Targeting Immediate Early Genes in Melanoma and Vascular Diseases

Targeting immediate early genes in melanoma and vascular diseases

Ahmad Mohammad Nabil Alhendi

A thesis submitted in fulfilment of the requirements for the degree of Doctorate of Philosophy (Biochemistry and Molecular Genetics)

School of Biotechnology and Biomolecular Sciences

The University of New South Wales

March 2015

ORIGINALITY STATEMENT

‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’

Signed ……………………………… Date …………………………………....

iii

‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'

Signed ……………………………… Date …………………………………....

AUTHENTICITY STATEMENT

‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’

Signed ……………………………… Date …………………………………....

ABSTRACT

Melanoma and cardiovascular disease (CVD) are highly prevalent diseases in Western nations. Disease initiation and progression occur via a number of different external and internal factors, often resulting in altered gene expression. The fastest response to such factors is the altered expression of the so-called immediate early genes (IEGs) and these genes are implicated in certain diseases including CVD and cancer.

Dysregulation of IEGs in human aortic smooth muscle cells (hASMCs) usually results in a phenotypic transformation, involving the secretion of high levels of extracellular matrix proteins and increased proliferation and migration. In this study, 347 IEGs that were stress induced by addition of growth factor FGF2 and cytokine IL-1B and expressed in hASMCs, were categorised into three groups, early, rapid transient and late responder genes. Early growth response-1 (EGR1) an early gene and modulator of rapid transient genes NAB2, VCAM-1, ICAM-1 and late responder genes C-JUN and JUND was knocked down and the effect (down-regulation) on other IEG groups evaluated.

Two miRNAs of interest with potential roles in cellular process relevant to melanoma are miR-155 and miR-125b. We demonstrated that the stress inducible transcription factors, C- JUN and C-FOS in melanoma cells are regulated by miR-125b and miR-155. Melanoma cell proliferation, migration and cell cycle analysis were performed to validate the effect of the two miRNAs on C-JUN and C-FOS expression. miRNAs caused decrease in proliferation, migration and affected cell cycle progression. The effect of miRNAs on C-JUN and C-FOS is promising in terms of down-regulating these transcription factors, which are usually upregulated in cancers.

In parallel, the lead compound termed X compound, and its derivatives X4, X6, X7, BT2 and BT3, were tested on a melanoma cell line to assess their potential as chemotherapeutic agents. Treatment with these compounds resulted in cancer relevant phenotypic changes such as decreased expression of genes that are associated with melanoma, which suggest that the X compound, and its derivatives, should be explored as therapeutic agents to treat melanoma. Melanoma and CVD are so prevalent, thus, finding additional therapeutic alternatives is of great importance.

ACKNOWLEDGEMENTS

First and foremost, I would like to express the deepest appreciation to my supervisor Noel for his guidance and mentorship for the past 2 years. Also, I would like to thank my co- supervisor Lionel for your assistance. Thanks for answering all those questions I had. Thank you both for always looking out for me and keeping my best interests at heart. I also would like to thank Levon for the great opportunity he offered me at the beginning of my PhD. To Jo, thank you for your patience and help.

To my parents, brothers and sisters, thank you for supporting me throughout these demanding 3 years. Thank you for your endless support and love, I couldn’t have done any of this without you. To the love of my life, Hayoush; you have made my life simply better and remained the motive which kept me going throughout these tough years. Thank you for entering my life at the right time. I would like to thank my friends, Hassan, Khaled and Mohammad as this work would not have been possible without you all. Thanks for all your advice, much appreciated.

To Blake, Joanna, Lucy and Sudi, your presence in my life through these tough years has been invaluable. Thanks so much for all the chats we had. Thanks for all the time you spent with me. I would never forget the lunches and coffee breaks we had together. To all my friends in BABS; Anoushcka, Akira, Beth, Chris and Nirmani thank you all for your assistance. I would also like to thank all of my friends who supported me in writing, and incented me to strive towards my goal.

LIST OF PUBLICATIONS

Research articles Review for “Insight into roles of immediate early genes in angiogenesis” (Leonel- Prado-Lourenco, Ahmad M.N. Alhendi, and Levon M. Khachigian). Springer (2014). Transcriptional dynamics implicate non-coding RNAs in the immediate early response. Stuart Aitken, Shigeyuki Magi, Ahmad M.N. Alhendi, Masayoshi Itoh, Hideya Kawaji, Timo Lassmann, Carsten O. Daub, Erik Arner, Piero Carninci, Alistair R.R. Forrest, Yoshihide Hayashizaki, Levon M. Khachigian, Mariko Okada-Hatakeyama and Colin A. Semple. Journal of PLOS Computational Biology (2015). Dynamics of enhancer and promoter activity during mammalian cellular activation and differentiation. Erik Arner &, Carsten O Daub &, Kristoffer Vitting-Seerup &, Robin Andersson &, Berit Lilje, Finn Drablos, Andreas Lennartsson, Michelle Rönnerblad, Olga Hrydziuszsko, Morana Vitezic, Tom C Freeman, Ahmad M.N. Alhendi…el. Journal of Science (2015). Structure & Dynamic of the TnI inhibitory peptide in reconstituted thin filaments as determined by SDSL-EPR. J. Cook, Ahmad M.N. Alhendi, P. Curmi, P. Fajer & L. Brown. In preparation Targeting C-JUN and C-FOS through miR-155 and miR-125b, Potential in combatting melanoma. Ahmad M.N. Alhendi, Leonel-Prado-Lourenco, Noel Whittaker. In preparation

Select conference publications

Scanning of the inhibitory region of troponin in the muscle thin filament complex. Phani Rekha Potluri, James.A. Cooke, Nicole M. Cordina, Ahmad M.N. Alhendi and Louise J. Brown. Department of Chemistry and Biomolecular Sciences, Macquarie University, Sydney, NSW 2109, Australia. East Coast Protein Meeting 2013. Immediate Early Gene Profiling in Vascular Smooth Muscle Cells Responding to Growth Factor and Cytokine Stimulation. Ahmad M.N. Alhendi, Margaret Patrikakis, Levon M. Khachigian. Centre for Vascular Research, University of New South Wales, New South Wales, Sydney 2052, Australia. Lorne Genome Conference Feb.2014.

vii

Targeting c-Jun and c-Fos using microRNAs has a potential in contesting melanoma. Ahmad M.N. Alhendi, Leonel Prado-Lourenço, Noel Whitaker. School of Biotechnology and Biomolecular Science, Faculty of Science, University of New South Wales, Sydney, 2052, Australia. American Association of Cancer research conference. April 2015 Novel transcriptional inhibitors for the inhibition of melanoma growth. Taylor, KM; Alhendi, AMN; Halliday, GM; Prado-Lourenço L. Centre for Vascular Research, University of New South Wales, New South Wales, Sydney 2052, Australia. American Association of Cancer research conference. April 2015

viii

Table of Contents

1 Introduction ...... 1 1.1 General Introduction Part I: Cardiovascular Disease ...... 1 1.1.1 The relevance of the evolution and development of heart to cardiovascular disease 1 1.1.2 History, background and epidemiology of cardiovascular disease ...... 4 1.1.3 Types of cardiovascular disease ...... 4 1.1.4 Cardiovascular disease prevention and therapy ...... 7 1.1.5 Inflammation and its correlation with atherosclerosis ...... 8 1.2 General Introduction Part II: Cancer ...... 11 1.2.1 History, background and epidemiology of cancer ...... 11 1.2.2 Types and origin of cancer ...... 13 1.2.3 Signs and symptoms of cancer development ...... 16 1.2.4 The diagnosis and treatment of melanoma ...... 17 1.2.5 The pathophysiology of melanoma ...... 18 1.2.6 Current research on melanoma ...... 20 1.3 General Introduction Part III: Immediate early genes in CVD and cancer ...... 23 1.3.1 The definition of immediate early genes ...... 23 1.3.2 C-JUN and C-FOS as targeted transcription factors in vascular and cancer diseases 26 1.4 General Introduction Part IV: Gene targeting agents ...... 31 1.4.1 DNAzymes ...... 31 1.4.2 Short interference RNA (RNAi) ...... 32 1.4.3 Antisense oligonucleotides ...... 34 1.4.4 Ribozymes ...... 35 1.4.5 Aptamers ...... 36 1.4.6 MicroRNA ...... 36 1.5 Aims and hypotheses ...... 43 2 General Materials and Methods ...... 45 2.1 Materials ...... 45 2.2 General Methods ...... 49 2.2.1 Cell culture ...... 49

2.2.2 Stimulation of gene expression ...... 51 2.2.3 Gene expression identification ...... 52 2.2.4 Post-transcriptional silencing of C-JUN, C-FOS and EGR1 ...... 59 2.2.5 Expression of cloned 3’-UTR of C-JUN and C-FOS in HEK293 and MM200 cell lines to target the miR-155 and miR-125b ...... 61 2.2.6 Measuring downstream effects of microRNAs on C-JUN and C-FOS treatment 65 2.2.7 Densitometry ...... 67 2.2.8 Statistical analysis ...... 67 3 Chapter 3: Immediate Early Genes Expression Profiles in Vascular Smooth Muscle Cells upon Growth Factor and Cytokine Stimulation ...... 69 3.1 Introduction ...... 70 3.2 Results ...... 73 3.2.1 EGR1 expression is stress induced and activated in human vascular smooth muscle cells ...... 73 3.2.2 Validation of the inducible expression of EGR1...... 75 3.2.3 Determine the expression of genes using CAGE tool ...... 78 3.2.4 Validation of CAGE data analysis ...... 81 3.2.5 Categorisation of IEGs ...... 83 3.3 Discussion ...... 109 3.3.1 Expression profile of EGR1 in serum arrested hASMCs ...... 109 3.3.2 Expression profile of genes using CAGE analysis ...... 110 3.3.3 Accuracy of the CAGE method ...... 110 3.3.4 The categorisation of IEGs ...... 110 3.3.5 Inhibiting stress induced EGR1 expression in hASMCs...... 111 3.3.6 EGR1 plays a role in the motogenic reaction to extracellular signals ...... 112 3.3.7 The role of early responder genes in cardiovascular disease ...... 113 3.4 Conclusion ...... 113 4 Chapter 4: Targeting C-JUN and C-FOS, Potential in combatting melanoma ...... 115 4.1 Introduction ...... 116 4.2 Results ...... 119 4.2.1 C-JUN, C-FOS and EGR1 are induced by stress and activated in HEK293 and MM200 cell lines ...... 119

4.2.2 Expression of miR-155 and miR-125b is not induced by serum stimulation in HEK293 and MM200 ...... 124 4.2.3 Inhibition of the expression of C-JUN/C-FOS is achievable using mimic microRNA ...... 125 4.2.4 Inhibition of C-JUN and C-FOS using mimic microRNAs ...... 127 4.2.5 Conduct a 3’UTR or CDS vs microRNA study ...... 137 4.2.6 Down-regulation of C-JUN and C-FOS inhibits HEK293 and MM200 cell migration ...... 145 4.2.7 Inhibition of C-JUN and C-FOS in HEK293 and MM200 blocks cells in the G1 phase of the cell cycle...... 149 4.2.8 Effect of C-JUN and C-FOS inhibition on HEK293 and MM200 proliferation .. 152 4.3 Discussion ...... 154 4.3.1 Expression profile of C-JUN, C-FOS and EGR1 in serum arrested HEK293 and MM200 cells ...... 154 4.3.2 Expression profile of miR-155 and miR-125b in serum arrested HEK293 and MM200 cells ...... 155 4.3.3 Efficiency of miR-155 and miR-125b in down-regulating stress induced C-JUN and C-FOS in HEK293 and MM200 ...... 155 4.3.4 Targeting C-JUN and C-FOS would be beneficial in inhibiting cell growth ...... 156 4.4 Conclusion ...... 158 5 Chapter 5: Drug development for targeting transcription factors ...... 159 5.1 Introduction ...... 160 5.2 Results ...... 163 5.2.1 Microarray analysis of X4 and X6 compounds on ME1007 cell line ...... 163 5.2.2 Measuring and identifying proteins with altered levels upon treatment with X, X4, X6, X7, BT2, BT3 compounds in melanoma cells ...... 168 5.2.3 The effect of BT2 and X compounds on protein kinase activity in melanoma cells 171 5.2.4 Collating mRNA and protein level changes upon treatment with the compounds ...... 181 5.3 Discussion ...... 183 5.4 Conclusion ...... 186 6 General discussion ...... 187 6.1 Findings and implications ...... 188

6.1.1 The categorisation of IEGs ...... 188 6.1.2 Inhibitors of IEGs in cancer disease ...... 189 6.1.3 Chemotherapeutic drug compounds as inhibitors of IEGs ...... 190 6.2 Limitations and future directions ...... 191 6.2.1 Response of IEGs ...... 191 6.2.2 Role of C-JUN and C-FOS in tumour growth and metastasis ...... 192 6.2.3 Drug development ...... 194 6.3 Final remarks ...... 194 7 Appendix ...... 197 8 References ...... 263

xii

LIST OF FIGURES

Figure 1.1.‎ Angiotensin II production as a result of NK cell/monocyte crosstalk during vascular inflammation in cardiac ischemic injury ...... 3 Figure 1.2.‎ The proportion of deaths caused by the different types of cardiovascular diseases in 2011 ...... 6 Figure 1.3.‎ The potential role of VSMCs in the development of adventitial tertiary lymphoid organs (ATLOs) ...... 10

Figure 1.4.‎ Cause of cancer related deaths in 2012 ...... 12

Figure 1.5.‎ Tumour development as a result of uncontrolled cell division ...... 14

Figure 1.6.‎ Metastatic spread of cancer cells ...... 15

Figure 1.7.‎ Microphthalmia-associated transcription factor (MITF) signalling pathway ...... 21

Figure 1.8.‎ Phosphorylation of C-JUN through the activation of JNK ...... 30

Figure 1.9.‎ Processing of short interfering RNA ...... 33 Figure 1.10.‎ Target prediction of miR-155 and miR-125b for C-JUN and C-FOS immediate early genes ...... 41

Figure 2.1.‎ CAGE data tool used for hASMC gene expression analysis ...... 56

Figure 2.2‎ pLightSwitch_3UTR plasmid used in this study ...... 62

Figure 2.3‎ Nhe1 and Xho1 digestion of pLightSwitch_3UTR plasmid...... 63

Figure 3.1.‎ The response of gene expression to FGF2 and IL-1β stimulation ...... 72

Figure 3.2.‎ Gene expression of EGR1 post-FGF2 or IL-1B stimulation in hASMCs ...... 74

Figure 3.3.‎ EGR1 protein levels in hASMCs after stimulation with FGF2 or IL-1B ...... 75

Figure 3.4.‎ qRT-PCR for EGR1 post- FGF2 or IL-1β stimulation...... 77 Figure 3.5.‎ Induction of EGR1, ICAM1 and C-JUN expression in response to FGF2 or IL-1β stimulation ...... 82

Figure 3.6.‎ Categorisation of IEGs into three distinct groups ...... 83

Figure 3.7.‎ CAGE analysis of early responder genes ...... 84

Figure 3.8.‎ CAGE analysis for rapid transient responder genes ...... 84

Figure 3.9.‎ CAGE analysis for late responder genes ...... 85

Figure 3.10.‎ EGR1 expression post-transfection with siEGR1 and FGF2 stimulation ...... 92

Figure 3.11‎ EGR1 expression post-transfection with siEGR1 and IL-1β stimulation ...... 93 Figure 3.12‎ EGR1 protein expression post-transfection with siEGR1 and FGF2 or IL-1β stimulation ...... 94

xiii

Figure 3.13‎ Growth factor and cytokine induction of Rapid transient responder gene expression ...... 96

Figure 3.14‎ . NAB2 expression post-transfection with siEGR1 and FGF2-stimulated ...... 97

Figure 3.15.‎ VCAM1 expression post-transfection with siEGR1 and FGF2-stimulated ...... 98

Figure 3.16.‎ VCAM1 expression post-transfection with siEGR1 and IL-1β-stimulated ...... 99

Figure 3.17.‎ ICAM1 expression post-transfection with siEGR1 and IL-1β-stimulated...... 100

Figure 3.18.‎ NAB2 expression post-transfection with siEGR1 and FGF2-stimulated ...... 101

Figure 3.19.‎ VCAM1 expression post-transfection with siEGR1 and IL-1β -stimulated ...... 102

Figure 3.20.‎ ICAM1 expression post-transfection with siEGR1 and IL-1β -stimulated ...... 103

Figure 3.21.‎ CAGE analysis of the late responder genes ...... 104

Figure 3.22.‎ C-JUN expression post-transfection with siEGR1 and IL-1β -stimulated ...... 105

Figure 3.23.‎ JUND expression post-transfection with siEGR1 and IL-1β -stimulated ...... 106 Figure 3.24.‎ C-JUN and JUND expression post-transfection with siEGR1 and IL-1β -stimulated ...... 107

Figure 4.1‎ Suggested binding site of miR-155 to C-JUN and C-FOS ...... 118

Figure 4.2‎ Suggested binding site of miR-125b to C-JUN coding sequence ...... 118 Figure 4‎ .3 Induction of C-JUN, C-FOS and EGR1 mRNA expression after serum stimulation in HEK293 cells ...... 120 Figure 4.4‎ Induction of C-JUN, C-FOS and EGR1 mRNA expression after serum stimulation in MM200 cells ...... 121 Figure 4.5‎ Induction of C-JUN, C-FOS and EGR1 protein expression after serum stimulation in HEK293 cells ...... 122 Figure 4.6‎ Protein expression of C-JUN, C-FOS and EGR1 after FBS stimulation in MM200 cells ...... 123

Figure 4.7‎ Induction of miR-155 and miR-125b expression after serum stimulation ...... 124

Figure 4.8‎ mimic miRNA transfection optimization for HEK2293 and MM200 cells ...... 126 Figure 4.9‎ Detection of miR-155 and miR-125b in HEK293 and MM200 cells after miRNA transfection ...... 129 Figure 4.10‎ No miRNA suppression of serum induction of C-JUN, C-FOS and EGR1 mRNA expression ...... 130 Figure 4.11‎ Suppression of C-JUN protein’s induction in HEK293 after transfection with miR155 but not miR125b ...... 131

xiv

Figure 4.12‎ Suppression of C-JUN protein’s induction in MM200 after transfection with miR125b but not miR155 ...... 132 Figure 4.13‎ Suppression of C-FOS protein’s induction in HEK293 after transfection with miR155 but not miR125b ...... 133 Figure 4.14‎ No Suppression of C-FOS protein’s induction in MM200 after transfection with miR155 or miR125b ...... 134 Figure 4.15‎ No Suppression of EGR-1 protein’s induction in HEK293 after transfection with miR155 or miR125b ...... 135 Figure 4.16‎ No Suppression of EGR-1 protein’s induction in MM200 after transfection with miR155 or miR125b ...... 136 Figure 4.17‎ Inhibition the C-JUN and C-FOS 3’UTR-luciferase upon transfection of HEK293 cells with miR-155 but not miR-125b ...... 139 Figure 4.‎ 18 No Inhibition of the C-JUN and C-FOS 3’UTR-luciferase upon transfection of MM200 cells with miR-155 or miR-125b ...... 140 Figure 4.19‎ Inhibition the C-JUN CDS-luciferase upon transfection of MM200 cells with miR- 125b and no effect on HEK293 cells ...... 141 Figure 4.20‎ No Inhibition the EGR1 3’UTR-luciferase upon transfection of HEK293 and MM200 cells with miR-155 or miR-125b ...... 142

Figure 4.21‎ Time 0 to confirm starting wound/scratch size in HEK293 and MM200 cells .... 146 Figure 4.22‎ Inhibition of migration in HEK293 and MM200 cells transfected with miR-155 versus miR-125b ...... 147 Figure 4.23‎ Effect of miRNA transfection on the un-migrated area in HEK293 and MM200 after scratch injury...... 148

Figure 4.24‎ G1, S and G2 phases of HEK293 after miR155 or miR-125b transfection ...... 150

Figure 4.25‎ G1, S and G2 phases of MM200 after miR155 or miR-125b transfection ...... 151 Figure 4.26‎ Proliferation of HEK293 and MM200 after transfection with miR-155 and miR- 125b ...... 153 Figure 5.1‎ . Effects of compound X4 (versus DMSO) on induced expression after 1 and 24 h of serum stimulation in the ME1007 melanoma cell line ...... 164

Figure 5.2‎ Effects of X6 compound versus DMSO at 1 and 24 h in ME1007 cell line ...... 166

Figure 5.3‎ Effects of X4 versus X6 compounds at 1 and 24 h in ME1007 cell line...... 167 Figure 5.4.‎ Effects of X, X4, X6 or X7compounds on protein levels at 6 h of serum stimulation in ME1007 cell line ...... 169

Figure 5.5.‎ Effects of BT2 or BT3 or Trametinib compounds versus DMSO at 6 h in ME1007 cell line ...... 170 Figure 5.6.‎ Inhibtion of cellular kinase activity with the use of 1 μM BT2 compound in biochemical based assay ...... 172 Figure 5.7.‎ Inhibtion of cellular kinase activity with the use of 10 μM BT2 compound in biochemical based assay ...... 174 Figure 5.8.‎ Inhibtion of cellular kinase activity with the use of 10 μM X compound in the biochemical based scanMAX Kinase Assay Panel ...... 179 Figure 5.9.‎ Comparison of genes with altered mRNA and protein levels upon treatment with compound X4 in the ME1007 cell line ...... 181 Figure 5.10.‎ Comparison of down-regulated and up-regulated genes and proteins as a result of using the X6 compound in ME1007 cell line ...... 182

xvi

LIST OF TABLES

Table 1.1.‎ Types of cardiovascular diseases ...... 5

Table 1.2.‎ Examples of immediate early genes (IEGs) ...... 23

Table 2.1‎ Cells, cell lines, reagents and kits used in this study ...... 45

Table 2.2‎ Antibodies used in western blot method during this study ...... 47

Table 2.3‎ Primers used in this study ...... 47

Table 2.4‎ ON-TARGET plus Human EGR1 siRNA used in this study ...... 47

Table 2.5‎ Oligonucleotides used in this study ...... 48

Table 2.6‎ MiScript primer used in this study ...... 48

Table 2.7‎ Transfection Reagent used in this study ...... 48

Table 2.8‎ Main instruments that have been used in this study ...... 48

Table 2.9‎ Genes cloned in the luciferase plasmid ...... 61 Table 3.1‎ Genes whose expression was stimulated in hASMCs upon treatment with FGF2 and/or IL-1β in one or more of these times up to 6 h (15, 30, 45, 60, 120, 180, 240, 300 and 360 min) as identified by the CAGE tool ...... 79 Table 3.2.‎ Genes whose expression was not stimulated in hASMCs upon treatment with FGF2 and/or IL-1β in all of these times up to 6 h (15, 30, 45, 60, 120, 180, 240, 300 and 360 min) as identified by the CAGE tool ...... 80

Table 3.3.‎ Early responder gene expression with FGF2 and/or IL-1β stimulation in hASMCs 86 Table 3.4.‎ Rapid transient responder gene expression with FGF2 and/or IL-1β stimulation in hASMCs ...... 87

Table 3.5.‎ Late responder gene expression with FGF2 and/or IL-1β stimulation in hASMCs . 88 Table 4.1‎ Summary of effects of miR-155/miR-125b transfection on C-JUN/C-FOS-luciferase reporter construct in HEK293 cells ...... 143 Table 4.2‎ Summary of effects that miR-155/miR-125 have on C-JUN/C-FOS in MM200 cells ...... 144 Table 5.1.‎ Summary of kinases inhibited using BT2 compound at 1μm in the biochemical based scanMAX Kinase Assay Panel...... 171 Table 5.2‎ Summary of kinases inhibited using BT2 compound at 10 μm in the biochemical based scanMAX Kinase Assay Panel...... 173 Table 5.3.‎ Summary of kinases inhibited using X compound at 10μm in the biochemical based scanMAX Kinase Assay Panel...... 175

Table 7.1‎ C-JUN 3ÚTR sequence ...... 197

xvii

Table 7.2‎ C-FOS 3ÚTR sequence ...... 197

Table 7.3‎ C-JUN CDs ...... 198

Table 7.4‎ C-JUN 3ÚTR sequence mutated ...... 198

Table 7.5‎ C-FOS 3ÚTR sequence mutated ...... 199

Table 7.6‎ C-JUN CDs mutated ...... 199

Table 7.7‎ EGR1 3ÚTR sequence ...... 199

Table 7.8‎ Raw data of GAPDH RT-PCR in HEK293 cells ...... 200

Table 7.9‎ Raw data of GAPDH RT-PCR in MM200 cells ...... 201 Table 7.10‎ Down-regulated genes due to treatment of compound X4 (versus DMSO) on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line ...... 201 Table 7.11‎ Up-regulated genes due to treatment of compound X4 (versus DMSO) on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line ...... 204 Table 7.12‎ Down-regulated genes due to treatment of compound X4 (versus DMSO) on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line ..... 208 Table 7.13‎ Up-regulated genes due to treatment of compound X4 (versus DMSO) on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line ...... 210 Table 7.14‎ Down-regulated genes due to treatment of compound X6 (versus DMSO) on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line ...... 213 Table 7.15‎ Up-regulated genes due to treatment of compound X6 (versus DMSO) on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line ...... 214 Table 7.16‎ Down-regulated genes due to treatment of compound X6 (versus DMSO) on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line ..... 216 Table 7.17‎ Up-regulated genes due to treatment of compound X6 (versus DMSO) on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line ...... 219 Table 7.18‎ Down-regulated genes due to treatment of compound X4 versus X6 on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line ...... 223 Table 7.19‎ Up-regulated genes due to treatment of compound X4 versus X6 on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line ...... 227 Table 7.20‎ Down-regulated genes due to treatment of compound X4 versus X6 on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line ...... 228 Table 7.21‎ Up-regulated genes due to treatment of compound X4 versus X6 on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line ...... 230 Table 7.22‎ Down-regulated proteins due to use of X compound in ME1007 cell line at 6 h of serum stimulation ...... 232

xviii

Table 7.23‎ Up-regulated proteins due to use of X compound in ME1007 cell line at 6 h of serum stimulation ...... 235 Table 7.24‎ Down-regulated proteins due to use of X4 compound in ME1007 cell line at 6 h of serum stimulation ...... 236 Table 7.25‎ Up-regulated proteins due to use of X4 compound in ME1007 cell line at 6 h of serum stimulation ...... 238 Table 7.26‎ Down-regulated proteins due to use of X6 compound in ME1007 cell line at 6 h of serum stimulation ...... 239 Table 7.27‎ Up-regulated proteins due to use of X4 compound in ME1007 cell line at 6 h of serum stimulation ...... 245 Table 7.28‎ Down-regulated proteins due to use of X7 compound in ME1007 cell line at 6 h of serum stimulation ...... 247 Table 7.29‎ Up-regulated proteins due to use of X7 compound in ME1007 cell line at 6 h of serum stimulation ...... 248 Table 7.30‎ Down-regulated proteins due to use of BT2 compound in ME1007 cell line at 6 h of serum stimulation ...... 249 Table 7.31‎ Up-regulated proteins due to use of BT2 compound in ME1007 cell line at 6 h of serum stimulation ...... 254 Table 7.32‎ Down-regulated proteins due to use of BT3 compound in ME1007 cell line at 6 h of serum stimulation ...... 255 Table 7.33‎ Up-regulated proteins due to use of BT3 compound in ME1007 cell line at 6 h of serum stimulation ...... 256 Table 7.34‎ Down-regulated proteins due to use of trametinib compound in ME1007 cell line at 6 h of serum stimulation ...... 256 Table 7.35‎ Up-regulated proteins due to use of BT2 compound in ME1007 cell line at 6 h of serum stimulation ...... 260

xix

Abbreviations CVD Cardiovascular disease HD Heart disease CAD Coronary artery disease IHD Ischemic heart disease CHF Chronic heart failure PAD Perephial artery disease BHLH Basic helix loop helix NK Natural killer ATII Angiotensin II BP Blood pressure ATLOs Adventitial tertiary lymphoid organs CXCL13 C-X-C motif chemokine 13 CCL21 Chemokine (C-C motif) ligand 21 LTβR Lymphtoxin βeta receptor LTO Lymphoid tissue organiser LTI Lymphoid tissue inducer CNS central nervous system lymphoma CDKN2A Cyclin-dependent kinase inhibitor 2A CDKs Cyclin dependent kinases TILs Tumour infiltrating lymphocytes MITF Microphthalmia-associated transcription factor MSH Melanocyte-stimulating hormone MC1R Melanocortin 1 receptor Camp Cyclic adenosine monophosphate CREB cAMP response element-binding MITF Microphthalmia-associated transcription factor Bcl2 B-cell lymphoma 2 IEGs Immediate early genes ITFS Inducible transcription factors NF-KB Nuclear factor kappa-light-chain-enhancer of activated B cells SRF Serum response factor TCF ternary complex factor NFATc3 Nuclear factor of activated T-cells cytoplasmic 3 NGFIB Nerve growth factor IB RNAi RNA intererence RISC RNA-induced silencing complex shRNAs Short hairpin RNAs ASOs Antisense oligonucleotides UVA Ultraviolet A HDFs Human dermal fibroblasts AP-1 Activator protein-1 bp Base pair BSA Bovine serum albumin cDNA Complementary DNA DMEM Dulbecco's Modified Eagle Medium xxi

DMSO Dimethyl Sulfoxide DNA Deoxyribonucleic acid dNTP Deoxynucleotide triphosphate ds double-stranded EDTA Ethylenediaminetetraacetic acid ER Endoplasmic reticulum FBS Foetal bovine serum kb Kilo base miRNA microRNA mRNA messenger RNA ORF Open reading frame PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline PCR Polymerase chain reaction PDB Protein data bank qRT-PCR Quantitative reverse transcriptase PCR RNA Ribonucleic acid SDS Sodium dodecyl sulphate UTR Untranslated region FGF2 Fibroblast growth factor-2 IL-1β Interleukin 1 βeta FITC Fluorescein isothiocanate JNK C-JUN N-terminal kinase MAPK Mitogen-activated protein kinase hASMCs Human aortic smooth muscle cells EGR1 Early growth response 1 PDGF Platelet-derive growth factor NAB2 NGFI-A-binding protein 2 ICAM1 Intercellular Adhesion Molecule 1 VCAM1 Vascular Cell adhesion protein 1 CAGE Cap analysis gene expression

xxii

1 Introduction

1.1 General Introduction Part I: Cardiovascular Disease

1.1.1 The relevance of the evolution and development of heart to cardiovascular disease The development of the heart is a significant role in embryonic development as it is the first functional organ in human and it starts beating by the fourth week of development. Heart development and its genetic mechanisms have been studied for years, revealing a number of conserved genes that form a regulatory network of efficient transcription factor interactions. This network of interactions occurs between myogenic transcriptions factors (basic helix loop helix (bHLH) transcription factors which regulate myogenesis), their downstream target genes and associated signalling pathways. This interaction directs the fate of cardiac cells, the differentiation of myocytes and ultimately, heart morphogenesis1. Cardiac muscle cells are the most fundamental functional unit in the heart, as most contractile proteins including muscle actin, myosin, troponin and tropomyosin are co-ordinately expressed in these cells 2. The process of muscle cell differentiation is considered a significant step in promoting the growth of skeletal, cardiac and smooth muscle cells. Cardiac muscle cell specialisation generates atrial and ventricular myocytes and forms the cells of the heart conduction system 3. Throughout evolution, the heart has progressed from being a single layered tube encompassing peristaltic contractility to an advanced, effective pump containing thick muscular chambers to receive (atrial) and pump (ventricular) blood. This structure allows synchronous contractions and smooth connections to a secure vascular system4. In humans, congenital heart disease is often caused by the heterozygous mutation in regulatory genes of the heart. This reveals the structural and functional sensitivity of the heart to genetic disruption. For example, a mutation in NKx2-5 gene results in a number of congenital heart defects such as cardiac conduction abnormalities, ventricular-septal defects and atrial-septal defects5. The complexity of congenital heart disease in patients is demonstrated by different levels of penetrance and expressivity, which raises the possibility for the role of modifier genes and the environment on cardiac phenotype 6.

Inflammation of the cardiac system was initially considered to be a valuable and adaptive reaction triggered by noxious stimuli and conditions, such as infection and tissue injury 7. However, as research into cardiac inflammation developed, it has been established that inflammation is not just a reaction to injury and infection as there are now other recognised conditions that induce the inflammatory process 8. For example, atherosclerosis, a human heart disease is linked with inflammation and thickening of the artery wall due to invasion and accumulation of white blood cells, and is usually categorised by chronic low grade inflammation. The chronic pathological progression is between a basal level and frank inflammatory states and is termed para-inflammation9. The ability of certain tissues to dedifferentiate during the inflammation process is a characteristic of the cells and tissues in the very primary stages of growth and development 10. Inflammation-induced dedifferentiation also serves as an efficient protection mechanism to avoid death after injury. Consequently, inflammation could be utilised in tissue repair via its induction of pathways involved in healing injured tissue, in the same way that cells dedifferentiate during the primary stages of embryonic development 10, 11. Conversely, chronic inflammation is an important factor in the development of atherosclerosis, mainly via the activation of inflammatory monocytes and macrophages. Inflammatory monocytes and macrophages secrete and stimulate the excretion of pro- inflammatory cytokines, chemokines and adhesion molecules 12. Monocytes and natural killer (NK) cells engage in crosstalk to encourage the inflammatory cells to be recruited to the sites of inflammation. This crosstalk between monocytes and NK cells is an important signal for the production of angiotensin II (ATII), one of the main risk factors for atherosclerosis and CVD (Fig. 1.1)13.

Figure 1‎ .1. Angiotensin II production as a result of NK cell/monocyte crosstalk during vascular inflammation in cardiac ischemic injury The transmigration and differentiation of monocytes into macrophages (due to crosstalk with the NK cell) in the infarcted zone leads to the exertion of different functions (inflammation) in the remodelling process, depending on the cytokines, chemokines, integrin and soluble lipid factors present constituting the microenvironment. Modified from 14.

1.1.2 History, background and epidemiology of cardiovascular disease Cardiovascular disease (CVD), also termed heart disease (HD), refers to any disease that affects the cardiovascular system15. CVD is a significant clinical issue in the modern era, consuming significant healthcare resources and being labelled as one of the main sources of morbidity and mortality in Western society16. In 2008, an estimated 17.3 million people died from CVD worldwide and it is expected that this number will increase to more than 23 million by 2030 17. There are a number of precautions that can be taken to reduce the risk of developing CVD, such as eating a healthy diet, undertaking regular physical activity and avoiding tobacco use. However, there are still more causal factors yet to be determined. Although research in CVD has advanced significantly in the last 20-30 years, there are still many issues that need to be addressed in this field.

1.1.3 Types of cardiovascular disease There are twelve types of CVD (Table 1.1). In 2011, ischaemic heart disease was responsible for the greatest number of deaths from CVD in men and women globally. This was followed by the incidence of cerebrovascular disease and subsequently hypertensive heart disease, causing death in 6% and 7% of men and women with CVD, respectively. Inflammatory heart disease resulted in an incidence rate of 2% and a mortality rate of 1% in men and women with rheumatic heart disease (Fig. 1.2).

Table 1‎ .1. Types of cardiovascular diseases

Types of CVD Description Coronary artery disease (CAD) or Plaque enrichment in the inner wall of arteries of the heart results in coronary heart disease or narrowing of the arteries and diminished blood flow to the heart 18. ischemic heart disease (IHD). Cardiomyopathy A disease of the heart muscle defined by the measurable decrease of myocardium function leading to heart failure 19. Hypertensive heart disease A result of systemic arterial hypertension or high blood pressure 20. Chronic heart failure (CHF) The heart does not inflate efficiently enough to preserve blood flow in the body 21 cor pulmonale The right side of the heart and the respiratory system undergo failure 22. Inflammatory heart disease Three subtypes: Endocarditis (inflammation of the inner layers of heart) Inflammatory cardiomegaly (enlargement of the heart) Myocarditis (inflammation of the heart muscle) 23. Valvular heart disease Disease of any of the four valves of the heart (i.e. the left side aortic and mitral, and the right side pulmonary and tricuspid valves) 24 Cerebrovascular disease Diseased blood vessels supplying the brain with blood results in inaccurate brain function 25 Peripheral arterial disease (PAD) A deficiency in the blood vessels that supplies blood to the arms and legs 26. Rheumatic heart disease Streptococcal bacterial infections cause rheumatic fever which in turn damages heart muscles and valves27. Cardiac dysrhythmia The heart suffers from rhythm abnormalities due to the fact a build-up of plaque in the inner walls of the arteries of the heart. Reduced blood flow occurs due to the narrowing of the lumen of the arteries resulting in ischemic heart disease (IHD) 28.

A B

1 .0 0 % 1 .0 0 % R h e u m a tic h e a rt d is e a s e 6 .0 0 % 7 .0 0 % H y p e rte n s iv e h e a rt d is e a s e 4 6 .0 0 % 3 8 .0 0 % Is c h a e m ic h e a rt d is e a s e 3 4 .0 0 % 3 7 .0 0 % C e re b ro v a s c u la r d is e a s e 2 .0 0 % 2 .0 0 % In fla m m a to ry h e a rt d is e a s e 1 1 .0 0 % 1 4 .0 0 % O th e r c a rd io v a s c u la r d is e a s e

M E N W O M E N

Figure 1‎ .2. The proportion of deaths caused by the different types of cardiovascular diseases in 2011 The various types of cardiovascular disease affecting (A) men and (B) women are presented. Rheumatic heart disease, hypertensive heart disease, ischaemic heart disease, cerebrovascular disease, inflammatory heart disease and other cardiovascular disease illustrate the highest prevalence. Modified from 29

1.1.4 Cardiovascular disease prevention and therapy Whilst there is a continuing drive for the primary prevention of CVD, it remains one of the primary causes of mortality in developing nations30, exacerbated by the fact that many do not adhere to the CVD prevention guidelines31. Most of the studies that have been carried out on people with a high risk of CVD demonstrate that the control of the CVD risk factors is suboptimal in this population, despite their undergoing general treatment to lower risk factors associated with CVD. Identified CVD risk factors include hypertension, dyslipidaemia, diabetes, obesity and tobacco consumption32. The presence and intensity of CVD risk factors are stated in the fourth European guidelines for CVD prevention, which assess the risk of developing CVD based on physical examination or blood samples collected during the study. Healthy patients display a blood pressure (BP) below 140/91 mmHg systolic/diastolic blood pressure (SBP/DBP), and below 130/80 mmHg for diabetic patients. A healthy lipid level is regarded as less than 5 mmol/L of total cholesterol and 3mmol/L of LDL-cholesterol. Again, for patients with diabetes, the target lipid levels are less than 4.5 mmol/L of total cholesterol and less than 2.5 mmol/L of LDL-cholesterol. Normal patients should display a glycated haemoglobin HbA1c level of less than 6.5% and a fasting plasma glucose level of less than 6.1 mmol/L. An optimal body mass index (BMI) is less than 30 kg/m2 with a waist circumference of less than 128 cm and 88 cm for men and women, respectively33. A campaign supporting the prevention of cardiovascular disease gained significant influence in Western countries as atherosclerotic CVD is the main cause of premature death, resulting in 42% and 38% of deaths before the age of 75 in women and men, respectively. Interestingly, implementing the CVD prevention guidelines and minimising exposure to risk factors resulted in a 50% reduction of mortality rates33. There are several measures employed in the prevention of CVD such as implementing a low fat, high fibre diet consisting of whole grains, fruits and vegetables34, 35 and avoiding cigarette smoke. It is established that quitting smoking and avoiding passive smoking contributes significantly in reducing CVD risk36. Alcohol intake is also considered a significant risk factor for CVD. However, defining alcohol intake has proven problematic. The current definition of ‘alcohol intake’ is ambiguous and depends on the drinking habits of certain populations and the damage that can be observed.

Reducing alcohol intake to approximately 1-2 drinks per day has been predicted to reduce the risk of CVD by 30% 37. As mentioned above, monitoring blood pressure, BMI, implementing a low fat, high fibre diet, quitting smoking and avoiding passive smoking and reducing the alcohol intake will collectively help to reduce the risk of CVD. Additionally, these strategies can be used as therapy for CVD38.

1.1.5 Inflammation and its correlation with atherosclerosis Atherosclerosis, as mentioned, is a chronic inflammatory disease that results in a build-up of lipoproteins, increased cell death and sclerosis of the vascular wall. The local development of revised self-antigens (familiar to the system), by both innate and adaptive immune reactions, facilitates atherosclerosis development. These autoimmune reactions have a valuable influence by enabling the exclusion of possibly destructive products that are generated from oxidised LDL and dying cells39. The clinical outcomes of atherosclerosis are coronary artery disease and ischemic heart failure, the main causes of death in the western world. For this reason, the development of new therapeutic schemes is imperative40. The correlation between the atherosclerotic lesion and the presence of adventitial inflammation has been recognised for a while. However, in the last few years, there has been a focus on the adventitial inflammatory structures and its cellular component, adventitial tertiary lymphoid organs (ATLOs)41. ATLOs represent a unique type of ectopic, highly organised, immunological construction similar to the secondary lymphoid organs. ATLOs are established in association with the immunological initiation of chronic inflammatory diseases, as seen in chronic infections, transplant rejection or autoimmune diseases. Lymphoid neogenesis is the key for the development of ATLOs, which occurs at the point of chronic inflammation with determined antigen stimulation 42. Both the arterial wall sections are detached by vascular smooth muscle cells (VSMCs) in the lamina media, supporting the prediction that VSMCs synchronise the communication between the atherosclerotic lesion and ATLOs. Both the number and type of inflammatory cells that pass through the smooth muscle layer of the lamina media are limited43. Moreover, medial VSMCs that are enclosed by intimal plaque and

ATLOs have been reported to express the C-X-C motif chemokine 13 (CXCL13) and chemokine (C-C motif) ligand 21 (CCL21) through the lymphtoxin βeta receptor (LTβR)- dependent signalling pathways44. Both CXCL13 and CCL21 are lymphorganogenic chemokines that play a role in the development of secondary and tertiary lymphoid organs45, 46. Secondary lymphoid organs are where the adaptive immune system is originated and the tertiary lymphoid organs where high lymphocytes get employed during inflammatory reaction. Both of the lymphoid organs contribute to innate and adaptive immune response in atherosclerosis47. It has been suggested that the stimulation of VSMCs by growth factors, chemokines, and injuries underlying the atherosclerotic lesion will induce characteristics of lymphoid tissue organiser (LTo) cells thereby encouraging ATLO neogenesis 48. LTo cells are the mesenchymal cells that regulate embryonic lymph node growth49, 50. It has demonstrated that VSMCs can be differentiated into LTo cells through the immediate stimulation of mouse aortic smooth muscle cells via tumour necrosis factor α (TNF-α) and LTβR signalling51. Once VSMCs differentiate into LTo cells, the expression profile of homeostatic and lymphorganogenic chemokines is altered. These chemokines are thought to sequester leukocytes to the adventitia, facilitating the development of ALTOs52. In addition, lymph nodes that act like channels linking medial VSMCs to ALTOs have an established role in the transport of low molecular weight molecules into ALTOs53. Similar channels also exit in lymph nodes that link multiple lymph vessels and endothelial venules, which have a role in organising the transference of antigens to lymph nodes54, 55. Moreover, it was recently demonstrated that M1 macrophages have the capability to act as lymphoid tissue inducer (LTi) cells, activating the differentiation of VSMCs into LTo cells. Thus, communication between M1 macrophages and VSMCs has been predicted to stimulate ATLO development56. Together, these data indicate that VSMCs are a part of ALTO formation and that there is cooperation between atherosclerotic lesions and ATLOs (Fig. 1.3).

Figure 1‎ .3. The potential role of VSMCs in the development of adventitial tertiary lymphoid organs (ATLOs) Activation of VSMCs by the pro-inflammatory cytokines TNF and LTα1β2 stimulates tumour necrosis factor receptor 1 (TNFR-1) and lymphotoxin β receptor (LTβR) signalling, inducing a lymphoid tissue organiser (LTo) cell phenotype in VSMCs. The activated VSMCs express lymphorganogenic chemokines such as CCL21 and CXCL13, which promote ATLO neogenesis and development. Modified from 57

1.2 General Introduction Part II: Cancer

1.2.1 History, background and epidemiology of cancer Cancer is a group of diseases characterised by unregulated cell growth with possible metastasis to other part of the body via the vascular and lymphatic systems58, 59. Cancer is one of the main causes of death globally 60, with 14.1 million of new cases of cancer worldwide in 2012 61 and 8.2 million or 14.6% of deaths annually being the result of cancer (Fig. 1.4) 62. Prostate, lung, colorectal and stomach tumours are the most common types of cancer in males. Conversely, breast, lung, colorectal and cervical cancers are the most prevalent type of cancer in females. In Australian males and females, skin cancer accounts for at least 40% of all cancer cases among the Australian population63, 64. Disease burden is the influence of heath problem as measured by financial cost, morbidity, mortality and other indicators. The incidence of cancer is increasing due to the aging population in developed countries. International agency for research on cancer (IARC) predicts a large increase in cancer incidence in developing countries associated with the increased lifespan and the high rate of infection. Cancer treatment is expensive, with an estimated US $1.6 trillion spent worldwide on cancer treatment 65.

Figure 1‎ .4. Cause of cancer related deaths in 2012 In 2012, cancer became the second leading cause of death worldwide resulting in an estimated 8.2 million deaths. Lung cancer is the leading cause of death in patients diagnosed with cancer, followed by liver, stomach and colorectal cancers. Breast and oesophageal cancers also presented high incidence rates 66.

1.2.2 Types and origin of cancer There are broadly over 40 different types of cancer that occur in the human body and they are categorised based on location of the primary cancer67. In order to understand the complex nature of cancer, it is beneficial to know the tissue of origin 68. Carcinoma is a cancer that originates from epithelial cells in the skin or in lining of internal organs69. Carcinoma is divided into more than four subtypes including adenocarcinoma, basal cell carcinoma, squamous cell carcinoma and translational cell carcinoma70, 71. The second category is sarcomas, which represents cancers derived from the mesenchymal cells in bone, cartilage, fat, muscle, blood vessels and any other connective or supporting tissue 72. Leukaemia refers to cancer that initiates in the blood-forming tissue of the bone marrow, resulting in the generation of irregular white blood cells that are dispersed into the bloodstream. These white blood cells are called blasts or leukaemia cells73. Lymphoma and myeloma are another cancer subtype and include cancers that are derived from immune system cells, such as lymphocytes and plasma cells (antibody- producing cells)74. The final category of cancer is central nervous system lymphoma (CNS), which refers to all the tumours that develop in the brain tissue and spinal cord75. Under normal conditions, cell populations need to be maintained via replacement with dividing stem cells or by simple controlled cell division. 76. This mechanism allows for the replacement of old and damaged cells 77 (Fig. 1.5). The DNA of cells is subject to damage and subsequently repaired, however, occasionally the damage is not repaired and this can lead to changes or mutations in the DNA. Sometimes, these mutations will affect the normal growth and division of cells. Altered cell growth can result in a surplus of new cells, not required by the body that may develop into a precancerous lesion. This lesion may develop into a palpable lump, except in the case of uncontrolled proliferating blood cells 78 (Fig. 1.6). Tumours are not yet necessarily cancerous; they may exist as a benign, non- cancerous tumour or, alternatively, develop into a malignant (cancerous) tumour. Cancerous lumpus and benign tumours can be resected with relapse rates very low. Moreover, metastasis is uncommon in these benign tumours, adding to their definition

13 as non-cancerous tumours. The cells of malignant tumours, however, can infiltrate surrounding tissues or even spread to distant sites in the body, via the vascular or lymphatic systems.

Figure 1‎ .5. Tumour development as a result of uncontrolled cell division Normal cell division occurs to replace cells that have damaged DNA. Cells that are not replaced contain genetic mutations that can lead to the uncontrolled division of these cells and ultimately an excess of cells. The development of a benign mass often ensues, termed a tumour. Modified from 79.

Figure 1‎ .6. Metastatic spread of cancer cells Tumour cells from the primary site of development can invade nearby blood and/or lymphatic vessels to be transported to distant sites within the body. The establishment of cancer cells in another region results in the development of a secondary tumour. Modified from 80

1.2.3 Signs and symptoms of cancer development Early symptoms of carcinogenesis are often absent or ambiguous; however as the cell mass increases, signs and symptoms become evident, depending on the cancer type and location81. While there are specific symptoms that are linked to specific types of cancer, they are very few compared with the other general symptoms that are common in cancer and other diseases 82. Symptoms of a particular cancer can be categorised into three groups; local effects, systemic symptoms and metastasis 83. The size and structure of the tumour, or its ulceration, may cause local symptoms84. An example of this is seen in the development of lung cancer, in which the increased size of the tumour usually blocks the bronchus and causes a cough or pneumonia 85. The local symptoms of oesophageal cancer, including difficulties in swallowing, similarly arise as a result of a decrease in the size of the oesophageal opening86. Conversely, ulceration associated with tumour development generally results in bleeding as seen in colon cancer and in lung cancer, which results in fecal blood or the patient coughing up blood87, respectively. Symptoms that arise due to the cancer indirectly, and affecting the body more generally, are known to be systemic symptoms 88. Unintentional weight gain or loss, lethargy and fever, as seen in leukaemia, kidney and liver cancers, are examples of systemic symptoms 89. Moreover, there are several tumour types that are known to cause specific systemic symptoms termed paraneoplastic phenomena. This is illustrated in lung cancer, with a myasthenia gravis (autoimmune or congenital neuromuscular disease) appearing in the thyroma and clubbing90. Metastasis, the spread of cancer cells from the primary site to other parts of the body, occurs via local spread involving tumour cells infiltrating nearby tissues or distant spread whereby cells travel though the body via the blood circulation or lymphatic system 91 (Fig. 1.6). The spread of cancer cells through these circulation systems potentially provides cancer cells with access to all regions of the body. However, cancer cells often establish secondary tumours in specific locations 92 which are specific to the type of cancer. It is important to note that not all cancer cells can metastasise, as requirements for metastatic spread include the ability to penetrate functional barriers, typically membranes, as well as to enter and depart from the blood and lymph vessels 93. Symptoms that arise from metastatic spread are often tumour location dependent. This

16 is illustrated in metastasis to local lymph nodes, which usually appear enlarged and can be easily visualised or palpated under the skin 94. Tumour metastasis to the abdomen is also evident in enlarged livers or spleens that can be palpated in the abdominal cavity95, 96. The establishment of a secondary tumour in the bone results in pain and easy fracture of affected bones 97. Early diagnosis of cancer facilitates the treatment and better prognosis, as the risk of metastasis is reduced and often the tumour mass will be lesser98, 99. Melanoma skin cancer is a good example of the success of early cancer detection management. Melanoma can be resected in its early stage as the cancer is yet to progress to infiltrating surrounding structures. Moreover, the five-year survival rate for melanoma patients diagnosed in the early stages of the disease is 98%. However, this is reduced to 16% if the disease is detected at a later stage100-102.

1.2.4 The diagnosis and treatment of melanoma Within the skin, there are various cell types carrying out differing functions. Of importance in melanoma are the melanin pigment-producing cells, melanocytes 103. Whilst melanoma can affect any part of the skin, it is most common on the legs and back of females and males, respectively 104. The primary cause of melanoma is ultraviolet (UV) irradiation, as a result of sun over exposure. The risk of developing melanoma is highly dependent on geographic location, with certain high UV-irradiation locations being more at risk than others. The more the sunlight distance travelled, the less the UV component hitting the earth will be 105. The top two populations with melanoma cases in the world are Australian and New Zealand106. The level of risk associated with developing melanoma skin cancer is also strongly inversely correlated with the amount of pigmentation in the skin107. The function of the dark pigment melanin is to colour the skin whilst protecting the nuclei of the skin cells from UV-irradiation 108. Melanocytes are not just localised to the skin, as they can also be found in the bowel and within the middle layer of the eye109. Early patient diagnosis with melanoma involves surgical removal as this therapy has the greatest efficacy with this particular tumour type 110. The risk of tumour recurrence is dependent on how deeply it initially penetrated the layers of the skin prior to surgical resection. Cancers that infiltrate the deeper layers of the skin require

17 additional treatment to ensure elimination of all malignant cells. The best treatment in this case involves chemo- and immune-therapy or radiation therapy111. If a melanoma is not diagnosed in the early stages, it becomes very dangerous, accounting for 75% of skin cancer related deaths 112. In 2012, there were 232,000 patients diagnosed with melanoma, of which 55,000 were fatal. The signs of early melanoma are easily identified and include the alteration of the shape and colour of existing moles. As the cancer develops, the symptoms encompass itching, ulcerating or bleeding from the affected mole113. The signs of melanoma development are summarised in this small checklist of characteristics of suspected moles: asymmetry, borders (irregular), colour (variegated), diameter (greater than 6 mm) and its evolution over time 114. Loss of appetite, nausea, vomiting and fatigue are nonspecific, paraneoplastic symptoms that are caused by metastatic melanoma 115. Melanoma in its early stages demonstrates metastatic spread in 20% of patients 116, with spread to the brain, liver, bones, abdomen or distant lymph nodes occurring most often 117. It is well established that melanoma can originate from DNA damage caused by the process of repairing UV-induced cyclobutane pyrimidine dimers118. A risk factor of recent importance for the development of melanoma is the increased use of tanning beds that implement UV radiation 119. People employing tanning devices before age 30 significantly increase their chance of melanoma 120. Importantly, genetics also plays a significant role in melanoma121, with certain familial mutations having a high association with melanoma122. An example of a commonly mutated gene in melanoma is the cyclin- dependent kinase inhibitor 2A (CDKN2A), which play a significant role in regulating cell cycle progression through the inhibition of cell cycle mediators Cyclin dependent kinases (CDKs). Mutations to CDKN2A result in a shift in the reading frame that will lead to destabilisation of the tumour suppressor protein 53 (p53). P53 regulate cell cycle and serves as tumour suppressor in human123.

1.2.5 The pathophysiology of melanoma The skin consists of three layers: an outer layer termed the epidermis, the internal layer called the dermis and the hypodermis or subcutaneous fat layer. Melanocytes are usually found between the epidermis and the dermis 124. The first stage

18 of melanoma is known as the radial growth phase and involves uncontrolled division of the affected melanocytes. During this initial stage, the tumour is less than 1 mm in thickness125. In this first stage, the tumour is yet to reach the lower layer of the skin containing the vasculature, hence it is unusual for the tumour to spread to other parts of the body in this phase 126. The second stage in the progression of melanoma is the invasive radial growth phase 127. The tumour cells possess invasive properties, which facilitates the spread of the cancer 128. Melanoma cells are usually at a depth of less than 1 mm but are able to invade the papillary dermis layer of the skin 129. The invasive melanoma or the vertical growth phase is the third stage of melanoma progression 130. By now, melanoma cells have acquired invasive potential thereby allowing infiltration of surrounding tissue. Moreover, they can spread through blood and lymph vessels to distant sites in the body 131. The tumour mass at this stage is usually greater than 1 mm in thickness and has invaded the internal dermis layer132. Typically, during the vertical growth phase, an immunological response is stimulated evident by the presence and action of tumour infiltrating lymphocytes (TILs) 133. TILs are a type of white blood cells that are usually present in tumours and play a role in killing tumour cells 134. TILs have demonstrated the ability to destroy primary tumours in a process called regression, the last step in the development of melanoma135. Whilst the primary tumour in certain cases is eliminated completely, metastatic secondary tumours may remain present at alternative locations 136. The proto-oncogenic protein B-Raf (B-Raf), encoded by the human BRAF gene, has an established role in promoting cell growth through the internalisation of chemical signals growth signals or mitogens 137. In 40% of human melanoma cases, an activated mutation has been identified that changes the structure of the B-Raf protein 138 leading to altered signalling between the RAF and mitogen activated protein kinase (MAPK) pathways139. The role of the MAPK pathway is to control the cellular reactions to different types of stimuli including pro-inflammatory cytokines, mitogens and heat shock. These stimuli affect various cellular processes such as proliferation, apoptosis and cell survival 140.

1.2.6 Current research on melanoma Possible new treatment strategies are being investigated through pharmacotherapy research into metastatic malignant melanoma141. Current research into combination therapy involving newly accepted chemotherapeutic agents would increase the chance of developing melanoma therapies that are more efficient and well tolerated by patients 142. It is generally accepted that studying the cellular pathways that are associated with melanoma development will help in the discovery and design of drugs capable of inhibiting these critical metabolic pathways143. Studies into melanoma- associated pathways are evident in research into the microphthalmia-associated transcription factor (MITF) that is involved in one of the melanin synthesis pathways 144. The human MITF gene encodes this transcription factor and its production is usually regulated through UV exposure 145. When the skin is exposed to UV radiation, expression of p53 and consequently melanocyte-stimulating hormone (MSH) is stimulated in keratinocytes146, 147. MSH binds to the melanocortin 1 receptor (MC1R) on melanocytes resulting in the activation of specific adenylate cyclases, which produce cyclic adenosine monophosphate (cAMP). cAMP activates the cAMP response element-binding (CREB) protein, which ultimately stimulates microphthalmia-associated transcription factor (MITF) expression (Fig. 1.7). The cyclin-dependent kinase (CDK) inhibitor CDKN2A and B- cell lymphoma 2 (Bcl2) are targets of MITF and they play a vital role in melanocyte survival 148. As melanin protects the skin from UV-induced damage, new approaches to prevent melanoma development have involved stimulating melanin production in those susceptible to skin cancer. This includes individuals with fair skin and red hair, characteristics arising due to mutations in the MC1R gene. Stimulating melanin production in these individuals could reduce their risk of developing melanoma 149.

Figure 1‎ .7. Microphthalmia-associated transcription factor (MITF) signalling pathway Binding of α-melanocyte stimulating hormone (α-MSH) to the melanocortin 1 receptor (MC1R) stimulates cyclic adenosine monophosphate (cAMP) pathway. Stimulation of cAMP occurs via heterotrimeric G-protein complexes, downstream of the MC1R. G-proteins stimulate adenylyl cyclase (AC), which in turn catalyses cAMP production. cAMP responsive element binding (CREB) protein will be stimulated by cAMP to be activated via phosphorylation. This recruits creb- binding protein (CBP) and ultimately transcriptionally activates multiple target genes, one of which is MITF in melanocytes. Several genes activated by microphthalmia-associated transcription factor (MITF) produce and facilitate the maturation of melanosomes, melanin- containing vesicles that usually get exported to neighbouring keratinocytes in the epidermis. Modified from 150

1.3 General Introduction Part III: Immediate early genes in CVD and cancer

1.3.1 The definition of immediate early genes The immediate early genes (IEGs) are defined as those genes that are upregulated immediately after cellular growth stimulation 151. This fast or immediate response is due to the fact that the IEGs do not require de novo protein synthesis, with expression induced within minutes of stimulation152. The existence of IEGs supports the assumption that all the transcriptional proteins and signalling pathways required for the expression of the IEGs, exist in non-stimulated cells153. There are a number of genes that are accepted as being IEGs (Table 1.2).

Table 1‎ .2. Examples of immediate early genes (IEGs) Name of gene Abbreviation References

Cellular- proto-oncogene C-FOS 154, 155, 156, 157, 158 Cellular proto-oncogene C-JUN 158, 159, 156

Nerve growth factor IB Nur77 (ngfi-b, TIS-1, N10, 154, 155, 156 AT416, TR3, Nak-1) Early growth response 1 EGR1 (NGFI-A, krox-24, AT225, 154, 155 zif/268, TIS8)

Inducible transcription factors (ITFs) are the protein products of certain IEGs that have a role in development, responding to intercellular signals and cell cycle control160, 161. IEGs are not limited to encoding transcription factors (TF), with some IEGs encoding such proteins as a protein phosphatase, G-protein, secreted cytokine-like molecule, tissue plasminogen activator, cyclooxygenase 162 and components of cell signalling cascades 163. This suggests that IEGs have the ability to control the cellular response to certain stimuli in addition to utilising secreted proteins to transfer the response between neighbouring cells164. Furthermore, other types of IEGs encode proteins that have differing functions such as signal transduction molecules, which are present at low levels in resting cells 165. Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-KB) is a group of transcription factors, encoded by IEGs that are functional in resting T cells and act as signal transducers between the cytoplasm and nucleus 166.

Transcription factors encoded by IEGs are classified into several classes depending on their DNA-binding motifs. The first class encompass leucine zippers comprising hydrophobic leucine residues that are repeated on one side of an α-helix region within the protein. This allows the transcription factor to combine with a similar protein to form a dimer as seen in JUN-FOS protein heterodimerisation 167, 168. The second class is characterised by TFs with zinc fingers. In this class, the cassette uses many proline, cysteine, and histidine residues allowing the TF to bend around a zinc ion and form a finger structure. This finger is able to fit into the major grooves of a DNA strand in a base-specific manner169. Zif268 (Egr1) is an example of the zinc finger class. Another example of a type of functional cassette that has DNA binding properties is the Helix-loop-helix motif Myc TF group170, 171. The final category of TFs is the steroid receptor proteins, most of which have more than one of the previously described functional domains in their structure172, 173. Macrophages that are metabolically active have a significant role in detection of tumour cells174. Bone marrow myeloid precursors differentiate into macrophages through activation via a number of different stimuli including phorbol esters175. This causes the stimulation of a stress-like response in macrophages and the induction of a number of stress response genes such as interleukin-1β (IL-1β). It is established that C- JUN, PU.1 and C/EBPβ cooperate to induce the transcription of monocyte-specific genes through the attachment to their respective promoter sites on DNA176, 177. C-JUN has been identified as a binding pair with C-FOS to form the active AP-1 transcription factor. PU.1 transcription factor is a member of the E-Twenty Six (ETS) family. PU.1 plays an important role in the transcription of different myelomonocytic genes and contributes to the development of myeloid and lymphoid cells178. The CCAAT/enhancer-binding protein β (C/EBPβ) is known to be one of the most important transcription factors for the activation of macrophages and phagocytes 179. The three main mechanisms control genetic expression through transcription factor binding are TF phosphorylation, ligand-receptor interactions and rapid transcription of target genes. The first mechanism, phosphorylation of the TF, involves attachment of a phosphate group to the TF. Phosphorylation of the TF regulates its activity resulting in the activation of a particular down-stream set of genes and ultimately downstream phenotypic changes in the cell180. The second means of

24 controlling gene expression, ligand-receptor interactions, affects gene transcription by translocation of bound receptors to the nucleus of a cell, as seen in steroid hormone receptors181. The final mechanism, the rapid transcription of target genes, involves a number of TF genes being rapidly transcribed and translated into the corresponding proteins. This affects and regulates downstream genes 182. The types of genes that are transcriptionally upregulated by the IEG TFs depends on the type of stress imposed on the cell 183. For example, cellular exposure to high temperatures results in the induction of heat shock protein expression. This class of proteins assist the cell in recovering from heat shock by stimulating the suitable refolding mechanisms of denatured proteins184. Another example is illustrated in the repair of DNA damage in E. coli exposed to UV irradiation or chemical agents. Upon DNA damage, approximately 20 genes involved in DNA repair, mutagenesis and recombination are upregulated from the SOS regulon 185. Phosphorylation and de-phosphorylation processes that are responsible for the activity of constitutively expressed transcription factors such as CREB, serum response factor (SRF) and ternary complex factor (TCF) proteins, can be activated through multiple signalling pathways. This in turn regulates the transcription of several inducible transcription factors (ITFs) that are encoded by IEGs152, 186. Proteins encoded in cellular proto-oncogenes can be categorised according to their sites of action: cell surface membrane, cytosol and nucleus187. In this project, the focus will be on the nuclear proto-oncogenes. The nuclear acting group of proto- oncogenes includes C-FOS, C-MYC, C-MYB, C-ERBA, p53, and C-JUN. Based on the fact that the protein products of the proto-oncogenes localise to the nucleus, it is suggested that these proteins play an important role in transcriptional regulation188. Transcription is regulated at multiple points as a result of the binding of multiple transcription factors to different recognition sequences within the regulatory regions of target genes176. Transcription level expression of typical IEGs begins to increase in certain cells within 5 minutes of applying an appropriate stimulus, such as FBS and terminates within 30-60 minutes. This drop is attributed to the short half-life of IEG mRNA transcripts that are typically subject to rapid degradation 189. However, the regulation of transcription that occurs via IEGs is a rather complex process. Firstly, IEGs encode proteins that work in a combinatorial manner to affect

25 gene expression pathways differently. Secondly, IEG activation of the late response transcription program can be stimulated according to the differentiation and physiological state of the stimulated cell157.

1.3.2 C-JUN and C-FOS as targeted transcription factors in vascular and cancer diseases The earliest identified IEGs are C-FOS, C-JUN and C-MYC; C-FOS and C-JUN are members of the Fos and Jun families, respectively. Expression of C-JUN is highly dependent on the different external stimuli such as the presence of phorbol ester tumour promoters, growth factors, cytokines and UV irradiation190. C-JUN plays an important role in cell differentiation, apoptosis and carcinogenesis; the role of C-JUN in tumorigeneses is to control the expression of various different genes191-193. Furthermore, changes in mRNA expression of C-JUN upon differentiation appear to be lineage specific as indicated by the fact that C-JUN mRNA levels increased upon differentiation of the acute myeloid leukaemia HL60 cells to macrophages but not upon differentiation to granulocytes194. A number of regulatory elements in the C-FOS promoter have been identified and characterised including, cyclic AMP response element (CRE), sterol response element (SRE) and the activator protein one site (AP-1) 195. Activation of these regulatory elements results in transcription196. Although C-FOS protein product is part of the AP-1 transcription factor and is localised to the nucleus, it does not have sequence-specific DNA binding activity197. The use of C-FOS-specific antibodies identified that the C-FOS protein complex bound to the C-JUN/AP-1-specific DNA motif, indicating that C-FOS complexes with C-JUN and this complex bound the C-JUN/AP-1 binding site198. The C-JUN and C-Fos proteins are now recognised as the two major components of AP-1 complex 199

DNA damaging agents, such as UV radiation or H2O2 induce the expression of both C-JUN and C-FOS in HeLa cells. Interestingly, C-JUN is induced more efficiently with UV irradiation than with tissue plasminogen activator (TPA), the standard inducer of C- JUN expression200. This response to UV irradiation was only observed for C-JUN and not for any of the other IEGs from the same family (C-FOS, FOSB, FRA-1, JUNB, JUND) 201. This high response to UV irradiation suggests that the C-JUN regulatory region is a

26 favoured primary target for the signalling cascade involved in the processing of UV radiation 202. Dimerization of C-FOS and C-JUN proteins occurs through a leucine zipper motif and alpha helix-permissive regions in the proteins 203. Proteins from the Jun family are capable of forming Jun-Jun homodimers, unlike proteins from Fos family that only form Fos-Jun heterodimers 204. Furthermore, the proteins of Fos family are only capable of dimerising with proteins of Jun family whilst proteins of Jun family are capable of dimerising with the protein products from other IEG families205. These homodimers and heterodimers bind to the TGACTCA canonical DNA sequence, which is the AP-1 consensus site 206. Fos and Jun family proteins have the ability to bind the AP-1 sequence through a basic amino acid-rich domain. Therefore, the AP-1 sites, and these transcription factor complexes, are essential factors for the stimulation of expression of specific target genes 207. AP-1 does not, therefore, is not a single transcription factor with unique characteristics. Rather, it refers to DNA binding and stimulation of transcriptional activities that are induced by the interaction between DNA and the Jun and Fos homodimeric and heterodimeric complexes 208. Transcription is moderated by protein complex formation and the interaction of these complexes with DNA. This is illustrated by the specific expression of certain genes at various times in response to the appropriate stimuli209. The result of dimerization is an increase the DNA binding affinity of each TF to its specific DNA binding sequence. Additionally, different combinations of dimers result in different effects on various regulatory elements210. It is well established that different heterodimers have diverse DNA-binding motifs; the Fos-Jun heterodimer binds the AP-1 consensus sequence TGACTCA while the Jun-CREBP1 heterodimer binds the sequence TGACGTCA of the cyclic AMP responsive element (CRE). Therefore, varying heterodimers have different effects on their corresponding binding sites within the same or on alternative genes 211. It was recently reported that there are a number of different mechanisms that enable individual cis- element and certain trans-acting factors to interact under certain physiological conditions. These interactions act as the nucleation site for a sequence of proteins involved in transcriptional regulation212.

Proteins are involved in a variety of roles and therefore, it is expected that there are great complexities in their transcriptional regulation. While a number of transcription factors and transcription factor binding sites have been identified and characterised, there regulation of transcription is still poorly understood. This gap in the literature is highlighted by the fact that only the cis-acting regulatory elements in the region 200 bp upstream of the transcription start site of the C-JUN gene have been classified213. This is not to say that the C-JUN gene is limited to regulation by these cis- acting elements, rather than other molecular switches are yet to be established and characterised. These regulatory molecular switches can be recognised by a myriad of trans-acting factors located further upstream, which may be employed under different physiological conditions 214. The unknown regulatory sites detected upstream of C-JUN promoter which interact with trans-acting factors, are targeted by different signalling molecules under various physiological states. Therefore, upstream regions of C-JUN have been studied for transcriptional activity and it was identified that certain cis-acting elements upregulate transcription of C-JUN 215. Recently, it was shown that targeting C-JUN through gene targeting agents such as small interfering RNA (siRNA) and DNAzymes, inhibits micro-vascular endothelial cell proliferation, migration, invasion and microtubule formation in vitro and also suppresses vascular endothelial growth factor (VEGF)-induced neovascularisation in vivo 216. Therefore, targeting C-JUN via the aforementioned gene targeting agents has suppressed vascular permeability and inflammation, providing an alternative anti- inflammatory treatment to steroids, nonsteroidal anti-inflammatory drugs and steroid sparing agents217. As previously mentioned in this section, the FOS and JUN protein families are IEGs, however, it has subsequently been identified that these IEG protein products belong to a superfamily of genes called the basic-zipper superfamily (bZip) 218. Genes in the bZip superfamily encode proteins that encompass a leucine zipper and basic DNA- binding domains. The bZip superfamily includes the cyclic AMP response element binding (CREB) protein family, activating transcription factors family and the Maf protein family. The products of the bZip superfamily combine with Fos or Jun proteins, increasing the variety of heterodimers involving Jun and Fos 219.

Myocardial ischemia and reperfusion result in the induced expression of C-JUN, with induction of the C-JUN proto-oncogene being the primary reaction to these stimuli. Stress-induced activation of the C-JUN N-terminal kinase (JNK), also termed stress- activated protein kinases (SAPKs), also stimulates the activity of the transcription factor C-JUN 220. Importantly, the JNKs are members of the established mitogen activated protein kinase (MAPK) family of the proteins221. Phosphorylation of two serine residues (Ser-63 and Ser-73) in the transactivation domain of C-JUN by JNKs enhances C-JUN transcriptional activity. JNKs are a group of kinases that are activated as a response to cellular stresses, cardiac ischemia and reperfusion222. Interestingly, active JNK signalling is used as an indicator of pathological cardiac remodelling and heart failure223. Induction of JNK signalling is considered a therapeutic intervention, and it has been demonstrated that inhibiting JNKs improves many pathological conditions (Fig. 1.8). However, JNK is present in many forms, each of which has an important role in various different cellular processes in a range of different cell types. It is therefore difficult to define the precise role for JNKs in the primary reaction to cardiac ischemia and reperfusion224, 225. The loss of phosphorylation of C-JUN on Ser-63 and Ser-73 has been reported to decrease the transactivation of C-JUN which, as result, will cause a reduction in apoptosis and cellular proliferation. While phosphorylation of C-JUN by JNK is important for C-JUN function (fig. 1.8), other IEGs can also be inhibited through phosphorylation by JNK: such as, nuclear factor of activated T-cells, cytoplasmic 3 (NFATc3), nerve growth factor IB (NGFIB or Nur77) and Tau. JNK has a host of targets including the transcription factors activating transcription factor 2 (ATF-2), ElK1, p53, survival molecules Bim, Bad, B-cell lymphoma 2 (Bcl-2), myeloid cell leukaemia 1 (Mcl1), migratory proteins paxillin, microtubule-associated proteins, kinases AKt, p90, and other interacting proteins JIP-1, 14-3-3, which work as scaffolds/adaptors to bring various JNK complexes together 226. In the event that JNK does not bind to, and phosphorylate, an IEG, such as C-JUN, the IEG will be degraded resulting in inhibited expression of downstream genes. Therefore, JNK plays a direct role in the degradation of IEGs and ultimately affects cell viability 227.

Figure 1‎ .8. Phosphorylation of C-JUN through the activation of JNK The C-JUN N-terminal kinase (JNK) pathway is a mitogen activated-protein kinase (MAPK) pathway, which is activated through different extracellular stimuli and environmental stresses. The MAPK pathway has three steps starting with MAPKKK, which phosphorylates a dual specificity protein kinase (MAPKK) that will subsequently phosphorylate MAPK. Modified from224.

C-JUN is one of the IEGs that are induced upon arterial injury, forming homodimers and heterodimers with other bZip proteins that bind and form the AP-1 transcription factor. AP-1 has been linked with cell proliferation, tumorigenesis and apoptosis whilst having an important role in tumour suppression and cell differentiation. It has been reported that human smooth muscle cells express JNK, an activator upstream of C-JUN and other transcription factors. The knockdown of JNK results in the inhibition of neointima formation following balloon injury228.

1.4 General Introduction Part IV: Gene targeting agents

1.4.1 DNAzymes Gene expression is regulated in various cell types via the action of gene targeting agents or mechanisms, such as DNAzymes. The term DNAzymes refers to DNA molecules that are capable of catalysing a chemical reaction. The specificity of DNAzymes is through the nucleotide sequence in the two arms that flank the catalytic core of the enzyme and interact with the cleavage site in long target RNA transcripts. This substrate specificity and the stability of DNAzymes are advantages over ribozymes229. Importantly, the catalytic core needs to be conserved to retain catalytic activity of DNAzymes 230. Therefore, testing different molecules to detect a high level of DNAzyme activity upon interaction with their relevant target molecules is important in regulating gene expression231. C-JUN-specific DNAzymes inactivation of C-JUN resulted in cleavage of the C-JUN mRNA and inhibition of the protein expression. Ultimately, this reduced the proliferation of vascular smooth muscle cells (VSMCs)228. Dz13, a DNAzyme that cleaves C-JUN mRNA, blocks the expression of inducible C-JUN in VSMCs resulting in two RNA products of 474 base pairs (bp) and 194 bp in length232. In addition, Dz13 inhibits VSMCs self-repair after injury and reduced the formation of neointima by 60% in rat carotid arteries. Furthermore, immunohistochemically analysis demonstrated that Dz13 was able to block the induction of C-JUN immune-reactivity in smooth muscle cells (SMCs) while Dz13scr was not able to induce the same reaction. This supports the significant role of C- JUN in cell proliferation, wound repair and neointima formation228. The use of single-stranded DNA (ssDNA) to inhibit the translation and, therefore, expression of a complementary target RNA transcript in a cell, is a well-established process in regulating gene expression233. Short antisense ssDNA has been shown to inhibit viral replication of virus causing Rous sarcoma in culture, indicating that antisense nucleotides are a promising a new therapeutic strategy. Gene expression modification can be divided into two strategies: either anti-gene or anti-mRNA234. For clinical trials, it is vital that the antisense nucleic acid is gene-specific to the relevant gene, active during the disease course and the role of the gene should not be compensable by other genes235. Importantly, inhibition of the gene should not affect other normal physiological processes within the body. The mode of delivery, 31 modification and stabilisation of the nucleic acid may impact on or lead to non-specific outcomes236, 237.

1.4.2 Short interference RNA (RNAi) An alternative strategy for gene silencing is RNA interference (RNAi), which involves short, double-stranded RNA molecules interacting with target mRNA strands resulting in the inhibition of translation or degradation of target mRNA strands. It has been utilised in many different process involving the RNase III family, which interacts with the RNA-induced silencing complex (RISC)238. During the process of forming RISC, the sense strand of the double-stranded siRNA is cleaved whilst the RNA helicases work to unwind the double-stranded siRNA. Subsequently, the antisense strand binds to the RISC and guides the complex to the target mRNA. RISC cleaves the mRNA transcript 239 avoiding long double-stranded RNA, as this would activate the interferon pathway, shutting down general protein synthesis and leading to non-specific degradation of mRNA molecules (Fig. 1.9). A variation of RNAi is short hairpin RNAs (shRNAs), transcribed by RNA polymerases II and III promoters from plasmid and viral vectors. The shRNA is then processed by the Dicer endonuclease, resulting in siRNA duplexes 240.

Figure 1‎ .9. Processing of short interfering RNA Double-stranded RNA is processed by the Dicer endonuclease to create small interfering RNA (siRNA). The antisense strand of the siRNA is recognised by the RNA-induced silencing complex (RISC). The antisense strand of the siRNA guides the RISC to cleave the target mRNA transcript, promoting degradation of the mRNA. Modified from 241.

1.4.2.1 The challenges of using siRNA: Avoiding off-target effects There are certain issues that arise with the application of siRNA in vivo such as the small nucleic acids having tissue specificity and the ability to resist the degradation by nucleases. Resistance to nucleases is a main issue as in order for the RNA molecule to provide lasting effects in the cellular context, it has to survive within the host. Small nucleic acids are increasingly being employed as cancer therapeutics and, therefore, siRNAs are increasingly being produced with ligands or peptides, to facilitate tissue specificity and nuclease resistance242. This will help to minimise non-specific siRNA endocytosis in non-target tissue. Alternatively, siRNA could target the neovasculature and inhibit angiogenesis, ultimately cutting the blood supply to the tumour. Tissue specificity to tumour tissue has been demonstrated through the use of a nano-immuno delivery system involving systemic delivery of 6-FAM-labelled nanoplexed siRNA. This nanoplexed siRNA has an anti-transferrin receptor antibody that allows deep penetration into the tumour mass. This specificity for tumour was illustrated through the lack of fluorescence (6-FAM) in blood vessels, surrounding the tumour, suggesting that tumour cells endocytosis siRNA whilst the nearby endothelial cells do not 243.

1.4.3 Antisense oligonucleotides Antisense oligonucleotides (ASOs) are single-stranded DNA or RNA segments, usually between 15-25 bp in length. ASO gene silencing relies on the sequence-specific interaction with the target mRNA via hydrogen bonding, which blocks mRNA translation and ultimately, protein production244. The presence of ASOs interacting with mRNA transcripts hinders the action of the ribosome along the RNA transcript. Translational inhibition is also achieved via degradation of target mRNA molecules through the activation of endogenous RNase H, which targets the destruction of the DNA/RNA heteroduplex. The disadvantages of ASOs are that they are quickly degraded if they are unmodified and the negative charge on the molecule can affect the efficiency of cellular membrane penetration. Therefore, ASOs undergo various modifications to increase their stability and to improve the efficacy of cellular uptake. One modification includes the PS backbone modification implemented in increase DNAzyme stability that results in increasing the half-life of oligonucleotide 245. However, this particular modification increases the occurrence of non-specific interactions with other proteins, leading to cytotoxicity and the inhibition of DNA polymerases and RNase H246. Replacements for

34 the PS adaptation include the incorporation of locked nucleic acid (LNAs) into ASOs in the form of LNA/DNA gapmers, which increase target binding affinity and stability247. The modification of ASOs to increase stability of the nucleic acid can also involve the addition of 2’-O-alkyl to the ribose ring and finally, 3’-3’ and 5’-3’-inverted T alterations, which have been shown to inhibit tumour growth more effectively than PS-modified ASOs 248. The use of ASOs provides an alternative to targeting mRNA and inhibiting protein production, as they can act as oligonucleotide decoys. These short dsDNA molecules bind to a number of different proteins thereby inhibiting their binding their promoter region and ultimately preventing target gene expression249. Different types of decoys have been produced including unmodified oligonucleotide duplexes, α-β-anomeric oligonucleotides, duplexes encompassing methyl phosphonate and phosphorothioate modified bonds and circular dumbbell double-stranded oligodeoxynucleotides. Using decoy oligonucleotides to E2F in a rat model for carotid injury demonstrated the suppression of neointima formation. Subsequently, a rabbit model studying vein conduit arterial bypass grafting in cholesterol-fed animals had E2F oligonucleotide decoys introduced. This demonstrated a decrease in neointima formation and atherosclerosis over a 6-month period of treating it with the E2F decoys. E2F are a family of transcription factors that are involved in regulation of cell cycle and DNA synthesis in mammalian cells 250.

1.4.4 Ribozymes Ribozymes are naturally occurring catalytically active RNA molecules capable of site-specific cleavage of target mRNA transcripts. These enzymes present a strategy for gene silencing. There are four different subtypes of ribozymes, of which the most studied groups are hammerhead and hairpin ribozymes. These two subtypes are dependent on changes in the pH of their solvent, making them different from each other with regards to their catalytic response; hammerhead and hairpin ribozymes do not rely on the binding and ligation of cleavage products or the presence of metal ions 251. In order to improve the catalytic activity and stability of ribozymes, the substitution of deoxyribonucleotides with ribonucleotides at non-catalytic bases is employed. The implementation of ribozymes has been practiced in targeting platelet-derived growth

35 factor A-chain mRNA with chimeric DNA-RNA hammerhead ribozymes. This study demonstrated the prevention of intimal thickening in balloon-injured rat carotid arteries following local delivery. Moreover, systemic delivery of transforming growth factor-β- targeted chimeric DNA-RNA hammerhead ribozymes have been shown to protect from renal injury in hypertensive rats 252.

1.4.5 Aptamers Aptamers are synthetic oligonucleotide ligands, which function like decoys by binding to their target protein with high affinity and specificity, resulting in inhibition of the protein function253. Aptamers have been chemically modified for use in clinical trials, an example of which involves the replacement of the 2’-OH groups of the ribose backbone. This decreases the enzymatic degradation of aptamers254. The use of aptamers clinically is highlighted in the RNA aptamer-targeting vascular epidermal growth factor, called pegaptanib, which has been approved from the United States Food and Drug Administration for use against age-related macular degeneration255. Post- aptamer treatment revealed patients with decreased visual loss and improvements in other clinical symptoms. Aptamers have also been developed to interfere with key proteins of the Human Immunodeficiency virus 1 in its viral replication cycle, which resulted in replication inhibition256.

1.4.6 MicroRNA MicroRNAs (miRNA, miR) are single-stranded RNA molecules that are usually 22 nucleotides in length, with a role in regulating gene expression via targeting specific mRNA transcripts within the cell for translational inhibitions and degradation or cleavage 257. Inhibition of mRNA occurs through the incorporation of the miRNA into the RNA-induced silencing complex (RISC), which then directly binds members of the Argonaute protein family258. Subsequently, the miRNA guides RISC to the complementary binding site within the target mRNA. Base pairing occurs between the 5’ end of the miRNA termed the ‘seed region’ and sequences usually located in the 3’ untranslated region (UTR) of the mRNA molecule259. The mRNA will then either be cleaved or translation of mRNA will be inhibited, depending on the levels of complementarity between the two RNA transcripts260. There are an estimated 1000 miRNAs encoded within the human genome that are divided into two groups, those

36 transcribed in a stand-alone transcript form and miRNAs generated from processing introns of protein-coding genes. Intron-encoded miRNAs are co-ordinately expressed with the gene from which they are derived. This eliminates the need to have a separate cis-regulatory element promoting the miRNA expression261. The role of miRNAs in gene regulation is supported by the demonstrated downregulation of many protein-coding mRNAs by miRNAs. For example, miR-29 inhibits the fibrotic response 262, miR-1 inhibits cardiac conduction and miR-145, inhibits actin cytoskeletal dynamics and stem cell pluripotency 263. The biology of miRNA regulation is complicated as a complex network of miRNA interactions exists involving a single miRNA targeting multiple genes as well as a single gene being targeted by a range of miRNAs. A single miRNA having different target genes may stimulate co-regulation of gene expression by miRNAs, in which an individual miRNA could target several mRNAs whose protein products participate in a specific regulatory axis. miRNAs impact most cellular processes and play important roles in disease initiation and progression 257. It is clear that important biological pathways are modulated by miRNAs and, therefore, there is an opportunity to manipulate miRNA function using oligonucleotide inhibitors such as anti-miRs or miRNA mimics264. Antisense oligonucleotides that target specific miRNA sequences are an efficient way to block miRNA function, demonstrated in studies on the heart and its vasculature 265. Target protectors or masks are another oligonucleotide-based technique that functions by blocking an individual miRNA from binding to mRNA targets thus preventing the inhibition of the mRNA. A final mechanism for intervening with miRNA-regulated gene expression is by inhibiting binding of miRNAs to target RNA molecules through miRNA sponges or decoys, which contain several miRNA binding sites266.

1.4.6.1 MicroRNA and diseases MiRNAs play an important role in cardiovascular development and function, demonstrated through the tissue-specific deletion of the Dicer gene in mice, an essential endonuclease-coding gene involved in miRNA processing. The deletion of the Dicer gene resulted in lethal phenotypes of myocardial and vascular cell lineages. While this finding demonstrated the importance of miRNAs in the development of the cardiovascular system, no specific miRNA deletion has shown fully penetrant embryonic lethality in

37 mice. Lack of full penetrance suggests a level of high redundancy in miRNA function or that the miRNAs regulate transcription at a fine control level267. In addition, the difference in penetrance between the deletion of DICER and specific miRNA suggests that deletion of the Dicer endonuclease will affect the collective functions of many miRNAs, as opposed to a single miRNA 268. Cardiomyocytes, endocardial, epicardial and vascular cells, fibroblasts and cells of the conduction system are all involved in heart formation. Certain miRNAs are present in different cardiac cell types, contributing to the characteristics unique to the various cardiac cells 269. miRNAs have also been shown to contribute to developmental processes in embryonic stem cell differentiation, cardiomyocyte proliferation, contractility of cardiac muscle cells, ion channel regulation and cardiac conduction270. Genetic ablation and antisense oligonucleotide-mediated knockdown studies have demonstrated the participation of miRNAs in the aforementioned developmental processes. To efficiently repress target gene expression, a threshold level of miRNA expression is required; heart development regulation may be dependent on either a discrete set of miRNAs or the low level expression of a large array of miRNAs with combinatorial function 271. In cardiomyocytes, it is established that the most abundant miRNA is miR-1, which was the first miRNA to be implicated in heart development 272. miR-1 and miR-133 are related miRNAs derived from the same precursor RNA molecule273. Two separate enhancers mediate the expression of these miRNAs, and are regulated by the transcription factors serum response factor (SRF) and myocyte enhancer factor-2 (MEF2). It has been shown that miR-1 and miR-133 cooperate to stimulate mesoderm differentiation of embryonic stem cells and prevent endodermal and ectodermal differentiation state of the cells274. Endothelial cells are critical in the formation and function of the vascular system as demonstrated through the establishment and remodelling of a contiguous series of lumenised tubes functioning as an artery of the heart. A number of miRNAs were found to play an important role in directing vascular maturity as well as disease, one of which was miR-126275. miR-126 is an endothelial cell-specific miRNA that is encoded by an intron of the epidermal growth factor like domain 7 (Egfl7) gene. This gene encodes an endothelial cell enriched growth factor that contributes in regulating cell migration276.

Blood flow stimulates miR-126, which in turn controls angiogenic developing of aortic arch vessels by the promotion of vascular endothelial growth factor signalling 277. Endothelial and smooth muscle cells (SMCs) form the blood vessel wall and their roles are developing a sealed barrier to the blood whilst allowing the exchange of oxygen and nutrients between adjacent tissues 278. In a state of injury, endothelial cell migration or fragility and SMC de-differentiation, proliferation and migration is induced in the vessels. Multiple miRNAs have shown detectible changes in expression as a result of vascular injury and disease279. In addition, specific expression signatures have been associated with a number of cardiovascular pathologies including ischemia, tumour angiogenesis, atherosclerosis and restenosis280. Angiogenesis is the process of neo-vascularisation and requires the coordination of endothelial cell proliferation and vascular tube development in response to various stimuli, including tumour growth, retinal damage and ischemia281. miR-21 has been reported to influence the function and migration of angiogenic progenitor cells during coronary artery disease. Furthermore, promoting or inhibiting ischemia-induced angiogenesis in adult tissue can be achieved through antisense oligonucleotides targeting miR-92a or miR-126, respectively282. SMC phenotypic alterations, as an indicator of a de-differentiated state, result from vessel injury caused by different factors such as atherosclerosis, hypertension and damage due to mechanical stenting. Therefore, SMCs will become proliferative and migratory, which in turn causes them to enter the vessel lumen and initiate restenosis283. Recently, it was demonstrated that miRNAs play a crucial role in SMC phenotypic alteration and vessel remodelling. After mechanical injury of large blood vessels, miR-21 and miR-143/145 clusters were up and down regulated, respectively. It was reported that in order to prevent restenosis, restoration of miR-21 and miR-145 to normal levels is required284.

1.4.6.2 Target predications of microRNA C-JUN has a significant role in ultraviolet A (UVA) radiation-induced photo-aging. Under experimental conditions, it was shown that UVA significantly up-regulates C-JUN expression at the gene and protein level in human dermal fibroblasts (HDFs) but decreased miR-155 expression. Conversely, miR-155 targeted the C-JUN protein,

39 decreasing its expression level, which was alleviated with the use of a miR-155 inhibitor. Therefore, miR-155 has a role in controlling C-JUN protein expression in both UVA non- exposed and exposed HDFs. Interestingly, miR-155 has no effect on C-JUN mRNA expression, indicating that miR-155 inhibits C-JUN at the post-transcriptional level by inhibiting translation. A miR-155 binding site was identified that within the C-JUN 3’- UTR, indicated by complementarity between the seed region of miR-155 and the C-JUN sequence (Fig. 1.10) 285. Majority of growth factor receptors are activated by UV irradiation, leading to the activation of protein kinase cascades such as MAPK. In turn, this activates the AP-1 complex through increased expression of C-JUN and C-FOS. In addition, UV irradiation down-regulates the expression of miR-155 in HDFs. Activation of the AP-1/JNK pathway could stimulate the expression of miR-155 which in turn interact with C-JUN 3ÚTR and inhibit its translation. Increased UVA exposure induces higher expression of C-JUN and in turn, increased expression of miR-155 in HDFs. Up-regulation of AP-1/JNK and miR-155 by UVA-irradiation suggests a self defence mechanism with miR-155 down-regulating C- JUN, a member of heterodimeric transcription factor AP-1. Since C-JUN is implicated in UVA radiation-induced abnormal collagen gene expression in HDFs, miR-155 will work as a protective miRNA to inhibit AP-1 interfering with collagen synthesis and mediate UVA radiation-induced connective tissue damage 285. miR-125b is capable of binding to the coding sequence of C-JUN mRNA (Fig 1.10) thereby down-regulating C-JUN expression, thereby decreasing c-Jun protein levels and AP-1 activity. Decreased AP-1 levels and, thereby, AP-1 activity, ultimately target genes expression. Moreover, C-JUN is capable of positively regulating cell proliferation; this may be a result of down-regulation of tumour suppressor p53 expression and function and inducing the expression of cyclin D1. Therefore, C-JUN can act as the key molecule in mediating the effects of miR-125b in a cellular context286, 287.

Figure 1‎ .10. Target prediction of miR-155 and miR-125b for C-JUN and C-FOS immediate early genes C-JUN and C-FOS are main modulator immediate early genes (IEGs) in cell progression and proliferation. miR-155 and miR-125b have a sequence demonstrating partial complementarity in the 3’untranslated region (3’UTR) of these IEGs. Bold bases indicate complementarity between the miRNA and target gene. miR-155 is predicted to bind in the 3’ÚTR of C-JUN and C-FOS whilst miR-125b is predicted to bind in coding sequence of C-JUN only. Modified from159, 285.

C-JUN and C-FOS transcription factors contribute in the progression of cancer and targeting those help in determining disease pathways. Determination of miRNAs which can regulate the expression of C-JUN and C-FOS transcription factors can serve as potential therapeutic candidates. In Chapter 4 of this study miR-155 and miR-125b effects over C-JUN and C-FOS will be investigated in Human Embryonic Kidney 293 (HEK293) and malignant melanoma 200 (MM200) cell lines.

1.5 Aims and hypotheses

Human vascular smooth muscle cells (hVSMCs) play a functional role in diseases such as ischemia, inflammation, atherosclerosis and hypertension. hVSMCs are normally quiescent, non-migratory cells and exhibiting a contractile phenotype. Following injury or other stimulation, hVSMCs are activated and switch to a dedifferentiated, proliferative, migratory phenotype. Activated hVSMCs are a major cell type involved in cardiovascular diseases as they make up the better portion of blood vessels. Immediate early genes (IEGs) such as EGR1 control hVSMCs physiology through stimulating downstream proliferation and migration genes. Identifying and profiling IEGs responding to growth factor (FGF2) and cytokine (IL-1β) stimulation will help in understanding the signalling pathways and the downstream genes that are associated with it. We hypothesise that IEGs can be categorised into three groups according to their induction profile and this categorisation will enhance our recognition of main mediator genes. Serum stimulation of cancer cells has been shown to induce positive regulatory transcription factors, such as C-JUN, C-FOS and Egr-1228, 288, 289, as well as increasing transcriptional repressors such as YY1, NAB2 and GCF2290-292. These transcription factors play crucial roles in the early activation of cancer disease phenotypes and are prime targets for elucidating disease pathways and as therapeutic candidates. The identification of microRNAs regulating these transcription factors will enhance our understanding of the mechanism of disease gene induction and subsequent pathway activation leading to cancer disease phenotypes such as proliferation, differentiation, apoptosis and migration. MicroRNAs that ablate disease phenotypes are potential pharmaceutical therapies. We hypothesised that miR-155 is able to recognize C-JUN and C-FOS 3ÚTR and interact with it to inhibit their expression. miR-125 is able to recognize C-JUN coding sequence and interact with it to inhibit its expression. This project focuses on two disparate diseases, melanoma and CVD, in which IEGs play a crucial role in the activation of cellular differentiation, proliferation, migration and cell-cycle progression.

Over all aims:

To identify and profile immediate early genes (IEGs) responding to growth factor fibroblast growth factor 2 (FGF2) and cytokine interleukin-1 βeta (IL-1β) stimulation and to gain insight into downstream genes and pathways underlying the IEG response in human aortic smooth muscle cells hASMCs. (Chapter 3). To identify miRNAs in human embryonic kidney 293 (HEK293) and malignant melanoma 200 (MM200) cells regulating the transcription factors C-JUN and C-FOS which can serve as potential pharmaceutical therapies for cancer disease since C-JUN and C-FOS are associated with cancer disease phenotypes such as proliferation, differentiation, apoptosis and migration. (Chapter 4). To conduct an integrative bioinformatics analysis using a microarray, Kinome and iTRAQ data for the identification of changes in TF and miRNA expression in malignant melanoma 1007(ME1007) cells as a result of a new chemotherapeutic drug treatment in order to identify new therapeutic drug for melanoma (Chapter 5).

2 General Materials and Methods A number of molecular, tissue culture and bioinformatics analyses were performed in this project to address the aims outlined in section 1.1. The source and quality of the materials used for these experiments are identified in section 2.1. The methods are actually described in section 2.2

2.1 Materials The general reagents, kits, bacterial and human cells used were of are listed in Table 2.1 along with their source.

Table 2‎ .1. Cells, cell lines, reagents and kits used in this study Reagent Source and details Bacterial strains E. coli DH5α New England biolabs (C2987H) Cells Human Aortic Smooth Muscle Cells (hASMCs) Cell Applications Inc., San Diego, CA Human Embryonic Kidney Cells (HEK293) Molecular and Cellular Oncology group, ACP, UNSW Melanoma Cell Line (MM200) and (ME1007) Prof. Peter Hersey at the University of Sydney Kits miScript II RT kit Qiagen (218161) miScript Primer Assay Qiagen (218300) Miscript SYBR Green PCR Kit Qiagen (218075) High capacity cDNA reverse transcription kit Life Technologies (4368814) Chambered coverslip µ-slidw 4 well Ibidi (80426) PureYield Plasmid Maxiprep System Promega (A2393) RNeasy Mini RNA extraction kit Qiagen (74104) LightSwitch Assay System SwitchGear Genomics (LS010) Reagents Ethylenediamine-tetraacetic acid (EDTA) Life Technologies (15400-054) Agarose for nucleic acid electrophoresis Invitrogen (16500-500) Bovine serum albumin (BSA) Thermo Scientific (23225) Dimethyl Sulfoxide (DMSO) Sigma-Aldrich (D4540) Diothiothreitol (DTT) Sigma Aldrich (D5545) Dulbecco's Modified Eagle Medium (DMEM) Life Technologies (11965-118) Foetal Bovine Serum (FBS) Sigma-Aldrich (12003C) GelCode Blue protein stain Thermo Scientific (24590) Glycerol Sigma-Aldrich (G5516) Luria Bertani (LB) broth Life Technologies (12795-027) LB-Agar Becton Dickinson (244510) Methanol Univar (A2314)

Reagents Source and details Penicillin-Streptomycin Life Technologies (15070-063) Precision Plus protein standard Bio-Rad (161-0395) L-glutamine Life Technologies (25030-081) Waymouth Sigma Aldrich (W1625) SOC medium Invitrogen (15544-034) Restriction Enzyme XhoI New England BioLabs (R0146L) Restriction Enzyme NheI New England BioLabs (R0131L) Prolong Gold Antifade reagent Life Technologies (P36935) SYBR safe DNA gel stain Invitrogen (S33102) 1 KB DNA ladder Promega (G5711) Dnase I Qiagen (79254) Fibro Blast Growth Factor (FGF2) Promega (G507A) Interleukin-1β (IL-1β) CALBIOCHEM (407615) Trizol Invitrogen (15596-018) SYBR Green PCR Master Mix Life Technologies (4309155) Leupeptin Sigma Aldrich (L2023) Phenylmethanesulfonyfluoride (PMSF) Sigma Aldrich (P7626) Aprotinin Sigma Aldrich (A4529) Triton-X Sigma Aldrich (T9284) Deoxycholate Sigma Aldrich (D6750) Pre-cast gradient gel BioRad (456-1024) Bromophenol Blue Sigma Aldrich (B0126) Tween 20 Sigma Aldrich (P5927) Ponceau S Sigma Aldrich (P7170) Immobilon-P polyvinylidene fluoride (PVDF) Millipore (IPVH00010) ECL Plus Reagent Perkin Elmer (NEL103001EA) ISOTON II Beckman Coulter (41116015 Mitomycin C Sigma Aldrich (M5287) Propidium Iodide (PI) Sigma Aldrich (P4170) Buffers Tris/Glycerol Sigma Aldrich (G5516) Tris-NaCl (pH 7.5) Sigma Aldrich (S7653) Sodium Dodecyl Sulfate (SDS) Sigma Aldrich (L4509) Tris/Glycine (10×) MP Biomedical (808831) Tris-HCl (pH 7.5) (1M) Life Technologies (15567-027) Dulbecco's Phosphate-buffered saline (PBS) Life Technologies (14190) Tris/Borate/EDTA (TBE) buffer Sigma Aldrich (B7901) Tris/Acetate/EDTA (TAE) buffer Life Technologies (24710-030) NEB Buffer 4 New England BioLabs (B7004S) Tris/Acrylamide/Bis BioRad (161-0146) Bis(dimethylamino)ethane (TEMED) Sigma Aldrich (T7024) Ammonium persulphate (APS) Sigma Aldrich (A3678) PBST(DPBS/5% Teween 20)

Western blot assays were carried out to explore variance in gene expression at the protein level. The primary and secondary antibodies used in these analyses were sourced from various suppliers, as indicated in Table 2.2. The dilutions of the antibodies used in the westerns are also indicated.

Table 2‎ .2. Antibodies used in western blot method during this study Target Source Dilution C-JUN abcam (ab32137) 1:5,000 ICAM1 abcam (ab124759) 1:3,000 VCAM1 abcam (ab134047) 1:3,000 C-FOS SANTA CRUZ BIOTECHNOLOGY, INC (sc-52) 1:5,000 EGR1 Cell Signaling (15F7) 1:5,000 FOSB Cell Signaling (5G4) 1:3,000 NAB2 SANTA CRUZ BIOTECHNOLOGY, INC (sc-23867) 1:3,000 βactin Sigma Aldrich (A5316) 1:30,000 Anti-Mouse Dako (P0447) 1:5,000 Anti-Rabbit Dako (P0448) 1:5,000

The primers used for sequencing of the various genes of interest in this study are listed in Table 2.3. All primers have been synthesized by Sigma Aldrich.

Table 2‎ .3. Primers used in this study PRIMERS FORWARD SEQUENCE REVERSE SEQUENCE Tm Human-C-JUN AGA-GGA-GCG-CAT-GAG-GAA CCA-GCC-GGG-CGA-TTC 62◦C Human-FOSB AGC-AGA-GCT-GGA-GTC-GGA-GAT CAG-CTG-AAG-CCA-TCT-TCC-TTA-GC 60◦C Human-C-FOS CTA-CCA-CTC-ACC-CGC-AGA-CT GTG-GGA-ATG-AAG-TTG-GCA-CT 62◦C Human-EGR1 AGC-AGC-ACC-TTC-AAC-CCT-CA CAG-CAC-CTT-CTC-GTT-GTT-CAG-A 62◦C Human-VCAM1 CGA-AAG-GCC-CAG-TTG-AAG-GA GAG-CAC-GAG-AAG-CTC-AGG-AGA-A 60◦C Human-ICAM1 TGC-CCG-AGC-TCA-AGT-GTC-TA GCC-TGC-AGT-GCC-CAT-TAT 60◦C Human-GAPDH GAA-GGC-TGG-GGC-TCA-ATT-T CAG-GAG-GCA-TTG-CTG-ATG-AT 60◦C Human-18S CGG-CTA-CCA-CAT-CCA-AGG-AA GCT-GGA-ATT-ACC-GCG-GCT 60◦C

Dharmacon ON-TARGETplus SMARTpool L-006526 that was employed to target human endogenouse EGR1 expression is shown in Table 2.4. 4 siRNAs are pooled together and all specific to EGR1.

Table 2‎ .4. ON-TARGET plus Human EGR1 siRNA used in this study Target Gene Catalog Number Target Sequence Human EGR1, NM_001964 J-006526-06 GAUGAACGCAAGAGGCAUA J-006526-07 CGACAGCAGUCCCAUUUAC J-006526-08 GGACAUGACAGCAACCUUU J-006526-09 GACCUGAAGGCCCUCAAUA

A number of standard oligonucleotides used as siRNA and miRs in this study. They are outlined in Table 2.5 along with the source.

Table 2‎ .5. Oligonucleotides used in this study Oligos Source and details Signal Silence Control siRNA Cell Signaling (6201) 2ÓMe-hsa-miR-155 Intergrated DNA Technology 2ÓMe-hsa-miR-125b Intergrated DNA Technology Pre-miR-hsa-155-5p Ambion (PM12601) Pre-miR-hsa-125b-5p Ambion (PM10148) Pre-miR miRNA Precursor Molecules Negative Control #1 Ambion (AM17110) Anti-miR, miRNA Inhibitor Negative Control #1 Ambion (AM17010)

A number of standard oligonucleotides used as primers for miRNAs in this study. They are outlined in Table 2.6 along with the source.

Table 2‎ .6. MiScript primer used in this study miSCRIPT Primer Assays Source and details Hs_miR-155_2 (miR155) Qiagen (MS00031486) Hs_miR-125b_1 (miR125b1) Qiagen (MS00006629) Hs_SNORD68_11 Qiagen (MS00033712*) Hs_RNU6-2_1 Qiagen (MS00033740*)

For transfection of the oligonucleotides into the various cell lines, a number of transfection reagents were used and optimised in this study. These, and the supplier, are listed in Table 2.7.

Table 2‎ .7. Transfection Reagent used in this study Transfection Reagent Source and details DharmaFECT 1 ThermoScientific (T-2001-04) DharmaFECT 2 ThermoScientific (T-2002-04) DharmaFECT DUO SwitchGear Genomics (T-2010-02) The critical equipment’s used in this study are listed in Table 2.8.

Table 2‎ .8. Main instruments that have been used in this study Instruments Source Nanodrop 1000 Thermo Scientific FluoView FV1000 Confocal microscope Olympus CFX96 Touch Real-Time PCR Detection System BioRad FLUOstar Omega BMG Labtech Coulter Counter Beckman Coulter Flow counter (FACSCANTO II) BD Bioscience Gel Doc 2000 BioRad Veritas MicroPlate Luminometer Turner BioSystem

2.2 General Methods The techniques employed in this study are outlined in the following sections. This are grouped into molecular and cell culture techniques and used the materials outlined in Section 2.1.

2.2.1 Cell culture The in vitro studies described in this study used a number of different cells and cell lines which were cultured and manipulated as described in the following sections.

2.2.1.1 Cell Maintenance Cell cultures in this study were maintained at 37◦C in humidified atmosphere of

5% CO2. Cell growth medium containing 10% FBS and 5% L-glutamine (referred to as complete medium in this study) and was changed every 2-3 days to new 175 cm2 flask. For passaging the cells, old media was removed and the cells washed with DPBS (Life Technologies). A mixture of 0.05% trypsin and 0.53 mM EDTA (Life Technologies) was added to the cells and the cells incubated at 37◦C for a maximum of three minutes or until the cells detached. Complete growth medium was added to inhibit digestion of the cell membrane proteins, and the cell suspension transferred to a 15ml centrifuge tube. The cells were then centrifuged at 480 g (2000 rpm) to pellet the cells. The supernatant was then removed and the cells re-suspended in fresh complete growth medium and a portion of the cells transferred into new flask at dilutions indicated under each cell line.

2.2.1.2 Human Aortic Smooth Muscle Cells (HASMCs) Primary HASMCs (Table 2.1) were used in this study as a Vascular Smooth Muscle Cell (VSMC) model. Cells were grown in complete waymouth (Table 2.1) medium. Subcultivation (or passage) of these primary cells was done at a split ratio of 1:2-1:4 during this study. The cells were only used up until passage eight at which time they were discarded. HASMCs were used to study the activation of VSMCs and Immediate Early Genes (IEGs) described in chapter 3.

2.2.1.3 Human Embryonic Kidney 293 Cells (HEK293) HEK293 cells were grown in complete high glucose DMEM (Life Technologies) medium. Subcultivation of HEK293 cells was done at a split ratio of 1:10-1:15. HEK293

49 cells were used in this study as positive control to investigate the effect of miR-155 and miR-125b on C-JUN and C-FOS expression levels as outlined in chapter 4.

2.2.1.4 MM200 Melanoma Cell Line MM200 cells were grown in complete high glucose DMEM (Life Technologies) medium. Subcultivation of MM200 cells was done at a split ratio of 1:10-1:15. MM200 cells are used in this study to investigate the effect of miR-155 and miR-125b on C-JUN and C-FOS expression levels as described in chapter 4.

2.2.1.5 ME1007 Melanoma Cell line ME1007 cells were grown in complete high glucose DMEM (Table 2.1) medium. Subcultivation of ME1007 cells was done at a split ratio of 1:10-1:15. ME1007 cells are used in this study to investigate the effect of X4 and X6 drug on various transcription factor expression levels as outlined in chapter 5.

2.2.2 Stimulation of gene expression In order to study the stimulation of the responder genes by FGF2 and IL-1β, the cells were first serum staved for 24 hours, treated with FGF2 and IL-1β before the cells were lysed for RNA and protein isolation

2.2.2.1 Serum starvation of HASMCs When cells reached 70-80% confluency, the old media was removed and the cells washed with DPBS (Table 2.1). The cells were then refed with Waymouth (Table 2.1) medium without FBS (i.e. serum free medium) and the cells incubated for 24 hours. This step is known as serum arrest step and was performed in order to study the induction of transcription factors after stimulation with FGF2 and/or IL-1β.

2.2.2.2 FGF2 and IL-1β stimulation of HASMCs FGF2 (Table 2.1) was reconstituted by dissolving it in 0.05% FBS/DMEM (Table 2.1) resulting in a 25µg/ml stock solution. FGF2 was stored at -80◦C. The serum serum arrested cells were treated with FGF2 at a concentration of 50ng/ml. Similarly, IL-1β (Table 2.1) was reconstituted by dissolving it in sterile water resulting in a 10µg/ml stock solution. IL-1β was stored in -80◦C. The serum serum arrested cells were treated with IL- 1β at a concentration of 10ng/ml.

2.2.2.3 Serum starvation of HEK293 and MM200 When cells reached 50-60% confluency, the old media was removed and the cells washed with DPBS (Table 2.1), refed with serum free DMEM (Table 2.1) for 24 hours. This step is known as serum arrest step and was performed in order to study the inductions of transcription factors and microRNAs after stimulation with FBS.

2.2.3 Gene expression identification In order to determine the variations in expression of various genes at the mRNA level, a Real time, quantitative, reverse transcription, polymerase chain reaction (qRT- PCR) was used. Simultaneously, changes in gene expression at the protein level were determined using Western blot. The use of these two methodologies allows us to determination if the gene expression is regulated at the level of transcription or post- transcriptionally and the effects on downstream genes.

2.2.3.1 Measurement of gene expression at mRNA level using real time quantitative reverse transcription polymerase chain reaction

2.2.3.1.1 RNA extraction Harvesting RNA from cell culture was accomplished by removing of the growth medium and washing the cells with ice-cold DPBS (Table 2.1) to remove dead cells and the growth medium. After removal of the DPBS, Trizol (Table 2.1) was added to the cell cultures and RNA was harvested according to the manufacturer’s instructions. Briefly, purification of the extracted RNA was achieved by using RNeasy Mini Kit (Table 2.1), as per the manufacturer’s instructions. A DNase I (Table 2.1) treatment step was used to eliminate DNA contamination. RNA concentration was assayed using Nanodrop 1000 (Table 2.1).

2.2.3.1.2 Synthesis of cDNA for transcription factors detection Synthesis of first strand cDNA was carried out using the High Capacity Reverse Transcription Kit (Table 2.1) according to the manufacturer’s instructions. Briefly, a reaction mix of 10X RT buffer, 100mM 25x dNTPs, 10 X RT random primers, RNase Inhibitor and multiscribe RT was prepared and diluted with nuclease free water (Table 2.1). This master mix was kept on ice. The extracted RNA was diluted to 100 ng/µl. 10µl of RNA was then mixed with 10µl of master mix, briefly centrifuged and incubated to allow cDNA synthesis under the following conditions; 25◦c for 10 mins, 37◦c for 120 mins, 85◦c for 5 mins. The cDNA was diluted 1:2 after cDNA synthesis and stored at 4◦C for later use.

2.2.3.1.3 Synthesis of cDNA for microRNA detection Synthesis of first strand cDNA carried out using the miScript II RT Kit (Table 2.1) according to the manufacturer’s instructions. Briefly, a reaction mix of 5X HiFlex buffer,

10X nucleics mix and miscript RT mix was prepared and diluted with nuclease free water (Table 2.1). The master mix was kept on ice and the extracted RNA was diluted in water to 100 ng/µl. 10µl of RNA was then mixed with 10µl of master mix and briefly centrifuged. The cDNA synthesis was then carried out under the following conditions; 37◦C for 60 mins, 95◦C for 5 mins, and then the cDNA samples were diluted 1:3 after cDNA synthesis and kept at 4◦C for later use.

2.2.3.1.4 qRT-PCR for transcription factors expression detection In order to detect the expression of transcription factors, a qPCR was performed using the Power SYBR Green PCR Master Mix Kit (Table 2.1). A master mix was prepared consisting of 1 µl cDNA template (see section 2.2.3.1.2) and 19 µl of SYBR Green, 10µM of forward and reverse primers (Primers used are shown in Table 2.3). Reactions were performed in a BIORAD CFX-96 Touch Real-Time PCR Detection System (96-well plate) according to the following protocol: an initial hold step (50ºC for 2 mins), an activation step (94◦C for 10 mins), followed by 45 cycles of denaturation (94ºC for 30s), annealing (62ºC for 30s), and extension (72ºC for 20s). After these 45 cycles, a thermal ramp step (60°C to 94°C) was accomplished to allow melt curve analysis. The existence of single peak in the melt curve indicated of the specificity of the PCR reaction. Data analyses were accomplished using CFX-96 software, version 2.1 (BIORAD) that were provided along with the instrument. The amount of template (indicating expression level) was estimated using the comparative threshold cycle (Ct) technique. Glyceraldehyde-3- phosphate dehydrogenase (GAPDH) was used as an internal control gene for the normalization of target gene expression level run in a separate tube in parallel.

2.2.3.1.5 qRT-PCR for microRNA expression detection In order to detect the expression of microRNA, a qPCR was performed using the miScript SYBR Green PCR Kit (Table 2.1). A master mix was prepared consisting of 2.5 µl cDNA template (see section 2.2.3.1.3) and 20 µl of 2x Quantitate SYBR green PCR Master Mix, 10x miScript universal primer and 10x miScript primer assay (Table 2.1) (Primers used are shown in Table 2.6). Reactions were performed in a BIORAD CFX-96 Touch Real- Time PCR Detection System (96-well plate) according to the following protocol: an activation step (95◦c for 15 mins), followed by 40 cycles of denaturation (94ºC for 15s), annealing (55ºC for 30s), and extension (70ºC for 30s). ). After these 45 cycles, a thermal

53 ramp step (60°C to 94°C) was accomplished to allow melt curve analysis. The existence of single peak in the melt curve indicated of the specificity of the PCR reaction. Data analyses were accomplished using CFX-96 software, version 2.1 (BIORAD) that were provided along with the instrument. The amount of template (indicating expression level) was estimated using the comparative threshold cycle (Ct) technique. Small nucleolar RNA, C/D box 68 (SNORD68_1) or RNA, U6 Small Nuclear_2 (RNAU6_2) was used as an internal control gene for the normalization of target microRNA expression level run in a separate tube in parallel.

2.2.3.1.6 Cap Analysis Gene Expression (CAGE) The cap analysis gene expression (CAGE) approach involves preparing and sequencing DNA tags derived from the original 20 nucleotides of the 5’end of mRNA transcripts293. CAGE approach gives a high amount of data for the identification of sequence tags matching the cap site of the 5’end of mRNA and also identifies the transcriptional start point (TSP) of the same mRNA. CAGE technique uses full-length cDNA, which are cap-trapped at the 5’end with biotinylated linkers (recognition site for cloning, short specific base sequences and endonuclease recognition site) 294. A class II restriction enzyme is used to cleave the first 20 base pairs of the mRNA transcript. Polymerase Chain Reaction (PCR) is performed to amplify the 5’ DNA tags with subsequent concatamerization (concatamers of repeated DNA sequence joined to form a long stretches of DNA with multiple copies of the same DNA sequence) and cloning. CAGE tags that result from sequencing such libraries are mapped to the genome to determine TSPs, perform expression studies and to define the 5’end borders of novel transcriptional units. Sequencing the CAGE concatamers is cheaper than library sequencing of the full-length cDNA, due to the great output of recognised tags293. CAGE analysis was performed by the Omics Science Centre, RIKEN Yokohama Institute (Japan) as part of a global consortium (FANTOM5). Total RNA (in triplicate) from hASMCs cells stimulated with IL-1beta or FGF-2 for times of up to 6 hours, was provided to Omics Science Centre. For preparation and isolation of the total RNA, the hASMCs cells were grown in 10 cm petri dishes in Waymouth’s medium, pH 7.4, supplemented with 1 mM L-glutamine, 10 units/ml penicillin, 10 mcg/ml streptomycin and 10% fetal bovine serum, at 37°C in a humidified atmosphere of 5% CO2. The cells

54 were serum starved at 80-90% confluency by incubation in serum-free medium O/N. Cells were then exposed to IL-1beta (10ng/ml) or FGF-2 (50ng/ml) for various times up to 6 hours (15, 30, 45, 60, 120, 180, 240, 300 and 360 min). 0 min samples represent serum starved, non-stimulated cells. RNA was harvested using TRIzol reagent and purified using mRneasy qiagen kit and according to the manufacturer’s manual. Extracted RNA was quantified using a Nanodrop 1000 (Thermo scientific) spectrophometer. cDNA synthesis has been performed as described in section 2.2.3.1.2. A q-PCR performed as in 2.2.3.1.4 was then performed to validate the transient induction of Egr-1 mRNA prior to shipment of the total RNA to the Omics Science Centre, for CAGE analysis. Gene expression data from CAGE was analysed as stimulated expression relative to unstimulated, for each gene (fold change). Gene mRNA expression was normalized to the expression at time 0. We adopted a 2-fold response cut off for the expression for a gene to be considered as a responsive gene in these primary cells295. Accessing the results of the samples after applying the CAGE technique was completed via ZENBU software (Fig 2.1).

2.2.3.1.7 Validation of transcription’s factors primers Sigma Aldrich was the source of all the primers used in this study. All primer sequences are detailed in Table 2.3. Duplicate sets for cDNA samples, of ten-fold serial dilution (1:1, 1:10, 1:100, 1:1000), were used to generate standard curves for each primer pair used. The existence of single peak in the melt curve, confirmed the amplification of just one amplicon during the PCR reaction. Furthermore, verification of primer specificity was carried out by electrophoresis of the PCR product on a 2% agarose gel/TAE (Table 2.1) and confirming a single PCR product detected by SYBR safe DNA Gel Stain (Table 2.1) using a Gel Doc 2000 (Table 2.1). The size of the PCR product was estimated by comparing with a 100 base pair DNA ladder (Table 2.1) run on the gel.

Figure 2‎ .1. CAGE data tool used for hASMC gene expression analysis Human VSMCs were stimulated with FGF2 and IL-1β over a 6 h time course. Total RNA was extracted and cap analysis gene expression (CAGE) analysis was performed by RIKEN Institute (Japan) as part of a global consortium (FANTOM5). CAGE was employed to generate snapshots of the 5’ end of the messenger RNA transcripts in biological samples, showing the expression profile of any gene present in the selected sample. Small fragments ~20-21 nucleotides in length from the 5’ end of capped mRNAs were reverse-transcribed to cDNA, amplified by PCR and sequenced. Gene names are searched in the FANTOM5 online browser, which provides details of the chromosomal location and length of the gene. FANTOM5 implements human genome 19 (hg19) versions.

2.2.3.2 Measurement of gene expression at protein level using western blot method

2.2.3.2.1 Extraction of protein Preparation of Radioimmunoprecipitation assay (RIPA) lysis buffer to extract protein from the cells was carried as follow; RIPA is an ionic buffer which consists of 50mM Tris pH 7.5 and 150 mM sodium chloride (NaCl) (Table 2.1) along cell permeabilizing/ protein-denaturing agents: 0.1% (SDS) (Table 2.1), 2% deoxycholate (Sigma Aldrich) and 1% Triton-X (Sigma Aldrich). Protease inhibitors were also added to the buffer at 5mg/ml leupeptin (Table 2.1), aprotinin (Table 2.1), 500 mM EDTA and 100 mM PMSF (Table 2.1). Protein was harvested from cells by washing cell cultures with cold DPBS two times and then adding 2 ml of ice-cold RIPA buffer per 100mm dish. The cells were immediately scrapped using a cell scraper (sigma Aldrich) at 40C. The lysate was sheared by pipetting up and down and the lysate collected into a 0.5 ml microtube and freeze- thawed in order to ensure lysis of the cells. Samples were then centrifuged at 4◦c for 15 mins in order to remove cell debris and supernatant transferred to new tube. Measuring protein concentration was obtained through the usage of the Pierce bicinchoninic acid (BSA) protein assay (Thermo Scientific). This was achieved according to the product instruction in 96-well plate, which were read at 562 nm on FLUOstar Omega (BMG Labtech).

2.2.3.2.2 Western blot method Equal amounts of the whole protein lysates were resolved by polyacrylamide gel electrophoresis (PAGE). Samples were diluted upto 15.5 µl with RIPA buffer as necessary, and 6 µl of 4X SDS loading buffer (1 ml 0.5 M Tris, pH 6.8; 0.8 ml 100% glycerol (Sigma Aldrich); 0.5 ml sterile water), and 2 µl of 0.5 M DTT (Sigma Aldrich). After mixing, the samples were boiled for 5 mins, allowed to cool for 5 mins on ice, and then loaded on an SDS-polyacrylamide gel along with the Precision Plus Kaleidoscope Protein Standards Ladder (BioRad) in order to estimate the molecular weights. For gel electrophoresis, a 7.5% precast gradient gel (BioRad), was always used in this study. Electrophoresis was carried out at 100 V for 1.5-2 hours in SDS running buffer (3 g Tris, 14.4 g glycine (Biomedicals), 1 g SDS that were prepared to a volume of 1 L using RO water). The proteins were then electro transferred to a PVDF membrane (Table

2.1). The membrane has been previously been wetted in 100% ethanol and washed with water until no beads are seen. Electro transfer was carried out at 100 V for 1.5-2 hours in cold transfer buffer (3 g Tris, 14.4 g glycine, 200 ml methanol (Table 2.1) and made upto 1L with RO water). The gel was stained with GelCode Blue Stain Reagent (Table 2.1) and the membrane stained with Ponceau S (Table 2.1) to confirm protein transfer. After transfer, the membranes were air-dried inside a fume hood. For Western blotting, the membranes were re-wetted with 100% ethanol and RO water until all beads were gone and then stored in PBST solution until western protein detection. A blocking solution (PBST plus 5% skim milk powder) was used to block non-specific protein binding at room temperature. Then, in order to detect protein of interest, the membrane was incubated overnight with a primary antibody (Table 2.1) diluted in blocking solution in 4◦C. The next day, the membrane was washed with PBST three times each for 15 mins in order to remove unbound primary antibody. Then the membrane was incubated for one hour at room temperature with horseradish peroxidase (HRP) conjugated secondary antibody (Table 2.1) diluted in the blocking solution. The membrane was then washed with PBST three times each for 15 mins in order to remove unbound secondary antibody. Western Lighting ECL plus Reagent (Perkin Elmer) was added to the membrane and incubation occurred for 1 min, luminescent signal was produced by HRP that cleaved the substrate. Exposing a photographic film to the membrane allows the luminescent bands to be detected.

2.2.4 Post-transcriptional silencing of C-JUN, C-FOS and EGR1

2.2.4.1 Silencing of C-JUN and C-FOS using microRNAs targeting human endogenous C- JUN and C-FOS Pre-miR miRNA precursors for miRNA for C-JUN and C-FOS inhibition are commercially available. Pre-miR miRNA precursors (hsa-miR-155 and hsa-mir-125b) were purchased from Ambion (Table 2.5). Pre-miR miRNA precursor negative control #1 and anti-miR miRNA inhibitor negative control #1 were also purchased from Ambion and used as control to confirm the specificity of has-miR-155 and has-miR-125b for C-JUN and C-FOS. 2’O Methyl RNA oligos for miR-155 and miR-125b (Integrated Technologies, Table 2.5) were used in this study to determine the effects of miR-155 and miR-125b on C-JUN and C-FOS.

2.2.4.2 siRNA targeting human endogenous EGR1 for inhibition Dharmacon ON-TARGET plus SMART pool siRNA specific for human EGR1296 were purchased from Thermo scientific and the sequences of the pooled siRNA are provided in table 2.4. Dharmacon ON-TARGET plus Non-Targeting Control Pool also was purchased from Thermo Scientific and was used in this study to validate specificity of siRNA.

2.2.4.3 Liposomal delivery of microRNA and siRNA Lipid based ransfection reagents were used in this study. For microRNA delivery in to HEK293 and MM200 cell lines, DharmaFECT 1 (Table 2.7) from Thermo Scientific was used. For siRNA delivery in to HASMCs cell line, DharmaFECT 2 (Table 2.7) from Thermo Scientific was used.

2.2.4.4 Transfection Optimization Transfection optimization was accomplished using a fluorescently labelled siRNA control (Table 2.5). Chambered coverslip µ-Slide 4 well (Table 2.1) was used to grow the cells on microscope appropriate slides. When the cells reached 50-60% confluency, they were serum starved for 6 hours before being transfected (as described in section 2.2.4.5) with siRNA-FITC. The transfected cells were then washed twice with DPBS and fixed in 10% neutral buffered formalin (Table 2.1) for 20 minutes. The fixed cells were then washed in two washes of DPBS, and then Prolong Gold Antifade reagent (Table 2.1)

59 was added to the slides as a nuclear counterstain. Flourescent photomicrographs were captured using the Olympus FluoView FV1000 confocal microscope,.

2.2.4.5 Transfection of HASMCs with siRNA HASMCs were serum starved for 6 hours before transfection with siRNA for 20 hours. A master mix of 2.68 µl DharmaFECT 2 for every 1 µg of siRNA was made using serum free growth media without antibiotics and the master mix was incubated at room temperature for at least 20 mins to complex the siRNA and liposomes. The Master Mix was then added to the culture in a drop-wise manner, mixed by gentle swirling and placed back into the incubator at 37◦C for 20 hours. In total, cells stayed in serum arrest condition for 26 hours.

2.2.4.6 Transfection of HEK293 and MM200 cell lines with microRNAs HEK293 and MM200 cell lines were transfected with microRNA after 6 hours of serum starvation and both cell lines were transfected for 20 hours. Transfection was done at 200nm concentration and dilution 1:3, thus a master mix of 3 µl DharmaFECT 1 for every 1 µl of microRNA was made using media with free serum and antibiotic which was left at room temperature for at least 20 mins to complex. Master Mix was added to the desired culture on drop-wise manner, mixed through gently being swirled and placed back into the incubator at 37◦c for 20 hours. In total cells stayed in serum arrest condition for 26 hours.

2.2.5 Expression of cloned 3’-UTR of C-JUN and C-FOS in HEK293 and MM200 cell lines to target the miR-155 and miR-125b A 3’-UTR sequences from C-JUN, C-FOS , C-JUN CDS and EGR1 were cloned into the luciferase expressing plasmid , Plight switch_3UTR (Fig 2.2) (Switch Gear Genomics) using NheI/XhoI. Details of the gene sequences used are shown in table 2.9. These cloned plasmids were used to demonstrate that miR-155 and miR-125b do actually bind the proposed sequences of C-JUN and C-FOS and that they act to repress the expression of C-JUN and C-FOS. EGR1, empty cloning vector and mutated C-JUN 3’-UTR, C-FOS 3’-UTR and C-JUN CDS were used as negative controls. pLight Switch_3UTR vector has a luciferase gene to demonstrate binding of miR-155 and miR-125b to the target sequence.

Table 2‎ .9. Genes cloned in the luciferase plasmid Symbol Gene ID/Product Insert Restriction Pair Sequence ID Length JUN 3’-UTR 3725/S808932 1394 NHE1, XHO1 Please refer to Appendix FOS 3’-UTR 2353/S806782 973 NHE1, XHO1 Please refer to Appendix JUN CDs 3725/ Custom 1049 NHE1, XHO1 Please refer to made Appendix EGR1 1958/S808505 1337 NHE1, XHO1 Please refer to 3’-UTR Appendix JUN 3ÚTR S808932_M 1394 NHE1, XHO1 Please refer to mutated Appendix FOS 3ÚTR S806782_M 973 NHE1, XHO1 Please refer to mutated Appendix JUN CDs Custom made 1049 NHE1, XHO1 Please refer to mutated Appendix

Figure 2‎ .2 pLightSwitch_3UTR plasmid used in this study pLight Switch_3UTR is 3910 base pairs and contains the PRL10 promoter, RenSP reporter gene (synthetic renilla luciferase includes mODC PEST), multiple cloning region 2, SV40 late poly(A) region, co1E1-derived plasmid replication origin, synthetic Beta-lactamase (Ampr) coding region and Synthetic poly(A) signal/transcriptional pause site.

2.2.5.1 Amplification of plasmid DNA DNA plasmids were supplied as 30ng/µl stock. One hundred and twenty µl of each plasmid were incubated with 50 µl DH5α competent Escherichia coli cells (Table 2.1) in an Eppendorf tube on ice for 30 minutes. The mix was then heat shocked for 20 seconds at 30◦C, which allows the competent cells to take up the plasmid DNA. The mix was then incubated on ice for two minutes in order to retain plasmid DNA 450 µl of SOC medium (Table 2.1) was added to the transfected cells. After an hour of incubation in the SOC medium in a shaking incubator at 37◦C, the transfected cells were then spread onto plates containing LB-agar (BD) containing 25µg/ml ampicillin (Table 2.1) antibiotic. The plates were incubated O/N at 37◦C after which single colonies from each plate was picked and cultured in 5 ml LB (Table 2.1) with ampicillin (25µg/ml) at 37◦C in a shaking incubator. After 4 hours, the culture was transferred to a larger volume (200 ml) of LB/ampicillin medium and incubated overnight, shaking at 37◦C. The next day, 500 µl of each culture was mixed with 500 µl of glycerol (Sigma Aldrich) and cryopreserved at - 80◦C for future use. The rest of the transformed bacteria were collected and the plasmids were isolated from cultures by PureYield Plasmid Maxiprep System kit (Table 2.1). The purified plasmid concentrations and purify were estimated using the Nanodrop 1000.

2.2.5.2 Validation of plasmid The inserts were cloned into the Nhe1 and Xho1 restriction sites of the pLightSwitch_3UTR plasmid. Verifying that the plasmids contained the inserts was achieved through enzymatic digestion using Nhe1 and Xho1 (New England Biolabs). 0.5 μl of each digestion enzymes plus 1.5 µl 10x NEB buffer 4 and 0.15 μl BSA (Table 2.1) were added to 1 µg of each plasmid DNA. Mix was diluted to 1x by sterile water and incubated at 37◦C O/N. Next day, a 0.8% agarose gel was prepared containing SYBR safe DNA Gel Stain (1:10000). 1 KB DNA Ladder (Table 2.1) was loaded as a reference and the digested plasmids were loaded and electrophoresed on the gel. The NheI/XhoI double digestion of the plasmids resulted in having two bands for all of the recombinant (insert containing) plasmids as shown in Figure 2.2.

1 2 3 4 5 6 7 8 9

3910 bp

1300 bp 1000 bp

Figure 2‎ .3 Nhe1 and Xho1 digestion of pLightSwitch_3UTR plasmid Recombinant plasmids were digested with Nhe1 and Xho1 (New England Biolabs) producing two cleavage products; the 3910 bp vector and the insert varies from ~900-1400 bp (as per Table 2.9). Lane.1: 1 KB ladder, Lane.2 : Nhe1 and Xho1 digestion of pLightSwitch-3UTR-c-Fos 3ÚTR, Lane.3: s Nhe1 and Xho1 digestion of pLightSwitch-3UTR-c-Jun 3ÚTR, Lane.4: Nhe1 and Xho1 digestion of pLightSwitch-3UTR-c-Jun CDS, Lane.5: s Nhe1 and Xho1 digestion of pLightSwitch- 3UTR- EGR-1 3ÚTR, Lane.6: empty Nhe1 and Xho1 digestion of pLightSwitch-3UTR, Lane.7: s Nhe1 and Xho1 digestion of pLightSwitch-3UTR-mutated c-Fos 3ÚTR, Lane.8: s Nhe1 and Xho1 digestion of pLightSwitch-3UTR- mutated c-Jun 3ÚTR, and Lane.9: s Nhe1 and Xho1 digestion of pLightSwitch-3UTR-mutated c-Jun CDS.

2.2.5.3 Transfection of pLightSwitch_3UTR plasmids expressing luciferase in HEK293 and MM200 The eight plasmids that were shown in figure 2.2, were purified for transfection into HEK293 and MM200 cells. The aim of this experiment is to confirm that hsa-miR- 155 is able to bind to 3’-UTR of C-JUN and C-FOS and that hsa-miR-125b is able to bind to c-Jun CDS. This transfection was carried out as follows; The HEK293 cell line was seeded in 96 well plates (5,000 cells/well) and MM200 cell line was seeded in 96 well plates (10,000 cells/well). Both cell lines were incubated in complete high glucose DMEM medium O/N. The cells were then washed with DPBS and then serum starved in high glucose DMEM medium containing no FBS/penicillin. After 6 hours of serum starvation, a master mix of 1 µg plasmid, 100µM precursor microRNA and 0.5 µl DharmaFECT DUO, were prepared with high glucose DMEM medium without serum and antibiotic, and incubated for 20 minutes at room temperature to complex the liposomes and plasmid DNA. The cells were then transfected by adding the master mix in a drop wise manner and mixed by rocking gently to back and forth. Plates were replaced in the incubator and incubated at 37◦C O/N. Cells remained serum starved in total for 24 hours and then a 10% FBS was added to each well for another 24 hours. Next day, two washes of DPBS were performed and plates were incubated at -80◦C for an hour to insure complete lysis of the cells. Luciferase assay was performed on these cells using Light Switch Assay System (SwitchGear Genomics) as per the manufacturer’s instructions. Luciferase luminescent for each plasmid was determined using Veritas Microplate Illuminometer (Turner BioSystem).

2.2.6 Measuring downstream effects of microRNAs on C-JUN and C-FOS treatment

2.2.6.1 Cell proliferation assay HEK293 and MM200 cells were seeded into 96 well plates in high glucose complete DMEM medium. After 24 hours, the cells were serum starved and then transfected as described in section 2.2.4.6. Twenty hours post-transfection, the cells were serum stimulated with 10% FBS containing growth medium for 24 hours, washed twice with cold DPBS and detached using 50 µl of TE. The cell suspension was then transferred to a Coulter tube containing 10 ml of ISOTON II (Beckman coulter) and cell counted using a Z Series Coulter Counter (Beckman Coulter)297.

2.2.6.2 Migration assay HEK293 and MM200 cells were seeded into 6 well plates in high glucose complete DMEM medium. After 24 hours, the cells were serum starved and transfected as described in section 2.2.4.6. Twenty hours post-transfection, the cell monolayer was scratched using a sterile pipette tip and then the cells were serum stimulated with 10% FBS containing growth medium for 24 hours. The cells were then washed twice with cold DPBS and migration of the cells into the scratch screened using FluoView FV1000 Confocal microscope (Olympus).

2.2.6.3 Cell cycle analysis HEK293 and MM200 cells were seeded into 6 well plates in high glucose complete DMEM medium. After 24 hours, the cells were serum starved and transfected as described in section 2.2.4.6. Twenty hours post-transfection, the cells were serum stimulated with 10% FBS containing medium for 24 hours and then floating and attached cells harvested. The suspended cells were pelleted by centrifugation at 14,000 g for 10 minutes and the supernatant removed. The cell pellet was washed by resuspension in 2ml ice-cold PBS and again pelleted by centrifugation at 14,000 g for 5 minutes. The supernatant was removed and the cells resuspended in 200 µl of DPBS. The cells were then fixed in ice cold 75-80% ethanol by the addition of 200 µl of the cell suspension into 800 µl of ice cold 100% ethanol while the cell suspension was vortexed. Cells were then diluted with 10 ml DPBS and centrifuged for 10 minutes at 14,000 g. The supernatant was discarded and cells resuspended in 10 ml of DPBS and centrifuged again and the supernatant was discarded. Resuspended in 10 ml of DPBS and sample number one,

65 which is the control in this case, was aliquot into two tubes; tube number one (unstained sample) contained cell suspension in 0.5 ml of DPBS containing 0.05% triton X100, and tube number two (stained sample) contained cell suspension in 1 ml DPBS containing 0.05% triton X100, 100µg/ml RNAse and 50µg/ml Propidium Iodide (PI). PI is an intercalating agent that is usually used to stain cells. All other samples were stained as described for tube number two. The samples were then incubated for 40 minutes at 37◦C. After which 3 ml DPBS was added to each sample and centrifuged for 5 minutes at 14,000 g. The majority of the supernatant was then removed, leaving approximately 200 µl. To each sample, 0.5 ml of DPBS and triton X100 were added and FACS analysis performed using Flow counter (FACSCANTO II) (BD BioScience) in the Flow Cytometry Facility (Biological Resources Imaging Laboratory). 2500 events per sample were collected on the Flow Counter with the medium was run on slow rate to allow gating of singlet/doublet populations. Mitomycin C is a compound that used as chemotherapeutic agents and it usually arrest cells in G1 phase, thus, it was used as a control for G2/M phase in this experiment.

2.2.7 Densitometry All the exposed X-ray films generated from western blots were analysed for band intensity (as a semi-quantative measure of the amount of protein) and this presented as histograms in this study. Band intensity was quantitated using the Gel Analysis method using the NIH ImageJ program. Data were analyzed according to the relative intensity of the band for the treated versus non-treated cells. the calibration of the image was changed to “uncalibrated OD” in the image J analysis software and an empty area of the image was selected using the rectangle selection tool and pressing ctrl + M, to generate a “background” reading for the gel. Then, each band of interest was select and pressing ctrl + M, generated a density reading (with the background subtracted) for each selected band on the gel. The band size differences are accounted for using the following formula: (Means * Areas) – (Meanb * Areab), where s: sample band, b: background band Ratio of the bands was calculated and the numbers that were generated were normalised against a known standard loaded on the same gel.

2.2.8 Statistical analysis All the histogram data presented in this study are expressed as mean values ± standard error mean (SEM). All data presented are demonstrative of at least three independent experiments. In order to improve statistical power, data were pooled only when effects were considered appropriate and, in case, it is stated where such pooling has been done in the study. Prism 6 (GraphPad) was used in this study to perform parametric statistical tests and to determine if the differences between groups was statistically significant. One-way analysis of variance (ANOVA), together with the Fisher’s LSD multiple comparison correction method, was used to test differences in the means of more than two groups. Two-tailed Student’s t-test was used to test differences in the means of two groups. If the p-value was equal or greater than 0.05, the hypothesis that the means were significantly different was rejected.

3 Chapter 3: Immediate Early Genes Expression Profiles in Vascular Smooth Muscle Cells upon Growth Factor and Cytokine Stimulation

Part of the following work has been published in:

Dynamics of enhancer and promoter activity during mammalian cellular activation and differentiation. Erik Arner &, Carsten O Daub &, Kristoffer Vitting-Seerup &, Robin Andersson &, Berit Lilje, Finn Drablos, Andreas Lennartsson, Michelle Rönnerblad, Olga Hrydziuszsko, Morana Vitezic, Tom C Freeman, Ahmad M.N. Alhendi…el. Science. February 2015.

Transcriptional dynamics implicate non-coding RNAs in the immediate early response. Stuart Aitken, Shigeyuki Magi, Ahmad M.N. Alhendi, Masayoshi Itoh, Hideya Kawaji, Timo Lassmann, Carsten O. Daub, Erik Arner, Piero Carninci, Alistair R.R. Forrest, Yoshihide Hayashizaki, Levon M. Khachigian, Mariko Okada-Hatakeyama and Colin A. Semple. Genome Biology. March 2014

3.1 Introduction The vascular wall is comprised of vascular smooth muscle cells (VSMCs), which are considered to be stromal cells or connective tissue cells. VSMCs have myosin/actin interactions hence they have a role in regulating arterial contraction, blood pressure and blood flow, depending on certain metabolic demands. The role of VSMCs as stromal cells involves the synthesis and secretion of insoluble extracellular matrix (ECM) molecules which are believed to play role in the high pressure of circulating blood in the arterial system298. VSMCs have a significant role in maintaining vascular tone in reaction to environmental stimuli, such as after cellular injury. The increased amount of local secretion of growth factors and cytokines as a result of injury stimulates activation and dedifferentiation of VSMCs. Therefore, cells go through phenotypic changes from contractile, quiescent, fully differentiated cells into proliferative, migratory, dedifferentiated VSMCs. Consequently, ECM proteins are synthesised in high amounts 299 and this results in altered expression of different immediate early genes (IEGs). The first genes to undergo regulation of expression immediately after cellular stimulation are referred to as the immediate early genes (IEGs). IEGs are stimulated within minutes of stimulation152. Early growth response-1 (EGR1) transcription factor is the product of an immediate early gene located on human chromosome 5q23-q31, encoded by two exons300. EGR1 is not a highly expressed gene in the regular wall of artery. However, upon acute mechanical injury or other stresses such as exposure to angiotensin II, lysophosphatidylcholine, platelet-derive growth factor (PDGF), fibroblast growth factor 1 (FGF1), fibroblast growth factor 2 (FGF2) and fluid shear stress, EGR1 is activated 301. EGR1 is a dominant regulator in a number of cardiovascular pathological processes such as atherosclerosis, cardiac hypertrophy, intimal thickening and ischemia- reperfusion302, 303. Once EGR1 is activated, a number of downstream genes involved in many cardiovascular disorders, including atherosclerosis and restenosis, are stimulated 304. The extensive study of IEGs has led to a number of strategies for studying IEGs in vivo. PCR amplification and subsequent subtractive hybridization of regulated tissue specific mRNA was used to discover the specific genes that are up- or down-regulated. Moreover, studies of transgenic IEG expression, focusing on the identification of gene function or the relation to disease, have been implemented in place of nonspecific

70 polyclonal antibody techniques. Also, the use of IEG-specific oligonucleotide probes to block or enhance specific genetic mechanisms is another strategy employed in studying the role of IEGs in vivo 173. IEGs are genes that get activated rapidly and transiently through different cellular stimuli such as growth factors and cytokines. Basic fibroblast growth factor (FGF2) is a member of the fibroblast growth factor family, which is usually present in the basement membranes and sub-endothelial extracellular matrix of all blood vessels. FGF2 has a significant role in the proliferation and differentiation of a range of cells and tissues305. Interleukin-1 beta (IL-1β) is a cytokine protein, the mature form of which is derived from its precursor via cleavage by cytosolic caspase 1. It is a member of the interleukin-1 family of cytokines. IL-1β plays an important role as a mediator of the inflammatory response and it is associated with number of cellular processes such as proliferation, differentiation and apoptosis 306. The aim of this part of the project is to identify and profile IEGs activated or up- regulated in response to growth factor (FGF2) and/or cytokine (IL-1β) stimulation and to understand the downstream genes and pathways involved in the IEGs response to injury, as illustrated in figure 3.1.

Figure 3‎ .1. The response of gene expression to FGF2 and IL-1β stimulation Gene expression is altered by growth factor and cytokine stimulation. IEGs get stimulated by growth factors or cytokines, and others get stimulated by both. This figure demonstrate the strategy of the project were we are trying to explain dynamics of gene expression.

3.2 Results

3.2.1 EGR1 expression is stress induced and activated in human vascular smooth muscle cells Human aortic smooth muscle cells (hASMCs) were used in this study as an in vitro model for the study of cardiovascular function and disease. These primary cells are actually a pool of primary hASMCs isolated from three individuals. GAPDH was chosen as a housekeeper gene in hASMCs because it showed sustained RNA level, at the different time points, upon stimulation with FGF2 or IL-1B. Moreover, a literature search for a suitable housekeeping gene in hASMCs revealed GAPDH to be the most commonly used housekeeper gene in hASMC line307. EGR1 expression is stress-induced and activated in hASMCs at the RNA and protein levels308. Confirmation of EGR1 mRNA induction in contest of my study was demonstrated by performing quantitative real-time PCR (qRT-PCR) (Fig. 3.2) and Western Blot analysis (Fig. 3.3) on hASMCs RNA and protein, respectively. A significant induction of EGR1 gene expression was detected in -serum starved hASMCs, subsequently treated for 1 h with FGF2 (50 ng/mL) or IL-1β (10 ng/mL)). Dose response curves for FGF2 and IL-1β were established by a previous member of the lab309 to identify the appropriate dose to be used for the stimulation of hASMCs. Additionally, the amount of EGR1 protein increased significantly after FGF2 (50 ng/mL) or IL-1β (10 ng/mL) treatment of the serum starved hASMCs at 1 and 2 h post treatment. Validation of the induction of EGR1 at the RNA and protein level after treatment with FGF2 or IL-1β in serum starved hASMCs confirmed the suitability of the hASMCs as an in vitro model for this project, investigating IEGs expression profiles in hASMCs upon growth factor and cytokine stimulation.

A B

Figure 3‎ .2. Gene expression of EGR1 post-FGF2 or IL-1B stimulation in hASMCs The cells were serum starved by incubation in serum-free medium O/N. Cells were then exposed to (A) FGF2 (50 ng/ml) or (B) IL-1β (10 ng/ml) for various times up to 6 h (0.25, 0.5, 0.75, 1, 2, 3, 4, 5 and 6 h), as indicated. Samples at 0 min represent serum starved, unstimulated samples. EGR1 expression induction was determined by quantitative real-time PCR (qRT-PCR) and normalized to GAPDH expression and compared with the EGR1 expression at 0 min to determine fold change. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant where *,**, ***and **** indicates p < 0.05, p < 0.01, p<0.001 and p < 0.0001 respectively.

A B

-75KDa EGR1 EGR1 -75 KDa

-50KDa -50 KDa β-ACTIN β-ACTIN

0 30 60 120 240 360 0 30 60 120 240 360 (mins) (mins)

FGF2 (50 ng/mL) IL-1β (10 ng/mL)

C 2.0 **** s n

t 1.5 i i t n c a U ****

- y B r / 1.0 a 1 - r t i R

b ** * G r * E

A 0.5

0.0 s 2 2 2 2 2 B B B B B C F F F F F -1 -1 -1 -1 -1 M G G G G G L L L L L S F F F F F I I I I I V .5 1 2 4 6 .5 1 2 4 6 h 0 0 0 Time(h) ‎ Figure 3.3. EGR1 protein levels in hASMCs after stimulation with FGF2 or IL-1B The hASMC cells were serum starved by incubation in serum-free medium O/N. After 24 h of serum starvation, cells were then exposed to (A) FGF-2 (50 ng/mL) or (B) IL-1β (10 ng/mL) for various times up to 6 h (30, 60, 120, 240 and 360 min), as indicated. Samples at 0 min represent serum starved, unstimulated samples. Protein was extracted and 10 μg of protein separated by PAGE (8%) for 2 h, and transferred to PVDF membrane by semi-dry transfer for 1 h, followed by Western Blot analysis using 1’Ab (EGR1) and 2’Ab (goat anti-rabbit). EGR1 and B-ACTIN protein expression was detected using X-ray film. (A) Rabbit Polyclonal EGR1 (stimulated with FGF2) antibody and (B) Rabbit Polyclonal EGR1 (stimulated with IL-1β). EGR1 Protein expression levels were compared to β-ACTIN protein expression. Quantifications of the western gels are shown in (C) EGR1 protein levels in hASMCs stimulated with FGF2 or IL-1β. All protein expression was normalized to β-actin. The western blots shown in A and B are representative of three independent experiments. The quantification in panel C is the pooled data from three independent experiments performed in triplicate ± SEM. It was analysed for statistical significance using3.2.2 unpaired Validation t-test of and the a inducible value of p<0.05 expression considered of EGR1 statistically significant where * ** and **** indicatesEGR1 p expression< 0.05, p < 0.01 is induced and p < upon0.0001 the respectively addition .of the growth factor FGF2 and

EGR1 is a dominant regulator and its induction activates a number of downstream genes such as NGFI-A-binding protein 2 (NAB2), Intercellular Adhesion Molecule 1 (ICAM1), Vascular Cell adhesion protein 1 (VCAM1), C-JUN and JUND 304. Cap Analysis Gene Expression (CAGE) method was performed by the Omics Science Centre, RIKEN, Yokohama Institute (Japan) as part of a global consortium (FANTOM5). Total RNA, in triplicate, from serum starved hASMCs stimulated with IL-1β or FGF2 for up to 6 h, was provided by the Transcription and Gene Targeting group from the Centre for Vascular Research (CVR), UNSW. RNA was harvested and purified (Section 2.2.31.1) and cDNA synthesised (Section 2.2.3.1.2). Quantitative-PCR was performed as described (Section 2.2.3.1.4) in order to validate the transient induction of EGR1 mRNA (Fig. 3.4) by FGF2 and IL-1β treatment. The RNA samples were then shipped to the Omics Science Centre, RIKEN Yokohama Institute for CAGE analysis. Validation of the EGR1 induction at the protein (Fig 3.3) and RNA (Fig 3.4) levels by FGF2 and IL-1β after serum starvation of hASMCs confirmed induction of EGR1. Accessing the results of the samples after applying the CAGE technique was completed via ZENBU software (section 2.2.3.1.6). There is a discrepancy between the data in fig 3.2 and fig 3.4. The only difference between the two experiments is the use of different cell batch numbers, and more DNA was used in the qPCR shown in fig 3.2 than the qPCR shown in fig 3.4. It is also acknowledged that the qPCR carried out in fig 3.4 was performed by Margaret Patrikakis (RA) in the laboratory. As explained by ATCC, different batches of cells have different characteristics as cells adapt to the cultured media which results in changes in their reaction to stimulants 310. It is reasonable that these changes explain the difference in the fold changes between the two figures.

Figure 3‎ .4. qRT-PCR for EGR1 post- FGF2 or IL-1β stimulation. hASMC cells were serum starved by incubation in serum-free medium O/N. Cells were then exposed to IL-1β (10 ng/mL) or FGF2 (50 ng/mL) for up to 6 h (30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 330, and 360 min) (Time (min) on the X-axis). EGR1 expression level was normalised to GAPDH expression within each sample. Samples at 0 min represent serum starved, unstimulated samples tested for the EGR1 mRNA induction by quantitative real-time PCR (qRT-PCR). The EGR1 qRT-PCR level for serum starved cells was set to 1 and EGR1 qRT-PCR levels for FGF2 or IL-1 β treated cells were compared to that of the serum starved hASMC cells to obtain the fold change (Y-axis). Samples were prepared by Margaret Patrikakis (RA).

3.2.3 Determine the expression of genes using CAGE tool Cells were cultured and serum starved at 80-90% level of confluence by incubation in serum-free medium O/N. Wells of serum starved cells were then exposed to IL-1β (10 ng/mL) or FGF2 (50 ng/mL) for various times up to 6 h (15, 30, 45, 60, 120, 180, 240, 300 and 360 min). Samples at 0 min represent serum starved, unstimulated samples. RNA was harvested using Trizol reagent and purified using miRNeasy® kit (Qiagen; VIC, Australia), according to the manufacturer’s protocol. RNA was quantified using the Nanodrop 1000 (Thermo Scientific, USA) spectrophotometer, prior to CAGE analysis. The expression levels of the genes were investigated from 0-6 h post- treatment. Gene expression was analysed by comparing it relative to an unstimulated sample for each gene at the 0 min time point. A 2-fold change in expression level was adopted as a suitable cut off in line with what has been reported as a responsive gene in these primary cells295. A total of 347 genes were analysed for expression in hASMCs after serum starvation followed by induction using FGF2 or IL-1β, these are a pool of genes from all the different time points combined with a minimum threshold of a two-fold change (Tables 3.1 – 3.2).

Table 3‎ .1. Genes whose expression was stimulated in hASMCs upon treatment with FGF2 and/or IL-1β in one or more of these times up to 6 h (15, 30, 45, 60, 120, 180, 240, 300 and 360 min) as identified by the CAGE tool FGF2 FGF2 FGF2 IL-1ß IL-1ß FGF2 & IL-1B FGF2 & IL-1B FGF2 & IL-1B FGF2 & IL-1B FGF2 & IL-1B FGF2 & IL-1B FGF2 & IL-1B STIMULATED STIMULATED STIMULATED STIMULATED STIMULATED STIMULATED STIMULATED STIMULATED STIMULATED STIMULATED STIMULATED STIMULATED Genes ONLY Genes ONLY Genes ONLY Genes ONLY Genes ONLY Genes Genes Genes Genes Genes Genes Genes ACTB GDF15 DUSP2 AMPD3 PRDM1 ADAM17 FLRT3 MAFF RELB CXCL1 IL6 PTGER4

ADM GPR84 DUSP4 BCL2A1 REL ADAMTS1 FOSB MAP3K8 RHOB CXCL2 IL8 PTGS1

AMPD3 HMGA1 EDN1 BFL1(BCL2A1) RORB ATF3 FOSL1 MAPK1 RND3 CXCL3 IRF1 PTGS2

ANG2 ID1 EIF5A CCL3 SELE ATF4 FOSL2 MCL1 RYBP CXCR7 IRF4 RASGEF1B

ARID5B ID2 ERF2(ZFP36L2) CD83 TLR2 B3GNT5 FRMD6 MCP1(CCL2) SDC4 DUSP1 ISG15 RCAN1

ARL4D ID3 ERRFI1 CH25H TNFAIP2 BHLHB2(BHLHE40) GADD45A MDM2 SERTAD1 DUSP14 JUNB ZC3H12A

AT1(AGTR1) IRS2 ETS1 CLCF1 TREX1 BIRC3 GADD45B MMP10 SGK1 DUSP5 JUND ZC3H12C

BCL10 ITGA5 ETS2 CSF1 ZFP36 BMP2 GADD45G MYH11 SIAH2 EGR-1 KLF10 ZFAND5

BCL3 KLF7 FOXC2 CSF2 CCL20 GATA2 NAB1 SIK1 EGR2 KLF2 ZNF93

BTG2 LMCD1 GAPDH CXCL10 CCL5 GATA6 NDRG4 SLC16A1 EGR3 KLF4

C1ORF51 MAFK SERTAD2 EPHA2 CCL7 GBP1 NEDD9 SLC2A3 EHD1 KLF6

CASP4 MYOCD SLC20A1 GPB1B CCNL1 GEM NFKB1 SOCS3 F3 KLHL21

CBX4 NAB2 SLC2A1 ICOSLG CDC42EP2 GPR19 NFKBIB SPRED2 FBXO33 LIF

CCRN4L NDRG1 TAGLN IER5 CEBPD GPR85 NFKBIZ SPRY2 PHLDA1 TNFSF9

CD14 NDRG3 TK2 IFIH1 CFLAR HBEGF NR4A1 SPTY2D1 PIM1 TRAF1

CDK4 NFKBID TRIM13 IFIT1 c-FOS ICAM1 OLR1 SQSTM1 PLAU TRIB1

CEBPB NR4A2 UBC NFATC1 C-JUN IER2 OSGIN2 TBX3 PLK2 TSC22D1

CHKB PDGFA VCL NFKB2 CLIC4 IER3 PDE4B TGIF1 PMAIP1 VCAM1

CITED2 PPIA VEGFA NFKBIA CNN1 IFRD1 PELI1 TIPARP PNRC1 VEGFC

CREM PVR YY1 NR4A3 CSF3 IKBKE PER1 TNFAIP1 PPP1R15A YRDC

CTGF RGS4 CYR61 NUAK2 CSRNP1 IL1A PGS2/DCN TNFAIP3 PTEN ZBTB10

Table 3‎ .2. Genes whose expression was not stimulated in hASMCs upon treatment with FGF2 and/or IL-1β in all of these times up to 6 h (15, 30, 45, 60, 120, 180, 240, 300 and 360 min) as identified by the CAGE tool IL-1B ONLY NON- FGF2 & IL-1B NON- FGF2 ONLY NON- FGF2 ONLY NON- IL-1B ONLY NON- IL-1B ONLY NON- RESPONSIVE Genes RESPONSIVE Genes RESPONSIVE Genes RESPONSIVE Genes RESPONSIVE Genes RESPONSIVE Genes

BFL1(BCL2A1) SELE ACTB GPR84 BHLHE40 EDN1 CCL3 TLR2 ADM HMGA1 CCRL2 EGR4 CD83 TNFAIP2 ANG2 ID1 C-MYC EIF5A CH25H TREX1 ARID5B ID2 DNAJB1 ERF2(ZFP36L2) CLCF1 ZFP36 ARL4D ID3 DUSP6 ERRFI1 CSF1 ZFP36L1 AT1(AGTR1) IRS2 ELK1 ETS1 CSF2 REL BCL10 ITGA5 ELL2 ETS2 CXCL10 RORB BCL3 KLF7 HES1 FOXC2 EGR4 BTG2 LMCD1 HES1 GAPDH EPHA2 C1ORF51 MAFK KDM6B GDF15 GPB1B CASP4 MYOCD LDLR SLC20A1 ICOSLG CBX4 NAB2 MCL1 SLC2A1 IER5 CCRN4L NDRG1 NFKBIE TAGLN IFIH1 CD14 NDRG3 OASL TK2 IFIT1 CDK4 NFKBID RORA TRIM13 NFATC1 CEBPB NR4A2 RORC UBC NFKB2 CHKB PDGFA SKIL VCL NFKBIA CITED2 PLAU SMTN VEGFA NR4A3 CREM PPIA SRF YY1 NR4A3 CTGF PVR SRFBP1 ZFP36L1 NUAK2 CYR61 RGS4 TOB1 DUSP4 PRDM1 DUSP2 SERPINE1 ACTA2 SERTAD2

3.2.4 Validation of CAGE data analysis As the CAGE experiments were performed once by the collaborators, there is no false discovery rate (FDR) of the gene expression (Figures 3.5 B, D and F). For this reason, a number of genes which are considered to be mediators of cardiovascular disease, such as EGR1, ICAM1 and C-JUN were selected for validation of the CAGE analysis data. Total RNA, in triplicate, from serum starved hASMCs stimulated with IL-1β or FGF2 for up to 6 h, was harvested and purified (Section 2.2.31.1). cDNA was synthesised (Section 2.2.3.1.2) and qRT-PCR (Section 2.2.3.1.4) performed using relevant primers (Table 2.3) to validate the transient induction of EGR1, ICAM1 and C-JUN mRNA identified in the CAGE analysis. Expression levels of the genes of interest were normalised to GAPDH expression. EGR1, ICAM1 and C-JUN expression profiles produced from qRT-PCR were compared with the expression profiles generated using the CAGE tool (Fig. 3.5).

A B

C D

E F

Figure 3‎ .5. Induction of EGR1, ICAM1 and C-JUN expression in response to FGF2 or IL-1β stimulation hASMCs cells were serum starved by incubation in serum-free medium O/N. Cells were then exposed to FGF2 (50 ng/mL) or IL-1β (10 ng/mL) for up to 6 h (0.25, 0.5, 0.75, 1, 2, 3, 4, 5 and 6 h). Samples at 0 h represent serum starved, unstimulated cells. (A, C and E) Samples tested for the EGR1, ICAM1 and C-JUN mRNA induction by quantitative real-time PCR (qRT-PCR). Gene’s expression was normalised to GAPDH mRNA. (B, D and F) Cap Analysis Gene Expression (CAGE) results for EGR1, ICAM1 and C-JUN expression was compared with that at the 0 h time point. EGR1 samples were stimulated with FGF2 and ICAM1 and C-JUN samples were stimulated with IL-1β. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant where *, ** and **** indicates p < 0.05, p < 0.01 and p < 0.001 respectively.

3.2.5 Categorisation of IEGs Based on the gene expression response to stimulation, three categories of IEGs were established as outlined in figure. 3.6. Early responder genes; demonstrate high inducible expression at approximately1 h with a return to basal levels by approximately 2-3 h (Fig. 3.7). Rapid transient responder genes generally peak in expression at approximately 1-3 h, with transient or sustained expression until 6 h post-stimulation (Fig. 3.8). Lastly, the late responder genes that display a lag period, peak at approximately 3 h and rapidly return to basal levels by 6 h post-stimulation (Fig. 3.9).

Figure 3‎ .6. Categorisation of IEGs into three distinct groups IEGs were categorised into three distinct groups depending on expression profiles. These groups include the early responders, rapid transient responders and the late responder genes that have been initiated from the analysis of the hASMCs genes by the CAGE tool.

A B

Figure 3‎ .7. CAGE analysis of early responder genes Early responder genes show high inducible expression at approximately 1 h with a return to basal levels by approximately 2-3 h post-stimulation. (A) Cap Analysis Gene Expression (CAGE) results for four genes stimulated with FGF2, normalised to GAPDH, relative to the 0 h time point sample. (B) Cap Analysis Gene Expression (CAGE) results for four genes stimulated with IL-1β normalised to GAPDH, relative to the 0 h time point sample.

A B

Figure 3‎ .8. CAGE analysis for rapid transient responder genes Transient responder genes typically peak in expression at approximately 1-3 h post-stimulation with transient or sustained expression until 6 h. (A) Cap Analysis Gene Expression (CAGE) results for four genes stimulated with FGF2 normalised to GAPDH, relative to the 0 h time point sample. (B) Cap Analysis Gene Expression (CAGE) results for four genes stimulated with IL-1β normalised to GAPDH, relative to the 0 h time point sample.

A B

Figure 3‎ .9. CAGE analysis for late responder genes Late responder genes display a lag period, with a peak in expression at approximately 3 h and rapidly return to basal levels by 6 h post-stimulation. (A) Cap Analysis Gene Expression (CAGE) results for four genes stimulated with FGF2 normalised to GAPDH, relative to the 0 h time point sample. (B) Cap Analysis Gene Expression (CAGE) results for four genes stimulated with IL-1β normalised to GAPDH, relative to the 0 h time point sample.

3.2.5.1 Categorisation of genes in response to cellular stimulation

The 347 genes that were examined previously for their response to FGF2 and/or IL-1β (Table 3.1 and 3.2) have been categorised into the three groups according to expression upon stimulation during a time course of 6 h (Tables 3.3-3.5).

Table 3‎ .3. Early responder gene expression with FGF2 and/or IL-1β stimulation in hASMCs FGF2 FGF2 FGF2 FGF2 FGF2 IL-1B FGF2 & IL-1B ONLY ONLY ONLY ONLY ONLY ONLY KLF4 TAGLN PER1 MDM2 OSGIN2 ZFP36 GADD45B JUNB MYH11 GDF15 FBXO33 RASGEF1B GPR19 c-FOS MCP1(CCL2) C-JUN DUSP14 CCNL1 B3GNT5 NUAK2 EGR1 NFKB1 MYOCD ID3 CLIC4 CD14 KLF2 FOSB DUSP1 MAPK1 FRMD6 TBX3 CXCR7 EPHA2 EGR2 PTGS2 ADAM17 CASP4 GADD45A PDE4B IER5 TRIB1 IL6 NDRG3 TRIM13 PVR ZC3H12C KLF6

MMP10 ETS1 IKBKE ZNF93 OLR1 IER2

ATF3 VCL SLC16A1 ARID5B BMP2 BHLHB2(BHLHE40)

ICAM1 NEDD9 ZBTB10 PGS2/DCN VEGFC KLF10

TNFAIP3 TNFAIP1 SERTAD2 PHLDA1 CEBPD PLK2

IER3 MCL1 RGS4 HBEGF PMAIP1 RHOB

IL8 GAPDH PNRC1 ERRFI1 ID1 ADAMTS1

NR4A1 ACTB ZFAND5 FOSL2 CYR61 SGK1

BTG2 PPIA ATF4 IFRD1 RYBP

ANG2 DUSP5 AMPD3 CREM NFKBIB

NFKBIZ RCAN1 UBC FOSL1 SPTY2D1

CXCL1 BCL10 EIF5A SPRED2 ITGA5

IL1A PPP1R15A CDC42EP2 MAFF EHD1

F3 TNFSF9 RELB PDGFA CSRNP1

DUSP2 PTGER4 IRF1 CFLAR LIF

SOCS3 ETS2 GADD45G SERPINE1 CSF3

PLAU BCL3 CXCL3 KLF7 GPR84

RND3 CCRN4L TRAF1 SERTAD1 CCL20

ZC3H12A ISG15 SDC4 CEBPB

CCL7 PELI1 MAP3K8 ADM

CCL5 GBP1 FLRT3 VEGFA

SPRY2 NDRG4 IRF4 ID2

Table 3‎ .4. Rapid transient responder gene expression with FGF2 and/or IL-1β stimulation in hASMCs FGF2 ONLY FGF2 ONLY IL-1B ONLY IL-1B ONLY IL-1B ONLY FGF2 & IL-1b AT1(AGTR1) SLC2A1 KLF4 F3 CSRNP1 PTEN NAB2 KLF2 BFL1(BCL2A1) SOCS3 IFIT1 EGR3 CHKB SLC20A1 JUNB RND3 SELE PTGS1 TSC22D1 SQSTM1 MCP1(CCL2) ZC3H12A LIF VCAM1

CITED2 EDN1 NFKB1 IRF1 CSF3 GEM NFKBID TGIF1 NR4A3 CSF2 CCL20 GATA2 KLHL21 LMCD1 DUSP1 GADD45G NEDD9 CXCL2 ARL4D SIAH2 PTGS2 TNFAIP2 IRF4 YRDC IRS2 FOXC2 IL6 CXCL3 RASGEF1B SIK1 TIPARP MAFK MMP10 CCL3 IFIH1 PIM1 GATA6 HMGA1 ATF3 CXCL10 MYH11 GPR85 ERF2(ZFP36L2) C1ORF51 ICAM1 TRAF1 B3GNT5 BIRC3 SLC2A3 CBX4 TNFAIP3 SDC4 CXCR7

NAB1 IER3 MAP3K8 ICOSLG

CTGF IL8 FLRT3 PDE4B

CNN1 GPB1B CCL7 ZC3H12C

CDK4 NR4A1 CCL5 OLR1

TK2 NFKBIZ SPRY2 HBEGF

NDRG1 NFKBIA EHD1 FOSL1

YY1 IL1A GADD45A PMAIP1

JUND PTGER4 ZNF93

DUSP4 PPP1R15A

Table 3‎ .5. Late responder gene expression with FGF2 and/or IL-1β stimulation in hASMCs FGF2 ONLY IL-1B ONLY IL-1B ONLY IL-1B ONLY NR4A2 NFATC1 GATA6 RCAN1 GPR19 GPB1B SPRED2 REL CXCL1 MAFF TNFSF9

PLAU SLC2A3 ISG15

CD83 NAB1 SQSTM1

TSC22D1 VEGFC CFLAR

GBP1 CEBPD TLR2

KLHL21 NDRG4 CSF1

OSGIN2 CNN1 SERTAD1

CH25H C-JUN PELI1

BMP2 MAPK1 PER1

RORB NFKB2 PRDM1

PGS2/DCN ADAM17 DUSP14

TIPARP JUND TGIF1

PHLDA1 TNFAIP1 TREX1

FOSL2 MCL1 FRMD6

IFRD1 DUSP5 IKBKE

SPTY2D1 AMPD3 SLC16A1

MDM2 CDC42EP2 SIAH2

FBXO33 RELB ZBTB10

CCNL1 RYBP PNRC1

CLIC4 NFKBIB ZFAND5

TBX3 CLCF1 ATF4

3.2.6 Validation of the relationship between the three IEG categories The relationship between the three IEG categories was examined in order to gain an insight into downstream genes and pathways underlying the IEGs response to injury. A small interfering RNA (siRNA) to knockdown EGR1 expression was utilised to elucidate the roles and regulatory specificity of targeted genes and pathways. It has been previously established that EGR1, an early responder gene, has an established role in stimulating several pathways that affect the genes of interest, ICAM1, VCAM1 and NAB2 304. These genes are all considered rapid transient responder genes. Moreover, C-JUN and JUND which are regulated by EGR1 304, are categorised as late responder genes. Therefore, validating these three categories by knocking down EGR1 expression and observing the effects on the downstream genes (VCAM1, ICAM1, NAB2, C-JUN and JUND) was considered essential.

3.2.6.1 Using RNA interference approach to inhibit EGR1 expression Upon establishing the three IEG categories, the accuracy of these results was examined by selecting a gene from the early responder genes category (EGR1) and determining the effect of EGR1 gene knockdown on a selection of genes in the rapid transient and late responder’s genes categories. EGR1 loss of function study was planned by post-transcriptional EGR1 silencing via RNA interference (RNAi).

3.2.6.1.1 Liposome delivery of short interfering RNA in hASMCs Fluorescein isothiocanate (FITC)-labelled siRNA was used in transfection experiments as a control to determine the efficiency of siRNA delivery. DharmaFECT2 was used as lipofection reagent to deliver the FITC-tagged siRNA into the hASMCs. Cells that endocytose FITC-tagged siRNA are evident via the fluorescent signal that can be observed under fluorescent microscopy. A more intense fluorescent signal corresponds to the successful delivery of more FITC-tagged siRNA. Experimental controls included a vehicle only and a non FITC-labelled siRNA (scrambled) control. Cells that were transfected with the vehicle only, or non FITC-labelled siRNA, demonstrated no fluorescent signal, as expected.

3.2.6.1.2 siRNA specificity in targeting EGR1 expression Commercially available siRNA targeting EGR1 consists of a pool of four siRNA sequences that target various locations in the EGR1 gene. The specificity of EGR1-

89 targeting siRNA used in this study was confirmed using the standard nucleotide Basic Local Alignment Search Tool (BLASTn) to identify complementarity between the human genomic and transcript database and the EGR1 siRNA sequences. The commercially available control siRNA used in this study also consists of a pool of four sequences. The sequences of these siRNAs were matched to the human genomic + transcript database to identify minimal targeting of human genes (Table 2.3).

3.2.6.1.3 Confirmation of siRNA specific inhibition of human endogenous EGR1 expression The effect of siRNA targeting human EGR1 was examined in vitro using primary hASMC cells. Varying concentrations of siRNA (50 nM, 100 nM and 200 nM) were introduced by DharmaFECT2 transfection into hASMCs to establish the siRNA concentration with the greatest transfection efficiency. This was performed to optimise siRNA treatment required to inhibit EGR1 expression after serum induction. Inhibiting EGR1 protein expression by transfecting the cells with siEGR1 was determined to assess the effectiveness of the siRNA. EGR1 expression was inhibited in hASMCs with 100 nM of EGR1 targeting siRNA. In contrast, no effect on EGR1 protein expression was observed after transfecting hASMCs with siRNA control. This was demonstrated in western-blot experiment. A reduced effect was observed on EGR1 protein expression with 50 nM and 200 nM EGR1 targeting siRNA. Therefore, 100 nM was considered as the optimal concentration of siRNA targeting EGR1 (siEGR1) for EGR1 protein expression inhibition.

3.2.6.2 Inhibition of EGR1 expression with siRNA in hASMCs Activation of EGR1 in hASMC cells, via the Ras-Raf-MEK-ERK1/2 pathway, is a survival mechanism in response to stress (serum starvation, scratch injury)308. Since EGR1 has the highest expression at 1 h post-stimulation with FGF2 and IL-1β (Fig. 3.2), the addition of FGF2 or IL-1β to hASMCs post-transfection with siRNA targeting EGR1(siEGR1) was carried out for an hour. Consequently, the effect of siRNA knockdown can be observed when EGR1 expression is highest (Fig 3.2). Cytokine stimulated EGR1 gene expression was knocked down by EGR1-targetted siRNA as shown for FGF2 (Fig. 3.10) and IL-1β (Fig. 3.11) stimulation. To validate EGR1 gene knockdown, the EGR1 protein levels were checked by western blot analysis (Fig. 3.12). The induction and activation of EGR1 through FGF2 and IL-1β stimulation in

90 hASMC cells was established, and with the transfection of siRNA specific for EGR1 confirmed that EGR1 could be blocked in hASMCs. Figures 3.2 and 3.3 show the expression of EGR1 at the RNA and protein level, respectively, following stimulation with FGF2 or IL-1β. Comparisons of the RNA levels that is shown in figure 3.2 with the RNA levels shown in figures 3.10 and 3.11, shows knockdown of EGR1 upon siEGR1 treatment following FGF2 or IL-1β stimulation. Moreover, comparison of the protein levels shown in figures 3.12 clearly shows the knockdown of EGR1 at the protein level after FGF2 or IL-1β stimulation

**** 2 5 ****

2 0 e g

n 1 5 a h C

d 1 0 l o F 5

e n e 1 L o n R T l lo G C A i A iE S ls s S l ll e e C C

1 h , F G F 2

Figure 3‎ .10. EGR1 expression post-transfection with siEGR1 and FGF2 stimulation hASMC cells were serum starved after transfection with siEGR1, siRNA Control (siCTL) or not transfected. After 24 h of serum starvation, FGF-2 (50 ng/mL) was added to the plates transfected with siEGR1, siCTL or not transfected, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 1 h. Another non-transfected plate was also incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 1 h, but in the absence of FGF-2. Total RNA was harvested from each plate and samples tested for the induction of EGR1 expression by qRT-PCR. For this, EGR1 expression was normalised to GAPDH expression, and then compared to the control (siCTL). First two columns are non-siRNA transfected hASMC cells with and without FGF2 stimulation. The other two columns are hASMC cells transfected with siEGR1 or siCTL, stimulated with FGF2. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where **** indicates p < 0.0001.

4 0 ****

3 0 e g n a

h 2 0 *** C

d l o

F 1 0

e e 1 L n n R T o o l l G iC A A iE S s s S ll ll e e C C

1 h , IL -1

Figure 3‎ .11 EGR1 expression post-transfection with siEGR1 and IL-1β stimulation hASMC cells were serum starved after transfection with siEGR1, siCTL or not transfected. After 24 h of serum starvation, IL-1β (10 ng/mL) was added to the plates transfected with siEGR1, siCTL or not transfected, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 1 h. Another non-transfected plate was also incubated at 37°C in a humidified atmosphere of 5%

(v/v) CO2 for 1 h, but in the absence of IL-1β. Total RNA was harvested from each plate and samples tested for the induction of EGR1 expression by qRT-PCR. For this, EGR1 expression was normalised to GAPDH expression, and then compared to the control (siCTL). First two columns are Non-siRNA transfected hASMC cells with and without IL-1β stimulation. The other two columns are hASMC cells transfected with siEGR1 or siCTL , stimulated with IL-1β. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where **** indicates p < 0.0001.

A siCTL+ siEGR1 siCTL+ siEGR1+ FGF2 +IL-1β IL-1β FGF2

75 KDa EGR1

50 KDa

Β-Actin

1 .5 B * * s t n i i t

n 1 .0 c U a

- y r / a 1 r t R i

b 0 .5 G r E A

0 .0

2 2 B B F F 1 1 G G - - F F IL IL + + + + 1 L 1 L R T R T G iC G iC iE s iE s s s

1 h , F G F 2 1 h , IL - 1

Figure 3‎ .12 EGR1 protein expression post-transfection with siEGR1 and FGF2 or IL-1β stimulation hASMC cells were serum starved after transfection with siEGR1, siRNA Control (siCTL). After 24 h of serum starvation, FGF-2 (50 ng/mL) or IL-1β (10 ng/mL) was added to the plates transfected with siEGR1 or siCTL, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 1 h. Protein was extracted and 10 μg of protein separated by PAGE (8%) for 2 h, and transferred to PVDF membrane by semi-dry transfer for 1 h, followed by Western Blot analysis using 1’Ab (Rabbit polyclonal EGR1) and 2’Ab (goat anti-rabbit). (A) EGR1 and β-actin (loading control) protein expression in hASMC cells. Quantification of the western gel are shown in (B) EGR1 protein levels in hASMC cells stimulated with FGF2 and Rabbit Polyclonal EGR1 (stimulated with IL-1β) antibody. All protein expression was normalized to β-actin. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where * indicates p < 0.05.

3.2.6.3 Inhibition of EGR1 induction results in the inhibition of downstream genes

3.2.6.3.1 Inhibition of rapid transient responder gene expression by EGR1 knockdown Transfection experiments were repeated using identical conditions to those involving EGR1 described in section 2.2.6.2 above, however the stimulation step was extended from 1 h to 2 h. This time was chosen as the rapid responder genes, such as NAB2, VCAM1 and ICAM1, are expressed at the highest level 2 h post-stimulation (Fig. 3.13). EGR1 knockdown would be expected to result in a reduction in NAB2, VCAM1 and ICAM1 gene expression, at both the RNA and protein levels. As shown, NAB2, VCAM1 and ICAM1 expression was knocked down at RNA level after being stimulated with FGF2 (Fig. 3.14 and 3.15) and IL-1β (Fig. 3.16 and 3.17). To validate the impact of EGR1 knockdown on the rapid responder gene expression, protein level analysis by western blot, was performed (Fig. 3.18-3.20). These experiments identified the second category of IEGs, the rapid transient responder genes.

3.2.6.3.2 Inhibition of late responder gene expression by EGR1 knockdown Transfection experiments were repeated as described in section 1.2.6.3.1 above, however the stimulation step was further extended to 4 h. This time was chosen as the late responders genes, such as C-JUN and JUND, are expressed at the highest levels at 4 h post-stimulation (Fig. 3.21). EGR1 knockdown would be expected to result in a reduction in C-JUN and JUND expression at both the RNA and protein levels. EGR1 knockdown resulted in the inhibition of C-JUN and JUND expression at RNA level after stimulation with IL-1β (Fig. 3.22 and 3.23). In order to validate the inhibition of late responder gene RNA expression, protein level analysis by western blot was performed (Fig. 3.24). These experiments supported the establishment of a third category of IEGs termed the late responder genes.

A B

Figure 3‎ .13 Growth factor and cytokine induction of Rapid transient responder gene expression Rapid transient responder genes display a peak in expression at ~1-3 h with transient or sustained expression until 6 h post-stimulation. (A) Cap Analysis Gene Expression (CAGE) results for NAB2 and VCAM1 genes stimulated with FGF2 (50 ng/mL) and normalised to the 0 h time point. (B) Cap Analysis Gene Expression (CAGE) results for VCAM1 and ICAM1 genes stimulated with IL-1β (10 ng/mL) and normalised to the 0 h time point. EGR1 knockdown would be expected to result in a reduction in NAB2, VCAM1 and ICAM1 gene expression, at both the RNA and protein levels.

4 *** * 3 e g n a

h 2 C

d l o

F 1

e e 1 L n n R T o o l l G iC A A iE S s s S ll ll e e C C

2 h , F G F 2

Figure 3‎ .14. NAB2 expression post-transfection with siEGR1 and FGF2-stimulated hASMC cells were serum starved after transfection with siEGR1, siCTL or not transfected. After 24 h of serum starvation, FGF-2 (50 ng/mL) was added to the plates transfected with siEGR1, siCTL or not transfected, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 2 h. Another non-transfected plate was also incubated at 37°C in a humidified atmosphere of 5%

(v/v) CO2 for 2 h, but in the absence of FGF2. Total RNA was harvested from each plate and samples tested for the induction of NAB2 expression by qRT-PCR. For this, NAB2 expression was normalised to GAPDH expression, and then compared to the control (siCTL). First two columns are Non-siRNA transfected hASMC cells with and without FGF2 stimulation. The other two columns are hASMC cells transfected with siEGR1 or siCTL , stimulated with FGF2. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where * and *** indicates p < 0.05 and p < 0.001 respectively.

3 ** ** e

g 2 n a h C

d l

o 1 F

e e 1 L n n R T o o l l G iC A A iE S s s S ll ll e e C C

2 h , F G F 2

Figure 3‎ .15. VCAM1 expression post-transfection with siEGR1 and FGF2-stimulated hASMC cells were serum starved after transfection with siEGR1, siCTL or not transfected. After 24 h of serum starvation, FGF-2 (50 ng/mL) was added to the plates transfected with siEGR1, siCTL or not transfected, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 2 h. Another non-transfected plate was also incubated at 37°C in a humidified atmosphere of 5%

(v/v) CO2 for 2 h, but in the absence of FGF2. Total RNA was harvested from each plate and samples tested for the induction of VCAM1 expression by qRT-PCR. For this, VCAM1 expression was normalised to GAPDH expression, and then compared to the control (siCTL). First two columns are Non-siRNA transfected hASMC cells with and without FGF2 stimulation. The other two columns are hASMC cells transfected with siEGR1 or siCTL , stimulated with FGF2. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where ** indicates p < 0.01.

1 5

* e

g 1 0 ** n a h C

d l

o 5 F

e e 1 n n L o o R T l l G A A iC iE s s S ll ll S e e C C

2 h , IL - 1

Figure 3‎ .16. VCAM1 expression post-transfection with siEGR1 and IL-1β-stimulated hASMC cells were serum starved after transfection with siEGR1, siCTL or not transfected. After 24 h of serum starvation, IL-1β (10 ng/mL) was added to the plates transfected with siEGR1, siCTL or not transfected, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 2 h. Another non-transfected plate was also incubated at 37°C in a humidified atmosphere of 5%

(v/v) CO2 for 2 h, but in the absence of IL-1β. Total RNA was harvested from each plate and samples tested for the induction of VCAM1 expression by qRT-PCR. For this, VCAM1 expression was normalised to GAPDH expression, and then compared to the control (siCTL). First two columns are Non-siRNA transfected hASMC cells with and without IL-1β stimulation. The other two columns are hASMC cells transfected with siEGR1 or siCTL , stimulated with IL-1β. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where * and ** indicates p < 0.05 and p < 0.01 respectively.

1 5

** e

g 1 0 n

a ** h C

d l

o 5 F

e e 1 n n L o o R T l l G A A iC iE s s S ll ll S e e C C

2 h , IL - 1

Figure 3‎ .17. ICAM1 expression post-transfection with siEGR1 and IL-1β-stimulated hASMC cells were serum starved after transfection with siEGR1, siCTL or not transfected. After 24 h of serum starvation, IL-1β (10 ng/mL) was added to the plates transfected with siEGR1, siCTL or not transfected, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 2 h. Another non-transfected plate was also incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 2 h, but in the absence of IL-1β. Total RNA was harvested from each plate and samples tested for the induction of ICAM1 expression by qRT-PCR. For this, ICAM1 expression was normalised to GAPDH expression, and then compared to the control (siCTL). First two columns are Non-siRNA transfected hASMC cells with and without IL-1β stimulation. The other two columns are hASMC cells transfected with siEGR1 or siCTL , stimulated with IL-1β. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where ** indicates p < 0.01.

100

A B siEGR1+FGF2 siCTL+FGF2 B

NAB2

Β-ACTIN

Figure 3‎ .18. NAB2 expression post-transfection with siEGR1 and FGF2-stimulated hASMC cells were serum starved after transfection with siEGR1, siRNA Control (siCTL). After 24 h of serum starvation, FGF-2 (50 ng/mL) was added to the plates transfected with siEGR1 or

siCTL, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 2 h. Protein was extracted and 10 μg of protein separated by PAGE (8%) for 2 h, and transferred to PVDF membrane by semi-dry transfer for 1 h, followed by Western Blot analysis using 1’Ab (Rabbit polyclonal NAB2) and 2’Ab (goat anti-rabbit). (A) NAB2 and β-actin (loading control) protein expression in hASMC cells. Quantification of the western gel are shown in (B) hASMC cells transfected with siEGR1 or siCTL , stimulated with FGF2. All protein expression was normalized to β-actin. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where * indicates p < 0.05.

101

A siEGR1+FGF2 siCTL+FGF2 siEGR1+IL-1β siCTL+IL-1β 100 KDa VCAM1

50 KDa Β-ACTIN

B 4 * s n i t 3 i t * c n a U -

y / r 2 1 a r M t i A b r C 1 A V

1 L 1 L R T R T G iC G iC iE s iE s s s

2 h , F G F 2 2 h , IL -1

Figure 3‎ .19. VCAM1 expression post-transfection with siEGR1 and IL-1β -stimulated hASMCs were serum starved and two plates were transfected with siEGR1 and two plates contained non-transfected hASMCs. After 24 h of serum starvation, IL-1β (10 ng/mL) or FGF2 (50

ng/mL) was added. Plates were incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 2 h. Protein was extracted and 10 μg of protein separated by PAGE (8%) for 2 h, and transferred to PVDF membrane by semi-dry transfer for 1 h, followed by Western Blot analysis using 1’Ab (Rabbit polyclonal VCAM1) and 2’Ab (goat anti-rabbit). (A) VCAM1 and β-actin (loading control) protein expression in hASMCs. Quantification of the western gel for VCAM1 are shown in (B) hASMCs transfected with siEGR1 or siCTL , stimulated with FGF2 or IL-1β. All proteins expression was normalized to β-actin. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where * indicates p < 0.05.

102

A B siEGR1+IL-1β siCTL+IL-1β 110KDa ICAM1

50KDa Β-ACTIN

Figure 3‎ .20. ICAM1 expression post-transfection with siEGR1 and IL-1β -stimulated hASMCs were serum starved and transfected with siEGR1. After 24 h of serum starvation, IL-1β (10 ng/mL) was added. Plates were incubated at 37°C in a humidified atmosphere of 5% (v/v)

CO2 for 2 h. Protein was extracted and 10 μg of protein separated by PAGE (8%) for 2 h, and transferred to PVDF membrane by semi-dry transfer for 1 h, followed by Western Blot analysis using 1’Ab (Rabbit polyclonal ICAM1) and 2’Ab (goat anti-rabbit). (A) ICAM1 and β-actin (loading control) protein expression in hASMCs. Quantification of the western gel for NAB2 is shown in (B) hASMCs transfected with siEGR1 or siCTL , stimulated with IL-1β. All proteins expression was normalized to β-actin. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where ** indicates p < 0.01.

103

Figure 3‎ .21. CAGE analysis of the late responder genes Expression of the late responder genes post-stimulation display a lag period, with a peak in expression at ~3 h and rapid return to basal levels by 6 h. Cap Analysis Gene Expression (CAGE) for C-JUN and JUND genes stimulated with IL-1β (10 ng/mL). Target gene expression was normalised to the 0 h time point. EGR1 knockdown would be expected to result in a reduction in C-JUN and JUND gene expression, at both the RNA and protein levels.

104

*** 2 .5

2 .0 * e g

n 1 .5 a h C

d 1 .0 l o F 0 .5

0 .0

e e 1 n n L o o R T l l G C A A i iE s s s s ll ll e e C C

4 h , IL - 1

Figure 3‎ .22. C-JUN expression post-transfection with siEGR1 and IL-1β -stimulated hASMC cells were serum starved after transfection with siEGR1, siCTL or not transfected. After 24 h of serum starvation, IL-1β (10 ng/mL) was added to the plates transfected with siEGR1, siCTL or not transfected, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 4 h. Another non-transfected plate was also incubated at 37°C in a humidified atmosphere of 5%

(v/v) CO2 for 4 h, but in the absence of IL-1β. Total RNA was harvested from each plate and samples tested for the induction of C-JUN expression by qRT-PCR. For this, C-JUN expression was normalised to GAPDH expression, and then compared to the control (siCTL). ). First two columns are Non-siRNA transfected hASMC cells with and without IL-1β stimulation. The other two columns are hASMC cells transfected with siEGR1 or siCTL , stimulated with IL-1β. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where * and *** indicates p < 0.05 and p < 0.001 respectively.

105

3 *

* e

g 2 n a h C

d l

o 1 F

e e 1 n n L o o R T l l G C A A i iE s s s s ll ll e e C C

4 h , IL - 1

Figure 3‎ .23. JUND expression post-transfection with siEGR1 and IL-1β -stimulated hASMC cells were serum starved after transfection with siEGR1, siCTL or not transfected. After 24 h of serum starvation, IL-1β (10 ng/mL) was added to the plates transfected with siEGR1, siCTL or not transfected, and incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 4 h. Another non-transfected plate was also incubated at 37°C in a humidified atmosphere of 5%

(v/v) CO2 for 4 h, but in the absence of IL-1β. Total RNA was harvested from each plate and samples tested for the induction of JUND expression by qRT-PCR. For this, JUND expression was normalised to GAPDH expression, and then compared to the control (siCTL). First two columns are Non-siRNA transfected hASMC cells with and without IL-1β stimulation. The other two columns are hASMC cells transfected with siEGR1 or siCTL , stimulated with IL-1β. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where * indicates p < 0.05.

106

A siEGR1+IL-1β siCTL+IL-1β

C-JUN 40KDa

45KDa JUND

β-ACTIN 50KDa

B C

Figure 3‎ .24. C-JUN and JUND expression post-transfection with siEGR1 and IL-1β - stimulated hASMCs were serum starved and two plates were transfected with siEGR1 and two plates were transfected with siCTL. After 24 h of serum starvation, IL-1β (10 ng/mL) was added. Plates were incubated at 37°C in a humidified atmosphere of 5% (v/v) CO2 for 4 h. Protein was extracted and 10 μg of protein separated by PAGE (8%) for 2 h, and transferred to PVDF membrane by semi- dry transfer for 1 h, followed by Western Blot analysis using 1’Ab (Rabbit polyclonal C-JUN or JUND) and 2’Ab (goat anti-rabbit). (A) C-JUN, JUND and β-actin (loading control) protein expression in hASMCs. Quantification of the western gel for C-JUN and JUND are shown in (B) and (C) respectively of hASMCs transfected with siEGR1 or siCTL, stimulated with IL-1β. All proteins expression was normalized to β-actin. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using unpaired t-test and a value of p<0.05 was considered statistically significant where * indicates p < 0.05.

107

In summary, 3 genes (EGR1, ICAM1 and C-JUN) have been selected and their expression profiles were tested in vitro using qRT-PCR. Generated profiles of the three genes from qRT-PCR were compared to their profiles from CAGE method; consequently, validation of the CAGE method has been established. Afterwards, three categories of genes were proposed depending on their expression profile; early responders (demonstrate high inducible expression at approximately 1 h with a return to basal levels by approximately 2-3 h), rapid transient responders (generally peak in expression at approximately 1-3 h, with transient or sustained expression until 6 h post-stimulation) and late responders genes (display a lag period, peak at approximately 3 h and rapidly return to basal levels by 6 h post-stimulation). Conformation of the three categories was accomplished by knocking down an early responder gene (EGR1) at RNA and protein levels and observing the impact on its downstream genes in the other two categorise (rapid transient responders genes (ICAM1, VCAM1 and NAB2) and late responders genes (C-JUN and JUND)).

108

3.3 Discussion Human vascular smooth muscle cells (hVSMCs) play a functional role in diseases such as ischemia, inflammation, atherosclerosis and hypertension. hVSMCs are normally quiescent and non-migratory cells, exhibiting a contractile phenotype. Following injury or stimulation with growth factors or cytokines, hVSMCs switch to a dedifferentiated, proliferative, migratory phenotype. Activated (stimulated by external stimuli) hVSMCs are a major cell type involved in cardiovascular diseases since they make up the better portion of blood vessels. Immediate early genes (IEGs), such as EGR1 control hVSMC physiology by stimulating downstream proliferation and migration genes. The aim of this study was to identify and profile IEGs responding to growth factor (FGF2) and cytokine (IL-1β) stimulation and to gain insight into the downstream genes. IEGs were categorised into three groups depending on their expression profile. EGR1 is a dominant regulator, thus, the validation of these three categories was accomplished by inhibiting EGR1 to demonstrate its critical role in the expression of downstream genes such as VCAM1, ICAM1, NAB2, C-JUN and JUND.

3.3.1 Expression profile of EGR1 in serum arrested hASMCs The results presented in this study demonstrate that EGR1 expression is stress inducible (serum starvation and stimulation with FBS) in hASMCs. EGR1 expression is upregulated in serum-arrested hASMCs within 15 min of adding FGF2 or IL-1β and the expression level peaked at 1 h. Moreover, EGR1 was transiently expressed over a 6 h time frame. Expression profile of EGR1 at the protein level correlated with the RNA expression and was observed to peak at 1-2 h after serum stimulation with FGF2 or IL- 1β. EGR1 stress induced protein expression was maintained for 6 h. Thus, EGR1 is readily expressed in cellular stress conditions and rapidly translated in hASMCs. EGR1 has significant role in hASMCs hyperplasia which causes restenosis237. Moreover, inhibition of EGR1 in porcine coronary arteries after stent implantation results in reduced neointima formation 311 and tumour growth along with reduction in tumour angiogenesis 312. Stress induction of EGR1 has a high impact on the formation of neointima after both balloon injury and carotid artery ligation313, 314.

109

3.3.2 Expression profile of genes using CAGE analysis Expression of chosen genes in FBS stimulated cells was analysed relative to unstimulated cells at the 0 h time point. As described by Chanakira (2012) 295, a two-fold response threshold was adopted as being indicative of a responsive gene in these primary cells. A total of 347 genes were identified and checked for expression levels in hASMCs after serum induction (stimulating cells with growth factor or cytokines after serum starvation) using FGF2 or IL-1β. The CAGE technique allows high throughout analysis of gene expression by identifying sequence tags that correspond to the 5’end of mRNA transcripts at the cap sites. Moreover, it can be used to identify the transcriptional start point (TSP)293. The CAGE method has served to map most of the human transcription starting sites and their associated promoters 315 in a tissue/cell/condition-specific context 316.

3.3.3 Accuracy of the CAGE method Validation of the CAGE tool was an important step in supporting its efficacy and accuracy. Three selected genes (EGR1, C-JUN and ICAM1) were analysed for expression levels using quantitative real-time RT-PCR (qRT-PCR). The resulting data from qRT-PCR was compared with the CAGE data and matching expression profiles became evident in this comparison. This study has demonstrated that the CAGE method can be effectively and specifically implemented as a high through-put alternative to qRT-PCR in the investigation of gene expression profiles. The CAGE method can be used in conjunction with the Kinome (Cell-wide analysis of protein phosphorylation and their kinases) and iTRAq (Determining protein existence in a sample) analysis techniques to determine and discover roles for gene products. Inhibiting an early responder gene, and observing the change in expression of other downstream genes, and examining their kinases and expression at the protein level through Kinome and iTRAQ methods, respectively, may unveil new links between genes and pathways. Combining these three methods will develop our understanding of novel connections between genes and provide insight into their mechanisms317, 318.

3.3.4 The categorisation of IEGs IEGs were characterised into three groups depending on their expression profile: early responders, rapid transient responders and late responders. Genes were examined

110 for their response to FGF2 and/or IL-1β stimulation to ensure accurate categorisation. The identification of these three categories will facilitate the identification of links between the responder genes and their downstream effectors. For example, EGR1, a main regulator for number of genes, has been sorted into the early responder gene category. This characterisation will facilitate the identification of downstream genes regulated by EGR1. Conversely, the categorisation of VCAM1 into the rapid transient responder classification, a gene stimulated by growth factors and cytokines and is associated with atherosclerosis319. This information may lead to the identification of the mechanism associated with its induction in hASMCs. The three aforementioned categories will facilitate understanding the induction of genes upon stimulation and their role in cellular pathways.

3.3.5 Inhibiting stress induced EGR1 expression in hASMCs. Gene silencing through the RNA interference (RNAi) approach is an effective means of post-transcriptionally regulating gene expression320, with a consequential inhibition of protein production. In this study, the induced expression of EGR1 at the protein level was inhibited in hASMCs using a siRNA specific for EGR1 mRNA. Preventing the translation of EGR1 mRNA proved to be an effective way of reducing EGR1 protein levels in hASMCs. EGR1 has been established to contribute to the pathogenesis of atherosclerotic lesion321. Moreover, EGR1 is usually induced after balloon catheter scrap injury, thus, it play significant role in hASMCs growth and intimal thickening which makes it a mediator in hASMCs 322. EGR1 has also been demonstrated to have other roles in cardiovascular pathological process; for example, ischemia reperfusion, cardiac hypertrophy, allograft rejection and angiogenesis 304. EGR1 has an important role in linking the changes that occur in the local cellular environment with the expression of key genes that have a broad spectrum in vascular pathologies. It has been established that, the downstream genes of EGR1 are NAB2, VCAM1, ICAM1, C-JUN and JunD 304. These genes fit in two of the previously described categories (rapid transient responders and late responders’ genes) (Section 3.3.4). Inhibition of EGR1 protein expression would be expected to result in the inhibition of expression of the target genes, at the protein level. Inhibition of EGR1 at the protein level, via EGR1- specific siRNA, resulted in reduced expression of NAB2, VCAM1, ICAM1, C-JUN and JUND

111 at the mRNA and protein levels. These results clearly demonstrate that, by targeting EGR1 and inhibiting it, reduced EGR1 modifies the transcriptional actions in the cellular stress response hASMCs 323. Inhibiting EGR1 has resulted in a reduction of expression of target genes which supports the hypothesis that a second and third IEG categories exists (rapid transient responders and late responders genes), downstream and dependent on the responders in first category (section 3.2.6.3).

3.3.6 EGR1 plays a role in the motogenic reaction to extracellular signals Production of growth factors and cytokines is a communal characteristic in cardiovascular disease and it is linked with growth dysregulation324. Chemokines and growth factors function as extracellular signals that drive hASMCs growth and migration325. hASMCs migration is a complex process and it comprises transformation of the cytoskeletal mechanisms and focal adhesion 326. Extracellular stimulation is required for the cytoskeleton to become polarised, and it is this cytoskeletal polarisation that directs cell locomotion. The occurrence of cell membrane extension, as seen in lamellipodia and filopodia, usually results from actin filament polarisation at the edge of the cell 327. Cell adhesion molecules associated with actin facilitate the interaction between the lamellipodia and the ECM. Conversely, filopodia extend from the lamellipodia, playing a role in cell movement via extracellular sensing 328. It was demonstrated that targeting EGR1 effects cell morphology, evident by less filopodia. Moreover, a decreased capability of the cell to sense extracellular signals was demonstrated329. Thus, EGR1 will not be induced in hASMCs and will not play as a master regulator for other key genes in the cell. EGR1 as a main regulator of number of genes involves EGR1 in a number of diseases related to cardiovascular including athersclerosis, intimial thickening, hypoxia, ischemia, cardiac hypertrophy, allograft rejection and angiogenesis289. The characterisation of EGR1 as an early responder gene confirms the position of EGR1 as a main regulator of other key genes in hASMCs. As it was mentioned earlier; EGR1 work as mediator that links the local cellular environment changes with the expression of key genes that have broad spectrum in vascular pathology.

112

3.3.7 The role of early responder genes in cardiovascular disease Additional genes such as C-FOS and FosB (Table 3.7) have been demonstrated to be stimulated by FGF2/IL-1β and are categorised as early responder genes. These two genes have an important role in cell migration and proliferation330. Therefore, sorting the genes into different categories depending on their post-stimulation expression profile will facilitate the discovery of the role of other genes within each category. Thus, more understanding of the pathways and the genes associated with each of them.

3.4 Conclusion In summary, EGR1 expression and activation (by growth factor and cytokines) is stress inducible in hASMCs. CAGE analysis facilitated the categorisation of IEGs into three groups: 1. early responders, which show high inducible expression at ~1 h with return to basal levels by approximately 2-3 h, 2. Rapid transient responders, that generally peak in expression at approximately 1-3 h post-stimulation with transient or sustained expression until 6 h, and 3. late responders that display a lag period, expression peak at approximately 3 h and rapidly return to basal levels by 6 h. qRT-PCR and Western Blot analysis validated a subset of genes from the CAGE gene profiles. The relationship between the three groups was then examined through siRNA and inhibitor knockdown of EGR1, which resulted in inhibiting the downstream genes (ICAM1, VCAM1, NAB2, C-JUN and JUND). Having three categories for all the IEGs will facilitate our understanding of the mechanism of each gene and its pathway. Moreover, it will help in researching for new mediators and regulators, which have broad impact on vascular pathology.

113

114

4 Chapter 4: Targeting C-JUN and C-FOS, Potential in combatting melanoma

The following work is under preparation for publication:

Targeting C-JUN and C-FOS through miR-155 and miR-125b, Potential in combatting melanoma. Ahmad M.N. Alhendi, Leonel-Prado-Lourenco, Noel Whitaker. In preparation

115

4.1 Introduction MicroRNAs (miRNAs or miRs) are an abundant class of short (17 to 25 nt) non- coding single-stranded RNAs that are important regulators of cellular gene expression 331. Mature miRNA is generated from long primary genomic transcripts (pri-miRNA), which are processed in the nucleus by the enzymes Drosha and DGCR8. The resulting 60–80 nucleotide precursor miRNA (pre-miRNA) is exported to the cytoplasm by Exportin 5. In the cytoplasm, the RNase III enzyme Dicer processes the pre-miRNA to generate a short RNA duplex. One strand of the duplex is degraded whilst the remaining single-stranded miRNA molecule combines with members of the Argonaute protein family forming the RNA-induced silencing complex (RISC). RISC along with the guide or combined miRNA bind to the 3’untranslated region (3’-UTR) of the targeted mRNA resulting in its down-regulation by mRNA cleavage or translational repression 332 333. MicroRNAs have been confirmed as regulators of complicated biological behaviours, such as cell differentiation, proliferation, apoptosis and tissue development 334. Of late, a plethora of data has emerged demonstrating the role of miRNA in disease. Deregulation of miRNA expression has shown to lead to major pathologies including heart disease and cancer 334-336 where profiles of differential miRNA expression have been uncovered for nearly every disease. The global race is now on to link the myriad of confirmed and putative miRNAs to their target genes and to gain an understanding of the post-transcriptional control mechanisms of miRNAs in both the normal and the diseased context. Serum stimulation of cancer cells to study gene expression patterns has identified the induction of expression of positive regulatory transcription factors, such as C-JUN, C-FOS and Egr-1228, 302, 304, as well as the induced expression of transcriptional repressors such as YY1, NAB2 and GCF2290-292. These transcription factors are known to play crucial roles in the early activation of cancer and are prime targets for discovering disease pathways. The identification of miRNAs which regulate the expression of these transcription factors may further our understanding of the mechanisms of gene induction and the downstream activation pathways whilst also identifying potential therapeutic candidates. The aim of the following chapter was to identify and profile miRNAs which interact with specific transcription factors such as C-JUN and C-FOS. C- JUN is an immediate early gene (IEG) and a member of heterodermic transcription factor

116 activator protein complex-1 (AP-1). Moreover, C-JUN has been shown to positively regulate cellular proliferation. This could be via the repression of tumour suppressor genes or by inducing the transcription of cyclin D1337. Conversely, C-JUN has been shown to be regulated by the miRNA miR-155. A study by Song et al. demonstrated that miR- 155 can bind C-JUN mRNA ultimately decreasing its protein level in human dermal fibroblasts (HDFs)158. Additionally in HDFs, ultraviolet A (UVA) irradiation-induced photoaging has shown to upregulate C-JUN mRNA as well as protein whilst decreasing the expression of miR-155. Interestingly, the addition or inhibition of miR-155 did not change the expression of C-JUN mRNA which could indicate that the inhibition of C-JUN by miR-155 occurs at the post-transcriptional level. In general growth factor receptor is a receptor that usually binds to growth factor. However, some growth factor receptors can be activated through UV irradiation, which in turn induces the activation of protein kinase cascades. This will activate the AP- 1 complex through increasing expression of C-JUN and C-FOS. Thus, UV irradiation has a negative effect on the expression of miR-155, but a positive effect on C-JUN and possibly C-FOS protein expression in HDFs since miR-155 will not be expressed and will not bind to C-JUN and C-FOS (Fig 4.1). C-JUN N-terminal kinase (JNK) signal transduction pathway has been shown to participate in proliferation and differentiation of cells. C-JUN gets activated through the phosphorylated JNK, which in turn forms the activator protein-1 (AP-1) transcription factor338. The AP-1/JNK pathway could stimulate the expression of miR-155. Since higher exposure to UVA leads to higher expression of C-JUN and increased expression of miR- 155 in HDFs, this suggests that HDFs have a self-defence mechanism against exposure with UVA irradiation. This validates that miR-155 dose target C-JUN and down-regulates it. It should be mentioned that miR-155 seed region matched the C-JUN 3’-UTR 158 thus miR-155 bind to C-JUN 3ÚTR.

117

A Human C-JUN and hsa-miR-155 binding

3ÚTR 5’ ACATTCGATCTCATTCAGTATTAAAGG 3’

miR-155 3’ UGGGGAUAGUGCUAAUCGUAAUU 5’

Human C-FOS and hsa-miR-155 binding

3’UTR 5’ CCTTAGTCTTCTCATAGCATTAA 3’

miR-155 3’ UGGGGAUAGUGCUAAUCGUAAUU 5’ Figure 4‎ .1. Suggested binding site of miR-155 to C-JUN and C-FOS C-JUN and C-FOS 3ÚTR binds to homo-sapiens miR-155 (hsa-miR-155) and the red nucleotide indicates where the binding occur158.

The inhibition of C-JUN via various miRNAs could ultimately serve as potential therapeutics for melanoma. Of interest, miR-125b negatively regulates C-JUN at the post-transcriptional level where the loss of miR-125b results in the increased expression of C-JUN protein 339. Studies have also demonstrated that miR-125b is capable of binding to the coding sequences (CDS) of C-JUN mRNA (fig 4.2), demonstrating its ability to regulate C-JUN protein expression, activity and AP-1 binding to DNA159. These findings illustrate the importance of C-JUN as a functional molecular key, propagating miR-125b mediated effects.

Human C-JUN and hsa-miR-125b binding

CDS 5’ CCAACATGCTCAGGGAACAGGTGGCAC 3’ miR -125b 3’ UCCCU GAGA CCC UAACUUGUGA 5’

Figure 4‎ .2. Suggested binding site of miR-125b to C-JUN coding sequence C-JUN coding sequence binds to Homo sapiens miR-125b (hsa-miR-125b) and the red nucleotide indicates where the binding occurs

The aim of this part of the project is to identify and profile miRNAs that interact with specific transcription factors such as C-JUN and C-FOS. C-JUN is an immediate early gene (IEG) and a member of heterodermic transcription factor activator protein complex-1 (AP-1).

118

4.2 Results

4.2.1 C-JUN, C-FOS and EGR1 are induced by stress and activated in HEK293 and MM200 cell lines HEK293 and MM200 cells were used in this study as an in vitro model for the microRNA studies. HEK293 was used as a positive control as C-JUN is reportedly regulated by miR- 155 in this cell line158. MM200 cell line was chosen to be tested in this project as it was one of the few melanoma cell lines in which miR-125b regulation of C-JUN has not been reported339. Moreover, our laboratory has experience with this cell line and we have plans to use MM200 to establish an in vivo model, as future work to my PhD.

FBS, rather than just purified growth factors, was used to stimulate IEGs in this chapter as FBS is a general of IEGs stimulators which are the subject of this study. FBS mimics stress (i.e uncontrolled proliferation for melanoma) and is the standard technique in this field, e.g. Juranic et al., 1999 340. Induction of C-JUN, C-FOS and EGR1 in both cell lines was detected by qRT-PCR for the mRNA (Fig 4.3 and 4.4) and western blot analysis for the protein (Fig 4.5 and 4.6). After serum starvation of HEK293 and MM200 cells, a significant induction of C-JUN, C- FOS and EGR1 was observed after 1 h of serum treatment (10% FBS) (Fig 4.3 and 4.4), with the greatest induction detectable at 1 h post serum induction. Protein expression of C-JUN, C-FOS and EGR1 was also significantly induced after serum stimulation (with 10% FBS) of the serum starved HEK293 and MM200 cells (Fig 4.5 and 4.6). The expression of EGR1 at both the mRNA and protein level was examined as an internal control in studying of the relation between miR-155/miR-125b and C-JUN/C- FOS. EGR1 was chosen as an internal control as miR-155/miR-125b sequences have no homology with the EGR1 3ÚTR sequence and, thus, are not expected to effect EGR1 mRNA and protein expression.

119

A B

Figure 4‎ .3. Induction of C-JUN, C-FOS and EGR1 mRNA expression after serum stimulation in HEK293 cells HEK293 Cells were grown in 10 cm petri dishes in DMEM medium, pH 7.4, supplemented with 1 mM L-glutamine, 10 units/ml penicillin, 10 mcg/ml streptomycin and 10% fetal bovine serum, at 37°C in a humidified atmosphere of 5% CO2. The cells were serum starved at 80-90% confluency by incubation in serum-free medium overnight. Cells were then exposed to 10% FBS for various times up to 6 hours (0.25, 0.50, 1, 1.5, 2, 4 and 6 h). 0 min samples represent serum starved and unstimulated cells. RNA was extracted and tested for the (A) C-JUN, (B) C-FOS and (C) EGR1 induction by qRT-PCR. C-JUN, C-FOS and EGR1 expression level (normalized to GAPDH) compared with that for the non-induced (0 min) samples. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant where ** and *** indicates p < 0.01 and p < 0.001 respectively. Ct values for GAPDH qRT-PCR are shown in appendix 7.8.

120

A B

Figure 4‎ .4. Induction of C-JUN, C-FOS and EGR1 mRNA expression after serum stimulation in MM200 cells MM200 Cells were grown in 10 cm petri dishes in DMEM medium, pH 7.4, supplemented with 1 mM L-glutamine, 10 units/ml penicillin, 10 mcg/ml streptomycin and 10% fetal bovine serum, at 37°C in a humidified atmosphere of 5% CO2. The cells were serum starved at 80-90% confluency by incubation in serum-free medium overnight. Cells were then exposed to 10% FBS for various times up to 6 hours (0.25, 0.50, 1, 1.5, 2, 4 and 6 h). 0 min samples represent serum starved cells and unstimulated. Samples tested for the (A) C-JUN, (B) C-FOS and (C) EGR1 induction by qRT- PCR. C-JUN, C-FOS and EGR1 expression level was normalized to GAPDH. This is a pooled data of three independent experiments performed in triplicates ± SEM. It was analysed for statistical significance using uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant where *, ** and *** indicates p < 0.05, p < 0.01 and p < 0.001 respectively. Ct values for GAPDH qRT-PCR are shown in appendix 7.9.

121

A B C-JUN B

C -FOS

EGR1

B-ACTIN

0 0.25 0.50 1 1.5 2 4 6 hours

C D

Figure 4‎ .5. Induction of C-JUN, C-FOS and EGR1 protein expression after serum stimulation in HEK293 cells (A) HEK293 cells were grown in 10 cm petri dishes in DMEM medium, pH 7.4, supplemented with 1 mM L-glutamine, 10 U/ml penicillin, 10 mcg/ml streptomycin and 10% fetal bovine serum (FBS), at 37°C in a humidified atmosphere of 5% CO2. The cells were serum starved at 80-90% confluency by incubation in serum-free medium overnight. After 24 h of serum starvation, cells were exposed to 10% FBS for various times up to 6 h (0.25, 0.50, 1, 1.5, 2, 4 and 6 h). 0 min samples represent unstimulated, serum starved cells. Protein was extracted from the cells and resolved on a 8% w/v polyacyramide gel and transferred to a membrane. The membrane was blocked with 5% Skim milk and probed with a 1’Ab (anti-C-JUN or -C-FOS or -EGR1) and then with a 2’Ab (goat anti-rabbit). The proteins were then detected by ECL treatment and exposure on X-ray film. Protein expression of (B) C-JUN, (C) C-FOS and (D) EGR1 was normalised to β-actin at the various time points indicated, relative to the 0 min sample which was set to 1.0 arbitrary unit. The immunoblot shown in panel A is representative of three independent experiments while the quantified densitometries, shown in panels B-D, are pooled data from three independent experiments. It was analysed for statistical significance using uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant where ** and **** indicates p < 0.01 and p < 0.0001 respectively.

122

A B C-JUN

C-FOS

EGR1

B-ACTIN

0 0.25 0.50 1 1.5 2 4 6 hours

C D

Figure 4‎ .6. Protein expression of C-JUN, C-FOS and EGR1 after FBS stimulation in MM200 cells (A) MM200 cells were grown in 10 cm petri dishes in DMEM medium, pH 7.4, supplemented with 1 mM L-glutamine, 10 U/ml penicillin, 10 mcg/ml streptomycin and 10% fetal bovine serum(FBS), at 37°C in a humidified atmosphere of 5% CO2. The cells were serum starved at 80- 90% confluency by incubation in serum-free medium overnight. After 24 h of serum starvation, cells were exposed to 10% FBS for various times up to 6 h (0.25, 0.50, 1, 1.5, 2, 4 and 6 h). 0 min samples represent unstimulated serum starved cells. Protein was extracted from the cells and resolved on a 8% w/v polyacyramide gel and transferred to a membrane. The membrane was blocked with 5% Skim milk and probed with a 1’Ab (anti-C-JUN or -C-FOS or -EGR1) and then with a 2’Ab (goat anti-rabbit). The proteins then detected by ECL treatment and exposure on X- ray film. Protein expression of (B) C-JUN, (C) C-FOS and (D) EGR1 was normalised to β-actin at the various time points indicated, relative to the 0 min sample which was set to 1.0 arbitrary unit. The immunoblot shown in panel A is representative of three independent experiments while the quantified densitometries, shown in panels B-D, are pooled data from three independent experiments. It was analysed for statistical significance using uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant where *, **, *** and **** indicates p < 0.05 p < 0.01 p < 0.001 and p < 0.0001 respectively.

123

4.2.2 Expression of miR-155 and miR-125b is not induced by serum stimulation in HEK293 and MM200 In order to test the expression of miR-155 and miR-125b in HEK293 and MM200, the induction of miR-155 and miR-125b expression in HEK293 and MM200 cell lines was detected by qRT-PCR (4.7). After serum starvation of HEK293 and MM200 cells, no significant induction of miR-155 or miR-125b was observed after 6 h of FBS stimulation (Fig 4.7).

A B

D C

Figure 4‎ .7. Induction of miR-155 and miR-125b expression after serum stimulation HEK293 and MM200 cells were grown in 10 cm petri dishes in DMEM medium, pH 7.4, supplemented with 1 mM L-glutamine, 10 U/ml penicillin, 10 mcg/ml streptomycin and 10% fetal bovine serum (FBS), at 37°C in a humidified atmosphere of 5% CO2. The cells were serum starved at 80-90% confluency by incubation in serum-free medium overnight. Cells were then exposed to 10% FBS for various times up to 6 h (0.25, 0.50, 1, 1.5, 2, 4 and 6 h). 0 min samples represent unstimulated serum starved cells. RNA was extracted and examined for the induction of (A)(B) miR-155 and (C)(D) miR-125b by qRT-PCR. miR-155 and miR-125b expression levels were normalised to SNORD68_1 (non-coding RNA that is used as a house keeping gene for microRNA normalization) and compared with the level at 0 min (which is set at 1.0). Data represents the mean of three independent experiments performed in triplicate ± SEM. Treatments were determined to be no significantly different using an uncorrected Fisher’s LSD test.

124

There is no induction of miR-155 and miR-125b in HEK293 and MM200 cell lines. Thus, C-JUN and C-FOS aren’t expected to be regulated in these two cell lines, explaining the high expression of C-JUN and C-FOS in HEK293 and MM200.

4.2.3 Inhibition of the expression of C-JUN/C-FOS is achievable using mimic microRNA The ability of miR-155 and miR-125b to inhibit C-JUN and C-FOS was examined through gain and loss of functions studies by the silencing of these genes at the post- transcriptional level. Mimic microRNAs of miR-155 and miR-125b were used to test their ability to recognize C-JUN and C-FOS and inhibit them. Antisense microRNAs were also used to recognize miR-155 and miR-125b and inhibit them from binding to C-JUN/C-FOS.

4.2.3.1 Delivery of short interfering RNA (siRNA) using liposomes in HEK293 and MM200 siRNA labelled with fluorescein isothiocanate (FITC), was used to demonstrate delivery of the siRNA. The liposome vehicles DharmaFECT1 and RNAiMAX were compared for the delivery of FITC labelled siRNA into HEK293 and MM200 cells. Cells which have taken up the FITC labelled siRNA emit a FITC signal detectable using a fluorescence-activated cell sorter (FACS) where the greater the FITC signal, the greater the amount of siRNA/cell delivery. No signal was detected with cells treated with only the vehicle (without siRNA FITC) which validates the methodology used for image acquisition. A higher siRNA uptake coupled with lower toxicities was observed for the vehicle DharmaFECT1 compared with RNAiMAX and, therefore, this transfection reagent was used for subsequent experiments (4.9). DharmaFECT 1 is cationic lipid transfection reagent which forms a complex with polyanionic DNA. It is a very suitable delivery reagent for an efficient uptake of mimic microRNAs into HEK293 and MM200 cells with less harmfulness than RNAiMAX.

4.2.3.2 Transfection efficiency was examined using an siRNA-FITC The efficiency of transfection into the cells with mimic microRNAs targeting C- JUN and C-FOS in human was examined in vitro. Two siRNA-FITC concentrations (100 nM and 200 nM) were trialed in HEK293 and MM200 cells to optimise the mimic microRNA treatment required to inhibit the expression of C-JUN and C-FOS following serum induction. siRNA-FITC signal was the highest at 200 nM in both the HEK293 and MM200

125 cells. As anticipated, no effect was observed with siRNA negative control. Less siRNA- FITC uptake was observed with 100 nM siRNA concentration compared with 200 nM. Therefore, 200 nM was considered as the optimal concentration for mimic microRNA’s to be used for subsequent experiments (Fig. 4.8).

Figure 4‎ .8. mimic miRNA transfection optimization for HEK2293 and MM200 cells HEK293 (A) and MM200 (B) cells were serum starved for 4 hours, transfected with FITC-labeled siRNA in serum free media. DharmaFECT1 and RNAiMAX were used for the delivery of siRNA into each cell type. 24 hours post-transfection, siRNA-FITC signal was measured by fluorescence activated cell sorting (FACS). The greater the FITC signal per cell, the greater the siRNA cell delivery. A higher siRNA uptake coupled with lower toxicities was observed for the vehicle DharmaFECT1 at 200 nM compared with RNAiMAX and therefor, this reagent was used for subsequent experiments.

126

4.2.4 Inhibition of C-JUN and C-FOS using mimic microRNAs Activation of C-JUN and C-FOS by JNK and ERK family members respectively, is a survival mechanism in reaction to stress341, 342. As microRNAs are known to regulate transcription factors at the post transcriptional level, we examined the expression of C- JUN and C-FOS at the protein level after being transfection. HEK293 and MM200 cells were transfected with miR-155 and miR-125b and stimulated with FBS for 1 h, as previous experiments have shown that this time point had the greatest expression of C- JUN and C-FOS (Fig.4.3 and 4.4). Since this study was focused on inhibiting C-JUN and C- FOS at the protein level, the efficiency of the transfection with miR-155 and miR-125b was established by persistent and specific inhibition of C-JUN and C-FOS at the protein level. In order to confirm the specificity of miR-155 to C-JUN/C-FOS 3ÚTR and miR-125b to C-JUN CDs, a query for each sequence using the standard nucleotide Basic Local Alignment Search Tool (BLAST) was performed against the human genomic and transcript database. Antisense miR-155 and miR-125b bind to miR-155 and miR-125b and prevent them from binding to their targets, thereby, relieving the repression of expression of target genes. Pre-miR miRNA precursor negative control #1 was used as a negative control in this study which was chemically designed and modified to mimic endogenous mature miRNA. Anti-miR miRNA inhibitor negative control #1 was also used in this study which was designed and chemically modified to specifically bind to and inhibit general endogenous miRNAs After transfection of the HEK293 and MM200 cells with miR-155 and miR-125b, RNA was extracted and qRT-PCRs for miR-155 and miR-125b were performed to ensure that the miRNAs had been delivered (Fig 4.9). C-JUN and C-FOS expression was not knocked down at the mRNA level following microRNAs transfection followed by serum stimulated HEK293 and MM200 cells (Fig 4.10). Transfection with miR-155, which has homology to C-JUN 3ÚTR region, has resulted in down-regulation of C-JUN protein expression in HEK293 but not in MM200 cells (Fig 4.11 and 4.12). miR-125b which has a complementary sequence to C-JUN CDs has down-regulated C-JUN at the protein level in MM200 but not HEK293 cells (Fig 4.11 and 4.12). miR-155 which also has a complementary sequence to C-FOS 3ÚTR was able to down-regulate C-FOS at the protein level in HEK293 but not in MM200 cells (Fig 4.13

127 and Fig 4.14). EGR1 was used in both cell lines as a negative control since miR-155 and miR-125b sequences do not complement EGR1.There were no changes in the expression of EGR1 in both cell lines with both mimic microRNAs (Fig 4.15 and 4.16). Inducing C-JUN, C-FOS and EGR1 with FBS in HEK293 and MM200 cells was established and the transfection of mimic microRNA’s and anti-sense microRNA’s specific for C-JUN and C-FOS has confirmed the hypothesis that C-JUN and C-FOS could be down-regulated in the aforesaid cell lines using miR-155 and miR-125b.

128

A B

C D

Figure 4‎ .9. Detection of miR-155 and miR-125b in HEK293 and MM200 cells after miRNA transfection HEK293 and MM200 cells were seeded in 6 well plates and serum starved be replacing the growth medium with FBS free DMEM after the cells had reached 80% confluency. After 6 h of serum starvation, cells were transfected overnight as indicated on the X-axes; cells alone (no FBS), cells alone( FBS), Pre-control +FBS (Pre-CTR), miR-155 +FBS (Pre-miR155), miR-125b +FBS (Pre-miR125b), anti-control +FBS (anti-CTR), anti-sense of miR-155 +FBS (2Ome-miR155) or anti- sense of miR-125b +FBS (2Ome-miR125b). 24 h post transfection, the cells were stimulated for 1 h with DMEM + 10% FBS except for ‘cells alone’ treatment group. RNA was then extracted and cDNA synthesised, followed by qRT-PCR for miR-155 and miR-125b. (A)(C) miR-155 and (B)(D) miR-125b expression levels were normalized to SNORD68_1 and compared with the untreated cells which were set to 1.0. The graphs are representative data from one of three independent experiments.

129

A B C

D E F

Figure 4‎ .10. No miRNA suppression of serum induction of C-JUN, C-FOS and EGR1 mRNA expression HEK293 and MM200 cells were serum starved after being seeded in 6 well plates by incubation in FBS free DMEM after cells reached 80% confluency. After 6 h of serum starvation, cells were transfected overnight as indicated on the X-axes; cells alone, cells + DharmaFECT1 alone + (no FBS), cells + DharmaFECT alone +FBS, cells + DharmaFECT1 + Pre-control +FBS (Pre-CTL), miR-155 +FBS (Pre-miR155), miR-125b +FBS (Pre-miR125b), anti-CTL +FBS (anti-CTL), anti-sense of miR-155 +FBS (2Óme-miR155) and anti-sense of miR-125b +FBS (2Óme-miR125b). 24 h post transfection, the cells were serum stimulated for 1 h with 10% FBS, except for cells alone and one of the cells alone + DharmaFECT1 samples. RNA was extracted and cDNA was synthesised followed by qRT-PCR for (A, D) C-JUN, (B, E) C-FOS and (C , F) EGR1. C-JUN, C-FOS and EGR1 expression and the levels normalized to GAPDH and compared with unstimulated cells alone (HEK293 or MM200 (no FBS) . The graphs are data from three independent experiments performed in triplicate ± SEM.Statistical significance was determined using an uncorrected Fisher’s LSD test. A value of p<0.05 was considered statistically significant where *, **, *** and **** indicates p < 0.05, p < 0.01, p < 0.001 and p < 0.0001 respectively.

130

Cells + Cells + Cells PRE-miR- PRE-miR- Anti- 2ÓM- Vehicle + Vehicle + 2ÓM- (no FBS) PRE-CTL 155 125b CTL 125B A FBS no FBS 155 50KDa C-JUN

37KDa β-ACTIN

Figure 4‎ .11. Suppression of C-JUN protein’s induction in HEK293 after transfection with miR155 but not miR125b HEK293 cells were seeded in 6 well plates and serum starbed after cells reached 80% confluency. After 6 h of serum starvation, the cells were transfected overnight with cells alone, cells + DharmaFECT1 alone + (no FBS), cells + DharmaFECT alone +FBS, cells + DharmaFECT1 + Pre-control +FBS (Pre-CTL), miR-155 +FBS (Pre-miR155), miR-125b +FBS (Pre-miR125b), anti-CTL +FBS (anti- CTL), anti-sense of miR-155 +FBS (2Óme-miR155) and anti-sense of miR-125b +FBS (2Óme- miR125b). After 24 h, cells were stimulated for 1 hour with 10% FBS except for the ‘cells alone’ and ‘cells alone + DharmaFECT1 (no FBS)’ treatment groups. Protein was extracted and run on 8% w/v polyacryamide gel for 2 h which was then transferred to a nitrocellulose membrane. The membrane was blocked and probed with 1’Ab (C-JUN) overnight and a 2’Ab (goat anti-rabbit) was probed for 1 h. ECL was then added to the membrane for 1 min and the membrane was then exposed. (A) Represents protein expression of C-JUN and B-actin at various time points, and (B) is the normalisation of C-JUN to B-actin at various time points. These results are a representative set from three independent experiments ± SEM. Data was analysed for statistical significance using an uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant. **** p < 0.0001 ns; not significant

131

Cells Cells + Cells + (no PRE- PRE- PRE- Vehicle + Vehicle + Anti- 2ÓM 2ÓM- A FBS) CTL miR- miR- FBS no FBS 155 125b CTL -155 125b C-JUN 50KDa

37KDa β-ACTIN

Figure 4‎ .12. Suppression of C-JUN protein’s induction in MM200 after transfection with miR125b but not miR155 Cells were seeded in 6 wells plate, when they are 80% confluent, DMEM media was removed and added new media with no FBS and cells were serum starved. After 6 h of serum arrest, cells were transfected overnight with cells alone, cells + DharmaFECT1 alone + (no FBS), cells + DharmaFECT alone +FBS, cells + DharmaFECT1 + Pre-control +FBS (Pre-CTL), miR-155 +FBS (Pre-miR155), miR- 125b +FBS (Pre-miR125b), anti-CTL +FBS (anti-CTL), anti-sense of miR-155 +FBS (2Óme-miR155) and anti-sense of miR-125b +FBS (2Óme-miR125b). After 24 h, cells were stimulated for 1 hour with 10% FBS except for the ‘cells alone’ and ‘cells alone + DharmaFECT1 (no FBS)’ treatment groups. Protein was extracted and run on 8% w/v polyacryamide gel for 2 h which was then transferred to a nitrocellulose membrane. Membrane was blocked and probed with 1’Ab (C-JUN) overnight and a 2’Ab (goat anti-rabbit) was probed for 1 h. ECL was added to the membrane for 1 min and the membrane was then exposed. (A)Represents protein expression of C-JUN and B-actin at various time points, and (B) normalisation of C-JUN to B-actin at various time points. These results are representative from three independent experiments ± SEM. It was analysed for statistical significance using uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant. **** p < 0.0001 ns; not significant

132

Cells Cells + (no Cells + PRE- PRE- Vehicle + FBS) Vehicle + PRE- miR- miR- Anti- 2ÓM- 2ÓM- FBS CTL CTL 155 125B A no FBS 155 125b 70KDa C-FOS

37KDa β-ACTIN

Figure 4‎ .13. Suppression of C-FOS protein’s induction in HEK293 after transfection with miR155 but not miR125b Cells were seeded in 6 wells plate, when they are 80% confluent, DMEM media was removed and added new media with no FBS and cells were serum starved. After 6 h of serum arrest, cells were transfected overnight with cells alone, cells + DharmaFECT1 alone + (no FBS), cells + DharmaFECT alone +FBS, cells + DharmaFECT1 + Pre-control +FBS (Pre-CTL), miR-155 +FBS (Pre-miR155), miR- 125b +FBS (Pre-miR125b), anti-CTL +FBS (anti-CTL), anti-sense of miR-155 +FBS (2Óme-miR155) and anti-sense of miR-125b +FBS (2Óme-miR125b). After 24 h, cells were stimulated for 1 hour with 10% FBS except for the ‘cells alone’ and ‘cells alone + DharmaFECT1 (no FBS)’ treatment groups. Protein was extracted and run on 8% w/v polyacryamide gel for 2 h which was then transferred to a nitrocellulose membrane. Membrane was blocked and probed with 1’Ab (C-FOS) overnight and a 2’Ab (goat anti-rabbit) was probed for 1 h. ECL was added to the membrane for 1 min and the membrane was then exposed. (A) Represents protein expression of C-FOS and B-actin at various time points, and (B) normalisation of C-FOS to B-actin at various time points. These results are a representative set from three independent experiments ± SEM. Data was analysed for statistical significance using an uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant. **** p < 0.0001 ns; not significant.

133

Cells Cells + Cells + PRE- PRE- PRE- A (no Vehicle Vehicle + Anti- 2ÓM- 2ÓM CTL miR- miR- FBS) + FBS no FBS 155 125b CTL 155 - 125b C-FOS 70KDa

β-ACTIN 37KDa

Figure 4‎ .14. No Suppression of C-FOS protein’s induction in MM200 after transfection with miR155 or miR125b Cells were seeded in 6 wells plate, when they are 80% confluent, DMEM media was removed and added new media with no FBS and cells were serum starved. After 6 h of serum arrest, cells were transfected overnight with cells alone, cells + DharmaFECT1 alone + (no FBS), cells + DharmaFECT alone +FBS, cells + DharmaFECT1 + Pre-control +FBS (Pre-CTL), miR-155 +FBS (Pre-miR155), miR- 125b +FBS (Pre-miR125b), anti-CTL +FBS (anti-CTL), anti-sense of miR-155 +FBS (2Óme-miR155) and anti-sense of miR-125b +FBS (2Óme-miR125b). After 24 h, cells were stimulated for 1 hour with 10% FBS except for the ‘cells alone’ and ‘cells alone + DharmaFECT1 (no FBS)’ treatment groups. Protein was extracted and run on 8% w/v polyacryamide gel for 2 h which was then transferred to a nitrocellulose membrane. Membrane was blocked and probed with 1’Ab (C-FOS) overnigh and a 2’Ab (goat anti-rabbit) was probed for 1 h. ECL was added to the membrane for 1 min and the membrane was then exposed. (A) Represents protein expression of C-FOS and B-actin at various time points, and (B) normalisation of C-FOS to B-actin at various time points. These results are representative from one of three independent experiments ± SEM. It was analysed for statistical significance using uncorrected Fisher’s LSD test, ns; not significant

134

Cells Cells + Cells + PRE- PRE-miR- 2ÓM- (no Vehicle Vehicle + PRE- Anti- 2ÓM- A miR-155 125b 125b FBS) + FBS no FBS CTL CTL 155 EGR1 80KDa

β-ACTIN 37KDa

Figure 4‎ .15. No Suppression of EGR-1 protein’s induction in HEK293 after transfection with miR155 or miR125b Cells were seeded in 6 wells plate, when they are 80% confluent, DMEM media was removed and added new media with no FBS and cells were serum starved. After 6 h of serum arrest, cells were transfected overnight with cells alone, cells + DharmaFECT1 alone + (no FBS), cells + DharmaFECT alone +FBS, cells + DharmaFECT1 + Pre-control +FBS (Pre-CTL), miR-155 +FBS (Pre-miR155), miR- 125b +FBS (Pre-miR125b), anti-CTL +FBS (anti-CTL), anti-sense of miR-155 +FBS (2Óme-miR155) and anti-sense of miR-125b +FBS (2Óme-miR125b). After 24 h, cells were stimulated for 1 hour with 10% FBS except for the ‘cells alone’ and ‘cells alone + DharmaFECT1 (no FBS)’ treatment groups. Protein was extracted and run on 8% w/v polyacryamide gel for 2 h which was then transferred to a nitrocellulose membrane. Membrane was blocked and probed with 1’Ab (EGR1) overnight and a 2’Ab (goat anti-rabbit) was probed for 1 h. ECL was added to the membrane for 1 min and the membrane was then exposed, (A) Represents protein expression of EGR1 and B-actin at various time points, and (B) normalisation of EGR1 to B-actin at various time points. These results are representative from three independent experiments ± SEM. It was analysed for statistical significance using uncorrected Fisher’s LSD test, ns; not significant

135

Cells Cells + Cells + PRE- PRE- A (no Vehicle + Vehicle + PRE- miR- miR- Anti- 2ÓM 2ÓM- FBS) FBS no FBS CTL 155 125b CTL -155 125b

EGR1 80KDa

β-ACTIN 37KDa

Figure 4‎ .16. No Suppression of EGR-1 protein’s induction in MM200 after transfection with miR155 or miR125b Cells were seeded in 6 wells plate, when they are 80% confluent, DMEM media was removed and added new media with no FBS and cells were serum starved. After 6 h of serum arrest, cells were transfected overnight with cells alone, cells + DharmaFECT1 alone + (no FBS), cells + DharmaFECT alone +FBS, cells + DharmaFECT1 + Pre-control +FBS (Pre-CTL), miR-155 +FBS (Pre-miR155), miR- 125b +FBS (Pre-miR125b), anti-CTL +FBS (anti-CTL), anti-sense of miR-155 +FBS (2Óme-miR155) and anti-sense of miR-125b +FBS (2Óme-miR125b). After 24 h, cells were stimulated for 1 hour with 10% FBS except for the ‘cells alone’ and ‘cells alone + DharmaFECT1 (no FBS)’ treatment groups. Protein was extracted and run on 8% w/v polyacryamide gel for 2 h which was then transferred to a nitrocellulose membrane. Membrane was blocked and probed with 1’Ab (EGR1) overnight and a 2’Ab (goat anti-rabbit) was probed for 1 h. ECL was added to the membrane for 1 min and the membrane was then exposed. (A) Represents protein expression of EGR1 and B-actin at various time points, and (B) normalisation of EGR1 to B-actin at various time points. These results are representative from one of three independent experiments ± SEM. It was analysed for statistical significance using uncorrected Fisher’s LSD test. ns; not significant.

136

4.2.5 Conduct a 3’UTR or CDS vs microRNA study The binding of miR-155 and miR-125b to homologous sequences in the 3’UTR and/or CDS of C-JUN and C-FOS was examined using luciferase expression plasmids. Kappelmann proposed that miR-155 binds to C-JUN/C-FOS 3ÚTR and regulates expression of both genes at the post transcriptional level 158 and miR-125b is able to bind to C-JUN CDS and regulate the expression of c-Jun also at a post transcriptional level159. Therefore, we attempted to confirm that miR-155 and miR-125b are able to bind to C-JUN and C-FOS 3ÚTR or CDS in HEK293 and MM200 cell lines. The data presented in section 4.2.4 establish that C-JUN and C-FOS are regulated at the post transcriptional level by miR-155 and miR-125b (section 4.2.4). These results were confirmed by the use of reporter constructs. Luciferase expression plasmids that have the designated sequence (C-JUN or C-FOS 3ÚTR or C-JUN CDs) were constructed and the impact on luciferase expression tested in the presence of the 3ÚTR –targeting miR-155 and the CDS-targeting miR-155. DharmaFECTDUO was used as lipofection reagent to deliver the luciferase expression plasmid into HEK293 and MM200 cells. Cells that express the luciferin protein are identified via luminescence signals that were measured in Veritas micro plate luminometer. Luciferin expression confirms that the plasmid was taken up by the cell and is expressed and translated.

4.2.5.1 miR-155 interacts with the C-JUN and C-FOS 3ÚTR while miR-125b interacts with C-JUN CDS Activation of C-JUN and C-FOS through the Ras-Raf-MEK-ERK1/2 and JNK pathway is a survival mechanism in response to stress (serum starvation, scratch injury)343. As demonstrated (section 4.2.4), C-JUN and C-FOS were down-regulated in HEK293 cell upon transfection with miR-155 (Fig 4.14 and 4.16). Additionally, C-JUN was down-regulated in MM200 cells upon transfection with miR-125b. Thus, we predicted that luciferin expression will be the lowest for C-JUN and C-FOS in HEK293 cell line after transfection with miR-155, and luciferin expression will be the lowest with C-JUN CDS after transfection with miR-125b in MM200 cells. This down regulation of expression is dependent on the microRNA binding to its target, and inhibiting translation of the targeted gene and, thus, inhibiting luciferin protein expression.

137

Through this experiment, we were able to demonstrate that miR-155 has negative effect on C-JUN and C-FOS (Fig.4.17) 3ÚTR expression in HEK293 but not in MM200 cells (Fig.4.18). miR-125b was shown to effect the C-JUN CDs in MM200 but not in HEK293 cells (Fig 4.19). EGR1 and empty plasmid were used as negative controls in both cell lines and as anticipated miR-155 and miR-125b did not have an effect on luciferin expression (Fig.4.20). For C-JUN, C-FOS 3ÚTR and C-JUN CDs, other plasmid of each containing mutation of the sequence where miR-155 or miR-125b is predicted to bind , called C-JUN 3ÚTR mutant, C- FOS 3ÚTR mutant and C-JUN CDs mutant, respectively. Using miR-155 and miR-125b binding regions mutants should confirm that the miR-155 and/or miR-125b recognize and inhibit C-JUN and C-FOS. Luciferase reporter construct containing HEK293 and MM220 cells were transfected with miR-155 and miR-125b followed by luciferin detection. Tables 4.1 and 4.2 summarise the results from each transfection.

138

(A) (B) n s n s 4 0 0 n s

5 0 0 n s n o i n

s **** o i

s 3 0 0 4 0 0 s e r s ** ) e p r x U ) p

3 0 0 e L

U 2 0 0 e e R L

( s

e R a ( s

2 0 0 r a e r f

i 1 0 0 e f c i u c 1 0 0 u L L 0 0 5 5 b b R T 5 5 b b R T 5 5 5 5 T N 5 5 5 5 /1 /1 2 2 1 1 2 T N 1 1 Ú A / / 2 Ú A R T / / 3 T T /1 /1 T R 3 T T N R S U T N R T U Ú A T N Ú T N N O M A U M 3 T Ú A 3 T Ú A 3 T .F R 3 T -J R S U N U M S U C T N U C T O Ú U M Ú F O M J U M . R 3 - R J 3 T .F R C T - R C S T N Ú C T Ú C U 3 Ú O 3 Ú J 3 .F 3 - S N S C U N C O J U .F O - J F C - C . C C

Figure 4‎ .17. Inhibition the C-JUN and C-FOS 3’UTR-luciferase upon transfection of HEK293 cells with miR-155 but not miR-125b HEK293 cells were seeded in 96 well plates (each treatment in triplicates) and allowed to proliferate until 80% confluency. The cells were then serum starved for 6h and then the cells were co-transfected overnight with the (A) C-JUN or (B) C-FOS 3’UTR-luciferase reporter-plasmid and either the miR-155 or miR-125b microRNA, as indicated. 24 h post transfection, the cells were stimulated with 10% FBS v/v for 24 h and the washed plates were then transferred to -80◦c for 1 h for cell lysis. Luciferase assay was performed on these cells using the Light Switch Assay System (Switchgear genomics) and reading the plates as per manufacturer’s instructions. This data set is a representative of three independent experiments ± standard error of the mean (SEM). Statistical significance was determined using an uncorrected fisher’s LSD test where a value of p<0.05 was considered statistically significant where ** and **** indicates p < 0.01 and p < 0.0001 respectively. ns; not significant, UTR; untranslated region.

139

(A) (B) n s n s 6 0 0 n s n s 6 0 0 n s

n s n n o i o i s s s s e e r 4 0 0

r 4 0 0 ) p ) p x U x U e L e

e R e R ( s (

a a r 2 0 0 r 2 0 0 e e f f i i c c u u L L 0 0 5 5 b 5 5 b b R T b R T 5 5 5 5 5 5 5 5 T N 1 1 2 T N 1 1 2 2 / / 2 Ú A / / 1 1 Ú A T /1 /1 R T / / 3 T R 3 T T T N R T U T N R S U N Ú T N Ú A T N M A O M 3 T Ú A U 3 T Ú A 3 J 3 T .F R N U T - R S U U C T M S U C T U M N O Ú J U M Ú F O M - R 3 . R 3 J T .F R C T - R N C S Ú C T Ú C T U 3 Ú O 3 Ú J F 3 - S 3 . N C U N C O S J U F O - J . F C - C . C C

Figure 4‎ .18. No Inhibition of the C-JUN and C-FOS 3’UTR-luciferase upon transfection of MM200 cells with miR-155 or miR-125b MM200 cells were seeded in 96 well plates (each treatment in triplicates) and allowed to proliferate until 80% confluency. The cells were then serum starved for 6h and then the cells were co-transfected overnight with the (A) C-JUN or (B) C-FOS 3’UTR-luciferase reporter-plasmid and either the miR-155 or miR-125b microRNA, as indicated. 24 h post transfection, the cells were stimulated with 10% FBS v/v for 24 h and the washed plates were then transferred to -80◦c for 1 h for cell lysis. Luciferase assay was performed on these cells using the Light Switch Assay System (Switchgear genomics) and reading the plates as per manufacturer’s instructions. This data set is a representative of three independent experiments ± standard error of the mean (SEM). Statistical significance was determined using an uncorrected fisher’s LSD test where a value of p<0.05 was considered statistically significant. ns; not significant, UTR; untranslated region.

140

(A) (B)

4 0 0 n s 5 0 0 n s n s n s n s n n o o

i i ** 4 0 0 s s

s 3 0 0 s e e r r ) ) p p 3 0 0 x x U U e e L L 2 0 0 e e R R ( ( s s

2 0 0 a a r r e e f f

i 1 0 0 i

c c 1 0 0 u u L L 0 0

5 5 b b s T 5 5 b b s T 5 5 5 5 D 5 5 5 5 D 1 1 2 2 N 1 1 2 2 N / / 1 1 C A / / 1 1 C A s T / / T s T / / T D N s T N U D N s T N U C A D N U C A D N U C J M C J M N T A - N T A - U T C s U T C s U N D U N D J M U U J M U U - J M C - J M C C s - C s - D C s N D C s N C D U C D U C J C J N - N - U N C U N C J U J U - J - J C - C - C C

Figure 4‎ .19. Inhibition the C-JUN CDS-luciferase upon transfection of MM200 cells with miR-125b and no effect on HEK293 cells (A) HEK293 and (B) MM200 cells were seeded in 96 well plates (each treatment in triplicates) and allowed to proliferate until 80% confluency. The cells were then serum starved for 6h and then the cells were co-transfected overnight with the C-JUN CDS-luciferase reporter-plasmid and either the miR-155 or miR-125b microRNA, as indicated. 24 h post transfection, the cells were stimulated with 10% FBS v/v for 24 h and the washed plates were then transferred to -80◦c for 1 h for cell lysis. Luciferase assay was performed on these cells using the Light Switch Assay System (Switchgear genomics) and reading the plates as per manufacturer’s instructions. This data set is a representative of three independent experiments ± standard error of the mean (SEM). Statistical significance was determined using an uncorrected fisher’s LSD test where a value of p<0.05 was considered statistically significant were ** indicate p<0.01. ns; not significant, CDS; coding sequence.

141

(A) (B) 4 0 0 n s n s n s n s n

o 6 0 0 n s i n s n s n s s n

s 3 0 0 o i e r s ) s p e x U

r 4 0 0 e ) L

2 0 0 p x e U R ( e s L

a e R r ( s

e a f r i 1 0 0 2 0 0 e c f i u c L u

0 L 0 d 5 b 1 5 b R i 5 5 R 5 5 1 2 1 2 O m 5 b 1 5 b id / G / s 5 5 5 5 R 1 /1 1 T 1 R O m E R / C a / 2 /1 2 R 1 R l 1 1 G 1 T s O E P / E R / a G R T O R 1 R C l G V o R O E P E C T G T O V E E C Y N E G C T o V E T E E C Y N V P V E T Y V P M Y T Y E M P T T Y E P P T M M P E M E M E E

Figure 4‎ .20. No Inhibition the EGR1 3’UTR-luciferase upon transfection of HEK293 and MM200 cells with miR-155 or miR-125b (A) HEK293 and (B) MM200 cells were seeded in DMEM media in 96 well plates (each treatment in triplicates) and when they reached 80% confluently, media was removed and replaced with fresh FBS free media. . After 6 h of serum starvation, cells were co-transfected overnight with the EGR1 3ÚTR- luciferase reporter-plasmid and either the miR-155 or miR-125b microRNA, as indicated. 24 h post transfection, the cells were stimulated with 10% FBS v/v for 24 h and the washed plates were then transferred to -80◦c for 1 h for cell lysis. Luciferase assay was performed on these cells using the Light Switch Assay System (Switchgear genomics) and reading the plates as per manufacturer’s instructions. This data set is a representative of three independent experiments ± standard error of the mean (SEM). Statistical significance was determined using an uncorrected fisher’s LSD test where a value of p<0.05 was considered statistically significant. ns; not significant, UTR; untranslated region.

142

Table 4‎ .1. Summary of effects of miR-155/miR-125b transfection on C-JUN/C-FOS-luciferase reporter construct in HEK293 cells Plasmid Luciferase expression in HEK293 Luciferase expression in cells after transfection with miR- HEK293 cells after 155 transfection with miR-125b

C-JUN 3ÚTR Lower expression compared to C- No difference in expression JUN 3ÚTR (mutated) compared to C-JUN 3ÚTR

(mutated)

C-FOS 3ÚTR Lower expression compared to C- No difference in expression FOS 3ÚTR (mutated) compared to C-FOS 3ÚTR

(mutated)

C-JUN CDs No difference in expression No difference in expression compared to C-JUN CDs compared to C-JUN CDs

(mutated) (mutated)

EGR1 3ÚTR No effect No effect

(negative control)

Empty plasmid No effect No effect

(negative control)

C-JUN 3ÚTR (mutated) Greater expression compared to No difference in expression C-JUN 3ÚTR compared to C-JUN 3ÚTR

C-FOS 3ÚTR (mutated) Greater expression compared to No difference in expression C-FOS 3ÚTR compared to C-FOS 3ÚTR

C-JUN CDs (mutated) No difference in expression No difference in expression compared to C-JUN CDs compared to C-JUN CDs

No Plasmid No expression No expression

143

Table 4‎ .2. Summary of effects that miR-155/miR-125 have on C-JUN/C-FOS in MM200 cells Plasmid Luciferase expression in MM200 Luciferase expression in after transfection with miR-155 MM200 after transfection with miR-125b

C-JUN 3ÚTR No difference in expression No difference in expression compared to C-JUN 3ÚTR compared to C-JUN 3ÚTR

(mutated) (mutated)

C-FOS 3ÚTR No difference in expression No difference in expression compared to C-FOS 3ÚTR compared to C-FOS 3ÚTR

(mutated) (mutated)

C-JUN CDs No difference in expression Lower expression compared to compared to C-JUN CDs C-JUN CDs (mutated)

(mutated)

EGR1 3ÚTR No effect No effect

(negative control)

Empty plasmid No effect No effect

(negative control)

C-JUN 3ÚTR (mutated) No difference in expression No difference in expression compared to C-JUN 3ÚTR compared to C-JUN 3ÚTR

C-FOS 3ÚTR (mutated) No difference in expression No difference in expression compared to C-FOS 3ÚTR compared to C-FOS 3ÚTR

C-JUN CDs (mutated) No difference in expression More expression compared to compared to C-JUN CDs C-JUN CDs

No Plasmid No expression No expression

144

4.2.6 Down-regulation of C-JUN and C-FOS inhibits HEK293 and MM200 cell migration C-JUN and C-FOS have been reported to promote cell migration 344, 345. Thus, the effect of down-regulation of C-JUN and C-FOS has on cell migration was measured using scratch migration assays. Scratch migration assays were initially performed to measure the ability of HEK293 and MM200 cells to migrate in the presence of FBS and mimic microRNAs (miR-155 and miR-125b). Experiments were performed using the same conditions for the miRNA transfections (section 4.2.3.2). Cell migration was measured by counting the number of cells that invade cell free areas created by scratch injury. Inhibition of migration was observed in HEK293 cells treated with miR-155 (fig 4.22) compared with cells that were treated with miR-125 (fig 4.22), or pre-CTL, or anti-CTL (fig 4.23). Interestingly, migration was inhibited in MM200 cells treated with miR-155 and miR- 125b (fig 4.22), compared with cells treated with pre-CTL or anti-CTL (4.23). Figure 4.21 represents HEK293 cells (A) and MM200 cells (B) that were scratched injured and unstimulated.

145

(A)

(B)

Figure 4‎ .21. Time 0 to confirm starting wound/scratch size in HEK293 and MM200 cells HEK293 (A) and MM200 (B) cells were seeded in DMEM media in 6 well plates, and serum starved when they reached 80% confluency. The dishes of cells were scratched injured. After 24 h, the cells were washed and visualized under microscope. This is a representative of one of three independent experiments.

146

(A) (B)

(G) (H)

Figure 4‎ .22. Inhibition of migration in HEK293 and MM200 cells transfected with miR-155 versus miR-125b HEK293 (A-D) and MM200 (E-H) cells were seeded in DMEM media in 6 well plates, and serum starved when they reached 80% confluency. After 6 h of serum starvation, cells were transfected overnight with (A) (E) miR-155 or (B) (F) miR-125b or (C) (G)2ÓM-155 or (D) (H) 2ÓM-125b. 24 h post transfections, the dishes of cells were scratched injured and then serum stimulated for 24 h. After 24 h, the cells were washed and visualized under microscope. This is a representative of one of three independent experiments. 2ÓM; 2’-O-conjugated methyl group that block the addition of uracil (U) residues, thus, miRNA degradation.

147

(A) (B)

1 .5 1 .5

** a * a ** * e e * r r

A 1 .0 A 1 .0

d d e e t t a a r n s r g g i 0 .5 i 0 .5 m m n n U U

0 .0 0 .0 l l y S S l 5 5 b b y S S l 5 5 b b l o o 5 5 l o o 5 5 n B B r tr 5 5 n B B r tr 5 5 F t 1 1 2 2 F t 1 1 2 2 O F n n R - 1 1 O F n n R - 1 1 + o i - + o i - s o a o M R s o a o M R l N c C m i M l N c C m i M l m - - - Ó l m - - - Ó e + r e ti e 2 -m Ó e + r e ti e 2 -m Ó C a a r n r e 2 C a a r n r e 2 m h P A P r m h P A P r r D P r D P a + a + h s h s D ll D ll + e + e s s ll C ll C e e C C

Figure 4‎ .23. Effect of miRNA transfection on the un-migrated area in HEK293 and MM200 after scratch injury. (A) HEK293 and (B) MM200 cells were seeded in 6 wells plate, when they are 80% confluent, DMEM media was removed and added new media with no FBS and cells were serum starved. After 6 h of serum arrest, cells were transfected overnight as indicated on the X-axes; cells alone (HEK293 (no FBS)) or (MM200 (no FBS), HEK293+vehicle (no FBS) or MM200+vehicle (no FBS) (cells + Dharma + no FBS), HEK293+vehicle+FBS or MM200+vehicle+FBS (cells + Dharma +FBS), cells + DharmaFECT1 + Pre-control (Pre-Control), cells + DharmaFECT1+ anti-Control (Anti-Control),cells + DharmaFECT1 + miR-155 (Pre- miR155), cells + DharmaFECT1 + anti-sense of miR-155 (2Óm-155) cells + DharmaFECT1 + miR-125b (Pre-miR125b), and cells + DharmaFECT1 + anti-sense of miR-125b (2Óm-125b). 24 h post transfection, the cells were scratched injured and then stimulated for 24 h with 10% FBS v/v except for cells alone and one of the cells alone + DharmaFECT1 samples. Followed by two washes of DPBS plate were put under microscope and checked for migration. The graphs are data from three independent experiments performed in triplicate ± SEM. The empty area into which the cells didn’t migrate was measured using image J. Statistical significance was determined using an uncorrected Fisher’s LSD test. A value of p<0.05 was considered statistically significant where *, and ** indicates p < 0.05 and p < 0.01 respectively. ns; not significant

148

4.2.7 Inhibition of C-JUN and C-FOS in HEK293 and MM200 blocks cells in the G1 phase of the cell cycle Cell cycle analysis quantifies the number of cells in each phase of the cell cycle using flow cytometry. This technique employs the use of the fluorescent dye, propidium iodide346, 347, which stains each cell’s DNA and the fluorescent intensity is proportional the amount of DNA in the cell. This allows for the discrimination of the various stages of the cell cycle based on differential DNA content. 348. Cell cycle analysis was employed to investigate the effect of inhibiting C-JUN and C- FOS, by miR-155 and miR-125b, in HEK293 and MM200 cells after serum stimulation. In HEK293 cells, populations that were treated with miR-155 (Fig 4.24) accumulated in the S phase compared with cells that were treated with miR-125b, or anti-sense miR155, or anti- sense miR125b, or pre-CTL, or anti-CTL. Additionally, MM200 cells that were treated with miR-155 or miR-125b (Fig 4.25), accumulated in the S phase compared with populations treated with anti-sense miR155, or anti-sense miR125b, or pre-CTL, or anti-CTL.

149

(A) (B) (C) e e e s s s 10 * * a a a 50 25 h h h p p p

2 1 S 8 40 20 G G n

n n i i s

l l s s 6 l l

30 e 15 l l e e C

f C C

o f f 20 4 10 o o e

g e e a g g t a a 2 n t t 10 5 e n n c e e r c c e r r 0 0 0 P e e L L 5 5 b b P P L L 5 5 b b T T 5 5 5 5 L L 5 5 b b T T 5 5 5 5 C C -1 -1 2 2 T T 5 5 5 5 C C -1 -1 2 2 . - 1 -1 C C -1 -1 2 2 . - 1 1 e ti iR M - . i- -1 -1 e ti iR M - - r n Ó iR M e t iR M r n Ó iR M P m 2 Ó r n Ó iR M P m 2 Ó A m 2 P m 2 Ó A m 2 A m 2

Figure 4‎ .24. G1, S and G2 phases of HEK293 after miR155 or miR-125b transfection HEK293 cells were seeded in DMEM media in 6 well plates and serum starved when they reached 80% confluency. After 6 h of serum starvation, cells were transfected overnight with cells + DharmaFECT1 + Pre-control (Pre-CTL), cells + DharmaFECT1+ anti-Control (Anti-CTL),cells + DharmaFECT1 + miR-155 (miR155), cells + DharmaFECT1 + anti-sense of miR-155 (2Óm-155) cells + DharmaFECT1 + miR-125b (miR-125b), and cells + DharmaFECT1 + anti-sense of miR-125b (2Óm-125b).. 24 h post transfection, the cells were serum stimulated for 24 hand then collected, fixed and assayed for cell cycle using flow cytometry. Data presented are pooled from three independent experiments ± SEM. (A) Percentage of cells in the G1 phase, (B) percentage of cells in the S phase, (C) percentage of cells in the G2 phase. Statistical significance was determined using an uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant were * indicates p<0.05.

150

(A) (B) (C) e e e s s s 8 * * a a 60 a 40 h h h p p p

** **

2 1 S

G G

n 6

i 30

n n i i s

40 l l s s l l e l l e e C 4 20 f C C

o f f

o o e

20 g e e a g g 2

t 10 a a n t t e n n c e e r c c e r r 0 0 0 e e P L L 5 5 b b P P L L 5 5 b b T 5 5 5 5 L L 5 5 b b T T 5 5 5 5 T 1 1 2 2 T T 5 5 5 5 C 1 1 2 2 C -C - - 1 1 C C -1 -1 2 2 . -C - - 1 1 . i R M - - . - 1 1 e ti iR M - - re t i R M e ti iR M - - r n Ó iR M P n m Ó i r n Ó iR M P m 2 Ó A 2 m Ó P m 2 Ó A m 2 2 A m 2 B

Figure 4‎ .25. G1, S and G2 phases of MM200 after miR155 or miR-125b transfection MM200 cells were seeded in DMEM media in 6 well plates and serum starved when they reached 80% confluency. After 6 h of serum starvation, cells were transfected overnight with cells + DharmaFECT1 + Pre-control (Pre-CTL), cells + DharmaFECT1+ anti-Control (Anti-CTL), cells + DharmaFECT1 + miR-155 (miR155), cells + DharmaFECT1 + anti-sense of miR-155 (2Óm-155) cells + DharmaFECT1 + miR-125b (miR-125b), and cells + DharmaFECT1 + anti-sense of miR-125b (2Óm-125b). 24 h post transfection, the cells were serum stimulated for 24 hand then collected, fixed and assayed for cell cycle using flow cytometry. Data presented are pooled from three independent experiments ± SEM. (A) Percentage of cells in the G1 phase, (B) percentage of cells in the S phase, (C) percentage of cells in the G2 phase. Statistical significance was determined using an uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant were * and ** indicates p<0.05 and p<0.01 respectively.

151

4.2.8 Effect of C-JUN and C-FOS inhibition on HEK293 and MM200 proliferation Proliferation assay is a technique used to measure cells capability to proliferate after a treatment. Pre-CTL and anti-CTL have been used as negative control treatments to compare with the proliferation of the miRNA transfected HEK293 and MM200 cells and highlight the negative effect these miRNAs have on proliferation. C-JUN and C-FOS have been reported to contribute to cell proliferation337, 349, therefore, a proliferation assay was performed to investigate the effect of inhibiting C-JUN and C-FOS by miR-155 and miR-125b in HEK293 and MM200 cells after serum stimulation. HEK293 cells treated with miR-155 were shown to have a decreased proliferative profile compared with cells treated with miR-125, or anti-sense miR155, or anti-sense miR125b, or pre-CTL, or anti-CTL (Fig 4.26). Additionally, MM200 cells that were treated with miR-155 or miR-125b had a reduced rate of proliferation compared with cells treated with anti-sense miR155, or anti-sense miR125b, or pre-CTL, or anti-CTL (Fig 4.26). These results correlate with the cell cycle experiments in HEK293 and MM200 (section 4.2.7).

152

(A) * 500 ns 400 **** r e b 300 m u N

l 200 e C 100

0 L L 5 5 b b T 5 5 5 5 T 1 1 2 2 -C -C R R 1 1 e ti i i R R r n m m i i P a - - m m re e - - P m re e 'O p m 2 'O 2

(B) 1000 **** **** 800 r e b 600 m u N

l 400 e C 200

0 L L 5 5 b b T 5 5 5 5 T 1 1 2 2 -C -C R R 1 1 e ti i i R R r n m m i i P a - - m m re e - - P m re e 'O p m 2 'O 2

Figure 4‎ .26. Proliferation of HEK293 and MM200 after transfection with miR-155 and miR- 125b (A) HEK293 and (B) MM200 cells were seeded in 6 wells plate and serum starved when they were 80% confluent. After 6 h of serum arrest, cells were transfected overnight with cells + DharmaFECT1 + Pre-control (Pre-CTL), cells + DharmaFECT1+ anti-Control (Anti-CTL), cells + DharmaFECT1 + miR- 155 (miR155), cells + DharmaFECT1 + anti-sense of miR-155 (2Óm-155) cells + DharmaFECT1 + miR- 125b (miR-125b), and cells + DharmaFECT1 + anti-sense of miR-125b (2Óm-125b). 24 h post transfection, the cells were serum stimulated for 24 h. The cells were washed and trypsinized and cell suspension transferred to 15 ml falcon tubes and analysed on the coulter counter. The presented data is a representative data of three independent experiments ± SEM. Statistical significance was determined using uncorrected Fisher’s LSD test and a value of p<0.05 was considered statistically significant where *and**** indicates p<0.05 and 0.0001 respectively. ns; not significant

153

4.3 Discussion miRNAs are an abundant class of short (17 to 25 nt) non-coding single-stranded RNAs that are significant regulators of cellular gene expression331. Targeting the seed region along with the 5’end of miRNA binds to the complementary sequences of the mRNA tails (3’ untranslated region). The strength of this binding depends on the sequence and complementary seeds numbers. This binding results is the assembly of a silencing complex which modulates mRNA expression. The majority of miRNAs cause a reduction in mRNA of their target which results in less protein. At present, there are about 1000 known functional human miRNAs , and each can be targeting 100 to thousands of human genes350. Serum stimulation of cancer cells has been shown to induce positive regulatory transcription factors, such as C-JUN, C-FOS and EGR1228, 302, 304, as well as increasing transcriptional repressors such as YY1, NAB2 and GCF2290-292. These transcription factors have been associated with cancer disease phenotypes 334. In order to understand the mechanism of cancer disease and the pathway associated with cancer, identification of miRNAs that control mRNAs transcription factors have recently become a priority. miRNAs, that have the potential of treating cancer, represent possible pharmaceutical therapies. The aim of this project was to identify and profile microRNAs that interact with the mRNA of transcription factors such as C-JUN and C-FOS.

4.3.1 Expression profile of C-JUN, C-FOS and EGR1 in serum arrested HEK293 and MM200 cells In this study, I have demonstrated that the expression of the proto-oncogenes C- JUN, C-FOS and EGR1 at the RNA and protein levels are stress inducible in HEK293 and MM200 cells. C-JUN and C-FOS transcription factors are known to be involved in pathway for cancerigenesis and are main targets for determining disease pathways. C-JUN, C-FOS and EGR1 mRNA expression is up-regulated in serum-arrested HEK293 and MM200 cells within 15 min of serum stimulation, peaking at 1 h. Moreover, they were expressed over a 6 h time frame. The expression of C-JUN, C-FOS and EGR1 protein also peaked at 1-2 h post serum- stimulation and C-JUN, C-FOS and EGR1 stress induced protein expression was maintained for 6 h. Thus, C-JUN, C-FOS and EGR1 are readily expressed in cellular stress conditions and rapidly translated in HEK293 and MM200 cells.

154

Increased transcription and translation of C-JUN is reported to contribute to cell differentiation in a retinoic acid-treated teratocarcinoma cell line287. Furthermore, changes in mRNA expression of C-JUN, upon differentiation, appears to be lineage specific as C-JUN mRNA levels were shown to increase upon differentiation of the acute myeloid leukemia HL60 cells to macrophages but not upon differentiation to granulocytes351.

4.3.2 Expression profile of miR-155 and miR-125b in serum arrested HEK293 and MM200 cells In this study, I have demonstrated that miR-155 and miR-125b expression is not induced by stress in HEK293 and MM200 cells. miR-155 and miR-125b expression did not change in serum starved HEK293 and MM200 cells within 6 h of serum stimulation. Thus, miR-155 and miR-125b are not expressed in cellular stress conditions in HEK293 and MM200 cells, in this in vitro system. Since miR-155 has homology to the C-JUN and C-FOS 3ÚTR 158, there is a high chance that C-JUN and C-FOS are expressed in HEK293 and MM200 cells as miR-155 is not expressed in these cell lines. Moreover, miR-125b has homology to C-JUN CDS 159 and miR-125b is not expressed in HEK293 and MM200 cells. Together, this strengthens the hypothesis that C-JUN is expressed in these two cell lines due to miR-125b being not expressed.

4.3.3 Efficiency of miR-155 and miR-125b in down-regulating stress induced C-JUN and C- FOS in HEK293 and MM200 Transfection of HEK293 and MM200 cell lines with miRNAs and anti-sense miRNAs were conducted to test the effectiveness of miRNAs in inhibiting gene expression at the post transcriptional level. Protein levels were down-regulated, probably through degradation of mRNA or through binding the microRNA to its target mRNA and thus preventing translation352. In this study, we were able to show that the expression of C-JUN and C-FOS protein were down-regulated, specifically in HEK293 cells with miR-155 and C-JUN protein expression by miR-125b in MM200 cells. At the RNA level, there were no changes of expression of C-JUN and C-FOS indicating that ,in this case, the microRNAs are binding to their target mRNA and preventing translation of the mRNA rather than via degradation of the mRNA265.

155

4.3.4 Targeting C-JUN and C-FOS would be beneficial in inhibiting cell growth In response to chemical signals, cell proliferation can lead to the migration of cells. In order for cells to proliferate, they must progress through the cell cycle353. As mentioned in section 4.3.1, C-JUN and C-FOS promote cellular migration and proliferation. In this study, I have demonstrated that miR-155 and mir-125b inhibit cellular proliferation and migration. Given the homology between miR-155 and c-Jun and c-Fos, and between miR-125b and c- Jun, the mechanism for this probably relies on the ability of miR-155 and miR-125b to interact with C-JUN and C-FOS. Furthermore, the fact that there was inhibition of protein expression but not on mRNA expression of both c-Jun and c-Fos, our results indicate that miR-155 and miR-125b block C-JUN and C-FOS protein expression, which in turn prevents cell migration and proliferation. These effects are being controlled through miR-155 and miR-125b by changing the capability of C-JUN and C-FOS to interact with extracellular stimuli.

4.3.4.1 C-JUN and C-FOS role in migration of the cells The production of growth factors is essential for regulating various cellular processes such as cell migration, proliferation and differentiation 354. Cells migrate via a highly complex method which includes cytoskeleton and focal adhesion alteration355. Extracellular cues, such as cytokines and growth factors, stimulate cytoskeleton polarization and control cell migration. Once actin filaments (F-actin) are polymerized at the primary edge of the cell, the cell membrane is extended (filopodia and lamellipodia)356. Actin is usually joined with cell adhesion molecules and they usually introduce the lamellipodia to the extra cellular matrix (ECM). Filopodia usually extend out from lamellipodia and are known to play a role in extracellular sensing357. The scratch migration assay is used to directly determine capability of cells to migrate 358. In this study, scratch migration assay was employed to demonstrate the potential of C-JUN and C-FOS targeting method in inhibiting HEK293 and/or MM200 to migrate. Inhibition of C-JUN and C-FOS protein expression in HEK293 and MM200 cells, with miR-155 and miR-125b, was shown to have an effect on the ability of HEK293 and MM200 cells to migrate. miR-155 was shown to inhibit C-JUN and C-FOS protein expression in HEK293 but not in MM200 cells, however, miR-155 has shown to inhibit MM200 migration. This may be due to targeting other genes that play role in migration of the cell and have complementary sequence with miR-155.

156

4.3.4.2 C-JUN and C-FOS role in proliferation of HEK293 and MM200 Disruption to the cell cycle through such mechanisms as the overexpression of genes which promote cell growth or the reduced expression of genes which inhibit cell growth, can lead to uncontrolled cellular proliferation, a characteristic of cancer cells359. The transfection of HEK293 and MM200 cells with miR-155 and miR-125b, resulted in decreased proliferation, which was also shown to inhibit C-JUN and C-FOS protein expression, suggest that C-JUN and C-FOS play an important role in the survival of HEK293 and MM200 cells. Moreover, our results identifiy C-JUN and C-FOS as stress response factors in these two cell lines, indicated by the fact that they are induced after the cells are serum starved and stimulated (Fig. 4.3 and 4.4). Similarly, my results show the importance of C-JUN and C-FOS in the progression of the cell from G1 phase to S and G2 phase (Fig. 4.23 and 4.24). Cells transfected with miR- 155 and miR-125b were shown to be stalled in S phase and did not progress to the G2 phase. C-JUN and C-FOS has previously been demonstrated to have role in the progression of cells through the G1 phase 360. Additionally, miR-125b has been shown to induce cellular senescence, however the mechanism behind this phenomenon is unknown361. miR-125b’s functional role is cell specific, demonstrated by the fact that it works as tumour suppressor in some cell lines and could also negatively regulate the tumour suppressor, p53, in other cell lines362. In this study, miR-125b inhibited C-JUN at the protein level in MM200 but not in HEK293. This confirms that miR-125b functional role is cell specific which may decrease its usefulness as a therapeutic agent for cancer disease. miR-155 is a multifunctional miRNA which has been attributed to cellular inflammation, immunity and carcinogenesis363, 364 . In this study, we demonstrated that miR- 155 supresses C-JUN and C-FOS protein expression in HEK293 cells. C-JUN and C-FOS form the AP-1 active complex 365 which, in turn, stimulates matrix metalloproteinase (MMP)-1, 2 and 3 transcription and induces extracellular matrix protein degradation 366. Moreover, AP-1 active complex will inhibit type I and III procollagen expression158. Thus, miR-155 inhibition of C-JUN and C-FOS protein expression will inhibit the formation of the AP-1 complex which could be expected to inhibit cellular differentiation, proliferation and apoptosis367-369, therefore, inhibiting the development and spread of cancer.

157

4.4 Conclusion The results obtained in this study illustrate that miR-155 and miR-125b function as C- JUN and C-FOS inhibitors. miR-155 directly inhibits C-JUN and C-FOS in HEK293 cells at the translational level and miR-125b inhibits C-JUN in MM200 cells at the translational level. These finding show that miRNA mimic and anti-sense miRNA could be targeted for therapy. However, the pathways related for each microRNA need to be studied and investigated in depth to identify which pathway of therapeutic relevance are being targeted by which microRNA. Thus, miRNAs could be a potential for anti-cancer therapy.

158

5 Chapter 5: Drug development for targeting transcription factors

Acknowledgements:

Kylie Taylor (School of Medical Sciences, University of New South Wales, NSW, Australia) tested a series of compounds (X4, X6, X7, BT2 and BT3), derived from a lead compound X, on their ability to inhibit transcription factors in the melanoma cell line ME1007.

159

5.1 Introduction Drug discovery involves identifying new candidate treatments to target a particular disease 370. The process of drug discovery comprises screening a range of compounds, medicinal chemistry, taking into consideration oral bioavailability, metabolic constancy, efficiency, selectivity and affinity to a specific target 371. If a compound of interest meets all these requirements, the drug development phase commences followed by clinical trials 372. In drug development or pre-clinical phase, a new chemical compound is discovered and its function is explored through testing its effects in vitro (cell line model) and in vivo (animal experiments). Drug discovery relies heavily on business investors such as large pharmaceutical companies. Even with current technology advancing continuously, and our deep understanding of biological systems, the process of drug discovery is expensive, challenging and time consuming 373 374. Moreover, the rate of drug discovery is low compared to time and money consumed. Drug molecule efficiency in the human body is mediated by precise interactions between the compound and biological macromolecules such as proteins and nucleic acids, thus, drug discovery is complicated and there are many things to consider 375 376.

Drug targets can be cellular or molecular structures, which are involved in the disease of interest and may interact with the drug compounds 377. A target can be “new” or “established” depending on the present scientific understanding of the target’s function in health and disease 378 379. An established target is identified based on a deep understanding of the functional information of a target whilst new targets are proteins that are newly discovered or their function have been recently understood 380.

Finding a new drug typically includes high throughput screening (HTS) of vast libraries of chemical compounds which are checked for their proficiency to interact with the target 381. For instance, if a G-protein-coupled receptor (GPCR) is a target of interest, the efficiency of the drug compound to inhibit the downstream pathway of the GPCR will be evaluated. Another example is illustrated in the inhibition of protein kinases by drug compounds targeting protein kinase activity. HTS also identifies the specificity of screened compounds; a molecule that only interferes with the desired target is ideal382. Subsequent to HTS, drug compounds are screened for off-target interactions, known as cross-screening.

160

Off-target effects increase the possibility of toxicity during the clinical trials phase hence cross-screening is vital in drug discovery 383 384.

Alternatively, the development of a drug can start using a known molecule with favourable characteristics for disease treatment. The development often involves alterations to increase specificity, efficacy, and stability or decrease off-target interactions to improve the existing compound and, thereby, generating a new drug molecule 385.

Virtual high throughput screening is another method used in drug discovery, which involves a computer-generated model being used for screening and associating existing drugs to a target. On the other hand, designing a drug is crucial in the process of drug discovery, as the biological and physical properties of the target are studied in depth, with the assumption that the type of compounds generated from the screening process will fit into target. Generated compounds that meet all drug prerequisites such as selectivity to a desired target and efficiency, proceed to the drug development phase (cell lines models and animal experiments) 386 387.

Known compound structures are stored in a database to facilitate the discovery of newly identified compounds388. Hence Mass spectrometry (MS) was employed in this study. Mass spectrometry (MS) approach determines the structure of a compound and its chemical activity. Each compound is usually identified and analysed on their mass/charge ratio 389 390. Chemical compounds often exist in nature as a mixture, thus separating them is usually performed using a combination of liquid chromatography and mass spectrometry.

An integrative analysis which typically functions through evaluating cancer transcriptome data in the context of other data sources, such as proteome or kinome, is known to be very beneficial to understand the insights of biological function from such data 391. In this study, an integrative analysis of data generated from microarray, kinome and iTRAQ approaches to understand the biological function of compound X and its derivatives, was attempted.

In this chapter, a series of compounds (X4, X6, X7, BT2 and BT3), derived from a lead compound X, had their ability to inhibit transcription factors tested in the melanoma cell line ME1007; these transcription factors have been generally accepted as playing a

161 significant role in the occurrence of melanoma. ME1007 cell line was used in this project because it was already being used in in vivo models in the laboratory and had already been optimised for these experiments by another member of the laboratory. As I was familiar with the bioinformatics analysis of the data, my role in the project was the described bioinformatics analysis of the RNA and protein expression data.

The details of the compounds and their structures are not available to the candidate because of commercial in confidence issues, with the patents not finalised and not owned by the candidate. No appropriate control in a drug development project can be used as it is new drugs that are being developed. Only a comparison with a drug used for the same disease in clinic can be done such as GSK1120212. A high throughput screen (HTS) for the identification of small molecule inhibitors has been employed and compound X has been discovered by one of the members of the transcription and gene targeting group at UNSW. An alteration was initiated on the structure of compound X and a number of compounds were derived (X4, X6, X7, BT2 and BT3).

While I did not carry out the HTS for the discovery of compound X (and its derivatives), I carried out the bioinformatics analysis of the RNA and protein expression data.

162

5.2 Results The results presented are a preliminary bioinformatics analysis but already identify key areas of interest for further study.

5.2.1 Microarray analysis of X4 and X6 compounds on ME1007 cell line The melanoma cell line, ME1007, was used as an in vitro model for microarray studies. Compounds X4 and X6 were tested for their effects on the expression of serum stimulated genes since this set of genes is reliably induced through serum stimulation. Thus, the impacts of these compounds have on the up-regulation or down-regulation of the serum induced gene expressions in ME1007 cell line can be readily identified. Dimethyl sulfoxide (DMSO) was used as a negative control as all compounds are dissolved in DMSO, to ensure that the observed effects were specific for the compound rather than for DMSO.

The genes whose mRNA expression levels were affected by treatment with X4 and X6 in the ME1007 cell line, was determined by microarray analysis (Gene Array 2.1 St). ME1007 cells were serum arrested to ensure minimal transcription of genes. ME1007 cells were treated with compound X4 or DMSO, for 1 h prior to serum stimulation, which was performed to ensure that both compounds entered the cells and to observe their effects on immediate early genes (IEGs) once they were stimulated. Serum stimulation (growth medium plus 10% FBS) was maintained for 1 h or 24 h. Total RNA was then extracted and microarray performed and the generated data analysed. The effect of compound X4 in the microarray analysis was compared with those of the DMSO control at 1 h (Fig. 5.1 A). Changes in expression were detected for 112 genes down-regulated and 115 up-regulated (Appendix 7.8-9), using a threshold of ≥1.5 fold-change. Generated data from microarray was analysed and compound X4 effects were also compared with DMSO at 24 h (Fig. 5.1 B). Changes in expression were detected for 70 genes down-regulated and 99 genes up- regulated (Appendix 7.10-11), using a threshold of ≥1.5 fold-change. None of the genes that have been down-regulated or up-regulated using X4 compounds at 1 and 24 h post serum stimulation are associated with melanoma progression. This was established through the usage of David bioinformatics database resources 6.7. By entering the reference sequences for each gene that resulted from the microarray experiment on this tool, a table with all the pathways that are associated with this gene is created.

163

1 5(A0 )

1 0 0 s e n

e 5 0 g

f o

0 r e b -5 0 m u

N -1 0 0

-1 5 0 U p -re g u la te d D o w n -re g u la te d

(B) 1 5 0

s 1 0 0 e n e g

5 0 f o

e 0 b m u

N -5 0

-1 0 0 U p -re g u la te d D o w n -re g u la te d

Figure 5‎ .1. Effects of compound X4 (versus DMSO) on induced expression after 1 and 24 h of serum stimulation in the ME1007 melanoma cell line ME1007 cells were seeded in a 96 well tissue culture plate. Upon reaching 80% confluence, the cells were serum starved for 24 h. Cells were then treated with 0.5μM of compound X4 or DMSO for 1 h then serum stimulated for (A) 1 h or (B) 24 h. RNA was then isolated and the samples sent to Ramaciotti Centre for Genomics at the University of New South Wales, for microarray analysis

164

Serum starved ME1007 cells were similarly treated with X6 compound or DMSO for 1 h and subsequently stimulated for 1 h or for 24 h using growth medium 10% (v/v) FBS. Total RNA was then extracted and purified for microarray analyses of gene expression, comparing the effect of X6 compound to DMSO at 1 h and 24 h (Fig. 5.2). After 1 h or serum stimulation, 74 genes were down-regulated and 67 genes were up-regulated (Appendix 7.12-13), upon treatment with X6 compound compared with treatment with the vehicle, DMSO. After 24 h of serum stimulation, 132 genes were down-regulated and 135 genes were up-regulated (Appendix 7.14-15), upon treatment with X6 compound compared with treatment with the vehicle, DMSO.

Examination of the genes that were differentially regulated revealed that Cyclin E1 and E2, E2F1, 2 and 3, protein kinase membrane associated tyrosine/threonine 1 (PKMYT1) are genes that are associated in MAPK pathway and have been down-regulated using X6 compound. Cyclin E1 and E2 are also associated with p53 signalling pathway. Transforming growth factor βeta 1, 2 and 3 (TGFβ1, 2 and 3), Growth Arrest and DNA Damage (GADD45) and structural maintenance of chromosome 1A (Smc1) are genes that are associated in cell cycle pathway 392 and were up-regulated by X6 compound treatment. All these investigated genes and their pathways are associated with melanoma development and growth of the cells.

165

(A) 1 0 0 s

e 5 0 n e g

f o

0 r e b m

u -5 0 N

-1 0 0 U p -re g u la te d D o w n -re g u la te d

(B) 2 0 0 s

e 1 0 0 n e g

f o

0 r e b m

u -1 0 0 N

-2 0 0 U p -re g u la te d D o w n -re g u la te d

Figure 5‎ .2. Effects of X6 compound versus DMSO at 1 and 24 h in ME1007 cell line ME1007 cells were seeded in DMEM in a 96 well tissue culture plate and upon reaching 80% confluence, cells were serum starved for 24 h. Cells were treated with 0.5μM X6 compounds or DMSO for 1 h then serum stimulated for (A) 1 or (B) 24 h. RNA samples were sent to Ramaciotti Centre for Genomics at the University of New South Wales, for microarray analysis. 74 and 67 genes have shown down-regulation and up-regulation, respectively; of ≥1.5 fold-change with X6 compound compared to DMSO at 1 h.

166

Re-analysis of the experiments was carried out by the comparison of the effect of X4 and X6 compounds at 1 h and at 24 h (Fig. 5.3). 126 and 65 genes demonstrated shown down-regulation and up-regulation (Appendix 7.16-17), respectively, when the effects of X4 compound treatment is compared with X6 compound at 1h. One hundred genes and 82 genes demonstrated down-regulation and up-regulation, respectively (Appendix 7.18-19) at 24 h serum stimulation. None of the genes that have been differentially down-regulated or up-regulated at 1 and 24 h of serum stimulation are associated with melanoma progression.

(A) (B 1 0 0 1 0 0 s s 5 0 5 0 e e n n e e g g

0 0 f f o o

r r e e -5 0 -5 0 b b m m u u

N -1 0 0

-1 5 0 -1 5 0 U p -re g u la te d D o w n -re g u la te d U p -re g u la te d D o w n -re g u la te d

Figure 5‎ .3. Effects of X4 versus X6 compounds at 1 and 24 h in ME1007 cell line. ME1007 cells were seeded in DMEM in a 96 well tissue culture plate and upon reaching 80% confluence, cells were serum starved for 24 h. Cells were treated with X4 or X6 compounds or DMSO for 1 h then serum stimulated for (A) 1 h or (B) 24 h. RNA samples were sent to Ramaciotti Centre for Genomics at the University of New South Wales, for microarray analysis.

In summary, treatment with X4 compound didn’t show any effect on genes or signalling pathways that are known to be associated with melanoma. Treatment with X6 compound did result in a down-regulation of Cyclin E1 and E2, E2F1, 2 and 3, PKMYT1 and these genes are known to be associated with MAPK pathway. Cyclin E1 and E2 are also associated with p53 signalling pathway. TGFβ1, 2 and 3, GADD45 and Smc1 are genes that are associated in cell cycle pathway and have been up-regulated using X6 compound. Finally, there were no overlapping genes in figures 5.1-5.3

167

5.2.2 Measuring and identifying proteins with altered levels upon treatment with X, X4, X6, X7, BT2, BT3 compounds in melanoma cells Melanoma ME1007 cells were used as an in vitro model for isobaric tags for relative and absolute quantitation (iTRAQ) studies which identifies, compares and quantifies proteins from multiple samples in one single experiment by Mass Spectrometry. iTRAQ technique is mainly used in quantitative proteomics to determine the amount of each of the proteins presented from various sources in a single experiment393. This can be accomplished through isotope labelling strategy were isotope labelled molecules are attached to the N- terminus and side chain amines of proteins by covalent bonding394.

The effect of compounds X, X4, X6, X7, BT2, BT3 and Trametinib on the quantity of each of the proteins present in the cell was tested in the ME1007 cell line. Trametinib was used as a control with known mitogen-activated protein kinase enzyme (MAPK) inhibitor that has anti-cancer activity. ME1007 cells contain a serine/threonine-protein kinase B-Raf (BRAF) V600E mutation which is known to result in an overactive MAPK pathway. The B-Raf V600E mutation, therefore, makes the ME1007 cell lines a suitable control for identifying MAPK inhibitors. DMSO was used as a negative control as all the compounds were dissolved in DMSO including trametinib, thereby allowing the effect of the compound to be isolated from the effect of the solvent.

Determining the effects of each compound in the ME1007 cell line was accomplished by performing iTRAQ analyses. For this, serum deprived ME1007 cells were treated with a compound or DMSO for 1 h followed by serum stimulation (with growth medium 10% (v/v) FBS) for 6 h. Total protein was extracted and all samples were sent to the Australian Proteome Analysis Facility (APAF), Macquarie University to perform iTRAQ analysis. All compounds (X, X4, X6, X7, BT2, BT3 and Trametinib) were compared with the DMSO control treated cells at this 6 h of serum stimulation time point (figs. 5.4 and 5.5). Using David Functional Annotation and Bioinformatics Tool, none of the genes identified to be down- regulated or up-regulated at protein level through the treatment of ME1007 cells with X, X4, X6, X7, BT2, BT3 or trametinib compounds are associated with melanoma progression.

168

(A) (B) 4 0 2 0 s 2 0 s 1 0 n n i i e e t t o 0 o 0 r r p p

f -2 0 f -1 0 o o

r r e e b -4 0 b -2 0 m m u -6 0 u -3 0 N N

-8 0 -4 0 U p -re g u la te d D o w n -re g u la te d U p -re g u la te d D o w n -re g u la te d

5 0 2 0 s s n n i i e e 1 0 t t o 0 o r r p p

f f 0 o o

r r e e b -5 0 b m m -1 0 u u N N

-1 0 0 -2 0 U p -re g u la te d D o w n -re g u la te d U p -re g u la te d D o w n -re g u la te d

Figure 5‎ .4. Effects of X, X4, X6 or X7compounds on protein levels at 6 h of serum stimulation in ME1007 cell line ME1007 cells were seeded in growth medium in 96 well tissue culture plates. Upon reaching 80% confluence, the cells were serum starved for 24 h and were then treated with compound X, X4, X6 or X7, or DMSO at 0.5 mM for 1 h then serum stimulated for 6 h. Total protein was extracted from cells subjected to iTRAQ analysis to measure levels and the identity of the proteins. (A) 60 proteins were down-regulated to ≥0.8 and 23 proteins were up-regulated to ≥ 1.5 of that of the DMSO controls cells (Appendix 7.20-21), upon treatment with compound X. (B) 33 were down regulated to ≥0.8 and 13 proteins were up-regulated to ≥ 1.5 of that of the DMSO control cells (Appendix 7.22-23), upon treatments with compound X4. (C) 81 proteins were down regulated to ≥0.8 and 26 proteins were up-regulated to ≥ 1.5 of that of the DMSO control cells (Appendix 7.24-25), upon treatment with compound X6. (D) 15 proteins were down-regulated to ≥0.8 and 12 proteins were up-regulated to ≥ 1.5 of that of the DMSO control cells (Appendix 7.26-27), upon treatment with compound X7.

169

( ) A 5 0 (B 1 .5 ) s s n n i i e e t t o 0 o 1 .0 r r p p

f f o o

r r e e b -5 0 b 0 .5 m m u u N N

-1 0 0 0 .0 U p -re g u la te d D o w n -re g u la te d U p -re g u la te d D o w n -re g u la te d

2 0 (C) s

n 0 i e t o r -2 0 p

f o

r -4 0 e b m

u -6 0 N

-8 0 U p -r e g u la te d D o w n -r e g u la te d

Figure 5‎ .5. Effects of BT2 or BT3 or Trametinib compounds versus DMSO at 6 h in ME1007 cell line ME1007 cells were seeded in DMEM in a 96 well tissue culture plate and upon reaching 80% confluence, cells were serum starved for 24 h. Cells were treated with BT2 compound or DMSO for 1 h then serum stimulated for 6 h. Total protein was extracted from cells and samples sent to the Australian Proteome Analysis Facility (APAF) at Macquarie University for iTRAQ analysis. (A) 82 proteins have shown a down-regulation ratio of ≥0.8 and 23 proteins have shown an up-regulation ratio of ≥ 1.5 (Appendix 7.28-29), when comparing the BT2 compound to DMSO. (B) 0 proteins have shown a down-regulation ratio of ≥0.8 and 1 proteins have shown an up-regulation ratio of ≥ 1.5 (Appendix 7.30-31), when comparing the BT3 compound to DMSO. (C) 72 proteins have shown a down-regulation ratio of ≥0.8 and 18 proteins have shown an up-regulation ratio of ≥ 1.5 (Appendix 7.32-33), when comparing Trametinib compound to DMSO.

170

5.2.3 The effect of BT2 and X compounds on protein kinase activity in melanoma cells At the time that the high throughput screening was completed, only compound X and its derivative (BT2) were identified, thus, the kinome experiment was carried out on these compounds only. Compound BT2 at 1000 nM and 10000 nM and compound X at 10000 nM were sent to the company DiscoveRX to carry on the experiment and test for their impact on biochemical based screening and profiling, using a scanMAX Kinase Assay Panel. ScanMAX Kinase Assay Panel is an assay that screens for 80% of the protein kinome (469 kinases) (please refer to DiscoveRX website for list of kinases). When the percent of control is 41%, it means that there is inhibition of 59% of that protein. A 70 percent of control cut-off was used as a threshold for deciding that the kinases were inhibited by the treatment.

Twenty genes showed inhibition of their encoded protein’s kinase activity of ≥ 30% upon treatment with the BT2 compound at 1000 nM (table 5.1) (Fig 5.6). Epidermal growth factor receptor (EGFR), fibroblast growth factor receptor 3 (FGFR3), ribosomal protein S6 kinase (RSK2), mitogen-activated protein kinase-kinase 4 (MAP2K4) and p38 mitogen activated protein kinases (p38) genes are associated with MAPK signalling pathway and were inhibited upon treatment with the BT2 compound in this study. The RSK gene encoded protein kinase activity was inhibited by the BT2 compound treatment and this kinase is associated with mTOR signalling pathway 392. Perturbations of MAPK and mTOR signalling in cancer correlate with melanoma metastasis395, 396.

Table 5‎ .1. Summary of kinases inhibited using BT2 compound at 1μm in the biochemical based scanMAX Kinase Assay Panel. KINOMEscan Gene Symbol Entrez Gene Symbol Percent Control

GRK7 GRK7 41

RSK4(Kin.Dom.1-N-terminal) RPS6KA6 43

AURKA AURKA 45

CSNK2A1 CSNK2A1 49

RSK2(Kin.Dom.1-N-terminal) RPS6KA3 49

MEK4 MAP2K4 50

DYRK2 DYRK2 51

EPHB6 EPHB6 53

171

EGFR(T790M) EGFR 56

MARK2 MARK2 57

HIPK3 HIPK3 61

CAMK1 CAMK1 62

FGFR3 FGFR3 63

CSNK2A2 CSNK2A2 65

p38-gamma MAPK12 67

TSSK1B TSSK1B 68

CHEK2 CHEK2 70

CSNK1D CSNK1D 70

EGFR(L858R,T790M) EGFR 70

RSK3(Kin.Dom.2-C-terminal) RPS6KA2 70

P ro te in in h ib itio n u s in g 1 M B T 2 c o m p o u n d

8 0

) 6 0 % (

l o r t n o C

4 0 f o

t n e c r e

P 2 0

7 6 A 1 3 4 2 6 R 2 3 1 3 2 2 B 2 D R 2 K A K A A K K B F K K K R A 1 1 K 1 F A K 2 K 2 2 K K R R R H G R IP M F K E K G 6 K 6 P Y P A G K P S H N 6 G S U S A E H A A E S A N D E M C F N S C S P S P M S M T C P R C R C R

G e n e N a m e

Figure 5‎ .6. Inhibtion of cellular kinase activity with the use of 1 μM BT2 compound in biochemical based assay Compound BT2-inhibition (1μM) of cellular kinase activity, of the kinases indicated on the X-axis, as tested by DiscoveRX using the scanMAX Kinase Assay Panel. Twenty kinases were inhibited by ≥ 30% using 1 μM of compound BT2 as compared with the kinase activity in the untreated cells.

172

When used at a higher concentration (10 μM) of compound BT2, 26 cellular kinases were shown to be inhibited ≥ 30% (table 5.2) (Fig. 5.7). Interestingly, the kinases; EGFR, FGFR3, RSK2, MAP2K4 and TAO kinase 1 (TAOK1), which are associated with the MAPK signalling pathway were inhibited by 10 μM BT2 compound. The RSK and AutophaGy (Atg1) kinases are also inhibited by compound BT2 and these kinases are known to be associated with the mTOR signalling pathway 392. As mentioned earlier, MAPK signalling and mTOR signalling are linked to melanoma metastasis395, 396.

Table 5‎ .2. Summary of kinases inhibited using BT2 compound at 10 μm in the biochemical based scanMAX Kinase Assay Panel. KINOMEscan Gene Symbol Entrez Gene Symbol Percent Control

MEK4 MAP2K4 35

SRPK1 SRPK1 40

RSK4(Kin.Dom.1-N-terminal) RPS6KA6 42

AURKA AURKA 43

GRK7 GRK7 44

MARK2 MARK2 44

FLT3(N841I) FLT3 45

DYRK2 DYRK2 47

EGFR(T790M) EGFR 48

EPHB6 EPHB6 50

HIPK3 HIPK3 54

CSNK2A1 CSNK2A1 56

CSNK2A2 CSNK2A2 56

RSK2(Kin.Dom.1-N-terminal) RPS6KA3 58

DAPK1 DAPK1 60

RSK3(Kin.Dom.2-C-terminal) RPS6KA2 64

PRKCE PRKCE 65

SBK1 SBK1 65

ULK1 ULK1 66

FGFR3 FGFR3 67

173

QSK KIAA0999 67

RIOK3 RIOK3 67

TAOK1 TAOK1 67

CDC2L2 CDC2L2 68

DCAMKL1 DCLK1 69

OSR1 OXSR1 70

P ro te in in h ib itio n u s in g 1 0 M B T 2 c o m p o u n d

8 0

) 6 0 % (

l o r t n o C

4 0 f o

t n e c r e

P 2 0

0 9 4 1 6 A 7 2 3 2 R 6 3 1 2 3 1 2 E 1 1 3 9 3 1 2 1 1 K K A K K K T K F B K A A A K A C K K R 9 K K L K R 2 K L 2 2 K P K 2 P R R R R G H IP K B L F 0 O O L S P R 6 A F Y P K K 6 A 6 S U G A I C C X A S U G E H S S R R A S A M D E N N D P F A T D D O M P S S P P I C R C C R R K

G e n e N a m e

Figure 5‎ .7. Inhibtion of cellular kinase activity with the use of 10 μM BT2 compound in biochemical based assay Compound BT2-inhibition (10μM) of cellular kinase activity, of the kinases indicated on the X-axis, as tested by DiscoveRX using the scanMAX Kinase Assay Panel. 26 genes have shown an inhibition of ≥ 30% using BT2 compound at 10 μM.

174

Using compound X at 10 μM in biochemical based assay, 105 cellular kinases were inhibited for kinase activity at ≥ 30% (table 5.3) (Fig 5.8). The kinases, EGFR, FGFR3, RSK2, Alpha-type platelet-derived growth factor receptor (PDGFRA), mitogen-activated protein kinase kinase 2 (MAP2K2), Mitogen-activated protein kinase kinase kinase kinase 4 (MAP4K4), Hematopoietic Progenitor Kinase 1 (HPK1), Serine/threonine-protein kinase PAK 1 (PAK1), tgf beta Receptor (TGFBR), mitogen-activated protein kinase kinase 7 (MAP2K7), p38, C-JUN N-terminal Kinases (JNKs), ribosomal protein S6 kinase (MSK1/2) and mitogen- activated protein kinase-activated protein kinase 2 (MAPKAPK2) genes, are all associated with the MAPK signalling pathway 392 and have been inhibited using X compound at 10 μM. As mentioned previously, MAPK signalling is linked to melanoma metastasis395, 396.

Table 5‎ .3. Summary of kinases inhibited using X compound at 10μm in the biochemical based scanMAX Kinase Assay Panel. KINOMEscan Gene Symbol Entrez Gene Symbol Percent Control

EPHB1 EPHB1 5

DDR1 DDR1 5

RSK3(Kin.Dom.1-N-terminal) RPS6KA2 8

DRAK2 STK17B 28

HPK1 MAP4K1 28

SRPK2 SRPK2 32

MAPKAPK2 MAPKAPK2 37

PRKX PRKX 39

PAK1 PAK1 40

RSK1(Kin.Dom.2-C-terminal) RPS6KA1 44

EPHB2 EPHB2 45

p38-gamma MAPK12 45

PIP5K2B PIP4K2B 47

KIT KIT 48

MARK3 MARK3 48

TRPM6 TRPM6 48

TTK TTK 48

175

PRKR EIF2AK2 49

LYN LYN 51

MST2 STK3 51

MST4 MST4 51

TGFBR1 TGFBR1 51

AAK1 AAK1 52

INSRR INSRR 52

p38-beta MAPK11 52

DLK MAP3K12 53

PDGFRB PDGFRB 53

PRP4 PRPF4B 53

YSK1 STK25 53

FLT3(N841I) FLT3 54

MARK4 MARK4 54

CAMK2D CAMK2D 55

JNK1 MAPK8 55

EGFR(S752-I759del) EGFR 56

MAK MAK 56

MUSK MUSK 57

ACVR1B ACVR1B 58

CDKL1 CDKL1 58

CSNK1E CSNK1E 58

EPHB3 EPHB3 58

PIM1 PIM1 58

ABL1(M351T)- ABL1 59 phosphorylated

BIKE BMP2K 59

FGFR2 FGFR2 59

MAP4K4 MAP4K4 59

BMPR1B BMPR1B 60

176

EGFR(E746-A750del) EGFR 60

EGFR(L747-S752del, P753S) EGFR 60

HIPK1 HIPK1 60

IGF1R IGF1R 60

KIT(V559D) KIT 60

PRKCI PRKCI 60

TIE1 TIE1 60

LZK MAP3K13 61

RIPK2 RIPK2 61

SIK SIK1 61

ADCK4 ADCK4 62

AMPK-alpha2 PRKAA2 62

CDK5 CDK5 62

DYRK2 DYRK2 62

JNK2 MAPK9 62

KIT(A829P) KIT 62

CDC2L2 CDC2L2 63

DRAK1 STK17A 63

LATS1 LATS1 63

CLK4 CLK4 64

DAPK1 DAPK1 64

FLT1 FLT1 64

STK16 STK16 64

ALK ALK 65

BMX BMX 65

BRSK1 BRSK1 65

MAST1 MAST1 65

MET(Y1235D) MET 65

TNIK TNIK 65

BMPR1A BMPR1A 66

177

CSNK2A1 CSNK2A1 66

RPS6KA5(Kin.Dom.1-N- RPS6KA5 66 terminal)

ADCK3 CABC1 67

CDKL2 CDKL2 67

CIT CIT 67

CSNK1A1 CSNK1A1 67

CSNK1D CSNK1D 67

EPHA8 EPHA8 67

FLT3(D835Y) FLT3 67

p38-delta MAPK13 67

PCTK2 CDK17 67

RET(V804M) RET 67

TESK1 TESK1 67

TLK1 TLK1 67

CDK11 CDK19 68

CSNK1G1 CSNK1G1 68

MEK2 MAP2K2 68

STK36 STK36 68

IKK-epsilon IKBKE 69

JAK3(JH1domain-catalytic) JAK3 69

PCTK1 CDK16 69

SIK2 SIK2 69

AXL AXL 70

KIT(V559D,V654A) KIT 70

MKK7 MAP2K7 70

MRCKA CDC42BPA 70

PRKCH PRKCH 70

SNRK SNRK 70

TYK2(JH2domain- TYK2 70 pseudokinase)

178

P ro te in in h ib itio n u s in g 1 0 M X c o m p o u n d

8 0

) 6 0 % (

l o r t n o C

4 0 f o

t n e c r e

P 2 0

0 I 1 1 2 B 1 2 2 X 1 1 2 2 B IT 3 6 K 2 N 3 4 1 1 R 1 2 B B 5 3 4 D 8 R K K B 1 E 3 1 1 K 2 4 B R R 1 R IT 1 3 2 B R A 7 K K K K A B 1 2 K T K K T R K 1 1 4 2 T K 2 K F 1 L 1 B L 2 R K 1 F F K 1 C E 1 K K K M Y R R A S IM K K I H D K 1 4 P P R A K H K K R P T A L T S B A S K K F F K L R K P G U R K K H B P F 4 R G G P F T K P K P P 4 2 S P 3 P T F M P P I R 3 I P D 6 R A P P 6 P A R M F A N G A M A E M V D N P A M G P E E H IG R E S T A S K S E A P T F G I A P R S C C S E F A P P S I M I A D M A M B M A P M P P M P E T M P P C A C M B R A R M M M

G e n e N a m e

P ro te in in h ib itio n u s in g 1 0 M X c o m p o u n d

8 0

) 6 0 % (

l o r t n o C

4 0 f o

t n e c r e

P 2 0

1 4 2 5 2 9 IT 2 A 1 4 1 1 6 K X 1 1 T K A 1 5 1 2 IT 1 D 8 3 3 7 T 1 1 9 1 2 6 E 3 6 2 L IT 7 A H K 2 K K A K K K L 7 S K K T 1 L K T E I 1 A A C L A 1 A T 1 1 E K K 1 G K 3 K 1 K X K K I K 2 M N C K I K P C R C A D R P 1 T L P L K A S S M R 2 K B K 1 K H L K K R S L K 1 2 K B A K A 2 B Y S C F T B T F P T P T S P K N D K C Y A K A C A R A P K 6 A D K N P D E D K K J D 2 R S T D D T L D S B M N S C N S E A C T C N A S I C A 4 A R M S M C P P C B S P S C M S M M C C R C C D C

G e n e N a m e

Figure 5‎ .8. Inhibtion of cellular kinase activity with the use of 10 μM X compound in the biochemical based scanMAX Kinase Assay Panel Compound X-inhibition (10μM) of cellular kinase activity, of the kinases indicated on the X-axis, as tested by DiscoveRX using the scanMAX Kinase Assay Panel. 105 genes have shown an inhibition of ≥ 30% using X compound

179

In summary of the analysis of the inhibition of the Kinome assay, using BT2 compound at 1 μM showed an inhibition of more than 30% for EGFR, FGFR3, RSK2, MAP2K4 and p38 genes, all of which are associated with the MAPK signalling pathway. The RSK gene was also inhibited using BT2. RSK pathway is associated with the mTOR signalling pathway and these two pathways are well known to be associated with melanoma progression. Testing BT2 compound at a higher concentration (10 μM) showed an inhibition of the activity of more than 30% of the kinases. The following kinases were shown to be inhibited by 10 μM BT2 compound treatment; EGFR, FGFR3, RSK2, MAP2K4 and TAOK1. These kinases are well known to be associated with the MAPK signalling pathway. The RSK and Atg1 kinases were also inhibited by compound 10 μM BT2 treatment and these kinases are well known to be associated with the mTOR signalling pathway. Testing compound X at 10 μM showed an inhibition of activity for more than 30% of the kinases. The kinases that were inhibited by 10 μM BT2 are, EGFR, FGFR3, RSK2, PDGFRA, MAP2K2, MAP4K4, HPK1, PAK1, TGFBR, MAP2K7, p38, JNKs, MSK1/2 and MAPKAPK2 genes. These kinases are all well known to be associated with the MAPK signalling pathway.

180

5.2.4 Collating mRNA and protein level changes upon treatment with the compounds Data obtained from mRNA expression and protein level changes using the microarray and iTRAQ techniques, respectively, were collated to evaluate the effect of the X4 and X6 compounds in the ME1007 melanoma cell line. The X4 and X6 compounds were chosen only as no other compounds were tested at the mRNA level using microarray approach. The other analogues had not yet been discovered at the time the microarray was carried out. The microarray analysis and iTRAQ were performed to identify genes affected at both the mRNA and protein levels. Genes that were down- regulated as a result of the X4 compound at the mRNA and protein levels were combined and genes that were up-regulated using the X4 compound (Fig 5.9), or compound X6 (Fig 5.10), at the RNA and protein levels were correlated. Using X4 and X6 compounds didn’t result in any gene that is down-regulated or/and up-regulated at the mRNA and protein levels.

(A)

(B)

Figure 5‎ .9. Comparison of genes with altered mRNA and protein levels upon treatment with compound X4 in the ME1007 cell line mRNA expression and protein level data obtained from microarray and iTRAQ methods, respectively, are integrated to identify genes whose expression was affected by the X4 compound at both the mRNA and protein level. (A) Down-regulated genes by X4 compound treatment, (B) Up-regulated genes by X4 compound treatment. A threshold of 1.5 fold-changes cut off for microarray data and 0.8 ratio cut off for iTRAQ were used. 181

(A)

(B)

Figure 5‎ .10. Comparison of down-regulated and up-regulated genes and proteins as a result of using the X6 compound in ME1007 cell line mRNA expression and protein level data obtained from microarray and iTRAQ methods, respectively, are integrated to identify genes whose expression was affected by the X6 compound at both the mRNA and protein level. (A) Down-regulated genes by X6 compound treatment, (B) Up-regulated genes by X6 compound treatment. A threshold of 1.5 fold-changes cut off for microarray data and 0.8 ratio cut off for iTRAQ were used.

182

5.3 Discussion There is an urgent need for effective therapies to combat the occurrence of melanoma and treat the malignancy as an adjunct to or without surgery. In this chapter, a lead compound called X, and its derivatives, X4, X6, X7, BT2 and BT3, have been identified as potential therapies for melanoma, through testing carried out in the melanoma cell line ME1007. Compound X is a novel compound and treatment with compound X and these derivitives were shown to alter the expression of various genes within ME1007 cells. Microarray and iTRAQ methods were used in this study to identify the influence of these compounds on gene expression at the mRNA and protein level. In addition, the ability of compound X to inhibit protein phosphorylation was investigated through protein kinase activity studies. I confined my analysis to genes that are already well known to be associated with melanoma.

The transcriptome (microarray) analysis of the ME1007 cell line identified altered the expression of various genes known to be associated with melanoma upon treatment with the X4 and X6 compounds. In addition, the kinases expressed by several of the genes encoding cellular kinases displayed a reduced ability to phosphorylate target proteins in the presence of X compounds, suggesting X compound and its derivatives may act as kinase inhibitors.

Cyclin E and E2F1 were down-regulated at mRNA level in the ME1007 cell line 24 h after the treatment with the X6 compound and subsequent serum stimulation. These serum stimulated genes are associated with a number of cellular pathways implicated in metastatic melanoma397, 398. The cyclin family of proteins are involved in regulating progression through the cell cycle; cyclin E is vital in the transition from gap 1 (G1) to S phase within the cell cycle399. In the G1 phase, cells increase in size and synthesis mRNA and proteins. S phase is the step in cell cycle where the DNA is replicated or synthesised. E2F1, has a major role in the progression of the cell cycle and acts as a tumour suppressor protein400. E2F1 is a transcription factor that is inhibited in G1 but is activated at the restriction point, and is associated with commitment of the cell to the S phase. It is this role (transition to S phase) that allows E2F1 to act as tumour suppressor gene. E2F is a family of transcription factors, three of which function as activators (E2F1, 2 and E2F3a) and another six function as suppressors (E2F3b and E2F4 to 8). E2F as a

183 family of transcription factors are involved in regulating cell cycle and DNA synthesis 401. Cyclin E and E2F1 genes are involved in several cellular pathways including cyclin E destruction, E2F1 destruction, and regulation of p27 phosphorylation during cell cycle progression, p53 signalling, influence of Ras and Rho proteins on G1 to S transition, cyclin and cell cycle regulation and finally, cell cycle pathways (BioCarta, 2015). If cell cycle progression is not regulated properly, then uncontrolled cell proliferation can occur and ultimately facilitate the development of cancer 402. The involvement of cyclin E and the E2F1 proteins in such a range of cell cycle associated pathways indicates that they are key players in regulated cell cycle progression. Inappropriate activation of E2F1, via its regulation of the cell cycle, can facilitate the development of cancer.

The treatment of the ME1007 melanoma cells with the BT2 or X compounds, led to the inhibition of phosphorylation activity of several protein kinases. This was expressed as a percentage of a control sample for each kinase, thereby reflecting the level of inhibition obtained for each gene analysed in the samples. Treatment with compound BT2 at both 1 µM and 10 µM, resulted in the inhibition of phosphorylation activity of a number of kinases that are well known to be associated with the progression of melanoma. For instance, mitogen-activated protein kinase (MAPK) signalling and mammalian target of rapamycin (mTOR) signalling in cancer are connected to melanoma metastasis; significantly, genes within these signalling pathways were inhibited significantly through the use of BT2 compound. 395, 396. The treatment of the melanoma cell line with compound X also resulted in the inhibition of the phosphorylation activity of a number of kinases in pathways associated with the progression of melanoma. These pathways include MAPK signalling, p53 signalling, VEGF signalling and melanogenesis (production of melanin)395, 403-405. Thus, X and BT2 compounds are potential drugs for inhibiting melanoma progression through inhibiting those signalling pathways. Further experiments and in vivo work is required to proof the efficiency of this new drug compound.

Compound X and its derivatives, X4, X6, X7, BT2, and BT3, impacted on the expression of a number of serum stimulated genes in the ME1007 cell line at the protein level, as detected by performing iTRAQ. Drug treatment with compound X did not affect any proteins known to be associated with melanoma progression. However, the use of

184 iTRAQ may have influenced the results as indicated by a recent study by Paulo et al, 2015 in which they demonstrated that the metabolic labelling that is used in iTRAQ typically results in some missing values as the isobaric peptides (peptides which has same molecular weight) which are generated from different samples, are isolated and then fragmented together to create the reporter ions which later will be employed to measure total of peptides and proteins from which they initiated. Moreover, one experiment can have several comparisons, thus, statistical significance could be measured while reducing variances as a result of instrumental condition 406.

Several of the compounds used in this study, X, X6 and BT2 (section 5.2.1 and 5.2.3) resulted in various inhibition profiles of genes involved in interconnected pathways. Microarray analysis of the effect of the X6 compound, a derivative of X compound, identified inhibition of expression of members of the p53 signalling pathway at the mRNA level. Treatment with the compounds X and BT2 resulted in inhibition of kinase activity of several proteins involved in the MAPK pathway, determined through kinome analysis (Section 5.2.3). p53 has been demonstrated as an upstream activator of MAPK signalling 407, 408. P53 is a tumour suppressor protein that affects its growth inhibitory activity through the activation and interaction with various signalling pathways. There is a study that suggests p53 as an upstream activator, which adjust MAPK pathways throughout the transcriptional stimulation of members of the double specificity phosphatase family359. And since p53 and MAPK signalling pathway are known to be altered in most human tumours408, understanding p53 and MAPK function could provide insight into the mechanism behind altered cell proliferation and cell survival in cancer. Extracellular signal regulated kinase (ERK) is also a member of the MAPK signalling pathway which acts as a main effector of the Ras oncoprotein. Activation of Ras protein would be expected to result in activating proteins that have a role in cell growth, differentiation and survival. Thus, inhibiting the kinases activity of MAPK signalling pathway through the X and BT2 compounds would serve as potential therapeutic uses for melanoma.

In a recent study, crosstalk between the ERK and mTOR pathways was demonstrated to have a significant role in controlling cell survival, differentiation, proliferation, metabolism and cell motility 409. The interaction between these pathways

185 is associated with vascular endothelial growth factor (VEGF) signalling pathway activation and ultimately, stimulation of angiogenesis. C-JUN N-terminal Kinases (JNKs) play a significant role in activation of VEGF signalling pathways410. Compound X was shown in section 5.2.3 to affect JNKs, a group of kinases is known to bind and phosphorylate C-JUN. This gene is usually up-regulated in liver, skin, breast cancer and brain tumours and causes cell migration and proliferation411. Thus, inhibition of JNKs activity will affect tumours cells ability to migrate and proliferate by C-JUN. Moreover, the inhibition of JNKs activity will inhibit the activation of VEGF signalling pathways, thus, no interaction between ERK and mTOR signalling pathways which in turn will affect cell survival, differentiation, proliferation, metabolism and motility.

5.4 Conclusion In conclusion, microarray, kinome and iTRAQ approaches were taken to identify genes that were dysregulated by the compound X or its derivatives in the melanoma cell line ME1007 and were compared with the gene/pathway database to identify the different gene/pathways potentially affected by the treatment with compound X and its derivatives. To further this research, all X compounds could be tested in other melanoma cell lines and non-melanoma cell lines to allow us to see if the pathways/genes affected are unique to ME1007, general to melanoma cell lines or even general to all cancers. Due to time constraints, I was not able to validate the iTraq results. Validation of these results is the next obvious step. Unfortunately, the cost of the iTraq technique was prohibitive to repeating for other cell lines. In vivo experiment is in progress to study the effect of these compounds on melanoma progression. This is occurring through the injection of the mice with ME1007 cell lines and growing a mass of tumours and then treating it with X compounds and its derivatives to observe their effects on reduction of its size.

186

6 General discussion The mechanisms behind the activation of immediate early genes (IEGs) have been studied recently, providing evidence that gene transcription is controlled in response to extracellular signalling412. A recent study demonstrated that the mechanistic details underlying the activation of IEGs could be dependent on cell type, cellular stimulus and the individual IEG of interest413. While the majority of IEGs are transcription factors, IEGs can also be cytokines, growth factors, enzymes, secreted factors, cytoskeletal proteins, transporters and anti-apoptotic proteins414. The expression of IEGs is often stimulated through muliplesignalling pathways such as mitogen-activated protein kinase (MAPK), C-JUN N-terminal kinase (JNK) and mammalian target of rapamycin (mTOR) 164 415. IEGs play a significant role in cancer and cardiovascular disease (CVD) 416. Thus, understanding their function and targeting their expression could be of therapeutic benefit in the treatment of specific cancers and CVD. The field of IEG research is advancing very rapidly, with several current studies aiming to establish ways to supress IEG expression 417 418. In this project, IEGs were studied in the context of CVD and melanoma. The three aims of this study were (i) to identify and profile IEGs responding to fibroblast growth factor 2 (FGF2) and interleukin-1 beta (IL-1β) stimulation in human aortic smooth muscle cells (hASMCs) as these cues get easily sensed in hASMCs by altering the expression of IEGs thereby gaining insight into downstream genes and pathways underlying the IEG response, (ii) to identify microRNAs (miRNAs) in human embryonic kidney 293 (HEK293) and malignant melanoma 200 (MM200) cells responsible for regulating the transcription factors C-JUN and C-FOS which play a significant role in cell proliferation, migration and progression of cell cycles, and (iii) to conduct a bioinformatic analysis to identify the changes in transcription factor and miRNA expression in malignant melanoma 1007 (ME1007) cells upon treatment with a newly designed chemotherapeutic drug.. The data collected in this study reveal that all these transcription factors, and their associated pathways, are stimulated by the extracellular stress response and hence could be targeted as potential therapeutic solutions in CVD and melanoma.

187

6.1 Findings and implications

6.1.1 The categorisation of IEGs To gain insight into the activation of downstream genes and pathways involved in the IEG response to FGF2 or IL-1β in hASMCs, the cap analysis gene expression (CAGE) approach was employed. This method measures gene expression of numerous genes per sample with great efficiency and increased sensitivity which allows the detection of mRNAs present in low abundance 419. To our knowledge, this is the first screen of hASMCs stimulated with FGF2 or IL-1β using the CAGE method. The expression profile of 347 genes was explored which reveals for the first time, that there are three categories of IEGs, depending on their expression profiles. 1) Early responder genes; demonstrate high inducible expression at approximately 1 h with a return to basal levels by approximately 2-3 h (Fig. 3.7). 2) Rapid transient responder genes generally peak in expression at approximately 1-3 h, with transient or sustained expression until 6 h post- stimulation (Fig. 3.8). 3) The late responder genes that display a lag period, peak at approximately 3 h and rapidly return to basal levels by 6 h post-stimulation (Fig. 3.9). The realisation of the three different categories of IEGs could provide insights into downstream signalling. Consequently, a gene from each category was evaluated to better understand the role it plays in the cell as a response to growth stimuli. This will provide insight in the signalling pathways involving IEGs; as previously established, some IEGs impacts/effects or act through ERK1. This is demonstrated by C-FOS, an IEG that functions as a sensor for the extracellular signal regulated kinase 1 (ERK1) and 2 (ERK2) 420. Thus, IEG transcription can determine cell fate through activation of signalling pathways and genes that are associated with cell survival421. The induction of some IEGs requires regulatory sequence that are known as serum response element (SRE) and Elk- 1. ERK signalling pathways have a significant role through the phosphorylation of Elk-1, thus, ERK family of MAP kinase and inductions of IEGs are directly linked422. Revealing the three categories of IEGs in this study will help in uncovering the pathways that are associated with each of the IEGs and linking the IEGs from the different categories to understand their induction mechanisms. The cell has stress-response mechanisms allowing it to manage cellular injury, geno-toxic damage and other disturbances via the extracellular environment. Early growth response 1 (EGR1) has been acknowledged as a stress induced transcription 188 factor in vascular disease that is strongly induced via growth factor and cytokine stimulation. EGR1, vascular cell adhesion molecule 1 (VCAM1), intercellular adhesion molecule 1 (ICAM1), (NAB2), C-JUN and JUND were stimulated by a growth factor and cytokine such as FGF2 and IL-1β (section 3.2.5.1). Moreover, those transcription factors are the most expressed in and associated with CVD. Thus, inhibition of these pro-survival pathways such as ERK1/2 that are associated with the inhibition of those genes will help in understanding the mechanism of such pathways. Moreover, by linking the IEGs with their associated pathways, we could have control over the cell fate through inhibiting an IEG that are linked to certain pathways which in turn could transfer the cell fate to cell death pathways. For instance, intimal hyperplasia and vascular remodelling are due to cell responding to growth factors and cytokines321. Occurring of intimal hyperplasia and vascular remodelling is known to usually result in atherosclerosis and CVD 423.

6.1.2 Inhibitors of IEGs in cancer disease Targeting and inhibiting of IEGs can be a useful strategy for cancer treatment417. To identify miRNAs involved in down-regulating IEGs with the potential to serve as therapeutics for cancer treatment, a selection of miRNAs believed to regulate the IEGs were evaluated159, 424. Two types of cells, human embryonic kidney cells (HEK293) and melanoma cells (MM200), were used to assess the interaction and regulation of two transcription factors C-JUN and C-FOS implicated in melanoma progression in relation to two miRNAs miR-125b and miR-155. These two miRNAs demonstrate sequence complementarity to C-JUN and C-FOS and are, therefore, potential regulators of the C- JUN and C-FOS mRNAs. In this project, I demonstrated the down-regulation of C-JUN and C-FOS at the protein level upon treatment of HEK293 cells with miR-155 but not in MM200 cells. miR-125b treatment resulted in down-regulation of C-JUN protein expression in MM200 cells but had no effect on C-FOS expression in the same cells. The varying ability of miR-155 and miR-125b to regulate C-JUN and C-FOS could have importance in melanoma. The reason behind the loss of miR-155 and miR-125b in melanoma cells would provide preliminary insight into the progression and development of melanoma. Moreover, analysing the expression profile of miR-155 and miR-125b in melanoma and determining their targets genes could lead to discovering new biomarkers and potential therapeutic targets.

189

It is well established that miRNAs are involved in numerous cellular processes, including differentiation, cell growth and apoptosis425, 426. miRNAs are involved in increasing the precision of regulation of gene expression through translational repression of specific proteins to ensure protein expression remains at normal physiological levels427-429. Moreover, miRNAs can function as molecular switches for certain cellular pathways 430. The two transcription factors C-JUN and C-FOS are the most commonly upregulated transcription factors reported in cancer and are generally accepted to affect disease progression 431. Down-regulation of C-JUN and C-FOS could reasonably be expected to result in decreased disease progression in cancers with over expression of miR-155 and miR-125b. The clinical relevance of this study could see miR- 155 and miR-125b as potential chemotherapeutics. While we were able to demonstrate that miRNA treatment resulted in decreased C-JUN and C-FOS mRNA and protein levels, demonstrating a role for the miRNAs in vivo in melanoma pathogenesis proves to be a challenge. Most miRNA research is conducted in vitro, with additional work required in human samples and animal models to support the in vitro findings. Moreover, the majority of studies on miRNAs are focused at a single target of miRNA whilst, in many cases, single miRNA is known to interact and regulate numerous different targets and pathways 432 433.

6.1.3 Chemotherapeutic drug compounds as inhibitors of IEGs To identify chemotherapeutic drugs targeting melanoma, microarray, kinome and iTRAQ methods were employed to test the effect of lead compound named X and its derivatives X4, X6, X7, BT2 and BT3 on mRNA levels, activity of known kinases and protein levels in the ME1007 melanoma cell line. The combination of these techniques allowed the identification of changes at the message and protein expression level and an indication of alterations to phosphorylation state in response to the drug. To our knowledge, X compound is novel, compound X and derivatives were designed by us, and our results indicate these compounds are of interest for implementation in the context of treating melanoma. Samples of ME1007 cells, which were treated with X4 or X6 compounds, were screened to evaluate the effect of the X4 and X6 compounds on melanoma cells. Both of X4 and X6 compounds have down-regulated and up-regulated various genes.

190

Compounds X and BT2 were tested against 468 kinases assays, a number of these kinases demonstrated greater than 30% inhibition in their activity. It was observed that genes that have been down-regulated at the mRNA level displayed inhibition in the kinase activity associated with such genes. Several of the cellular kinases had a reduced ability to phosphorylate their target proteins in the presence of X compounds, suggesting compound X, and its derivatives, may be used a poly-kinase inhibitor. Inhibition at the protein level was not evident after treating the cells with X compound and its derivatives and employing iTRAQ method, and there was no correlation between the iTRAQ data and Kinome data, thus, this is not indicative of protein expression inhibition; proteins that are associated with kinases may be present in the cell however remain in an un-phosphorylated, inactive state. X4 and X6 compounds down-regulated cyclin E and E2F1 at the mRNA level. These two genes are associated with a number of signalling pathways in metastatic melanoma 397 398, such as, cyclin E and E2F1 destruction pathways, p53 signalling pathways and cell cycles pathway 434. The application of X and BT2 compounds on the melanoma cell line identified their potential as kinase inhibitors revealing a number of signalling pathways with reduced activity, such as MAPK, mTOR, p53 and vascular endothelial growth factor (VEGF) signalling. These pathways are recognised as being associated with development and progression of melanoma435-437.

6.2 Limitations and future directions

6.2.1 Response of IEGs The study highlights three potential categories of IEGs in hASMCs. Further studies into the existence of this categorisation are required in a broader variety of cells to confirm these IEG groups. Fibroblast growth factor (FGF2) and interleukin 1 beta (IL- 1β) were used in this project to stimulate the expression and activation of IEGs. Continuing this work in hASMCs, including the screening of other growth factors and cytokines in these cells, would provide initial insights into the expression profile of IEGs in cardiac cells and whether they are stimulated by the same extracellular stimuli. Exploring upstream of early responder genes in hASMCs and studying the cause of the

191 constitutively activated signalling mechanism would be an interesting step in understanding the regulation of early responder genes. Investigation into the effect on the protease activity of EGR1 upon targeting it with siRNA would be of interest as a reduction in its protease activity may affect the interaction of EGR1 and metalloproteinase 9 (MMP-9). A various amount of normal and pathologic conditions such as inflammation, tissue repair, tumour invasion and metastasis are being regulated by MMP-9. Tumour necrosis alpha (TNFalpha) is a proinflammatory cytokine which play a significant role in tumour progression. EGR1 is known to be induced by TNFalpha. A study by Shin (2010), showed that EGR1 binds directly to the promoter of MMP-9 and has a major role in the initiation of MMP-9 transcription by TNFalpha438. Thus, EGR1 is a vital transcription factor in expression of MMP-9 438, 439. Down regulation of EGR1 at the mRNA and protein level was accomplished using small interfering RNA (siRNA) in vitro specific to EGR1. Delivery of siRNA is one of the limitations in vivo as hASMCs are only accessible through surgery. The systematic delivery of siRNA to hASMCs in vivo has proven to be inefficient ; with increased off- target affects a potential outcome 440. Lipid nanoparticles can assist in delivery of chemotherapeutic agents and could help in transporting encapsulated siRNA to hASMCs in vivo as indicated by the fact that targeted delivery of siRNA to smooth muscle cells from the aorta of C57BL/6 mice has been achieved using lipid nanoparticles (NP) 441. NPs are effective in increasing the stability of nucleic acids and prevent siRNA elimination from the body238. Several types of NP exist which can be conjugated to targeted siRNA allowing increased efficiency and specificity of siRNA to tumour cells or hASMCs442.

6.2.2 Role of C-JUN and C-FOS in tumour growth and metastasis C-JUN and C-FOS have been established to be a potential targets in vitro, thus, an in vivo model is required to better understand the suitability of these transcription factors as targets in a more accurate melanoma setting. To recognise the role of C-JUN and C-FOS in melanoma tumorigenesis and solid tumour growth, establishing an in vivo subcutaneous xenograft model will need to be generated. To further this animal work, testing the efficiency of a combination of gemcitabine C-JUN or C-FOS targeting siRNA could be administered to this model.

192

Understanding the role of C-JUN and C-FOS in metastasis is imperative in evaluating the efficacy of inhibiting these proteins as therapeutic targets for metastatic disease like melanoma. Tail vein experiment that tests the effect of C-JUN and C-FOS inhibition on metastasis is required in order to assess the possibility of tumour cells to survive in the bloodstream 443. An advantage of an in vivo model is that it includes the tumour encompassing stroma which is believed to dictate the response of a tumour to therapy. A subcutaneous injection of a combination of skin cancer cells and mesenchymal stromal cells in the mouse model will better mimic the human tumour microenvironment disease more accurately444-446. Cell motility and actin dynamics to help in the assessment of the effect of inhibiting C-JUN and C-FOS in melanoma cells could be further investigated through a deeper understanding of skin cancer cell morphology and can be carried out by visualisation of F-actin fibres in these cells. Employment of the toxin phalloidin to study the F-actin network in cells has the limitation of only being suited to fixed cells. Therefore using lifeact, a mix of actin-binding polypeptide with green fluorescence protein (GFP) allows the visualisation of F-actin in live cells, thereby providing a more accurate picture of melanoma447. To further understand melanoma cell morphology and movement, inhibition of C-JUN and C-FOS in various tumour micro-environmental settings could deepen our knowledge of melanoma cell chemotaxis and chemokinesis. Further to this, exploring the degradation of the extracellular matrix during chemotaxis and chemokinesis would facilitate understanding melanoma cell morphology448. In this study, stress-inducible proteins (C-JUN and C-FOS) were explored as potential targets for therapeutic purposes in treating melanoma, as these cells proliferation and migration are very dependent on cues which altered stress response pathways such MAPK signalling pathway. Targeting stress-induced signalling molecules has a limitation as these adaptive responses occur to maintain homeostasis and are activated by severe environmental stimuli in normal cells 449 450. C-JUN and C-FOS have been reported to be expressed in melanoma cells but not in normal skin cells 287 451. This strengthens the strategy of C-JUN and C-FOS as cancer specific targets. 193

Further work is required to evaluate the feasibility of C-JUN and C-FOS as therapeutic targets in treating melanoma, any effects on the selected stress response genes being targeted needs to be established in regular skin cells 452. For instance, chemotherapy and radiation therapy induce changes at the molecular level in normal cells, thereby activating progression for a normal cellular state to a diseased state 453 452.

6.2.3 Drug development Initial investigations of the effects of the lead compound X and its derivatives in melanoma cells have been accomplished but needs to be repeated and extended by further studies on the effects of these compounds on gene expression and phosphorylation state of proteins to assess whether X compounds could be translated into in vivo models. Moreover, identifying any effect of X compounds and its derivatives on upstream genetic elements associated with IEGs such as enhancers may provide insight into the mechanism of these compounds and how IEGs are regulated at a molecular level. We established that X and BT2 compounds elicit an effect on a number of signalling pathways that are associated with melanoma progression and metastasis such as MAPK, mTOR, p53 and VEGF signalling pathways. To further this, in vivo animal work experiments testing the effect of these compounds on melanoma progression would identify the effect on tumour metastasis and whether X compounds exhibit any off- target toxicity. Recently, it has been established by Karp (2010) that iTRAQ data suffer from impreciseness as the data is affected by variance heterogeneity since data with low signal have higher inconsistency and on the other hand data sets are dominated by low abundance peptides. Ratio of the data is compressed to 1 which causes underestimation of the ratio454. Thus, further protein work is needed to verify findings.

6.3 Final remarks In conclusion, identifying the IEGs which are associated with CVD and melanoma skin disease was the aim of this study. This allowed us and for the first time to establish the three IEGs categories. Furthering this study in order to provide insight into the regulation of IEGs including downstream genes and associated signalling pathways may

194 well be achieved by improved understanding of the individual characteristics of these genes groups. Additionally, by linking the IEGs from the three different categories we will be able to provide preliminary understanding of the mechanism of induction for each of the IEGs. Intracellular signalling is pivotal in the altered physiological conditions present in CVD and cancer development and the role of miRNAs in disease progression including cancer is becoming increasingly recognised. The rapidly evolving field of miRNA research makes these elements an appealing therapeutic target due to their involvement in a range of cellular processes. Our initial data suggest that miR-125b targets C-JUN CDS and miR-155 targets C-JUN and C-FOS 3ÚTR, which are involved in melanoma maintenance and therefore hold potential as therapeutic targets. This study also explored the effects of a lead compound and its derivatives on the mRNA, protein and kinase levels of genes in melanoma cells, illustrating their effect in pathways associated with melanoma. Thus, these compounds serve as a potential in chemotherapeutic therapy. The high prevalence of melanoma, particularly in Australia makes this study particularly important and relevant to Australia 455.

195

196

7 Appendix Table 7‎ .1. C-JUN 3ÚTR sequence GGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACG CAGCAGTTGCAAACATTTTGAAGAGAGACCGTCGGGGGCTGAGGGGCAACGAAGAAAAAAAA TAACACAGAGAGACAGACTTGAGAACTTGACAAGTTGCGACGGAGAGAAAAAAGAAGTGTCC GAGAACTAAAGCCAAGGGTATCCAAGTTGGACTGGGTTGCGTCCTGACGGCGCCCCCAGTGTG CACGAGTGGGAAGGACTTGGCGCGCCCTCCCTTGGCGTGGAGCCAGGGAGCGGCCGCCTGCG GGCTGCCCCGCTTTGCGGACGGGCTGTCCCCGCGCGAACGGAACGTTGGACTTTTCGTTAACAT TGACCAAGAACTGCATGGACCTAACATTCGATCTCATTCAGTATTAAAGGGGGGAGGGGGAGG GGGTTACAAACTGCAATAGAGACTGTAGATTGCTTCTGTAGTACTCCTTAAGAACACAAAGCGG GGGGAGGGTTGGGGAGGGGCGGCAGGAGGGAGGTTTGTGAGAGCGAGGCTGAGCCTACAGA TGAACTCTTTCTGGCCTGCCTTCGTTAACTGTGTATGTACATATATATATTTTTTAATTTGATGAAA GCTGATTACTGTCAATAAACAGCTTCATGCCTTTGTAAGTTATTTCTTGTTTGTTTGTTTGGGTAT CCTGCCCAGTGTTGTTTGTAAATAAGAGATTTGGAGCACTCTGAGTTTACCATTTGTAATAAAGT ATATAATTTTTTTATGTTTTGTTTCTGAAAATTCCAGAAAGGATATTTAAGAAAATACAATAAACT ATTGGAAAGTACTCCCCTAACCTCTTTTCTGCATCATCTGTAGATACTAGCTATCTAGGTGGAGTT GAAAGAGTTAAGAATGTCGATTAAAATCACTCTCAGTGCTTCTTACTATTAAGCAGTAAAAACTG TTCTCTATTAGACTTTAGAAATAAATGTACCTGATGTACCTGATGCTATGGTCAGGTTATACTCCT CCTCCCCCAGCTATCTATATGGAATTGCTTACCAAAGGATAGTGCGATGTTTCAGGAGGCTGGA GGAAGGGGGGTTGCAGTGGAGAGGGACAGCCCACTGAGAAGTCAAACATTTCAAAGTTTGGA TTGTATCAAGTGGCATGTGCTGTGACCATTTATAATGTTAGTAGAAATTTTACAATAGGTGCTTA TTCTCAAAGCAGGAATTGGTGGCAGATTTTACAAAAGATGTATCCTTCCAATTTGGAATCTTCTC TTTGACAATTCCTAGATAAAAAGATGGCCTTTGCTTATGAATATTTATAACAGCATTCTTGTCACA ATAAATGTATTCAAATACCAATAACAGATCTTGAATTGCTTCCCTT

Table 7‎ .2. C-FOS 3ÚTR sequence ACTGCTTACACGTCTTCCTTCGTCTTCACCTACCCCGAGGCTGACTCCTTCCCCAGCTGTGCAGCT GCCCACCGCAAGGGCAGCAGCAGCAATGAGCCTTCCTCTGACTCGCTCAGCTCACCCACGCTGC TGGCCCTGTGAGGGGGCAGGGAAGGGGAGGCAGCCGGCACCCACAAGTGCCACTGCCCGAGC TGGTGCATTACAGAGAGGAGAAACACATCTTCCCTAGAGGGTTCCTGTAGACCTAGGGAGGAC CTTATCTGTGCGTGAAACACACCAGGCTGTGGGCCTCAAGGACTTGAAAGCATCCATGTGTGGA CTCAAGTCCTTACCTCTTCCGGAGATGTAGCAAAACGCATGGAGTGTGTATTGTTCCCAGTGACA CTTCAGAGAGCTGGTAGTTAGTAGCATGTTGAGCCAGGCCTGGGTCTGTGTCTCTTTTCTCTTTC TCCTTAGTCTTCTCATAGCATTAACTAATCTATTGGGTTCATTATTGGAATTAACCTGGTGCTGGA TATTTTCAAATTGTATCTAGTGCAGCTGATTTTAACAATAACTACTGTGTTCCTGGCAATAGTGTG TTCTGATTAGAAATGACCAATATTATACTAAGAAAAGATACGACTTTATTTTCTGGTAGATAGAA ATAAATAGCTATATCCATGTACTGTAGTTTTTCTTCAACATCAATGTTCATTGTAATGTTACTGAT CATGCATTGTTGAGGTGGTCTGAATGTTCTGACATTAACAGTTTTCCATGAAAACGTTTTATTGT GTTTTTAATTTATTTATTAAGATGGATTCTCAGatatttatatttttattttatttttttCTACCTTGAGGTCTT TTGACATGTGGAAAGTGAATTTGAATGAAAAATTTAAGCATTGTTTGCTTATTGTTCCAAGACAT

197

TGTCAATAAAAGCATTTAAGTTGAATGCGACCAACCTTGTGCTCTTTTCATTCTGG

Table 7‎ .3. C-JUN CDs agcccaaactaacctcacgtgaagtgacggactgttctatgactgcaaagatggaaacgaccttctatgacgatgccctcaac gcctcgttcctcccgtccgagagcggaccttatggctacagtaaccccaagatcctgaaacagagcatgaccctgaacctggc cgacccagtggggagcctgaagccgcacctccgcgccaagaactcggacctcctcacctcgcccgacgtggggctgctcaag ctggcgtcgcccgagctggagcgcctgataatccagtccagcaacgggcacatcaccaccacgccgacccccacccagttcct gtgccccaagaacgtgacagatgagcaggagggcttcgccgagggcttcgtgcgcgccctggccgaactgcacagccagaa cacgctgcccagcgtcacgtcggcggcgcagccggtcaacggggcaggcatggtggctcccgcggtagcctcggtggcaggg ggcagcggcagcggcggcttcagcgccagcctgcacagcgagccgccggtctacgcaaacctcagcaacttcaacccaggc gcgctgagcagcggcggcggggcgccctcctacggcgcggccggcctggcctttcccgcgcaaccccagcagcagcagcagc cgccgcaccacctgccccagcagatgcccgtgcagcacccgcggctgcaggccctgaaggaggagcctcagacagtgcccg agatgcccggcgagacaccgcccctgtcccccatcgacatggagtcccaggagcggatcaaggcggagaggaagcgcatga ggaaccgcatcgctgcctccaagtgccgaaaaaggaagctggagagaatcgcccggctggaggaaaaagtgaaaaccttga aagctcagaactcggagctggcgtccacggccaacatgctcagggaacaggtggcacagcttaaacagaaagtcatgaacc acgttaacagtgggtgccaactcatgctaacgcagcagttgcaaacattttgaagagagaccgtcggg

Table 7‎ .4. C-JUN 3ÚTR sequence mutated GGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACG CAGCAGTTGCAAACATTTTGAAGAGAGACCGTCGGGGGCTGAGGGGCAACGAAGAAAAAAAA TAACACAGAGAGACAGACTTGAGAACTTGACAAGTTGCGACGGAGAGAAAAAAGAAGTGTCC GAGAACTAAAGCCAAGGGTATCCAAGTTGGACTGGGTTGCGTCCTGACGGCGCCCCCAGTGTG CACGAGTGGGAAGGACTTGGCGCGCCCTCCCTTGGCGTGGAGCCAGGGAGCGGCCGCCTGCG GGCTGCCCCGCTTTGCGGACGGGCTGTCCCCGCGCGAACGGAACGTTGGACTTTTCGTTAACAT TGACCAAGAACTGCATGGACCTAACATTCGATCTCATTCAGTGCCGAAGGGGGGAGGGGGAGG GGGTTACAAACTGCAATAGAGACTGTAGATTGCTTCTGTAGTACTCCTTAAGAACACAAAGCGG GGGGAGGGTTGGGGAGGGGCGGCAGGAGGGAGGTTTGTGAGAGCGAGGCTGAGCCTACAGA TGAACTCTTTCTGGCCTGCCTTCGTTAACTGTGTATGTACATATATATATTTTTTAATTTGATGAAA GCTGATTACTGTCAATAAACAGCTTCATGCCTTTGTAAGTTATTTCTTGTTTGTTTGTTTGGGTAT CCTGCCCAGTGTTGTTTGTAAATAAGAGATTTGGAGCACTCTGAGTTTACCATTTGTAATAAAGT ATATAATTTTTTTATGTTTTGTTTCTGAAAATTCCAGAAAGGATATTTAAGAAAATACAATAAACT ATTGGAAAGTACTCCCCTAACCTCTTTTCTGCATCATCTGTAGATACTAGCTATCTAGGTGGAGTT GAAAGAGTTAAGAATGTCGATTAAAATCACTCTCAGTGCTTCTTACTATTAAGCAGTAAAAACTG TTCTCTATTAGACTTTAGAAATAAATGTACCTGATGTACCTGATGCTATGGTCAGGTTATACTCCT CCTCCCCCAGCTATCTATATGGAATTGCTTACCAAAGGATAGTGCGATGTTTCAGGAGGCTGGA GGAAGGGGGGTTGCAGTGGAGAGGGACAGCCCACTGAGAAGTCAAACATTTCAAAGTTTGGA TTGTATCAAGTGGCATGTGCTGTGACCATTTATAATGTTAGTAGAAATTTTACAATAGGTGCTTA TTCTCAAAGCAGGAATTGGTGGCAGATTTTACAAAAGATGTATCCTTCCAATTTGGAATCTTCTC TTTGACAATTCCTAGATAAAAAGATGGCCTTTGCTTATGAATATTTATAACAGCATTCTTGTCACA

198

ATAAATGTATTCAAATACCAATAACAGATCTTGAATTGCTTCCCTT

Table 7‎ .5. C-FOS 3ÚTR sequence mutated ACTGCTTACACGTCTTCCTTCGTCTTCACCTACCCCGAGGCTGACTCCTTCCCCAGCTGTGCAGCT GCCCACCGCAAGGGCAGCAGCAGCAATGAGCCTTCCTCTGACTCGCTCAGCTCACCCACGCTGC TGGCCCTGTGAGGGGGCAGGGAAGGGGAGGCAGCCGGCACCCACAAGTGCCACTGCCCGAGC TGGTGCATTACAGAGAGGAGAAACACATCTTCCCTAGAGGGTTCCTGTAGACCTAGGGAGGAC CTTATCTGTGCGTGAAACACACCAGGCTGTGGGCCTCAAGGACTTGAAAGCATCCATGTGTGGA CTCAAGTCCTTACCTCTTCCGGAGATGTAGCAAAACGCATGGAGTGTGTATTGTTCCCAGTGACA CTTCAGAGAGCTGGTAGTTAGTAGCATGTTGAGCCAGGCCTGGGTCTGTGTCTCTTTTCTCTTTC TCCTTAGTCTTCTCATCTAGCTAACTAATCTATTGGGTTCATTATTGGAATTAACCTGGTGCTGGA TATTTTCAAATTGTATCTAGTGCAGCTGATTTTAACAATAACTACTGTGTTCCTGGCAATAGTGTG TTCTGATTAGAAATGACCAATATTATACTAAGAAAAGATACGACTTTATTTTCTGGTAGATAGAA ATAAATAGCTATATCCATGTACTGTAGTTTTTCTTCAACATCAATGTTCATTGTAATGTTACTGAT CATGCATTGTTGAGGTGGTCTGAATGTTCTGACATTAACAGTTTTCCATGAAAACGTTTTATTGT GTTTTTAATTTATTTATTAAGATGGATTCTCAGATATTTATATTTTTATTTTATTTTTTTCTACCTTG AGGTCTTTTGACATGTGGAAAGTGAATTTGAATGAAAAATTTAAGCATTGTTTGCTTATTGTTCC AAGACATTGTCAATAAAAGCATTTAAGTTGAATGCGACCAACCTTGTGCTCTTTTCATTCTGG

Table 7‎ .6. C-JUN CDs mutated agcccaaactaacctcacgtgaagtgacggactgttctatgactgcaaagatggaaacgaccttctatgacgatgccctcaac gcctcgttcctcccgtccgagagcggaccttatggctacagtaaccccaagatcctgaaacagagcatgaccctgaacctggc cgacccagtggggagcctgaagccgcacctccgcgccaagaactcggacctcctcacctcgcccgacgtggggctgctcaag ctggcgtcgcccgagctggagcgcctgataatccagtccagcaacgggcacatcaccaccacgccgacccccacccagttcct gtgccccaagaacgtgacagatgagcaggagggcttcgccgagggcttcgtgcgcgccctggccgaactgcacagccagaa cacgctgcccagcgtcacgtcggcggcgcagccggtcaacggggcaggcatggtggctcccgcggtagcctcggtggcaggg ggcagcggcagcggcggcttcagcgccagcctgcacagcgagccgccggtctacgcaaacctcagcaacttcaacccaggc gcgctgagcagcggcggcggggcgccctcctacggcgcggccggcctggcctttcccgcgcaaccccagcagcagcagcagc cgccgcaccacctgccccagcagatgcccgtgcagcacccgcggctgcaggccctgaaggaggagcctcagacagtgcccg agatgcccggcgagacaccgcccctgtcccccatcgacatggagtcccaggagcggatcaaggcggagaggaagcgcatga ggaaccgcatcgctgcctccaagtgccgaaaaaggaagctggagagaatcgcccggctggaggaaaaagtgaaaaccttga aagctcagaactcggagctggcgtccacggccaacatgagagaggaacaggtggcacagcttaaacagaaagtcatgaacc acgttaacagtgggtgccaactcatgctaacgcagcagttgcaaacattttgaagagagaccgtcggg

Table 7‎ .7. EGR1 3ÚTR sequence GACATGACAGCAACCTTTTCTCCCAGGACAATTGAAATTTGCTAAAGGGAAAGGGGAAAGAAA GGGAAAAGGGAGAAAAAGAAACACAAGAGACTTAAAGGACAGGAGGAGGAGATGGCCATAG GAGAGGAGGGTTCCTCTTAGGTCAGATGGAGGTTCTCAGAGCCAAGTCCTCCCTCTCTACTGGA

199

GTGGAAGGTCTATTGGCCAACAATCCTTTCTGCCCACTTCCCCTTCCCCAATTACTATTCCCTTTG ACTTCAGCTGCCTGAAACAGCCATGTCCAAGTTCTTCACCTCTATCCAAAGAACTTGATTTGCAT GGATTTTGGATAAATCATTTCAGTATCATCTCCATCATATGCCTGACCCCTTGCTCCCTTCAATGC TAGAAAATCGAGTTGGCAAAATGGGGTTTGGGCCCCTCAGAGCCCTGCCCTGCACCCTTGTACA GTGTCTGTGCCATGGATTTCGTTTTTCTTGGGGTACTCTTGATGTGAAGATAATTTGCATATTCTA TTGTATTATTTGGAGTTAGGTCCTCACTTGGGGGAAAAAAAAAAAAGAAAAGCCAAGCAAACCA ATGGTGATCCTCTATTTTGTGATGATGCTGTGACAATAAGTTTGAACCTTTTTTTTTGAAACAGCA GTCCCAGTATTCTCAGAGCATGTGTCAGAGTGTTGTTCCGTTAACCTTTTTGTAAATACTGCTTGA CCGTACTCTCACATGTGGCAAAATATGGTTTGGTTTTTCTTTTTTTTTTTTTTTGAAAGTGTTTTTT CTTCGTCCTTTTGGTTTAAAAAGTTTCACGTCTTGGTGCCTTTTGTGTGATGCGCCTTGCTGATGG CTTGACATGTGCAATTGTGAGGGACATGCTCACCTCTAGCCTTAAGGGGGGCAGGGAGTGATG ATTTGGGGGAGGCTTTGGGAGCAAAATAAGGAAGAGGGCTGAGCTGAGCTTCGGTTCTCCAGA ATGTAAGAAAACAAAATCTAAAACAAAATCTGAACTCTCAAAAGTCTATTTTTTTAACTGAAAAT GTAAATTTATAAATATATTCAGGAGTTGGAATGTTGTAGTTACCTACTGAGTAGGCGGCGATTTT TGTATGTTATGAACATGCAGTTCATTATTTTGTGGTTCTATTTTACTTTGTACTTGTGTTTGCTTAA ACAAAGTGACTGTTTGGCTTATAAACACATTGAATGCGCTTTATTGCCCATGGGATATGTGGTGT ATATCCTTCCAAAAAATTAAAACGAAAATAAAGTAGCTGCGATTGGGTATGTGTTTCCTGGGTTA GGGGAAGGACTCTGCCCTATTGAGGGCTGTGAGGTTTTCT

Table 7‎ .8. Raw data of GAPDH RT-PCR in HEK293 cells Name Ct values for GAPDH 0 mins 19.71 0 mins 19.85 0 mins 19.69 15 mins 19.37 15 mins 19.26 15 mins 19.68 30 mins 18.99 30 mins 19.31 30 mins 19.25 1hr 19.44 1hr 19.54 1hr 20.02 1.5hrs 20.02 1.5hrs 19.75 1.5hrs 19.81 2hrs 19.08 2hrs 19.01 2hrs 19.11 4hrs 19.10 4hrs 19.29

200

4hrs 19.56 6hrs 19.29 6hrs 19.42 6hrs 19.16

Table 7‎ .9. Raw data of GAPDH RT-PCR in MM200 cells Name Ct values for GAPDH 0 mins 18.80 0 mins 18.43 0 mins 18.56 15 mins 18.60 15 mins 18.07 15 mins 18.53 30 mins 19.05 30 mins 19.35 30 mins 19.18 1hr 18.78 1hr 18.78 1hr 18.45 1.5hrs 18.29 1.5hrs 18.11 1.5hrs 18.36 2hrs 19.12 2hrs 19.17 2hrs 18.88 4hrs 18.69 4hrs 18.45 4hrs 18.65 6hrs 18.60 6hrs 18.37 6hrs 18.67

Table 7‎ .10. Down-regulated genes due to treatment of compound X4 (versus DMSO) on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name

NM_005298 G protein-coupled receptor 25 NM_001002925 olfactory receptor, family 5, subfamily AP, member 2 NR_002217 PMS2 C-terminal like pseudogene NM_001078171 family with sequence similarity 127, member A AK310157 retinoic acid early transcript 1G AK289373 hypothetical protein LOC100290146 similar to Glycine cleavage system H protein, mitochondrial precursor; glycine cleavage system NM_004483 protein H (aminomethyl carrier); similar to Glycine cleavage system H protein, mitochondrial

201

NM_001038628 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2; similar to killer cell immunoglobulin-like receptor 3DL2 precursor (MHC class I NK cell receptor) (Natural killer- NM_006737 associated transcript 4) (NKAT-4) (p70 natural killer cell receptor clone CL-5) (CD158k antigen) AK098413 topoisomerase I binding, arginine/serine-rich NM_000517 hemoglobin, alpha 2; hemoglobin, alpha 1 AK302171 hypothetical protein LOC100289428 AK302171 hypothetical protein LOC100289637 AK302171 hypothetical protein LOC100288601 AK302171 hypothetical protein LOC100289902 AK302171 hypothetical protein LOC100288381 NR_027035 hypothetical protein LOC144486 NR_003072 small nucleolar RNA, C/D box 91B; small nucleolar RNA, C/D box 91A NM_003745 suppressor of cytokine signaling 1 NR_003073 small nucleolar RNA, C/D box 91B; small nucleolar RNA, C/D box 91A NM_001013736 family with sequence similarity 47, member C NM_004979 potassium voltage-gated channel, Shal-related subfamily, member 1 NM_004472 forkhead box D1 histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; NM_003546 histone cluster 2, H4b NM_152635 oncoprotein induced transcript 3 NR_024251 family with sequence similarity 86, member A pseudogene NM_001080487 similar to poly(A)binding protein nuclear-like 1 NM_000184 hemoglobin, gamma G NR_023390 chromosome 9 open reading frame 130 golgi autoantigen, golgin subfamily a, 6C; golgi autoantigen, golgin subfamily a, 6 pseudogene; golgi NR_027024 autoantigen, golgin subfamily a, 6D; golgi autoantigen, golgin subfamily a, 6 BC039000 cyclin Y-like 2 NM_005456 mitogen-activated protein kinase 8 interacting protein 1 NM_001042747 Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog NM_005782 THO complex 4 NR_003064 peptide YY, 2 (seminalplasmin) AF400494 small nuclear ribonucleoprotein polypeptide N; SNRPN upstream reading frame NM_031313 alkaline phosphatase, placental-like 2 NM_001004724 olfactory receptor, family 4, subfamily N, member 5 NR_003341 small nucleolar RNA, C/D box 116-27 NM_002472 myosin, heavy chain 8, skeletal muscle, perinatal NR_030347 microRNA 548c NM_006919 serpin peptidase inhibitor, clade B (ovalbumin), member 3 BC046415 zinc finger protein 726 NM_002995 chemokine (C motif) ligand 1 NM_005060 RAR-related orphan receptor C NM_001170905 similar to hCG40110 NM_001004697 olfactory receptor, family 2, subfamily T, member 5 NM_174924 protein disulfide isomerase-like, testis expressed NR_004381 small nucleolar RNA, C/D box 105 NM_203408 family with sequence similarity 47, member A AK131095 FLJ00317 protein NM_177530 sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 NM_023003 transmembrane 6 superfamily member 1 NM_005064 chemokine (C-C motif) ligand 23 AK096036 FLJ38717 protein AY358802 VLGN1945

202

NM_014898 zinc finger protein 30 homolog (mouse) RNA, U5E small nuclear; RNA, U5A small nuclear; RNA, U5F small nuclear; RNA, U5B small NR_002756 nuclear 1; RNA, U5D small nuclear NR_003143 myeloid-associated differentiation marker-like small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar NR_003333 RNA, C/D box 116-20 NM_175857 keratin associated protein 8-1 NM_001013692 PRAME family member 18; PRAME family member 3 NR_002908 small nucleolar RNA, C/D box 20 NM_006994 butyrophilin, subfamily 3, member A3 NM_001001414 non-specific cytotoxic cell receptor protein 1 homolog (zebrafish) NR_003694 small nucleolar RNA, C/D box 11B NM_002551 olfactory receptor, family 3, subfamily A, member 2 NR_024494 breakpoint cluster region pseudogene NR_003048 small nucleolar RNA, C/D box 23 NM_001004740 olfactory receptor, family 5, subfamily M, member 1 NR_003607 cat eye syndrome chromosome region, candidate 8 (non-protein coding) BC112060 chromosome 20 open reading frame 173 NR_027087 hypothetical LOC284632 NM_001130413 sodium channel, nonvoltage-gated 1, delta NM_000846 glutathione S-transferase alpha 2 NM_005577 lipoprotein, Lp(a) AF052121 hypothetical LOC100131510 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar NR_003215 RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 AK093366 hypothetical LOC399884 NM_013447 egf-like module containing, mucin-like, hormone receptor-like 2 NR_021493 hypothetical LOC100144604 NM_002762 protamine 2 NM_001085447 chromosome 2 open reading frame 77 AK294783 BMS1 pseudogene 4 Fc fragment of IgG binding protein; similar to IgGFc-binding protein precursor (FcgammaBP) NM_003890 (Fcgamma-binding protein antigen) NM_001042506 poly(A) binding protein, cytoplasmic 1-like 2A; poly(A) binding protein, cytoplasmic 1-like 2B protein tyrosine phosphatase, non-receptor type 20B; protein tyrosine phosphatase, non-receptor NM_001042389 type 20A NM_001004687 olfactory receptor, family 2, subfamily L, member 3 NM_182603 ankyrin repeat domain 42 small nucleolar RNA, C/D box 18B; small nucleolar RNA, C/D box 18A; small nucleolar RNA, C/D NR_002442 box 18C 203

BC040902 PRAME family member 2 NM_000699 amylase, alpha 2A (pancreatic) T cell receptor alpha constant; T cell receptor alpha locus; T cell receptor alpha variable 20; T cell BC070364 receptor delta locus; T cell receptor delta variable 2 NM_001126334 forkhead box D4-like 5 immunoglobulin lambda variable 2-11; immunoglobulin lambda constant 2 (Kern-Oz- marker); immunoglobulin lambda variable 1-44; immunoglobulin lambda constant 1 (Mcg marker); immunoglobulin lambda variable 1-40; immunoglobulin lambda variable 3-21; immunoglobulin BC071725 lambda locus; immunoglobulin lambda constant 3 (Kern-Oz+ marker) NM_001014450 small proline-rich protein 2F CTAGE family, member 5 pseudogene; CTAGE family member; CTAGE family, member 4; CTAGE NM_005930 family, member 5 NR_026873 non-protein coding RNA 174 acyl-malonyl condensing enzyme 1-like 3; acyl-malonyl condensing enzyme 1-like 2; acyl-malonyl NM_152462 condensing enzyme 1-like 1; acyl-malonyl condensing enzyme 1 NM_021195 claudin 6; similar to claudin 6 tripartite motif-containing protein 64C-like; similar to tripartite motif-containing 43; tripartite motif- NM_001164397 containing protein 64B-like NR_002950 small nucleolar RNA, H/ACA box 2A; small nucleolar RNA, H/ACA box 2B AK095698 hypothetical FLJ38379 NM_175053 keratin 74 AK130278 hypothetical LOC100130876 NM_004174 solute carrier family 9 (sodium/hydrogen exchanger), member 3 NM_138689 protein phosphatase 1, regulatory (inhibitor) subunit 14B AK057520 hypothetical protein LOC100130548 NM_024087 ankyrin repeat and SOCS box-containing 9 NM_001496 GDNF family receptor alpha 3 NM_148674 structural maintenance of chromosomes 1B NM_199136 chromosome 7 open reading frame 46

Table 7‎ .11. Up-regulated genes due to treatment of compound X4 (versus DMSO) on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name

NR_001276 small nucleolar RNA, C/D box 56; small nucleolar RNA, C/D box 56B NM_006014 L antigen family, member 3 NM_001011548 melanoma antigen family A, 4 NM_198477 chemokine (C-X-C motif) ligand 17 NM_203471 lectin, galactoside-binding, soluble, 14 NM_001080469 F-box protein 46 AF357221 DNM1 pseudogene 35 NR_024342 small ILF3/NF90-associated RNA H NR_024243 small ILF3/NF90-associated RNA D NM_001264 corneodesmosin NM_033440 chymotrypsin-like elastase family, member 2A NM_205848 synaptotagmin VI NM_181684 keratin associated protein 12-2 keratin associated protein 4-6; keratin associated protein 4-7; keratin associated protein 4-8; keratin NM_033059 associated protein 4-11 NM_001033018 defensin, beta 136 NM_001006933 transcription elongation factor A (SII)-like 3 NM_001040429 protocadherin 17 AF277230 leukotriene B4 receptor 2 NR_026934 hypothetical LOC152225

204

NM_020721 KIAA1210 BC013184 major histocompatibility complex, class II, DP beta 1 NM_006018 niacin receptor 2; niacin receptor 1 NM_001010845 acyl-CoA synthetase medium-chain family member 2A NR_024258 small ILF3/NF90-associated RNA E NM_001164442 SFRS12-interacting protein 1; family with sequence similarity 159, member B small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar NR_003338 RNA, C/D box 116-20 AK309685 hypothetical LOC644554 NM_005274 guanine nucleotide binding protein (G protein), gamma 5 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar NR_003204 RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NM_022164 tubulointerstitial nephritis antigen-like 1 NR_002966 small nucleolar RNA, H/ACA box 30; small nucleolar RNA, H/ACA box 37 AK130702 hypothetical protein LOC100131910 BC098585 transcription elongation factor A (SII), 2 NM_152721 docking protein 6 AF370414 Ras protein-specific guanine nucleotide-releasing factor 1 NR_024220 small ILF3/NF90-associated RNA C1 NM_033033 keratin 82 NM_178349 late cornified envelope 1B NM_139018 CD300 molecule-like family member f hypothetical LOC100271832; RNA, Ro-associated Y5 pseudogene 10; RNA, Ro-associated Y1; RNA, Ro-associated Y4 pseudogene 7; RNA, Ro-associated Y4 pseudogene 19; RNA, Ro- BC035107 associated Y3; hypothetical LOC100132111; RNA, Ro-associated Y4 U22030 cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 NM_015848 keratin 76 NM_001039213 carcinoembryonic antigen-related cell adhesion molecule 16 NM_006889 CD86 molecule NR_024374 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11-like NM_000584 interleukin 8 NM_002986 chemokine (C-C motif) ligand 11 olfactory receptor, family 11, subfamily H, member 2; olfactory receptor, family 11, subfamily H, member 1; olfactory receptor, family 11, subfamily H, member 13 pseudogene; olfactory receptor, NM_001005239 family 11, subfamily H, member 12 NR_024231 small ILF3/NF90-associated RNA B1 NM_012404 acidic (leucine-rich) nuclear phosphoprotein 32 family, member D nudix (nucleoside diphosphate linked moiety X)-type motif 4; nudix (nucleoside diphosphate linked NR_002212 moiety X)-type motif 4 pseudogene 1 NR_003334 small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D

205

box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar RNA, C/D box 116-20 NM_014429 MORC family CW-type zinc finger 1 NM_001004059 olfactory receptor, family 4, subfamily S, member 2 NM_175834 keratin 79 NM_002159 histatin 1 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar NR_003224 RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, NM_021018 H3c; histone cluster 2, H3d NM_003490 synapsin III NM_001128636 extracellular leucine-rich repeat and fibronectin type III domain containing 1 NR_024004 hypothetical LOC84771 NM_001039361 PRAME family member 10 NM_033401 contactin associated protein-like 4 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar NR_003193 RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 AK123727 FLJ41733 protein NM_001005484 olfactory receptor, family 4, subfamily F, member 5 NR_002601 flavin containing monooxygenase 6 pseudogene similar to hCG26659; immunoglobulin kappa constant; similar to Ig kappa chain V-I region HK102 BC056256 precursor NM_006382 CMT1A duplicated region transcript 1 NM_147198 WAP four-disulfide core domain 9 NM_001037729 defensin, beta 113 AK127183 FLJ45248 protein NR_003291 hypothetical LOC348840 NM_002769 protease, serine, 1 (trypsin 1); trypsinogen C NR_030312 microRNA 548a-1 206

NM_003294 tryptase alpha/beta 1; tryptase beta 2 AK056598 hypothetical LOC151121 NR_026779 chromosome 14 open reading frame 139 NM_001039567 ribosomal protein S4, Y-linked 2 NM_016378 variable charge, X-linked 2 NR_024390 hypothetical LOC646999 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar NR_003209 RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NM_001004063 olfactory receptor, family 4, subfamily K, member 1 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar NR_003206 RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NM_001080440 Otolin-1 NM_005434 mal, T-cell differentiation protein-like U63828 chromosome 20 open reading frame 181 NR_027471 hypothetical LOC440173 NR_015417 hypothetical LOC284276 NM_006955 zinc finger protein 33B NM_018431 docking protein 5 NM_001005469 olfactory receptor, family 5, subfamily B, member 3 NM_207362 chromosome 2 open reading frame 55 NR_003955 embigin homolog (mouse) pseudogene NM_030753 wingless-type MMTV integration site family, member 3 NM_002619 platelet factor 4 NR_023343 RNA, U4atac small nuclear (U12-dependent splicing) NR_024524 cyclin Y-like pseudogene NM_001011718 XK, Kell blood group complex subunit-related family, member 7 NM_003554 olfactory receptor, family 1, subfamily E, member 2 NM_020061 opsin 1 (cone pigments), long-wave-sensitive NM_004420 dual specificity phosphatase 8 AY956760 heat shock protein 90kDa alpha (cytosolic), class A member 4 (pseudogene) NM_001012708 keratin associated protein 5-3 NM_001013646 chromosome 20 open reading frame 107 AF438406 GCRG-P224 NR_003012 small Cajal body-specific RNA 11

207

NR_003186 neutrophil cytosolic factor 1B pseudogene NM_001109878 T-box 22 NM_006446 solute carrier organic anion transporter family, member 1B1 NR_002307 msh homeobox 2 pseudogene 1 NM_002170 interferon, alpha 8 NM_001005275 olfactory receptor, family 4, subfamily A, member 15 BC046248 chromosome X open reading frame 67 NM_021187 cytochrome P450, family 4, subfamily F, polypeptide 11

Table 7‎ .12. Down-regulated genes due to treatment of compound X4 (versus DMSO) on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name

NR_024045 retinoic acid early transcript 1K pseudogene small nucleolar RNA, H/ACA box 11C (retrotransposed); small nucleolar RNA, H/ACA box 11B (retrotransposed); small nucleolar RNA, H/ACA box 11; small nucleolar RNA, H/ACA box 11E; small NR_003710 nucleolar RNA, H/ACA box 11D NR_003694 small nucleolar RNA, C/D box 11B NR_004379 small nucleolar RNA, C/D box 96B; small nucleolar RNA, C/D box 96A NM_024007 early B-cell factor 1 RNA, U5E small nuclear; RNA, U5A small nuclear; RNA, U5F small nuclear; RNA, U5B small NR_002754 nuclear 1; RNA, U5D small nuclear AK310157 retinoic acid early transcript 1G NM_018949 urotensin 2 receptor NR_003046 small nucleolar RNA, C/D box 59B; small nucleolar RNA, C/D box 59A similar to Glycine cleavage system H protein, mitochondrial precursor; glycine cleavage system NM_004483 protein H (aminomethyl carrier); similar to Glycine cleavage system H protein, mitochondrial NM_080825 chromosome 20 open reading frame 144 similar to hCG26659; immunoglobulin kappa constant; similar to Ig kappa chain V-I region HK102 BC056256 precursor NM_000370 tocopherol (alpha) transfer protein histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, NM_003535 H3c; histone cluster 2, H3d NM_021062 histone cluster 1, H2bb NM_001007189 chromosome 5 open reading frame 53 NM_000846 glutathione S-transferase alpha 2 TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa; small nucleolar AK128061 RNA, H/ACA box 32; small nucleolar RNA, H/ACA box 25 NR_003077 small nucleolar RNA, C/D box 99 hCG2042718; chromosome 21 open reading frame 81; ankyrin repeat domain 20 family, member NM_032250 A1; ankyrin repeat domain 20 family, member A3; ankyrin repeat domain 20 family, member A2 NM_001164375 chromosome 10 open reading frame 105 NM_021066 histone cluster 1, H2aj NM_181790 G protein-coupled receptor 142 NM_001004471 olfactory receptor, family 10, subfamily Q, member 1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc- T13); UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 NM_052917 (GalNAc-T1) NM_004093 ephrin-B2 histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; NM_003544 histone cluster 2, H4b NM_016371 hydroxysteroid (17-beta) dehydrogenase 7 histone cluster 1, H2ag; histone cluster 1, H2ah; histone cluster 1, H2ai; histone cluster 1, H2ak; NM_003509 histone cluster 1, H2al; histone cluster 1, H2am

208

NR_003719 neuroblastoma breakpoint family, member 22 (pseudogene) NM_017879 zinc finger protein 416 NM_003429 zinc finger protein 85 speedy homolog E6 (Xenopus laevis); similar to speedy homolog A; speedy homolog E5 (Xenopus NM_175064 laevis); WBSCR19-like protein 8-like; speedy homolog E1 (Xenopus laevis) NR_030302 microRNA 576 NM_152274 family with sequence similarity 58, member A; hypothetical gene supported by NM_152274 NM_148959 HUS1 checkpoint homolog b (S. pombe) NM_020917 zinc finger protein 14 homolog (mouse) NR_026867 zinc finger protein 300 pseudogene NR_003129 ring finger protein 5; ring finger protein 5 pseudogene 1 AF111708 misato homolog 1 (Drosophila) NR_002186 hypothetical protein DKFZp586I1420 AK097187 hypothetical protein LOC285771 NM_032681 SPRY domain containing 5 pseudogene; SPRY domain containing 5; similar to hCG1802386 NR_002436 small nucleolar RNA, H/ACA box 33 BC098585 transcription elongation factor A (SII), 2 histone cluster 1, H2ag; histone cluster 1, H2ah; histone cluster 1, H2ai; histone cluster 1, H2ak; NM_003514 histone cluster 1, H2al; histone cluster 1, H2am NR_026771 hypothetical LOC26082 NM_003513 histone cluster 1, H2ae; histone cluster 1, H2ab histone cluster 1, H2ag; histone cluster 1, H2ah; histone cluster 1, H2ai; histone cluster 1, H2ak; NM_003510 histone cluster 1, H2al; histone cluster 1, H2am NM_005325 histone cluster 1, H1a NM_183387 echinoderm microtubule associated protein like 5 immunoglobulin heavy constant gamma 1 (G1m marker); immunoglobulin heavy constant mu; immunoglobulin heavy variable 3-7; immunoglobulin heavy constant gamma 3 (G3m marker); immunoglobulin heavy variable 3-11 (gene/pseudogene); immunoglobulin heavy variable 4-31; BC009851 immunoglobulin heavy locus BC046415 zinc finger protein 726 NM_003519 histone cluster 1, H2bl NR_027272 chromosome 21 open reading frame 129 olfactory receptor, family 1, subfamily D, member 4; olfactory receptor, family 1, subfamily D, NM_014566 member 5 small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar NR_003328 RNA, C/D box 116-20 NM_012177 F-box protein 5 NR_002957 small nucleolar RNA, H/ACA box 15 NM_001454 forkhead box J1 AK096036 FLJ38717 protein NR_030293 microRNA 568 NR_002307 msh homeobox 2 pseudogene 1 NM_001171197 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) NM_133489 RhoA/RAC/CDC42 exchange factor; solute carrier family 26, member 10 NM_001097622 oncomodulin NM_138286 zinc finger protein 681 NM_017440 Mdm1 nuclear protein homolog (mouse) NM_012404 acidic (leucine-rich) nuclear phosphoprotein 32 family, member D NR_002908 small nucleolar RNA, C/D box 20

209

Table 7‎ .13. Up-regulated genes due to treatment of compound X4 (versus DMSO) on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name

NR_024044 defensin, beta 109, pseudogene 1; defensin, beta 109, pseudogene 1B NM_000704 ATPase, H+/K+ exchanging, alpha polypeptide NR_027042 myelodysplastic syndrome 2 translocation associated NM_001004703 olfactory receptor, family 4, subfamily C, member 46 NM_003251 thyroid hormone responsive (SPOT14 homolog, rat) histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, NM_003536 H3c; histone cluster 2, H3d keratin associated protein 4-6; keratin associated protein 4-7; keratin associated protein 4-8; keratin NM_033059 associated protein 4-11 AK125751 hypothetical protein LOC642316 NM_138801 galactose mutarotase (aldose 1-epimerase) NM_182619 C-type lectin domain family 18, member A NM_014020 transmembrane protein 176B small nucleolar RNA, C/D box 115-8; HBII-52-27 snoRNA; small nucleolar RNA, C/D box 115-9; small nucleolar RNA, C/D box 115-19; small nucleolar RNA, C/D box 115-21; small nucleolar RNA, C/D box 115-20; small nucleolar RNA, C/D box 115-26; small nucleolar RNA, C/D box 115-29; small nucleolar RNA, C/D box 115-23; small nucleolar RNA, C/D box 115-22; small nucleolar RNA, C/D box 115-25; HBII-52-24 snoRNA; small nucleolar RNA, C/D box 115-42; small nucleolar RNA, C/D box 115-43; small nucleolar RNA, C/D box 115-40; small nucleolar RNA, C/D box 115-41; HBII-52- 28 snoRNA; Prader-Willi/Angelman region gene 4; small nucleolar RNA, C/D box 115-48; HBII-52-45 snoRNA; small nucleolar RNA, C/D box 115-44; small nucleolar RNA, C/D box 115-32; small nucleolar RNA, C/D box 115-31; small nucleolar RNA, C/D box 115-30; small nucleolar RNA, C/D box 115-10; small nucleolar RNA, C/D box 115-1; small nucleolar RNA, C/D box 115-14; HBII-52-46 snoRNA; small nucleolar RNA, C/D box 115-39; small nucleolar RNA, C/D box 115-13; small nucleolar RNA, C/D box 115-38; small nucleolar RNA, C/D box 115-12; small nucleolar RNA, C/D box 115-3; small nucleolar RNA, C/D box 115-37; small nucleolar RNA, C/D box 115-11; small nucleolar RNA, C/D box 115-2; small nucleolar RNA, C/D box 115-36; small nucleolar RNA, C/D box 115-5; small nucleolar RNA, C/D box 115-18; small nucleolar RNA, C/D box 115-35; small nucleolar RNA, C/D box 115-4; small nucleolar RNA, C/D box 115-17; small nucleolar RNA, C/D box 115-34; small nucleolar RNA, C/D box 115-7; small nucleolar RNA, C/D box 115-16; small nucleolar RNA, NR_003359 C/D box 115-33; small nucleolar RNA, C/D box 115-6; small nucleolar RNA, C/D box 115-15 NM_021072 hyperpolarization activated cyclic nucleotide-gated potassium channel 1 small nucleolar RNA, C/D box 115-8; HBII-52-27 snoRNA; small nucleolar RNA, C/D box 115-9; small nucleolar RNA, C/D box 115-19; small nucleolar RNA, C/D box 115-21; small nucleolar RNA, C/D box 115-20; small nucleolar RNA, C/D box 115-26; small nucleolar RNA, C/D box 115-29; small nucleolar RNA, C/D box 115-23; small nucleolar RNA, C/D box 115-22; small nucleolar RNA, C/D box 115-25; HBII-52-24 snoRNA; small nucleolar RNA, C/D box 115-42; small nucleolar RNA, C/D box 115-43; small nucleolar RNA, C/D box 115-40; small nucleolar RNA, C/D box 115-41; HBII-52- 28 snoRNA; Prader-Willi/Angelman region gene 4; small nucleolar RNA, C/D box 115-48; HBII-52-45 snoRNA; small nucleolar RNA, C/D box 115-44; small nucleolar RNA, C/D box 115-32; small nucleolar RNA, C/D box 115-31; small nucleolar RNA, C/D box 115-30; small nucleolar RNA, C/D box 115-10; small nucleolar RNA, C/D box 115-1; small nucleolar RNA, C/D box 115-14; HBII-52-46 snoRNA; small nucleolar RNA, C/D box 115-39; small nucleolar RNA, C/D box 115-13; small nucleolar RNA, C/D box 115-38; small nucleolar RNA, C/D box 115-12; small nucleolar RNA, C/D box 115-3; small nucleolar RNA, C/D box 115-37; small nucleolar RNA, C/D box 115-11; small nucleolar RNA, C/D box 115-2; small nucleolar RNA, C/D box 115-36; small nucleolar RNA, C/D box 115-5; small nucleolar RNA, C/D box 115-18; small nucleolar RNA, C/D box 115-35; small nucleolar RNA, C/D box 115-4; small nucleolar RNA, C/D box 115-17; small nucleolar RNA, C/D box 115-34; small nucleolar RNA, C/D box 115-7; small nucleolar RNA, C/D box 115-16; small nucleolar RNA, NR_003357 C/D box 115-33; small nucleolar RNA, C/D box 115-6; small nucleolar RNA, C/D box 115-15 NM_198492 C-type lectin domain family 4, member G NM_198596 sulfatase 2 AK097604 hypothetical LOC100130285 NM_018965 triggering receptor expressed on myeloid cells 2 NM_012367 olfactory receptor, family 2, subfamily B, member 6 G antigen 2A; G antigen 2B; G antigen 12I; G antigen 12F; G antigen 2E; G antigen 12G; G antigen 12D; G antigen 1; G antigen 2C; G antigen 12E; G antigen 2D; G antigen 12B; G antigen 3; G NM_001127212 antigen 4; G antigen 12C; G antigen 5; G antigen 6; G antigen 7; G antigen 8 AK126833 hypothetical protein LOC284475 NM_000432 myosin, light chain 2, regulatory, cardiac, slow

210

NM_005060 RAR-related orphan receptor C NR_003058 small nucleolar RNA, C/D box 70 NM_001011880 C-type lectin domain family 18, member B AK090418 hypothetical LOC349196 NM_000780 cytochrome P450, family 7, subfamily A, polypeptide 1 NM_177530 sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 NM_033142 chorionic gonadotropin, beta polypeptide 7 NR_002145 olfactory receptor, family 2, subfamily L, member 1 pseudogene NM_030904 olfactory receptor, family 2, subfamily T, member 1 NM_030905 olfactory receptor, family 2, subfamily J, member 2 NM_001146344 PRAME family member 11; PRAME family member 9; PRAME family member 15 NM_170745 histone cluster 1, H2aa AY358802 VLGN1945 NM_001143818 serpin peptidase inhibitor, clade B (ovalbumin), member 2 AK125677 similar to cDNA sequence BC021523 AK125677 hypothetical protein LOC100288902 AK125677 hypothetical protein LOC100289296 NR_003143 myeloid-associated differentiation marker-like olfactory receptor, family 11, subfamily H, member 2; olfactory receptor, family 11, subfamily H, member 1; olfactory receptor, family 11, subfamily H, member 13 pseudogene; olfactory receptor, NM_001005239 family 11, subfamily H, member 12 NM_014224 pepsinogen 5, group I (pepsinogen A) NM_012242 dickkopf homolog 1 (Xenopus laevis) NM_001220 calcium/calmodulin-dependent protein kinase II beta NM_001040078 lectin, galactoside-binding, soluble, 9C NR_024409 four and a half LIM domains 1 pseudogene NM_000545 HNF1 homeobox A NR_024591 POM121 membrane glycoprotein-like 1 (rat) pseudogene NM_001004740 olfactory receptor, family 5, subfamily M, member 1 NM_001159522 zinc finger protein 727 olfactory receptor, family 8, subfamily G, member 5; olfactory receptor, family 8, subfamily G, NM_001005198 member 1 NR_003934 GTF2I repeat domain containing 1-like NM_005951 metallothionein 1H small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar NR_003193 RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NR_026795 chromosome 10 open reading frame 51 olfactory receptor, family 8, subfamily U, member 1; olfactory receptor, family 8, subfamily U, NM_001005204 member 8; olfactory receptor, family 8, subfamily U, member 9 NM_001005203 olfactory receptor, family 8, subfamily S, member 1 NR_024387 coxsackie virus and adenovirus receptor pseudogene 2; coxsackie virus and adenovirus receptor NM_001013661 chromosome 1 open reading frame 204; V-set and immunoglobulin domain containing 8 NM_033341 baculoviral IAP repeat-containing 8 AB016901 chromosome 6 open reading frame 123 NM_001103170 arylacetamide deacetylase-like 3

211

AK093366 hypothetical LOC399884 NM_004116 FK506 binding protein 1B, 12.6 kDa NM_003294 tryptase alpha/beta 1; tryptase beta 2 NM_001005496 olfactory receptor, family 5, subfamily D, member 16 NM_003378 VGF nerve growth factor inducible AK303463 ubiquitin specific peptidase 41 NM_001005497 olfactory receptor, family 6, subfamily C, member 75 NM_001124758 spinster homolog 2 (Drosophila) NM_001005500 olfactory receptor, family 4, subfamily M, member 1 NR_026783 blepharophimosis, epicanthus inversus and ptosis, candidate 1 NR_001552 testis-specific transcript, Y-linked 16 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar NR_003206 RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NM_178456 chromosome 20 open reading frame 85 alcohol dehydrogenase 1B (class I), beta polypeptide; alcohol dehydrogenase 1A (class I), alpha NM_000669 polypeptide; alcohol dehydrogenase 1C (class I), gamma polypeptide NM_001631 alkaline phosphatase, intestinal NM_003048 solute carrier family 9 (sodium/hydrogen exchanger), member 2 NM_025237 sclerosteosis NM_002619 platelet factor 4 NM_001081552 sperm associated antigen 11A; sperm associated antigen 11B NM_024893 chromosome 20 open reading frame 39 NR_003578 zinc finger protein 702 pseudogene NM_001004463 olfactory receptor, family 10, subfamily G, member 7 similar to hCG26659; immunoglobulin kappa constant; similar to Ig kappa chain V-I region HK102 BC093097 precursor AF289611 hypothetical protein LOC100128343 NM_020709 PNMA-like 2 NM_001014450 small proline-rich protein 2F NR_027279 deubiquitinating enzyme DUB4 AY972817 olfactory receptor, family 4, subfamily F, member 4 NM_001001915 olfactory receptor, family 2, subfamily G, member 2 NR_015421 hypothetical LOC154761 proline-rich protein BstNI subfamily 1; proline-rich protein BstNI subfamily 2; proline-rich protein NM_006248 BstNI subfamily 4 NM_176823 S100 calcium binding protein A7A AL832294 Rho guanine nucleotide exchange factor (GEF) 1 NM_001005270 olfactory receptor, family 4, subfamily C, member 12 NR_003952 zinc finger protein 479 pseudogene keratin associated protein 2-1; keratin associated protein 2-4; keratin associated protein 2-3; similar NM_001123387 to keratin associated protein 2-4; keratin associated protein 2-2 NM_148674 structural maintenance of chromosomes 1B NR_026663 chromosome 9 open reading frame 70 NM_031963 keratin associated protein 9-8

212

Table 7‎ .14. Down-regulated genes due to treatment of compound X6 (versus DMSO) on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name

NM_033273 zinc finger protein 479; zinc finger protein 733 NM_145276 zinc finger protein 563 AK310157 retinoic acid early transcript 1G triggering receptor expressed on myeloid cells-like 2 pseudogene; triggering receptor expressed on NR_002794 myeloid cells-like 2 AK307291 hypothetical protein LOC100129046 NM_001038628 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) NM_002700 POU class 4 homeobox 3 NM_207317 zinc finger protein 474 NM_006273 chemokine (C-C motif) ligand 7 NR_002784 SMEK homolog 3, suppressor of mek1 (Dictyostelium) pseudogene NR_003073 small nucleolar RNA, C/D box 91B; small nucleolar RNA, C/D box 91A NM_001013736 family with sequence similarity 47, member C NM_004979 potassium voltage-gated channel, Shal-related subfamily, member 1 NM_000085 chloride channel Kb Fc fragment of IgG, high affinity Ic, receptor (CD64); Fc fragment of IgG, high affinity Ia, receptor NM_000566 (CD64) NM_001080487 similar to poly(A)binding protein nuclear-like 1 NM_021269 zinc finger protein 708 NM_000184 hemoglobin, gamma G golgi autoantigen, golgin subfamily a, 6C; golgi autoantigen, golgin subfamily a, 6 pseudogene; golgi NR_027024 autoantigen, golgin subfamily a, 6D; golgi autoantigen, golgin subfamily a, 6 NM_001900 cystatin D BC009987 collapsin response mediator protein 1 NR_003064 peptide YY, 2 (seminalplasmin) NM_031313 alkaline phosphatase, placental-like 2 NR_003341 small nucleolar RNA, C/D box 116-27 NM_002472 myosin, heavy chain 8, skeletal muscle, perinatal NM_203408 family with sequence similarity 47, member A small nucleolar RNA, H/ACA box 11C (retrotransposed); small nucleolar RNA, H/ACA box 11B (retrotransposed); small nucleolar RNA, H/ACA box 11; small nucleolar RNA, H/ACA box 11E; small NR_002953 nucleolar RNA, H/ACA box 11D NM_001161425 zinc finger protein 610 NM_004857 A kinase (PRKA) anchor protein 5 NR_002908 small nucleolar RNA, C/D box 20 NM_006994 butyrophilin, subfamily 3, member A3 NM_021118 cylicin, basic protein of sperm head cytoskeleton 1 BC062704 immunoglobulin kappa locus NM_130776 XAGE-4 protein; X antigen family, member 3 NM_003301 thyrotropin-releasing hormone receptor NM_153015 transmembrane protein 74 NR_003694 small nucleolar RNA, C/D box 11B NM_001001412 calcium homeostasis modulator 1 NM_130808 copine IV NR_003602 FK506 binding protein 6, 36kDa pseudogene NR_003599 chymosin pseudogene NR_003048 small nucleolar RNA, C/D box 23 NM_001034172 mitochondrial carrier triple repeat 2 NM_021013 keratin 34 NM_001130413 sodium channel, nonvoltage-gated 1, delta olfactory receptor, family 2, subfamily A, member 1; olfactory receptor, family 2, subfamily A, NM_001005287 member 42

213

AK128005 hypothetical protein LOC100129869 AF052121 hypothetical LOC100131510 NM_001099694 zinc finger protein 578 NM_001122757 POU class 1 homeobox 1 NM_001085447 chromosome 2 open reading frame 77 NM_013256 zinc finger protein 180 NM_001145718 cancer/testis antigen family 147, member B1 NR_027073 hypothetical protein LOC283731 NM_001042506 poly(A) binding protein, cytoplasmic 1-like 2A; poly(A) binding protein, cytoplasmic 1-like 2B NR_026640 makorin ring finger protein 1 pseudogene NM_020769 retrotransposon gag domain containing 1 NM_001145712 hypothetical protein LOC389493 NM_001145197 FAM75-like protein FLJ43859 BC040902 PRAME family member 2 NM_173568 uromodulin-like 1 NM_001001914 olfactory receptor, family 2, subfamily G, member 3 NM_170776 G protein-coupled receptor 97 Z26248 proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) NM_000145 follicle stimulating hormone receptor tripartite motif-containing protein 64C-like; similar to tripartite motif-containing 43; tripartite motif- NM_001164397 containing protein 64B-like NR_002950 small nucleolar RNA, H/ACA box 2A; small nucleolar RNA, H/ACA box 2B AK093042 similar to LOC285679 protein NM_004174 solute carrier family 9 (sodium/hydrogen exchanger), member 3 NR_026866 chromosome 3 open reading frame 49 NM_012465 tolloid-like 2 NR_003951 ADAM metallopeptidase domain 21 pseudogene; ADAM metallopeptidase domain 21 NM_148674 structural maintenance of chromosomes 1B NM_007227 G protein-coupled receptor 45

Table 7‎ .15. Up-regulated genes due to treatment of compound X6 (versus DMSO) on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name

NR_024045 retinoic acid early transcript 1K pseudogene NR_002815 TPTE and PTEN homologous inositol lipid phosphatase pseudogene NR_024591 POM121 membrane glycoprotein-like 1 (rat) pseudogene NM_002309 leukemia inhibitory factor (cholinergic differentiation factor) NR_003190 TL132 pseudogene NM_001824 creatine kinase, muscle NM_001005484 olfactory receptor, family 4, subfamily F, member 5 AK124942 hypothetical protein LOC727808 histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, NM_003536 H3c; histone cluster 2, H3d NM_001264 corneodesmosin NM_000517 hemoglobin, alpha 2; hemoglobin, alpha 1 NR_002825 sialic acid binding Ig-like lectin 16 (gene/pseudogene) NM_033199 urocortin 2 NM_001033018 defensin, beta 136 NM_173619 C-type lectin domain family 18, member C

214

NM_001029886 profilin 3 NM_006300 zinc finger protein 230 AF277230 leukotriene B4 receptor 2 NR_026934 hypothetical LOC152225 NM_198968 DAZ interacting protein 1 NM_032487 actin related protein M1 NM_182619 C-type lectin domain family 18, member A NM_020721 KIAA1210 WAS protein family homolog 3 pseudogene; WAS protein family homolog 2 pseudogene; WAS NR_003659 protein family homolog 1; WAS protein family homolog 5 pseudogene NM_001170 aquaporin 7 NM_152475 zinc finger protein 417 NM_001012753 zinc finger protein 763 NM_001164442 SFRS12-interacting protein 1; family with sequence similarity 159, member B small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar NR_003338 RNA, C/D box 116-20 NM_005274 guanine nucleotide binding protein (G protein), gamma 5 NM_006955 zinc finger protein 33B NM_198504 progestin and adipoQ receptor family member IX NM_001024675 chromosome 20 open reading frame 134 NM_014601 EH-domain containing 2 NM_213656 keratin 39 NM_022164 tubulointerstitial nephritis antigen-like 1 NM_005362 melanoma antigen family A, 3 BC098585 transcription elongation factor A (SII), 2 NM_003469 secretogranin II (chromogranin C) NR_026770 chromosome 17 open reading frame 88 NR_024220 small ILF3/NF90-associated RNA C1 NM_152621 sphingomyelin synthase 2 BC092449 immunoglobulin heavy constant alpha 1 small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar NR_003328 RNA, C/D box 116-20 NM_005261 GTP binding protein overexpressed in skeletal muscle NM_006143 G protein-coupled receptor 19 NM_001039213 carcinoembryonic antigen-related cell adhesion molecule 16 NR_004389 small nucleolar RNA, H/ACA box 16B; small nucleolar RNA, H/ACA box 16A NM_018937 protocadherin beta 3 NR_003012 small Cajal body-specific RNA 11 NR_003186 neutrophil cytosolic factor 1B pseudogene NM_006446 solute carrier organic anion transporter family, member 1B1 NM_005373 myeloproliferative leukemia virus oncogene

215

NR_002961 small nucleolar RNA, H/ACA box 22 NR_002307 msh homeobox 2 pseudogene 1 NR_003952 zinc finger protein 479 pseudogene NM_000584 interleukin 8 NR_027094 synaptotagmin XIV-like NM_001080423 glutamate receptor interacting protein 2 AK309475 integrin alpha FG-GAP repeat containing 1 NM_001080424 lysine (K)-specific demethylase 6B olfactory receptor, family 11, subfamily H, member 2; olfactory receptor, family 11, subfamily H, member 1; olfactory receptor, family 11, subfamily H, member 13 pseudogene; olfactory receptor, NM_001005239 family 11, subfamily H, member 12 NM_021189 cell adhesion molecule 3 small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar NR_003337 RNA, C/D box 116-20 NR_002713 neuropeptide Y receptor Y6 (pseudogene) NM_012242 dickkopf homolog 1 (Xenopus laevis) small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar NR_003334 RNA, C/D box 116-20

Table 7‎ .16. Down-regulated genes due to treatment of compound X6 (versus DMSO) on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name

NR_024045 retinoic acid early transcript 1K pseudogene AK126895 hypothetical LOC100129111 NM_006669 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 NM_024007 early B-cell factor 1 NM_001142935 MAX dimerization protein 3 NM_057749 cyclin E2 AY358245 AGVR6190 NM_024908 WD repeat domain 76 NM_005097 leucine-rich, glioma inactivated 1 NM_020675 SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) NM_130398 exonuclease 1 NM_001009613 SPANX family, member N4 NM_005915 minichromosome maintenance complex component 6 histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, H3c; NM_003533 histone cluster 2, H3d

216

BC036640 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6 histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; NM_003538 histone cluster 2, H4b NM_000370 tocopherol (alpha) transfer protein histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, H3c; NM_003535 histone cluster 2, H3d NM_020937 Fanconi anemia, complementation group M NM_021062 histone cluster 1, H2bb TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa; small nucleolar RNA, AK128061 H/ACA box 32; small nucleolar RNA, H/ACA box 25 NM_024016 homeobox B8 AL162052 hypothetical LOC100134040 NM_021066 histone cluster 1, H2aj NM_001136504 synaptotagmin II NR_001591 TPTE pseudogene NR_003007 small Cajal body-specific RNA 22; small Cajal body-specific RNA 23 NM_004091 E2F transcription factor 2 histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; NM_003544 histone cluster 2, H4b NM_173812 dpy-19-like 2 (C. elegans) histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; NM_003546 histone cluster 2, H4b NR_001446 annexin A2 pseudogene 3; annexin A2; annexin A2 pseudogene 1 NR_003558 WW domain binding protein 11 pseudogene 1 NR_024259 hypothetical LOC728606 NM_001085476 forkhead box D4-like 6 NR_003676 otoancorin pseudogene NM_001080449 DNA replication helicase 2 homolog (yeast) AF111708 misato homolog 1 (Drosophila) NM_032336 GINS complex subunit 4 (Sld5 homolog) AJ420506 translocase of outer mitochondrial membrane 6 homolog (yeast) BC098585 transcription elongation factor A (SII), 2 histone cluster 1, H2ag; histone cluster 1, H2ah; histone cluster 1, H2ai; histone cluster 1, H2ak; NM_003514 histone cluster 1, H2al; histone cluster 1, H2am NM_003513 histone cluster 1, H2ae; histone cluster 1, H2ab NM_016307 paired related homeobox 2 NM_031313 alkaline phosphatase, placental-like 2 NM_001001954 olfactory receptor, family 5, subfamily A, member 2 histone cluster 1, H2ag; histone cluster 1, H2ah; histone cluster 1, H2ai; histone cluster 1, H2ak; NM_003510 histone cluster 1, H2al; histone cluster 1, H2am NR_002970 small nucleolar RNA, H/ACA box 30; small nucleolar RNA, H/ACA box 37 proline-rich protein BstNI subfamily 1; proline-rich protein BstNI subfamily 2; proline-rich protein BstNI NM_002723 subfamily 4 NM_182506 melanoma antigen family B, 10 NM_018063 helicase, lymphoid-specific NM_003519 histone cluster 1, H2bl small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar NR_003328 RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; 217

small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar RNA, C/D box 116-20 NM_203402 fat storage-inducing transmembrane protein 1 NM_012177 F-box protein 5 NM_001104587 schlafen family member 11 NM_012378 olfactory receptor, family 8, subfamily B, member 8 NR_001527 testis-specific transcript, Y-linked 6; testis-specific transcript, Y-linked 6B AK096036 FLJ38717 protein NM_199352 solute carrier family 22, member 25 NM_003524 histone cluster 1, H2bh NR_024376 chromosome 9 open reading frame 110 NR_030293 microRNA 568 AY662656 sporadic kidney cancer gene 1 NM_003521 histone cluster 1, H2bm NM_031921 similar to AAA-ATPase TOB3; ATPase family, AAA domain containing 3B NM_025004 coiled-coil domain containing 15 NM_020742 neuroligin 4, X-linked NM_001002236 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 NM_012404 acidic (leucine-rich) nuclear phosphoprotein 32 family, member D histone cluster 1, H4l; histone cluster 1, H4k; histone cluster 4, H4; histone cluster 1, H4h; histone cluster 1, H4j; histone cluster 1, H4i; histone cluster 1, H4d; histone cluster 1, H4c; histone cluster 1, H4f; histone cluster 1, H4e; histone cluster 1, H4b; histone cluster 1, H4a; histone cluster 2, H4a; NM_021968 histone cluster 2, H4b small nucleolar RNA, H/ACA box 11C (retrotransposed); small nucleolar RNA, H/ACA box 11B (retrotransposed); small nucleolar RNA, H/ACA box 11; small nucleolar RNA, H/ACA box 11E; small NR_003710 nucleolar RNA, H/ACA box 11D NM_014109 ATPase family, AAA domain containing 2 NM_178470 WD repeat domain 40B NM_015656 kinesin family member 26A NM_000946 primase, DNA, polypeptide 1 (49kDa) NM_052945 tumor necrosis factor receptor superfamily, member 13C NM_001130862 RAD51 associated protein 1 POM121 membrane glycoprotein-like 7 (rat); POM121 membrane glycoprotein-like 4 pseudogene (rat); POM121 membrane glycoprotein-like 3 (rat) pseudogene; POM121 membrane glycoprotein-like NR_024592 10 (rat) pseudogene; similar to nuclear pore membrane protein 121 NM_003579 RAD54-like (S. cerevisiae) NM_014264 polo-like kinase 4 (Drosophila) speedy homolog E6 (Xenopus laevis); similar to speedy homolog A; speedy homolog E5 (Xenopus NM_001099435 laevis); WBSCR19-like protein 8-like; speedy homolog E1 (Xenopus laevis) AF452720 hypothetical LOC729040 small nucleolar RNA, H/ACA box 36A; small nucleolar RNA, H/ACA box 36B; small nucleolar RNA, NR_003705 H/ACA box 36C (retrotransposed) NR_027157 hypothetical protein LOC100128191 NM_005441 chromatin assembly factor 1, subunit B (p60) NM_173351 olfactory receptor, family 6, subfamily B, member 3 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar RNA, C/D box 114-19; small nucleolar NR_003210 RNA, C/D box 114-18 NM_177551 niacin receptor 2; niacin receptor 1

218

NM_001764 CD1b molecule TCR gamma alternate reading frame protein; T cell receptor gamma variable 9; T cell receptor gamma BC030554 constant 1 AK055745 hypothetical gene supported by AK055745 NM_006300 zinc finger protein 230 NR_004845 cytoplasmic beta-actin pseudogene NM_001004471 olfactory receptor, family 10, subfamily Q, member 1 NR_002929 actin pseudogene histone cluster 1, H2ag; histone cluster 1, H2ah; histone cluster 1, H2ai; histone cluster 1, H2ak; NM_003509 histone cluster 1, H2al; histone cluster 1, H2am NM_001004476 olfactory receptor, family 10, subfamily K, member 2 NM_182751 minichromosome maintenance complex component 10 NM_018132 centromere protein Q NR_003719 neuroblastoma breakpoint family, member 22 (pseudogene) NM_175065 histone cluster 2, H2ab NM_003608 G protein-coupled receptor 65 NM_152279 zinc finger protein 585B NM_198690 keratin associated protein 10-9 NM_005330 hemoglobin, epsilon 1 AY358648 GKGM353 NM_020061 opsin 1 (cone pigments), long-wave-sensitive NM_005225 E2F transcription factor 1 NM_182687 protein kinase, membrane associated tyrosine/threonine 1 NM_005325 histone cluster 1, H1a NM_022111 claspin homolog (Xenopus laevis) NM_001039876 chromosome 19 open reading frame 46 NM_153695 zinc finger protein 367 NM_001238 cyclin E1 NM_012074 D4, zinc and double PHD fingers, family 3 NM_005427 tumor protein p73 NM_148961 otospiralin NM_020813 zinc finger protein 471 NR_002997 small Cajal body-specific RNA 1 NM_001012968 spindlin family, member 4 BX647655 DKFZp451A211 protein NM_138693 Kruppel-like factor 14 hypothetical LOC729505; similar to hCG2040565; high-mobility group nucleosomal binding domain 2; NM_005517 similar to high-mobility group nucleosomal binding domain 2 NM_005322 histone cluster 1, H1b NM_005319 histone cluster 1, H1c NM_033518 solute carrier family 38, member 5 NM_173635 hypothetical protein FLJ40235 NM_020880 zinc finger protein 530 NM_138286 zinc finger protein 681 NM_000298 pyruvate kinase, liver and RBC NM_003978 proline-serine-threonine phosphatase interacting protein 1

Table 7‎ .17. Up-regulated genes due to treatment of compound X6 (versus DMSO) on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name NR_002815 TPTE and PTEN homologous inositol lipid phosphatase pseudogene NM_017709 family with sequence similarity 46, member C DQ656060 PFTAIRE protein kinase 1

219

NM_002309 leukemia inhibitory factor (cholinergic differentiation factor) NM_138938 regenerating islet-derived 3 alpha NM_001159293 zinc finger protein 737 NM_078487 cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) NM_001164457 zinc finger protein 705G-like NM_080865 G protein-coupled receptor 62 NR_004405 laminin, beta 2-like histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, H3c; NM_003536 histone cluster 2, H3d NM_145064 SH3 and cysteine rich domain 3 NM_000887 integrin, alpha X (complement component 3 receptor 4 subunit) NM_001004706 olfactory receptor, family 4, subfamily D, member 11 NM_003155 stanniocalcin 1 NM_006732 FBJ murine osteosarcoma viral oncogene homolog B NM_001135599 transforming growth factor, beta 2 NM_000911 opioid receptor, delta 1 tripartite motif-containing 53; similar to Tripartite motif protein 49 (RING finger protein 18) (Testis- specific ring-finger protein); similar to ring finger protein 18; similar to hCG1988749; tripartite motif- NM_020358 containing 49; tripartite motif-containing 48; hypothetical protein LOC100131392 NM_002006 fibroblast growth factor 2 (basic) NM_182898 cAMP responsive element binding protein 5 NM_021068 interferon, alpha 4 NM_006472 thioredoxin interacting protein NM_002214 integrin, beta 8 BC016954 solute carrier family 25 (mitochondrial carrier), member 18 NM_001006939 leucine rich repeat containing 18 NR_003073 small nucleolar RNA, C/D box 91B; small nucleolar RNA, C/D box 91A NM_024164 tryptase alpha/beta 1; tryptase beta 2 small nucleolar RNA, C/D box 115-8; HBII-52-27 snoRNA; small nucleolar RNA, C/D box 115-9; small nucleolar RNA, C/D box 115-19; small nucleolar RNA, C/D box 115-21; small nucleolar RNA, C/D box 115-20; small nucleolar RNA, C/D box 115-26; small nucleolar RNA, C/D box 115-29; small nucleolar RNA, C/D box 115-23; small nucleolar RNA, C/D box 115-22; small nucleolar RNA, C/D box 115-25; HBII-52-24 snoRNA; small nucleolar RNA, C/D box 115-42; small nucleolar RNA, C/D box 115-43; small nucleolar RNA, C/D box 115-40; small nucleolar RNA, C/D box 115-41; HBII-52-28 snoRNA; Prader-Willi/Angelman region gene 4; small nucleolar RNA, C/D box 115-48; HBII-52-45 snoRNA; small nucleolar RNA, C/D box 115-44; small nucleolar RNA, C/D box 115-32; small nucleolar RNA, C/D box 115-31; small nucleolar RNA, C/D box 115-30; small nucleolar RNA, C/D box 115-10; small nucleolar RNA, C/D box 115-1; small nucleolar RNA, C/D box 115-14; HBII-52-46 snoRNA; small nucleolar RNA, C/D box 115-39; small nucleolar RNA, C/D box 115-13; small nucleolar RNA, C/D box 115-38; small nucleolar RNA, C/D box 115-12; small nucleolar RNA, C/D box 115-3; small nucleolar RNA, C/D box 115-37; small nucleolar RNA, C/D box 115-11; small nucleolar RNA, C/D box 115-2; small nucleolar RNA, C/D box 115-36; small nucleolar RNA, C/D box 115-5; small nucleolar RNA, C/D box 115-18; small nucleolar RNA, C/D box 115-35; small nucleolar RNA, C/D box 115-4; small nucleolar RNA, C/D box 115-17; small nucleolar RNA, C/D box 115-34; small nucleolar RNA, C/D box 115-7; small nucleolar RNA, C/D box 115-16; small nucleolar RNA, C/D box 115-33; small nucleolar NR_003359 RNA, C/D box 115-6; small nucleolar RNA, C/D box 115-15 NM_021072 hyperpolarization activated cyclic nucleotide-gated potassium channel 1 NR_024027 non-protein coding RNA 158 NM_019058 DNA-damage-inducible transcript 4 NM_018965 triggering receptor expressed on myeloid cells 2 NM_001032392 plasminogen-like B2; plasminogen-like B1 NM_005272 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 BC039000 cyclin Y-like 2 AF400494 small nuclear ribonucleoprotein polypeptide N; SNRPN upstream reading frame NM_001003940 Bcl2 modifying factor NM_012367 olfactory receptor, family 2, subfamily B, member 6 NM_006079 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 NM_170732 brain-derived neurotrophic factor

220

AK095288 small nucleolar RNA, H/ACA box 21 NM_031459 sestrin 2 AK093292 hypothetical protein LOC283501 AK090412 ankyrin repeat domain 20 family, member A pseudogene NM_203403 chromosome 9 open reading frame 150 T cell receptor alpha constant; T cell receptor alpha locus; T cell receptor alpha variable 20; T cell BC110354 receptor delta locus; T cell receptor delta variable 2 small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D NR_003327 box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar RNA, C/D box 116-20 NM_001011880 C-type lectin domain family 18, member B NM_005261 GTP binding protein overexpressed in skeletal muscle BC150574 chromosome 4 open reading frame 47 NM_005260 growth differentiation factor 9 NM_001706 B-cell CLL/lymphoma 6 NR_004389 small nucleolar RNA, H/ACA box 16B; small nucleolar RNA, H/ACA box 16A NM_054032 MAS-related GPR, member X4 NM_030904 olfactory receptor, family 2, subfamily T, member 1 NM_001146344 PRAME family member 11; PRAME family member 9; PRAME family member 15 AY358802 VLGN1945 NM_001143818 serpin peptidase inhibitor, clade B (ovalbumin), member 2 NM_001206 Kruppel-like factor 9 NM_000584 interleukin 8 AK093382 hypothetical protein LOC283887 NM_001554 cysteine-rich, angiogenic inducer, 61 NM_001004690 olfactory receptor, family 2, subfamily M, member 5 NM_001296 chemokine binding protein 2 NM_014224 pepsinogen 5, group I (pepsinogen A) NM_012242 dickkopf homolog 1 (Xenopus laevis) NM_144586 LY6/PLAUR domain containing 1 NM_003679 kynurenine 3-monooxygenase (kynurenine 3-hydroxylase) NR_024409 four and a half LIM domains 1 pseudogene NM_145804 ankyrin repeat and BTB (POZ) domain containing 2 NM_002550 olfactory receptor, family 3, subfamily A, member 1 NM_001126049 killin protein NM_001039362 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 NM_001004740 olfactory receptor, family 5, subfamily M, member 1 NM_005951 metallothionein 1H NM_032211 lysyl oxidase-like 4 NM_003389 coronin, actin binding protein, 2A small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar NR_003193 RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small

221

nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NM_001964 early growth response 1 NM_001161334 histone cluster 2, H2bf NR_026795 chromosome 10 open reading frame 51 NM_001159323 phospholipase A2, group IVC (cytosolic, calcium-independent) NM_001217 carbonic anhydrase XI small nucleolar RNA, H/ACA box 70C (retrotransposed); small nucleolar RNA, H/ACA box 70; small NR_003707 nucleolar RNA, H/ACA box 70B (retrotransposed) NR_026790 HLA complex group 11 NM_001103170 arylacetamide deacetylase-like 3 NM_005639 synaptotagmin I NM_013447 egf-like module containing, mucin-like, hormone receptor-like 2 NM_032034 solute carrier family 4, sodium borate transporter, member 11 NM_032961 protocadherin 10 NM_145010 enkurin, TRPC channel interacting protein NM_003378 VGF nerve growth factor inducible NM_213607 coiled-coil domain containing 103 NM_001008949 inositol 1,4,5-triphosphate receptor interacting protein-like 1 NM_138720 histone cluster 1, H2bd NM_000036 adenosine monophosphate deaminase 1 (isoform M) NR_002171 olfactory receptor, family 7, subfamily E, member 156 pseudogene protein tyrosine phosphatase, non-receptor type 20B; protein tyrosine phosphatase, non-receptor type NM_001042389 20A NM_003476 cysteine and glycine-rich protein 3 (cardiac LIM protein) NM_013451 myoferlin NM_020989 crystallin, gamma C NM_015675 growth arrest and DNA-damage-inducible, beta NR_003244 highly accelerated region 1A (non-protein coding) NM_001135242 N-myc downstream regulated 1 NM_020801 arrestin domain containing 3 AK054937 hypothetical protein LOC440982 NM_002619 platelet factor 4 NM_033210 zinc finger protein 502 NM_212555 prostate and testis expressed 2 NM_004385 versican AF289611 hypothetical protein LOC100128343 NM_003948 cyclin-dependent kinase-like 2 (CDC2-related kinase) NM_004420 dual specificity phosphatase 8 NM_001001915 olfactory receptor, family 2, subfamily G, member 2 NM_031957 keratin associated protein 1-5 NM_001009565 cyclin-dependent kinase-like 4 REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 3 (pseudogene); REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 2 (pseudogene); REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 6 (pseudogene); REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 8; REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 7 (pseudogene); REX1, RNA exonuclease 1 homolog (S. cerevisiae)- NM_172239 like 5 (pseudogene); REX1, RNA exonuclease 1 homolog (S. cerevisiae)-like 1 NR_015421 hypothetical LOC154761 NM_002421 matrix metallopeptidase 1 (interstitial collagenase) NR_026552 non-protein coding RNA 161 NM_153607 chromosome 5 open reading frame 41 NM_178827 IQ motif and ubiquitin domain containing NR_002950 small nucleolar RNA, H/ACA box 2A; small nucleolar RNA, H/ACA box 2B NR_002594 SLC7A5 pseudogene NM_001037499 defensin, beta 114

222

keratin associated protein 2-1; keratin associated protein 2-4; keratin associated protein 2-3; similar to NM_001165252 keratin associated protein 2-4; keratin associated protein 2-2 proline-rich protein BstNI subfamily 1; proline-rich protein BstNI subfamily 2; proline-rich protein BstNI NM_006248 subfamily 4 NM_006186 nuclear receptor subfamily 4, group A, member 2 NM_001004458 olfactory receptor, family 1, subfamily S, member 1 NM_080759 dachshund homolog 1 (Drosophila) NM_170685 tachykinin 4 (hemokinin) NM_148674 structural maintenance of chromosomes 1B AK057085 hypothetical LOC440149 NM_004102 fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)

Table 7‎ .18. Down-regulated genes due to treatment of compound X4 versus X6 on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name NM_033273 zinc finger protein 479; zinc finger protein 733 NR_001276 small nucleolar RNA, C/D box 56; small nucleolar RNA, C/D box 56B NM_006014 L antigen family, member 3 NM_145276 zinc finger protein 563 NM_203374 zinc finger protein 784 NM_021057 interferon, alpha 7 NM_203471 lectin, galactoside-binding, soluble, 14 NM_001105576 ankyrin repeat domain 58 AF357221 DNM1 pseudogene 35 NM_005995 T-box 10 NM_000369 thyroid stimulating hormone receptor AK126744 hypothetical FLJ44790 similar to hCG2042724; similar to HLA class II histocompatibility antigen, DQ(1) alpha chain precursor NM_002122 (DC-4 alpha chain); major histocompatibility complex, class II, DQ alpha 1 NM_033440 chymotrypsin-like elastase family, member 2A NM_001025389 adenosine monophosphate deaminase (isoform E) NM_022039 F-box and WD repeat domain containing 4 keratin associated protein 4-6; keratin associated protein 4-7; keratin associated protein 4-8; keratin NM_033059 associated protein 4-11 NM_001145641 hypothetical protein LOC100170229 NM_032534 KRAB-A domain containing 1 NR_026740 placenta-specific 9 pseudogene AK130248 hypothetical protein LOC100129233 NM_007156 zinc finger, X-linked, duplicated A BC013184 major histocompatibility complex, class II, DP beta 1 NM_003433 zinc finger protein 132 NR_024351 non-protein coding RNA 160 AK094945 hypothetical protein LOC285500 Fc fragment of IgG, high affinity Ic, receptor (CD64); Fc fragment of IgG, high affinity Ia, receptor NM_000566 (CD64) NR_001446 annexin A2 pseudogene 3; annexin A2; annexin A2 pseudogene 1 NM_001001963 olfactory receptor, family 2, subfamily L, member 8 NM_054112 defensin, beta 118 NM_001146037 solute carrier family 14 (urea transporter), member 1 (Kidd blood group) NM_001900 cystatin D NM_057091 artemin AK309685 hypothetical LOC644554 AY358263 AHPA9419 NR_003204 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D

223

box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NM_013361 zinc finger protein 223 NR_002966 small nucleolar RNA, H/ACA box 30; small nucleolar RNA, H/ACA box 37 AK130702 hypothetical protein LOC100131910 NM_004657 serum deprivation response (phosphatidylserine binding protein) NM_001008409 tubulin tyrosine ligase-like family, member 9 similar to hCG26659; immunoglobulin kappa constant; similar to Ig kappa chain V-I region HK102 BC110292 precursor small nucleolar RNA, C/D box 115-8; HBII-52-27 snoRNA; small nucleolar RNA, C/D box 115-9; small nucleolar RNA, C/D box 115-19; small nucleolar RNA, C/D box 115-21; small nucleolar RNA, C/D box 115-20; small nucleolar RNA, C/D box 115-26; small nucleolar RNA, C/D box 115-29; small nucleolar RNA, C/D box 115-23; small nucleolar RNA, C/D box 115-22; small nucleolar RNA, C/D box 115-25; HBII-52-24 snoRNA; small nucleolar RNA, C/D box 115-42; small nucleolar RNA, C/D box 115-43; small nucleolar RNA, C/D box 115-40; small nucleolar RNA, C/D box 115-41; HBII-52-28 snoRNA; Prader-Willi/Angelman region gene 4; small nucleolar RNA, C/D box 115-48; HBII-52-45 snoRNA; small nucleolar RNA, C/D box 115-44; small nucleolar RNA, C/D box 115-32; small nucleolar RNA, C/D box 115-31; small nucleolar RNA, C/D box 115-30; small nucleolar RNA, C/D box 115-10; small nucleolar RNA, C/D box 115-1; small nucleolar RNA, C/D box 115-14; HBII-52-46 snoRNA; small nucleolar RNA, C/D box 115-39; small nucleolar RNA, C/D box 115-13; small nucleolar RNA, C/D box 115-38; small nucleolar RNA, C/D box 115-12; small nucleolar RNA, C/D box 115-3; small nucleolar RNA, C/D box 115-37; small nucleolar RNA, C/D box 115-11; small nucleolar RNA, C/D box 115-2; small nucleolar RNA, C/D box 115-36; small nucleolar RNA, C/D box 115-5; small nucleolar RNA, C/D box 115-18; small nucleolar RNA, C/D box 115-35; small nucleolar RNA, C/D box 115-4; small nucleolar RNA, C/D box 115-17; small nucleolar RNA, C/D box 115-34; small nucleolar RNA, C/D box 115-7; small nucleolar RNA, C/D box 115-16; small nucleolar RNA, C/D box 115-33; small nucleolar NR_003347 RNA, C/D box 115-6; small nucleolar RNA, C/D box 115-15 NM_133639 ras homolog gene family, member V NM_033033 keratin 82 NM_139018 CD300 molecule-like family member f NM_001131065 Rieske (Fe-S) domain containing NM_002784 pregnancy specific beta-1-glycoprotein 9 U22030 cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 NR_027019 non-protein coding RNA 164 NR_024418 hypothetical LOC389332 small nucleolar RNA, H/ACA box 11C (retrotransposed); small nucleolar RNA, H/ACA box 11B (retrotransposed); small nucleolar RNA, H/ACA box 11; small nucleolar RNA, H/ACA box 11E; small NR_002953 nucleolar RNA, H/ACA box 11D NM_001161425 zinc finger protein 610 AK125573 hypothetical gene supported by AK125573 NR_024563 hypothetical LOC100130238 NM_002277 keratin 31 NM_014429 MORC family CW-type zinc finger 1 NM_207345 C-type lectin domain family 9, member A small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, NR_003220 C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small 224

nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NM_130776 XAGE-4 protein; X antigen family, member 3 NM_020389 transient receptor potential cation channel, subfamily C, member 7 NM_002159 histatin 1 POM121 membrane glycoprotein-like 7 (rat); POM121 membrane glycoprotein-like 4 pseudogene (rat); POM121 membrane glycoprotein-like 3 (rat) pseudogene; POM121 membrane glycoprotein-like NR_024593 10 (rat) pseudogene; similar to nuclear pore membrane protein 121 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar RNA, C/D box 114-19; small nucleolar NR_003224 RNA, C/D box 114-18 NM_001004748 olfactory receptor, family 51, subfamily A, member 2 NM_033337 caveolin 3 NM_003490 synapsin III NM_005250 forkhead box L1 NM_001099287 NIPA-like domain containing 4 AK127830 FLJ45933 protein NM_000641 interleukin 11 NM_001039361 PRAME family member 10 NM_005304 free fatty acid receptor 3 NM_033401 contactin associated protein-like 4 NR_027258 non-protein coding RNA 117 NM_006382 CMT1A duplicated region transcript 1 NM_147198 WAP four-disulfide core domain 9 NR_026703 vault RNA 1-3; vault RNA 1-1; vault RNA 1-2 AK127183 FLJ45248 protein NM_080431 actin-related protein T2 NM_005382 neurofilament, medium polypeptide NM_002769 protease, serine, 1 (trypsin 1); trypsinogen C NM_001113475 chromosome 14 open reading frame 148 NM_003294 tryptase alpha/beta 1; tryptase beta 2 NM_000238 potassium voltage-gated channel, subfamily H (eag-related), member 2 NR_026779 chromosome 14 open reading frame 139 NM_001039567 ribosomal protein S4, Y-linked 2 NM_016378 variable charge, X-linked 2 NM_015672 RIMS binding protein 3B; RIMS binding protein 3C; RIMS binding protein 3 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, NR_003209 C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small

225

nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar RNA, C/D box 114-19; small nucleolar RNA, C/D box 114-18 NM_001080440 Otolin-1 small nucleolar RNA, C/D box 114-14; small nucleolar RNA, C/D box 113-1; small nucleolar RNA, C/D box 114-15; small nucleolar RNA, C/D box 114-16; small nucleolar RNA, C/D box 114-17; small nucleolar RNA, C/D box 114-10; small nucleolar RNA, C/D box 114-11; small nucleolar RNA, C/D box 114-31; small nucleolar RNA, C/D box 114-12; small nucleolar RNA, C/D box 114-30; small nucleolar RNA, C/D box 114-13; small nucleolar RNA, C/D box 113-8; small nucleolar RNA, C/D box 113-9; small nucleolar RNA, C/D box 113-6; small nucleolar RNA, C/D box 113-7; small nucleolar RNA, C/D box 113-4; small nucleolar RNA, C/D box 113-5; small nucleolar RNA, C/D box 113-2; small nucleolar RNA, C/D box 114-9; small nucleolar RNA, C/D box 113-3; small nucleolar RNA, C/D box 114-29; small nucleolar RNA, C/D box 114-27; small nucleolar RNA, C/D box 114-28; small nucleolar RNA, C/D box 114-25; small nucleolar RNA, C/D box 114-26; small nucleolar RNA, C/D box 114-23; small nucleolar RNA, C/D box 114-24; small nucleolar RNA, C/D box 114-21; small nucleolar RNA, C/D box 114-22; small nucleolar RNA, C/D box 114-20; small nucleolar RNA, C/D box 114-6; small nucleolar RNA, C/D box 114-5; small nucleolar RNA, C/D box 114-8; small nucleolar RNA, C/D box 114-7; small nucleolar RNA, C/D box 114-2; small nucleolar RNA, C/D box 114-1; small nucleolar RNA, C/D box 114-4; small nucleolar RNA, C/D box 114-3; small nucleolar RNA, C/D box 114-19; small nucleolar NR_003206 RNA, C/D box 114-18 NM_005434 mal, T-cell differentiation protein-like NM_004430 early growth response 3 NM_000340 solute carrier family 2 (facilitated glucose transporter), member 2 NM_001018082 adipogenin U63828 chromosome 20 open reading frame 181 NM_000151 glucose-6-phosphatase, catalytic subunit NM_138350 THAP domain containing, apoptosis associated protein 3 NM_000200 histatin 3 NM_001005469 olfactory receptor, family 5, subfamily B, member 3 NM_002619 platelet factor 4 NR_024524 cyclin Y-like pseudogene NR_024472 Ras suppressor protein 1 pseudogene NM_001011718 XK, Kell blood group complex subunit-related family, member 7 NM_003554 olfactory receptor, family 1, subfamily E, member 2 NR_003578 zinc finger protein 702 pseudogene AY358123 AILT5830 NM_020061 opsin 1 (cone pigments), long-wave-sensitive NM_033423 granzyme H (cathepsin G-like 2, protein h-CCPX) AK127645 hypothetical protein LOC642484 NM_002183 interleukin 3 receptor, alpha (low affinity) BC041424 similar to CG32662-PA AY956760 heat shock protein 90kDa alpha (cytosolic), class A member 4 (pseudogene) NR_002181 pancreatic polypeptide 2 NM_001013646 chromosome 20 open reading frame 107 NM_000145 follicle stimulating hormone receptor NM_016247 interphotoreceptor matrix proteoglycan 2 NM_001004759 olfactory receptor, family 51, subfamily T, member 1 AF438406 GCRG-P224 NM_022006 FXYD domain containing ion transport regulator 7 NR_026866 chromosome 3 open reading frame 49 NM_001104 actinin, alpha 3 NM_002170 interferon, alpha 8 NM_004686 myotubularin related protein 7 NM_020884 myosin, heavy chain 7B, cardiac muscle, beta

226

Table 7‎ .19. Up-regulated genes due to treatment of compound X4 versus X6 on induced expression after 1 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name NR_024045 retinoic acid early transcript 1K pseudogene NM_194278 chromosome 14 open reading frame 43 NM_015658 nucleolar complex associated 2 homolog (S. cerevisiae) NR_024595 DNM1 pseudogene 35 NR_024591 POM121 membrane glycoprotein-like 1 (rat) pseudogene NR_003607 cat eye syndrome chromosome region, candidate 8 (non-protein coding) NM_001004740 olfactory receptor, family 5, subfamily M, member 1 similar to Glycine cleavage system H protein, mitochondrial precursor; glycine cleavage system protein NM_004483 H (aminomethyl carrier); similar to Glycine cleavage system H protein, mitochondrial AK124942 hypothetical protein LOC727808 NM_032867 MICAL C-terminal like histone cluster 1, H3j; histone cluster 1, H3i; histone cluster 1, H3h; histone cluster 1, H3g; histone cluster 1, H3f; histone cluster 1, H3e; histone cluster 1, H3d; histone cluster 1, H3c; histone cluster 1, H3b; histone cluster 1, H3a; histone cluster 1, H2ad; histone cluster 2, H3a; histone cluster 2, H3c; NM_003536 histone cluster 2, H3d NM_145064 SH3 and cysteine rich domain 3 AK098413 topoisomerase I binding, arginine/serine-rich NM_001080515 family with sequence similarity 163, member B NM_000517 hemoglobin, alpha 2; hemoglobin, alpha 1 AK093366 hypothetical LOC399884 NM_001079530 cripto, FRL-1, cryptic family 1B NM_013348 potassium inwardly-rectifying channel, subfamily J, member 14 NM_006300 zinc finger protein 230 AK294783 BMS1 pseudogene 4 NM_024786 zinc finger, DHHC-type containing 11 NM_182619 C-type lectin domain family 18, member A Fc fragment of IgG binding protein; similar to IgGFc-binding protein precursor (FcgammaBP) NM_003890 (Fcgamma-binding protein antigen) WAS protein family homolog 3 pseudogene; WAS protein family homolog 2 pseudogene; WAS protein NR_003659 family homolog 1; WAS protein family homolog 5 pseudogene NM_001170 aquaporin 7 NM_182906 C-type lectin domain family 10, member A NR_027071 chromosome 8 open reading frame 56 NR_024251 family with sequence similarity 86, member A pseudogene pregnancy specific beta-1-glycoprotein 7; pregnancy specific beta-1-glycoprotein 8; pregnancy specific NM_001130167 beta-1-glycoprotein 4 NM_152475 zinc finger protein 417 NR_023390 chromosome 9 open reading frame 130 NR_026980 FSHD region gene 2 family member pseudogene NM_001906 chymotrypsinogen B1 NR_030302 microRNA 576 AF400494 small nuclear ribonucleoprotein polypeptide N; SNRPN upstream reading frame NM_001024675 chromosome 20 open reading frame 134 NM_001136233 family with sequence similarity 48, member B2 NM_001081552 sperm associated antigen 11A; sperm associated antigen 11B NM_005362 melanoma antigen family A, 3 NM_021138 TNF receptor-associated factor 2 NR_026873 non-protein coding RNA 174 NR_003668 defensin, beta 109, pseudogene 1; defensin, beta 109, pseudogene 1B NR_030347 microRNA 548c NM_002995 chemokine (C motif) ligand 1 NR_002141 olfactory receptor, family 2, subfamily M, member 1 pseudogene NM_001001670 FAM75-like protein FLJ46321 227

NM_001013699 histone H3-like NM_175053 keratin 74 NM_014431 KIAA1274 NM_177530 sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 AK130278 hypothetical LOC100130876 NM_001129979 hypothetical protein LOC100130958 NM_018937 protocadherin beta 3 AK056852 hypothetical protein LOC144571 NM_024087 ankyrin repeat and SOCS box-containing 9 AY358802 VLGN1945 NM_001004750 olfactory receptor, family 51, subfamily B, member 6 NM_031921 similar to AAA-ATPase TOB3; ATPase family, AAA domain containing 3B NR_027141 family with sequence similarity 45, member B NM_001496 GDNF family receptor alpha 3 NM_014898 zinc finger protein 30 homolog (mouse) AB001736 immunoglobulin lambda joining 3 AK309475 integrin alpha FG-GAP repeat containing 1 NR_027282 chromosome 10 open reading frame 88 pseudogene NR_030204 microRNA 520d

Table 7‎ .20. Down-regulated genes due to treatment of compound X4 versus X6 on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name NR_024044 defensin, beta 109, pseudogene 1; defensin, beta 109, pseudogene 1B NM_006669 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 AK098218 hypothetical locus LOC572558 NM_005099 ADAM metallopeptidase with thrombospondin type 1 motif, 4 NR_002818 ring finger protein 126 pseudogene 1 DQ012021 defensin, beta 117 NM_001004703 olfactory receptor, family 4, subfamily C, member 46 NM_002704 pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) NM_058173 mucin-like 1 AK125751 hypothetical protein LOC642316 NR_002821 TPTE and PTEN homologous inositol lipid phosphatase pseudogene NM_001015038 P antigen family, member 2B NM_138801 galactose mutarotase (aldose 1-epimerase) AK304656 phosphatidylinositol glycan anchor biosynthesis, class P NM_005353 integrin, alpha D NM_173812 dpy-19-like 2 (C. elegans) NR_024253 family with sequence similarity 86, member A pseudogene AF258550 hypothetical protein LOC100129503 NR_003558 WW domain binding protein 11 pseudogene 1 NM_001042600 mitogen-activated protein kinase kinase kinase kinase 1 NM_014441 sialic acid binding Ig-like lectin 9 NM_016307 paired related homeobox 2 NM_031313 alkaline phosphatase, placental-like 2 NM_001001954 olfactory receptor, family 5, subfamily A, member 2 coiled-coil domain containing 144B; coiled-coil domain containing 144A; coiled-coil domain containing AB011137 144C proline-rich protein BstNI subfamily 1; proline-rich protein BstNI subfamily 2; proline-rich protein BstNI NM_002723 subfamily 4 NM_182701 glutathione peroxidase 6 (olfactory)

228

NM_004137 potassium large conductance calcium-activated channel, subfamily M, beta member 1 NM_018485 G protein-coupled receptor 77 NM_177530 sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 NM_183059 retinal degeneration 3 NM_005064 chemokine (C-C motif) ligand 23 NM_012378 olfactory receptor, family 8, subfamily B, member 8 NM_006889 CD86 molecule NR_001527 testis-specific transcript, Y-linked 6; testis-specific transcript, Y-linked 6B AK131224 FLJ16124 protein NM_170745 histone cluster 1, H2aa NM_001102658 hypothetical protein LOC196993 NM_031921 similar to AAA-ATPase TOB3; ATPase family, AAA domain containing 3B AK125677 similar to cDNA sequence BC021523 AK125677 hypothetical protein LOC100288902 AK125677 hypothetical protein LOC100289296 NM_178864 neuronal PAS domain protein 4 NM_020742 neuroligin 4, X-linked AK127362 chromosome 11 open reading frame 39 olfactory receptor, family 11, subfamily H, member 2; olfactory receptor, family 11, subfamily H, member 1; olfactory receptor, family 11, subfamily H, member 13 pseudogene; olfactory receptor, NM_001005239 family 11, subfamily H, member 12 NM_130776 XAGE-4 protein; X antigen family, member 3 NM_003189 T-cell acute lymphocytic leukemia 1 NM_001040078 lectin, galactoside-binding, soluble, 9C NM_178470 WD repeat domain 40B NM_000545 HNF1 homeobox A NR_024591 POM121 membrane glycoprotein-like 1 (rat) pseudogene NM_016512 sperm associated antigen 11A; sperm associated antigen 11B NM_001004740 olfactory receptor, family 5, subfamily M, member 1 olfactory receptor, family 8, subfamily G, member 5; olfactory receptor, family 8, subfamily G, member NM_001005198 1 NR_003934 GTF2I repeat domain containing 1-like NM_001039361 PRAME family member 10 NR_002169 olfactory receptor, family 1, subfamily F, member 2 AK123727 FLJ41733 protein AF452720 hypothetical LOC729040 NR_002165 high-mobility group box 3-like 1 NR_027250 synovial sarcoma, X breakpoint 8; synovial sarcoma, X breakpoint 1 NM_001018072 BTB (POZ) domain containing 11 NM_005383 sialidase 2 (cytosolic sialidase) NM_001122757 POU class 1 homeobox 1 NR_004845 cytoplasmic beta-actin pseudogene NM_001005496 olfactory receptor, family 5, subfamily D, member 16 NM_001005497 olfactory receptor, family 6, subfamily C, member 75 NM_001124758 spinster homolog 2 (Drosophila) NM_001004476 olfactory receptor, family 10, subfamily K, member 2 NM_001144856 pleckstrin homology domain containing, family G (with RhoGef domain) member 6 BC063384 immunoglobulin heavy constant delta NR_003714 POM121 membrane glycoprotein-like 9 (rat) pseudogene AK098828 hypothetical protein LOC348817 NM_178456 chromosome 20 open reading frame 85 NM_003608 G protein-coupled receptor 65 NM_014383 zinc finger and BTB domain containing 32 NM_001110219 gap junction protein, beta 6, 30kDa 229

NM_198690 keratin associated protein 10-9 NM_006760 uroplakin 2 NM_005330 hemoglobin, epsilon 1 NM_003554 olfactory receptor, family 1, subfamily E, member 2 NM_024893 chromosome 20 open reading frame 39 NM_001004463 olfactory receptor, family 10, subfamily G, member 7 NM_000728 calcitonin-related polypeptide beta NM_001014450 small proline-rich protein 2F NM_001159576 sodium channel, nonvoltage-gated 1 alpha BC045817 hypothetical LOC286094 NM_001130913 zinc finger protein 720 NM_198682 glycophorin E; glycophorin B (MNS blood group) NM_006847 leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 NM_001311 cysteine-rich protein 1 (intestinal) NM_001741 calcitonin-related polypeptide alpha NM_020994 cancer/testis antigen 2 NM_015893 prolactin releasing hormone NM_001005270 olfactory receptor, family 4, subfamily C, member 12 NR_003952 zinc finger protein 479 pseudogene keratin associated protein 2-1; keratin associated protein 2-4; keratin associated protein 2-3; similar to NM_001123387 keratin associated protein 2-4; keratin associated protein 2-2 NM_178433 late cornified envelope 3B NR_026663 chromosome 9 open reading frame 70

Table 7‎ .21. Up-regulated genes due to treatment of compound X4 versus X6 on induced expression after 24 h of serum stimulation in the ME1007 melanoma cell line Ref-Sequence Gene Name NM_001134407 glutamate receptor, ionotropic, N-methyl D-aspartate 2A NR_002815 TPTE and PTEN homologous inositol lipid phosphatase pseudogene NM_199290 nascent polypeptide-associated complex alpha subunit 2 DQ656060 PFTAIRE protein kinase 1 NM_001159293 zinc finger protein 737 NM_078487 cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) NM_001164457 zinc finger protein 705G-like NM_020873 leucine rich repeat neuronal 1 NM_018664 basic leucine zipper transcription factor, ATF-like 3 NR_002221 divergent-paired related homeobox pseudogene 4; divergent-paired related homeobox NM_006732 FBJ murine osteosarcoma viral oncogene homolog B NM_033199 urocortin 2 tripartite motif-containing 53; similar to Tripartite motif protein 49 (RING finger protein 18) (Testis- specific ring-finger protein); similar to ring finger protein 18; similar to hCG1988749; tripartite motif- NM_020358 containing 49; tripartite motif-containing 48; hypothetical protein LOC100131392 NM_001009606 heparan sulfate (glucosamine) 3-O-sulfotransferase 6 NR_002978 small nucleolar RNA, H/ACA box 46 NR_026578 occludin pseudogene; occludin NM_001040429 protocadherin 17 NR_003074 small nucleolar RNA, C/D box 92 NR_026934 hypothetical LOC152225 NR_003073 small nucleolar RNA, C/D box 91B; small nucleolar RNA, C/D box 91A NM_182597 chromosome 7 open reading frame 53 NM_152634 transcription elongation factor A (SII) N-terminal and central domain containing NM_033106 galanin-like peptide

230

NM_017879 zinc finger protein 416 NM_001032392 plasminogen-like B2; plasminogen-like B1 NM_017534 myosin, heavy chain 2, skeletal muscle, adult AF400494 small nuclear ribonucleoprotein polypeptide N; SNRPN upstream reading frame NR_002964 small nucleolar RNA, H/ACA box 28 NM_170732 brain-derived neurotrophic factor NM_001015878 aurora kinase C T cell receptor alpha constant; T cell receptor alpha locus; T cell receptor alpha variable 20; T cell BC110354 receptor delta locus; T cell receptor delta variable 2 NR_026817 hypothetical LOC148696 NR_003542 RTFV9368 small nucleolar RNA, C/D box 116-4; small nucleolar RNA, C/D box 116-3; small nucleolar RNA, C/D box 116-6; small nucleolar RNA, C/D box 116-5; small nucleolar RNA, C/D box 116-2; small nucleolar RNA, C/D box 116-1; small nucleolar RNA, C/D box 116-13; small nucleolar RNA, C/D box 116-12; small nucleolar RNA, C/D box 116-15; small nucleolar RNA, C/D box 116-14; small nucleolar RNA, C/D box 116-17; small nucleolar RNA, C/D box 116-16; small nucleolar RNA, C/D box 116-19; small nucleolar RNA, C/D box 116-18; small nucleolar RNA, C/D box 116-11; small nucleolar RNA, C/D box 116-10; small nucleolar RNA, C/D box 116-26; small nucleolar RNA, C/D box 116-24; small nucleolar RNA, C/D box 116-23; small nucleolar RNA, C/D box 116-9; small nucleolar RNA, C/D box 116-29; small nucleolar RNA, C/D box 116-7; small nucleolar RNA, C/D box 116-8; small nucleolar RNA, C/D box 116-22; small nucleolar RNA, C/D box 116-21; small nucleolar NR_003327 RNA, C/D box 116-20 NM_152412 zinc finger protein 572 NM_005261 GTP binding protein overexpressed in skeletal muscle NM_001040619 activating transcription factor 3 BC150574 chromosome 4 open reading frame 47 NR_004389 small nucleolar RNA, H/ACA box 16B; small nucleolar RNA, H/ACA box 16A NM_001143818 serpin peptidase inhibitor, clade B (ovalbumin), member 2 NM_000584 interleukin 8 NM_012242 dickkopf homolog 1 (Xenopus laevis) NM_002982 chemokine (C-C motif) ligand 2 NM_144586 LY6/PLAUR domain containing 1 NM_001004058 olfactory receptor, family 8, subfamily K, member 5 NM_002550 olfactory receptor, family 3, subfamily A, member 1 NR_027456 hypothetical LOC100272228 NM_001161334 histone cluster 2, H2bf NM_001099434 doublecortin domain containing 2B NR_026792 makorin ring finger protein 1 pseudogene olfactory receptor, family 2, subfamily A, member 1; olfactory receptor, family 2, subfamily A, NM_001005287 member 42 BX648970 chromosome 9 open reading frame 3 NM_000846 glutathione S-transferase alpha 2 NM_001164375 chromosome 10 open reading frame 105 NM_003378 VGF nerve growth factor inducible NM_213607 coiled-coil domain containing 103 NM_138720 histone cluster 1, H2bd AK096395 hypothetical protein LOC100127974 NM_001004686 olfactory receptor, family 2, subfamily L, member 2 NM_006068 toll-like receptor 6 NM_015675 growth arrest and DNA-damage-inducible, beta NR_030302 microRNA 576 NM_001142958 F-box protein 15 NM_148959 HUS1 checkpoint homolog b (S. pombe) NM_020917 zinc finger protein 14 homolog (mouse) NM_033210 zinc finger protein 502 NR_026768 ribosomal protein S15a pseudogene 10 NM_199451 zinc finger protein 365 231

NR_003569 ATP-binding cassette, sub-family C, member 6 pseudogene 1 NM_001004465 olfactory receptor, family 10, subfamily H, member 4 NM_003948 cyclin-dependent kinase-like 2 (CDC2-related kinase) NM_031957 keratin associated protein 1-5 NM_002421 matrix metallopeptidase 1 (interstitial collagenase) NR_002950 small nucleolar RNA, H/ACA box 2A; small nucleolar RNA, H/ACA box 2B NM_001010917 golgi autoantigen, golgin subfamily a, 7B NM_001037499 defensin, beta 114 NR_003945 GTPase, very large interferon inducible 1 NM_024764 cation channel, sperm-associated, beta keratin associated protein 2-1; keratin associated protein 2-4; keratin associated protein 2-3; similar NM_001165252 to keratin associated protein 2-4; keratin associated protein 2-2 NM_001004458 olfactory receptor, family 1, subfamily S, member 1 NM_080759 dachshund homolog 1 (Drosophila) NM_001171197 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)

Table 7‎ .22. Down-regulated proteins due to use of X compound in ME1007 cell line at 6 h of serum stimulation Accession Description P09104 Gamma-enolase OS=Homo sapiens GN=ENO2 PE=1 SV=3 - [ENOG_HUMAN] Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform OS=Homo sapiens GN=PPP2R5C Q13362 PE=1 SV=3 - [2A5G_HUMAN] P28288 ATP-binding cassette sub-family D member 3 OS=Homo sapiens GN=ABCD3 PE=1 SV=1 - [ABCD3_HUMAN] Q8N2K0 Monoacylglycerol lipase ABHD12 OS=Homo sapiens GN=ABHD12 PE=1 SV=2 - [ABD12_HUMAN] P11766 Alcohol dehydrogenase class-3 OS=Homo sapiens GN=ADH5 PE=1 SV=4 - [ADHX_HUMAN] P12235 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 - [ADT1_HUMAN] Aminoacyl tRNA synthase complex-interacting multifunctional protein 2 OS=Homo sapiens GN=AIMP2 PE=1 SV=2 - Q13155 [AIMP2_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member B OS=Homo sapiens GN=ANP32B PE=1 SV=1 - Q92688 [AN32B_HUMAN] Q99873 Protein arginine N-methyltransferase 1 OS=Homo sapiens GN=PRMT1 PE=1 SV=2 - [ANM1_HUMAN] O94973 AP-2 complex subunit alpha-2 OS=Homo sapiens GN=AP2A2 PE=1 SV=2 - [AP2A2_HUMAN] P27695 DNA-(apurinic or apyrimidinic site) lyase OS=Homo sapiens GN=APEX1 PE=1 SV=2 - [APEX1_HUMAN] P61204 ADP-ribosylation factor 3 OS=Homo sapiens GN=ARF3 PE=1 SV=2 - [ARF3_HUMAN] P18085 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3 - [ARF4_HUMAN] Q9NVJ2 ADP-ribosylation factor-like protein 8B OS=Homo sapiens GN=ARL8B PE=1 SV=1 - [ARL8B_HUMAN] P00846 ATP synthase subunit a OS=Homo sapiens GN=MT-ATP6 PE=1 SV=1 - [ATP6_HUMAN] ATP synthase mitochondrial F1 complex assembly factor 1 OS=Homo sapiens GN=ATPAF1 PE=1 SV=1 - Q5TC12 [ATPF1_HUMAN] Q9UBB4 Ataxin-10 OS=Homo sapiens GN=ATXN10 PE=1 SV=1 - [ATX10_HUMAN] Q16548 Bcl-2-related protein A1 OS=Homo sapiens GN=BCL2A1 PE=1 SV=1 - [B2LA1_HUMAN] O75531 Barrier-to-autointegration factor OS=Homo sapiens GN=BANF1 PE=1 SV=1 - [BAF_HUMAN] P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] Q86VP6 Cullin-associated NEDD8-dissociated protein 1 OS=Homo sapiens GN=CAND1 PE=1 SV=2 - [CAND1_HUMAN] Q86X55 Histone-arginine methyltransferase CARM1 OS=Homo sapiens GN=CARM1 PE=1 SV=3 - [CARM1_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] P35790 Choline kinase alpha OS=Homo sapiens GN=CHKA PE=1 SV=3 - [CHKA_HUMAN] Q9BRX8 Redox-regulatory protein FAM213A OS=Homo sapiens GN=FAM213A PE=1 SV=3 - [F213A_HUMAN] P61024 Cyclin-dependent kinases regulatory subunit 1 OS=Homo sapiens GN=CKS1B PE=1 SV=1 - [CKS1_HUMAN]

232

P38432 Coilin OS=Homo sapiens GN=COIL PE=1 SV=1 - [COIL_HUMAN] Q9NX08 COMM domain-containing protein 8 OS=Homo sapiens GN=COMMD8 PE=1 SV=1 - [COMD8_HUMAN] P10606 Cytochrome c oxidase subunit 5B, mitochondrial OS=Homo sapiens GN=COX5B PE=1 SV=2 - [COX5B_HUMAN] Q9NRP2 COX assembly mitochondrial protein 2 homolog OS=Homo sapiens GN=CMC2 PE=1 SV=1 - [COXM2_HUMAN] Q7Z3J2 UPF0505 protein C16orf62 OS=Homo sapiens GN=C16orf62 PE=1 SV=2 - [CP062_HUMAN] Q02318 Sterol 26-hydroxylase, mitochondrial OS=Homo sapiens GN=CYP27A1 PE=1 SV=1 - [CP27A_HUMAN] O75131 Copine-3 OS=Homo sapiens GN=CPNE3 PE=1 SV=1 - [CPNE3_HUMAN] Calcineurin-like phosphoesterase domain-containing protein 1 OS=Homo sapiens GN=CPPED1 PE=1 SV=3 - Q9BRF8 [CPPED_HUMAN] O95639 Cleavage and polyadenylation specificity factor subunit 4 OS=Homo sapiens GN=CPSF4 PE=1 SV=1 - [CPSF4_HUMAN] Q9Y2S2 Lambda-crystallin homolog OS=Homo sapiens GN=CRYL1 PE=1 SV=3 - [CRYL1_HUMAN] O43169 Cytochrome b5 type B OS=Homo sapiens GN=CYB5B PE=1 SV=2 - [CYB5B_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1 OS=Homo sapiens GN=DAD1 PE=1 SV=3 P61803 - [DAD1_HUMAN] Q9GZR7 ATP-dependent RNA helicase DDX24 OS=Homo sapiens GN=DDX24 PE=1 SV=1 - [DDX24_HUMAN] Q96GQ7 Probable ATP-dependent RNA helicase DDX27 OS=Homo sapiens GN=DDX27 PE=1 SV=2 - [DDX27_HUMAN] Q9BUN8 Derlin-1 OS=Homo sapiens GN=DERL1 PE=1 SV=1 - [DERL1_HUMAN] Q7L2H7 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens GN=EIF3M PE=1 SV=1 - [EIF3M_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN] Q7L8L6 FAST kinase domain-containing protein 5 OS=Homo sapiens GN=FASTKD5 PE=1 SV=1 - [FAKD5_HUMAN] P37268 Squalene synthase OS=Homo sapiens GN=FDFT1 PE=1 SV=1 - [FDFT_HUMAN] Q9Y3D6 Mitochondrial fission 1 protein OS=Homo sapiens GN=FIS1 PE=1 SV=2 - [FIS1_HUMAN] Q9NY12 H/ACA ribonucleoprotein complex subunit 1 OS=Homo sapiens GN=GAR1 PE=1 SV=1 - [GAR1_HUMAN] P06396 Gelsolin OS=Homo sapiens GN=GSN PE=1 SV=1 - [GELS_HUMAN] Q9Y3E0 Vesicle transport protein GOT1B OS=Homo sapiens GN=GOLT1B PE=1 SV=1 - [GOT1B_HUMAN] P51810 G-protein coupled receptor 143 OS=Homo sapiens GN=GPR143 PE=1 SV=2 - [GP143_HUMAN] Q4G148 Glucoside xylosyltransferase 1 OS=Homo sapiens GN=GXYLT1 PE=1 SV=2 - [GXLT1_HUMAN] O14929 Histone acetyltransferase type B catalytic subunit OS=Homo sapiens GN=HAT1 PE=1 SV=1 - [HAT1_HUMAN] Q9H583 HEAT repeat-containing protein 1 OS=Homo sapiens GN=HEATR1 PE=1 SV=3 - [HEAT1_HUMAN] Q8TCT9 Minor histocompatibility antigen H13 OS=Homo sapiens GN=HM13 PE=1 SV=1 - [HM13_HUMAN] P60842 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - [IF4A1_HUMAN] P78344 Eukaryotic translation initiation factor 4 gamma 2 OS=Homo sapiens GN=EIF4G2 PE=1 SV=1 - [IF4G2_HUMAN] Q8TEX9 Importin-4 OS=Homo sapiens GN=IPO4 PE=1 SV=2 - [IPO4_HUMAN] P23919 Thymidylate kinase OS=Homo sapiens GN=DTYMK PE=1 SV=4 - [KTHY_HUMAN] Q9BU23 Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2 - [LMF2_HUMAN] Q8ND56 Protein LSM14 homolog A OS=Homo sapiens GN=LSM14A PE=1 SV=3 - [LS14A_HUMAN] Q9Y333 U6 snRNA-associated Sm-like protein LSm2 OS=Homo sapiens GN=LSM2 PE=1 SV=1 - [LSM2_HUMAN] Q9BQ69 O-acetyl-ADP-ribose deacetylase MACROD1 OS=Homo sapiens GN=MACROD1 PE=1 SV=2 - [MACD1_HUMAN] P28482 Mitogen-activated protein kinase 1 OS=Homo sapiens GN=MAPK1 PE=1 SV=3 - [MK01_HUMAN] O75352 Mannose-P-dolichol utilization defect 1 protein OS=Homo sapiens GN=MPDU1 PE=1 SV=2 - [MPU1_HUMAN] P58546 Myotrophin OS=Homo sapiens GN=MTPN PE=1 SV=2 - [MTPN_HUMAN] P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 8, mitochondrial OS=Homo sapiens GN=NDUFB8 PE=1 O95169 SV=1 - [NDUB8_HUMAN] NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial OS=Homo sapiens GN=NDUFS8 PE=1 SV=1 - O00217 [NDUS8_HUMAN] NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial OS=Homo sapiens GN=NDUFV2 PE=1 SV=2 - P19404 [NDUV2_HUMAN]

233

Q15843 NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 - [NEDD8_HUMAN] Q9Y2X3 Nucleolar protein 58 OS=Homo sapiens GN=NOP58 PE=1 SV=1 - [NOP58_HUMAN] O15118 Niemann-Pick C1 protein OS=Homo sapiens GN=NPC1 PE=1 SV=2 - [NPC1_HUMAN] Q9Y639 Neuroplastin OS=Homo sapiens GN=NPTN PE=1 SV=2 - [NPTN_HUMAN] Q9Y5Y2 Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens GN=NUBP2 PE=1 SV=1 - [NUBP2_HUMAN] O43929 Origin recognition complex subunit 4 OS=Homo sapiens GN=ORC4 PE=1 SV=2 - [ORC4_HUMAN] O95747 Serine/threonine-protein kinase OSR1 OS=Homo sapiens GN=OXSR1 PE=1 SV=1 - [OXSR1_HUMAN] P12955 Xaa-Pro dipeptidase OS=Homo sapiens GN=PEPD PE=1 SV=3 - [PEPD_HUMAN] P61457 Pterin-4-alpha-carbinolamine dehydratase OS=Homo sapiens GN=PCBD1 PE=1 SV=2 - [PHS_HUMAN] O60664 Perilipin-3 OS=Homo sapiens GN=PLIN3 PE=1 SV=3 - [PLIN3_HUMAN] P40967 Melanocyte protein PMEL OS=Homo sapiens GN=PMEL PE=1 SV=2 - [PMEL_HUMAN] Q15126 Phosphomevalonate kinase OS=Homo sapiens GN=PMVK PE=1 SV=3 - [PMVK_HUMAN] P13686 Tartrate-resistant acid phosphatase type 5 OS=Homo sapiens GN=ACP5 PE=1 SV=3 - [PPA5_HUMAN] P61289 Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 PE=1 SV=1 - [PSME3_HUMAN] P30566 Adenylosuccinate lyase OS=Homo sapiens GN=ADSL PE=1 SV=2 - [PUR8_HUMAN] P14927 Cytochrome b-c1 complex subunit 7 OS=Homo sapiens GN=UQCRB PE=1 SV=2 - [QCR7_HUMAN] P06400 Retinoblastoma-associated protein OS=Homo sapiens GN=RB1 PE=1 SV=2 - [RB_HUMAN] Q15293 Reticulocalbin-1 OS=Homo sapiens GN=RCN1 PE=1 SV=1 - [RCN1_HUMAN] P46063 ATP-dependent DNA helicase Q1 OS=Homo sapiens GN=RECQL PE=1 SV=3 - [RECQ1_HUMAN] Q96HR9 Receptor expression-enhancing protein 6 OS=Homo sapiens GN=REEP6 PE=1 SV=1 - [REEP6_HUMAN] Q92900 Regulator of nonsense transcripts 1 OS=Homo sapiens GN=UPF1 PE=1 SV=2 - [RENT1_HUMAN] Q6NUM9 All-trans-retinol 13,14-reductase OS=Homo sapiens GN=RETSAT PE=1 SV=2 - [RETST_HUMAN] P62987 Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 - [RL40_HUMAN] O75116 Rho-associated protein kinase 2 OS=Homo sapiens GN=ROCK2 PE=1 SV=4 - [ROCK2_HUMAN] Q9H7B2 Ribosome production factor 2 homolog OS=Homo sapiens GN=RPF2 PE=1 SV=2 - [RPF2_HUMAN] Q5JTH9 RRP12-like protein OS=Homo sapiens GN=RRP12 PE=1 SV=2 - [RRP12_HUMAN] P0CW22 40S ribosomal protein S17-like OS=Homo sapiens GN=RPS17L PE=3 SV=1 - [RS17L_HUMAN] P62847 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=1 SV=1 - [RS24_HUMAN] P31949 Protein S100-A11 OS=Homo sapiens GN=S100A11 PE=1 SV=2 - [S10AB_HUMAN] O43865 Putative adenosylhomocysteinase 2 OS=Homo sapiens GN=AHCYL1 PE=1 SV=2 - [SAHH2_HUMAN] P07602 Proactivator polypeptide OS=Homo sapiens GN=PSAP PE=1 SV=2 - [SAP_HUMAN] P67812 Signal peptidase complex catalytic subunit SEC11A OS=Homo sapiens GN=SEC11A PE=1 SV=1 - [SC11A_HUMAN] Q9BY50 Signal peptidase complex catalytic subunit SEC11C OS=Homo sapiens GN=SEC11C PE=1 SV=3 - [SC11C_HUMAN] Q14108 Lysosome membrane protein 2 OS=Homo sapiens GN=SCARB2 PE=1 SV=2 - [SCRB2_HUMAN] Q9Y5B9 FACT complex subunit SPT16 OS=Homo sapiens GN=SUPT16H PE=1 SV=1 - [SP16H_HUMAN] P35237 Serpin B6 OS=Homo sapiens GN=SERPINB6 PE=1 SV=3 - [SPB6_HUMAN] O43815 Striatin OS=Homo sapiens GN=STRN PE=1 SV=4 - [STRN_HUMAN] P49589 Cysteine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=CARS PE=1 SV=3 - [SYCC_HUMAN] Q16563 Synaptophysin-like protein 1 OS=Homo sapiens GN=SYPL1 PE=1 SV=1 - [SYPL1_HUMAN] P23381 Tryptophan--tRNA ligase, cytoplasmic OS=Homo sapiens GN=WARS PE=1 SV=2 - [SYWC_HUMAN] Q13148 TAR DNA-binding protein 43 OS=Homo sapiens GN=TARDBP PE=1 SV=1 - [TADBP_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] Q15813 Tubulin-specific chaperone E OS=Homo sapiens GN=TBCE PE=1 SV=1 - [TBCE_HUMAN] Q9NZ01 Very-long-chain enoyl-CoA reductase OS=Homo sapiens GN=TECR PE=1 SV=1 - [TECR_HUMAN]

234

Q99805 Transmembrane 9 superfamily member 2 OS=Homo sapiens GN=TM9SF2 PE=1 SV=1 - [TM9S2_HUMAN] Q13595 Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A PE=1 SV=1 - [TRA2A_HUMAN] Q8NG06 Tripartite motif-containing protein 58 OS=Homo sapiens GN=TRIM58 PE=2 SV=2 - [TRI58_HUMAN] Q9H1Z9 Tetraspanin-10 OS=Homo sapiens GN=TSPAN10 PE=2 SV=1 - [TSN10_HUMAN] P40126 L-dopachrome tautomerase OS=Homo sapiens GN=DCT PE=1 SV=1 - [TYRP2_HUMAN] O43818 U3 small nucleolar RNA-interacting protein 2 OS=Homo sapiens GN=RRP9 PE=1 SV=1 - [U3IP2_HUMAN] P61086 Ubiquitin-conjugating enzyme E2 K OS=Homo sapiens GN=UBE2K PE=1 SV=3 - [UBE2K_HUMAN] P61088 Ubiquitin-conjugating enzyme E2 N OS=Homo sapiens GN=UBE2N PE=1 SV=1 - [UBE2N_HUMAN] P61960 Ubiquitin-fold modifier 1 OS=Homo sapiens GN=UFM1 PE=1 SV=1 - [UFM1_HUMAN] Q16864 V-type proton ATPase subunit F OS=Homo sapiens GN=ATP6V1F PE=1 SV=2 - [VATF_HUMAN] Q96GC9 Vacuole membrane protein 1 OS=Homo sapiens GN=VMP1 PE=1 SV=1 - [VMP1_HUMAN] Q3MJ13 WD repeat-containing protein 72 OS=Homo sapiens GN=WDR72 PE=2 SV=2 - [WDR72_HUMAN] O76024 Wolframin OS=Homo sapiens GN=WFS1 PE=1 SV=2 - [WFS1_HUMAN] Q9UIA9 Exportin-7 OS=Homo sapiens GN=XPO7 PE=1 SV=3 - [XPO7_HUMAN]

Table 7‎ .23. Up-regulated proteins due to use of X compound in ME1007 cell line at 6 h of serum stimulation Accession Description

P31946 14-3-3 protein beta/alpha OS=Homo sapiens GN=YWHAB PE=1 SV=3 - [1433B_HUMAN] Eukaryotic translation initiation factor 4E-binding protein 1 OS=Homo sapiens GN=EIF4EBP1 PE=1 SV=3 - Q13541 [4EBP1_HUMAN] Q96A33 Coiled-coil domain-containing protein 47 OS=Homo sapiens GN=CCDC47 PE=1 SV=1 - [CCD47_HUMAN] P63167 Dynein light chain 1, cytoplasmic OS=Homo sapiens GN=DYNLL1 PE=1 SV=1 - [DYL1_HUMAN] Eukaryotic peptide chain release factor GTP-binding subunit ERF3A OS=Homo sapiens GN=GSPT1 PE=1 SV=1 - P15170 [ERF3A_HUMAN] P38117 Electron transfer flavoprotein subunit beta OS=Homo sapiens GN=ETFB PE=1 SV=3 - [ETFB_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] Q8TB36 Ganglioside-induced differentiation-associated protein 1 OS=Homo sapiens GN=GDAP1 PE=1 SV=3 - [GDAP1_HUMAN] P04908 Histone H2A type 1-B/E OS=Homo sapiens GN=HIST1H2AB PE=1 SV=2 - [H2A1B_HUMAN] Q99878 Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 - [H2A1J_HUMAN] P69905 Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 - [HBA_HUMAN] Integrin-linked kinase-associated serine/threonine phosphatase 2C OS=Homo sapiens GN=ILKAP PE=1 SV=1 - Q9H0C8 [ILKAP_HUMAN] Q9BSU3 N-alpha-acetyltransferase 11 OS=Homo sapiens GN=NAA11 PE=1 SV=3 - [NAA11_HUMAN] P30419 Glycylpeptide N-tetradecanoyltransferase 1 OS=Homo sapiens GN=NMT1 PE=1 SV=2 - [NMT1_HUMAN] Q14978 Nucleolar and coiled-body phosphoprotein 1 OS=Homo sapiens GN=NOLC1 PE=1 SV=2 - [NOLC1_HUMAN] Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial P11182 OS=Homo sapiens GN=DBT PE=1 SV=3 - [ODB2_HUMAN] O60925 Prefoldin subunit 1 OS=Homo sapiens GN=PFDN1 PE=1 SV=2 - [PFD1_HUMAN] P78356 Phosphatidylinositol 5-phosphate 4-kinase type-2 beta OS=Homo sapiens GN=PIP4K2B PE=1 SV=1 - [PI42B_HUMAN] P51817 cAMP-dependent protein kinase catalytic subunit PRKX OS=Homo sapiens GN=PRKX PE=1 SV=1 - [PRKX_HUMAN] P51159 Ras-related protein Rab-27A OS=Homo sapiens GN=RAB27A PE=1 SV=3 - [RB27A_HUMAN] Q9Y4C8 Probable RNA-binding protein 19 OS=Homo sapiens GN=RBM19 PE=1 SV=3 - [RBM19_HUMAN] P61927 60S ribosomal protein L37 OS=Homo sapiens GN=RPL37 PE=1 SV=2 - [RL37_HUMAN] P62273 40S ribosomal protein S29 OS=Homo sapiens GN=RPS29 PE=1 SV=2 - [RS29_HUMAN] Q14151 Scaffold attachment factor B2 OS=Homo sapiens GN=SAFB2 PE=1 SV=1 - [SAFB2_HUMAN]

235

Q0VDG4 Secernin-3 OS=Homo sapiens GN=SCRN3 PE=1 SV=1 - [SCRN3_HUMAN] Q9HD45 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9SF3 PE=1 SV=2 - [TM9S3_HUMAN] Q96LD4 Tripartite motif-containing protein 47 OS=Homo sapiens GN=TRIM47 PE=1 SV=2 - [TRI47_HUMAN] Q14966 Zinc finger protein 638 OS=Homo sapiens GN=ZNF638 PE=1 SV=2 - [ZN638_HUMAN]

Table 7‎ .24. Down-regulated proteins due to use of X4 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform OS=Homo sapiens GN=PPP2R5C Q13362 PE=1 SV=3 - [2A5G_HUMAN] Q8N2K0 Monoacylglycerol lipase ABHD12 OS=Homo sapiens GN=ABHD12 PE=1 SV=2 - [ABD12_HUMAN] P12235 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 - [ADT1_HUMAN] Aminoacyl tRNA synthase complex-interacting multifunctional protein 2 OS=Homo sapiens GN=AIMP2 PE=1 SV=2 - Q13155 [AIMP2_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member B OS=Homo sapiens GN=ANP32B PE=1 SV=1 - Q92688 [AN32B_HUMAN] O94973 AP-2 complex subunit alpha-2 OS=Homo sapiens GN=AP2A2 PE=1 SV=2 - [AP2A2_HUMAN] P05090 Apolipoprotein D OS=Homo sapiens GN=APOD PE=1 SV=1 - [APOD_HUMAN] Q9BUR5 Apolipoprotein O OS=Homo sapiens GN=APOO PE=1 SV=1 - [APOO_HUMAN] Q9NVJ2 ADP-ribosylation factor-like protein 8B OS=Homo sapiens GN=ARL8B PE=1 SV=1 - [ARL8B_HUMAN] Q9H1I8 Activating signal cointegrator 1 complex subunit 2 OS=Homo sapiens GN=ASCC2 PE=1 SV=3 - [ASCC2_HUMAN] P05496 ATP synthase F(0) complex subunit C1, mitochondrial OS=Homo sapiens GN=ATP5G1 PE=2 SV=2 - [AT5G1_HUMAN] P56385 ATP synthase subunit e, mitochondrial OS=Homo sapiens GN=ATP5I PE=1 SV=2 - [ATP5I_HUMAN] Q16548 Bcl-2-related protein A1 OS=Homo sapiens GN=BCL2A1 PE=1 SV=1 - [B2LA1_HUMAN] Q92560 Ubiquitin carboxyl-terminal hydrolase BAP1 OS=Homo sapiens GN=BAP1 PE=1 SV=2 - [BAP1_HUMAN] P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] Q8WWC4 Uncharacterized protein C2orf47, mitochondrial OS=Homo sapiens GN=C2orf47 PE=1 SV=1 - [CB047_HUMAN] P24385 G1/S-specific cyclin-D1 OS=Homo sapiens GN=CCND1 PE=1 SV=1 - [CCND1_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] Q9BRX8 Redox-regulatory protein FAM213A OS=Homo sapiens GN=FAM213A PE=1 SV=3 - [F213A_HUMAN] Q9NX08 COMM domain-containing protein 8 OS=Homo sapiens GN=COMMD8 PE=1 SV=1 - [COMD8_HUMAN] Q7Z3J2 UPF0505 protein C16orf62 OS=Homo sapiens GN=C16orf62 PE=1 SV=2 - [CP062_HUMAN] O75131 Copine-3 OS=Homo sapiens GN=CPNE3 PE=1 SV=1 - [CPNE3_HUMAN] Calcineurin-like phosphoesterase domain-containing protein 1 OS=Homo sapiens GN=CPPED1 PE=1 SV=3 - Q9BRF8 [CPPED_HUMAN] Q969H8 UPF0556 protein C19orf10 OS=Homo sapiens GN=C19orf10 PE=1 SV=1 - [CS010_HUMAN] O43169 Cytochrome b5 type B OS=Homo sapiens GN=CYB5B PE=1 SV=2 - [CYB5B_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1 OS=Homo sapiens GN=DAD1 PE=1 SV=3 P61803 - [DAD1_HUMAN] Q96HY6 DDRGK domain-containing protein 1 OS=Homo sapiens GN=DDRGK1 PE=1 SV=2 - [DDRGK_HUMAN] Q9GZR7 ATP-dependent RNA helicase DDX24 OS=Homo sapiens GN=DDX24 PE=1 SV=1 - [DDX24_HUMAN] Q9BUN8 Derlin-1 OS=Homo sapiens GN=DERL1 PE=1 SV=1 - [DERL1_HUMAN] P25685 DnaJ homolog subfamily B member 1 OS=Homo sapiens GN=DNAJB1 PE=1 SV=4 - [DNJB1_HUMAN] O43491 Band 4.1-like protein 2 OS=Homo sapiens GN=EPB41L2 PE=1 SV=1 - [E41L2_HUMAN] Q7L2H7 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens GN=EIF3M PE=1 SV=1 - [EIF3M_HUMAN] P84090 Enhancer of rudimentary homolog OS=Homo sapiens GN=ERH PE=1 SV=1 - [ERH_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN] 236

Q7L8L6 FAST kinase domain-containing protein 5 OS=Homo sapiens GN=FASTKD5 PE=1 SV=1 - [FAKD5_HUMAN] Q9Y613 FH1/FH2 domain-containing protein 1 OS=Homo sapiens GN=FHOD1 PE=1 SV=3 - [FHOD1_HUMAN] Q9Y3D6 Mitochondrial fission 1 protein OS=Homo sapiens GN=FIS1 PE=1 SV=2 - [FIS1_HUMAN] Q9NY12 H/ACA ribonucleoprotein complex subunit 1 OS=Homo sapiens GN=GAR1 PE=1 SV=1 - [GAR1_HUMAN] P06396 Gelsolin OS=Homo sapiens GN=GSN PE=1 SV=1 - [GELS_HUMAN] Q16775 Hydroxyacylglutathione hydrolase, mitochondrial OS=Homo sapiens GN=HAGH PE=1 SV=2 - [GLO2_HUMAN] Q9Y3E0 Vesicle transport protein GOT1B OS=Homo sapiens GN=GOLT1B PE=1 SV=1 - [GOT1B_HUMAN] P51810 G-protein coupled receptor 143 OS=Homo sapiens GN=GPR143 PE=1 SV=2 - [GP143_HUMAN] P28161 Glutathione S-transferase Mu 2 OS=Homo sapiens GN=GSTM2 PE=1 SV=2 - [GSTM2_HUMAN] Q9H583 HEAT repeat-containing protein 1 OS=Homo sapiens GN=HEATR1 PE=1 SV=3 - [HEAT1_HUMAN] Q8TCT9 Minor histocompatibility antigen H13 OS=Homo sapiens GN=HM13 PE=1 SV=1 - [HM13_HUMAN] P60842 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - [IF4A1_HUMAN] P78344 Eukaryotic translation initiation factor 4 gamma 2 OS=Homo sapiens GN=EIF4G2 PE=1 SV=1 - [IF4G2_HUMAN] P04183 Thymidine kinase, cytosolic OS=Homo sapiens GN=TK1 PE=1 SV=2 - [KITH_HUMAN] Q07866 Kinesin light chain 1 OS=Homo sapiens GN=KLC1 PE=1 SV=2 - [KLC1_HUMAN] P23919 Thymidylate kinase OS=Homo sapiens GN=DTYMK PE=1 SV=4 - [KTHY_HUMAN] Q9BU23 Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2 - [LMF2_HUMAN] Q8ND56 Protein LSM14 homolog A OS=Homo sapiens GN=LSM14A PE=1 SV=3 - [LS14A_HUMAN] Q9Y333 U6 snRNA-associated Sm-like protein LSm2 OS=Homo sapiens GN=LSM2 PE=1 SV=1 - [LSM2_HUMAN] Q02978 Mitochondrial 2-oxoglutarate/malate carrier protein OS=Homo sapiens GN=SLC25A11 PE=1 SV=3 - [M2OM_HUMAN] P58546 Myotrophin OS=Homo sapiens GN=MTPN PE=1 SV=2 - [MTPN_HUMAN] Q13765 Nascent polypeptide-associated complex subunit alpha OS=Homo sapiens GN=NACA PE=1 SV=1 - [NACA_HUMAN] P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 11, mitochondrial OS=Homo sapiens GN=NDUFB11 Q9NX14 PE=1 SV=1 - [NDUBB_HUMAN] NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial OS=Homo sapiens GN=NDUFS8 PE=1 SV=1 - O00217 [NDUS8_HUMAN] Q15843 NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 - [NEDD8_HUMAN] Q9BPW8 Protein NipSnap homolog 1 OS=Homo sapiens GN=NIPSNAP1 PE=1 SV=1 - [NIPS1_HUMAN] Q9Y2X3 Nucleolar protein 58 OS=Homo sapiens GN=NOP58 PE=1 SV=1 - [NOP58_HUMAN] O15118 Niemann-Pick C1 protein OS=Homo sapiens GN=NPC1 PE=1 SV=2 - [NPC1_HUMAN] Q9Y639 Neuroplastin OS=Homo sapiens GN=NPTN PE=1 SV=2 - [NPTN_HUMAN] Q9UNZ2 NSFL1 cofactor p47 OS=Homo sapiens GN=NSFL1C PE=1 SV=2 - [NSF1C_HUMAN] Q9BV86 N-terminal Xaa-Pro-Lys N-methyltransferase 1 OS=Homo sapiens GN=NTMT1 PE=1 SV=3 - [NTM1A_HUMAN] Q9Y5Y2 Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens GN=NUBP2 PE=1 SV=1 - [NUBP2_HUMAN] O43929 Origin recognition complex subunit 4 OS=Homo sapiens GN=ORC4 PE=1 SV=2 - [ORC4_HUMAN] O95747 Serine/threonine-protein kinase OSR1 OS=Homo sapiens GN=OXSR1 PE=1 SV=1 - [OXSR1_HUMAN] O75340 Programmed cell death protein 6 OS=Homo sapiens GN=PDCD6 PE=1 SV=1 - [PDCD6_HUMAN] P12955 Xaa-Pro dipeptidase OS=Homo sapiens GN=PEPD PE=1 SV=3 - [PEPD_HUMAN] O60664 Perilipin-3 OS=Homo sapiens GN=PLIN3 PE=1 SV=3 - [PLIN3_HUMAN] P28074 Proteasome subunit beta type-5 OS=Homo sapiens GN=PSMB5 PE=1 SV=3 - [PSB5_HUMAN] P61289 Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 PE=1 SV=1 - [PSME3_HUMAN] P30566 Adenylosuccinate lyase OS=Homo sapiens GN=ADSL PE=1 SV=2 - [PUR8_HUMAN] P30520 Adenylosuccinate synthetase isozyme 2 OS=Homo sapiens GN=ADSS PE=1 SV=3 - [PURA2_HUMAN] P14927 Cytochrome b-c1 complex subunit 7 OS=Homo sapiens GN=UQCRB PE=1 SV=2 - [QCR7_HUMAN] P35241 Radixin OS=Homo sapiens GN=RDX PE=1 SV=1 - [RADI_HUMAN]

237

P06400 Retinoblastoma-associated protein OS=Homo sapiens GN=RB1 PE=1 SV=2 - [RB_HUMAN] P46063 ATP-dependent DNA helicase Q1 OS=Homo sapiens GN=RECQL PE=1 SV=3 - [RECQ1_HUMAN] Q92900 Regulator of nonsense transcripts 1 OS=Homo sapiens GN=UPF1 PE=1 SV=2 - [RENT1_HUMAN] Q6NUM9 All-trans-retinol 13,14-reductase OS=Homo sapiens GN=RETSAT PE=1 SV=2 - [RETST_HUMAN] O75116 Rho-associated protein kinase 2 OS=Homo sapiens GN=ROCK2 PE=1 SV=4 - [ROCK2_HUMAN] Q9H7B2 Ribosome production factor 2 homolog OS=Homo sapiens GN=RPF2 PE=1 SV=2 - [RPF2_HUMAN] P31949 Protein S100-A11 OS=Homo sapiens GN=S100A11 PE=1 SV=2 - [S10AB_HUMAN] Q9BY50 Signal peptidase complex catalytic subunit SEC11C OS=Homo sapiens GN=SEC11C PE=1 SV=3 - [SC11C_HUMAN] P11831 Serum response factor OS=Homo sapiens GN=SRF PE=1 SV=1 - [SRF_HUMAN] Q9UJZ1 Stomatin-like protein 2 OS=Homo sapiens GN=STOML2 PE=1 SV=1 - [STML2_HUMAN] O15260 Surfeit locus protein 4 OS=Homo sapiens GN=SURF4 PE=1 SV=3 - [SURF4_HUMAN] Q9H061 Transmembrane protein 126A OS=Homo sapiens GN=TMEM126A PE=1 SV=1 - [T126A_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] P07437 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 - [TBB5_HUMAN] Q15813 Tubulin-specific chaperone E OS=Homo sapiens GN=TBCE PE=1 SV=1 - [TBCE_HUMAN] P02786 Transferrin receptor protein 1 OS=Homo sapiens GN=TFRC PE=1 SV=2 - [TFR1_HUMAN] P24752 Acetyl-CoA acetyltransferase, mitochondrial OS=Homo sapiens GN=ACAT1 PE=1 SV=1 - [THIL_HUMAN] Q9Y2W1 Thyroid hormone receptor-associated protein 3 OS=Homo sapiens GN=THRAP3 PE=1 SV=2 - [TR150_HUMAN] Q13595 Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A PE=1 SV=1 - [TRA2A_HUMAN] P63313 Thymosin beta-10 OS=Homo sapiens GN=TMSB10 PE=1 SV=2 - [TYB10_HUMAN] O43818 U3 small nucleolar RNA-interacting protein 2 OS=Homo sapiens GN=RRP9 PE=1 SV=1 - [U3IP2_HUMAN] P61088 Ubiquitin-conjugating enzyme E2 N OS=Homo sapiens GN=UBE2N PE=1 SV=1 - [UBE2N_HUMAN] O94874 E3 UFM1-protein ligase 1 OS=Homo sapiens GN=UFL1 PE=1 SV=2 - [UFL1_HUMAN] P61960 Ubiquitin-fold modifier 1 OS=Homo sapiens GN=UFM1 PE=1 SV=1 - [UFM1_HUMAN] Q9NUQ7 Ufm1-specific protease 2 OS=Homo sapiens GN=UFSP2 PE=2 SV=3 - [UFSP2_HUMAN] Q96GC9 Vacuole membrane protein 1 OS=Homo sapiens GN=VMP1 PE=1 SV=1 - [VMP1_HUMAN] O94967 WD repeat-containing protein 47 OS=Homo sapiens GN=WDR47 PE=1 SV=1 - [WDR47_HUMAN] O76024 Wolframin OS=Homo sapiens GN=WFS1 PE=1 SV=2 - [WFS1_HUMAN] Q9UIA9 Exportin-7 OS=Homo sapiens GN=XPO7 PE=1 SV=3 - [XPO7_HUMAN]

Table 7‎ .25. Up-regulated proteins due to use of X4 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Eukaryotic translation initiation factor 4E-binding protein 1 OS=Homo sapiens GN=EIF4EBP1 PE=1 SV=3 - Q13541 [4EBP1_HUMAN] O75843 AP-1 complex subunit gamma-like 2 OS=Homo sapiens GN=AP1G2 PE=1 SV=1 - [AP1G2_HUMAN] P61160 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 - [ARP2_HUMAN] Coiled-coil-helix-coiled-coil-helix domain-containing protein 2, mitochondrial OS=Homo sapiens GN=CHCHD2 PE=1 Q9Y6H1 SV=1 - [CHCH2_HUMAN] O75122 CLIP-associating protein 2 OS=Homo sapiens GN=CLASP2 PE=1 SV=2 - [CLAP2_HUMAN] Q9BZJ0 Crooked neck-like protein 1 OS=Homo sapiens GN=CRNKL1 PE=1 SV=4 - [CRNL1_HUMAN] P63167 Dynein light chain 1, cytoplasmic OS=Homo sapiens GN=DYNLL1 PE=1 SV=1 - [DYL1_HUMAN] Q13011 Delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial OS=Homo sapiens GN=ECH1 PE=1 SV=2 - [ECH1_HUMAN] P38117 Electron transfer flavoprotein subunit beta OS=Homo sapiens GN=ETFB PE=1 SV=3 - [ETFB_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN]

238

Q7L5D6 Golgi to ER traffic protein 4 homolog OS=Homo sapiens GN=GET4 PE=1 SV=1 - [GET4_HUMAN] Q49A26 Putative oxidoreductase GLYR1 OS=Homo sapiens GN=GLYR1 PE=1 SV=3 - [GLYR1_HUMAN] P04908 Histone H2A type 1-B/E OS=Homo sapiens GN=HIST1H2AB PE=1 SV=2 - [H2A1B_HUMAN] Q99878 Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 - [H2A1J_HUMAN] P69905 Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 - [HBA_HUMAN] O75526 RNA-binding motif protein, X-linked-like-2 OS=Homo sapiens GN=RBMXL2 PE=1 SV=3 - [RMXL2_HUMAN] Integrin-linked kinase-associated serine/threonine phosphatase 2C OS=Homo sapiens GN=ILKAP PE=1 SV=1 - Q9H0C8 [ILKAP_HUMAN] Q8N163 DBIRD complex subunit KIAA1967 OS=Homo sapiens GN=KIAA1967 PE=1 SV=2 - [K1967_HUMAN] P42167 Lamina-associated polypeptide 2, isoforms beta/gamma OS=Homo sapiens GN=TMPO PE=1 SV=2 - [LAP2B_HUMAN] Q9H089 Large subunit GTPase 1 homolog OS=Homo sapiens GN=LSG1 PE=1 SV=2 - [LSG1_HUMAN] Q9GZZ1 N-alpha-acetyltransferase 50 OS=Homo sapiens GN=NAA50 PE=1 SV=1 - [NAA50_HUMAN] O60502 Bifunctional protein NCOAT OS=Homo sapiens GN=MGEA5 PE=1 SV=2 - [NCOAT_HUMAN] P30419 Glycylpeptide N-tetradecanoyltransferase 1 OS=Homo sapiens GN=NMT1 PE=1 SV=2 - [NMT1_HUMAN] Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial P11182 OS=Homo sapiens GN=DBT PE=1 SV=3 - [ODB2_HUMAN] Q9H792 Pseudopodium-enriched atypical kinase 1 OS=Homo sapiens GN=PEAK1 PE=1 SV=4 - [PEAK1_HUMAN] Q92696 Geranylgeranyl transferase type-2 subunit alpha OS=Homo sapiens GN=RABGGTA PE=1 SV=2 - [PGTA_HUMAN] O43663 Protein regulator of cytokinesis 1 OS=Homo sapiens GN=PRC1 PE=1 SV=2 - [PRC1_HUMAN] O60216 Double-strand-break repair protein rad21 homolog OS=Homo sapiens GN=RAD21 PE=1 SV=2 - [RAD21_HUMAN] P51159 Ras-related protein Rab-27A OS=Homo sapiens GN=RAB27A PE=1 SV=3 - [RB27A_HUMAN] Q9NTZ6 RNA-binding protein 12 OS=Homo sapiens GN=RBM12 PE=1 SV=1 - [RBM12_HUMAN] P62273 40S ribosomal protein S29 OS=Homo sapiens GN=RPS29 PE=1 SV=2 - [RS29_HUMAN] Q15477 Helicase SKI2W OS=Homo sapiens GN=SKIV2L PE=1 SV=3 - [SKIV2_HUMAN] P62316 Small nuclear ribonucleoprotein Sm D2 OS=Homo sapiens GN=SNRPD2 PE=1 SV=1 - [SMD2_HUMAN] Q9HD45 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9SF3 PE=1 SV=2 - [TM9S3_HUMAN] Q9NYL9 Tropomodulin-3 OS=Homo sapiens GN=TMOD3 PE=1 SV=1 - [TMOD3_HUMAN] Q96LD4 Tripartite motif-containing protein 47 OS=Homo sapiens GN=TRIM47 PE=1 SV=2 - [TRI47_HUMAN] Q14966 Zinc finger protein 638 OS=Homo sapiens GN=ZNF638 PE=1 SV=2 - [ZN638_HUMAN]

Table 7‎ .26. Down-regulated proteins due to use of X6 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform OS=Homo sapiens GN=PPP2R5C Q13362 PE=1 SV=3 - [2A5G_HUMAN] Mycophenolic acid acyl-glucuronide esterase, mitochondrial OS=Homo sapiens GN=ABHD10 PE=1 SV=1 - Q9NUJ1 [ABHDA_HUMAN] P21399 Cytoplasmic aconitate hydratase OS=Homo sapiens GN=ACO1 PE=1 SV=3 - [ACOC_HUMAN] P12235 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 - [ADT1_HUMAN] Aminoacyl tRNA synthase complex-interacting multifunctional protein 2 OS=Homo sapiens GN=AIMP2 PE=1 SV=2 - Q13155 [AIMP2_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member B OS=Homo sapiens GN=ANP32B PE=1 SV=1 - Q92688 [AN32B_HUMAN] Q99873 Protein arginine N-methyltransferase 1 OS=Homo sapiens GN=PRMT1 PE=1 SV=2 - [ANM1_HUMAN] O94973 AP-2 complex subunit alpha-2 OS=Homo sapiens GN=AP2A2 PE=1 SV=2 - [AP2A2_HUMAN] P27695 DNA-(apurinic or apyrimidinic site) lyase OS=Homo sapiens GN=APEX1 PE=1 SV=2 - [APEX1_HUMAN] P61204 ADP-ribosylation factor 3 OS=Homo sapiens GN=ARF3 PE=1 SV=2 - [ARF3_HUMAN] 239

Q9H1I8 Activating signal cointegrator 1 complex subunit 2 OS=Homo sapiens GN=ASCC2 PE=1 SV=3 - [ASCC2_HUMAN] P05496 ATP synthase F(0) complex subunit C1, mitochondrial OS=Homo sapiens GN=ATP5G1 PE=2 SV=2 - [AT5G1_HUMAN] P00846 ATP synthase subunit a OS=Homo sapiens GN=MT-ATP6 PE=1 SV=1 - [ATP6_HUMAN] ATP synthase mitochondrial F1 complex assembly factor 1 OS=Homo sapiens GN=ATPAF1 PE=1 SV=1 - Q5TC12 [ATPF1_HUMAN] Q9UBB4 Ataxin-10 OS=Homo sapiens GN=ATXN10 PE=1 SV=1 - [ATX10_HUMAN] Q16548 Bcl-2-related protein A1 OS=Homo sapiens GN=BCL2A1 PE=1 SV=1 - [B2LA1_HUMAN] Branched-chain-amino-acid aminotransferase, mitochondrial OS=Homo sapiens GN=BCAT2 PE=1 SV=2 - O15382 [BCAT2_HUMAN] P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] Q86X55 Histone-arginine methyltransferase CARM1 OS=Homo sapiens GN=CARM1 PE=1 SV=3 - [CARM1_HUMAN] P42574 Caspase-3 OS=Homo sapiens GN=CASP3 PE=1 SV=2 - [CASP3_HUMAN] Q8WWC4 Uncharacterized protein C2orf47, mitochondrial OS=Homo sapiens GN=C2orf47 PE=1 SV=1 - [CB047_HUMAN] Q16204 Coiled-coil domain-containing protein 6 OS=Homo sapiens GN=CCDC6 PE=1 SV=2 - [CCDC6_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] Q9BRX8 Redox-regulatory protein FAM213A OS=Homo sapiens GN=FAM213A PE=1 SV=3 - [F213A_HUMAN] P61024 Cyclin-dependent kinases regulatory subunit 1 OS=Homo sapiens GN=CKS1B PE=1 SV=1 - [CKS1_HUMAN] Q9NX08 COMM domain-containing protein 8 OS=Homo sapiens GN=COMMD8 PE=1 SV=1 - [COMD8_HUMAN] Q9NRP2 COX assembly mitochondrial protein 2 homolog OS=Homo sapiens GN=CMC2 PE=1 SV=1 - [COXM2_HUMAN] Q7Z3J2 UPF0505 protein C16orf62 OS=Homo sapiens GN=C16orf62 PE=1 SV=2 - [CP062_HUMAN] Q02318 Sterol 26-hydroxylase, mitochondrial OS=Homo sapiens GN=CYP27A1 PE=1 SV=1 - [CP27A_HUMAN] O75131 Copine-3 OS=Homo sapiens GN=CPNE3 PE=1 SV=1 - [CPNE3_HUMAN] Calcineurin-like phosphoesterase domain-containing protein 1 OS=Homo sapiens GN=CPPED1 PE=1 SV=3 - Q9BRF8 [CPPED_HUMAN] Q9Y2S2 Lambda-crystallin homolog OS=Homo sapiens GN=CRYL1 PE=1 SV=3 - [CRYL1_HUMAN] O43169 Cytochrome b5 type B OS=Homo sapiens GN=CYB5B PE=1 SV=2 - [CYB5B_HUMAN] Q96HY6 DDRGK domain-containing protein 1 OS=Homo sapiens GN=DDRGK1 PE=1 SV=2 - [DDRGK_HUMAN] Q9GZR7 ATP-dependent RNA helicase DDX24 OS=Homo sapiens GN=DDX24 PE=1 SV=1 - [DDX24_HUMAN] P25685 DnaJ homolog subfamily B member 1 OS=Homo sapiens GN=DNAJB1 PE=1 SV=4 - [DNJB1_HUMAN] Q9NY33 Dipeptidyl peptidase 3 OS=Homo sapiens GN=DPP3 PE=1 SV=2 - [DPP3_HUMAN] O43491 Band 4.1-like protein 2 OS=Homo sapiens GN=EPB41L2 PE=1 SV=1 - [E41L2_HUMAN] Q7L2H7 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens GN=EIF3M PE=1 SV=1 - [EIF3M_HUMAN] P84090 Enhancer of rudimentary homolog OS=Homo sapiens GN=ERH PE=1 SV=1 - [ERH_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN] Q7L8L6 FAST kinase domain-containing protein 5 OS=Homo sapiens GN=FASTKD5 PE=1 SV=1 - [FAKD5_HUMAN] Q9Y613 FH1/FH2 domain-containing protein 1 OS=Homo sapiens GN=FHOD1 PE=1 SV=3 - [FHOD1_HUMAN] Q9Y3D6 Mitochondrial fission 1 protein OS=Homo sapiens GN=FIS1 PE=1 SV=2 - [FIS1_HUMAN] Q9NY12 H/ACA ribonucleoprotein complex subunit 1 OS=Homo sapiens GN=GAR1 PE=1 SV=1 - [GAR1_HUMAN] Q16775 Hydroxyacylglutathione hydrolase, mitochondrial OS=Homo sapiens GN=HAGH PE=1 SV=2 - [GLO2_HUMAN] Q9H8Y8 Golgi reassembly-stacking protein 2 OS=Homo sapiens GN=GORASP2 PE=1 SV=3 - [GORS2_HUMAN] Q9Y3E0 Vesicle transport protein GOT1B OS=Homo sapiens GN=GOLT1B PE=1 SV=1 - [GOT1B_HUMAN] P51810 G-protein coupled receptor 143 OS=Homo sapiens GN=GPR143 PE=1 SV=2 - [GP143_HUMAN] P28161 Glutathione S-transferase Mu 2 OS=Homo sapiens GN=GSTM2 PE=1 SV=2 - [GSTM2_HUMAN] Q4G148 Glucoside xylosyltransferase 1 OS=Homo sapiens GN=GXYLT1 PE=1 SV=2 - [GXLT1_HUMAN] Q9H583 HEAT repeat-containing protein 1 OS=Homo sapiens GN=HEATR1 PE=1 SV=3 - [HEAT1_HUMAN] Q8TCT9 Minor histocompatibility antigen H13 OS=Homo sapiens GN=HM13 PE=1 SV=1 - [HM13_HUMAN] P60842 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - [IF4A1_HUMAN]

240

P78344 Eukaryotic translation initiation factor 4 gamma 2 OS=Homo sapiens GN=EIF4G2 PE=1 SV=1 - [IF4G2_HUMAN] P78318 Immunoglobulin-binding protein 1 OS=Homo sapiens GN=IGBP1 PE=1 SV=1 - [IGBP1_HUMAN] Q8TEX9 Importin-4 OS=Homo sapiens GN=IPO4 PE=1 SV=2 - [IPO4_HUMAN] P04183 Thymidine kinase, cytosolic OS=Homo sapiens GN=TK1 PE=1 SV=2 - [KITH_HUMAN] P23919 Thymidylate kinase OS=Homo sapiens GN=DTYMK PE=1 SV=4 - [KTHY_HUMAN] Q9BU23 Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2 - [LMF2_HUMAN] Q8ND56 Protein LSM14 homolog A OS=Homo sapiens GN=LSM14A PE=1 SV=3 - [LS14A_HUMAN] Q02978 Mitochondrial 2-oxoglutarate/malate carrier protein OS=Homo sapiens GN=SLC25A11 PE=1 SV=3 - [M2OM_HUMAN] Q9BQ69 O-acetyl-ADP-ribose deacetylase MACROD1 OS=Homo sapiens GN=MACROD1 PE=1 SV=2 - [MACD1_HUMAN] P28482 Mitogen-activated protein kinase 1 OS=Homo sapiens GN=MAPK1 PE=1 SV=3 - [MK01_HUMAN] O75352 Mannose-P-dolichol utilization defect 1 protein OS=Homo sapiens GN=MPDU1 PE=1 SV=2 - [MPU1_HUMAN] P58546 Myotrophin OS=Homo sapiens GN=MTPN PE=1 SV=2 - [MTPN_HUMAN] P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5 OS=Homo sapiens GN=NDUFA5 PE=1 SV=3 - Q16718 [NDUA5_HUMAN] NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial OS=Homo sapiens GN=NDUFS8 PE=1 SV=1 - O00217 [NDUS8_HUMAN] NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial OS=Homo sapiens GN=NDUFV2 PE=1 SV=2 - P19404 [NDUV2_HUMAN] Q15843 NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 - [NEDD8_HUMAN] Q9Y3T9 Nucleolar complex protein 2 homolog OS=Homo sapiens GN=NOC2L PE=1 SV=4 - [NOC2L_HUMAN] Q9Y2X3 Nucleolar protein 58 OS=Homo sapiens GN=NOP58 PE=1 SV=1 - [NOP58_HUMAN] O15118 Niemann-Pick C1 protein OS=Homo sapiens GN=NPC1 PE=1 SV=2 - [NPC1_HUMAN] Q9Y639 Neuroplastin OS=Homo sapiens GN=NPTN PE=1 SV=2 - [NPTN_HUMAN] Q9UNZ2 NSFL1 cofactor p47 OS=Homo sapiens GN=NSFL1C PE=1 SV=2 - [NSF1C_HUMAN] Q9Y5Y2 Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens GN=NUBP2 PE=1 SV=1 - [NUBP2_HUMAN] O43929 Origin recognition complex subunit 4 OS=Homo sapiens GN=ORC4 PE=1 SV=2 - [ORC4_HUMAN] O95747 Serine/threonine-protein kinase OSR1 OS=Homo sapiens GN=OXSR1 PE=1 SV=1 - [OXSR1_HUMAN] P12955 Xaa-Pro dipeptidase OS=Homo sapiens GN=PEPD PE=1 SV=3 - [PEPD_HUMAN] P61457 Pterin-4-alpha-carbinolamine dehydratase OS=Homo sapiens GN=PCBD1 PE=1 SV=2 - [PHS_HUMAN] O60664 Perilipin-3 OS=Homo sapiens GN=PLIN3 PE=1 SV=3 - [PLIN3_HUMAN] P40967 Melanocyte protein PMEL OS=Homo sapiens GN=PMEL PE=1 SV=2 - [PMEL_HUMAN] Low molecular weight phosphotyrosine protein phosphatase OS=Homo sapiens GN=ACP1 PE=1 SV=3 - P24666 [PPAC_HUMAN] P61289 Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 PE=1 SV=1 - [PSME3_HUMAN] P30566 Adenylosuccinate lyase OS=Homo sapiens GN=ADSL PE=1 SV=2 - [PUR8_HUMAN] P14927 Cytochrome b-c1 complex subunit 7 OS=Homo sapiens GN=UQCRB PE=1 SV=2 - [QCR7_HUMAN] P06400 Retinoblastoma-associated protein OS=Homo sapiens GN=RB1 PE=1 SV=2 - [RB_HUMAN] Q15293 Reticulocalbin-1 OS=Homo sapiens GN=RCN1 PE=1 SV=1 - [RCN1_HUMAN] Q92900 Regulator of nonsense transcripts 1 OS=Homo sapiens GN=UPF1 PE=1 SV=2 - [RENT1_HUMAN] Q6NUM9 All-trans-retinol 13,14-reductase OS=Homo sapiens GN=RETSAT PE=1 SV=2 - [RETST_HUMAN] P62987 Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 - [RL40_HUMAN] Q9P015 39S ribosomal protein L15, mitochondrial OS=Homo sapiens GN=MRPL15 PE=1 SV=1 - [RM15_HUMAN] O75116 Rho-associated protein kinase 2 OS=Homo sapiens GN=ROCK2 PE=1 SV=4 - [ROCK2_HUMAN] Q9H7B2 Ribosome production factor 2 homolog OS=Homo sapiens GN=RPF2 PE=1 SV=2 - [RPF2_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 2 OS=Homo sapiens GN=RPN2 PE=1 SV=3 - P04844 [RPN2_HUMAN] Q5JTH9 RRP12-like protein OS=Homo sapiens GN=RRP12 PE=1 SV=2 - [RRP12_HUMAN]

241

P0CW22 40S ribosomal protein S17-like OS=Homo sapiens GN=RPS17L PE=3 SV=1 - [RS17L_HUMAN] P62847 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=1 SV=1 - [RS24_HUMAN] O00442 RNA 3'-terminal phosphate cyclase OS=Homo sapiens GN=RTCA PE=1 SV=1 - [RTCA_HUMAN] P31949 Protein S100-A11 OS=Homo sapiens GN=S100A11 PE=1 SV=2 - [S10AB_HUMAN] O43865 Putative adenosylhomocysteinase 2 OS=Homo sapiens GN=AHCYL1 PE=1 SV=2 - [SAHH2_HUMAN] P67812 Signal peptidase complex catalytic subunit SEC11A OS=Homo sapiens GN=SEC11A PE=1 SV=1 - [SC11A_HUMAN] Q9BY50 Signal peptidase complex catalytic subunit SEC11C OS=Homo sapiens GN=SEC11C PE=1 SV=3 - [SC11C_HUMAN] P35237 Serpin B6 OS=Homo sapiens GN=SERPINB6 PE=1 SV=3 - [SPB6_HUMAN] Q9UJZ1 Stomatin-like protein 2 OS=Homo sapiens GN=STOML2 PE=1 SV=1 - [STML2_HUMAN] O43815 Striatin OS=Homo sapiens GN=STRN PE=1 SV=4 - [STRN_HUMAN] O15260 Surfeit locus protein 4 OS=Homo sapiens GN=SURF4 PE=1 SV=3 - [SURF4_HUMAN] Q16563 Synaptophysin-like protein 1 OS=Homo sapiens GN=SYPL1 PE=1 SV=1 - [SYPL1_HUMAN] P23381 Tryptophan--tRNA ligase, cytoplasmic OS=Homo sapiens GN=WARS PE=1 SV=2 - [SYWC_HUMAN] Q9H061 Transmembrane protein 126A OS=Homo sapiens GN=TMEM126A PE=1 SV=1 - [T126A_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] Q15813 Tubulin-specific chaperone E OS=Homo sapiens GN=TBCE PE=1 SV=1 - [TBCE_HUMAN] P02786 Transferrin receptor protein 1 OS=Homo sapiens GN=TFRC PE=1 SV=2 - [TFR1_HUMAN] Q6ZXV5 Transmembrane and TPR repeat-containing protein 3 OS=Homo sapiens GN=TMTC3 PE=1 SV=2 - [TMTC3_HUMAN] Q9H3N1 Thioredoxin-related transmembrane protein 1 OS=Homo sapiens GN=TMX1 PE=1 SV=1 - [TMX1_HUMAN] Q9Y2W1 Thyroid hormone receptor-associated protein 3 OS=Homo sapiens GN=THRAP3 PE=1 SV=2 - [TR150_HUMAN] Q13595 Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A PE=1 SV=1 - [TRA2A_HUMAN] Q9H1Z9 Tetraspanin-10 OS=Homo sapiens GN=TSPAN10 PE=2 SV=1 - [TSN10_HUMAN] P63313 Thymosin beta-10 OS=Homo sapiens GN=TMSB10 PE=1 SV=2 - [TYB10_HUMAN] O43818 U3 small nucleolar RNA-interacting protein 2 OS=Homo sapiens GN=RRP9 PE=1 SV=1 - [U3IP2_HUMAN] P61088 Ubiquitin-conjugating enzyme E2 N OS=Homo sapiens GN=UBE2N PE=1 SV=1 - [UBE2N_HUMAN] P61960 Ubiquitin-fold modifier 1 OS=Homo sapiens GN=UFM1 PE=1 SV=1 - [UFM1_HUMAN] Q16864 V-type proton ATPase subunit F OS=Homo sapiens GN=ATP6V1F PE=1 SV=2 - [VATF_HUMAN] Q96GC9 Vacuole membrane protein 1 OS=Homo sapiens GN=VMP1 PE=1 SV=1 - [VMP1_HUMAN] Q13488 V-type proton ATPase 116 kDa subunit a isoform 3 OS=Homo sapiens GN=TCIRG1 PE=1 SV=3 - [VPP3_HUMAN] Q3MJ13 WD repeat-containing protein 72 OS=Homo sapiens GN=WDR72 PE=2 SV=2 - [WDR72_HUMAN] O76024 Wolframin OS=Homo sapiens GN=WFS1 PE=1 SV=2 - [WFS1_HUMAN] Q9HAV4 Exportin-5 OS=Homo sapiens GN=XPO5 PE=1 SV=1 - [XPO5_HUMAN] Q9UIA9 Exportin-7 OS=Homo sapiens GN=XPO7 PE=1 SV=3 - [XPO7_HUMAN] Q8IWR0 Zinc finger CCCH domain-containing protein 7A OS=Homo sapiens GN=ZC3H7A PE=1 SV=1 - [Z3H7A_HUMAN] P23229 Integrin alpha-6 OS=Homo sapiens GN=ITGA6 PE=1 SV=5 - [ITA6_HUMAN] Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform OS=Homo sapiens GN=PPP2R5C Q13362 PE=1 SV=3 - [2A5G_HUMAN] Q8N2K0 Monoacylglycerol lipase ABHD12 OS=Homo sapiens GN=ABHD12 PE=1 SV=2 - [ABD12_HUMAN] P12235 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 - [ADT1_HUMAN] Aminoacyl tRNA synthase complex-interacting multifunctional protein 2 OS=Homo sapiens GN=AIMP2 PE=1 SV=2 - Q13155 [AIMP2_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member A OS=Homo sapiens GN=ANP32A PE=1 SV=1 - P39687 [AN32A_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member B OS=Homo sapiens GN=ANP32B PE=1 SV=1 - Q92688 [AN32B_HUMAN] Q99873 Protein arginine N-methyltransferase 1 OS=Homo sapiens GN=PRMT1 PE=1 SV=2 - [ANM1_HUMAN] P61204 ADP-ribosylation factor 3 OS=Homo sapiens GN=ARF3 PE=1 SV=2 - [ARF3_HUMAN]

242

P18085 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3 - [ARF4_HUMAN] Q9H1I8 Activating signal cointegrator 1 complex subunit 2 OS=Homo sapiens GN=ASCC2 PE=1 SV=3 - [ASCC2_HUMAN] P05496 ATP synthase F(0) complex subunit C1, mitochondrial OS=Homo sapiens GN=ATP5G1 PE=2 SV=2 - [AT5G1_HUMAN] P00846 ATP synthase subunit a OS=Homo sapiens GN=MT-ATP6 PE=1 SV=1 - [ATP6_HUMAN] Q16548 Bcl-2-related protein A1 OS=Homo sapiens GN=BCL2A1 PE=1 SV=1 - [B2LA1_HUMAN] Q92560 Ubiquitin carboxyl-terminal hydrolase BAP1 OS=Homo sapiens GN=BAP1 PE=1 SV=2 - [BAP1_HUMAN] P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] Q8WWC4 Uncharacterized protein C2orf47, mitochondrial OS=Homo sapiens GN=C2orf47 PE=1 SV=1 - [CB047_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] P61024 Cyclin-dependent kinases regulatory subunit 1 OS=Homo sapiens GN=CKS1B PE=1 SV=1 - [CKS1_HUMAN] Q9Y696 Chloride intracellular channel protein 4 OS=Homo sapiens GN=CLIC4 PE=1 SV=4 - [CLIC4_HUMAN] Q9NX08 COMM domain-containing protein 8 OS=Homo sapiens GN=COMMD8 PE=1 SV=1 - [COMD8_HUMAN] Q7Z3J2 UPF0505 protein C16orf62 OS=Homo sapiens GN=C16orf62 PE=1 SV=2 - [CP062_HUMAN] Q02318 Sterol 26-hydroxylase, mitochondrial OS=Homo sapiens GN=CYP27A1 PE=1 SV=1 - [CP27A_HUMAN] O75131 Copine-3 OS=Homo sapiens GN=CPNE3 PE=1 SV=1 - [CPNE3_HUMAN] Calcineurin-like phosphoesterase domain-containing protein 1 OS=Homo sapiens GN=CPPED1 PE=1 SV=3 - Q9BRF8 [CPPED_HUMAN] O43169 Cytochrome b5 type B OS=Homo sapiens GN=CYB5B PE=1 SV=2 - [CYB5B_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1 OS=Homo sapiens GN=DAD1 PE=1 SV=3 P61803 - [DAD1_HUMAN] Q96HY6 DDRGK domain-containing protein 1 OS=Homo sapiens GN=DDRGK1 PE=1 SV=2 - [DDRGK_HUMAN] Q9BUN8 Derlin-1 OS=Homo sapiens GN=DERL1 PE=1 SV=1 - [DERL1_HUMAN] O60443 Non-syndromic hearing impairment protein 5 OS=Homo sapiens GN=DFNA5 PE=1 SV=2 - [DFNA5_HUMAN] P25685 DnaJ homolog subfamily B member 1 OS=Homo sapiens GN=DNAJB1 PE=1 SV=4 - [DNJB1_HUMAN] Q9NY33 Dipeptidyl peptidase 3 OS=Homo sapiens GN=DPP3 PE=1 SV=2 - [DPP3_HUMAN] O43491 Band 4.1-like protein 2 OS=Homo sapiens GN=EPB41L2 PE=1 SV=1 - [E41L2_HUMAN] Q7L2H7 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens GN=EIF3M PE=1 SV=1 - [EIF3M_HUMAN] P84090 Enhancer of rudimentary homolog OS=Homo sapiens GN=ERH PE=1 SV=1 - [ERH_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN] Q7L8L6 FAST kinase domain-containing protein 5 OS=Homo sapiens GN=FASTKD5 PE=1 SV=1 - [FAKD5_HUMAN] P37268 Squalene synthase OS=Homo sapiens GN=FDFT1 PE=1 SV=1 - [FDFT_HUMAN] Q9Y3D6 Mitochondrial fission 1 protein OS=Homo sapiens GN=FIS1 PE=1 SV=2 - [FIS1_HUMAN] Protein farnesyltransferase/geranylgeranyltransferase type-1 subunit alpha OS=Homo sapiens GN=FNTA PE=1 SV=1 - P49354 [FNTA_HUMAN] Q9NY12 H/ACA ribonucleoprotein complex subunit 1 OS=Homo sapiens GN=GAR1 PE=1 SV=1 - [GAR1_HUMAN] P06396 Gelsolin OS=Homo sapiens GN=GSN PE=1 SV=1 - [GELS_HUMAN] Q16775 Hydroxyacylglutathione hydrolase, mitochondrial OS=Homo sapiens GN=HAGH PE=1 SV=2 - [GLO2_HUMAN] Q9Y3E0 Vesicle transport protein GOT1B OS=Homo sapiens GN=GOLT1B PE=1 SV=1 - [GOT1B_HUMAN] P51810 G-protein coupled receptor 143 OS=Homo sapiens GN=GPR143 PE=1 SV=2 - [GP143_HUMAN] Q4G148 Glucoside xylosyltransferase 1 OS=Homo sapiens GN=GXYLT1 PE=1 SV=2 - [GXLT1_HUMAN] Q9H583 HEAT repeat-containing protein 1 OS=Homo sapiens GN=HEATR1 PE=1 SV=3 - [HEAT1_HUMAN] Q8TCT9 Minor histocompatibility antigen H13 OS=Homo sapiens GN=HM13 PE=1 SV=1 - [HM13_HUMAN] P60842 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - [IF4A1_HUMAN] P78344 Eukaryotic translation initiation factor 4 gamma 2 OS=Homo sapiens GN=EIF4G2 PE=1 SV=1 - [IF4G2_HUMAN] O75153 Clustered mitochondria protein homolog OS=Homo sapiens GN=CLUH PE=1 SV=2 - [CLU_HUMAN] LisH domain and HEAT repeat-containing protein KIAA1468 OS=Homo sapiens GN=KIAA1468 PE=1 SV=2 - Q9P260 [K1468_HUMAN]

243

P04183 Thymidine kinase, cytosolic OS=Homo sapiens GN=TK1 PE=1 SV=2 - [KITH_HUMAN] P23919 Thymidylate kinase OS=Homo sapiens GN=DTYMK PE=1 SV=4 - [KTHY_HUMAN] Q9BU23 Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2 - [LMF2_HUMAN] Q8ND56 Protein LSM14 homolog A OS=Homo sapiens GN=LSM14A PE=1 SV=3 - [LS14A_HUMAN] O75352 Mannose-P-dolichol utilization defect 1 protein OS=Homo sapiens GN=MPDU1 PE=1 SV=2 - [MPU1_HUMAN] P58546 Myotrophin OS=Homo sapiens GN=MTPN PE=1 SV=2 - [MTPN_HUMAN] Q9UBB6 Neurochondrin OS=Homo sapiens GN=NCDN PE=1 SV=1 - [NCDN_HUMAN] P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5 OS=Homo sapiens GN=NDUFA5 PE=1 SV=3 - Q16718 [NDUA5_HUMAN] NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial OS=Homo sapiens GN=NDUFS8 PE=1 SV=1 - O00217 [NDUS8_HUMAN] NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial OS=Homo sapiens GN=NDUFV2 PE=1 SV=2 - P19404 [NDUV2_HUMAN] Q15843 NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 - [NEDD8_HUMAN] Q8NFW8 N-acylneuraminate cytidylyltransferase OS=Homo sapiens GN=CMAS PE=1 SV=2 - [NEUA_HUMAN] O15118 Niemann-Pick C1 protein OS=Homo sapiens GN=NPC1 PE=1 SV=2 - [NPC1_HUMAN] Q9Y639 Neuroplastin OS=Homo sapiens GN=NPTN PE=1 SV=2 - [NPTN_HUMAN] Q9Y5Y2 Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens GN=NUBP2 PE=1 SV=1 - [NUBP2_HUMAN] Nuclear ubiquitous casein and cyclin-dependent kinase substrate 1 OS=Homo sapiens GN=NUCKS1 PE=1 SV=1 - Q9H1E3 [NUCKS_HUMAN] Q15070 Mitochondrial inner membrane protein OXA1L OS=Homo sapiens GN=OXA1L PE=1 SV=3 - [OXA1L_HUMAN] P12955 Xaa-Pro dipeptidase OS=Homo sapiens GN=PEPD PE=1 SV=3 - [PEPD_HUMAN] P61457 Pterin-4-alpha-carbinolamine dehydratase OS=Homo sapiens GN=PCBD1 PE=1 SV=2 - [PHS_HUMAN] Q13492 Phosphatidylinositol-binding clathrin assembly protein OS=Homo sapiens GN=PICALM PE=1 SV=2 - [PICAL_HUMAN] O60664 Perilipin-3 OS=Homo sapiens GN=PLIN3 PE=1 SV=3 - [PLIN3_HUMAN] P40967 Melanocyte protein PMEL OS=Homo sapiens GN=PMEL PE=1 SV=2 - [PMEL_HUMAN] Q15126 Phosphomevalonate kinase OS=Homo sapiens GN=PMVK PE=1 SV=3 - [PMVK_HUMAN] P61289 Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 PE=1 SV=1 - [PSME3_HUMAN] P30566 Adenylosuccinate lyase OS=Homo sapiens GN=ADSL PE=1 SV=2 - [PUR8_HUMAN] P14927 Cytochrome b-c1 complex subunit 7 OS=Homo sapiens GN=UQCRB PE=1 SV=2 - [QCR7_HUMAN] P20340 Ras-related protein Rab-6A OS=Homo sapiens GN=RAB6A PE=1 SV=3 - [RAB6A_HUMAN] P35241 Radixin OS=Homo sapiens GN=RDX PE=1 SV=1 - [RADI_HUMAN] P06400 Retinoblastoma-associated protein OS=Homo sapiens GN=RB1 PE=1 SV=2 - [RB_HUMAN] Q92900 Regulator of nonsense transcripts 1 OS=Homo sapiens GN=UPF1 PE=1 SV=2 - [RENT1_HUMAN] Q6NUM9 All-trans-retinol 13,14-reductase OS=Homo sapiens GN=RETSAT PE=1 SV=2 - [RETST_HUMAN] P62987 Ubiquitin-60S ribosomal protein L40 OS=Homo sapiens GN=UBA52 PE=1 SV=2 - [RL40_HUMAN] Q9P015 39S ribosomal protein L15, mitochondrial OS=Homo sapiens GN=MRPL15 PE=1 SV=1 - [RM15_HUMAN] O75116 Rho-associated protein kinase 2 OS=Homo sapiens GN=ROCK2 PE=1 SV=4 - [ROCK2_HUMAN] Q9H7B2 Ribosome production factor 2 homolog OS=Homo sapiens GN=RPF2 PE=1 SV=2 - [RPF2_HUMAN] Q5JTH9 RRP12-like protein OS=Homo sapiens GN=RRP12 PE=1 SV=2 - [RRP12_HUMAN] P0CW22 40S ribosomal protein S17-like OS=Homo sapiens GN=RPS17L PE=3 SV=1 - [RS17L_HUMAN] P62847 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=1 SV=1 - [RS24_HUMAN] P67812 Signal peptidase complex catalytic subunit SEC11A OS=Homo sapiens GN=SEC11A PE=1 SV=1 - [SC11A_HUMAN] Q9BY50 Signal peptidase complex catalytic subunit SEC11C OS=Homo sapiens GN=SEC11C PE=1 SV=3 - [SC11C_HUMAN] Q9UJZ1 Stomatin-like protein 2 OS=Homo sapiens GN=STOML2 PE=1 SV=1 - [STML2_HUMAN] P49589 Cysteine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=CARS PE=1 SV=3 - [SYCC_HUMAN]

244

P23381 Tryptophan--tRNA ligase, cytoplasmic OS=Homo sapiens GN=WARS PE=1 SV=2 - [SYWC_HUMAN] Q9H061 Transmembrane protein 126A OS=Homo sapiens GN=TMEM126A PE=1 SV=1 - [T126A_HUMAN] Q13148 TAR DNA-binding protein 43 OS=Homo sapiens GN=TARDBP PE=1 SV=1 - [TADBP_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] Q15813 Tubulin-specific chaperone E OS=Homo sapiens GN=TBCE PE=1 SV=1 - [TBCE_HUMAN] Q9NZ01 Very-long-chain enoyl-CoA reductase OS=Homo sapiens GN=TECR PE=1 SV=1 - [TECR_HUMAN] P24752 Acetyl-CoA acetyltransferase, mitochondrial OS=Homo sapiens GN=ACAT1 PE=1 SV=1 - [THIL_HUMAN] Q13595 Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A PE=1 SV=1 - [TRA2A_HUMAN] Q8NG06 Tripartite motif-containing protein 58 OS=Homo sapiens GN=TRIM58 PE=2 SV=2 - [TRI58_HUMAN] P63313 Thymosin beta-10 OS=Homo sapiens GN=TMSB10 PE=1 SV=2 - [TYB10_HUMAN] O43818 U3 small nucleolar RNA-interacting protein 2 OS=Homo sapiens GN=RRP9 PE=1 SV=1 - [U3IP2_HUMAN] P61086 Ubiquitin-conjugating enzyme E2 K OS=Homo sapiens GN=UBE2K PE=1 SV=3 - [UBE2K_HUMAN] P61088 Ubiquitin-conjugating enzyme E2 N OS=Homo sapiens GN=UBE2N PE=1 SV=1 - [UBE2N_HUMAN] P61960 Ubiquitin-fold modifier 1 OS=Homo sapiens GN=UFM1 PE=1 SV=1 - [UFM1_HUMAN] Q9NUQ7 Ufm1-specific protease 2 OS=Homo sapiens GN=UFSP2 PE=2 SV=3 - [UFSP2_HUMAN] Q16864 V-type proton ATPase subunit F OS=Homo sapiens GN=ATP6V1F PE=1 SV=2 - [VATF_HUMAN] Q96GC9 Vacuole membrane protein 1 OS=Homo sapiens GN=VMP1 PE=1 SV=1 - [VMP1_HUMAN] O94967 WD repeat-containing protein 47 OS=Homo sapiens GN=WDR47 PE=1 SV=1 - [WDR47_HUMAN] Q3MJ13 WD repeat-containing protein 72 OS=Homo sapiens GN=WDR72 PE=2 SV=2 - [WDR72_HUMAN] O76024 Wolframin OS=Homo sapiens GN=WFS1 PE=1 SV=2 - [WFS1_HUMAN] Q9UIA9 Exportin-7 OS=Homo sapiens GN=XPO7 PE=1 SV=3 - [XPO7_HUMAN] Q13972 Ras-specific guanine nucleotide-releasing factor 1 OS=Homo sapiens GN=RASGRF1 PE=1 SV=2 - [RGRF1_HUMAN]

Table 7‎ .27. Up-regulated proteins due to use of X4 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Eukaryotic translation initiation factor 4E-binding protein 1 OS=Homo sapiens GN=EIF4EBP1 PE=1 SV=3 - Q13541 [4EBP1_HUMAN] P61160 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 - [ARP2_HUMAN] Q7Z5Q1 Cytoplasmic polyadenylation element-binding protein 2 OS=Homo sapiens GN=CPEB2 PE=2 SV=3 - [CPEB2_HUMAN] P63167 Dynein light chain 1, cytoplasmic OS=Homo sapiens GN=DYNLL1 PE=1 SV=1 - [DYL1_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] P04908 Histone H2A type 1-B/E OS=Homo sapiens GN=HIST1H2AB PE=1 SV=2 - [H2A1B_HUMAN] Q99878 Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 - [H2A1J_HUMAN] P69905 Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 - [HBA_HUMAN] Q5SSJ5 Heterochromatin protein 1-binding protein 3 OS=Homo sapiens GN=HP1BP3 PE=1 SV=1 - [HP1B3_HUMAN] Q15181 Inorganic pyrophosphatase OS=Homo sapiens GN=PPA1 PE=1 SV=2 - [IPYR_HUMAN] P10721 Mast/stem cell growth factor receptor Kit OS=Homo sapiens GN=KIT PE=1 SV=1 - [KIT_HUMAN] Q9BSU3 N-alpha-acetyltransferase 11 OS=Homo sapiens GN=NAA11 PE=1 SV=3 - [NAA11_HUMAN] O60925 Prefoldin subunit 1 OS=Homo sapiens GN=PFDN1 PE=1 SV=2 - [PFD1_HUMAN] P51159 Ras-related protein Rab-27A OS=Homo sapiens GN=RAB27A PE=1 SV=3 - [RB27A_HUMAN] P47914 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2 - [RL29_HUMAN] P61927 60S ribosomal protein L37 OS=Homo sapiens GN=RPL37 PE=1 SV=2 - [RL37_HUMAN] Q8N5N7 39S ribosomal protein L50, mitochondrial OS=Homo sapiens GN=MRPL50 PE=1 SV=2 - [RM50_HUMAN] P62273 40S ribosomal protein S29 OS=Homo sapiens GN=RPS29 PE=1 SV=2 - [RS29_HUMAN]

245

Q6NUQ4 Transmembrane protein 214 OS=Homo sapiens GN=TMEM214 PE=1 SV=2 - [TM214_HUMAN] Q9HD45 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9SF3 PE=1 SV=2 - [TM9S3_HUMAN] Q96LD4 Tripartite motif-containing protein 47 OS=Homo sapiens GN=TRIM47 PE=1 SV=2 - [TRI47_HUMAN] Accession Description Eukaryotic translation initiation factor 4E-binding protein 1 OS=Homo sapiens GN=EIF4EBP1 PE=1 SV=3 - Q13541 [4EBP1_HUMAN] Q8IWZ3 Ankyrin repeat and KH domain-containing protein 1 OS=Homo sapiens GN=ANKHD1 PE=1 SV=1 - [ANKH1_HUMAN] P61160 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 - [ARP2_HUMAN] P13987 CD59 glycoprotein OS=Homo sapiens GN=CD59 PE=1 SV=1 - [CD59_HUMAN] Q8WUY1 Protein THEM6 OS=Homo sapiens GN=THEM6 PE=1 SV=2 - [THEM6_HUMAN] Coiled-coil-helix-coiled-coil-helix domain-containing protein 3, mitochondrial OS=Homo sapiens GN=CHCHD3 PE=1 Q9NX63 SV=1 - [CHCH3_HUMAN] P02511 Alpha-crystallin B chain OS=Homo sapiens GN=CRYAB PE=1 SV=2 - [CRYAB_HUMAN] O60888 Protein CutA OS=Homo sapiens GN=CUTA PE=1 SV=2 - [CUTA_HUMAN] P63167 Dynein light chain 1, cytoplasmic OS=Homo sapiens GN=DYNLL1 PE=1 SV=1 - [DYL1_HUMAN] Q01780 Exosome component 10 OS=Homo sapiens GN=EXOSC10 PE=1 SV=2 - [EXOSX_HUMAN] Q96AC1 Fermitin family homolog 2 OS=Homo sapiens GN=FERMT2 PE=1 SV=1 - [FERM2_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] Q8TB36 Ganglioside-induced differentiation-associated protein 1 OS=Homo sapiens GN=GDAP1 PE=1 SV=3 - [GDAP1_HUMAN] P04908 Histone H2A type 1-B/E OS=Homo sapiens GN=HIST1H2AB PE=1 SV=2 - [H2A1B_HUMAN] Q99878 Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 - [H2A1J_HUMAN] P69905 Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 - [HBA_HUMAN] Integrin-linked kinase-associated serine/threonine phosphatase 2C OS=Homo sapiens GN=ILKAP PE=1 SV=1 - Q9H0C8 [ILKAP_HUMAN] P52292 Importin subunit alpha-2 OS=Homo sapiens GN=KPNA2 PE=1 SV=1 - [IMA2_HUMAN] P42167 Lamina-associated polypeptide 2, isoforms beta/gamma OS=Homo sapiens GN=TMPO PE=1 SV=2 - [LAP2B_HUMAN] P30419 Glycylpeptide N-tetradecanoyltransferase 1 OS=Homo sapiens GN=NMT1 PE=1 SV=2 - [NMT1_HUMAN] Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial P11182 OS=Homo sapiens GN=DBT PE=1 SV=3 - [ODB2_HUMAN] O60925 Prefoldin subunit 1 OS=Homo sapiens GN=PFDN1 PE=1 SV=2 - [PFD1_HUMAN] P78356 Phosphatidylinositol 5-phosphate 4-kinase type-2 beta OS=Homo sapiens GN=PIP4K2B PE=1 SV=1 - [PI42B_HUMAN] O43663 Protein regulator of cytokinesis 1 OS=Homo sapiens GN=PRC1 PE=1 SV=2 - [PRC1_HUMAN] Q06323 Proteasome activator complex subunit 1 OS=Homo sapiens GN=PSME1 PE=1 SV=1 - [PSME1_HUMAN] P61927 60S ribosomal protein L37 OS=Homo sapiens GN=RPL37 PE=1 SV=2 - [RL37_HUMAN] Q8N5N7 39S ribosomal protein L50, mitochondrial OS=Homo sapiens GN=MRPL50 PE=1 SV=2 - [RM50_HUMAN] P62273 40S ribosomal protein S29 OS=Homo sapiens GN=RPS29 PE=1 SV=2 - [RS29_HUMAN] Q9Y3Z3 SAM domain and HD domain-containing protein 1 OS=Homo sapiens GN=SAMHD1 PE=1 SV=2 - [SAMH1_HUMAN] Q6ZW31 Rho GTPase-activating protein SYDE1 OS=Homo sapiens GN=SYDE1 PE=1 SV=1 - [SYDE1_HUMAN] Q6NUQ4 Transmembrane protein 214 OS=Homo sapiens GN=TMEM214 PE=1 SV=2 - [TM214_HUMAN] Q9HD45 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9SF3 PE=1 SV=2 - [TM9S3_HUMAN] Q9NYL9 Tropomodulin-3 OS=Homo sapiens GN=TMOD3 PE=1 SV=1 - [TMOD3_HUMAN] Q96LD4 Tripartite motif-containing protein 47 OS=Homo sapiens GN=TRIM47 PE=1 SV=2 - [TRI47_HUMAN] Q14966 Zinc finger protein 638 OS=Homo sapiens GN=ZNF638 PE=1 SV=2 - [ZN638_HUMAN]

246

Table 7‎ .28. Down-regulated proteins due to use of X7 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform OS=Homo sapiens GN=PPP2R5C Q13362 PE=1 SV=3 - [2A5G_HUMAN] P31937 3-hydroxyisobutyrate dehydrogenase, mitochondrial OS=Homo sapiens GN=HIBADH PE=1 SV=2 - [3HIDH_HUMAN] P12235 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 - [ADT1_HUMAN] P53004 Biliverdin reductase A OS=Homo sapiens GN=BLVRA PE=1 SV=2 - [BIEA_HUMAN] P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] Q8WWC4 Uncharacterized protein C2orf47, mitochondrial OS=Homo sapiens GN=C2orf47 PE=1 SV=1 - [CB047_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] Q8IWX8 Calcium homeostasis endoplasmic reticulum protein OS=Homo sapiens GN=CHERP PE=1 SV=3 - [CHERP_HUMAN] Q9BRX8 Redox-regulatory protein FAM213A OS=Homo sapiens GN=FAM213A PE=1 SV=3 - [F213A_HUMAN] P61024 Cyclin-dependent kinases regulatory subunit 1 OS=Homo sapiens GN=CKS1B PE=1 SV=1 - [CKS1_HUMAN] Q9NX08 COMM domain-containing protein 8 OS=Homo sapiens GN=COMMD8 PE=1 SV=1 - [COMD8_HUMAN] Q02318 Sterol 26-hydroxylase, mitochondrial OS=Homo sapiens GN=CYP27A1 PE=1 SV=1 - [CP27A_HUMAN] O43169 Cytochrome b5 type B OS=Homo sapiens GN=CYB5B PE=1 SV=2 - [CYB5B_HUMAN] P25685 DnaJ homolog subfamily B member 1 OS=Homo sapiens GN=DNAJB1 PE=1 SV=4 - [DNJB1_HUMAN] Q9NY33 Dipeptidyl peptidase 3 OS=Homo sapiens GN=DPP3 PE=1 SV=2 - [DPP3_HUMAN] Q7L2H7 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens GN=EIF3M PE=1 SV=1 - [EIF3M_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN] Q9BSJ2 Gamma-tubulin complex component 2 OS=Homo sapiens GN=TUBGCP2 PE=1 SV=2 - [GCP2_HUMAN] Q9Y3E0 Vesicle transport protein GOT1B OS=Homo sapiens GN=GOLT1B PE=1 SV=1 - [GOT1B_HUMAN] P51810 G-protein coupled receptor 143 OS=Homo sapiens GN=GPR143 PE=1 SV=2 - [GP143_HUMAN] Q4G148 Glucoside xylosyltransferase 1 OS=Homo sapiens GN=GXYLT1 PE=1 SV=2 - [GXLT1_HUMAN] Q8TCT9 Minor histocompatibility antigen H13 OS=Homo sapiens GN=HM13 PE=1 SV=1 - [HM13_HUMAN] P60842 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - [IF4A1_HUMAN] O75153 Clustered mitochondria protein homolog OS=Homo sapiens GN=CLUH PE=1 SV=2 - [CLU_HUMAN] P23919 Thymidylate kinase OS=Homo sapiens GN=DTYMK PE=1 SV=4 - [KTHY_HUMAN] Q9BU23 Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2 - [LMF2_HUMAN] Q8ND56 Protein LSM14 homolog A OS=Homo sapiens GN=LSM14A PE=1 SV=3 - [LS14A_HUMAN] P46821 Microtubule-associated protein 1B OS=Homo sapiens GN=MAP1B PE=1 SV=2 - [MAP1B_HUMAN] Q13765 Nascent polypeptide-associated complex subunit alpha OS=Homo sapiens GN=NACA PE=1 SV=1 - [NACA_HUMAN] P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial OS=Homo sapiens GN=NDUFS8 PE=1 SV=1 - O00217 [NDUS8_HUMAN] Q15843 NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 - [NEDD8_HUMAN] Q8NFW8 N-acylneuraminate cytidylyltransferase OS=Homo sapiens GN=CMAS PE=1 SV=2 - [NEUA_HUMAN] Q92542 Nicastrin OS=Homo sapiens GN=NCSTN PE=1 SV=2 - [NICA_HUMAN] O15118 Niemann-Pick C1 protein OS=Homo sapiens GN=NPC1 PE=1 SV=2 - [NPC1_HUMAN] Q9UNZ2 NSFL1 cofactor p47 OS=Homo sapiens GN=NSFL1C PE=1 SV=2 - [NSF1C_HUMAN] O43929 Origin recognition complex subunit 4 OS=Homo sapiens GN=ORC4 PE=1 SV=2 - [ORC4_HUMAN] P12955 Xaa-Pro dipeptidase OS=Homo sapiens GN=PEPD PE=1 SV=3 - [PEPD_HUMAN] P40967 Melanocyte protein PMEL OS=Homo sapiens GN=PMEL PE=1 SV=2 - [PMEL_HUMAN] Serine/threonine-protein phosphatase 6 regulatory subunit 3 OS=Homo sapiens GN=PPP6R3 PE=1 SV=2 - Q5H9R7 [PP6R3_HUMAN] Low molecular weight phosphotyrosine protein phosphatase OS=Homo sapiens GN=ACP1 PE=1 SV=3 - P24666 [PPAC_HUMAN] 247

P61289 Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 PE=1 SV=1 - [PSME3_HUMAN] P30566 Adenylosuccinate lyase OS=Homo sapiens GN=ADSL PE=1 SV=2 - [PUR8_HUMAN] Q9NRW1 Ras-related protein Rab-6B OS=Homo sapiens GN=RAB6B PE=1 SV=1 - [RAB6B_HUMAN] Q96HR9 Receptor expression-enhancing protein 6 OS=Homo sapiens GN=REEP6 PE=1 SV=1 - [REEP6_HUMAN] Q6NUM9 All-trans-retinol 13,14-reductase OS=Homo sapiens GN=RETSAT PE=1 SV=2 - [RETST_HUMAN] P62910 60S ribosomal protein L32 OS=Homo sapiens GN=RPL32 PE=1 SV=2 - [RL32_HUMAN] Q9H7B2 Ribosome production factor 2 homolog OS=Homo sapiens GN=RPF2 PE=1 SV=2 - [RPF2_HUMAN] P08621 U1 small nuclear ribonucleoprotein 70 kDa OS=Homo sapiens GN=SNRNP70 PE=1 SV=2 - [RU17_HUMAN] Q9BY50 Signal peptidase complex catalytic subunit SEC11C OS=Homo sapiens GN=SEC11C PE=1 SV=3 - [SC11C_HUMAN] Q13247 Serine/arginine-rich splicing factor 6 OS=Homo sapiens GN=SRSF6 PE=1 SV=2 - [SRSF6_HUMAN] Q9UJZ1 Stomatin-like protein 2 OS=Homo sapiens GN=STOML2 PE=1 SV=1 - [STML2_HUMAN] Q15526 Surfeit locus protein 1 OS=Homo sapiens GN=SURF1 PE=1 SV=1 - [SURF1_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] Q13428 Treacle protein OS=Homo sapiens GN=TCOF1 PE=1 SV=3 - [TCOF_HUMAN] Q9NZ01 Very-long-chain enoyl-CoA reductase OS=Homo sapiens GN=TECR PE=1 SV=1 - [TECR_HUMAN] Q99805 Transmembrane 9 superfamily member 2 OS=Homo sapiens GN=TM9SF2 PE=1 SV=1 - [TM9S2_HUMAN] Q6ZXV5 Transmembrane and TPR repeat-containing protein 3 OS=Homo sapiens GN=TMTC3 PE=1 SV=2 - [TMTC3_HUMAN] Q9Y2W1 Thyroid hormone receptor-associated protein 3 OS=Homo sapiens GN=THRAP3 PE=1 SV=2 - [TR150_HUMAN] Q13595 Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A PE=1 SV=1 - [TRA2A_HUMAN] O43818 U3 small nucleolar RNA-interacting protein 2 OS=Homo sapiens GN=RRP9 PE=1 SV=1 - [U3IP2_HUMAN] P61088 Ubiquitin-conjugating enzyme E2 N OS=Homo sapiens GN=UBE2N PE=1 SV=1 - [UBE2N_HUMAN] P61960 Ubiquitin-fold modifier 1 OS=Homo sapiens GN=UFM1 PE=1 SV=1 - [UFM1_HUMAN] Q9GZL7 Ribosome biogenesis protein WDR12 OS=Homo sapiens GN=WDR12 PE=1 SV=2 - [WDR12_HUMAN]

Table 7‎ .29. Up-regulated proteins due to use of X7 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Q8IWZ3 Ankyrin repeat and KH domain-containing protein 1 OS=Homo sapiens GN=ANKHD1 PE=1 SV=1 - [ANKH1_HUMAN] P61160 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 - [ARP2_HUMAN] P46379 Large proline-rich protein BAG6 OS=Homo sapiens GN=BAG6 PE=1 SV=2 - [BAG6_HUMAN] P07339 Cathepsin D OS=Homo sapiens GN=CTSD PE=1 SV=1 - [CATD_HUMAN] P61201 COP9 signalosome complex subunit 2 OS=Homo sapiens GN=COPS2 PE=1 SV=1 - [CSN2_HUMAN] O60888 Protein CutA OS=Homo sapiens GN=CUTA PE=1 SV=2 - [CUTA_HUMAN] Q7L576 Cytoplasmic FMR1-interacting protein 1 OS=Homo sapiens GN=CYFIP1 PE=1 SV=1 - [CYFP1_HUMAN] Q9UJU6 Drebrin-like protein OS=Homo sapiens GN=DBNL PE=1 SV=1 - [DBNL_HUMAN] P63167 Dynein light chain 1, cytoplasmic OS=Homo sapiens GN=DYNLL1 PE=1 SV=1 - [DYL1_HUMAN] Q7RTS9 Dymeclin OS=Homo sapiens GN=DYM PE=1 SV=1 - [DYM_HUMAN] Q96AC1 Fermitin family homolog 2 OS=Homo sapiens GN=FERMT2 PE=1 SV=1 - [FERM2_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] Q9C0B1 Alpha-ketoglutarate-dependent dioxygenase FTO OS=Homo sapiens GN=FTO PE=1 SV=3 - [FTO_HUMAN] Q8TB36 Ganglioside-induced differentiation-associated protein 1 OS=Homo sapiens GN=GDAP1 PE=1 SV=3 - [GDAP1_HUMAN] Q7L5D6 Golgi to ER traffic protein 4 homolog OS=Homo sapiens GN=GET4 PE=1 SV=1 - [GET4_HUMAN] Q49A26 Putative oxidoreductase GLYR1 OS=Homo sapiens GN=GLYR1 PE=1 SV=3 - [GLYR1_HUMAN] P04908 Histone H2A type 1-B/E OS=Homo sapiens GN=HIST1H2AB PE=1 SV=2 - [H2A1B_HUMAN] Q99878 Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 - [H2A1J_HUMAN]

248

P56524 Histone deacetylase 4 OS=Homo sapiens GN=HDAC4 PE=1 SV=3 - [HDAC4_HUMAN] P09429 High mobility group protein B1 OS=Homo sapiens GN=HMGB1 PE=1 SV=3 - [HMGB1_HUMAN] O75526 RNA-binding motif protein, X-linked-like-2 OS=Homo sapiens GN=RBMXL2 PE=1 SV=3 - [RMXL2_HUMAN] Q5SSJ5 Heterochromatin protein 1-binding protein 3 OS=Homo sapiens GN=HP1BP3 PE=1 SV=1 - [HP1B3_HUMAN] P52292 Importin subunit alpha-2 OS=Homo sapiens GN=KPNA2 PE=1 SV=1 - [IMA2_HUMAN] P42167 Lamina-associated polypeptide 2, isoforms beta/gamma OS=Homo sapiens GN=TMPO PE=1 SV=2 - [LAP2B_HUMAN] O95232 Luc7-like protein 3 OS=Homo sapiens GN=LUC7L3 PE=1 SV=2 - [LC7L3_HUMAN] P62310 U6 snRNA-associated Sm-like protein LSm3 OS=Homo sapiens GN=LSM3 PE=1 SV=2 - [LSM3_HUMAN] O75431 Metaxin-2 OS=Homo sapiens GN=MTX2 PE=1 SV=1 - [MTX2_HUMAN] Q9UJ70 N-acetyl-D-glucosamine kinase OS=Homo sapiens GN=NAGK PE=1 SV=4 - [NAGK_HUMAN] P30419 Glycylpeptide N-tetradecanoyltransferase 1 OS=Homo sapiens GN=NMT1 PE=1 SV=2 - [NMT1_HUMAN] Q9NZT2 Opioid growth factor receptor OS=Homo sapiens GN=OGFR PE=1 SV=3 - [OGFR_HUMAN] Q9H074 Polyadenylate-binding protein-interacting protein 1 OS=Homo sapiens GN=PAIP1 PE=1 SV=1 - [PAIP1_HUMAN] P51159 Ras-related protein Rab-27A OS=Homo sapiens GN=RAB27A PE=1 SV=3 - [RB27A_HUMAN] P46776 60S ribosomal protein L27a OS=Homo sapiens GN=RPL27A PE=1 SV=2 - [RL27A_HUMAN] Q9H9J2 39S ribosomal protein L44, mitochondrial OS=Homo sapiens GN=MRPL44 PE=1 SV=1 - [RM44_HUMAN] P62273 40S ribosomal protein S29 OS=Homo sapiens GN=RPS29 PE=1 SV=2 - [RS29_HUMAN] Q9NR45 Sialic acid synthase OS=Homo sapiens GN=NANS PE=1 SV=2 - [SIAS_HUMAN] P49458 Signal recognition particle 9 kDa protein OS=Homo sapiens GN=SRP9 PE=1 SV=2 - [SRP09_HUMAN] Q13509 Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 - [TBB3_HUMAN] Q9HD45 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9SF3 PE=1 SV=2 - [TM9S3_HUMAN] Q9Y296 Trafficking protein particle complex subunit 4 OS=Homo sapiens GN=TRAPPC4 PE=1 SV=1 - [TPPC4_HUMAN] Q96LD4 Tripartite motif-containing protein 47 OS=Homo sapiens GN=TRIM47 PE=1 SV=2 - [TRI47_HUMAN] Q9BRA2 Thioredoxin domain-containing protein 17 OS=Homo sapiens GN=TXNDC17 PE=1 SV=1 - [TXD17_HUMAN]

Table 7‎ .30. Down-regulated proteins due to use of BT2 compound in ME1007 cell line at 6 h of serum stimulation Accession Description O95336 6-phosphogluconolactonase OS=Homo sapiens GN=PGLS PE=1 SV=2 - [6PGL_HUMAN] Q9UJX5 Anaphase-promoting complex subunit 4 OS=Homo sapiens GN=ANAPC4 PE=1 SV=2 - [APC4_HUMAN] Q9HDC9 Adipocyte plasma membrane-associated protein OS=Homo sapiens GN=APMAP PE=1 SV=2 - [APMAP_HUMAN] Branched-chain-amino-acid aminotransferase, mitochondrial OS=Homo sapiens GN=BCAT2 PE=1 SV=2 - O15382 [BCAT2_HUMAN] Q9UQ03 Coronin-2B OS=Homo sapiens GN=CORO2B PE=2 SV=4 - [COR2B_HUMAN] Q9UJU6 Drebrin-like protein OS=Homo sapiens GN=DBNL PE=1 SV=1 - [DBNL_HUMAN] P38117 Electron transfer flavoprotein subunit beta OS=Homo sapiens GN=ETFB PE=1 SV=3 - [ETFB_HUMAN] Q01780 Exosome component 10 OS=Homo sapiens GN=EXOSC10 PE=1 SV=2 - [EXOSX_HUMAN] P48637 Glutathione synthetase OS=Homo sapiens GN=GSS PE=1 SV=1 - [GSHB_HUMAN] Q9UPZ3 Hermansky-Pudlak syndrome 5 protein OS=Homo sapiens GN=HPS5 PE=1 SV=2 - [HPS5_HUMAN] Dual specificity mitogen-activated protein kinase kinase 2 OS=Homo sapiens GN=MAP2K2 PE=1 SV=1 - P36507 [MP2K2_HUMAN] Q9UBB6 Neurochondrin OS=Homo sapiens GN=NCDN PE=1 SV=1 - [NCDN_HUMAN] Q9GZM8 Nuclear distribution protein nudE-like 1 OS=Homo sapiens GN=NDEL1 PE=1 SV=1 - [NDEL1_HUMAN] Nuclear ubiquitous casein and cyclin-dependent kinase substrate 1 OS=Homo sapiens GN=NUCKS1 PE=1 SV=1 - Q9H1E3 [NUCKS_HUMAN] Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial P11182 OS=Homo sapiens GN=DBT PE=1 SV=3 - [ODB2_HUMAN] Q9H792 Pseudopodium-enriched atypical kinase 1 OS=Homo sapiens GN=PEAK1 PE=1 SV=4 - [PEAK1_HUMAN]

249

P62854 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3 - [RS26_HUMAN] Q8NBI5 Solute carrier family 43 member 3 OS=Homo sapiens GN=SLC43A3 PE=1 SV=2 - [S43A3_HUMAN] P42285 Superkiller viralicidic activity 2-like 2 OS=Homo sapiens GN=SKIV2L2 PE=1 SV=3 - [SK2L2_HUMAN] Q04837 Single-stranded DNA-binding protein, mitochondrial OS=Homo sapiens GN=SSBP1 PE=1 SV=1 - [SSBP_HUMAN] Q15526 Surfeit locus protein 1 OS=Homo sapiens GN=SURF1 PE=1 SV=1 - [SURF1_HUMAN] Q13428 Treacle protein OS=Homo sapiens GN=TCOF1 PE=1 SV=3 - [TCOF_HUMAN] Q9HD45 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9SF3 PE=1 SV=2 - [TM9S3_HUMAN] Q96LD4 Tripartite motif-containing protein 47 OS=Homo sapiens GN=TRIM47 PE=1 SV=2 - [TRI47_HUMAN] P40126 L-dopachrome tautomerase OS=Homo sapiens GN=DCT PE=1 SV=1 - [TYRP2_HUMAN] P61421 V-type proton ATPase subunit d 1 OS=Homo sapiens GN=ATP6V0D1 PE=1 SV=1 - [VA0D1_HUMAN]

Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform OS=Homo sapiens GN=PPP2R5C Q13362 PE=1 SV=3 - [2A5G_HUMAN] P31937 3-hydroxyisobutyrate dehydrogenase, mitochondrial OS=Homo sapiens GN=HIBADH PE=1 SV=2 - [3HIDH_HUMAN] P28288 ATP-binding cassette sub-family D member 3 OS=Homo sapiens GN=ABCD3 PE=1 SV=1 - [ABCD3_HUMAN] Q8N2K0 Monoacylglycerol lipase ABHD12 OS=Homo sapiens GN=ABHD12 PE=1 SV=2 - [ABD12_HUMAN] P21399 Cytoplasmic aconitate hydratase OS=Homo sapiens GN=ACO1 PE=1 SV=3 - [ACOC_HUMAN] P12235 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 - [ADT1_HUMAN] Aminoacyl tRNA synthase complex-interacting multifunctional protein 2 OS=Homo sapiens GN=AIMP2 PE=1 SV=2 - Q13155 [AIMP2_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member A OS=Homo sapiens GN=ANP32A PE=1 SV=1 - P39687 [AN32A_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member B OS=Homo sapiens GN=ANP32B PE=1 SV=1 - Q92688 [AN32B_HUMAN] O94973 AP-2 complex subunit alpha-2 OS=Homo sapiens GN=AP2A2 PE=1 SV=2 - [AP2A2_HUMAN] P27695 DNA-(apurinic or apyrimidinic site) lyase OS=Homo sapiens GN=APEX1 PE=1 SV=2 - [APEX1_HUMAN] P61204 ADP-ribosylation factor 3 OS=Homo sapiens GN=ARF3 PE=1 SV=2 - [ARF3_HUMAN] P18085 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3 - [ARF4_HUMAN] Q9H1I8 Activating signal cointegrator 1 complex subunit 2 OS=Homo sapiens GN=ASCC2 PE=1 SV=3 - [ASCC2_HUMAN] P05496 ATP synthase F(0) complex subunit C1, mitochondrial OS=Homo sapiens GN=ATP5G1 PE=2 SV=2 - [AT5G1_HUMAN] ATP synthase mitochondrial F1 complex assembly factor 1 OS=Homo sapiens GN=ATPAF1 PE=1 SV=1 - Q5TC12 [ATPF1_HUMAN] Q9UBB4 Ataxin-10 OS=Homo sapiens GN=ATXN10 PE=1 SV=1 - [ATX10_HUMAN] Q16548 Bcl-2-related protein A1 OS=Homo sapiens GN=BCL2A1 PE=1 SV=1 - [B2LA1_HUMAN] Q92560 Ubiquitin carboxyl-terminal hydrolase BAP1 OS=Homo sapiens GN=BAP1 PE=1 SV=2 - [BAP1_HUMAN] Branched-chain-amino-acid aminotransferase, mitochondrial OS=Homo sapiens GN=BCAT2 PE=1 SV=2 - O15382 [BCAT2_HUMAN] Q9P287 BRCA2 and CDKN1A-interacting protein OS=Homo sapiens GN=BCCIP PE=1 SV=1 - [BCCIP_HUMAN] P53004 Biliverdin reductase A OS=Homo sapiens GN=BLVRA PE=1 SV=2 - [BIEA_HUMAN] P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] Q86X55 Histone-arginine methyltransferase CARM1 OS=Homo sapiens GN=CARM1 PE=1 SV=3 - [CARM1_HUMAN] P42574 Caspase-3 OS=Homo sapiens GN=CASP3 PE=1 SV=2 - [CASP3_HUMAN] Q8WWC4 Uncharacterized protein C2orf47, mitochondrial OS=Homo sapiens GN=C2orf47 PE=1 SV=1 - [CB047_HUMAN] Q16204 Coiled-coil domain-containing protein 6 OS=Homo sapiens GN=CCDC6 PE=1 SV=2 - [CCDC6_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] Q9BRX8 Redox-regulatory protein FAM213A OS=Homo sapiens GN=FAM213A PE=1 SV=3 - [F213A_HUMAN] Q7Z7L8 Uncharacterized protein C11orf96 OS=Homo sapiens GN=C11orf96 PE=1 SV=3 - [CK096_HUMAN] Q14008 Cytoskeleton-associated protein 5 OS=Homo sapiens GN=CKAP5 PE=1 SV=3 - [CKAP5_HUMAN] P61024 Cyclin-dependent kinases regulatory subunit 1 OS=Homo sapiens GN=CKS1B PE=1 SV=1 - [CKS1_HUMAN]

250

Q9Y696 Chloride intracellular channel protein 4 OS=Homo sapiens GN=CLIC4 PE=1 SV=4 - [CLIC4_HUMAN] Q9NX08 COMM domain-containing protein 8 OS=Homo sapiens GN=COMMD8 PE=1 SV=1 - [COMD8_HUMAN] Q7Z3J2 UPF0505 protein C16orf62 OS=Homo sapiens GN=C16orf62 PE=1 SV=2 - [CP062_HUMAN] Q02318 Sterol 26-hydroxylase, mitochondrial OS=Homo sapiens GN=CYP27A1 PE=1 SV=1 - [CP27A_HUMAN] Calcineurin-like phosphoesterase domain-containing protein 1 OS=Homo sapiens GN=CPPED1 PE=1 SV=3 - Q9BRF8 [CPPED_HUMAN] Q9Y2S2 Lambda-crystallin homolog OS=Homo sapiens GN=CRYL1 PE=1 SV=3 - [CRYL1_HUMAN] O43169 Cytochrome b5 type B OS=Homo sapiens GN=CYB5B PE=1 SV=2 - [CYB5B_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1 OS=Homo sapiens GN=DAD1 PE=1 SV=3 P61803 - [DAD1_HUMAN] Q13409 Cytoplasmic dynein 1 intermediate chain 2 OS=Homo sapiens GN=DYNC1I2 PE=1 SV=3 - [DC1I2_HUMAN] Q96HY6 DDRGK domain-containing protein 1 OS=Homo sapiens GN=DDRGK1 PE=1 SV=2 - [DDRGK_HUMAN] Q9GZR7 ATP-dependent RNA helicase DDX24 OS=Homo sapiens GN=DDX24 PE=1 SV=1 - [DDX24_HUMAN] Q8TDJ6 DmX-like protein 2 OS=Homo sapiens GN=DMXL2 PE=1 SV=2 - [DMXL2_HUMAN] Q9NY33 Dipeptidyl peptidase 3 OS=Homo sapiens GN=DPP3 PE=1 SV=2 - [DPP3_HUMAN] Q7RTS9 Dymeclin OS=Homo sapiens GN=DYM PE=1 SV=1 - [DYM_HUMAN] O43491 Band 4.1-like protein 2 OS=Homo sapiens GN=EPB41L2 PE=1 SV=1 - [E41L2_HUMAN] Q7L2H7 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens GN=EIF3M PE=1 SV=1 - [EIF3M_HUMAN] P84090 Enhancer of rudimentary homolog OS=Homo sapiens GN=ERH PE=1 SV=1 - [ERH_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN] Q96KP1 Exocyst complex component 2 OS=Homo sapiens GN=EXOC2 PE=1 SV=1 - [EXOC2_HUMAN] Q9UNN5 FAS-associated factor 1 OS=Homo sapiens GN=FAF1 PE=1 SV=2 - [FAF1_HUMAN] Q7L8L6 FAST kinase domain-containing protein 5 OS=Homo sapiens GN=FASTKD5 PE=1 SV=1 - [FAKD5_HUMAN] Q9Y613 FH1/FH2 domain-containing protein 1 OS=Homo sapiens GN=FHOD1 PE=1 SV=3 - [FHOD1_HUMAN] Q9Y3D6 Mitochondrial fission 1 protein OS=Homo sapiens GN=FIS1 PE=1 SV=2 - [FIS1_HUMAN] Protein farnesyltransferase/geranylgeranyltransferase type-1 subunit alpha OS=Homo sapiens GN=FNTA PE=1 SV=1 - P49354 [FNTA_HUMAN] Q9NY12 H/ACA ribonucleoprotein complex subunit 1 OS=Homo sapiens GN=GAR1 PE=1 SV=1 - [GAR1_HUMAN] Q16775 Hydroxyacylglutathione hydrolase, mitochondrial OS=Homo sapiens GN=HAGH PE=1 SV=2 - [GLO2_HUMAN] Q9Y3E0 Vesicle transport protein GOT1B OS=Homo sapiens GN=GOLT1B PE=1 SV=1 - [GOT1B_HUMAN] P51810 G-protein coupled receptor 143 OS=Homo sapiens GN=GPR143 PE=1 SV=2 - [GP143_HUMAN] Q9Y2Q3 Glutathione S-transferase kappa 1 OS=Homo sapiens GN=GSTK1 PE=1 SV=3 - [GSTK1_HUMAN] P28161 Glutathione S-transferase Mu 2 OS=Homo sapiens GN=GSTM2 PE=1 SV=2 - [GSTM2_HUMAN] Q4G148 Glucoside xylosyltransferase 1 OS=Homo sapiens GN=GXYLT1 PE=1 SV=2 - [GXLT1_HUMAN] Q9H583 HEAT repeat-containing protein 1 OS=Homo sapiens GN=HEATR1 PE=1 SV=3 - [HEAT1_HUMAN] Q8TCT9 Minor histocompatibility antigen H13 OS=Homo sapiens GN=HM13 PE=1 SV=1 - [HM13_HUMAN] Q01581 Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens GN=HMGCS1 PE=1 SV=2 - [HMCS1_HUMAN] Q7Z6Z7 E3 ubiquitin-protein ligase HUWE1 OS=Homo sapiens GN=HUWE1 PE=1 SV=3 - [HUWE1_HUMAN] P60842 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - [IF4A1_HUMAN] P78344 Eukaryotic translation initiation factor 4 gamma 2 OS=Homo sapiens GN=EIF4G2 PE=1 SV=1 - [IF4G2_HUMAN] P78318 Immunoglobulin-binding protein 1 OS=Homo sapiens GN=IGBP1 PE=1 SV=1 - [IGBP1_HUMAN] Q8TEX9 Importin-4 OS=Homo sapiens GN=IPO4 PE=1 SV=2 - [IPO4_HUMAN] Q96AZ6 Interferon-stimulated gene 20 kDa protein OS=Homo sapiens GN=ISG20 PE=1 SV=2 - [ISG20_HUMAN] P23919 Thymidylate kinase OS=Homo sapiens GN=DTYMK PE=1 SV=4 - [KTHY_HUMAN] P05455 Lupus La protein OS=Homo sapiens GN=SSB PE=1 SV=2 - [LA_HUMAN] Q9BU23 Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2 - [LMF2_HUMAN] Q8ND56 Protein LSM14 homolog A OS=Homo sapiens GN=LSM14A PE=1 SV=3 - [LS14A_HUMAN]

251

Q9Y333 U6 snRNA-associated Sm-like protein LSm2 OS=Homo sapiens GN=LSM2 PE=1 SV=1 - [LSM2_HUMAN] Q02978 Mitochondrial 2-oxoglutarate/malate carrier protein OS=Homo sapiens GN=SLC25A11 PE=1 SV=3 - [M2OM_HUMAN] Q9BQ69 O-acetyl-ADP-ribose deacetylase MACROD1 OS=Homo sapiens GN=MACROD1 PE=1 SV=2 - [MACD1_HUMAN] P27816 Microtubule-associated protein 4 OS=Homo sapiens GN=MAP4 PE=1 SV=3 - [MAP4_HUMAN] P28482 Mitogen-activated protein kinase 1 OS=Homo sapiens GN=MAPK1 PE=1 SV=3 - [MK01_HUMAN] O75352 Mannose-P-dolichol utilization defect 1 protein OS=Homo sapiens GN=MPDU1 PE=1 SV=2 - [MPU1_HUMAN] P58546 Myotrophin OS=Homo sapiens GN=MTPN PE=1 SV=2 - [MTPN_HUMAN] P60201 Myelin proteolipid protein OS=Homo sapiens GN=PLP1 PE=1 SV=2 - [MYPR_HUMAN] Q9UBB6 Neurochondrin OS=Homo sapiens GN=NCDN PE=1 SV=1 - [NCDN_HUMAN] Q9GZM8 Nuclear distribution protein nudE-like 1 OS=Homo sapiens GN=NDEL1 PE=1 SV=1 - [NDEL1_HUMAN] P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5 OS=Homo sapiens GN=NDUFA5 PE=1 SV=3 - Q16718 [NDUA5_HUMAN] NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial OS=Homo sapiens GN=NDUFS8 PE=1 SV=1 - O00217 [NDUS8_HUMAN] Q15843 NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 - [NEDD8_HUMAN] Q9Y2X3 Nucleolar protein 58 OS=Homo sapiens GN=NOP58 PE=1 SV=1 - [NOP58_HUMAN] O15118 Niemann-Pick C1 protein OS=Homo sapiens GN=NPC1 PE=1 SV=2 - [NPC1_HUMAN] Q9Y639 Neuroplastin OS=Homo sapiens GN=NPTN PE=1 SV=2 - [NPTN_HUMAN] Q9UNZ2 NSFL1 cofactor p47 OS=Homo sapiens GN=NSFL1C PE=1 SV=2 - [NSF1C_HUMAN] Q96P11 Putative methyltransferase NSUN5 OS=Homo sapiens GN=NSUN5 PE=1 SV=2 - [NSUN5_HUMAN] Q9BV86 N-terminal Xaa-Pro-Lys N-methyltransferase 1 OS=Homo sapiens GN=NTMT1 PE=1 SV=3 - [NTM1A_HUMAN] Q9Y5Y2 Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens GN=NUBP2 PE=1 SV=1 - [NUBP2_HUMAN] O43929 Origin recognition complex subunit 4 OS=Homo sapiens GN=ORC4 PE=1 SV=2 - [ORC4_HUMAN] Q9BXW6 Oxysterol-binding protein-related protein 1 OS=Homo sapiens GN=OSBPL1A PE=1 SV=2 - [OSBL1_HUMAN] O95747 Serine/threonine-protein kinase OSR1 OS=Homo sapiens GN=OXSR1 PE=1 SV=1 - [OXSR1_HUMAN] O75340 Programmed cell death protein 6 OS=Homo sapiens GN=PDCD6 PE=1 SV=1 - [PDCD6_HUMAN] P12955 Xaa-Pro dipeptidase OS=Homo sapiens GN=PEPD PE=1 SV=3 - [PEPD_HUMAN] P61457 Pterin-4-alpha-carbinolamine dehydratase OS=Homo sapiens GN=PCBD1 PE=1 SV=2 - [PHS_HUMAN] O60664 Perilipin-3 OS=Homo sapiens GN=PLIN3 PE=1 SV=3 - [PLIN3_HUMAN] P13686 Tartrate-resistant acid phosphatase type 5 OS=Homo sapiens GN=ACP5 PE=1 SV=3 - [PPA5_HUMAN] P49643 DNA primase large subunit OS=Homo sapiens GN=PRIM2 PE=1 SV=2 - [PRI2_HUMAN] P61289 Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 PE=1 SV=1 - [PSME3_HUMAN] P30566 Adenylosuccinate lyase OS=Homo sapiens GN=ADSL PE=1 SV=2 - [PUR8_HUMAN] P11172 Uridine 5'-monophosphate synthase OS=Homo sapiens GN=UMPS PE=1 SV=1 - [UMPS_HUMAN] P14927 Cytochrome b-c1 complex subunit 7 OS=Homo sapiens GN=UQCRB PE=1 SV=2 - [QCR7_HUMAN] P06400 Retinoblastoma-associated protein OS=Homo sapiens GN=RB1 PE=1 SV=2 - [RB_HUMAN] P54727 UV excision repair protein RAD23 homolog B OS=Homo sapiens GN=RAD23B PE=1 SV=1 - [RD23B_HUMAN] Q92900 Regulator of nonsense transcripts 1 OS=Homo sapiens GN=UPF1 PE=1 SV=2 - [RENT1_HUMAN] Q6NUM9 All-trans-retinol 13,14-reductase OS=Homo sapiens GN=RETSAT PE=1 SV=2 - [RETST_HUMAN] Q9Y3B7 39S ribosomal protein L11, mitochondrial OS=Homo sapiens GN=MRPL11 PE=1 SV=1 - [RM11_HUMAN] Q9P015 39S ribosomal protein L15, mitochondrial OS=Homo sapiens GN=MRPL15 PE=1 SV=1 - [RM15_HUMAN] O75116 Rho-associated protein kinase 2 OS=Homo sapiens GN=ROCK2 PE=1 SV=4 - [ROCK2_HUMAN] O14802 DNA-directed RNA polymerase III subunit RPC1 OS=Homo sapiens GN=POLR3A PE=1 SV=2 - [RPC1_HUMAN] Q9H7B2 Ribosome production factor 2 homolog OS=Homo sapiens GN=RPF2 PE=1 SV=2 - [RPF2_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 2 OS=Homo sapiens GN=RPN2 PE=1 SV=3 - P04844 [RPN2_HUMAN]

252

Q5JTH9 RRP12-like protein OS=Homo sapiens GN=RRP12 PE=1 SV=2 - [RRP12_HUMAN] P0CW22 40S ribosomal protein S17-like OS=Homo sapiens GN=RPS17L PE=3 SV=1 - [RS17L_HUMAN] P62847 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=1 SV=1 - [RS24_HUMAN] O00442 RNA 3'-terminal phosphate cyclase OS=Homo sapiens GN=RTCA PE=1 SV=1 - [RTCA_HUMAN] P31949 Protein S100-A11 OS=Homo sapiens GN=S100A11 PE=1 SV=2 - [S10AB_HUMAN] P67812 Signal peptidase complex catalytic subunit SEC11A OS=Homo sapiens GN=SEC11A PE=1 SV=1 - [SC11A_HUMAN] Q9BY50 Signal peptidase complex catalytic subunit SEC11C OS=Homo sapiens GN=SEC11C PE=1 SV=3 - [SC11C_HUMAN] Q9UQE7 Structural maintenance of chromosomes protein 3 OS=Homo sapiens GN=SMC3 PE=1 SV=2 - [SMC3_HUMAN] P35237 Serpin B6 OS=Homo sapiens GN=SERPINB6 PE=1 SV=3 - [SPB6_HUMAN] Q9UJZ1 Stomatin-like protein 2 OS=Homo sapiens GN=STOML2 PE=1 SV=1 - [STML2_HUMAN] O43815 Striatin OS=Homo sapiens GN=STRN PE=1 SV=4 - [STRN_HUMAN] Q15526 Surfeit locus protein 1 OS=Homo sapiens GN=SURF1 PE=1 SV=1 - [SURF1_HUMAN] Q8WXH0 Nesprin-2 OS=Homo sapiens GN=SYNE2 PE=1 SV=3 - [SYNE2_HUMAN] Q16563 Synaptophysin-like protein 1 OS=Homo sapiens GN=SYPL1 PE=1 SV=1 - [SYPL1_HUMAN] P23381 Tryptophan--tRNA ligase, cytoplasmic OS=Homo sapiens GN=WARS PE=1 SV=2 - [SYWC_HUMAN] Q13148 TAR DNA-binding protein 43 OS=Homo sapiens GN=TARDBP PE=1 SV=1 - [TADBP_HUMAN] Q71U36 Tubulin alpha-1A chain OS=Homo sapiens GN=TUBA1A PE=1 SV=1 - [TBA1A_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] Q15813 Tubulin-specific chaperone E OS=Homo sapiens GN=TBCE PE=1 SV=1 - [TBCE_HUMAN] P02786 Transferrin receptor protein 1 OS=Homo sapiens GN=TFRC PE=1 SV=2 - [TFR1_HUMAN] O75663 TIP41-like protein OS=Homo sapiens GN=TIPRL PE=1 SV=2 - [TIPRL_HUMAN] Q99805 Transmembrane 9 superfamily member 2 OS=Homo sapiens GN=TM9SF2 PE=1 SV=1 - [TM9S2_HUMAN] Q6ZXV5 Transmembrane and TPR repeat-containing protein 3 OS=Homo sapiens GN=TMTC3 PE=1 SV=2 - [TMTC3_HUMAN] Q13595 Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A PE=1 SV=1 - [TRA2A_HUMAN] Q8NG06 Tripartite motif-containing protein 58 OS=Homo sapiens GN=TRIM58 PE=2 SV=2 - [TRI58_HUMAN] Q9H1Z9 Tetraspanin-10 OS=Homo sapiens GN=TSPAN10 PE=2 SV=1 - [TSN10_HUMAN] P63313 Thymosin beta-10 OS=Homo sapiens GN=TMSB10 PE=1 SV=2 - [TYB10_HUMAN] P04818 Thymidylate synthase OS=Homo sapiens GN=TYMS PE=1 SV=3 - [TYSY_HUMAN] O43818 U3 small nucleolar RNA-interacting protein 2 OS=Homo sapiens GN=RRP9 PE=1 SV=1 - [U3IP2_HUMAN] Q13404 Ubiquitin-conjugating enzyme E2 variant 1 OS=Homo sapiens GN=UBE2V1 PE=1 SV=2 - [UB2V1_HUMAN] P61088 Ubiquitin-conjugating enzyme E2 N OS=Homo sapiens GN=UBE2N PE=1 SV=1 - [UBE2N_HUMAN] P61960 Ubiquitin-fold modifier 1 OS=Homo sapiens GN=UFM1 PE=1 SV=1 - [UFM1_HUMAN] Q9NUQ7 Ufm1-specific protease 2 OS=Homo sapiens GN=UFSP2 PE=2 SV=3 - [UFSP2_HUMAN] P51809 Vesicle-associated membrane protein 7 OS=Homo sapiens GN=VAMP7 PE=1 SV=3 - [VAMP7_HUMAN] Q16864 V-type proton ATPase subunit F OS=Homo sapiens GN=ATP6V1F PE=1 SV=2 - [VATF_HUMAN] Q96JH7 Deubiquitinating protein VCIP135 OS=Homo sapiens GN=VCPIP1 PE=1 SV=2 - [VCIP1_HUMAN] Q96GC9 Vacuole membrane protein 1 OS=Homo sapiens GN=VMP1 PE=1 SV=1 - [VMP1_HUMAN] Q3MJ13 WD repeat-containing protein 72 OS=Homo sapiens GN=WDR72 PE=2 SV=2 - [WDR72_HUMAN] O76024 Wolframin OS=Homo sapiens GN=WFS1 PE=1 SV=2 - [WFS1_HUMAN] Q9UIA9 Exportin-7 OS=Homo sapiens GN=XPO7 PE=1 SV=3 - [XPO7_HUMAN] Q8IWR0 Zinc finger CCCH domain-containing protein 7A OS=Homo sapiens GN=ZC3H7A PE=1 SV=1 - [Z3H7A_HUMAN] P23229 Integrin alpha-6 OS=Homo sapiens GN=ITGA6 PE=1 SV=5 - [ITA6_HUMAN]

253

Table 7‎ .31. Up-regulated proteins due to use of BT2 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Acidic leucine-rich nuclear phosphoprotein 32 family member B OS=Homo sapiens GN=ANP32B PE=1 SV=1 - Q92688 [AN32B_HUMAN] P18085 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3 - [ARF4_HUMAN] P61160 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 - [ARP2_HUMAN] P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] Q8WWC4 Uncharacterized protein C2orf47, mitochondrial OS=Homo sapiens GN=C2orf47 PE=1 SV=1 - [CB047_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] Q99653 Calcineurin B homologous protein 1 OS=Homo sapiens GN=CHP1 PE=1 SV=3 - [CHP1_HUMAN] Q9Y696 Chloride intracellular channel protein 4 OS=Homo sapiens GN=CLIC4 PE=1 SV=4 - [CLIC4_HUMAN] P21964 Catechol O-methyltransferase OS=Homo sapiens GN=COMT PE=1 SV=2 - [COMT_HUMAN] Q9NRP2 COX assembly mitochondrial protein 2 homolog OS=Homo sapiens GN=CMC2 PE=1 SV=1 - [COXM2_HUMAN] Q7Z3J2 UPF0505 protein C16orf62 OS=Homo sapiens GN=C16orf62 PE=1 SV=2 - [CP062_HUMAN] P25685 DnaJ homolog subfamily B member 1 OS=Homo sapiens GN=DNAJB1 PE=1 SV=4 - [DNJB1_HUMAN] P30046 D-dopachrome decarboxylase OS=Homo sapiens GN=DDT PE=1 SV=3 - [DOPD_HUMAN] Q7L2H7 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens GN=EIF3M PE=1 SV=1 - [EIF3M_HUMAN] Eukaryotic peptide chain release factor GTP-binding subunit ERF3A OS=Homo sapiens GN=GSPT1 PE=1 SV=1 - P15170 [ERF3A_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN] Q7L8L6 FAST kinase domain-containing protein 5 OS=Homo sapiens GN=FASTKD5 PE=1 SV=1 - [FAKD5_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] Q9NY12 H/ACA ribonucleoprotein complex subunit 1 OS=Homo sapiens GN=GAR1 PE=1 SV=1 - [GAR1_HUMAN] P51810 G-protein coupled receptor 143 OS=Homo sapiens GN=GPR143 PE=1 SV=2 - [GP143_HUMAN] P16403 Histone H1.2 OS=Homo sapiens GN=HIST1H1C PE=1 SV=2 - [H12_HUMAN] P16401 Histone H1.5 OS=Homo sapiens GN=HIST1H1B PE=1 SV=3 - [H15_HUMAN] P69905 Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 - [HBA_HUMAN] O75526 RNA-binding motif protein, X-linked-like-2 OS=Homo sapiens GN=RBMXL2 PE=1 SV=3 - [RMXL2_HUMAN] P60842 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - [IF4A1_HUMAN] Q9BU23 Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2 - [LMF2_HUMAN] P58546 Myotrophin OS=Homo sapiens GN=MTPN PE=1 SV=2 - [MTPN_HUMAN] P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] Q15843 NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 - [NEDD8_HUMAN] Q9Y5Y2 Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens GN=NUBP2 PE=1 SV=1 - [NUBP2_HUMAN] O43929 Origin recognition complex subunit 4 OS=Homo sapiens GN=ORC4 PE=1 SV=2 - [ORC4_HUMAN] O43663 Protein regulator of cytokinesis 1 OS=Homo sapiens GN=PRC1 PE=1 SV=2 - [PRC1_HUMAN] P61289 Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 PE=1 SV=1 - [PSME3_HUMAN] P14927 Cytochrome b-c1 complex subunit 7 OS=Homo sapiens GN=UQCRB PE=1 SV=2 - [QCR7_HUMAN] P61927 60S ribosomal protein L37 OS=Homo sapiens GN=RPL37 PE=1 SV=2 - [RL37_HUMAN] P62861 40S ribosomal protein S30 OS=Homo sapiens GN=FAU PE=1 SV=1 - [RS30_HUMAN] Q71U36 Tubulin alpha-1A chain OS=Homo sapiens GN=TUBA1A PE=1 SV=1 - [TBA1A_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] Q3MJ13 WD repeat-containing protein 72 OS=Homo sapiens GN=WDR72 PE=2 SV=2 - [WDR72_HUMAN] Eukaryotic translation initiation factor 4E-binding protein 1 OS=Homo sapiens GN=EIF4EBP1 PE=1 SV=3 - Q13541 [4EBP1_HUMAN] P07339 Cathepsin D OS=Homo sapiens GN=CTSD PE=1 SV=1 - [CATD_HUMAN]

254

Coiled-coil-helix-coiled-coil-helix domain-containing protein 2, mitochondrial OS=Homo sapiens GN=CHCHD2 PE=1 Q9Y6H1 SV=1 - [CHCH2_HUMAN] P51798 H(+)/Cl(-) exchange transporter 7 OS=Homo sapiens GN=CLCN7 PE=1 SV=2 - [CLCN7_HUMAN] Q9NR30 Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 PE=1 SV=5 - [DDX21_HUMAN] P63167 Dynein light chain 1, cytoplasmic OS=Homo sapiens GN=DYNLL1 PE=1 SV=1 - [DYL1_HUMAN] Q5VYK3 Proteasome-associated protein ECM29 homolog OS=Homo sapiens GN=ECM29 PE=1 SV=2 - [ECM29_HUMAN] Q01780 Exosome component 10 OS=Homo sapiens GN=EXOSC10 PE=1 SV=2 - [EXOSX_HUMAN] Q96AC1 Fermitin family homolog 2 OS=Homo sapiens GN=FERMT2 PE=1 SV=1 - [FERM2_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] Q8TB36 Ganglioside-induced differentiation-associated protein 1 OS=Homo sapiens GN=GDAP1 PE=1 SV=3 - [GDAP1_HUMAN] P04908 Histone H2A type 1-B/E OS=Homo sapiens GN=HIST1H2AB PE=1 SV=2 - [H2A1B_HUMAN] Q99878 Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 - [H2A1J_HUMAN] P69905 Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 - [HBA_HUMAN] Q5SSJ5 Heterochromatin protein 1-binding protein 3 OS=Homo sapiens GN=HP1BP3 PE=1 SV=1 - [HP1B3_HUMAN] Q8IZT8 Heparan sulfate glucosamine 3-O-sulfotransferase 5 OS=Homo sapiens GN=HS3ST5 PE=1 SV=1 - [HS3S5_HUMAN] Integrin-linked kinase-associated serine/threonine phosphatase 2C OS=Homo sapiens GN=ILKAP PE=1 SV=1 - Q9H0C8 [ILKAP_HUMAN] P42167 Lamina-associated polypeptide 2, isoforms beta/gamma OS=Homo sapiens GN=TMPO PE=1 SV=2 - [LAP2B_HUMAN] P46087 Putative ribosomal RNA methyltransferase NOP2 OS=Homo sapiens GN=NOP2 PE=1 SV=2 - [NOP2_HUMAN] O43663 Protein regulator of cytokinesis 1 OS=Homo sapiens GN=PRC1 PE=1 SV=2 - [PRC1_HUMAN] P07919 Cytochrome b-c1 complex subunit 6, mitochondrial OS=Homo sapiens GN=UQCRH PE=1 SV=2 - [QCR6_HUMAN] P51159 Ras-related protein Rab-27A OS=Homo sapiens GN=RAB27A PE=1 SV=3 - [RB27A_HUMAN] P47914 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2 - [RL29_HUMAN] Q16540 39S ribosomal protein L23, mitochondrial OS=Homo sapiens GN=MRPL23 PE=1 SV=1 - [RM23_HUMAN] P56182 Ribosomal RNA processing protein 1 homolog A OS=Homo sapiens GN=RRP1 PE=1 SV=1 - [RRP1_HUMAN] P62273 40S ribosomal protein S29 OS=Homo sapiens GN=RPS29 PE=1 SV=2 - [RS29_HUMAN] Q14151 Scaffold attachment factor B2 OS=Homo sapiens GN=SAFB2 PE=1 SV=1 - [SAFB2_HUMAN] Q9Y3Z3 SAM domain and HD domain-containing protein 1 OS=Homo sapiens GN=SAMHD1 PE=1 SV=2 - [SAMH1_HUMAN] O00560 Syntenin-1 OS=Homo sapiens GN=SDCBP PE=1 SV=1 - [SDCB1_HUMAN] P42285 Superkiller viralicidic activity 2-like 2 OS=Homo sapiens GN=SKIV2L2 PE=1 SV=3 - [SK2L2_HUMAN] P49458 Signal recognition particle 9 kDa protein OS=Homo sapiens GN=SRP9 PE=1 SV=2 - [SRP09_HUMAN] Q6NUQ4 Transmembrane protein 214 OS=Homo sapiens GN=TMEM214 PE=1 SV=2 - [TM214_HUMAN] Mitochondrial import receptor subunit TOM22 homolog OS=Homo sapiens GN=TOMM22 PE=1 SV=3 - Q9NS69 [TOM22_HUMAN] Q96LD4 Tripartite motif-containing protein 47 OS=Homo sapiens GN=TRIM47 PE=1 SV=2 - [TRI47_HUMAN] Q5BKZ1 DBIRD complex subunit ZNF326 OS=Homo sapiens GN=ZNF326 PE=1 SV=2 - [ZN326_HUMAN] Q14966 Zinc finger protein 638 OS=Homo sapiens GN=ZNF638 PE=1 SV=2 - [ZN638_HUMAN]

Table 7‎ .32. Down-regulated proteins due to use of BT3 compound in ME1007 cell line at 6 h of serum stimulation Accession Description P05090 Apolipoprotein D OS=Homo sapiens GN=APOD PE=1 SV=1 - [APOD_HUMAN] Q92560 Ubiquitin carboxyl-terminal hydrolase BAP1 OS=Homo sapiens GN=BAP1 PE=1 SV=2 - [BAP1_HUMAN] Q96A33 Coiled-coil domain-containing protein 47 OS=Homo sapiens GN=CCDC47 PE=1 SV=1 - [CCD47_HUMAN] Q13838 Spliceosome RNA helicase DDX39B OS=Homo sapiens GN=DDX39B PE=1 SV=1 - [DX39B_HUMAN] Q9UNN5 FAS-associated factor 1 OS=Homo sapiens GN=FAF1 PE=1 SV=2 - [FAF1_HUMAN]

255

Q99878 Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 - [H2A1J_HUMAN] Bifunctional arginine demethylase and lysyl-hydroxylase JMJD6 OS=Homo sapiens GN=JMJD6 PE=1 SV=1 - Q6NYC1 [JMJD6_HUMAN] Q86UP2 Kinectin OS=Homo sapiens GN=KTN1 PE=1 SV=1 - [KTN1_HUMAN] Q14847 LIM and SH3 domain protein 1 OS=Homo sapiens GN=LASP1 PE=1 SV=2 - [LASP1_HUMAN] Q9H000 Probable E3 ubiquitin-protein ligase makorin-2 OS=Homo sapiens GN=MKRN2 PE=2 SV=2 - [MKRN2_HUMAN] NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 11, mitochondrial OS=Homo sapiens GN=NDUFB11 Q9NX14 PE=1 SV=1 - [NDUBB_HUMAN] Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial P11182 OS=Homo sapiens GN=DBT PE=1 SV=3 - [ODB2_HUMAN] P13686 Tartrate-resistant acid phosphatase type 5 OS=Homo sapiens GN=ACP5 PE=1 SV=3 - [PPA5_HUMAN] P26599 Polypyrimidine tract-binding protein 1 OS=Homo sapiens GN=PTBP1 PE=1 SV=1 - [PTBP1_HUMAN] P62854 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3 - [RS26_HUMAN] O75368 SH3 domain-binding glutamic acid-rich-like protein OS=Homo sapiens GN=SH3BGRL PE=1 SV=1 - [SH3L1_HUMAN] P42285 Superkiller viralicidic activity 2-like 2 OS=Homo sapiens GN=SKIV2L2 PE=1 SV=3 - [SK2L2_HUMAN] Q13428 Treacle protein OS=Homo sapiens GN=TCOF1 PE=1 SV=3 - [TCOF_HUMAN] Q9HD45 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9SF3 PE=1 SV=2 - [TM9S3_HUMAN]

Table 7‎ .33. Up-regulated proteins due to use of BT3 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Acidic leucine-rich nuclear phosphoprotein 32 family member B OS=Homo sapiens GN=ANP32B PE=1 SV=1 - Q92688 [AN32B_HUMAN] P61160 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 - [ARP2_HUMAN] Q8WWC4 Uncharacterized protein C2orf47, mitochondrial OS=Homo sapiens GN=C2orf47 PE=1 SV=1 - [CB047_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] Q9NRP2 COX assembly mitochondrial protein 2 homolog OS=Homo sapiens GN=CMC2 PE=1 SV=1 - [COXM2_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] P69905 Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 - [HBA_HUMAN] Q9BSU3 N-alpha-acetyltransferase 11 OS=Homo sapiens GN=NAA11 PE=1 SV=3 - [NAA11_HUMAN] P30419 Glycylpeptide N-tetradecanoyltransferase 1 OS=Homo sapiens GN=NMT1 PE=1 SV=2 - [NMT1_HUMAN] Q9Y5Y2 Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens GN=NUBP2 PE=1 SV=1 - [NUBP2_HUMAN] P14927 Cytochrome b-c1 complex subunit 7 OS=Homo sapiens GN=UQCRB PE=1 SV=2 - [QCR7_HUMAN] P51159 Ras-related protein Rab-27A OS=Homo sapiens GN=RAB27A PE=1 SV=3 - [RB27A_HUMAN] P61927 60S ribosomal protein L37 OS=Homo sapiens GN=RPL37 PE=1 SV=2 - [RL37_HUMAN] Q71U36 Tubulin alpha-1A chain OS=Homo sapiens GN=TUBA1A PE=1 SV=1 - [TBA1A_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] Q9Y296 Trafficking protein particle complex subunit 4 OS=Homo sapiens GN=TRAPPC4 PE=1 SV=1 - [TPPC4_HUMAN] Q13404 Ubiquitin-conjugating enzyme E2 variant 1 OS=Homo sapiens GN=UBE2V1 PE=1 SV=2 - [UB2V1_HUMAN]

Table 7‎ .34. Down-regulated proteins due to use of trametinib compound in ME1007 cell line at 6 h of serum stimulation Accession Description Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform OS=Homo sapiens Q13362 GN=PPP2R5C PE=1 SV=3 - [2A5G_HUMAN] Q8N2K0 Monoacylglycerol lipase ABHD12 OS=Homo sapiens GN=ABHD12 PE=1 SV=2 - [ABD12_HUMAN] P12235 ADP/ATP translocase 1 OS=Homo sapiens GN=SLC25A4 PE=1 SV=4 - [ADT1_HUMAN] P52594 Arf-GAP domain and FG repeat-containing protein 1 OS=Homo sapiens GN=AGFG1 PE=1 SV=2 - [AGFG1_HUMAN]

256

O95394 Phosphoacetylglucosamine mutase OS=Homo sapiens GN=PGM3 PE=1 SV=1 - [AGM1_HUMAN] Aminoacyl tRNA synthase complex-interacting multifunctional protein 2 OS=Homo sapiens GN=AIMP2 PE=1 SV=2 - Q13155 [AIMP2_HUMAN] Acidic leucine-rich nuclear phosphoprotein 32 family member B OS=Homo sapiens GN=ANP32B PE=1 SV=1 - Q92688 [AN32B_HUMAN] Q99873 Protein arginine N-methyltransferase 1 OS=Homo sapiens GN=PRMT1 PE=1 SV=2 - [ANM1_HUMAN] O94973 AP-2 complex subunit alpha-2 OS=Homo sapiens GN=AP2A2 PE=1 SV=2 - [AP2A2_HUMAN] P05090 Apolipoprotein D OS=Homo sapiens GN=APOD PE=1 SV=1 - [APOD_HUMAN] Q9BUR5 Apolipoprotein O OS=Homo sapiens GN=APOO PE=1 SV=1 - [APOO_HUMAN] P18085 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3 - [ARF4_HUMAN] Q9NVJ2 ADP-ribosylation factor-like protein 8B OS=Homo sapiens GN=ARL8B PE=1 SV=1 - [ARL8B_HUMAN] Q9H1I8 Activating signal cointegrator 1 complex subunit 2 OS=Homo sapiens GN=ASCC2 PE=1 SV=3 - [ASCC2_HUMAN] P24539 ATP synthase subunit b, mitochondrial OS=Homo sapiens GN=ATP5F1 PE=1 SV=2 - [AT5F1_HUMAN] P05496 ATP synthase F(0) complex subunit C1, mitochondrial OS=Homo sapiens GN=ATP5G1 PE=2 SV=2 - [AT5G1_HUMAN] ATP synthase mitochondrial F1 complex assembly factor 1 OS=Homo sapiens GN=ATPAF1 PE=1 SV=1 - Q5TC12 [ATPF1_HUMAN] Q9UBB4 Ataxin-10 OS=Homo sapiens GN=ATXN10 PE=1 SV=1 - [ATX10_HUMAN] Q16548 Bcl-2-related protein A1 OS=Homo sapiens GN=BCL2A1 PE=1 SV=1 - [B2LA1_HUMAN] Branched-chain-amino-acid aminotransferase, mitochondrial OS=Homo sapiens GN=BCAT2 PE=1 SV=2 - O15382 [BCAT2_HUMAN] P62158 Calmodulin OS=Homo sapiens GN=CALM1 PE=1 SV=2 - [CALM_HUMAN] Q8WWC4 Uncharacterized protein C2orf47, mitochondrial OS=Homo sapiens GN=C2orf47 PE=1 SV=1 - [CB047_HUMAN] P24385 G1/S-specific cyclin-D1 OS=Homo sapiens GN=CCND1 PE=1 SV=1 - [CCND1_HUMAN] Q03701 CCAAT/enhancer-binding protein zeta OS=Homo sapiens GN=CEBPZ PE=1 SV=3 - [CEBPZ_HUMAN] Q9P1F3 Costars family protein ABRACL OS=Homo sapiens GN=ABRACL PE=1 SV=1 - [ABRAL_HUMAN] Q7Z7L8 Uncharacterized protein C11orf96 OS=Homo sapiens GN=C11orf96 PE=1 SV=3 - [CK096_HUMAN] P61024 Cyclin-dependent kinases regulatory subunit 1 OS=Homo sapiens GN=CKS1B PE=1 SV=1 - [CKS1_HUMAN] Q9NX08 COMM domain-containing protein 8 OS=Homo sapiens GN=COMMD8 PE=1 SV=1 - [COMD8_HUMAN] P10606 Cytochrome c oxidase subunit 5B, mitochondrial OS=Homo sapiens GN=COX5B PE=1 SV=2 - [COX5B_HUMAN] Q9NRP2 COX assembly mitochondrial protein 2 homolog OS=Homo sapiens GN=CMC2 PE=1 SV=1 - [COXM2_HUMAN] Q7Z3J2 UPF0505 protein C16orf62 OS=Homo sapiens GN=C16orf62 PE=1 SV=2 - [CP062_HUMAN] Q02318 Sterol 26-hydroxylase, mitochondrial OS=Homo sapiens GN=CYP27A1 PE=1 SV=1 - [CP27A_HUMAN] Calcineurin-like phosphoesterase domain-containing protein 1 OS=Homo sapiens GN=CPPED1 PE=1 SV=3 - Q9BRF8 [CPPED_HUMAN] Q9Y2S2 Lambda-crystallin homolog OS=Homo sapiens GN=CRYL1 PE=1 SV=3 - [CRYL1_HUMAN] O43169 Cytochrome b5 type B OS=Homo sapiens GN=CYB5B PE=1 SV=2 - [CYB5B_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1 OS=Homo sapiens GN=DAD1 PE=1 P61803 SV=3 - [DAD1_HUMAN] O15075 Serine/threonine-protein kinase DCLK1 OS=Homo sapiens GN=DCLK1 PE=1 SV=2 - [DCLK1_HUMAN] Q96HY6 DDRGK domain-containing protein 1 OS=Homo sapiens GN=DDRGK1 PE=1 SV=2 - [DDRGK_HUMAN] Q9GZR7 ATP-dependent RNA helicase DDX24 OS=Homo sapiens GN=DDX24 PE=1 SV=1 - [DDX24_HUMAN] Q8TDJ6 DmX-like protein 2 OS=Homo sapiens GN=DMXL2 PE=1 SV=2 - [DMXL2_HUMAN] Q9NY33 Dipeptidyl peptidase 3 OS=Homo sapiens GN=DPP3 PE=1 SV=2 - [DPP3_HUMAN] O43491 Band 4.1-like protein 2 OS=Homo sapiens GN=EPB41L2 PE=1 SV=1 - [E41L2_HUMAN] Q7L2H7 Eukaryotic translation initiation factor 3 subunit M OS=Homo sapiens GN=EIF3M PE=1 SV=1 - [EIF3M_HUMAN] P84090 Enhancer of rudimentary homolog OS=Homo sapiens GN=ERH PE=1 SV=1 - [ERH_HUMAN] Elongation factor Tu GTP-binding domain-containing protein 1 OS=Homo sapiens GN=EFTUD1 PE=1 SV=2 - Q7Z2Z2 [ETUD1_HUMAN] Q01844 RNA-binding protein EWS OS=Homo sapiens GN=EWSR1 PE=1 SV=1 - [EWS_HUMAN]

257

Q96KP1 Exocyst complex component 2 OS=Homo sapiens GN=EXOC2 PE=1 SV=1 - [EXOC2_HUMAN] Q7L8L6 FAST kinase domain-containing protein 5 OS=Homo sapiens GN=FASTKD5 PE=1 SV=1 - [FAKD5_HUMAN] Q9Y613 FH1/FH2 domain-containing protein 1 OS=Homo sapiens GN=FHOD1 PE=1 SV=3 - [FHOD1_HUMAN] Q9Y3D6 Mitochondrial fission 1 protein OS=Homo sapiens GN=FIS1 PE=1 SV=2 - [FIS1_HUMAN] Q9NY12 H/ACA ribonucleoprotein complex subunit 1 OS=Homo sapiens GN=GAR1 PE=1 SV=1 - [GAR1_HUMAN] Q16775 Hydroxyacylglutathione hydrolase, mitochondrial OS=Homo sapiens GN=HAGH PE=1 SV=2 - [GLO2_HUMAN] Q9Y3E0 Vesicle transport protein GOT1B OS=Homo sapiens GN=GOLT1B PE=1 SV=1 - [GOT1B_HUMAN] P51810 G-protein coupled receptor 143 OS=Homo sapiens GN=GPR143 PE=1 SV=2 - [GP143_HUMAN] Q9Y2Q3 Glutathione S-transferase kappa 1 OS=Homo sapiens GN=GSTK1 PE=1 SV=3 - [GSTK1_HUMAN] P28161 Glutathione S-transferase Mu 2 OS=Homo sapiens GN=GSTM2 PE=1 SV=2 - [GSTM2_HUMAN] Q4G148 Glucoside xylosyltransferase 1 OS=Homo sapiens GN=GXYLT1 PE=1 SV=2 - [GXLT1_HUMAN] Q9H583 HEAT repeat-containing protein 1 OS=Homo sapiens GN=HEATR1 PE=1 SV=3 - [HEAT1_HUMAN] Q8TCT9 Minor histocompatibility antigen H13 OS=Homo sapiens GN=HM13 PE=1 SV=1 - [HM13_HUMAN] P60842 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 PE=1 SV=1 - [IF4A1_HUMAN] P78344 Eukaryotic translation initiation factor 4 gamma 2 OS=Homo sapiens GN=EIF4G2 PE=1 SV=1 - [IF4G2_HUMAN] P78318 Immunoglobulin-binding protein 1 OS=Homo sapiens GN=IGBP1 PE=1 SV=1 - [IGBP1_HUMAN] Q96AZ6 Interferon-stimulated gene 20 kDa protein OS=Homo sapiens GN=ISG20 PE=1 SV=2 - [ISG20_HUMAN] O75153 Clustered mitochondria protein homolog OS=Homo sapiens GN=CLUH PE=1 SV=2 - [CLU_HUMAN] LisH domain and HEAT repeat-containing protein KIAA1468 OS=Homo sapiens GN=KIAA1468 PE=1 SV=2 - Q9P260 [K1468_HUMAN] P04183 Thymidine kinase, cytosolic OS=Homo sapiens GN=TK1 PE=1 SV=2 - [KITH_HUMAN] P23919 Thymidylate kinase OS=Homo sapiens GN=DTYMK PE=1 SV=4 - [KTHY_HUMAN] Q9BU23 Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2 - [LMF2_HUMAN] Q8ND56 Protein LSM14 homolog A OS=Homo sapiens GN=LSM14A PE=1 SV=3 - [LS14A_HUMAN] Q9Y250 Leucine zipper putative tumor suppressor 1 OS=Homo sapiens GN=LZTS1 PE=1 SV=3 - [LZTS1_HUMAN] Q9BXT6 Putative helicase Mov10l1 OS=Homo sapiens GN=MOV10L1 PE=1 SV=1 - [M10L1_HUMAN] Q9BQ69 O-acetyl-ADP-ribose deacetylase MACROD1 OS=Homo sapiens GN=MACROD1 PE=1 SV=2 - [MACD1_HUMAN] O75352 Mannose-P-dolichol utilization defect 1 protein OS=Homo sapiens GN=MPDU1 PE=1 SV=2 - [MPU1_HUMAN] P58546 Myotrophin OS=Homo sapiens GN=MTPN PE=1 SV=2 - [MTPN_HUMAN] Q13765 Nascent polypeptide-associated complex subunit alpha OS=Homo sapiens GN=NACA PE=1 SV=1 - [NACA_HUMAN] Q9UBB6 Neurochondrin OS=Homo sapiens GN=NCDN PE=1 SV=1 - [NCDN_HUMAN] Q9GZM8 Nuclear distribution protein nudE-like 1 OS=Homo sapiens GN=NDEL1 PE=1 SV=1 - [NDEL1_HUMAN] P15531 Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1 SV=1 - [NDKA_HUMAN] NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5 OS=Homo sapiens GN=NDUFA5 PE=1 SV=3 - Q16718 [NDUA5_HUMAN] NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial OS=Homo sapiens GN=NDUFS8 PE=1 SV=1 - O00217 [NDUS8_HUMAN] NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial OS=Homo sapiens GN=NDUFV2 PE=1 SV=2 - P19404 [NDUV2_HUMAN] Q15843 NEDD8 OS=Homo sapiens GN=NEDD8 PE=1 SV=1 - [NEDD8_HUMAN] Q8NFW8 N-acylneuraminate cytidylyltransferase OS=Homo sapiens GN=CMAS PE=1 SV=2 - [NEUA_HUMAN] Q92542 Nicastrin OS=Homo sapiens GN=NCSTN PE=1 SV=2 - [NICA_HUMAN] Q9Y3T9 Nucleolar complex protein 2 homolog OS=Homo sapiens GN=NOC2L PE=1 SV=4 - [NOC2L_HUMAN] Q9Y2X3 Nucleolar protein 58 OS=Homo sapiens GN=NOP58 PE=1 SV=1 - [NOP58_HUMAN] O15118 Niemann-Pick C1 protein OS=Homo sapiens GN=NPC1 PE=1 SV=2 - [NPC1_HUMAN] Q9Y639 Neuroplastin OS=Homo sapiens GN=NPTN PE=1 SV=2 - [NPTN_HUMAN] Q9UNZ2 NSFL1 cofactor p47 OS=Homo sapiens GN=NSFL1C PE=1 SV=2 - [NSF1C_HUMAN]

258

Q9BV86 N-terminal Xaa-Pro-Lys N-methyltransferase 1 OS=Homo sapiens GN=NTMT1 PE=1 SV=3 - [NTM1A_HUMAN] Q9Y5Y2 Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens GN=NUBP2 PE=1 SV=1 - [NUBP2_HUMAN] Q9Y266 Nuclear migration protein nudC OS=Homo sapiens GN=NUDC PE=1 SV=1 - [NUDC_HUMAN] O43929 Origin recognition complex subunit 4 OS=Homo sapiens GN=ORC4 PE=1 SV=2 - [ORC4_HUMAN] Q9BXW6 Oxysterol-binding protein-related protein 1 OS=Homo sapiens GN=OSBPL1A PE=1 SV=2 - [OSBL1_HUMAN] Q15070 Mitochondrial inner membrane protein OXA1L OS=Homo sapiens GN=OXA1L PE=1 SV=3 - [OXA1L_HUMAN] O95747 Serine/threonine-protein kinase OSR1 OS=Homo sapiens GN=OXSR1 PE=1 SV=1 - [OXSR1_HUMAN] P12955 Xaa-Pro dipeptidase OS=Homo sapiens GN=PEPD PE=1 SV=3 - [PEPD_HUMAN] O60664 Perilipin-3 OS=Homo sapiens GN=PLIN3 PE=1 SV=3 - [PLIN3_HUMAN] P13686 Tartrate-resistant acid phosphatase type 5 OS=Homo sapiens GN=ACP5 PE=1 SV=3 - [PPA5_HUMAN] Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16 OS=Homo sapiens GN=DHX38 PE=1 SV=2 - Q92620 [PRP16_HUMAN] P61289 Proteasome activator complex subunit 3 OS=Homo sapiens GN=PSME3 PE=1 SV=1 - [PSME3_HUMAN] Q06124 Tyrosine-protein phosphatase non-receptor type 11 OS=Homo sapiens GN=PTPN11 PE=1 SV=2 - [PTN11_HUMAN] P30566 Adenylosuccinate lyase OS=Homo sapiens GN=ADSL PE=1 SV=2 - [PUR8_HUMAN] P14927 Cytochrome b-c1 complex subunit 7 OS=Homo sapiens GN=UQCRB PE=1 SV=2 - [QCR7_HUMAN] P51153 Ras-related protein Rab-13 OS=Homo sapiens GN=RAB13 PE=1 SV=1 - [RAB13_HUMAN] P20340 Ras-related protein Rab-6A OS=Homo sapiens GN=RAB6A PE=1 SV=3 - [RAB6A_HUMAN] P06400 Retinoblastoma-associated protein OS=Homo sapiens GN=RB1 PE=1 SV=2 - [RB_HUMAN] P46063 ATP-dependent DNA helicase Q1 OS=Homo sapiens GN=RECQL PE=1 SV=3 - [RECQ1_HUMAN] Q6NUM9 All-trans-retinol 13,14-reductase OS=Homo sapiens GN=RETSAT PE=1 SV=2 - [RETST_HUMAN] P31350 Ribonucleoside-diphosphate reductase subunit M2 OS=Homo sapiens GN=RRM2 PE=1 SV=1 - [RIR2_HUMAN] Q9P015 39S ribosomal protein L15, mitochondrial OS=Homo sapiens GN=MRPL15 PE=1 SV=1 - [RM15_HUMAN] O75116 Rho-associated protein kinase 2 OS=Homo sapiens GN=ROCK2 PE=1 SV=4 - [ROCK2_HUMAN] O14802 DNA-directed RNA polymerase III subunit RPC1 OS=Homo sapiens GN=POLR3A PE=1 SV=2 - [RPC1_HUMAN] Q9H7B2 Ribosome production factor 2 homolog OS=Homo sapiens GN=RPF2 PE=1 SV=2 - [RPF2_HUMAN] Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 2 OS=Homo sapiens GN=RPN2 PE=1 SV=3 - P04844 [RPN2_HUMAN] Q5JTH9 RRP12-like protein OS=Homo sapiens GN=RRP12 PE=1 SV=2 - [RRP12_HUMAN] P0CW22 40S ribosomal protein S17-like OS=Homo sapiens GN=RPS17L PE=3 SV=1 - [RS17L_HUMAN] P62847 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=1 SV=1 - [RS24_HUMAN] P62854 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3 - [RS26_HUMAN] P31949 Protein S100-A11 OS=Homo sapiens GN=S100A11 PE=1 SV=2 - [S10AB_HUMAN] P67812 Signal peptidase complex catalytic subunit SEC11A OS=Homo sapiens GN=SEC11A PE=1 SV=1 - [SC11A_HUMAN] Q9BY50 Signal peptidase complex catalytic subunit SEC11C OS=Homo sapiens GN=SEC11C PE=1 SV=3 - [SC11C_HUMAN] P08240 Signal recognition particle receptor subunit alpha OS=Homo sapiens GN=SRPR PE=1 SV=2 - [SRPR_HUMAN] Q9UJZ1 Stomatin-like protein 2 OS=Homo sapiens GN=STOML2 PE=1 SV=1 - [STML2_HUMAN] O43815 Striatin OS=Homo sapiens GN=STRN PE=1 SV=4 - [STRN_HUMAN] P49589 Cysteine--tRNA ligase, cytoplasmic OS=Homo sapiens GN=CARS PE=1 SV=3 - [SYCC_HUMAN] Q16563 Synaptophysin-like protein 1 OS=Homo sapiens GN=SYPL1 PE=1 SV=1 - [SYPL1_HUMAN] P23381 Tryptophan--tRNA ligase, cytoplasmic OS=Homo sapiens GN=WARS PE=1 SV=2 - [SYWC_HUMAN] Q9H061 Transmembrane protein 126A OS=Homo sapiens GN=TMEM126A PE=1 SV=1 - [T126A_HUMAN] Q13148 TAR DNA-binding protein 43 OS=Homo sapiens GN=TARDBP PE=1 SV=1 - [TADBP_HUMAN] P68363 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 - [TBA1B_HUMAN] Q8TBP0 TBC1 domain family member 16 OS=Homo sapiens GN=TBC1D16 PE=2 SV=1 - [TBC16_HUMAN] Q15813 Tubulin-specific chaperone E OS=Homo sapiens GN=TBCE PE=1 SV=1 - [TBCE_HUMAN]

259

Q13428 Treacle protein OS=Homo sapiens GN=TCOF1 PE=1 SV=3 - [TCOF_HUMAN] Q9NZ01 Very-long-chain enoyl-CoA reductase OS=Homo sapiens GN=TECR PE=1 SV=1 - [TECR_HUMAN] Q04206 Transcription factor p65 OS=Homo sapiens GN=RELA PE=1 SV=2 - [TF65_HUMAN] P02786 Transferrin receptor protein 1 OS=Homo sapiens GN=TFRC PE=1 SV=2 - [TFR1_HUMAN] Transforming growth factor beta-1-induced transcript 1 protein OS=Homo sapiens GN=TGFB1I1 PE=1 SV=2 - O43294 [TGFI1_HUMAN] Q99805 Transmembrane 9 superfamily member 2 OS=Homo sapiens GN=TM9SF2 PE=1 SV=1 - [TM9S2_HUMAN] O43399 Tumor protein D54 OS=Homo sapiens GN=TPD52L2 PE=1 SV=2 - [TPD54_HUMAN] P12270 Nucleoprotein TPR OS=Homo sapiens GN=TPR PE=1 SV=3 - [TPR_HUMAN] Q13595 Transformer-2 protein homolog alpha OS=Homo sapiens GN=TRA2A PE=1 SV=1 - [TRA2A_HUMAN] Q8NG06 Tripartite motif-containing protein 58 OS=Homo sapiens GN=TRIM58 PE=2 SV=2 - [TRI58_HUMAN] Q9H1Z9 Tetraspanin-10 OS=Homo sapiens GN=TSPAN10 PE=2 SV=1 - [TSN10_HUMAN] P63313 Thymosin beta-10 OS=Homo sapiens GN=TMSB10 PE=1 SV=2 - [TYB10_HUMAN] O43818 U3 small nucleolar RNA-interacting protein 2 OS=Homo sapiens GN=RRP9 PE=1 SV=1 - [U3IP2_HUMAN] P61088 Ubiquitin-conjugating enzyme E2 N OS=Homo sapiens GN=UBE2N PE=1 SV=1 - [UBE2N_HUMAN] P61960 Ubiquitin-fold modifier 1 OS=Homo sapiens GN=UFM1 PE=1 SV=1 - [UFM1_HUMAN] Q16864 V-type proton ATPase subunit F OS=Homo sapiens GN=ATP6V1F PE=1 SV=2 - [VATF_HUMAN] O75348 V-type proton ATPase subunit G 1 OS=Homo sapiens GN=ATP6V1G1 PE=1 SV=3 - [VATG1_HUMAN] Q96JH7 Deubiquitinating protein VCIP135 OS=Homo sapiens GN=VCPIP1 PE=1 SV=2 - [VCIP1_HUMAN] Q96GC9 Vacuole membrane protein 1 OS=Homo sapiens GN=VMP1 PE=1 SV=1 - [VMP1_HUMAN] Q3MJ13 WD repeat-containing protein 72 OS=Homo sapiens GN=WDR72 PE=2 SV=2 - [WDR72_HUMAN] O76024 Wolframin OS=Homo sapiens GN=WFS1 PE=1 SV=2 - [WFS1_HUMAN] Q9HAV4 Exportin-5 OS=Homo sapiens GN=XPO5 PE=1 SV=1 - [XPO5_HUMAN] Q9UIA9 Exportin-7 OS=Homo sapiens GN=XPO7 PE=1 SV=3 - [XPO7_HUMAN] Q8IWR0 Zinc finger CCCH domain-containing protein 7A OS=Homo sapiens GN=ZC3H7A PE=1 SV=1 - [Z3H7A_HUMAN] Q13972 Ras-specific guanine nucleotide-releasing factor 1 OS=Homo sapiens GN=RASGRF1 PE=1 SV=2 - [RGRF1_HUMAN]

Table 7‎ .35. Up-regulated proteins due to use of BT2 compound in ME1007 cell line at 6 h of serum stimulation Accession Description Eukaryotic translation initiation factor 4E-binding protein 1 OS=Homo sapiens GN=EIF4EBP1 PE=1 SV=3 - Q13541 [4EBP1_HUMAN] Q9NY61 Protein AATF OS=Homo sapiens GN=AATF PE=1 SV=1 - [AATF_HUMAN] P62330 ADP-ribosylation factor 6 OS=Homo sapiens GN=ARF6 PE=1 SV=2 - [ARF6_HUMAN] P61160 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 - [ARP2_HUMAN] P07339 Cathepsin D OS=Homo sapiens GN=CTSD PE=1 SV=1 - [CATD_HUMAN] P13987 CD59 glycoprotein OS=Homo sapiens GN=CD59 PE=1 SV=1 - [CD59_HUMAN] Q6UXH1 Cysteine-rich with EGF-like domain protein 2 OS=Homo sapiens GN=CRELD2 PE=1 SV=1 - [CREL2_HUMAN] P21291 Cysteine and glycine-rich protein 1 OS=Homo sapiens GN=CSRP1 PE=1 SV=3 - [CSRP1_HUMAN] P30046 D-dopachrome decarboxylase OS=Homo sapiens GN=DDT PE=1 SV=3 - [DOPD_HUMAN] P63167 Dynein light chain 1, cytoplasmic OS=Homo sapiens GN=DYNLL1 PE=1 SV=1 - [DYL1_HUMAN] Q15369 Transcription elongation factor B polypeptide 1 OS=Homo sapiens GN=TCEB1 PE=1 SV=1 - [ELOC_HUMAN] Q49A26 Putative oxidoreductase GLYR1 OS=Homo sapiens GN=GLYR1 PE=1 SV=3 - [GLYR1_HUMAN] P04908 Histone H2A type 1-B/E OS=Homo sapiens GN=HIST1H2AB PE=1 SV=2 - [H2A1B_HUMAN] Q99878 Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 - [H2A1J_HUMAN] P69905 Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 - [HBA_HUMAN]

260

Q9GZZ1 N-alpha-acetyltransferase 50 OS=Homo sapiens GN=NAA50 PE=1 SV=1 - [NAA50_HUMAN] Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial P11182 OS=Homo sapiens GN=DBT PE=1 SV=3 - [ODB2_HUMAN] O60925 Prefoldin subunit 1 OS=Homo sapiens GN=PFDN1 PE=1 SV=2 - [PFD1_HUMAN] P51159 Ras-related protein Rab-27A OS=Homo sapiens GN=RAB27A PE=1 SV=3 - [RB27A_HUMAN] Q9Y4C8 Probable RNA-binding protein 19 OS=Homo sapiens GN=RBM19 PE=1 SV=3 - [RBM19_HUMAN] P61927 60S ribosomal protein L37 OS=Homo sapiens GN=RPL37 PE=1 SV=2 - [RL37_HUMAN] P62273 40S ribosomal protein S29 OS=Homo sapiens GN=RPS29 PE=1 SV=2 - [RS29_HUMAN] SRA stem-loop-interacting RNA-binding protein, mitochondrial OS=Homo sapiens GN=SLIRP PE=1 SV=1 - Q9GZT3 [SLIRP_HUMAN] Q13509 Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 - [TBB3_HUMAN] Q6NUQ4 Transmembrane protein 214 OS=Homo sapiens GN=TMEM214 PE=1 SV=2 - [TM214_HUMAN] Q9HD45 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9SF3 PE=1 SV=2 - [TM9S3_HUMAN] Q96LD4 Tripartite motif-containing protein 47 OS=Homo sapiens GN=TRIM47 PE=1 SV=2 - [TRI47_HUMAN] Q9BRA2 Thioredoxin domain-containing protein 17 OS=Homo sapiens GN=TXNDC17 PE=1 SV=1 - [TXD17_HUMAN] P40126 L-dopachrome tautomerase OS=Homo sapiens GN=DCT PE=1 SV=1 - [TYRP2_HUMAN] P21796 Voltage-dependent anion-selective channel protein 1 OS=Homo sapiens GN=VDAC1 PE=1 SV=2 - [VDAC1_HUMAN] Q14966 Zinc finger protein 638 OS=Homo sapiens GN=ZNF638 PE=1 SV=2 - [ZN638_HUMAN] Q07157 Tight junction protein ZO-1 OS=Homo sapiens GN=TJP1 PE=1 SV=3 - [ZO1_HUMAN]

261

262

8 References

1. Cripps RM, Olson EN. Control of cardiac development by an evolutionarily conserved transcriptional network. Developmental Biology 2002;246:14-28. 2. Oota S, Saitou N. Phylogenetic relationship of muscle tissues deduced from superimposition of gene trees. Molecular Biology and Evolution 1999;16:856-867. 3. Bishopric NH. Evolution of the heart from bacteria to man. Communicative Cardiac Cell 2005;1047:13-29. 4. Simoes-Costa MS, Vasconcelos M, Sampaio AC, et al. The evolutionary origin of cardiac chambers. Developmental Biology 2005;277:1-15. 5. Lindsay EA, Vitelli F, Su H, et al. Tbx1 haploinsufficiency in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 2001;410:97-101. 6. Olson EN. Gene regulatory networks in the evolution and development of the heart. Science 2006;313:1922-1927. 7. Medzhitov R. Origin and physiological roles of inflammation. Nature 2008;454:428-435. 8. Smale ST. Selective Transcription in Response to an Inflammatory Stimulus. Cell 2010;140:833-844. 9. Aller MA, Arias N, Fuentes-Julian S, et al. Coupling inflammation with evo-devo. Medical Hypotheses 2012;78:721-731. 10. Aller MA, Arias JI, Arias J. Pathological axes of wound repair: Gastrulation revisited. Theoretical Biology and Medical Modelling 2010;7. 11. Aller MA, Arias JL, Sanchez-Patan F, et al. The inflammatory response: An efficient way of life. Medical Science Monitor 2006;12:Ra225-Ra234. 12. Shibata N, Glass CK. Regulation of macrophage function in inflammation and atherosclerosis. Journal of Lipid Research 2009;50:S277-S281. 13. Yokoyama WM, Kim SJ, French AR. The dynamic life of natural killer cells. Annual Review of Immunology 2004;22:405-429. 14. Knorr M, Munzel T, Wenzel P. Interplay of NK cells and monocytes in vascular inflammation and myocardial infarction. Front Physiol 2014;5:295. 15. Alikhani S, Delavari A, Alaedini F, et al. A province-based surveillance system for the risk factors of non-communicable diseases: A prototype for integration of risk factor surveillance into primary healthcare systems of developing countries. Public Health 2009;123:358-364. 16. Hastings CL, Roche ET, Ruiz-Hernandez E, et al. Drug and cell delivery for cardiac regeneration. Adv Drug Deliv Rev 2014. 17. McGill HC, Jr., McMahan CA, Gidding SS. Preventing heart disease in the 21st century: implications of the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study. Circulation 2008;117:1216-27. 18. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med 2005;352:1685-95. 19. Avci-Adali M, Mludek K, Perle N, et al. Importance of Rigorous In Vitro Evaluation of Prospective Cell Binding Aptamers. Nucleic Acid Therapeutics 2014;24:250-257. 20. Hoey ET, Pakala V, Teoh JK, et al. The role of imaging in hypertensive heart disease. Int J Angiol 2014;23:85-92. 21. Omland T, Rosjo H, Giannitsis E, et al. Troponins in heart failure. Clin Chim Acta 2014. 22. Zangiabadi A, De Pasquale CG, Sajkov D. Pulmonary hypertension and right heart dysfunction in chronic lung disease. Biomed Res Int 2014;2014:739674. 23. Bachmaier K, Toya S, Malik AB. Therapeutic administration of the chemokine CXCL1/KC abrogates autoimmune inflammatory heart disease. PLoS One 2014;9:e89647.

263

24. Henri C, Pierard LA, Lancellotti P, et al. Exercise Testing and Stress Imaging in Valvular Heart Disease. Can J Cardiol 2014;30:1012-1026. 25. Nace SR, Gentry LR. Cerebrovascular Trauma. Neuroimaging Clin N Am 2014;24:487-511. 26. Novo S, Paleologo C. Metabolic syndrome and peripheral arterial disease. Rev Clin Esp 2014. 27. Roberts K, Maguire G, Brown A, et al. Echocardiographic Screening for Rheumatic Heart Disease in High and Low Risk Australian Children. Circulation 2014;129:1953-1961. 28. Cho HJ, Hwang YS, Mood K, et al. EphrinB1 Interacts with CNK1 and Promotes Cell Migration through c-Jun N-terminal Kinase (JNK) Activation. Journal of Biological Chemistry 2014;289:18556-18568. 29. Wong ND. Epidemiological studies of CHD and the evolution of preventive cardiology. Nature Reviews Cardiology 2014;11:276-289. 30. Akesson A, Weismayer C, Newby PK, et al. Combined effect of low-risk dietary and lifestyle behaviors in primary prevention of myocardial infarction in women. Archives of Internal Medicine 2007;167:2122-2127. 31. Graham I, Atar D, Borch-Johnsen K, et al. European guidelines on cardiovascular disease prevention in clinical practice: Full text. European Journal of Cardiovascular Prevention & Rehabilitation 2007;14:S1-S113. 32. Fagard RH, Van den Enden M, Leeman M, et al. Survey on treatment of hypertension and implementation of World Health Organization/International Society of Hypertension risk stratification in primary care in Belgium. Journal of Hypertension 2002;20:1297- 1302. 33. Perk J, De Backer G, Gohlke H, et al. European Guidelines on Cardiovascular Disease Prevention in Clinical Practice (Version 2012). International Journal of Behavioral Medicine 2012;19:403-488. 34. Ignarro LJ, Balestrieri ML, Napoli C. Nutrition, physical activity, and cardiovascular disease: An update. Cardiovascular Research 2007;73:326-340. 35. Wang X, Ouyang YY, Liu J, et al. Fruit and vegetable consumption and mortality from all causes, cardiovascular disease, and cancer: systematic review and dose-response metaanalysis of prospective cohort studies. Bmj-British Medical Journal 2014;349. 36. Messner B, Bernhard D. Smoking and cardiovascular disease: mechanisms of endothelial dysfunction and early atherogenesis. Arterioscler Thromb Vasc Biol 2014;34:509-15. 37. Sinn DH, Gwak GY, Paik YH, et al. Modest Alcohol Consumption and Risk of Cardiovascular Diseases among Men with Non-Alcoholic Fatty Liver Disease. Hepatology 2013;58:492a-492a. 38. McTigue KM, Hess R, Ziouras J. Obesity in older adults: A systematic review of the evidence for diagnosis and treatment. Obesity 2006;14:1485-1497. 39. Nilsson J, Hansson GK. Autoimmunity in atherosclerosis: a protective response losing control? Journal of Internal Medicine 2008;263:464-478. 40. Go AS, Mozaffarian D, Roger VL, et al. Heart Disease and Stroke Statistics-2014 Update A Report From the American Heart Association. Circulation 2014;129:E28-E292. 41. Grabner R, Lotzer K, Dopping S, et al. Lymphotoxin beta receptor signaling promotes tertiary lymphoid organogenesis in the aorta adventitia of aged ApoE-/- mice. J Exp Med 2009;206:233-48. 42. Neyt K, Perros F, GeurtsvanKessel CH, et al. Tertiary lymphoid organs in infection and autoimmunity. Trends Immunol 2012;33:297-305. 43. Dal Canto AJ, Swanson PE, O'Guin AK, et al. IFN-gamma action in the media of the great elastic arteries, a novel immunoprivileged site. J Clin Invest 2001;107:R15-22. 44. Seleznik G, Seeger H, Papandile A, et al. LYMPHOTOXIN beta RECEPTOR SIGNALING IN RENAL INFLAMMATION. Nephrology Dialysis Transplantation 2014;29:25-25.

264

45. Buchhaupt M, Pelfer C, Entian KD. Analysis of 2 '-O-methylated nucleosides and pseudouridines in ribosomal RNAs using DNAzymes. Analytical Biochemistry 2007;361:102-108. 46. Cupedo T, Mebius RE. Cellular interactions in lymph node development. Journal of Immunology 2005;174:21-25. 47. Mohanta SK, Yin CJ, Peng L, et al. Artery Tertiary Lymphoid Organs Contribute to Innate and Adaptive Immune Responses in Advanced Mouse Atherosclerosis. Circulation Research 2014;114:1772-1787. 48. Apta B, Harrison MJ, Benezech C, et al. LYMPHOTOXIN-beta RECEPTOR SIGNALLING LINKS STEATOHEPATITIS, HYPER-LIPIDEMIA AND ATHEROSCLEROSIS. Atherosclerosis 2014;232:E4-E4. 49. Carragher DM, Rangel-Moreno J, Randall TD. Ectopic lymphoid tissues and local immunity. Seminars in Immunology 2008;20:26-42. 50. Luther SA, Bidgol A, Hargreaves DC, et al. Differing activities of homeostatic chemokines CCL19, CCL21, and CXCL12 in lymphocyte and dendritic cell recruitment and lymphoid neogenesis. Journal of Immunology 2002;169:424-433. 51. Goetze S, Xi XP, Fleck E, et al. TNF alpha-induced migration of vascular smooth muscle cells is MAPK-dependent. Hypertension 1998;32:591-591. 52. Lotzer K, Dopping S, Connert S, et al. Mouse Aorta Smooth Muscle Cells Differentiate Into Lymphoid Tissue Organizer-Like Cells on Combined Tumor Necrosis Factor Receptor- 1/Lymphotoxin beta-Receptor NF-kappa B Signaling. Arteriosclerosis Thrombosis and Vascular Biology 2010;30:395-402. 53. Benezech C, Mader E, Desanti G, et al. Lymphotoxin-beta Receptor Signaling through NF- kappa B2-RelB Pathway Reprograms Adipocyte Precursors as Lymph Node Stromal Cells. Immunity 2012;37:721-734. 54. Itano AA, Jenkins MK. Antigen presentation to naive CD4 T cells in the lymph node. Nature Immunology 2003;4:733-739. 55. Sixt M, Kanazawa N, Seig M, et al. The conduit system transports soluble antigens from the afferent lymph to resident dendritic cells in the T cell area of the lymph node. Immunity 2005;22:19-29. 56. Guedj K, Khallou-Laschet J, Clement M, et al. M1 macrophages act as LT beta R- independent lymphoid tissue inducer cells during atherosclerosis-related lymphoid neogenesis. Cardiovascular Research 2014;101:434-443. 57. Akhavanpoor M, Wangler S, Gleissner CA, et al. Adventitial inflammation and its interaction with intimal atherosclerotic lesions. Front Physiol 2014;5:296. 58. Tomic MM, Pele NA, Bishop JW, et al. Reproducibility and Cancer Risk Stratification of Endometrial Samplings Utilizing World Health Organization and Endometrial Intraepithelial Neoplasia Classifications. Laboratory Investigation 2013;93:297a-297a. 59. Abrams JS, Mooney M, Zwiebel J, et al. Improving the Protocol Implementation Process: The National Cancer Institute's Response. Journal of Clinical Oncology 2014;32:2515- U164. 60. Sudhakar A. History of Cancer, Ancient and Modern Treatment Methods. J Cancer Sci Ther 2009;1:1-4. 61. Kushi LH, Doyle C, McCullough M, et al. American Cancer Society Guidelines on Nutrition and Physical Activity for Cancer Prevention Reducing the Risk of Cancer With Healthy Food Choices and Physical Activity. Ca-a Cancer Journal for Clinicians 2012;62:30-67. 62. Grilley-Olson JE, Hayes DN, Moore DT, et al. Validation of Interobserver Agreement in Lung Cancer Assessment: Hematoxylin-Eosin Diagnostic Reproducibility for Non-Small Cell Lung Cancer The 2004 World Health Organization Classification and Therapeutically Relevant Subsets. Archives of Pathology & Laboratory Medicine 2013;137:32-40.

265

63. Dubas LE, Ingraffea A. Nonmelanoma Skin Cancer. Facial Plastic Surgery Clinics of North America 2013;21:43-+. 64. Cakir BO, Adamson P, Cingi C. Epidemiology and economic burden of nonmelanoma skin cancer. Facial Plast Surg Clin North Am 2012;20:419-22. 65. Jemal A, Bray F, Center MM, et al. Global cancer statistics. CA Cancer J Clin 2011;61:69- 90. 66. Matsuda A, Katanoda K. Estimated Disability-adjusted Life Year (DALY) in All Cancers in GLOBOCAN 2008, in Asia by the County. Japanese Journal of Clinical Oncology 2013;43:943-944. 67. Rajaram M, Zhang JP, Wang T, et al. Two Distinct Categories of Focal Deletions in Cancer Genomes. Plos One 2013;8. 68. Dang HT, Budhu A, Wang XW. The origin of cancer stem cells. Journal of Hepatology 2014;60:1304-1305. 69. Kuphal S, Bosserhoff A. Recent progress in understanding the pathology of malignant melanoma. Journal of Pathology 2009;219:400-409. 70. Tang YJ, Khalaf AT, Liu XM, et al. Zinc finger A20 and NF-kappaB correlate with high-risk human papillomavirus of squamous cell carcinoma patients. Tumour Biol 2014. 71. Gomez-Mateo Mdel C, Sabater-Orti L, Ferrandez-Izquierdo A. Pathology handling of pancreatoduodenectomy specimens: Approaches and controversies. World J Gastrointest Oncol 2014;6:351-9. 72. Ksentini M, Ellouze S, Mnif H, et al. Sarcoma in irradiated fields. Tunis Med 2014;92:291- 2. 73. Zhou MH, Yang QM. NUP214 fusion genes in acute leukemia. Oncology Letters 2014;8:959-962. 74. Alrawi O, Najjar R, Abujazar H, et al. Cytomegalovirus Reactivation Following Autologous Peripheral Blood Stem Cell Transplantation for Lymphoma and Multiple Myeloma, Single Center Experience. Biology of Blood and Marrow Transplantation 2014;20:S104-S104. 75. Nabors LB, Ammirati M, Bierman PJ, et al. Central Nervous System Cancers Clinical Practice Guidelines in Oncology. Journal of the National Comprehensive Cancer Network 2013;11:1114-1151. 76. Hou JM, Yang S, Yang H, et al. Generation of male differentiated germ cells from various types of stem cells. Reproduction 2014;147:R179-R188. 77. Humphreys BD. Introduction: stem cells and kidney regeneration. Semin Nephrol 2014;34:349-50. 78. Bredemeyer AL, Sleckman BP. DNA Damage Responses: Beyond Double-Strand Break Repair. Current Biology 2015;25:R45-R46. 79. Fearon ER, Vogelstein B. A Genetic Model for Colorectal Tumorigenesis. Cell 1990;61:759-767. 80. Schroeder A, Heller DA, Winslow MM, et al. Treating metastatic cancer with nanotechnology. Nature Reviews Cancer 2012;12:39-50. 81. Wymenga AN, Slebos DJ, van der Naalt J, et al. [Abdominal complaints and neurological symptoms as an early sign of lung cancer: a manifestation of the anti-Hu syndrome]. Ned Tijdschr Geneeskd 2003;147:616-9. 82. Lafontaine M, Crane M, Kite J, et al. Awareness About the Signs and Symptoms of Lung Cancer in at Risk Populations in Nsw. Journal of Thoracic Oncology 2012;7:S175-S175. 83. Printz C. High-Throughput Sequencing Detects Signs of Cancer Recurrence. Cancer 2012;118:4097-4097. 84. Gravina GL, Mancini A, Rucci N, et al. EFFECTS OF DUAL PI3K AND mTOR INHIBITION ON INCIDENCE AND LOCAL GROWTH OF PROSTATE CANCER BONE METASTASES. Anticancer Research 2012;32:1854-1855.

266

85. Khan SLA, Anwar N, Nuttal E, et al. Lung cancer from symptoms to referral across the Lancashire and South Cumbria Network. Lung Cancer 2014;83:S50-S50. 86. Ginex P, Thom B, Jingeleski M, et al. Patterns of symptoms following surgery for esophageal cancer. Oncol Nurs Forum 2013;40:E101-7. 87. Bruzzese F, Hagglof C, Leone A, et al. Local and Systemic Protumorigenic Effects of Cancer-Associated Fibroblast-Derived GDF15. Cancer Research 2014;74:3408-3417. 88. Laird BJ, McMillan DC, Fayers P, et al. The systemic inflammatory response and its relationship to pain and other symptoms in advanced cancer. Oncologist 2013;18:1050- 5. 89. Landi P, Torrejon GAF. Fever of Unkown Origin and Gastrointestinal Bleeding. Medicina- Buenos Aires 2011;71:397-401. 90. Pircher A, Verdorfer I, Brunner A, et al. Paraneoplastic Phenomena and Diagnostic Challenges in Angioimmunoblastic T-Cell Lymphoma (AITL): Report of Two Cases and Review of the Literature. In Vivo 2014;28:327-332. 91. Chu GCY, Chung LWK. RANK-mediated signaling network and cancer metastasis. Cancer and Metastasis Reviews 2014;33:497-509. 92. Hooper J, He YW, Casar B, et al. Novel protease mediated mechanisms promote the spread of cancer cells via the blood circulation. Faseb Journal 2013;27. 93. Evans M. Essentials of Stem Cell Biology Second Edition Foreword. Essentials of Stem Cell Biology, 2nd Edition 2009:Xvii-Xvii. 94. Herbolsheimer M. Refraining from Removal of Armpit-Lymphnodes in Breast Cancer. Onkologe 2012;18:711-712. 95. Lee CH, Kim SH, Kim IH, et al. Endoscopic stenting in bile duct cancer increases liver volume. Gastrointestinal Endoscopy 2014;80:447-455. 96. Chorazy M, Majcher M, Fedyszyn-Urbanowicz K, et al. Atypical dissemination of lung cancer to the adrenal gland and to the spleen. Wspolczesna Onkologia-Contemporary Oncology 2012;16:444-446. 97. Benhammane H, El M'Rabet FZ, Bouyahia N, et al. Bones Metastases in Gastric Cancer Patients: Review of 12 Cases. Annals of Oncology 2012;23:39-39. 98. Patel SA, Chen YH, Hornick JL, et al. Early- Stage Rectal Cancer: Clinical and Pathologic Prognostic Markers of Time to Local Recurrence and Overall Survival After Resection. Diseases of the Colon & Rectum 2014;57:449-459. 99. Heitz F, Harter P, du Bois A. Staging laparoscopy for the management of early-stage ovarian cancer: a metaanalysis. American Journal of Obstetrics and Gynecology 2013;209:592-593. 100. Pandian TK, Krishnamurthy V, Hieken TJ. Removing barriers to patient detection of early stage melanoma. European Journal of Cancer 2013;49:S860-S860. 101. Hikage M, Kamei T, Fujishima F, et al. Early-stage primary malignant melanoma of the esophagus detected simultaneously with esophageal squamous cell carcinoma. Esophagus 2012;9:33-38. 102. Azoury SC, Lange JR. Epidemiology, Risk Factors, Prevention, and Early Detection of Melanoma. Surg Clin North Am 2014;94:945-962. 103. Stubblefield J, Kelly B. Melanoma in Non-Caucasian Populations. Surg Clin North Am 2014;94:1115-1126. 104. Belova I, Breuninger H, Flessa S. Skin Cancer Screening and Mortality Statistics in Germany. Journal Der Deutschen Dermatologischen Gesellschaft 2013;11:924-925. 105. Jost LM, Jelic S, Purkalne G, et al. ESMO Minimum Clinical Recommendations for diagnosis, treatment and follow-up of cutaneous malignant melanoma. Annals of Oncology 2005;16:66-68. 106. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin 2012;62:10-29.

267

107. Kanavy HE, Gerstenblith MR. Ultraviolet Radiation and Melanoma. Seminars in Cutaneous Medicine and Surgery 2011;30:222-228. 108. Delmas V, Larue L. How keratinocytes instruct melanocytes to deliver the pigment. M S- Medecine Sciences 2008;24:147-148. 109. Besch R, Berking C. POU transcription factors in melanocytes and melanoma. European Journal of Cell Biology 2014;93:55-60. 110. Verdecchia GM, Ridolfi R, Bazzocchi F, et al. Surgical removal of metastases and adoptive immunotherapy with tumor-infiltrating lymphocytes and interleukin-2 in the treatment of melanoma, colorectal cancer and renal carcinoma. Xxiii National Congress Societa Italiana Di Chirurgia Oncologica 1999:485-490. 111. Mavropoulos JC, Wang TS. Managing The Skin Toxicities From New Melanoma Drugs. Current Treatment Options in Oncology 2014;15:281-301. 112. Jerant AF, Johnson JT, Sheridan CD, et al. Early detection and treatment of skin cancer. American Family Physician 2000;62:357-368. 113. Lomuto M, Calabrese P, Giuliani A. Prognostic signs in melanoma: state of the art. J Eur Acad Dermatol Venereol 2004;18:291-300. 114. Braga JCT, Gomes E, Macedo MP, et al. Early detection of melanoma arising within nevus spilus. Journal of the American Academy of Dermatology 2014;70:E31-E32. 115. Tritschler P, Azar AR, De Coene B, et al. Trigeminal Melanoma Metastasis. Clinical Neuroradiology 2014;24:51-54. 116. Haq R, Flaherty K. The melanoma metastasis X-factor. Pigment Cell Melanoma Res 2014;27:698. 117. Lok E, Chung AS, Swanson KD, et al. Melanoma brain metastasis globally reconfigures chemokine and cytokine profiles in patient cerebrospinal fluid. Melanoma Research 2014;24:120-130. 118. Runger TM, Farahvash B, Hatvani Z, et al. Comparison of DNA damage responses following equimutagenic doses of UVA and UVB: A less effective cell cycle arrest with UVA may render UVA-induced pyrimidine dimers more mutagenic than UVB-induced ones. Photochemical & Photobiological Sciences 2012;11:207-215. 119. Boniol M, Autier P, Boyle P, et al. Cutaneous melanoma attributable to sunbed use: systematic review and meta-analysis. British Medical Journal 2012;345. 120. El Ghissassi F, Baan R, Straif K, et al. A review of human carcinogens--part D: radiation. Lancet Oncol 2009;10:751-2. 121. Hill VK, Gartner JJ, Samuels Y, et al. The Genetics of Melanoma: Recent Advances. Annual Review of Genomics and Human Genetics, Vol 14 2013;14:257-279. 122. Cireap N, Narita D. Molecular Profiling of ADAM12 and ADAM17 Genes in Human Malignant Melanoma. Pathology & Oncology Research 2013;19:755-762. 123. Harland M, Goldstein AM, Kukalizch K, et al. A comparison of CDKN2A mutation detection within the Melanoma Genetics Consortium (GenoMEL). European Journal of Cancer 2008;44:1269-1274. 124. Yamaguchi Y, Hearing VJ. Melanocytes and Their Diseases. Cold Spring Harbor Perspectives in Medicine 2014;4. 125. Kim JY, Choi M, Jo SJ, et al. Acral Lentiginous Melanoma: Indolent Subtype With Long Radial Growth Phase. American Journal of Dermatopathology 2014;36:142-147. 126. Choi M, Kim JY, Park SY, et al. Acral lentiginous melanoma with a long radial growth phase. Journal of Dermatology 2012;39:112-112. 127. Klausner M, Kaluzhny Y, Ayehunie S. Reconstructed human skin model to study melanoma at different stages of progression. Journal of Investigative Dermatology 2011;131:S129-S129.

268

128. Sharma BK, Manglik V, Elias EG. Immuno-Expression of Human Melanoma Stem Cell Markers in Tissues at Different Stages of the Disease. Journal of Surgical Research 2010;163:E11-E15. 129. Mokhtari M, Rezaeian M, Gharibzadeh S, et al. Computer aided measurement of melanoma depth of invasion in microscopic images. Micron 2014;61:40-48. 130. Laga AC, Murphy GF. Cellular Heterogeneity in Vertical Growth Phase Melanoma. Archives of Pathology & Laboratory Medicine 2010;134:1750-1757. 131. Gimotty P, Guerry D, VanBelle P, et al. Ki67 as a prognostic biomarker for patients with vertical growth phase (VGP) melanomas. Journal of Clinical Oncology 2009;27. 132. Oliveira RS, Ferreira LM, Biasi LJ, et al. Vertical growth phase and positive sentinel node in thin melanoma. Brazilian Journal of Medical and Biological Research 2003;36:347-350. 133. Mansfield JR, Lloyd RC, Lane K, et al. Phenotyping of Tumour-Infiltrating Lymphocytes in Melanoma Using Tissue Cytometry. Journal of Pathology 2013;229:S31-S31. 134. Aksenenko M, Ruksha T. Matrix metalloproteinase-9 and N-cadherin levels in melanoma patients with negative tumor infiltrating lymphocytes status. Journal Der Deutschen Dermatologischen Gesellschaft 2013;11:94-94. 135. Schatton T, Scolyer RA, Thompson JF, et al. Tumor-Infiltrating Lymphocytes and Their Significance in Melanoma Prognosis. Molecular Diagnostics for Melanoma: Methods and Protocols 2014;1102:287-324. 136. Martires KJ, Barnholtz-Sloan JS, Bordeaux JS. A Call for Consistent Reporting of Regression in Melanoma. Archives of Dermatology 2012;148:1081-1083. 137. Garg E, Kong X, Shi H, et al. Mechanisms of Resistance to the B-Raf Inhibitor Zelboraf in Four Melanoma Cell Lines. Journal of Investigative Medicine 2012;60:147-147. 138. Davies MA, Samuels Y. Analysis of the genome to personalize therapy for melanoma. Oncogene 2010;29:5545-5555. 139. Cheng YB, Zhang GH, Li G. Targeting MAPK pathway in melanoma therapy. Cancer and Metastasis Reviews 2013;32:567-584. 140. Fecher LA, Arnaravadi RK, Flaherty KT. The MAPK pathway in melanoma. Current Opinion in Oncology 2008;20:183-189. 141. Pretto F, Neri D. Pharmacotherapy of metastatic melanoma: Emerging trends and opportunities for a cure. Pharmacology & Therapeutics 2013;139:405-411. 142. Thompson JA. Agents Make "Preferred List" in Metastatic Melanoma. Journal of the National Comprehensive Cancer Network 2014;12:785-787. 143. Mohana-Kumaran N, Hill DS, Allen JD, et al. Targeting the intrinsic apoptosis pathway as a strategy for melanoma therapy. Pigment Cell & Melanoma Research 2014;27. 144. Goding CR. Fishful thinking: the rise and fall of MITF in melanoma. Pigment Cell & Melanoma Research 2014;27:7-8. 145. Roider EM, Fisher DE. The Impact of MITF on Melanoma Development: News from Bench and Bedside. Journal of Investigative Dermatology 2014;134:16-17. 146. Lewis J, Burgler C, Girardi M. Langerhans cells promote clonal expansion of UV-induced p53 mutant keratinocytes independently of T cells. Journal of Investigative Dermatology 2014;134:S34-S34. 147. Dalziel M, Kolesnichenko M, das Neves RP, et al. alpha-MSH regulates intergenic splicing of MC1R and TUBB3 in human melanocytes. Nucleic Acids Research 2011;39:2378-2392. 148. Kim HE, Lee SG. Induction of ATP synthase beta by H2O2 induces melanogenesis by activating PAH and cAMP/CREB/MITF signaling in melanoma cells. International Journal of Biochemistry & Cell Biology 2013;45:1217-1222. 149. Hacker E, Hayward NK, Dumenil T, et al. The Association between MC1R Genotype and BRAF Mutation Status in Cutaneous Melanoma: Findings from an Australian Population. Journal of Investigative Dermatology 2010;130:241-248.

269

150. Chin L, Garraway LA, Fisher DE. Malignant melanoma: genetics and therapeutics in the genomic era. Genes & Development 2006;20:2149-2182. 151. Cohen-Armon M. PARP-1 activation mediates the expression of immediate early genes implicated in long-term memory formation. Febs Journal 2008;275:92-92. 152. Tischmeyer W, Grimm R. Activation of immediate early genes and memory formation. Cellular and Molecular Life Sciences 1999;55:564-574. 153. Qiao X, Lu JY, Hofmann SL. Gene expression profiling in a mouse model of infantile neuronal ceroid lipofuscinosis reveals upregulation of immediate early genes and mediators of the inflammatory response. BMC Neurosci 2007;8:95. 154. Lubelski D, Ponzio TA, Gainer H. Effects of A-CREB, a dominant negative inhibitor of CREB, on the expression of c-fos and other immediate early genes in the rat SON during hyperosmotic stimulation in vivo. Brain Research 2012;1429:18-28. 155. Wanet A, Tacheny A, Arnould T, et al. miR-212/132 expression and functions: within and beyond the neuronal compartment. Nucleic Acids Research 2012;40:4742-4753. 156. Kelly K, Siebenlist U. Immediate-Early Genes Induced by Antigen Receptor Stimulation. Current Opinion in Immunology 1995;7:327-332. 157. Perez-Cadahia B, Drobic B, Davie JR. Activation and function of immediate-early genes in the nervous system. Biochemistry and Cell Biology-Biochimie Et Biologie Cellulaire 2011;89:61-73. 158. Song JW, Liu P, Yang ZS, et al. MiR-155 Negatively Regulates c-Jun Expression at the Post-transcriptional Level in Human Dermal Fibroblasts in vitro: Implications in UVA Irradiation-induced Photoaging. Cellular Physiology and Biochemistry 2012;29:331-340. 159. Kappelmann M, Kuphal S, Meister G, et al. MicroRNA miR-125b controls melanoma progression by direct regulation of c-Jun protein expression. Oncogene 2013;32:2984- 2991. 160. Zandarashvili L, Esadze A, Iwahara J. Mechanisms of Rapid Action by Stress-inducible Transcription Factor Egr-1. Circulation 2013;128. 161. Ratan RR, Lin KI, Semenza G, et al. Protection from oxidative stress-induced apoptosis by iron chelators in cortical neuronal cultures is associated with induction of glycolytic enzymes and the transcription factor, hypoxia-inducible factor-1. Neurology 1997;48:3001-3001. 162. Hendrickx A, Pierrot N, Tasiaux B, et al. Epigenetic Regulations of Immediate Early Genes Expression Involved in Memory Formation by the Amyloid Precursor Protein of Alzheimer Disease. Plos One 2014;9. 163. Szekely AM, Grayson D, Costa E. Nuclear Signal Transduction Via Immediate Early Genes in Neurons and Glia. Biochemical Society Transactions 1993;21:61-65. 164. Antoine B, Serge L, Jocelyne C. Comparative dynamics of MAPK/ERK signalling components and immediate early genes in the hippocampus and amygdala following contextual fear conditioning and retrieval. Brain Structure & Function 2014;219:415-430. 165. Doucet JP, Bazan NG. Excitable-Membranes, Lipid Messengers, and Immediate-Early Genes - Alteration of Signal Transduction in Neuromodulation and Neurotrauma. Molecular Neurobiology 1992;6:407-424. 166. Liuwantara D, Elliot M, Smith M, et al. Nf-kb regulates b-cell death: A critical role for early immediate response genes in b-cell protection. Diabetes 2007;56:A411-A412. 167. Stahl SM. Molecular neurobiology for practicing psychiatrists, part 5: How a leucine zipper can turn on genes: immediate-early genes activate late-gene expression in the brain. Journal of Clinical Psychiatry 2000;61:7-8. 168. Melko M, Nguyen LS, Shaw M, et al. Loss of FMR2 further emphasizes the link between deregulation of immediate early response genes FOS and JUN and intellectual disability. Human Molecular Genetics 2013;22:2984-2991.

270

169. Honkaniemi J, Zhang JS, Longo FM, et al. Stress induces zinc finger immediate early genes in the rat adrenal gland. Brain Research 2000;877:203-208. 170. Close R, Toro S, Martial JA, et al. Expression of the zinc finger Egr1 gene during zebrafish embryonic development. Mechanisms of Development 2002;118:269-272. 171. Dudas J, Haller F, Fuezesi L, et al. Myc-associated Zinc-finger protein (MAZ) is a potent regulator of Prox1-gene-expression in human hepatocellular carcinoma. Journal of Hepatology 2008;48:S128-S128. 172. Yan Y, Penner CC, Skliris GP, et al. Steroid receptor RNA activator protein (SRAP) expression as a prognostic factor in ER plus human breast tumors. Journal of Cancer Research and Clinical Oncology 2013;139:1637-1647. 173. Kaufman GD. Activation of immediate early genes by vestibular stimulation. New Directions in Vestibular Research 1996;781:437-442. 174. Solana R, Alonso MC, de la Fuente M, et al. Effect of phorbol ester TPA on macrophage metabolic activity. Methods Find Exp Clin Pharmacol 1984;6:67-71. 175. Dondossola E, Rangel R, Guzman-Rojas L, et al. CD13-positive bone marrow-derived myeloid cells promote angiogenesis, tumor growth, and metastasis. Proceedings of the National Academy of Sciences of the United States of America 2013;110:20717-20722. 176. Grondin B, Lefrancois M, Tremblay M, et al. c-Jun homodimers can function as a context- specific coactivator. Molecular and Cellular Biology 2007;27:2919-2933. 177. Shibata N, Carlin AF, Spann NJ, et al. 25-Hydroxycholesterol Activates the Integrated Stress Response to Reprogram Transcription and Translation in Macrophages. Journal of Biological Chemistry 2013;288:35812-35823. 178. Pham TH, Minderjahn J, Schmidl C, et al. Mechanisms of in vivo binding site selection of the hematopoietic master transcription factor PU.1. Nucleic Acids Research 2013;41:6391-6402. 179. Memisoglu AS, Banerjee S. Regulation and role of CCAAT/enhancer binding protein during differentiation of intestinal epithelial cells. European Journal of Cancer 2013;49:S107-S107. 180. Sun LY, Steinbaugh MJ, Masternak MM, et al. Fibroblasts from long-lived mutant mice show diminished ERK1/2 phosphorylation but exaggerated induction of immediate early genes. Free Radical Biology and Medicine 2009;47:1753-1761. 181. Ruiz-Herrero T, Estrada J, Guantes R, et al. A Tunable Coarse-Grained Model for Ligand- Receptor Interaction. Plos Computational Biology 2013;9. 182. Saha RN, Wissink EM, Dudek SM. Rapid Transcription of Neuronal Arc Is Mediated by a Stalled Rna Polymerase-Ii Mechanism. Journal of Neurochemistry 2009;108:95-95. 183. Rubio N, Dewaele M, Verfaillie T, et al. Photodynamic Stress: on the Trail of Secondary ROS that Decide Cell Fate. Free Radical Biology and Medicine 2010;49:S68-S69. 184. Li R, Qian JF, Zhang WH, et al. Human heat shock protein-specific cytotoxic T lymphocytes display potent antitumour immunity in multiple myeloma. British Journal of Haematology 2014;166:690-701. 185. Beuning P, Silva MC, Nevin P, et al. Interactions Between the E. Coli Sos Response Protein Umud and DNA Polymerase III Alpha Subunit Have Implications for Regulating Replication in Response to DNA Damage. Biophysical Journal 2014;106:230a-231a. 186. Komatsu T, Takeuchi K, Yokoo J, et al. Sendai virus C protein impairs both phosphorylation and dephosphorylation processes of Stat1. Febs Letters 2002;511:139- 144. 187. LLeonart ME. A new generation of proto-oncogenes: Cold-inducible RNA binding proteins. Biochimica Et Biophysica Acta-Reviews on Cancer 2010;1805:43-52. 188. Li HY, Xie P, Li GY, et al. In vivo study on the effects of microcystin extracts on the expression profiles of proto-oncogenes (c-fos, c-jun and c-myc) in liver, kidney and testis of male Wistar rats injected i.v. with toxins. Toxicon 2009;53:169-175.

271

189. Lee SM, Vasishtha M, Prywes R. Activation and Repression of Cellular Immediate Early Genes by Serum Response Factor Cofactors. Journal of Biological Chemistry 2010;285:22036-22049. 190. Torres LC, Kulikowski LD, Ramos PL, et al. Disruption of the CREBBP gene and decreased expression of CREB, NF kappa B p65, c-JUN, c-FOS, BCL2 and c-MYC suggest immune dysregulation. Human Immunology 2013;74:911-915. 191. Qin Z, Voorhees JJ, Fisher GJ, et al. Age-associated reduction of cellular spreading/mechanical force up-regulates matrix metalloproteinase-1 expression and collagen fibril fragmentation via c-Jun/AP-1 in human dermal fibroblasts. Aging Cell 2014. 192. Agarwal S, Kumar R, Gupta P, et al. Identification and Characterization of a Positive Regulatory cis-element Within the Upstream Region of c-jun. Journal of Biochemistry 2008;144:741-752. 193. Reddy SP, Reddy NM, Vegiraju S. Deregulation Of Jun/AP1 Transcription Factor Expression In Interstitial Lung Disease In Humans. American Journal of Respiratory and Critical Care Medicine 2010;181. 194. Zhang W, Chen BA, Jin JF, et al. Involvement of c-Jun N-terminal kinase in reversal of multidrug resistance of human leukemia cells in hypoxia by 5-bromotetrandrine. Leuk Lymphoma 2013;54:2506-16. 195. Eby B, Lau K. Evidence for regulatory elements in the promoter region of the human Ca channel alpha 1c subunit gene which interact with heterodimers of transcription factors Fos/Jun & CREB. Journal of the American Society of Nephrology 2003;14:22a-23a. 196. Whisler RL, Chen M, Beiqing L, et al. Impaired induction of c-fos/c-jun genes and of transcriptional regulatory proteins binding distinct c-fos/c-jun promoter elements in activated human T cells during aging. Cell Immunol 1997;175:41-50. 197. Li Y, Kim IC, Kim YJ, et al. Cloning and sequence analysis of the self-fertilizing fish Rivulus marmoratus immediate early gene c-fos. Marine Environmental Research 2004;58:681- 685. 198. Gustems M, Woellmer A, Rothbauer U, et al. c-Jun/c-Fos heterodimers regulate cellular genes via a newly identified class of methylated DNA sequence motifs. Nucleic Acids Research 2014;42:3059-3072. 199. Calaf GM, Hei TK. Ionizing radiation induces alterations in cellular proliferation and c- myc, c-jun and c-fos protein expression in breast epithelial cells. International Journal of Oncology 2004;25:1859-1866. 200. Yu XF, Luo AP, Zhou CC, et al. Differentiation-associated genes regulated by TPA-induced c-Jun expression via a PKC/JNK pathway in KYSE450 cells. Biochemical and Biophysical Research Communications 2006;342:286-292. 201. Lagroye I, Poncy JL. Influence of 50-Hz magnetic fields and ionizing radiation on c-jun and c-fos oncoproteins. Bioelectromagnetics 1998;19:112-116. 202. Devary Y, Gottlieb RA, Lau LF, et al. Rapid and Preferential Activation of the C-Jun Gene during the Mammalian Uv Response. Molecular and Cellular Biology 1991;11:2804-2811. 203. Veiga E, de Lorenzo V, Fernandez LA. Autotransporters as scaffolds for novel bacterial adhesins: Surface properties of Escherichia coli cells displaying Jun/Fos dimerization domains. Journal of Bacteriology 2003;185:5585-5590. 204. Kohler JJ, Schepartz A. Kinetic studies of Fos center dot Jun center dot DNA complex formation: DNA binding prior to dimerization. Biochemistry 2001;40:130-142. 205. Ahrens T, Pertz O, Haussinger D, et al. Analysis of heterophilic and homophilic interactions of cadherins using the c-jun/c-fos dimerization domains. Journal of Biological Chemistry 2002;277:19455-19460. 206. Wagner EF. Functions of AP1 (Fos/Jun) in bone development. Annals of the Rheumatic Diseases 2002;61:40-42.

272

207. Gauss KA, Bunger PL, Siemsen DW, et al. Induction of the human P67(phox) promoter by TNF alpha requires AP1 factors, jun and fos. Faseb Journal 2002;16:A1050-A1050. 208. Patel HR, Sytkowski AJ. Erythropoietin Activation of Ap1 (Fos/Jun). Experimental Hematology 1995;23:619-625. 209. Esnault C, Chenais B, Casse N, et al. Electrochemically Modified Carbon and Chromium Surfaces for AFM Imaging of Double-Strand DNA Interaction with Transposase Protein. Chemphyschem 2013;14:338-345. 210. Zhang BZ, Xiang SY, Yin YR, et al. C-terminal in Sp1-like artificial zinc-finger proteins plays crucial roles in determining their DNA binding affinity. Bmc Biotechnology 2013;13. 211. Rajaram N, Kerppola TK. DNA bending by Fos-Jun and the orientation of heterodimer binding depend on the sequence of the AP-1 site. Embo Journal 1997;16:2917-2925. 212. Melanson BD, Cabrita MA, Bose R, et al. A novel cis-acting element from the 3'UTR of DNA damage-binding protein 2 mRNA links transcriptional and post-transcriptional regulation of gene expression. Nucleic Acids Research 2013;41:5692-5703. 213. Murray TVA, Smyrnias I, Shah AM, et al. NADPH Oxidase 4 Regulates Cardiomyocyte Differentiation via Redox Activation of c-Jun Protein and the cis-Regulation of GATA-4 Gene Transcription. Journal of Biological Chemistry 2013;288:15745-15759. 214. Kuphal S, Spangler B, Bosserhoff AK. Cell adhesion dependent regulation of the transcription factor c-Jun in melanoma. Experimental Dermatology 2011;20:195-195. 215. Lee SI, Boyle DL, Firestein GS. Regulation of Inflammatory Arthritis by the Upstream Kinase MKK7 in the c-Jun N-Terminal Kinase (JNK) Pathway. Arthritis and Rheumatism 2011;63:S442-S442. 216. Uz YH, Murk W, Bozkurt I, et al. Increased c-Jun N-terminal kinase activation in human endometriotic endothelial cells. Histochemistry and Cell Biology 2011;135:83-91. 217. Ma J, Zhang L, Han WN, et al. Activation of JNK/c-Jun is required for the proliferation, survival, and angiogenesis induced by EET in pulmonary artery endothelial cells. Journal of Lipid Research 2012;53:1093-1105. 218. Leonard DA, Rajaram N, Kerppola TK. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun. Proceedings of the National Academy of Sciences of the United States of America 1997;94:4913-4918. 219. Mayr BM, Guzman E, Montminy M. Glutamine rich and basic region/leucine zipper (bZIP) domains stabilize cAMP-response element-binding protein (CREB) binding to chromatin. Journal of Biological Chemistry 2005;280:15103-15110. 220. Cao S, Zeng Z, Wang X, et al. Pravastatin slows the progression of heart failure by inhibiting the c-Jun N-terminal kinase-mediated intrinsic apoptotic signaling pathway. Mol Med Rep 2013;8:1163-8. 221. Sabapathy K. Role of the JNK Pathway in Human Diseases. Protein Phosphorylation in Health and Disease 2012;106:145-169. 222. Qian HJ, Li ZL, Jiao BM, et al. [The influence of JNK inhibitor on hemodynamics after ischemia/reperfusion injury to the heart in rats]. Zhongguo Wei Zhong Bing Ji Jiu Yi Xue 2008;20:727-9. 223. Petrich BG, Eloff BC, Lerner DL, et al. Targeted activation of c-Jun N-terminal kinase in vivo induces restrictive cardiomyopathy and conduction defects. J Biol Chem 2004;279:15330-8. 224. Wang LH, Besirli CG, Johnson EM. Mixed-lineage kinases: A target for the prevention of neurodegeneration. Annual Review of Pharmacology and Toxicology 2004;44:451-474. 225. Bubici C, Papa S. JNK signalling in cancer: in need of new, smarter therapeutic targets. Br J Pharmacol 2014;171:24-37. 226. Reynolds CH, Gibb GM, Nebreda AR, et al. The stress-activated kinases JNK/SAPK and P38/RK phosphorylate tau protein. Faseb Journal 1997;11:A1005-A1005.

273

227. Gao K, Chai RC, Jiang F, et al. Calcium up-regulates GFAP in activated astrocytes through JNK/c-Jun/AP-1 signaling pathway. Journal of Neuroscience Research 2013;91:1102- 1103. 228. Khachigian LM, Fahmy RG, Zhang GS, et al. c-Jun regulates vascular smooth muscle cell growth and neointima formation after arterial injury - Inhibition by a novel DNA enzyme targeting c-Jun. Journal of Biological Chemistry 2002;277:22985-22991. 229. Seifert G, Taube T, Paal K, et al. Brief communication: Stability and catalytic activity of novel circular DNAzymes. Nucleosides Nucleotides & Nucleic Acids 2006;25:785-793. 230. Seifert GJ, Taube T, Wellmann S, et al. Overexpression of VEGF mRNA and protein in malignant tumors can be downregulated with DNAzymes. Blood 2002;100:198b-198b. 231. Achenbach JC, Chiuman W, Cruz RPG, et al. DNAzymes: From creation in vitro to application in vivo. Current Pharmaceutical Biotechnology 2004;5:321-336. 232. Luo X, Cai H, Ni J, et al. c-Jun DNAzymes Inhibit Myocardial Inflammation, ROS Generation, Infarct Size, and Improve Cardiac Function After Ischemia-Reperfusion Injury. Arteriosclerosis Thrombosis and Vascular Biology 2009;29:1836-U282. 233. Reyes-Darias JA, Berzal-Herranz A. Detection of immune response activation by exogenous nucleic acids by a multiplex RT-PCR method. Molecular and Cellular Probes 2014;28:181-185. 234. Opalinska JB, Gewirtz AM. Nucleic-acid therapeutics: Basic principles and recent applications. Nature Reviews Drug Discovery 2002;1:503-514. 235. Rintisch C, Heinig M, Bauerfeind A, et al. Natural variation of histone modification and its impact on gene expression in the rat genome. Genome Research 2014;24:942-953. 236. Shiraishi T, Nielsen PE. Cellular Delivery of Peptide Nucleic Acids (PNAs). Peptide Nucleic Acids: Methods and Protocols, 2nd Edition 2014;1050:193-205. 237. Bhindi R, Fahmy RG, Lowe HC, et al. Brothers in arms - DNA enzymes, short interfering RNA, and the emerging wave of small-molecule nucleic acid-based gene-silencing strategies. American Journal of Pathology 2007;171:1079-1088. 238. Koli U, Krishnan RA, Pofali P, et al. siRNA-Based Therapies for Pulmonary Diseases. Journal of Biomedical Nanotechnology 2014;10:1953-1997. 239. Claycomb JM. Ancient Endo-siRNA Pathways Reveal New Tricks. Current Biology 2014;24:R703-R715. 240. Sierant M, Janicka M, Yang X, et al. Chemically modified siRNA duplexes with improved biological potential. Journal of Biotechnology 2010;150:S32-S32. 241. McManus MT, Sharp PA. Gene silencing in mammals by small interfering RNAs. Nat Rev Genet 2002;3:737-47. 242. Liu HM, Qiao CM, Yang J, et al. Self-assembling doxorubicin-prodrug nanoparticles as siRNA drug delivery system for cancer treatment: in vitro and in vivo. Journal of Materials Chemistry B 2014;2:5910-5924. 243. Kuwahara H, Nishina K, Yoshida K, et al. EFFICIENT IN VIVO DELIVERY OF siRNA INTO BRAIN CAPILLARY ENDOTHELIAL CELLS ALONG WITH ENDOGENOUS LIPOPROTEIN. Journal of Gene Medicine 2014;16:231-231. 244. Luo YB, Mitrpant C, Adams AM, et al. Antisense Oligonucleotide Induction of Progerin in Human Myogenic Cells. Plos One 2014;9. 245. Akl MR, Ayoub NM. Tumor Cell Transformation Using Antisense Oligonucleotide. Cancer Vaccines: Methods and Protocols 2014;1139:259-268. 246. Eritja R, Terrazas M, Grijalvo S, et al. Challenges and Opportunities for Oligonucleotide- Based Therapeutics by Antisense and RNA Interference Mechanisms. Chemical Biology of Nucleic Acids: Fundamentals and Clinical Applications 2014:227-242. 247. Gupta N, Fisker N, Asselin MC, et al. A Locked Nucleic Acid Antisense Oligonucleotide (LNA) Silences PCSK9 and Enhances LDLR Expression In Vitro and In Vivo. Plos One 2010;5.

274

248. Marcussekura CJ, Woerner AM, Shinozuka K, et al. Comparative Inhibition of Chloramphenicol Acetyltransferase Gene-Expression by Antisense Oligonucleotide Analogs Having Alkyl Phosphotriester, Methylphosphonate and Phosphorothioate Linkages. Nucleic Acids Research 1987;15:5749-5763. 249. Crinelli R, Bianchi M, Gentilini L, et al. Locked nucleic acids (LNA): Versatile tools for designing oligonucleotide decoys with high stability and affinity. Current Drug Targets 2004;5:745-752. 250. Bolser DM, Filippis I, Stehr H, et al. Residue contact-count potentials are as effective as residue-residue contact-type potentials for ranking protein decoys. Bmc Structural Biology 2008;8. 251. Amini ZN, Olson KE, Muller UF. Spliceozymes: Ribozymes that Remove Introns from Pre- mRNAs in Trans. Plos One 2014;9. 252. Strobel SA. Riboswitches as ribozymes and riboregulators. Abstracts of Papers of the American Chemical Society 2013;245. 253. Ying GQ, Zhu FF, Yi Y, et al. Selecting DNA aptamers for endotoxin separation. Biotechnology Letters 2015;37:1601-1605. 254. Xi ZJ, Huang RR, Deng Y, et al. Progress in Selection and Biomedical Applications of Aptamers. Journal of Biomedical Nanotechnology 2014;10:3043-3062. 255. Veedu RN. Medicinal Chemistry of Aptamers. Current Topics in Medicinal Chemistry 2015;15:1065-1065. 256. Magbanua E, Hahn U. Aptamers as Molecular Smugglers. Chemical Biology of Nucleic Acids: Fundamentals and Clinical Applications 2014:271-292. 257. Small EM, Olson EN. Pervasive roles of microRNAs in cardiovascular biology. Nature 2011;469:336-342. 258. Kawamata T, Yoda M, Tomari Y. Multilayer checkpoints for microRNA authenticity during RISC assembly. Embo Reports 2011;12:944-949. 259. Matkovich SJ, Van Booven DJ, Eschenbacher WH, et al. RISC RNA Sequencing for Context-Specific Identification of In Vivo MicroRNA Targets. Circulation Research 2011;108:18-U50. 260. Kozubek J, Ma ZH, Fleming E, et al. In-Depth Characterization of microRNA Transcriptome in Melanoma. Plos One 2013;8. 261. Khare S, Zhang Q, Ibdah JA. Epigenetics of hepatocellular carcinoma: Role of microRNA. World Journal of Gastroenterology 2013;19:5439-5445. 262. Huang BR, Liu Y, Yang C, et al. Tumor Necrosis Factor-alpha Suppresses miR-29 and Up- regulates Fibrotic Genes in the Kidney. Hypertension 2013;62. 263. Letelier P, Garcia P, Leal P, et al. miR-1 and miR-145 act as tumor suppressor microRNAs in gallbladder cancer. International Journal of Clinical and Experimental Pathology 2014;7:1849-1867. 264. Aime A, Beztsinna N, Patwa A, et al. Quantum Dot Lipid Oligonucleotide Bioconjugates: Toward a New Anti-MicroRNA Nanoplatform. Bioconjugate Chemistry 2013;24:1345- 1355. 265. Bouchie A. First microRNA mimic enters clinic. Nature Biotechnology 2013;31:577-577. 266. Zhang H. Reversal of HIV-1 latency with anti-microRNA inhibitors. International Journal of Biochemistry & Cell Biology 2009;41:451-454. 267. Das S, Halushka MK. Extracellular vesicle microRNA transfer in cardiovascular disease. Cardiovascular Pathology 2015;24:199-206. 268. Chen WD, Li SJ. Role of circulating microRNA in pulmonary arterial hypertension associated with congenital cardiac shunts. Circulation 2012;125:E768-E768. 269. McLendon JM, Joshi SR, Abe K, et al. Role Of MicroRNA-204 In Arterial Smooth Muscle Phenotype In Pulmonary Hypertension. American Journal of Respiratory and Critical Care Medicine 2011;183.

275

270. Arunachalam G, Upadhyay R, Ding H, et al. MicroRNA Signature and Cardiovascular Dysfunction. Journal of Cardiovascular Pharmacology 2015;65:419-429. 271. Pillai RS. MicroRNA function: Multiple mechanisms for a tiny RNA? Rna-a Publication of the Rna Society 2005;11:1753-1761. 272. Danowski N, Frey U, Kottenberg-Assenmacher E, et al. Decreased expression of microRNA miR-133 but not miR-1 is associated with impaired cardiac performance. Faseb Journal 2009;23. 273. Luo XB, Lin HX, Pan ZW, et al. Down-regulation of miR-1/miR-133 contributes to re- expression of pacemaker channel genes HCN2 and HCN4 in hypertrophic heart (vol 283, pg 20045, 2008). Journal of Biological Chemistry 2011;286:28656-28656. 274. Belevych AE, Sansom SE, Terentyeva R, et al. Increased Levels of Micrornas miR-1 and miR-133 in Failing Heart Underlie Dissociation of Phosphatase Activity from RyR2 Complex Resulting in Enhanced RyR2 CaMKII-Dependent Phosphorylation and Cardiac Arrhythmias. Biophysical Journal 2011;100:560-561. 275. Li J, Liu FF, Zhang JL, et al. MiR-126: a valuable predictor for hypertensive heart failure. European Journal of Heart Failure 2014;16:325-325. 276. Zhang RJ. Investigation the Changes of the Plasma Mir-126 and Mir-143 in Patients with Coronary Heart Disease. Heart 2011;97. 277. Ren GW, Kang Y. A one-two punch of miR-126/126*against metastasis. Nature Cell Biology 2013;15:231-233. 278. Stefanowicz L, Adamski M, Wisniewski R, et al. Application of Hypergraphs to SMCs Selection. Technological Innovation for Collective Awareness Systems 2014;423:249-256. 279. Zhang XM, Azhar G, Williams ED, et al. MicroRNA Clusters in the Adult Mouse Heart: Age-Associated Changes. Biomed Research International 2015. 280. Ucuzian AA, Bufalino DV, Pang YG, et al. Angiogenic endothelial cell invasion into fibrin is stimulated by proliferating smooth muscle cells. Microvascular Research 2013;90:40-47. 281. Varinska L, Gal P, Mojzisova G, et al. Soy and Breast Cancer: Focus on Angiogenesis. International Journal of Molecular Sciences 2015;16:11728-11749. 282. Kang H, Davis-Dusenbery BN, Nguyen PH, et al. Bone Morphogenetic Protein 4 Promotes Vascular Smooth Muscle Contractility by Activating MicroRNA-21 (miR-21), which Down- regulates Expression of Family of Dedicator of Cytokinesis (DOCK) Proteins. Journal of Biological Chemistry 2012;287:3976-3986. 283. Zakari M, Gerton JL. The SMC loader Scc2 regulates gene expression. Cell Cycle 2015;14:943-943. 284. Rangrez AY, Massy ZA, Metzinger-Le Meuth V, et al. miR-143 and miR-145 Molecular Keys to Switch the Phenotype of Vascular Smooth Muscle Cells. Circulation- Cardiovascular Genetics 2011;4:197-205. 285. Song JW, Liu P, Yang ZS, et al. MiR-155 regulates c-Jun expression at the post- transcriptional level in human dermal fibroblasts in vitro. Journal of Dermatology 2012;39:79-79. 286. Kappelmann M, Spangler B, Bosserhoff AK, et al. Regulation of the transcription factor c- Jun in malignant melanoma. Experimental Dermatology 2012;21:e45-e45. 287. Kappelmann M, Bosserhoff A, Kuphal S. AP-1/c-Jun transcription factors: Regulation and function in malignant melanoma. European Journal of Cell Biology 2014;93:76-81. 288. Bhindi R, Khachigian LM, Lowe HC. Egr-1 targeting DNAzymes reduce myocardial infarct size following ischaemia-reperfusion. European Heart Journal 2006;27:409-409. 289. Khachigian LM. DNAzymes as molecular agents that manipulate Egr-1 gene expression. Biochemical Pharmacology 2004;68:1023-1025. 290. Santiago FS, Ishii H, Shafi S, et al. Yin Yang-1 inhibits vascular smooth muscle cell growth and intimal thickening by repressing p21(WAF1/Cip1) transcription and p21(WAF1/Cip1)-Cdk4-cyclin D1 assembly. Circulation Research 2007;101:146-155.

276

291. Silverman ES, Khachigian LM, Santiago FS, et al. Vascular smooth muscle cells express the transcriptional corepressor NAB2 in response to injury. American Journal of Pathology 1999;155:1311-1317. 292. Khachigian LM, Santiago FS, Rafty LA, et al. GC factor 2 represses platelet-derived growth factor A-chain gene transcription and is itself induced by arterial injury. Circulation Research 1999;84:1258-1267. 293. Shiraki T, Kondo S, Katayama S, et al. Cap analysis gene expression for high-throughput analysis of transcriptional starting point and identification of promoter usage. Proceedings of the National Academy of Sciences of the United States of America 2003;100:15776-15781. 294. Carninci P, Hayashizaki Y. High-efficiency full-length cDNA cloning. Methods Enzymol 1999;303:19-44. 295. Chanakira A, Dutta R, Charboneau R, et al. Hypoxia differentially regulates arterial and venous smooth muscle cell proliferation via PDGFR-beta and VEGFR-2 expression. American Journal of Physiology-Heart and Circulatory Physiology 2012;302:H1173- H1184. 296. Anderson EM, Birmingham A, Baskerville S, et al. Experimental validation of the importance of seed complement frequency to siRNA specificity. RNA 2008;14:853-61. 297. Wu Y, Han X, Benson JD, et al. Micromachined Coulter counter for dynamic impedance study of time sensitive cells. Biomed Microdevices 2012;14:739-50. 298. Sager P, Heilbraun J, Turner JR, et al. Assessment of drug-induced increases in blood pressure during drug development: Report from the Cardiac Safety Research Consortium. American Heart Journal 2013;165:477-488. 299. Martinez-Gonzalez J, Badimon L. The NR4A subfamily of nuclear receptors: new early genes regulated by growth factors in vascular cells. Cardiovasc Res 2005;65:609-18. 300. Sukhatme VP, Cao XM, Chang LC, et al. A zinc finger-encoding gene coregulated with c- fos during growth and differentiation, and after cellular depolarization. Cell 1988;53:37- 43. 301. Bhindi R, Khachigian LM, Lowe HC. DNAzymes targeting the transcription factor Egr-1 reduce myocardial infarct size following ischemia-reperfusion in rats. Journal of Thrombosis and Haemostasis 2006;4:1479-1483. 302. Khachigian LM. Early growth response-1: blocking angiogenesis by shooting the messenger. Cell Cycle 2004;3:10-1. 303. Abdel-Malak NA, Mofarrahi M, Mayaki D, et al. Early growth response-1 regulates angiopoietin-1-induced endothelial cell proliferation, migration, and differentiation. Arterioscler Thromb Vasc Biol 2009;29:209-16. 304. Khachigian LM. Early growth response-1 in cardiovascular pathobiology. Circ Res 2006;98:186-91. 305. Gupta AA, Chou RH, Li HC, et al. Structural insights into the interaction of human S100B and basic fibroblast growth factor (FGF2): Effects on FGFR1 receptor signaling. Biochimica Et Biophysica Acta-Proteins and Proteomics 2013;1834:2606-2619. 306. Zielinski C, Lanzavecchia A, Sallusto F. Differential requirement for IL-1beta for the generation of human microbiota specific TH17 cells. Allergy 2011;66:53-53. 307. Bools LM, Fisher RK, Grandas OH, et al. Comparative analysis of polymers for short interfering RNA delivery in vascular smooth muscle cells. J Surg Res 2015. 308. Hasan RN, Schafer AI. Hemin upregulates Egr-1 expression in vascular smooth muscle cells via reactive oxygen species ERK-1/2-Elk-1 and NF-kappa B. Circulation Research 2008;102:42-50. 309. Patrikakis M. RESPONSE CURVE FOR FGF2 AND IL-1B, 2012.

277

310. Smith P. The effect of passage number on the stimulation by hypoxia of growth and sprouting activity in cultured aortic endothelium from the rat. Int J Exp Pathol 1990;71:479-84. 311. Lowe HC, Fahmy RG, Kavurma MM, et al. Catalytic oligodeoxynucleotides define a key regulatory role for early growth response factor-1 in the porcine model of coronary in- stent restenosis. Circulation Research 2001;89:670-677. 312. Fahmy RG, Dass CR, Sun LQ, et al. Transcription factor Egr-1 supports FGF-dependent angiogenesis during neovascularization and tumor growth. Nature Medicine 2003;9:1026-1032. 313. Santiago FS, Lowe HC, Kavurma MM, et al. New DNA enzyme targeting Egr-1 mRNA inhibits vascular smooth muscle proliferation and regrowth after injury. Nat Med 1999;5:1438. 314. Lowe HC, Chesterman CN, Khachigian LM. Catalytic antisense DNA molecules targeting Egr-1 inhibit neointima formation following permanent ligation of rat common carotid arteries. Thrombosis and Haemostasis 2002;87:134-140. 315. Kurosawa J, Nishiyori H, Hayashizaki Y. Deep Cap Analysis of Gene Expression. Pcr Protocols, Third Edition 2011;687:147-163. 316. de Hoon M, Hayashizaki Y. Deep cap analysis gene expression (CAGE): genome-wide identification of promoters, quantification of their expression, and network inference. Biotechniques 2008;44:627-+. 317. Schwegmann A, Brombacher F. Host-directed drug targeting of factors hijacked by pathogens. Sci Signal 2008;1:re8. 318. Asano T, Nishiuchi T. Quantitative phosphoproteomic analysis using iTRAQ method. Methods Mol Biol 2014;1171:251-8. 319. Miyoshi T, Yuan ZB, Shi WB. Association of a Vcam1 mutation with atherosclerosis susceptibility in diet-induced models of atherosclerosis. Atherosclerosis 2008;196:234- 239. 320. Jackson AL, Linsley PS. Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application. Nature Reviews Drug Discovery 2010;9:57-67. 321. Kaiura TL, Itoh H, Kubaska SM, et al. The effect of growth factors, cytokines, and extracellular matrix proteins on fibronectin production in human vascular smooth muscle cells. Journal of Vascular Surgery 2000;31:577-584. 322. Khachigian LM, Lindner V, Williams AJ, et al. Egr-1-induced endothelial gene expression: A common theme in vascular injury. Science 1996;271:1427-1431. 323. Saben JL, Andres A, Borengasser S, et al. Early growth response protein 1 (EGR1) regulates pro-inflammatory gene expression in response to palmitate and TNFa in human placenta cells and is induced in obese placenta. Faseb Journal 2013;27. 324. Makki N, Thiel KW, Miller FJ. The Epidermal Growth Factor Receptor and Its Ligands in Cardiovascular Disease. International Journal of Molecular Sciences 2013;14:20597- 20613. 325. Wakabayashi Y, Usui Y, Okunuki Y, et al. Correlation of Vascular Endothelial Growth Factor with Chemokines in the Vitreous in Diabetic Retinopathy. Retina-the Journal of Retinal and Vitreous Diseases 2010;30:339-344. 326. Lin YC, Chen LH, Varadharajan T, et al. Resveratrol inhibits glucose-induced migration of vascular smooth muscle cells mediated by focal adhesion kinase. Molecular Nutrition & Food Research 2014;58:1389-1401. 327. Le Clainche C, Carlier MF. Regulation of actin assembly associated with protrusion and adhesion in cell migration. Physiological Reviews 2008;88:489-513. 328. Mattila PK, Lappalainen P. Filopodia: molecular architecture and cellular functions. Nature Reviews Molecular Cell Biology 2008;9:446-454.

278

329. Cermak V, Kosla J, Plachy J, et al. The transcription factor EGR1 regulates metastatic potential of v-src transformed sarcoma cells. Cellular and Molecular Life Sciences 2010;67:3557-3568. 330. Yau L, Litchie B, Thomas S, et al. Endogenous mono-ADP-ribosylation mediates smooth muscle cell proliferation and migration via protein kinase N-dependent induction of c-fos expression. European Journal of Biochemistry 2003;270:101-110. 331. Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function (Reprinted from Cell, vol 116, pg 281-297, 2004). Cell 2007;131:11-29. 332. Pratt AJ, MacRae IJ. The RNA-induced Silencing Complex: A Versatile Gene-silencing Machine. Journal of Biological Chemistry 2009;284:17897-17901. 333. Valencia-Sanchez MA, Liu JD, Hannon GJ, et al. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes & Development 2006;20:515-524. 334. Sayed D, Abdellatif M. Micrornas in Development and Disease. Physiological Reviews 2011;91:827-887. 335. Catalucci D, Gallo P, Condorelli G. MicroRNAs in Cardiovascular Biology and Heart Disease. Circulation-Cardiovascular Genetics 2009;2:402-408. 336. Urbich C, Kuehbacher A, Dimmeler S. Role of microRNAs in vascular diseases, inflammation, and angiogenesis. Cardiovascular Research 2008;79:581-588. 337. Leventaki V, Drakos E, Karanikou M, et al. c-JUN N-terminal kinase (JNK) is activated and contributes to tumor cell proliferation in classical Hodgkin lymphoma. Hum Pathol 2014;45:565-72. 338. Papachristou DJ, Batistatou A, Sykiotis GP, et al. Activation of the JNK-AP-1 signal transduction pathway is associated with pathogenesis and progression of human osteosarcomas. Bone 2003;32:364-371. 339. Kappelmann M, Kuphal S, Meister G, et al. Expression of c-Jun protein, a main driver of melanoma progression, is directly regulated by miR-125b. Journal Der Deutschen Dermatologischen Gesellschaft 2013;11:943-943. 340. Juranic ZD, Stanojkovic TP, Stanojevic-Bakic N, et al. Lyophilized whole human melanoma cells stimulate human PBMC proliferation and enhance suppressive action of PBMC toward survival of the same malignant cell line in vitro. Neoplasma 1999;46:224-30. 341. Dunn C, Wiltshire C, MacLaren A, et al. Molecular mechanism and biological functions of c-Jun N-terminal kinase signalling via the c-Jun transcription factor. Cellular Signalling 2002;14:585-593. 342. Kidambi S, Yarmush J, Fong W, et al. Propofol induces ERK-dependant expression of c- Fos and Egr-1 in neuronal cells. Neuroreport 2009;20:657-662. 343. Chan QKY, Lam HM, Ng CF, et al. Activation of GPR30 inhibits the growth of prostate cancer cells through sustained activation of Erk1/2, c-jun/c-fos-dependent upregulation of p21, and induction of G(2) cell-cycle arrest. Cell Death and Differentiation 2010;17:1511-1523. 344. Zhou XP, Hua L, Zhang WJ, et al. FRK controls migration and invasion of human glioma cells by regulating JNK/c-Jun signaling. Journal of Neuro-Oncology 2012;110:9-19. 345. Hashiramoto A, Mizukami H, Yamashita T. Ganglioside GM3 promotes cell migration by regulating MAPK and c-Fos/AP-1. Oncogene 2006;25:3948-3955. 346. Buchegger F, Dupertuis YM, Perillo-Adamer F. A pitfall of propidium iodide staining in fluorescence-activated cell sorting cell cycle analysis? Cancer Res 2007;67:5576-7; author reply 5577. 347. Kalejta RF, Brideau AD, Banfield BW, et al. An integral membrane green fluorescent protein marker, Us9-GFP, is quantitatively retained in cells during propidium iodide- based cell cycle analysis by flow cytometry. Exp Cell Res 1999;248:322-8.

279

348. Yoshizawa-Sugata N, Masai H. Cell Cycle Synchronization and Flow Cytometry Analysis of Mammalian Cells. Cell Cycle Control: Mechanisms and Protocols, 2nd Edition 2014;1170:279-293. 349. Zhang L, Ye DX, Pan HY, et al. Yes-associated protein promotes cell proliferation by activating Fos Related Activator-1 in oral squamous cell carcinoma. Oral Oncology 2011;47:693-697. 350. Catto JWF, Alcaraz A, Bjartell AS, et al. MicroRNA in Prostate, Bladder, and Kidney Cancer: A Systematic Review. European Urology 2011;59:671-681. 351. Zhang YL, Liang J, Sun LJ, et al. Inhibition of PP2A and the consequent activation of JNK/c-Jun are involved in tributyltin-induced apoptosis in human amnionic cells. Environmental Toxicology 2013;28:390-400. 352. Cannell IG, Kong YW, Bushell M. How do microRNAs regulate gene expression? Biochemical Society Transactions 2008;36:1224-1231. 353. Olszewska M, Bujarski JJ, Kurpisz M. P-bodies and their functions during mRNA cell cycle: Mini-review. Cell Biochemistry and Function 2012;30:177-182. 354. Zhou QQ, Verne GN. Role of microRNA in chronic visceral nociception. Pain 2013;154:9- 10. 355. Bach CTT, Schevzov G, Bryce NS, et al. Tropomyosin isoform modulation of focal adhesion structure and cell migration. Cell Adhesion & Migration 2010;4:226-234. 356. Flaiz C, Hanemann OC. Like to move it? Actin-rich protrusions, migration and adhesion in schwannoma, a benign tumour of the nervous system. Neuropathology and Applied Neurobiology 2007;33:259-259. 357. Dalby MJ, Gadegaard N, Riehle MO, et al. Investigating filopodia sensing using arrays of defined nano-pits down to 35 nm diameter in size. International Journal of Biochemistry & Cell Biology 2004;36:2005-2015. 358. Liang CC, Park AY, Guan JL. In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nature Protocols 2007;2:329-333. 359. Golias CH, Charalabopoulos A, Charalabopoulos K. Cell proliferation and cell cycle control: a mini review. International Journal of Clinical Practice 2004;58:1134-1141. 360. Tay DLM, Hoffbrand AV, Wickremasinghe RG. Expression of c-fos and c-jun proteins and AP-1 binding activity during cell cycle progression of HL60 cells and phytohemagglutinin- stimulated lymphocytes. Experimental Hematology 1996;24:277-284. 361. Nyholm AM, Holst LMB, Lerche C, et al. miR-125b induces cellular senescence in melanocytes and malignant melanoma. Journal of Investigative Dermatology 2011;131:S107-S107. 362. Le MTN, Teh C, Shyh-Chang N, et al. MicroRNA-125b is a novel negative regulator of p53. Genes & Development 2009;23:862-876. 363. Stanczyk J, Pedrioli DAL, Brentano F, et al. Altered expression of microRNA in synovial fibroblasts and synovial tissue in rheumatoid arthritis. Arthritis and Rheumatism 2008;58:1001-1009. 364. Vigorito E, Perks KL, Abreu-Goodger C, et al. MicroRNA-155 regulates the generation of immunoglobulin class-switched plasma cells. Immunity 2007;27:847-859. 365. Yaar M, Gilchrest BA. Photoageing: mechanism, prevention and therapy. British Journal of Dermatology 2007;157:874-887. 366. Fisher GJ, Kang SW, Varani J, et al. Mechanisms of photoaging and chronological skin aging. Archives of Dermatology 2002;138:1462-1470. 367. Angel P, Karin M. The Role of Jun, Fos and the Ap-1 Complex in Cell-Proliferation and Transformation. Biochimica Et Biophysica Acta 1991;1072:129-157. 368. Leppa S, Eriksson M, Saffrich R, et al. Complex functions of AP-1 transcription factors in differentiation and survival of PC12 cells. Molecular and Cellular Biology 2001;21:4369- 4378.

280

369. Chen SH, Lin JK, Liang YC, et al. Involvement of activating transcription factors JNK, NF- kappa B, and AP-1 in apoptosis induced by pyrrolidine dithiocarbamate/Cu complex. European Journal of Pharmacology 2008;594:9-17. 370. Cox B. Ion Channel Drug Discovery: a Historical Perspective. Ion Channel Drug Discovery 2015:1-15. 371. Chatterjee AK. Cell-Based Medicinal Chemistry Optimization of High-Throughput Screening (HTS) Hits for Orally Active Antimalarials. Part 1: Challenges in Potency and Absorption, Distribution, Metabolism, Excretion/Pharmacokinetics (ADME/PK). Journal of Medicinal Chemistry 2013;56:7741-7749. 372. Younis Y, Street LJ, Waterson D, et al. Cell-Based Medicinal Chemistry Optimization of High Throughput Screening Hits for Orally Active Antimalarials. Part 2: Hits from SoftFocus Kinase and other Libraries. Journal of Medicinal Chemistry 2013;56:7750- 7754. 373. Zanders ED. The Science and Business of Drug Discovery Introduction. Science and Business of Drug Discovery: Demystifying the Jargon 2011:1-7. 374. Rydzewski RM. The Drug Discovery Business to Date. Real World Drug Discovery: A Chemist's Guide to Biotech and Pharmaceutical Research 2008:1-52. 375. Hopkins AL, Keseru GM, Leeson PD, et al. The role of ligand efficiency metrics in drug discovery. Nature Reviews Drug Discovery 2014;13:105-121. 376. Song Y, Dhodda R, Zhang J, et al. A high efficiency, high quality and low cost internal regulated bioanalytical laboratory to support drug development needs. Bioanalysis 2014;6:1295-1309. 377. Burke M. Drug discovery Novel dementia target. Chemistry & Industry 2014;78:15-15. 378. Kawahara R, Hiruma W. New Development of Drug Discovery Research -Novel Molecular Target and Novel Strategy- Foreword. Yakugaku Zasshi-Journal of the Pharmaceutical Society of Japan 2014;134:687-688. 379. Labots M, Buffart TE, Haan JC, et al. High-level copy number gains of established and potential drug target genes in gastric cancer as a lead for treatment development and selection. Cellular Oncology 2014;37:41-52. 380. Sinha A, Ahmad F, Hassan MI. Structure Based Functional Annotation of Putative Conserved Proteins from Treponema pallidum: Search for a Potential Drug Target. Letters in Drug Design & Discovery 2015;12:46-59. 381. Bocker A, Schaertl S, Hess SD. High-Throughput Screening. Ion Channel Drug Discovery 2015:16-41. 382. Zhang QT, Tu ZC, Wang H, et al. A high throughput screening assay for identifying glycation inhibitors on MALDI-TOF target. Food Chemistry 2015;170:160-168. 383. Vunjak-Novakovic G. Cardiac Tissue Engineering for Modeling of Disease and Drug Screening. Tissue Engineering Part A 2014;20:S43-S43. 384. Moffat JG, Rudolph J, Bailey D. Phenotypic screening in cancer drug discovery - past, present and future. Nature Reviews Drug Discovery 2014;13:588-602. 385. Matsui H. Support of drug development and clinical research using imaging technology. Journal of Physiological Sciences 2013;63:S104-S104. 386. Binkowski TA, Jiang W, Roux B, et al. Virtual High-Throughput Ligand Screening. Structural Genomics and Drug Discovery: Methods and Protocols 2014;1140:251-261. 387. Korth M. Large-scale virtual high-throughput screening for the identification of new battery electrolyte solvents: evaluation of electronic structure theory methods. Physical Chemistry Chemical Physics 2014;16:7919-7926. 388. Bourget P, Amin A, Chandesris MO, et al. Liquid chromatography-tandem mass spectrometry assay for therapeutic drug monitoring of the tyrosine kinase inhibitor, midostaurin, in plasma from patients with advanced systemic mastocytosis. Journal of

281

Chromatography B-Analytical Technologies in the Biomedical and Life Sciences 2014;944:175-181. 389. Yuan C, Chen D, Wang SH. Drug confirmation by mass spectrometry: Identification criteria and complicating factors. Clinica Chimica Acta 2015;438:119-125. 390. Miller RA, Spellman DS. Mass Spectrometry-Based Biomarkers in Drug Development. Advancements of Mass Spectrometry in Biomedical Research 2014;806:341-359. 391. Rhodes DR, Chinnaiyan AM. Integrative analysis of the cancer transcriptome. Nature Genetics 2005;37:S31-S37. 392. Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols 2009;4:44-57. 393. Ding YB, Yang M, She S, et al. iTRAQ-based quantitative proteomic analysis of cervical cancer. International Journal of Oncology 2015;46:1748-1758. 394. Sun YT, Hu BL, Fan CF, et al. iTRAQ-based quantitative subcellular proteomic analysis of Avibirnavirus-infected cells. Electrophoresis 2015;36:1596-1611. 395. Sumimoto H, Imabayashi F, Iwata T, et al. The BRAF-MAPK signaling pathway is essential for cancer-immune evasion in human melanoma cells. Journal of Experimental Medicine 2006;203:1651-1656. 396. Valencak J, Schmid K, Mastan P, et al. The prognostic relevance of the expression of mTOR signalling pathway markers in melanoma patients. Journal of Investigative Dermatology 2009;129:S142-S142. 397. Bales E, Mills L, Milam N, et al. The low molecular weight cyclin E isoforms augment angiogenesis and metastasis of human melanoma cells in vivo. Cancer Research 2005;65:692-697. 398. Alla V, Engelmann D, Niemetz A, et al. E2F1 in Melanoma Progression and Metastasis. Journal of the National Cancer Institute 2010;102:127-133. 399. Gao S, Ma JJ, Lu C. Prognostic value of cyclin E expression in breast cancer: a metaanalysis. Tumor Biology 2013;34:3423-3430. 400. Lu K, Shih C, Teicher BA. Expression of pRB, cyclin/cyclin-dependent kinases and E2F1/DP-1 in human tumor lines in cell culture and in xenograft tissues and response to cell cycle agents. Cancer Chemotherapy and Pharmacology 2000;46:293-304. 401. Szeberenyi J. Problem-Solving Test: E2F: A family of S Phase Regulating Transcription Factors. Biochemistry and Molecular Biology Education 2014;42:88-90. 402. Carvalho F, Welbourn W, Reid J, et al. Evidence for a Cell Cycle Proliferation "Field Effect" in Prostate Cancer. Journal of Urology 2013;189:E605-E605. 403. Dar AA, Majid S, Rittsteuer C, et al. The Role of miR-18b in MDM2-p53 Pathway Signaling and Melanoma Progression. Jnci-Journal of the National Cancer Institute 2013;105:433- 442. 404. Radeljak SE, Seiwerth S, Sikiric P. BPC157 inhibits cell growth and VEGF signaling via MAPK pathway in human melanoma cell line. Faseb Journal 2004;18:A589-A589. 405. Huang YC, Liu KC, Chiou YL, et al. Fenofibrate suppresses melanogenesis in B16-F10 melanoma cells via activation of the p38 mitogen-activated protein kinase pathway. Chemico-Biological Interactions 2013;205:157-164. 406. Joao A. Paulo1∗, Fiona E. McAllister1∗, Robert A. Everley1, Sean A. Beausoleil2, Alexander S. Banks3 and Steven P. Gygi1. Effects of MEK inhibitors GSK1120212 and PD0325901 in vivo using 10-plex quantitative proteomics and phosphoproteomics. Proteomics 2015:462-473. 407. Wang H, Ye Y, Chu JH, et al. Oridonin induces G2/M cell cycle arrest and apoptosis through MAPK and p53 signaling pathways in HepG2 cells. Oncology Reports 2010;24:647-651. 408. Wu GS. The functional interactions between the p53 and MAPK signaling pathways. Cancer Biology & Therapy 2004;3:156-161.

282

409. Mendoza MC, Er EE, Blenis J. The Ras-ERK and PI3K-mTOR pathways: cross-talk and compensation. Trends in Biochemical Sciences 2011;36:320-328. 410. Hosseini H, Rajabibazl M, Ebrahimizadeh W, et al. Inhibiting angiogenesis with human single-chain variable fragment antibody targeting VEGF. Microvascular Research 2015;97:13-18. 411. Fang Y, Wang YH, Wang YL, et al. A new tumour suppression mechanism by p27(KiP1): EGFR down-regulation mediated by JNK/c-Jun pathway inhibition. Biochemical Journal 2014;463:383-392. 412. Ma L, Shen CA, Chai JK, et al. Extracellular Signal-Regulated Kinase-Mammalian Target of Rapamycin Signaling and Forkhead-Box Transcription Factor 3a Phosphorylation Are Involved in Testosterone's Effect on Severe Burn Injury in a Rat Model. Shock 2015;43:85-91. 413. O'Donnell A, Odrowaz Z, Sharrocks AD. Immediate-early gene activation by the MAPK pathways: what do and don't we know? Biochemical Society Transactions 2012;40:58- 66. 414. Tullai JW, Schaffer ME, Mullenbrock S, et al. Immediate-early and delayed primary response genes are distinct in function and genomic architecture. Journal of Biological Chemistry 2007;282:23981-23995. 415. Rosenbluth JM, Pietenpol JA. mTOR regulates autophagy-associated genes downstream of p73. Autophagy 2009;5:114-116. 416. Benson VL, Khachigian LM, Lowe HC. DNAzymes and cardiovascular disease. British Journal of Pharmacology 2008;154:741-748. 417. Healy S, Khan P, Davie JR. Immediate early response genes and cell transformation. Pharmacology & Therapeutics 2013;137:64-77. 418. Khachigian LM. Immediate-early genes as master regulators in cancer and other vascular disease. International Journal of Molecular Medicine 2009;24:S77-S77. 419. Hayashizaki Y. Cap Analysis Gene Expression (CAGE). Cap-Analysis Gene Expression (Cage): The Science of Decoding Gene Transcription 2010:1-5. 420. Murphy LO, Smith S, Chen RH, et al. Molecular interpretation of ERK signal duration by immediate early gene products. Nature Cell Biology 2002;4:556-564. 421. Catar R, Witowski J, Wagner P, et al. The proto-oncogene c-Fos transcriptionally regulates VEGF production during peritoneal inflammation. Kidney International 2013;84:1119-1128. 422. Takeda E, Taketani Y, Nashiki K, et al. A novel function of phosphate-mediated intracellular signal transduction pathways. Advances in Enzyme Regulation, Vol 46, Proceedings 2006;46:154-161. 423. Hayoz D, Weber R, Brunner HR. Prevention of Vascular Remodeling in Cardiovascular- Disease. Cardiology 1995;86:23-29. 424. Song J, Liu P, Yang Z, et al. MiR-155 negatively regulates c-Jun expression at the post- transcriptional level in human dermal fibroblasts in vitro: implications in UVA irradiation- induced photoaging. Cell Physiol Biochem 2012;29:331-40. 425. Palma CA, Al Sheikha D, Lim TK, et al. MicroRNA-155 as an inducer of apoptosis and cell differentiation in Acute Myeloid Leukaemia. Molecular Cancer 2014;13. 426. Chen YX, Stallings RL. Differential patterns of microRNA expression in neuroblastoma are correlated with prognosis, differentiation, and apoptosis. Cancer Research 2007;67:976- 983. 427. Herranz H, Cohen SM. MicroRNAs and gene regulatory networks: managing the impact of noise in biological systems. Genes & Development 2010;24:1339-1344. 428. Hornstein E, Shomron N. Canalization of development by microRNAs. Nature Genetics 2006;38:S20-S24.

283

429. Levine E, McHale P, Levine H. Small regulatory RNAs may sharpen spatial expression patterns. Plos Computational Biology 2007;3:2356-2365. 430. Reinhart BJ, Slack FJ, Basson M, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 2000;403:901-906. 431. Wagner EF. AP-1 (Fos/Jun) and cancer. Febs Journal 2006;273:21-22. 432. Segura MF, Greenwald HS, Hanniford D, et al. MicroRNA and cutaneous melanoma: from discovery to prognosis and therapy. Carcinogenesis 2012;33:1823-1832. 433. Williams Z, Ben-Dov IZ, Elias R, et al. Comprehensive profiling of circulating microRNA via small RNA sequencing of cDNA libraries reveals biomarker potential and limitations. Proceedings of the National Academy of Sciences of the United States of America 2013;110:4255-4260. 434. Sanchez-Diaz PC, Hsiao TH, Chang JC, et al. De-Regulated MicroRNAs in Pediatric Cancer Stem Cells Target Pathways Involved in Cell Proliferation, Cell Cycle and Development. Plos One 2013;8. 435. Asundi J, Lacap JA, Clark S, et al. MAPK Pathway Inhibition Enhances the Efficacy of an Anti-Endothelin B Receptor Drug Conjugate by Inducing Target Expression in Melanoma. Molecular Cancer Therapeutics 2014;13:1599-1610. 436. Role of PI3K/PTEN/AKT and mTOR pathway genes for the prediction of clinical outcome in esophageal cancer? Pharmacogenomics 2009;10:1222-1223. 437. Aboud M, Schavinsky-Khrapunsky Y, Torgeman A. PKC-activated c-Jun coordinates a shuttle of an Sp1-p53 complex between the Sp1 sites of HTLV-I LTR and the p21WAF-1 promoter in TPA-treated T-cells. Aids Research and Human Retroviruses 2003;19:S56- S56. 438. Shin SY, Kim JH, Baker A, et al. Transcription Factor Egr-1 Is Essential for Maximal Matrix Metalloproteinase-9 Transcription by Tumor Necrosis Factor alpha. Molecular Cancer Research 2010;8:507-519. 439. Shin SY, Bahk YY, Ko J, et al. Suppression of Egr-1 transcription through targeting of the serum response factor by oncogenic H-Ras. Embo Journal 2006;25:1093-1103. 440. Kim DH, Rossi JJ. Strategies for silencing human disease using RNA interference. Nat Rev Genet 2007;8:173-84. 441. Petersen EJ, Miyoshi T, Yuan Z, et al. siRNA silencing reveals role of vascular cell adhesion molecule-1 in vascular smooth muscle cell migration. Atherosclerosis 2008;198:301-6. 442. Luo YC, Wang Q. Zein-Based Micro- and Nano-Particles for Drug and Nutrient Delivery: A Review. Journal of Applied Polymer Science 2014;131. 443. Elkin M, Vlodavsky I. Tail vein assay of cancer metastasis. Curr Protoc Cell Biol 2001;Chapter 19:Unit 19 2. 444. Kucerova L, Skolekova S, Demkova L, et al. Long-term efficiency of mesenchymal stromal cell-mediated CD-MSC/5FC therapy in human melanoma xenograft model. Gene Therapy 2014;21:874-887. 445. Li Z, Xiang J, Zhang W, et al. Nanoparticle delivery of anti-metastatic NM23-H1 gene improves chemotherapy in a mouse tumor model. Cancer Gene Ther 2009;16:423-9. 446. Abety AN, Fox JW, Schonefuss A, et al. Stromal Fibroblast-Specific Expression of ADAM-9 Modulates Proliferation and Apoptosis in Melanoma Cells In Vitro and In Vivo. Journal of Investigative Dermatology 2012;132:2451-2458. 447. Riedl J, Crevenna AH, Kessenbrock K, et al. Lifeact: a versatile marker to visualize F-actin. Nature Methods 2008;5:605-607. 448. Friedl P. Dynamic imaging of cellular interactions with extracellular matrix. Histochemistry and Cell Biology 2004;122:183-190. 449. Luo J, Solimini NL, Elledge SJ. Principles of Cancer Therapy: Oncogene and Non-oncogene Addiction. Cell 2009;136:823-837.

284

450. Demirovic D, Rattan SI. Establishing cellular stress response profiles as biomarkers of homeodynamics, health and hormesis. Exp Gerontol 2013;48:94-8. 451. Mallikarjuna K, Pushparaj V, Biswas J, et al. Expression of insulin-like growth factor receptor (IGF-1R), c-Fos, and c-Jun in uveal melanoma: An immunohistochemical study. Current Eye Research 2006;31:875-883. 452. Kaelin WG. The concept of synthetic lethality in the context of anticancer therapy. Nature Reviews Cancer 2005;5:689-698. 453. Fulda S. Cell Death and Survival Signaling in Oncogenesis. Klinische Padiatrie 2010;222:340-344. 454. Karp NA, Huber W, Sadowski PG, et al. Addressing Accuracy and Precision Issues in iTRAQ Quantitation. Molecular & Cellular Proteomics 2010;9:1885-1897. 455. McCracken JA, Gin AD, Campbell I, et al. Melanoma in a Rural Australia, a Retrospective 10 Year Audit of Diagnosis and Management in the Wimmera. Asia-Pacific Journal of Clinical Oncology 2014;10:149-149.

285