTG 3' 5’ AAATTCAGCCTGGCAGCTCT 3’ IL31RA 5’ TGGACTCCAAGTGCAGGTTA 3' 5' TGAAGCCACGTCCTTCATCC 3' EB13 5' TTCCCCGTAGTCTGTGAGGT 3' 5' TGCACCACCAACTGCTTAGC 3' GAPDH 5' GGCATGGACTGTGGTCATGAG 3' Primer Table