The Human DNA Repair Gene, ERCC2 (XPD)

[CANCERRESEARCH54,3837â€”3844,July15,1994] The Human DNA Repair Gene, ERCC2 (XPD), Corrects Ultraviolet Hypersensitivity and Ultraviolet Hypermutability of a Shuttle Vector Replicated in Xeroderma Pigmentosum Group D Cells

Engin M. GÃ¶zÃ¼kara,'Christopher N. Parris,2 Christine A. Weber,3 Edmund P. Salazar, Michael M. Seidman, John F. Watkins, Louise Prakash,4 and Kenneth H. Kraemer@

Laboratory ofMolecular Carcinogenesis, National Cancer Institute, NIH, Bethesda, Maryland 20892 fE. M. G., C. N. P., M. M. S., K. H. K.J; Biology and Biotechnology Research Program, Lawrence Livermore National Laboratory, Livermore, California 94550 [C. A. W., E. P. S.]; Otsuka Pharmaceuticals, Rockville, Maryland 20850 [M. M. 5.1; and Department ofBiophysics, University ofRochester School ofMedicine, Rochester, New York 14642 [J. F. W., L. P.]

ABSTRACT from defects in at least 8 different genes (complementation groups Aâ€”Uplusa variant form) (2, 6, 7). Recently, the ERCC2 (XPD) gene To determine the contribution of a human DNA repair gene, ERCC2 (8), which was originally discovered because of its ability to correct (XPD), to mutagenesis in human cells, two ERCC2 (XPD).transformed defective excision repair in Chinese hamster ovary cells of comple xeroderma pigmentosum complementation group D (XPD) cell lines with increased 1W survival compared to XP6BE(SV4O), the original XPD line, mentation group 2 (9), was reported to correct the excision repair were studied: D6BE-ER2-2 with slightly increased UV survival; and defect in XP cells from complementation group D (10â€”12).In order D6BE-ER2-9 with normal UV survivaL ERCC2 (XPD) antibody-reactive to examine the extent of correction of the characteristic UV hyper protein levels were elevated 4.8-fold in D6BE-ER2-2 and 17.6-fold in mutability in XP6BE(SV4O), we examined two XP6BE(SV4O) clones D6BE-ER2-9 relative to XP6BE(SV4O). DNA repair ability was assessed (D6BE-ER2-2 and D6BE-ER2-9) expressing different levels of the by measuring the abifity of the cells to restore expression to UV.treated transfected ERCC2 (XPD) gene (12). plasmids. Transfection of pRSVcat exposed to 1000 JIm2 UV resulted in Plasmid host cell reactivation assays (13â€”22)were used to measure 0.3% chloramphenicol acetyltrnnsfernse activity in XP6BE(SV4O) cells the ability of the ERCC2 (XPD)-transformed XP6BE(SV4O) cells to but 20â€”80%in D6BE-ER2.2, D6BE-ER2-9, and repair-proficient cells repair DNA damage or to introduce mutations into UV-treated DNA. compared to untreated control plasmids. The 1W hypersensitivity of the DNA repair was assessed with a nonreplicating plasmid containing mutagenesis shuttle vector pSP189 in XP6BE(SV4O) cells was partially corrected and the UV hypermutabifity and excess ofG:Câ€”'A:T mutations the bacterial CAT gene and mutations were measured by use of the ofpSPl89 fell to the normal range in D6BE-ER2.2 and D6BE-ER2-9 cells. replicating shuttle vector plasmid, pSP189 (15, 19, 21). We found However, the frequency of plnsmids recovered with multiple base substi increased plasmid survival and decreased mutation frequency in the tution mutations was significantly reduced with XP6BE(SV4O) cells and XP6BE(SV4O) cells expressing the ERCC2 (XPD) gene in compari remained low in D6BE-ER2-2 and D6BE-ER2-9 cells, when compared son to the parental XP6BE(SV4O) line. However, the classes of with the normal fibroblasts. The human DNA excision repair gene, mutations recovered remained different from those with the normal ERCC2 (XPD), substantially corrected the plasmid UV hypersensitivity line and the correlation between the extent of correction and the level and UV hypermutabiity of xeroderma pigmentosum complementation of ERCC2 (XPD) protein varied with different biological end points. group D cells; however, the dose response relationship varied for different end points. MATERIALS AND METhODS INTRODUCTION Cells. XP6BE(SV4O)[GM8207}an SV4Oimmortalized skin fibroblast line Exposure of cells to UV radiation produces DNA damage which, if established from a 19-year-old female with xeroderma pigmentosum, comple not properly repaired before cell division, may lead to cell death, mentation group D (4, 17) and an SV4Oimmortalized DNA repair proficient mutations, or carcinogenic transformation. Skin cancers, which are the fibroblast line (GM0637) were obtained from the Human Genetic Mutant Cell most frequent type of neoplasm in Caucasians, often result from Repository, Camden, NJ. The human nucleotide excision repair cross-comple menting rodent complementation group 2 [ERCC2 (XPD)] gene (8, 9) con repeated exposure of the skin to sunlight (1). Efficient DNA repair tamed in p2E-ER2, a complementary DNA expression construct, was trans events play an important role in the survival of the cell after UV fected into the XP6BE(SV4O) cells at Lawrence Livermore National damage. ,@p6is a rare autosomal recessive disease with sun sensitiv Laboratory, Livermore, CA (10), and two cell lines were selected from ity, pigmentary abnormalities, and greatly elevated frequency of skin independent G418-resistant cells (12), D6BE-ER2-2 and D6BE-ER2-9. The cancer (2â€”5).XP cells have defective DNA excision repair resulting cells were grown in Dulbecco's modified Eagle's medium supplemented with 20 mr@tL-glutamine (Gibco BRL) and 10% fetal bovine serum (S and S Media) Received 10/27/93; accepted 5/13/94 in an 8% CO2 humidified incubator. D6BE-ER2-2 and D6BE-ER2-9 cell lines The costs of publication of this article were defrayed in part by the payment of page were grown in the same medium with the addition of 0.6 mg/ml geneticin, 100 charges. This article must therefore be hereby marked advertisement in accordance with units/mi penicillin G, and 100 mg/mI streptomycin. 18 U.S.C. Section 1734 solely to indicate this fact. Cell Survival Study. Post-UV cell survival was measured by a growth 1 Present address: Inonu University Medical School, Department of Biochemistry, 44069 Malatya, Turkey. inhibition assay using microwell plates (23). Briefly, 50,000 cells were plated 2 Present address: Biology and Biotechnology Research Program, Lawrence Livermore in each well of a 6-well culture chamber; 24 h later the medium was removed National Laboratory, Livermore, CA 94550. and the cells were washed twice with phosphate-buffered saline without 3 Work performed at Lawrence Livermore National Laboratory under auspices of the United States Department of Energy under Contract W-7405-ENG-48. calcium and magnesium. UV irradiation was performed with an unfiltered 4 Work supported in part by United States Department of Energy Grant DE-FGO2- germicidal lamp at a dose rate of 1.42â€”1.47J/m2 sec as measured with a 92ER60621.Presentaddress:ScalyCenterfor MolecularScience,UniversityofTexas calibrated International Light Company, model 12770A radiometer with a Medical Branch, Galveston, TX 77555-1061. PT171C detector. Duplicate wells were exposed to 0, 1.5, 3, or 6 i/rn2 UV and 5 To whom requests for reprints should be addressed, at Laboratory of Molecular Carcinogenesis, NC!, Building 37, Room 3E24, Bethesda, MD 20892. fresh complete medium was replaced. Four days later the cells were suspended

6 The abbreviations used are: XP, xeroderma pigmentosum; CAT, chloramphenicol by trypsin-EDTA treatment and the total cell number was determined with a acetyltransferase. Coulter Counter (Coulter Electronics, Hialeah, FL). Cell survival was calcu 3837

Uv MUTAGENESIS CORRECFION BY ERCC2 (XPD) IN XPD CELLS

lated as the ratio of the number of cells per well in the UV-treated wells compared to that in the control, unirradiated wells (23). ERCC2 (XPD) Protein Measurements. Affinity purificationof anti-xe roderma pigmentosum group D antibodies, preparation of immunobeads, and \ . . .NORMAL S â€¢! A immunoprecipitation were carried out as described (24). 80 S Plasmid UV Treatment, Transfection, CAT, and Mutation Assays. The t , V D6BE-ER2-2 â€˜S a pRSVcat and pSP189 plasmids were prepared using standard techniques as -J described previously (16, 19). For UV treatment (0â€”1000i/rn2)the plasmid DNA was diluted to 31 @g/mlinsterile glass-distilled water on ice. Transfec > 60 SI > SI tion was performed by using calcium phosphate/DNA precipitation (14, 16). @1 Cells (1 X 106)were transfected with 2 pg plasmid for 12 h after which the S a Cl) S @ cells were allowed to grow another 36â€”48h. â€˜ N Lu For the CAT assay, cells were transfected with UV-treated or untreated > 40 pRSVcat and CAT assays were performed according to the scintillation cock I- V Ni tail extraction procedure of Neumann et aL (25) except no carrier acetyl-CoA -I . was added and 1 @.&Ci[3H]acetyl-CoAwas used per assay. Enzyme activity was Lu determined after 10, 20, and 30 mm incubation. Protein determination was 20 U performed with Bio-Rad protein assay and enzyme activity was expressed as @ flM mm mg â€˜protein. I For the mutagenesis assay, cells were transfected with UV-treated or un treated pSP189 (15). pSP189, a derivative of the pZ189 mutagenesis plasmid 0 (19),containsa150-basepairmutagenesismarkergene,thebacterialsupF 0 1 2 3 4 5 6 tRNA. pSP189 has a randomly synthesized signature patch permitting identi fication of twin and independent mutations. Replicated plasmid was recovered uv DOSE TO CELLS (J.m2) from the human cells by alkaline lysis and used to transform indicator bacteria Fig. 1. Post-UV survival of XP6BE(SV4O) cells containing ERCC2 (XPD) compared by electroporation as described by Parris and Kraemer (26). White or light blue to XP6BE(SV4O) and normal cells. Survival of ERCC2 (XPD)-containing D6BE-ER2-9 colonies indicating a mutated (inactivated) supF gene were scored in a stan and D6BE-ER2-2 cells compared to XP6BE(SV4O)and repair-proficient (normal) cells measured 4 days after exposure to 1.5 to 6 J/m2 UV. Each point represents the mean of dard microbiological screen. The total number of colonies reflects plasmid two or three independent experiments. Bars, SD. survival while the proportion of white or light blue colonies gives an estima tion of plasmid mutation frequency. Mutant white or light blue colonies were subjected to sequence analysis according to the protocol of the manufacturer @ (Sequenase; United States Biochemicals, Cleveland, OH). kDa 2 3 4 Least square regression curves were plotted for CAT activity, plasmid survival, and plasmid mutation frequency using a first order (linear) polyno mial using SlideWrite Plus (Advanced Graphics Software, Inc., Sunnyvale, 200â€” CA). Fisher's exact test was used to evaluate the significance of differences in mutation frequencies. Single tailed P values are presented. 116â€” RESULTS 97â€”

Cell Survival. Xeroderma pigmentosum complementation group D [XP6BE(SV4O)] cells, two XP6BE(SV4O) cell lines containing the human DNA repair gene ERCC2 (XPD) (D6BE-ER2-2 and D6BE 66â€” ER2-9), and repair proficient normal human fibrobbasts were exposed

to UV radiation and cell survival was measured (Fig. 1). The XP6BE(SV4O) cells showed typical hypersensitivity to UV with a survival approximately 20% of the untreated cells after exposure to 1.5 i/rn2. This level is similar to the UV hypersensitivity previously 45â€” reported for these XP6BE(SV4O) cells (17). The D6BE-ER2-2 cell line showed an increased survival pattern compared with Fig. 2. Immunoprecipitation of ERCC2 (XPD) protein from human cells. Extracts from XP6BE(SV4O) cells with a survival of about 40% [P < 0.15 versus 1.3 X i07 cells (i0@ cells for strain GM0637) were incubated with anti-ERCC2 (XPD)/ XP6BE(SV4O)] after 1.5 JIm2. The D6BE-ER2-9 cells had a survival protein A immunobeads. Bound proteins and immunoglobulins were eluted from the similar to that of the normal cells, about 75% after 1.5 JIm2. Thus the beads by treatment with 2% sodium dodecyl sulfate and analyzed by immunoblotting. Nitrocellulose blots were probed with anti-ERCC2 (XPD). Lane 1, GM0637; Lane 2, extent of correction of the UV hypersensitivity differed in the two XP6BE(SV4O);Lane 3, D6BE-ER2-2; Lane 4, D6BE-ER2-9. The major band is located XP6BE(SV4O) lines containing the cloned ERCC2 (XPD) gene; at M, 85,000 (kDa). The faint bands at M, â€”50,000are reduced anti-ERCC2 (XPD) D6BE-ER2-2 had slightly elevated survival and D6BE-ER2-9 had immunoglobulin chains. Ordinate, position and size of protein standards. normal survival. ERCC2 (XPD) Protein. The amountof ERCC2(XPD) proteinin and D6BE-ER2-9 cells (Fig. 2, Lanes 3 and 4) was 4.8- and 17.6-fold the cell lines was determined using immunoprecipitation and immu higher, respectively, than that from the XP6BE(SV4O) cells. nobbotting (Fig. 2). The major band of immunoreactive protein recov CAT Activity. We used the UV-treatedpRSVcatplasmidto meas ered from all 4 cell lines was located at about Mr 85,000, in good ure DNA repair ability of the XP6BE(SV4O) cells (Fig. 3). This assay agreement with the predicted molecular weight of 86,900 (8). The reflects the cellular repair of damaged DNA by using transcriptional amount of immunoreactive ERCC2 (XPD) protein was similar in the activity measured indirectly as enzyme activity of the transfected gene normal cell extracts compared to the XP6BE(SV4O) cells (Fig. 2, (16). The XP6BE(SV4O) cell line showed a steep inactivation curve Lanes 1 and 2). Densitometric scans of the Western blot revealed that for CAT activity. This curve is similar to that previously reported for the amount of ERCC2 (XPD) protein extracted from the D6BE-ER2-2 Uv inactivation of pRSVcatSVgpt in this same cell line (16). In 3838

mid mutation frequency of the supF gene was 0.01â€”0.04% in the XP6BE(SV4O), D6BE-ER2-2, D6BE-ER2-9, and normal fibroblast cell lines, a frequency similar to that previously reported for pZ189 in the XP6BE(SV4O) cells (17, 18). The mutation frequency increased linearly with UV dose to the plasmid in all four cell lines (Fig. 5). I- With a dose of 1000 i/rn2 to the plasmid, the increase was greatest > with the XP6BE(SV4O) cells, amounting to more than 1500-fold I- above background but with the normal cells the increase was elevated U only 155-fold above background. The mutation frequency in plasmids transfected into the D6BE-ER2-2 and D6BE-ER2-9 cells was similar I- to that with the normal cells. For example, after treatment with 500 U i/rn2, the plasmid mutation frequency was 11.7% in XP6BE(SV4O), Lu > 1.5% in D6BE-ER2-2, 2.6â€”6.8% in D6BE-ER2-9, and 2.3% in nor I. mal fibrobbast line (Fig. 5). Thus, addition of the ERCC2 (XPD) gene @1 to the XP6BE(SV4O) cells reduced the post-UV plasmid mutation Lu frequency to close to the normal range although the extent of correc tion was similar in both cell lines despite different levels of ERCC2 (XPD) protein. Mutation Analysis. Mutant plasmids were purified from white or 0 200 400 600 800 1000 light blue colonies, and the mutations inactivating the supF tRNA gene were characterized by DNA sequence analysis. DNA from 373 uv DOSETO PLASMID(J.m2) mutant plasmids was analyzed from the four cell lines (Table 1). As Fig. 3. Relative CAT activity of UV-treated plasmid in XP6BE(SV4O)cells containing reported previously for UV mutations in this system (13, 14, 18, 22, ERCC2 (XPD) compared to XP6BE(SV4O) and normal cells. Relative CAT activity (reflecting rate of DNA repair) of UV-treated pRSVcat in ERCC2 (XPD)-containing 26, 27), most of the plasmids contained point mutations and only 2% D6BE-ER2-9 and D6BE-ER2-2 cells compared to XP6BE(SV4O) and repair proficient had frame-shift mutations. The point mutations were classified as (normal) cells measured 2 days after transfection with plasmid treated with 100â€”1000 having single base changes, tandem mutations (2 base substitutions J/m2 UV. Each point represents the mean of the duplicate samples in an independent experiment. ,@ 0â€”2bases apart, or 3 adjacent base substitutions) or multiple muta tions (3 or more nonadjacent mutations or 2 mutations 3 or more bases apart). With all 4 cell lines the most abundant mutations (78â€”83%) marked contrast, the D6BE-ER2-2 and D6BE-ER2-9 cells containing were single base substitution mutations. The second most common ERCC2 (XPD) showed normal CAT expression with only slight type of mutations were tandem base substitutions, amounting to inactivation with increased dose of UV. For example, with plasmid 6â€”11% of the plasmids analyzed with all 4 lines. The frequency of exposed to 1000 JIm2 UV, 20â€”80% of activity was observed in plasmids with multiple base substitutions was significantly greater D6BE-ER2-2, D6BE-ER2-9, and normal fibroblasts, but only 0.3% with the normal line (16%) than with the XP6BE(SV4O) line (3%) activity was measured in the XP6BE(SV4O) cell line (Fig. 3). This (P = 0.003). The cell lines containing the ERCC2 (XPD) gene also result indicates that addition of the human ERCC2 (XPD) gene corrected the reduced expression of UV-treated plasmid present in the XP6BE(SV4O) cells. However, the extent of correction was similar in both cell lines despite different levels of ERCC2 (XPD) protein. Plasmid Survival. The plasmid, pSP189, was used to measure mutation induction in the XP6BE(SV4O) cells. This assay measures -I both transcription (SV4O T-antigen) and replication of the UV dam aged plasmid. UV-treated plasmid was introduced into the cell line and after 48 h the replicated plasmids were harvested and introduced Cl) into bacteria. The yield of bacterial colonies reflects plasmid survival (Fig. 4). With increasing UV dose the relative number of bacterial colonies Cl) formed decreased sharply in the XP6BE(SV4O) cells. This plasmid -I survival curve was similar to that previously reported with the Lu XP6BE(SV4O) cells using the plasmid pZ189 (17, 18). UV-treated I- plasmids replicated in D6BE-ER2-2 and D6BE-ER2-9 cells showed @1 survival intermediate between survival in the XP6BE(SV4O) and in Lu the normal cells. For example, after treatment with 500 J/m2 survival was 3% in XP6BE(SV4O) cells, approximately 20% in D6BE-ER2-2 and D6BE-ER2-9 cells, and 90% in the normal fibrobbasts (Fig. 4) 0 200 400 600 800 1000 compared to untreated plasmid. This result suggests that in the D6BE uv DOSETO PLASMID(J.m2) ER2-2 and D6BE-ER2-9 cells, the human DNA excision repair gene ERCC2 (XPD) partially corrected the ability of XP6BE(SV4O) cells to Fig. 4. Repair of UV-treated plasmid pSP189 in XP6BE(SV4O) cells containing replicate UV-damaged plasmid. As with the pRSVcat plasmid assay ERCC2 (XPD) compared to XP6BE(SV4O) and normal cells. Relative survival of UV treated pSP189 in ERCC2 (XPD)-containing D6BE-ER2-9 and D6BE-ER2-2 cells corn (Fig. 3), the extent of correction was similar in both cell lines despite pared to XP6BE(SV4O)and repair-proficient (normal) cells measured 2 days after trans different levels of ERCC2 (XPD) protein. fection with plasmid treated with 100â€”1000i/rn2 UV. Plasmid survival was measured by transforming indicator bacteria to ampicillin resistance with replicated plasmid recovered Plasmid Mutation Frequency. The proportionof bightblue or from the human cells. Each point represents the mean of the 2 to 3 replicate samples in white colonies reflects the mutation frequency. The spontaneous plas an independent experiment. 3839

cells (8%) increased to normal levels with the D6BE-ER2-2 (20%, P = 0.008). The frequencies of single or tandem base substitution

a mutations of all types with the D6BE-ER2-9 (Table 2, Column B) and z D6BE-ER2-2 (Table 2, Column C) cells were not significantly dif â€˜C ferent from that with the normal cells (Table 2, Column A), with the I- exception of an increased frequency of A:Tâ€”@G:Ctransitions with the I D6BE-ER2-9 cells (P = 0.02). Mutation Spectrum. The location of the single and tandem base substitution mutations in the supF gene from plasmids recovered from all 4 cell lines is shown in Fig. 6. Virtually all the mutations were found within 76 base pairs of the supF gene coding sequence. The G:Câ€”@A:Tbase substitution mutations were the major mutations in plasmids recovered from the XP6BE(SV4O), D6BE-ER2-2, D6BE ER2-9, and normal cell lines. These mutations were located at several strong hot spots in each cell line. There was a major hot spot at position 156 with all 4 cell lines. With the XP6BE(SV4O) cell line (Fig. 6D), there were strong hot spots at base pairs 155, 156, and 163 with weaker hot spots at 0 200 400 600 800 1000 positions 139, 164, 168, and 169 within the supF gene. With the uv DOSE TO PLASMID(J.m2) D6BE-ER2-2 cells (Fig. 6C) the strongest hot spots were also at Fig. 5. Mutagenesis of UV-treated plasmid pSP189 in XP6BE(SV4O)cells containing positions 155 and 156. The hot spots at base pair 163 was significantly ERCC2 (XPD) compared to XP6BE(SV4O) and normal cells. Mutation frequency of weaker than with the XP6BE(SV4O) cells. A new hot spot was present UV-treated pSP189 in ERCC2 (XPD)-containing D6BE-ER2-9 and D6BE-ER2-2 cells at base pair 133, a site with no mutations with XP6BE(5V40) cells, compared to XP6BE(SV4O) and repair proficient (normal) cells measured 2 days after transfection with plasmid treated with 100â€”1000JIm2 UV. Mutations in the supF marker and the hot spot at base pair 159 increased significantly. With the gene of pSP189 were measured by transforming indicator bacteria to ampidillin resistance D6BE-ER2-9 cells (Fig. 6B) the strongest hot spots were at positions with replicated plasmid recovered from the human cells and scoring for loss of suppressor 156 and 123â€”124and new hot spots were present at position 133 and tRNA function by changes in colony color on indicator plates. Each point represents the mean of the 2 to 3 replicate samples in an independent experiment (the same transfections in a cluster at positions 108â€”110.Remarkably, with the D6BE-ER2-9 as in Fig. 3). cells no mutations were found at base pair 155, the first and second

showed a significantly lower frequency of plasmids with multiple Tableshuttlevector 2 Types of single or tandem base substitution mutations in UV-treated pSPl8P replicatedthehuman in xeroderma pigmentosum group D cells containing base substitution mutations [D6BE-ER2-9 (5%), P = 0.014; D6BE DNA repair(XPD)No. gene, ERCC2 ER2-2 (1%), P = 0.0001] compared to the normal line. Only 6 (%)aA. of mutations plasmids with single or tandem base deletions were observed among all 4 cell lines and no base insertion mutations were detected. GM0637XP6BE(SV4O)cells B. D6BE-ER2-9 C. D6BE-ER2-2 D. The types of single and tandem base substitution mutations found cellsTransitions cells cells with UV-treated pSP189 plasmids are shown in Table 2. All six 70 (82)b 85 (87) 82 (80)c 85 (92) (90)A:Tâ€”*G:CG:Câ€”'A:T 70 (82) 79 (81)d 82 (@J)b 83 possible types of base substitution mutations were found. With all 4 2(2)Transversions 0(0) 6(6)e 0(0) cell lines, the major mutation was the G:Câ€”@'A:Ttransition amounting (8)G:Câ€”'T:A 15 (18)b 13 (13) 21 (20)c 7 to 80â€”90%of the mutations. As in previous studies with the shuttle 2(2)G:Câ€”*C:G 7(8) 8(8) 7(7) vector plasmid, the frequency of transition mutations was higher with 2(2)A:Tâ€”'T:A1(1) 2(2) 6(6) 2(2)A:T-*C:G 7(8) 3(3) 8(8) the XP6BE(5V40) cells (92%) (Table 2, Column D) than with the 1(1)Total 0(0) 0(0) 0(0) normal cells (82%) (Table 2, Column A) (P = 0.03). Introduction of 92(100)a 85 (100) 98 (100) 103 (100) the ERCC2 (XPD) gene reduced the frequency of G:Câ€”@A:Tmuta Mutantswere recovered from plasmids treatedwith 100-1000 i/rn2 with the normal tions with the D6BE-ER2-9 cells to 81% (P = 0.05)(Table 2, Column (GM0637)andD). cells (Column A) and 100-500 J/m2 UV with the XP cells (Columns B, C, B) and with the D6BE-ER2-2 cells to 80% (P = 0.03) (Table 2, @ bD).C 0.03 versus XP6BE(SV4O) cells (Column Column C), values not significantly different from that with the p 0.008 versus XP6BE(SV4O) cells (Column D). normal cells (Table 2, Column A). Similarly, the frequency of trans dpD).e o.os versus XP6BE(SV4O) cells (Column version mutations which was abnormally low with the XP6BE(SV4O) p 0.02versusnormal(GM0637)cells(ColumnA).

Table 1 Mutations in WI-treated shuttlevector pSP189 replicated inxeroderma pigmentosum(XPD)No. group D cells containing the human DNArepair gene, ERCC2 (%)â€œA. of plasmids with base changes

cellsIndependent GM0637 cellsB. D6BE-ER2-9 cells C. D6BE-ER2-2 cellsD. XP6BE(SV4O) (100)88(100)Pointplasmids sequenced94 (100)95 (100) 96 mutations Single base substitutions (78) (82) 83 (87) Tandem base substitutions 6 (6) 12 (1 12 10 (10) 9(10) (3)CFrame-shiftMultiple base substitutions73 15 (16)78 5 (5) 1 (1)c74(84) 3 mutations Single or tandem base deletions02 (2) 2 (2)2 (2) a Mutants were recovered from plasmids treated with 100â€”1000i/rn2with the normal (GM0637) cells (Column A) and 100â€”500i/rn2UV with the XP cells (Columns B, C, and D). @ b o.oi versus normal (GM0637) cells (Column A).

C p < o.oo@i versus normal (GM0637) cells (Column A). 3840

3' CCACCCCAAGGGCTCGCCGGTTTCCCTCGTCTGAGATTTAGACGGCAGTAGCTGAAGCTTCCAAGCTTAGGAAGGGGG @ IIIIII II --100 - 110 - 120 - 130 . 140 - 150 - 160 . 170- IIIIIIII 5'GGTGGGGTTCCCGAGCGGCCAAAGGGAGCAGACTCTAAATCTGCCGTCATCCACTTCGAAGCTTCGAATCCTTCCCCC A A IIA_AA T MAA A TIITA T A TA II T TTI_A AAAA A T A A TA AA I TT TG TA AA I TA A T TT A AA TA T A TA I TA A TA TA A A A

I A NORMAL IIIIIII .lOO 110 120 130 140 150 160 170 IIIIIII I A ITTA TAAAA A TG I I AIflAGA TA G II A TT A P111 AA C IC A A AGA IIII Til AA A A AGA III III AA A AAAI II AA C IAAI @ Fig. 6. Location of independent single and tandem I A AAI base substitution mutations found in UV-treated pSP189 passed through XP6BE(SV4O) cells containing L_J A AA A A ERCC2 (XPD) compared to XP6BE(SV4O) and normal cells. A portion of the supF suppressor tRNA marker U A gene in pSPI89 is shown. Base substitutions are mdi A cated below the altered base pair as a change in the A lower strand. Each letter represents the mutation found A in a sequenced independent plasmid. Tandem or closely A spaced base substitutions in a single plasmid are mdi A cated by underlining. A, plasmid mutation data [the A normal line (85 base substitutions)1; B, D6BE-ER2-9 I (98basesubstitutionsincludingaGâ€”*Abasesubstitu tion at base pair 73 not shown); C, D6BE-ER2-2 (103 B D6BE-ER2-9 base substitutions); and D, the XP6BE(SV4O)line (92 IIIIIII base substitutions including a tandem GOâ€”'AAmuta --100 110 120 130 140 150 160 170 tion at base pairs 72â€”73not shown). Mutants were IIIIIII recovered from plasmids treated with 100â€”500i/rn2 A AA@4T TT AA TMA A I I I A I TATIA TI_I TTAAII UV with the XP cells and 100â€”1000i/rn2with the AAT I AA A C I I Al TAIA TC normal cells. U-shaped brackets (or inverted U-shaped A TA IC I A TAIA flc brackets), plasmid sequenceswith increased(or de A C TA IA creased) frequency of mutations relative to those with A C TAA theXP-Dcells.Arrow,mutationalhotspotat position U TA Al 155 with the D6BE-ER2-2 cells. TA A TA A TA A TA A TA A TA U I I I I T@ C D6BE-ER2-2 IIIIIII --100 110 120 130 140 150 160 170 IIIIIII AAAAA TTAAA G AAAACA A I Al TAIA TA IICII A TA AA I A TA A TA TI II A IC T A TA A TA TT II I TA TC TI II TA II TA TA TA TA TA A A D XP6BE(SV4O)

3841

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 1994 American Association for Cancer Research. Uv MIJTAGENESISCORRECFION BY ERCC2 (XPD) IN XPD CELLS strongest hot spots, respectively, for the XP6BE(SV4O) and D6BE DNA and DNA.RNA helicase activities (8, 38â€”40). Like the DNA ER2-2 lines and a weak hot spot with the normal line. repair gene ERCC3 (XPB), ERCC2 (XPD) may also function as part The mutation spectrum of plasmids passed through the normal cells of a transcription complex (7). (Fig. 6A) showed strongest hot spots at base pairs 156, 155, and 163 The molecular defect in the ERCC2 (XPD) gene of the and weaker hot spots at base pairs 122â€”124.This hot spot pattern is XP6BE(SV4O) cell line we studied has not yet been fully character not significantly different from that of the XP6BE(5V40) cells. The ized (12). The amount and size of ERCC2 (XPD) immunoreactive normal cells had a similar mutation spectrum to the D6BE-ER2-9 and protein were similar in the XP6BE(SV4O) and the normal cells. This D6BE-ER2-2 cells, with the major hot spots at base pair 156 and in suggests that the XP6BE(SV4O) phenotype is not due either to re the 123â€”125cluster. However, the cluster of mutations at positions duced levels of ERCC2 (XPD) protein or to mutations in the gene 108â€”110was significantly larger with the D6BE-ER2-9 cells than which causes large deletions in the transcribed product (12). with the normal cells (P 0.03). In addition, the hot spot at position Flejter et a!. (1 1) transfected a genomic ERCC2 (XPD) gene con 133 was present in the D6BE-ER2-2 and D6BE-ER2-9 cells but tamed in a 48-kilobase cosmid insert in p5T4-1-27 into the same absent in the normal and XP6BE(SV4O) cells. XP6BE(SV4O) line we studied and recovered 2 UV-resistant clones. They reported that the clone they designated XPD/ERCC2-6 con ferred â€œnearlycomplete correctionâ€•of the UV sensitivity associated DISCUSSION with XP6BE(5V40) cells but ERCC2 (XPD) protein levels were not Mutagenesis in skin cells due to damage of cellular DNA by UV is measured. In addition, they did not isolate the 19-kilobase segment of a crucial step in carcinogenesis and is one of the few identified types the cosmid containing the ERCC2 (XPD) gene (9). We studied two of DNA damage directly linked to cancer in humans (1, 28). Brash et other independent XP6BE(SV4O) clones transfected with an ERCC2 a!. (29) found that squamous cell carcinoma from sun exposed skin (XPD) complementary DNA expression plasmid (12). The level of had a high frequency (58%) of G:Câ€”+A:Tmutations in the p53 tumor ERCC2 (XPD) protein was elevated about 5-fold in D6BE-ER2-2 and suppressor gene and that 20% of the tumors contained CCâ€”@iT 18-fold in D6BE-ER2-9, cells with slightly elevated and normal UV double base change mutations, features which are characteristic of survival, respectively (Fig. 1) indicating a partial correlation with UV UV mutagenesis with shuttle vector plasmids (Refs. 13â€”15,17â€”22; survival. Fig. 6). ERCC2 (XPD) and DNA Repair. ProtiÃ©-SabljiÃ©andKraemer (16) Xeroderma Pigmentosum. Patientswith the rareautosomalreces found that xeroderma pigmentosum complementation group A and D sive disease, xeroderma pigmentosum have defective DNA repair cell lines [including the same XP6BE(5V40) line we studied] were with extreme sensitivity to sun exposure (5). Xeroderma pigmentosum much more sensitive to inhibition of CAT expression by UV treatment patients develop skin cancers at an early age (median age of first skin of the nonrepbicating plasmid pSV2catSVgpt than repair-proficient cancer less than 10 years) at a frequency 1000-fold greater than the cells, including the normal (GM0637) cell line we examined. In these general population (3). Cells from most xeroderma pigmentosum very sensitive DNA repair-deficient xeroderma pigmentosum cells, patients are hypersensitive to the lethal and mutagenic effects of one pyrimidine dimer was sufficient to inactivate expression of the UV (2). transfected CAT gene, presumably by blockage of transcription by the Cell fusion studies have shown that there are seven xeroderma unrepaired DNA photoproducts (16). As shown in Fig. 3, the pigmentosum complementation groups (XPA to XPG) and a variant XP6BE(5V40) cell line transfected with UV-treated pRSVcat showed form (XPV), presumably due to mutations of different genes (2, 4, 7). a steep inactivation curve for CAT activity similar to that reported Human genes correcting complementation XP groups A [XPA (30)], previously (16). In contrast, the D6BE-ER2-2 and D6BE-ER2-9 lines B [XPB = ERCC3 (31)], C [XPC (32)1, D [XPD = ERCC2 (10)], G showed CAT inactivation in the normal range. This result suggests [XPG = ERCCS (33, 34)] and Cockayne syndrome complementation that the human DNA excision repair gene ERCC2 (XPD) corrected group B [CSB = ERCC6 (35)] have recently been identified. Parallel the DNA repair defect to the extent that transcription blocking lesions studies in DNA repair-deficient Chinese hamster ovary and yeast were removed in the D6BE-ER2-2 and D6BE-ER2-9 cell lines. How mutant cells have revealed convergent paths of DNA repair and ever, the extent of correction was similar with both cell lines despite sequence homologies among the DNA repair genes and proteins different levels of ERCC2 (XPD) protein. identified (6, 7). Previous experiments indicated that survival of the UV-treated The clinical features of patients in xeroderma pigmentosum replicating shuttle vector pZ189 in the XP6BE(SV4O) fibrobbasts complementation group D are remarkably heterogeneous (2, 5). Most (17, 18) was much less than in the normal line, reflecting the UV have the skin features of xeroderma pigmentosum with sun sensitivity, hypersensitivity of the XP6BE(SV4O) cells. We found a similar result marked freckling, and increased frequency of skin and eye cancer. with the related plasmid pSP189 transfected into the XP6BE(5V40) Some of these patients have progressive neurological abnormalities cells (Fig. 4). The relative survival of UV treated plasmid was much with onset in their second decade of life. One XPD patient was higher with the D6BE-ER2-2 and D6BE-ER2-9 cells but was bower described who had clinical features of both xeroderma pigmentosum than with the normal line indicating partial correction of the plasmid with skin cancer and Cockayne syndrome (5, 36). In addition, cells survival defect. Again, the extent of correction was similar with both from patients with a photosensitive form of trichothiodystrophy cell lines despite different bevels of ERCC2 (XPD) protein. (without xeroderma pigmentosum) have the cellular defect of ERCC2 (XPD) and Mutations. Seetharamet a!. (18) showed that xeroderma pigmentosum complementation group D (37). The re the frequency of mutations in pZ189 after UV treatment increased in lationship among these different clinical phenotypes and the XPD a dose-dependent manner, and the XP6BE(SV4O) cells showed 6-fold gene defect is presently unknown. higher mutation frequency after a dose of 500 JIm2 to the plasmid than ERCC2 (XPD) Gene and XPD. The human ERCC2 (XPD) gene did normal cell lines. Our experiments with pSP189 showed a similar on chromosome 19 corrects the DNA excision repair defect in Chi linear increase in mutation frequency as a function of UV dose, and nese hamster ovary complementation group 2 cells and encodes a after 1000 J/m2 this increase was about 5-fold greater in the protein of 760 amino acids (8, 9). ERCC2 (XPD), a DNA hebicase XP6BE(SV4O) fibroblasts than with the normal cells (Fig. 5). A (24), bears sequence homology to the yeast RAD3 gene which codes similar plasmid UV hypermutability was previously reported with for a protein with single-stranded, DNA-dependent ATPase as well as cells from XP complementation groups A (14, 26, 27), C (41), F (27), 3842

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 1994 American Association for Cancer Research. Uv MUTAGENESIS CORRECFION BY ERCC2 (XPD) IN XPD CELLS and variant (22, 42). This plasmid hypermutability in the normal cells (Table 1, Columns B and C). This observation suggests XP6BE(SV4O) cells was lowered to the normal range in the D6BE that the process leading to multiple base substitution mutations was ER2-2 and D6BE-ER2-9 cells containing the ERCC2 (XPD) gene not restored by addition of the ERCC2 (XPD) gene. (Fig. 4) without a clear correlation with protein bevels. Similarly, the In summary, our studies indicate that addition of the ERCC2 (XPD) UV hypermutability of UV-sensitive Chinese hamster ovary cell line gene to XP6BE(SV4O) cells while correcting much of the defective UV5 was reduced to the normal range by addition of the ERCC2 phenotype (cell survival, plasmid host cell reactivation repair and (XPD) gene (9). mutagenesis, proportion of G:Câ€”*A:T mutations) may not fully re Base Substitution Mutations. Sequence analysis of more than 350 store mutational properties to those of the wild type cells (frequency independent mutant plasmids from the XP6BE(SV4O), D6BE-ER2-2, of plasmids with multiple mutations and location of mutagenic hot D6BE-ER2-9, and repair-proficient cells revealed that the major mu spots). The relationship between the amount of ERCC2 (XPD) protein tation was the G:Câ€”*A:T transition (Table 2). This finding is in expressed and the extent of correction of the defect varied with the accord with numerous earlier investigations that found that the end point measured. G:Câ€”@A:Ttransition was the major type of UV induced base substi tution mutation (reviewed in Refs. 1 and 14). This mutation involves REFERENCES cytosine rather than thymine and implies that the major UV product, the IT cycbobutane pyrimidine dimer (13), was not the principal I. International Agency for Research on Cancer. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, Vol. 55. Lyon, France: International Agency for mutagenic lesion. The frequency of these G:Câ€”@A:Tmutations was Research on Cancer, 1992. lowered to the normal range by addition of the ERCC2 (XPD) gene 2. Cleaver, i. E., and Kraerner, K. H. Xeroderrna pigmentosum. In: C. R. Scriver, A. L. indicating a correlation at the molecular level. Beaudet, W. S. Sly, and D. Valle (eds.), The Metabolic Basis of Inherited Disease, pp. 2949â€”2971.NewYork: McGraw-Hill Book Co., 1989. Mutation Hot Spots. Several studies of UV mutagenesis with 3. Kraerner, K. H., Lee, M. M., and Scotto, i. Xeroderma pigmentosum. Cutaneous, shuttle vector plasmids have shown that the mutations in the supF ocular, and neurologic abnormalities in 830 published cases. Arch. Dermatol., 123: 241â€”250,1987. gene passed through human cells did not occur randomly but were 4. Robbins, i. H., Kraemer, K. H., Lutzner, M. A., Festoff, B. W., and Coon, H. G. seen at mutational hot spots (13â€”15, 18â€”20, 22, 26, 27, 41). These hot Xeroderrna pigmentosum. An inherited disease with sun sensitivity, multiple cutane spots were at sites of UV photoproducts but did not correlate with ous neoplasms, and abnormal DNA repair. Ann. Intern. Med., 80: 221â€”248,1974. 5. Kraemer, K. H. Heritable diseases with increased sensitivity to cellular injury. in: photoproduct frequency (13). T. B. Fitzpatrick, A. Z. Eisen, K. Wolff, I. M. Freedberg, and K. F. Austen (eds.), The most consistent hot spot was seen at base pair 156 with the Dermatology in General Medicine, pp. 1974â€”1991.NewYork: McGraw-Hill Book Co., 1993. XPA, XP6BE(SV4O), XPC, XPF, XPV, and several normal lines. 6. Friedberg, E. C. Xeroderrna pigmentosurn, Cockayne's syndrome, helicases, and This hot spot was also present with all 4 cell lines studied. The DNA repair: what's the relationship? Cell, 71: 887â€”889,1992. distribution of hot spots of single or tandem mutations with pSP189 in 7. Hoeijmakers, i. H. Nucleotide excision repair. II: From yeast to mammals. Trends Genet., 9: 211â€”217,1993. the XP6BE(SV4O) cells (Fig. 6D) was similar to that with the normal 8. Weber, C. A., Salazar, E. P., Stewart, S. A., and Thornpson, L H. ERCC2: cDNA cells (Fig. 6et). The two lines containing the transfected ERCC2 cloning and molecular characterization of a human nucleotide excision repair gene (XPD) gene differed from the XPD and normal lines by the presence with high homology to yeast RAD3. EMBO i., 9: 1437â€”1447,1990. 9. Weber, C. A., Salazar, E. P., Stewart, S. A., and Thompson, L. H. Molecular cloning of a new hot spot at position 133 with both lines and more intense hot and biological characterization of a human gene, ERCC2, that corrects the nucleotide spots at base pairs 108â€”110and 123â€”124with the D6BE-ER2-9 cells excision repair defect in CHO UVS cells. Mol. Cell Biol., 8: 1137â€”1146,1988. and at base pair 159 with the D6BE-ER2-2 cells. The intense hot spot 10. Lehmann, A. R., Hoeijmakers, i. H., van Zeeland, A. A., Backendorf, C. M., Bridges, B. A., Collins, A., Fuchs, R. P., Margison, G. P., Montesano, R., and Moustacchi, E. at position 155 disappeared with the D6BE-ER2-9 cells. These results Workshop on DNA repair. Mutat. Res., 273: 1â€”28,1992. indicate that the mutational spectrum changed in cells transfected with 11. Flejter, W. L., McDaniel, L. D., iohns, D., Friedberg, E. C., and Schultz, R. A. Correction of xeroderma pigmentosum complementation group D mutant cell phe the ERCC2 (XPD) gene both by addition and by deletion of hot spots. notypes by chromosome and gene transfer: involvement of the human ERCC2 DNA Further studies will be required to establish a linkage between ERCC2 repair gene. Proc. Nail. Acad. Sci. USA, 89: 261â€”265,1992. (XPD) activity and the mutational hot spot patterns. Perhaps the 12. Thompson, L H., Fomace, A. i., ir., Caldecott, K. W., Brookman, K. W., Weber, C. A., Salazar, E. P., and Takayama, K. Recent developments with the human addition of the ERCC2 (XPD) gene altered the pattern of repair of repair genes ERCC2, ERCC4, and XRCCJ. In: V. A. Bohr, K. Wasserman, and individual photoproducts in the marker gene in analogy to the K. H. Kraemer (eds.), DNA Repair Mechanisms, pp. 42â€”53.Copenhagen: Ejnar differential repair of UV lesions noted in the p53 gene in human Munksgaard. 1993. 13. Brash, D. E., Seetharam, S., Kraemer, K. H., Seidman, M. M., and Bredberg, A. skin cells (43). Photoproduct frequency is not the major determinant of UV base substitution hot Multiple Base Substitution Mutations. UV-treated plasmids spots or cold spots in human cells. Proc. Natl. Acad. Sci. USA, 84: 3782â€”3786,1987. 14. Bredberg, A., Kraemer, K. H., and Seidman, M. M. Restricted ultraviolet mutational passed through DNA repair-defective XPA (14, 27), XPC (41), XPF spectrum in a shuttle vector propagated in xeroderma pigmentosum cells. Proc. NatI. (27),andXP6BE(5V40)(18)cellswerepreviouslyfoundto havea Acad. Sci. USA, 83: 8273â€”8277,1986. significantly lower frequency of multiple base substitutions than plas 15. Parris, C. N., and Seidman, M. M. A signature element distinguishes sibling and independent mutations in a shuttle vector plasmid. Gene, 117: 1â€”5,1992. mids passed through repair-proficient cells. This result suggests that 16. ProtiÃ©-SabljiÃ©,M.,and Kraemer, K. H. One pyrimidine dimer inactivates expression the multiple base substitutions are linked to a normally functioning of a transfected gene in xeroderrna pigmentosum cells. Proc. NatI. Acad. Sci. USA, excision repair system (14, 20). In the XPA cells the frequency of 82:6622â€”6626,1985. 17. Protid-Sabljid, M., Seetharam, S., Seidman, M. M., and Kraemer, K. H. An SV4O- plasmids with multiple base substitutions could be dramatically in transformed xeroderma pigmentosurn group D cell line: establishment, ultraviolet creased by introducing a single strand nick at one end of the supF sensitivity, transfection efficiency and plasmid mutation induction. Mutat. Res., 166: 287â€”294,1986. gene (20). This nick presumably overcomes the DNA repair defect in 18. Seetharam, S., ProtiÃ©-Sabljid,M., Seidman, M. M., and Kraemer, K. H. Abnormal the XP cells which is manifested by an inability to make the initial ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts nick near a UV photoproduct. In the repair-proficient cells, the nick from a patient with the skin cancer-prone disease, xeroderma pigmentosum. i. Clin. Invest., 80: 1613â€”1617,1987. introduced by the DNA repair system is thought to provide a site of 19. Seidman, M. M., Dixon, K., Razzaque, A., Zagursky, R. i., and Berman, M. L. A entry for action of an error-prone polymerase (20). In our experi shuttle vector plasmid for studying carcinogen-induced point mutations in mamma ments, UV-treated plasmid passed through the XP6BE(SV4O) cells han cells. Gene, 38: 233â€”237,1985. 20. Seidman, M. M., Bredberg, A., Seetharam, S., and Kraerner, K. H. Multiple point also had a low frequency of multiple base substitution mutations mutations in a shuttle vector propagated in human cells: evidence for an error-prone (Table 1, Column D). With the D6BE-ER2-9 and D6BE-ER2-2 cells DNA polymerase activity. Proc. Nat!. Acad. Sci. USA, 84: 4944â€”4948,1987. 21. Seidman, M. The development of transient 5V40 based shuttle vectors for rnutagen containing the ERCC2 (XPD) gene the frequency of plasmids with esis studies: problems and solutions. Mutat. Res., 220: 55â€”60,1989. multiple base substitutions was still significantly lower than with the 22. Wang, Y. C., Maher, V. M., and McCormick, i. I. Xeroderma pigmentosum variant 3843

cells are less likely than normal cells to incorporate dAMP opposite photoproducts 1992, issue: 360 (6404): 610; see comments]. Nature (Lond.), 359: 70â€”73,1992. during replication of UV-irradiated plasmids. Proc. NatI. Acad. Sci. USA, 88: 33. O'Donovan, A., and Wood, R. D. Identical defects in DNA repair in xeroderma 7810â€”7814,1991. pigmentosum group G and rodent ERCC group 5. Nature (Lond.), 363: 185â€”188, 23. Kraemer, K. H., Herlyn, M., Yuspa, S. H., Clark, W. H., ir., Townsend, G. K., Neises, 1993. G. R., and Hearing, V. i. Reduced DNA repair in cultured melanocytes and nevus 34. Scherly, D., Nouspikel, T., Corlet, i., Ucla, C., Bairoch, A., and Clarkson, S. G. cells from a patient with xeroderma pigmentosum. Arch. Dermatol., 125: 263â€”268, Complementation of the DNA repair defect in xeroderma pigmentosum group 0 cells 1989. by a human cDNA related to yeast RAD2. Nature (Lond.), 363: 182â€”185,1993. 24. Sung, P., Bailly, V., Weber, C., Thompson, L. H., Prakash, L., and Prakash, S. Human 35. Troelstra, C., Van Gool, A., Dc Wit, i., Vermeulen, W., Bootsma, D., and xeroderma pigmentosurn group D gene encodes a DNA helicase. Nature (Lund.), 365: Hoeijmakers,J. H. ERCC6, a member of a subfamily of putative helicases, is involved 852â€”855,1993. in Cockayne's syndrome and preferential repair of active genes. Cell, 71: 939â€”953, 25. Neumann, J. R., Morency, C. A., and Russian, K. 0. A novel rapid assay for 1992. chloramphenicol acetyltransferase gene expression. Biotechnology, 5: 444â€”447, 36. Vermeulen, W., Stefanini, M., Giliani, S., Hoeijmakers, i. H., and Bootsma, D. 1993. Xeroderma pigmentosum complementation group H falls into complementation 26. Parris, C. N., and Kraerner, K. H. Ultraviolet mutagenesis in human lymphocytes: the group D. Mutat. Res., 255: 201â€”208,1991. effect of cellular transformation. Exp. Cell Res., 201: 462â€”469, 1992. 37. Lehmann, A. R., Arleu, C. F., Broughton, B. C., Harcourt, S. A., Steingrimsdottir, H., 27. Yagi, T., Tatsumi-Miyajima, i., Sato, M., Kraerner, K. H., and Takebe, H. Analysis Stefanini, M., Malcolm, A., Taylor, R., Natarajan, A. T., and Green, S. Trichothio of point mutations in an ultraviolet-irradiated shuttle vector plasmid propagated in dystrophy, a human DNA repair disorder with heterogeneity in the cellular response cells from iapanese xeroderma pigmentosum patients in complernentation groups A to ultraviolet light. Cancer Res., 48: 6090â€”6096, 1988. and F. Cancer Res., 51: 3177â€”3182, 1991. 38. Bailly, V., Sung, P., Prakash, L., and Prakash, S. DNA.RNA helicase activity 28. Ananthaswamy, H. N., and Pierceall, W. E. Molecular mechanisms of ultraviolet of RAD3 protein of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA, 88: radiation carcinogenesis. Photochem. Photobiol., 52: 1119â€”1136, 1990. 9712â€”9716,1991. 29. Brash, D. E., Rudolph, I. A., Simon, J. A., Lin, A., McKenna, G. J., Baden, H. P., 39. Sung, P., Prakash, L., Weber, S., and Prakash, S. The RAD3 gene of Saccharomyces Halperin, A. J., and PontÃ«n,J. A role for sunlight in skin cancer: UV-induced cerevisiae encodes a DNA-dependent ATPase. Proc. Natl. Acad. Sci. USA, 84: p53 mutations in squamous cell carcinoma. Proc. NatI. Acad. Sci. USA, 88: 6045â€”6049,1987. 10124â€”10128, 1991. 40. Sung, P., Prakash, L., Matson, S. W., and Prakash, S. RAD3 protein of Saccharo 30. Tanaka, K., Miura, N., Satokata, I., Miyamoto, I., Yoshida, M. C., Satoh, Y., Kondo, myces cerevisiae is a DNA helicase. Proc. Natl. Acad. Sci. USA, 84: 8951â€”8955, S., Yasui, A., Okayama, H., and Okada, Y. Analysis of a human DNA excision repair 1987. gene involved in group A xeroderma pigmentosum and containing a zinc-finger 41. Yagi, T., Sato, M., Tatsumi-Miyajima, i., and Takebe, H. UV-induced base substi domain. Nature (Lund.), 348: 73â€”76,1990. tution mutations in a shuttle vector plasmid propagated in group C xeroderma 31. Weeda, G., van Ham, R. C., Vermeulen, W., Bootsma, D., van der Eb, A. J., and pigmentosum cells. Mutat. Res., 273: 213â€”220,1992. Hoeijmakers, i. H. A presumed DNA helicase encoded by ERCC-3 is involved in the 42. Waters, H. L., Seetharam, S., Seidman, M. M., and Kraemer, K. H. Ultraviolet human repair disorders xeroderma pigmentosum and Cockayne's syndrome. Cell, 62: hypermutability of a shuttle vector propagated in xeroderma pigmentosum variant 777â€”791,1990. cells. i. Invest. Dermatol., 101: 744â€”748,1993. 32. Legerski, R., and Peterson, C. Expression cloning of a human DNA repair gene 43. Tomaletti, S., and Pfeifer, G. P. Slow repair of pyrimidine dimers at p53 mutation involved in xeroderma pigmentosum group C [published erratum appears in Dec. 10, hotspots in skin cancer. Science (Washington, DC), 263: 1436â€”1438, 1994.

3844

Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 1994 American Association for Cancer Research. The Human DNA Repair Gene, ERCC2 (XPD), Corrects Ultraviolet Hypersensitivity and Ultraviolet Hypermutability of a Shuttle Vector Replicated in Xeroderma Pigmentosum Group D Cells

Engin M. Gözükara, Christopher N. Parris, Christine A. Weber, et al.

Cancer Res 1994;54:3837-3844.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/54/14/3837

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/54/14/3837. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.