Functional and Activity Analysis of Cattle UCP3 Promoter with Mrfs-Related Factors

International Journal of Molecular Sciences

Article Functional and Activity Analysis of Cattle UCP3 Promoter with MRFs-Related Factors

Wei Chen 1,2,3, Houqiang Xu 1,2,*, Xiang Chen 1,2, Zhongwei Liu 3, Wen Zhang 1 and Dan Xia 1,2

1 Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Guizhou University, Guiyang 550025, China; [email protected] (W.C.); [email protected] (X.C.); [email protected] (W.Z.); [email protected] (D.X.) 2 College of Animal Science, Guizhou University, Guiyang 550025, China 3 College of Life Science, Guizhou University, Guiyang 550025, China; [email protected] * Correspondence: [email protected]; Tel.: +86-851-8829-2183

Academic Editor: Constantinos Stathopoulos Received: 27 March 2016; Accepted: 13 April 2016; Published: 5 May 2016

Abstract: Uncoupling protein 3 (UCP3) is mainly expressed in muscle. It plays an important role in muscle, but less research on the regulation of cattle UCP3 has been performed. In order to elucidate whether cattle UCP3 can be regulated by muscle-related factors, deletion of cattle UCP3 promoter was ampliﬁed and cloned into pGL3-basic, pGL3-promoter and PEGFP-N3 vector, respectively, then transfected into C2C12 myoblasts cells and UCP3 promoter activity was measured using the dual-Luciferase reporter assay system. The results showed that there is some negative-regulatory element from ´620 to ´433 bp, and there is some positive-regulatory element between ´433 and ´385 bp. The fragment (1.08 kb) of UCP3 promoter was cotransfected with muscle-related transcription factor myogenic regulatory factors (MRFs) and myocyte-specific enhancer factor 2A (MEF2A). We found that UCP3 promoter could be upregulated by Myf5, Myf6 and MyoD and downregulated by MyoG and MEF2A.

Keywords: uncoupling protein 3 (UCP3); promoter; transcriptional activity; MRFs family; myocyte-speciﬁc enhancer factor 2A (MEF2A)

1. Introduction Uncoupling protein 3 (UCP3) is a member of the family of uncoupling proteins (UCPs), which are members of the mitochondrial anion carrier family. UCPs consist of seven members: UCP1, UCP2, UCP3, UCP4, BMCP1 (brainmitochondrial carrier protein 1), StUCP (plant UCP homologs have been identified in Solanum tuberosum) and AtUCP (Arabidopsis thaliana)[1,2]. UCP3 was first discovered and described in 1997 [3,4]. Because of its close homology with UCP1, UCP3 was initially implicated in thermoregulation [3,4], as it has been demonstrated to uncouple in a number of experimental models. Uncoupling protein-3 (UCP3) gene is primarily expressed in skeletal muscle and up-regulated by fatty acids [5]. UCP3 is primarily expressed in skeletal muscle, but is also found in brown fat and heart tissue [6]. UCP3 protein is one of the most important target proteins involved in skeletal muscle energy metabolism substance, and plays key regulatory roles in mitochondrial fatty acid oxidation [7–11]. Until recently, the eukaryotic core promoter recognition complex played a critical regulatory role in driving cell specific programs of transcription during development [12]. Several studies have shown that a transcription factor not only plays a control function in gene expression, but also inhibits the action of the complex combination [13]. MyoD controls UCP3 promoter activity through a noncanonical E box site located close to the transcription initiation site [5]; in this context, it is important to note that the MyoD response element is located at different positions in rats compared to mice/humans, which may cause species-specific differences in UCP3 expression [14]. The study of the molecular mechanisms of this transcription element have shown that it can synthesize muscle specific activity of

Int. J. Mol. Sci. 2016, 17, 682; doi:10.3390/ijms17050682 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2016, 17, 682 2 of 15 Int. J. Mol. Sci. 2016, 17, 682 2 of 15 thestudy promoter, of the somemolecular promoters mechanisms have beenof this synthesized transcription that element have highhave expressingshown that activityit can synthesize specificity inmuscle theInt. muscle. J. Mol.specific Sci. With2016 activity, 17 continuous, 682 of the promoter, development some and promoters improvement have been of the synthesized research, thethat regulationhave2 of high15 of muscle-specificexpressing activity promoter specificity element in the values muscle. to controlWith continuous muscle-specific development promoter and elementsimprovement will of become the a powerfulresearch,study of toolthe the for regulationmolecular animal mechanisms muscleof musc developmentle-specific of this transcri promoter researchption elementelement [15]. havevalu esshown to control that it canmuscle-specific synthesize promoterGuanlingmuscle elementsspecific cattle activity will are become a of yellow-coated the apromoter, powerful breedsome tool forpromoters that animal was muscle developedhave been development synthesized in China research [16that]. have In [15]. this high study, 51 upstreamexpressingGuanling regions activity cattle of specificityareUCP3 a yellow-coatedof in Guanling the muscle. breed cattle With that continuous were was analyzed, developed development and in PCRChina and amplifiedimprovement [16]. In this segments of study, the of research, the regulation of muscle-specific promoter element values to control muscle-specific different5′ upstream length regionsUCP3 ofgene UCP3 promoter of Guanling sequences, cattle were different analyzed, length and fragments PCR amplified of UCP3 segmentspromoter of promoter elements will become a powerful tool for animal muscle development research [15]. different length UCP3 gene promoter sequences, different length fragments of UCP3 promoter activity andGuanling the core cattle of areUCP3 a yellow-coatedpromoter were breed tested. that was Transcription developed in factorChina binding[16]. In this sites study, of cattle activity and the core of UCP3 promoter were tested. Transcription factor binding sites of cattle UCP3 UCP35′promoter upstream regions were screened of UCP3 usingof Guanling Promoter-Binding cattle were analyzed, transcription and PCR factors amplified (TF) segments Profiling of assay promoter were screened using Promoter-Binding transcription factors (TF) Profiling assay combined combineddifferent with length bioinformatics UCP3 gene analysis,promoter andsequences, we identified different several length transcriptionfragments of UCP3 factor promoter binding sites forwithUCP3activity bioinformatics. We and investigated the core analysis, of UCP3 whether and promoter we the identified wereUCP3 tested. promoterseveral Transcript transcription activityion factor could factor binding be binding increased sites of sites cattle by for UCP3 myogenic UCP3 . regulatoryWepromoter investigated factors were (MRFs)whetherscreened family usingthe UCP3 Promoter-Binding and promoter myocyte-specific activity transcription could enhancer befactors in factorcreased (TF) 2AProfiling by (MEF2A myogenic assay) transcriptional combined regulatory factors (MRFs) family and myocyte-specific enhancer factor 2A (MEF2A) transcriptional factors. These factors.with These bioinformatics results of analysis, cattle UCP3 and wepromoter identified provide several atranscription platform for factor further binding researche sites for on UCP3 promoter. results of cattle UCP3 promoter provide a platform for further researche on promoter activity and activityWe andinvestigated expression whether regulation. the UCP3 The promoter results activity are meaningful could be in increased the research by myogenic of muscle-specific regulatory expression regulation. The results are meaningful in the research of muscle-specific promoters and promotersfactors and (MRFs) the family mechanism and myocyte-specific of cattle’s muscle enhancer development factor 2A (MEF2A and growth.) transcriptional factors. These theresults mechanism of cattle of UCP3cattle’s promoter muscle developmentprovide a platform and growth. for furthe r researche on promoter activity and 2. Resultsexpression regulation. The results are meaningful in the research of muscle-specific promoters and 2. Resultsthe mechanism of cattle’s muscle development and growth. 2.1. Analysis of Uncoupling Protein 3 (UCP3) Gene Using qRT-PCR 2.1.2. Analysis Results of Uncoupling Protein 3 (UCP3) Gene Using qRT-PCR Total RNA was analyzed by 2100 expert_Eukaryote Total RNA Nano and Agarose gel Total RNA was analyzed by 2100 expert_Eukaryote Total RNA Nano and Agarose gel electrophoresis2.1. Analysis (Figuresof Uncoupling1 and Protein2). The 3 (UCP3) results Gene showed Using qRT-PCR that purity, number and integrity of RNA electrophoresis (Figures 1 and 2). The results showed that purity, number and integrity of RNA samples conformed to the requirements of the experiments. The levels of UCP3 gene expression in samplesTotal conformed RNA was to the analyzed requirements by 2100 of theexpert_Euk experiments.aryote TheTotal levels RNA of NanoUCP3 andgene Agarose expression gel in the longissimus dorsi, adipose tissue, hind shin, heart, liver, and small intestine tissues were recorded theelectrophoresis longissimus dorsi, (Figures adipose 1 and tissue, 2). The hind results shin, hearshowedt, liver, that and purity, small number intestine and tissues integrity were of recorded RNA samples conformed to the requirements of the experiments. The levels of UCP3 gene expression in usingusing qRT-PCR. qRT-PCR. The The result result showed showed thatthat expressionexpression of the UCP3UCP3 waswas at at a ahigh high level level in in longissimus longissimus the longissimus dorsi, adipose tissue, hind shin, heart, liver, and small intestine tissues were recorded dorsidorsi and and hind hind shin shin tissues. tissues. The The lowest lowest levellevel waswas in small intestine intestine (Figure (Figure 3),3), and and the the results results showed showed using qRT-PCR. The result showed that expression of the UCP3 was at a high level in longissimus consistentconsistent expression expression of ofβ β-actin,-actin, RPL4 RPL4 andand 18S18S RNA in in six six tissue tissues.s. The The qRT-PCR qRT-PCR data data confirmed confirmed that that dorsi and hind shin tissues. The lowest level was in small intestine (Figure 3), and the results showed thethe ucp3 ucp3 was was tissue-specifically tissue-specifically expressed expressed inin thethe longissimuslongissimus dorsi dorsi and and hind hind shin. shin. consistent expression of β-actin, RPL4 and 18S RNA in six tissues. The qRT-PCR data confirmed that the ucp3 was tissue-specifically expressed in the longissimus dorsi and hind shin.

Figure 1. The electrophoretogram of RNA. From1 to 6, the results represent heart tissue, liver tissue, Figure 1. The electrophoretogram of RNA. From1 to 6, the results represent heart tissue, liver tissue, smallFigure intestine 1. The tissue, electrophoretogram longissimus dorsi of RNA. tissue, From1 hind to shin 6, the tissue, results adipose represent tissue, heart respectively. tissue, liver tissue, small intestine tissue, longissimus dorsi tissue, hind shin tissue, adipose tissue, respectively. small intestine tissue, longissimus dorsi tissue, hind shin tissue, adipose tissue, respectively.

FigureFigure 2. The2. The 2100 2100 biological biological analyzer analyzer re resultssults ofof RNA.RNA. From1 toto 6,6, the the results results represent represent heart heart tissue, tissue, Figure 2. The 2100 biological analyzer results of RNA. From1 to 6, the results represent heart tissue, liverliver tissue, tissue, small small intestine, intestine, longissimus longissimus dors dorsi,i, hindhind shin, adiposeadipose tissue, tissue, respectively. respectively. liver tissue, small intestine, longissimus dorsi, hind shin, adipose tissue, respectively. Int. J. Mol. Sci. 2016, 17, 682 3 of 15 Int. J. Mol. Sci. 2016, 17, 682 3 of 15

Int. J. Mol. Sci. 2016, 17, 682 3 of 15

Figure 3. The expressing level of uncoupling protein 3 ( ucp3) gene in Guanling cattle different tissues.

2.2. Cloning Figure and 3. The Activity expressing Analysis level of uncoupling the Cattle ucp3protein Promoter 3 (ucp3) gene in Guanling cattle different tissues. 2.2.The Cloning result result and shows Activity shows that Analysis that the theofeukaryotic the eukaryoticCattle ucp3 expres Promoter expressionsion vectors vectors pGL3-basic-ucp3-pro pGL3-basic-ucp3-pro and pGL3- and promoter-ucp3-pro were constructed successfully (Figures 4 and 5). The promoter activities of the pGL3-promoter-ucp3-proThe result shows that were the constructed eukaryotic successfully expression (Figuresvectors pGL3-basic-ucp3-pro4 and5). The promoter and activities pGL3- of different deleted regions were measured in C2C12 myoblasts cells. A series of pGL3-basic-ucp3-pro thepromoter-ucp3-pro different deleted regions were constructed were measured successfully in C2C12 (Fig myoblastsures 4 and cells. 5). The A seriespromoter of pGL3-basic-ucp3-pro activities of the anddifferent pGL3-promoter-ucp3-pro deleted regions were recombinant measured in C2C12 vectors myoblasts with different cells. A fragmens series of pGL3-basic-ucp3-pro of UCP3 promoter were constructedand pGL3-promoter-ucp3-pro (Figures(Figures4 and4 and5) to5) determine torecombinant determine the vectors minimalthe minimal with promoter different promoter region fragmens region of UCP3of UCP3of UCP3promoter. promoter promoter. The were results The indicateresultsconstructed indicate that the (Figures that deletion the 4 deletionand plasmid 5) to plasmid pGL3-basic-ucp3-P5determine pGL3-basic-ucp3-P5 the minimal containing promoter containing theregion promoter of the UCP3 promoter region promoter. from region The´433 from to +3−433 bpresults to and +3 theindicate bp plasmid and that the pGL3-ucp3-P6the plasmid deletion pGL3-ucp3-P6 plasmid containing pGL3-basic-ucp3-P5 thecontaining promoter the region containing promoter from the´ region385 promoter to +3from bp region had−385 signiﬁcant fromto +3 bp activityhad− 433significant to compared +3 bp activity and to the pGL3-basic. compared plasmid pGL3-ucp3-P6 to These pGL3-basic results containing.suggest These results thatthe promoter the suggest sequence region that fromthe from sequence´ −385385 to +3from bp bp − has385 theto +3had minimal bp significant has regulatorythe minimal activity region compared regulatory that to contains regionpGL3-basic that the .contai transcriptionThesens results the transcription suggest start site that necessary startthe sequence site fornecessary ucp3 from promoter− for385 ucp3 to +3 bp has the minimal regulatory region that contains the transcription start site necessary for ucp3 activitypromoter (Figure activity4A,B). (Figure The 4A,B). 5 1-upstream The 5′-upstream region from region´433 from to +3 −433 bp ofto +3 the bpUCP3 of thepromoter UCP3 promoter only induced only promoter activity (Figure 4A,B). The 5′-upstream region from −433 to +3 bp of the UCP3 promoter only 4-foldinduced increases, 4-fold increases, which is lowerwhich thanis lower the increasesthan the associatedincreases associated with the pGL3-basicwith the pGL3-basic in the luciferase in the induced 4-fold increases, which is lower than the increases associated with the pGL3-basic in the luciferase activities. Our data show1 that the 5′-flanking region of UCP3´ from −385 to +3 bp contains activities.luciferase Our activities. data show Our thatdata theshow 5 -ﬂankingthat the 5′-flanking region of regionUCP3 offrom UCP3 385from to − +3385 bpto +3 contains bp contains the basal the basal promoter element of the cattle UCP3. promoterthe basal element promoter of theelement cattle ofUCP3 the cattle. UCP3.

Figure 4. Cont. Figure 4. Cont. Figure 4. Cont. Int. J. Mol. Sci. 2016, 17, 682 4 of 15 Int. J. Mol. Sci. 2016, 17, 682 4 of 15

FigureFigure 4. 4. DeletionDeletion analysis analysis of the of cattle the UCP3 cattle promoter.UCP3 (Apromoter.) Promoter activity (A) Promoter of the pGL3-basic-ucp3- activity of the Pro in C2C12 Cells; (B) Promoter activity of the pGL3-promoter-ucp3-Pro in C2C12 Cells; (C) Activity pGL3-basic-ucp3-Pro in C2C12 Cells; (B) Promoter activity of the pGL3-promoter-ucp3-Pro in C2C12 of the ucp3 promoter in C2C12 Cells. (a) Schematic diagram of the UCP3 promoter constructs Cells; (C) Activity of the ucp3 promoter in C2C12 Cells. (a) Schematic diagram of the UCP3 promoter consisting of the 5′-flanking region with serial deletions cloned into the pGL3-basic and pGL3-promoter constructs consisting of the 51-flanking region with serial deletions cloned into the pGL3-basic and vector. The arrows show the direction of transcription. The numbers represent the end points of each pGL3-promoterconstruct; (b) vector.The deletion The arrowsplasmids show were thedigested direction by re ofstriction transcription. enzyme and The run numbers on a 1.5% represent agarose the endgel. points The ofsize each of the construct; vector is (4.8b) kb. The The deletion inserted plasmids fragments were of the digested UCP3 promoter by restriction range enzymefrom 389 and runto on 1086 a 1.5% bp which agarose are gel.confirmed The size by sequencing; of the vector (c) isThe 4.8 deletion kb. The plasmids inserted were fragments cotransfected of the withUCP3 promoterpGL3-basic range and from pGL3-promoter 389 to 1086 into bp whichC2C12 arecells; confirmed the cells were by sequencing;harvested 24 h (c later) The after deletion transfection plasmids wereand cotransfected luciferase activity with pGL3-basic was measured and and pGL3-promoter expressed in intorelative C2C12 luciferase cells; the units cells (RLU). were The harvested values 24 h laterrepresent after transfection means ± SE. and vector luciferase represents activity pGL3-basic, was measured n = 3, ** and p < expressed 0.01, by analysis in relative of variance luciferase with units (RLU).one-way The values ANOVA. represent means ˘ SE. vector represents pGL3-basic, n = 3, ** p < 0.01, by analysis of variance with one-way ANOVA. pGL3-basic-ucp3-P5 had low promoter activity, but pGL3-promoter-ucp3-p5 and pGL3- promoter-ucp3-p6 exhibited significantly higher promoter activity (96.54 ± 3.96 and 95.25 ± 3.91 pGL3-basic-ucp3-P5 had low promoter activity, but pGL3-promoter-ucp3-p5 and relative luciferase units (RLU), relative to pGL3-basic) (Figure 5A,B). This difference in the promoter pGL3-promoter-ucp3-p6 exhibited significantly higher promoter activity (96.54 ˘ 3.96 and 95.25 ˘ 3.91 activities between different segments of UCP3 promoter suggests that additional factors can increase relativethe promoter luciferase activity units of (RLU), UCP3 relative. The result to pGL3-basic)showed that the (Figure trend5 ofA,B). relative This luciferase difference activity in the units promoter of activitiesdifferent between pGL3-basic-ucp3-pro/pGL3-basic different segments of UCP3 werepromoter similar to those suggests of pGL3-basic/pGL3-basic that additional factors (Figure can 5). increase In the promotercontrast, the activity relative of luciferaseUCP3. The activity result units showed of pGL3-promter-ucp3-pro/pGL3-basic that the trend of relative luciferase increased, activity with units of differenta 20-fold pGL3-basic-ucp3-pro/pGL3-basic to 100-fold increase observed compared were similar to that to for those pGL3-promoter-ucp3-pro/pGL3-basic of pGL3-basic/pGL3-basic (Figure 5). In contrast,(Figure 5). the These relative results luciferase indicate activity that the units additional of pGL3-promter-ucp3-pro/pGL3-basic promoter had a positive affect on the increased, expression with a 20-foldof the totarget 100-fold gene before increase UCP3 observed promoter. compared to that for pGL3-promoter-ucp3-pro/pGL3-basic (Figure5). These results indicate that the additional promoter had a positive affect on the expression of the target gene before UCP3 promoter. Int. J. Mol. Sci. 2016, 17, 682 5 of 15 Int. J. Mol. Sci. 2016, 17, 682 5 of 15

FigureFigure 5. AnalysisAnalysis of the cattle of UCP3 the promoter. cattle UCP3 (A) Analysispromoter. of activity of pGL3-basic-ucp3-pro/pGL3-basic (A) Analysis of activity of and pGL3-promoter-ucp3-pro/pGL3-basic; (B) Analysis of activity of of pGL3-promoter-ucp3- pGL3-basic-ucp3-pro/pGL3-basic and pGL3-promoter-ucp3-pro/pGL3-basic; (B) Analysis of pro/pGL3-basic and pGL3-promoter-ucp3-pro/pGL3-promoter. (a) Schematic diagram of the ucp3 activity of of pGL3-promoter-ucp3-pro/pGL3-basic and pGL3-promoter-ucp3-pro/pGL3-promoter. promoter constructs consisting of the 5′-flanking region with serial deletions cloned into the (a) Schematic diagram of the ucp3 promoter constructs consisting of the 51-flanking region with serial pGL3-basic and pGL3-promoter vector. The arrows show the direction of transcription. The numbers deletions cloned into the pGL3-basic and pGL3-promoter vector. The arrows show the direction of represent the end points of each construct; (b) The deletion plasmids were digested by the restriction transcription. The numbers represent the end points of each construct; (b) The deletion plasmids enzyme and run on a 1.5% agarose gel. The size of vector is 4.8 kb. The inserted fragments of the were digested by the restriction enzyme and run on a 1.5% agarose gel. The size of vector is 4.8 kb. ucp3 promoter range from 389 to 1086 bp which are confirmed by sequencing; (c) The deletion plasmids The inserted fragments of the ucp3 promoter range from 389 to 1086 bp which are confirmed by were cotransfected with pGL3-basic and pGL3-promoter into C2C12 cells; the cells were harvested 24 h c sequencing;later after (transfection) The deletion and plasmidsluciferase wereactivity cotransfected was measured with and pGL3-basic expressed and in pGL3-promoterrelative luciferase into C2C12units cells;(RLU). the cells were harvested 24 h later after transfection and luciferase activity was measured and expressed in relative luciferase units (RLU). 2.3. Expression of PEGFP-N3-ucp3-pro in C2C12 Cell Line 2.3. Expression of PEGFP-N3-ucp3-pro in C2C12 Cell Line In this study, plasmid PEGFP-N3-ucp3-pro and PEGFP-N3 transfection C2C12 cells after 48 h wereIn thisobserved study, with plasmid an inverted PEGFP-N3-ucp3-pro fluorescence micr andoscope PEGFP-N3 to determine transfection the fluorescence C2C12 cells peak after of the 48 h wererecombinant observed plasmid with an expression inverted in fluorescence C2C12 cells. microscope The results show to determine that Eukaryotic the fluorescence expression vector peak of thePEGFP-N3-ucp3-pro recombinant plasmid was expressionsuccessfully in constructed C2C12 cells. (Fig Theure 6). results Green show fluorescent that Eukaryotic protein were expression partly vectorexpressed PEGFP-N3-ucp3-pro in the cytoplasm wasand successfullynuclei of C2C12 constructed cells, but non-existent (Figure6). Green in PEGFP-N3-ucp3-P4. fluorescent protein Green were partlyfluorescence expressed was in expressed the cytoplasm in various and nuclei strengths of C2C12 in different cells,but segments non-existent of the promoter. in PEGFP-N3-ucp3-P4. The result Greenshowed fluorescence that PEGFP-N3 was > expressed PEGFP-N3-ucp3-P6 in various > PEGFP-N3-ucp3-P5 strengths in different > PEGF segmentsP-N3-ucp3-P2 of the > PEGFP- promoter. TheN3-ucp3-P3 result showed > PEGFP-N3-ucp3-P1 that PEGFP-N3 > PEGFP-N3-ucp3-P4 PEGFP-N3-ucp3-P6. The > PEGFP-N3-ucp3-P5 six promoters that were > PEGFP-N3-ucp3-P2 constructed have differential promoter activity: the promoter activity of P6 and P5 promoter are the highest. The region > PEGFP-N3-ucp3-P3 > PEGFP-N3-ucp3-P1 > PEGFP-N3-ucp3-P4. The six promoters that were from −385 to +3 bp contains the functional promoter of the cattle UCP3 promoter, it is regarded as the constructed have differential promoter activity: the promoter activity of P6 and P5 promoter are the core promoter of UCP3 and is consistent with the result of pGL3-basic-ucp3-pro. highest. The region from ´385 to +3 bp contains the functional promoter of the cattle UCP3 promoter, it is regarded as the core promoter of UCP3 and is consistent with the result of pGL3-basic-ucp3-pro. Int. J. Mol. Sci. 2016, 17, 682 6 of 15 Int. J. Mol. Sci. 2016, 17, 682 6 of 15 Int. J. Mol. Sci. 2016, 17, 682 6 of 15

Figure 6. Identification and analysis of PEGFP-N3-ucp3-pro. (a) Enzyme digestion results of PEGFP- Figure 6. Identification and analysis of PEGFP-N3-ucp3-pro. (a) Enzyme digestion results of FigureN3-ucp3-pro 6. Identification recombinant and plasmid. analysis Mof PEGFP-N3-ucp3-pro.represent 15,000 bp marker, (a) Enzyme from1 digestion to 6, the results results of represent PEGFP- PEGFP-N3-ucp3-pro recombinant plasmid. M represent 15,000 bp marker, from1 to 6, the results N3-ucp3-proPEGFP-N3-ucp3-p1–PEGFP-N3- recombinant plasmid.ucp3-p6, M represent respectively; 15,000 ( bbp–h marker,) The green from1 fluorescence to 6, the results of recombinant represent represent PEGFP-N3-ucp3-p1–PEGFP-N3-ucp3-p6, respectively; (b–h) The green fluorescence of PEGFP-N3-ucp3-p1–PEGFP-N3-expression vector PEGFP-N3-ucp3-ucp3-p6,pro transitional respectively; C2C12 (b– cellh) The (Fluor greenescent fluorescence inverted microscope of recombinant ×20). recombinant expression vector PEGFP-N3-ucp3-pro transitional C2C12 cell (Fluorescent inverted expression vector PEGFP-N3-ucp3-pro transitional C2C12 cell (Fluorescent inverted microscope ×20). microscope ˆ20). 2.4. The Screening of Transcription Factor by Promoter-Binding Transcription Factors (TF) Profiling 2.4.Assay The II Screening of Transcription Factor by Promoter-Binding Transcription Factors (TF) Profiling 2.4.Assay The II Screening of Transcription Factor by Promoter-Binding Transcription Factors (TF) Profiling Assay II The screening of transcription factor of UCP3 promoter using promoter-binding TF profiling The screening of transcription factor of UCP3 promoter using promoter-binding TF profiling AssayThe II detectsscreening the ofexperimental transcription results factor by of multifunctional UCP3 promoter microplate using promoter-binding chemiluminescence TF detectionprofiling Assay II detects the experimental results by multifunctional microplate chemiluminescence detection Assayfunction. II detects The data the experimentalobtained by the results experimental by multifunctional methods microplatedeals with chemiluminescencethe data analysis processing detection function. The data obtained by the experimental methods deals with the data analysis processing function.value. The The processing data obtained value representsby the experimental the intensity methods of luminosity. deals with In essence, the data it representsanalysis processing the probe value. The processing value represents the intensity of luminosity. In essence, it represents the probe value.number The after processing the nuclear value extracts represents corresponding the intensity transcription of luminosity. factor In bindinessence,g probeit represents has been the eluted. probe number after the nuclear extracts corresponding transcription factor binding probe has been eluted. numberIndirectly, after it indicatesthe nuclear whether extracts the corresponding promoter region transcription contains factorthe transcriptio binding proben factor has binding been eluted. sites. Indirectly, it indicates whether the promoter region contains the transcription factor binding sites. Indirectly,The results it from indicates the data whether processing the promoter point of regionview could contains determine the transcriptio that the UCP3n factor promoter binding region sites. The results from the data processing point of view could determine that the UCP3 promoter region Thehad resultsMEF2, fromMyoD the, MZF data, pax-5processing, PPAR po, SATB1int of view, TFIID could, HOX4C determine, Nkx2-5 that, Nkx3-2the UCP3, Pax3 promoter, MEF1 ,region Snail, had MEF2, MyoD, MZF, pax-5, PPAR, SATB1, TFIID, HOX4C, Nkx2-5, Nkx3-2, Pax3, MEF1, Snail, NRF2 hadNRF2 MEF2 (ARE, MyoD) transcription, MZF, pax-5 factor, PPAR binding, SATB1 sites, TFIID(Figure, HOX4C 7). The, Nkx2-5predictions, Nkx3-2 of , transcriptionPax3, MEF1, factorSnail, (ARE) transcription factor binding sites (Figure7). The predictions of transcription factor binding sites NRF2binding (ARE sites) oftranscription Guanling cattle factor ucp3 binding promoter sites region (Figure by 7).online The software predictions show of that transcription it contains MyoD,factor of Guanling cattle ucp3 promoter region by online software show that it contains MyoD, MZF1 and bindingMZF1 and sites Nkx-2 of Guanling transcription cattle factor ucp3 bindingpromoter sites region (Tab byles online1 and 2).software In summary, show that Guanling it contains cattle MyoD, UCP3 Nkx-2 transcription factor binding sites (Tables1 and2). In summary, Guanling cattle UCP3 promoter MZF1promoter and regions Nkx-2 transcription had MyoD, TFIID factor, bindingPax3, MEF1 sites, MEF2(Tables transcription 1 and 2). In summary, factor binding Guanling sites. cattle UCP3 regionspromoter had regionsMyoD had, TFIID MyoD, Pax3, TFIID, MEF1, Pax3, MEF2, MEF1transcription, MEF2 transcription factor binding factor sites. binding sites.

Figure 7. Cont. FigureFigure 7.7. Cont.Cont. Int. J. Mol. Sci. 2016, 17, 682 7 of 15 Int. J. Mol. Sci. 2016, 17, 682 7 of 15

Figure 7. Transcription factor screening results. (A) The comparison chart of the control group and experimentalFigure 7. Transcription group processing factor screening value of results. the screened (A) The out comparison transcription chart factors; of the (B control) The comparison group and chartexperimental of the control group group processing and experimental value of the group screened processing out transcr valueiption of some factors; transcription (B) The comparison factors. chart of the control group and experimental group processing value of some transcription factors. Table 1. Sequence prediction results of uncoupling protein 3 (UCP3) promoter. Table 1. Sequence prediction results of uncoupling protein 3 (UCP3) promoter. Start End Score Promoter Sequence (51 to 31) Start End Score Promoter Sequence (5′ to 3′) ´−907 ´857−857 0.950.95 ATTAAAATGCATGAATCCGCAGTCATAAAAAGGCACGAAGTGCTGACATAATTAAAATGCATGAATCCGCAGTCATAAAAAGGCACGAAGTGCTGACATA ´−842 ´792−792 0.870.87 AACTTGGAAAACACTTTGGTAAGTAAAAGAAGCCAGTCACAAAAGGTCA AACTTGGAAAACACTTTGGTAAGTAAAAGAAGCCAGTCACAAAAGGTCA ´ ´ −449 399−399 0.800.80 GAATTAGCATCACCATTGTTACTATTAAGAGGAGGCCCAGGGGAACCCTG GAATTAGCATCACCATTGTTACTATTAAGAGGAGGCCCAGGGGAACCCTG ´301 ´251 0.99 TCATCACCTGCAATGGGGTGTTTTAAAGAAGCCCAAGTCAAGGGAACTGA −301 −251 0.99 TCATCACCTGCAATGGGGTGTTTTAAAGAAGCCCAAGTCAAGGGAACTGA ´154 ´104 1.00 AAGGTTTCAGGTCAGCCAGAGTGTATAAAGACAGGTGCCAAGCCAGAGGC −154 −104 1.00 AAGGTTTCAGGTCAGCCAGAGTGTATAAAGACAGGTGCCAAGCCAGAGGC ´52 ´2 1.00 CCTGGGATGGAGCCCTGAGGACCCTTAAAGAGGCCCCATGCTTCCGCCAC −52 −2 1.00 CCTGGGATGGAGCCCTGAGGACCCTTAAAGAGGCCCCATGCTTCCGCCAC

TableTable 2.2. The predictionprediction resultsresults ofof transcriptiontranscription factor binding sites of UCP3 gene promoter in Guanling cattlecattle byby onlineonline softwaresoftware TFSEARCH.TFSEARCH.

SiteSite Transcription Transcription Factor Factor Binding Binding Sites Sites −1300~−1200 bp GATA-1, p300, MZF1 ´1300~´1200 bp GATA-1, p300, MZF1 −1200~−1100 bp GATA-1, GATA-2, GATA-3, GATA-X, C/EBPb, C/EBP, MZF1 ´1200~´1100 bp GATA-1, GATA-2, GATA-3, GATA-X, C/EBPb, C/EBP, MZF1 −´1100~1100~−1000´1000 bp bp CdxACdxA, Nkx-2, Nkx-2, AML-1a, AML-1a, GATA-1, GATA-1, GATA-2, GATA-2, GATA-3, GATA-3, GATA-X, GATA-X, Cdx, Cdx, COUP-T, COUP-T −´1000~1000~−900´900 bp bp NF-kapNF-kap, Lyf-1, Lyf-1, CdxA, CdxA, NF-kap, NF-kap, Sox-5, Sox-5, GATA-1, GATA-1, Pbx-1, Pbx-1 −´900~900~−800´800 bp bp CdxACdxA, C/EBP, C/EBP −´800~800~−700´700 bp bp GATA-XGATA-X, GATA-2, GATA-2, CdxA, CdxA, SRY, SRY, Egr-1, Egr-1, Egr-2, Egr-2, Egr-3, Egr-3, NGFI-C, NGFI-C −´700~700~−600´600 bp bp MZF1MZF1, Oct-1, Oct-1, GATA-1, GATA-1, CdxA, CdxA, AML-1a, AML-1a, Nkx-2, Nkx-2 −´600~600~−500´500 bp bp CdxACdxA, C/EBP, C/EBP, USF, USF, Nkx-2, Nkx-2, SRY, SRY, C/EBPb, C/EBPb, HNF-3b, HNF-3b, S8,,S8 HFH-2, HFH-2 −´500~500~−400´400 bp bp Sox-5Sox-5, GATA-1, GATA-1, S8, ,S8 Oct-1, Oct-1, Nkx-2, Nkx-2, CdxA, CdxA ´ ´ CdxA GATA-X AML-1a HNF-4 GATA-1 deltaE C/EBPb USF Lyf-1 −400~400~−300300 bp bp CdxA, GATA-X, , AML-1a, , HNF-4, , GATA-1, , deltaE, , C/EBPb, , USF, , Lyf-1, ´300~´200 bp TATA, SRY , AML-1a, Nkx-2, USF, Sp1 −300~−200 bp TATA, SRY , AML-1a, Nkx-2, USF, Sp1 ´200~´100 bp Nkx-2, USF, deltaE, CdxA, TATA, MyoD −200~´100~+1−100 bp bp Nkx-2Nkx-2, USF, USF, deltaE, deltaE, CdxA, CdxA, TATA, TATA, MyoD, MyoD −+1~+100100~+1 bp bp Nkx-2GATA-1, USF,, GATA-2deltaE, CdxA, CdxA, TATA, MyoD +1~+100 bp GATA-1, GATA-2, CdxA

2.5. Effect of Transcription Factors on UCP3 Promoter Activity 2.5. Effect of Transcription Factors on UCP3 Promoter Activity By design, restriction enzyme sites contain primers and high-ﬁdelity enzymes to enable the By design, restriction enzyme sites contain primers and high-fidelity enzymes to enable the cloning of coding area sequence of MRFs family and MEF2A, and insert the fragment orientation to the cloning of coding area sequence of MRFs family and MEF2A, and insert the fragment orientation to eukaryotic expression vector pcDNA3.1(+) polyclonal loci of the plasmid. Coding area sequence of the the eukaryotic expression vector pcDNA3.1(+) polyclonal loci of the plasmid. Coding area sequence MRFs family and MEF2A were cloned through double enzyme digestion and sequenced. The result of the MRFs family and MEF2A were cloned through double enzyme digestion and sequenced. The shows that the eukaryotic expression vector pcDNA3.1(+)-MRFs family and pcDNA3.1(+)-MEF2A result shows that the eukaryotic expression vector pcDNA3.1(+)-MRFs family and pcDNA3.1(+)- were constructed successfully (Figure8), as a base for expression of MRFs family and MEF2A MEF2A were constructed successfully (Figure 8), as a base for expression of MRFs family and MEF2A transcription factors in the eukaryocyte. transcription factors in the eukaryocyte. Int. J. Mol. Sci. 2016, 17, 682 8 of 15 Int. J. Mol. Sci. 2016, 17, 682 8 of 15

Figure 8. The effect of transcriptional activity of Guangling Cattle UCP3 promoter by MRFs family Figure 8. The effect of transcriptional activity of Guangling Cattle UCP3 promoter by MRFs family and myocyte-specific enhancer factor 2A (MEF2A) in C2C12 myoblasts.C2C12 myoblasts were and myocyte-specific enhancer factor 2A (MEF2A) in C2C12 myoblasts.C2C12 myoblasts were transfected with the reporter gene constructs, pGL3-basic-ucp3-p1, pGL3-Basic, and the internal transfected with the reporter gene constructs, pGL3-basic-ucp3-p1, pGL3-Basic, and the internal control, pcDNA3.1(+)-MRFs family and pcDNA3.1(+)-MEF2A expression vector. After 48 h, the cells control, pcDNA3.1(+)-MRFs family and pcDNA3.1(+)-MEF2A expression vector. After 48 h, the cells were harvested for reporter gene assays. The normalized firefly luciferase activity of the experimental were harvested for reporter gene assays. The normalized firefly luciferase activity of the experimental group was compared to that of the control group, which was transfected with an empty expression group was compared to that of the control group, which was transfected with an empty expression vector containing no cDNA. The control group (open bar) value was set at 1.0, with the fold induction vector containing no cDNA. The control group (open bar) value was set at 1.0, with the fold induction ofof each each group group being determined. The The bars bars repres representent the means ±˘ SESE of of triplicate triplicate determinations. determinations.

MRFs family and MEF2A potential activate an UCP3 promoter fragment of 1080 bp were MEF2A UCP3 detectedMRFs through family dual and luciferasepotential reporter activate gene as ansay afterpromoter cotransfection. fragment To of evaluate 1080 bp werethe influence detected ofthrough the MRFs dual family luciferase and reporterMEF2A we gene compared assay after cotransfections cotransfection. with To or evaluate without the expression influence vectors of the MEF2A MyoD forMRFs MyoD family, Myf5 and, Myf6, MyoGwe compared and MEF2A cotransfections factors known with to or regulate without expressionUCP3 promoter vectors expression for , Myf5 Myf6 MyoG MEF2A UCP3 (Figure, 8). In, the pGL3-basic-ucp3-p1and factors transfected known gr tooup, regulate the pGL3-basicpromoter vector showed expression responsiveness (Figure8). toIn the the co-expression pGL3-basic-ucp3-p1 of Myf5, transfected Myf6 or MyoD group, alone the respectively. pGL3-basic vectorFor pGL3 showed-basic-ucp3-p1, responsiveness the activity to the Myf5 Myf6 MyoD increasedco-expression 1.4-fold of more, by Myf5or , 3.3-foldalone more respectively. by Myf6 For, and pGL3-basic-ucp3-p1, 2-fold more by MyoD the, activitycompared increased to the activities1.4-fold more in C2C12 by Myf5 cells, 3.3-foldtransfected more with by Myf6pGL3-Basic.This, and 2-fold moreindicates by MyoD that the, compared increases to in the the activities activity ofin the C2C12 UCP3 cells promoter transfected are brought with pGL3-Basic.This about by the transcription indicates factors that the Myf5 increases, Myf6 and in theMyoD activity. In contrast, of the theUCP3 co-expressionpromoter are of broughtMyoG and about MEF2A by the resulted transcription in only factors 0.37- andMyf5 0.32-fold, Myf6 and changesMyoD of. In luciferase contrast, activity,the co-expression respectively.These of MyoG resultsand MEF2A indicateresulted that MyoG in onlyand MEF2A 0.37- and have 0.32-fold a negative changes regulation of luciferase role of UCP3activity, promoter. respectively.These results indicate that MyoG and MEF2A have a negative regulation role of UCP3 promoter. 3. Discussion 3. Discussion The results of this study showed that the expression of the UCP3 was almost undetectable in The results of this study showed that the expression of the UCP3 was almost undetectable in small small intestine and adipose. However, the expression of the UCP3 in longissimus dorsi and hind shin intestine and adipose. However, the expression of the UCP3 in longissimus dorsi and hind shin tissue tissue were about 60-fold and 40-fold greater than the expression of UCP3 in adipose and the small were about 60-fold and 40-fold greater than the expression of UCP3 in adipose and the small intestine, intestine, and about 6-fold and 4-fold greater than the in liver and heart, suggesting it has characteristics and about 6-fold and 4-fold greater than the in liver and heart, suggesting it has characteristics of high of high efficiency, and specificity expression in skeletal muscle, which was consistent with the efficiency, and specificity expression in skeletal muscle, which was consistent with the observation that observation that the preferential expression of UCP3 in skeletal muscle and brown fat [3,17–20] and the preferential expression of UCP3 in skeletal muscle and brown fat [3,17–20] and the UCP3 promoter the UCP3 promoter being activated in the muscle cell differentiation process [21]. being activated in the muscle cell differentiation process [21]. The cloned 5′-upstream regions of the Guanling cattle UCP3 genes showed varying degrees of The cloned 51-upstream regions of the Guanling cattle UCP3 genes showed varying degrees promoter activity transfection into C2C12 cells. The result showed that the sequence of UCP3 of promoter activity transfection into C2C12 cells. The result showed that the sequence of UCP3 promoter from −385 to +3 bp has the minimal promoter region containing the transcription start site promoter from ´385 to +3 bp has the minimal promoter region containing the transcription start site necessary for UCP3 promoter activity, and several studies have reported activity of the UCP3 promoter in C2C12 [22,23]. Deletion of UCP3 promoter expression showed that it has some Int. J. Mol. Sci. 2016, 17, 682 9 of 15 necessary for UCP3 promoter activity, and several studies have reported activity of the UCP3 promoter in C2C12 [22,23]. Deletion of UCP3 promoter expression showed that it has some negative-regulatory elements from ´620 to ´433 bp, and there exist some positive-regulatory elements between ´433 and ´385 bp. Therefore, this difference in the promoter activities between different segments of UCP3 promoter suggests that additional factors were needed to activate the UCP3 promoter. Note that pGL3-basic-ucp3-P5 had much lower promoter activity, but pGL3-promoter-ucp3-p5 and pGL3-promoter-ucp3-p6 exhibited significantly higher promoter activity (96.54 ˘ 3.96 and 95.25 ˘ 3.91 RLU, relative to pGL3-basic). In a word, the results showed that additional SV40 promoter can strengthen the activity of UCP3 promoter, thereby optimizing the question about low activity of UCP3 promoter in skeletal muscles. The result of PEGFP-N3-ucp3 recombinant vector transfection into C2C12 cells was in agreement with the result of pGL3-promoter-ucp3 transfection into C2C12 cells. Previous studies had shown that transcription factors combined with these special sequences can open or close a set of specific gene expressions. The interaction of regulatory sequence and transcription factors plays a key role in gene expression [13]. Bioinformatic analysis revealed the presence of some potential transcription factor binding sites of UCP3 promoters such as MyoD, MZF, sox-5, TATA, Nkx2. The result of the software also includes MyoD, MZF1 and Nkx-2. We have shown that the UCP3 promoter of Guanling cattle have MyoD, TFIID, Pax3, MEF1 and MEF2 transcription factor binding sites by promoter-binding TF brofiling Assay II study. Our experimental and bioinformatics analysis revealed that the Guanling cattle UCP3 promoter region had MyoD, TFIID, Pax3, MEF1, MEF2 transcription factor binding sites. Several studies have reported that the muscle-specific promoter contained Trex/MEF-3 components, MEF-1, Pax3/7, SRE, MEF-2, CACCC boxes and other transcriptional regulatory components [14]. Multiple lines of evidence have shown that PPARα and PPARδ are mediators of the fatty acid-dependent control of UCP3 transcription in skeletal muscle [24]. Pax3 is a key regulator of MyoG during development [25,26]. The embryonic progenitors that express Pax3, and its close homolog Pax7, give rise to a population of adult muscle stem cells [27,28]. MEF2 was considered to be a conservative member of the vast majority of muscle-specific genes [29–33]. MEF2 and the transcription factor containing the basic helix-loop-helix (bHLH) could coordinate muscle genes expression and regulation of the initial myogenic differentiation [34]. In addition, promoter activity was induced by overexpression of MyoD1, which bound to this canonical E-box during C2C12 differentiation [35]. To explore the role of UCP3 promoter for a possible regulation of MRFs family and MEF2A transcription factor, Myf5, Myf6, MyoD, MyoG and MEF2A were selected as the most likely transcription factors to be involved in this study. C2C12 myoblasts were co-transfected with the MRFs family transcription factor or MEF2A transcription factors expression vectors and pGL3-basic-ucp3-pro reporter vectors. The results showed that Myf5, Myf6 and MyoD contributed to the up-regulation of the UCP3 expression in C2C12 myoblasts, which was consistent with the present results that MyoD was required to activate the promoter of human UCP3 [5]. Several transcription factor binding sites in the UCP3 promoter from cattle have been identified including MyoD, which is also present in mouse [5] and rat [14]. Conversely, the MyoG and MEF2A had down-regulation effects on the UCP3 promoter region. Interestingly, the effects of MRFs family and MEF2A were different in C2C12 cell line, Myf5, My6 and MyoD increased the dual luciferase activity, but myogenin and MEF2A had no effect. These results indicated that both the MRFs family and MEF2A are necessary, but, together, they were not sufficient enough transcription factors to induce UCP3 promoter activity. The result is consistent with previous findings [21]. In summary, the results indicated that this difference was most likely conferred by different ways in which UCP3 promoter regions respond to the Myf5, Myf6 and MyoD transcription factors, and the promoter-binding TF profiling assay shows that these transcription factors bind directly to the UCP3 promoter. We only focus the UCP3 promoter in this study, so we can not exclude the possibility that the intoronic region (e.g., intron 1) is associated with the regulation of UCP3 gene [36,37]. Int. J. Mol. Sci. 2016, 17, 682 10 of 15

4. Experimental Section

4.1. Experimental Animals and Tissue Sampling Guanling cattle (castrated steers, n = 3) with similar genetic backgrounds in Guanling county of Guizhou province were reared under the same experimental conditions. At a mean age of 18 months, the animals were slaughtered using standard commercial procedures. We collected longissimus dorsi, adipose tissue, hind shin, heart, liver, and small intestine tissue samples. The tissue samples were placed in the RNAlater RNA stabilization solution (Qiagen, Hilden, Germany) immediately after collection. The samples were frozen in liquid nitrogen, and stored at ´80 ˝C.

4.2. RNA Isolation and Synthesis of cDNA Total RNA was isolated from each tissue sample using the TRIzol reagent (Invitrogen, Waltham, MA, USA), according to the manufacturer’s instructions. An aliquot containing 1 µg of total RNA was used for the synthesis of complementary DNA (cDNA) by reverse transcription using TransStart® One-Step gDNA Removal and cDNA Removal and cDNA Synthesis Super Mix (TransGen Biotech, Beijing, China).

4.3. Confirmation of Gene Expression Using qRT-PCR The primer pairs of UCP3 were designed to have matching melting temperatures. The primer sequences are listed in Table3. The same RNA used for UCP3 analysis of the longissimus dorsi, adipose, hind shin, heart, liver, and small intestine tissue samples were used in the quantitative reverse transcription and polymerase chain reaction (qRT-PCR) experiments. The first strand of the cDNA was synthesized from 1 µg of total RNA using the TransScript II One-Step gDNA Removal and cDNA Synthesis SuperMixkits (TransGen Biotech, Beijing, China) with the oligo (dT) 20 primer (TransGen Biotech). The real-time PCR reactions were performed in a final volume of 20 µL using the Trans Start Green qPCR SuperMix UDG kit (TransGen Biotech), according to the manufacturer’s instructions. The mRNA expression were normalized to that of the β-actin, RPL4 and 18SRNA gene. The real-time PCR assays were performed using a CFX96 real-time PCR system (Bio-Rad, Hercules, CA, USA). Thermal cycling was performed using an initial denaturation step of 95 ˝C for 1 min, followed by 40 cycles of 95 ˝C for 30 s, 58 ˝C for 30 s, and 72 ˝C for 1 min. A melting curve was constructed using annealing temperatures from 58 to 95 ˝C to verify the specificity of the amplified product. The data were analyzed using the 2´∆∆Ct method.

Table 3. Sequences of primers used for real-time PCR.

Gene Symbol Forward Primer (51 to 31) Reverse Primer (51 to 31) Length (bp) β-actin GCAGGTCATCACCATCGG GCTGTCACCTTCACCGTTC 564 bp RPL4 AGGAGGCTGTGTTGCTTCTG CGACGGTTTCTCATCTTGC 106 bp 18SRNA GACTCAACACGGGAAACCTC AGACAAATCGCTCCACCAAC 120 bp UCP3 TCTACGACTCCGTCAAGC CTGGCGATGGTCCTGT 469 bp

4.4. Amplify UCP3 Promoter of Guanling Cattle Genomic DNA of Guanling cattle was extracted from blood samples using DNA extraction kit (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions. Based on the sequence of UCP3 gene of cattle (UCSC NM_174210), a pair of PCR primers were designed using Primer Premier 5.0 (version 5.00, PREMIER Biosoft international, Palo Alto, CA, USA, 2000) to amplify 1080, 980, 814, 624, 437 and 389 bp sequence of UCP3 promoter (Table4). Six fragments of UCP3 promoter were ampliﬁed by PCR form DNA genome of Guanling cattle (Figure9). The PCR system consisted of 1 µL templates, 1 µL of each antiprimer, 1 µL primer, 10 µL 2ˆ PCR Master Mix (Takara, Dalian, China) and 7 µL ddH2O. Thermal cycling was performed using an initial denaturation step of Int. J. Mol. Sci. 2016, 17, 682 11 of 15

with Nhe I and xho I, and ligated together into pGL3-basic, pGL3-promoter and PEGFP-N3 at NheI and xhoI site. Double enzyme fragment lengths were 1080, 980, 814, 624, 437 and 389 bp, respectively (Figures 5–7). The PCR product was ligated into pUCm-T easy vector, pGL3-basic, PGL3-promoter, PEGFP-N3 and sequenced.

Int. J. Mol. Sci. 2016, 17, 682 11 of 15 Table 4. Sequences of primers of UCP3 promoter used for PCR.

Gene Length ˝ Forward Primer (5′ to 3′) ˝ Reverse˝ Primer (5′ to 3′) ˝ Tm (°C) Symbol94 C for 3 min, followed by 30 cycles of 94 C for 30 s, 56–60 C for 30 s, and 72 C for 1 min.(bp) After the ˝ UCP3-cycles,P1 a ﬁnalCTAGCTAGCTACCCTCAGTGCCTATCA extension was performed at 72 C toCCGCTCGAGGCCATTTGCTGGTGTCT 7 min. The ampliﬁed fragments were1080 digested 56 UCP3-withP2 Nhe I andCTAGCTAGCGCCTCCAAGTGTCATGT xho I, and ligated together into pGL3-basic,CCGCTCGAGGCCATTTGCTGGTGTCT pGL3-promoter and PEGFP-N3 980 at NheI 60 UCP3-and xhoIP3 site.CTAGCTAGCTGAATCCGCAGTCATAAA Double enzyme fragment lengths wereCCGCTCGAGGCCATTTGCTGGTGTCT 1080, 980, 814, 624, 437 and 389 bp, 814 respectively 60 UCP3-P4 CTAGCTAGCTGAAGGGAAGAGGAAACA CCGCTCGAGGCCATTTGCTGGTGTCT 624 59.4 UCP3-(FiguresP5 5–CTAGCTAGCCCTACCTCGTAAGAGTTGTG7). The PCR product was ligated into pUCm-TCCGCTCGAGGCCATTTGCTGGTGTCT easy vector, pGL3-basic, PGL3-promoter, 437 60 UCP3-PEGFP-N3P6 CTAGCTAGCCACATAGTAGGCACCAAGA and sequenced. CCGCTCGAGGCCATTTGCTGGTGTCT 389 59.3

Figure 9. Cloned and identified sequence of the cattle UCP3 promoter (a) The electrophoretogram of Figure 9. Cloned and identiﬁed sequence of the cattle UCP3 promoter (a) The electrophoretogram DNA, the product was run on a 1.5% agarose gel; (b) Different PCR products of UCP3 promoters; of DNA, the product was run on a 1.5% agarose gel; (b) Different PCR products of UCP3 promoters; (c) Restriction analysis Identification of pUCm-T-ucp3-pro. (c) Restriction analysis Identiﬁcation of pUCm-T-ucp3-pro.

4.5. Transcription Factor Profiling of UCP3 Promoter by Filter Assay Table 4. Sequences of primers of UCP3 promoter used for PCR. For monitoring the activation of multiple TFs of the UCP3 promoter simultaneously, Gene Length Promoter-Binding TFForward Profiling Primer Assay (51 to 3II1) was used according Reverse to Primerthe protocol (51 to 31) provided by SignosisTm (˝ C)Inc. Symbol (bp) (Signosis Inc., Santa Clara, CA, USA). Nuclear proteins were isolated from longissimus dorsi using UCP3-P1 CTAGCTAGCTACCCTCAGTGCCTATCA CCGCTCGAGGCCATTTGCTGGTGTCT 1080 56 theUCP3 reagents-P2 and CTAGCTAGCGCCTCCAAGTGTCATGT protocol provided by a Nuclear Ex CCGCTCGAGGCCATTTGCTGGTGTCTtraction Kit (Signosis Inc., Santa Clara, 980 CA, 60USA). AndrogenUCP3-P3 receptor CTAGCTAGCTGAATCCGCAGTCATAAA (AR) was used to normalize CCGCTCGAGGCCATTTGCTGGTGTCT the readings for as a blank control 814 (Table 60 5). UCP3-P4 CTAGCTAGCTGAAGGGAAGAGGAAACA CCGCTCGAGGCCATTTGCTGGTGTCT 624 59.4 LuminescenceUCP3-P5 CTAGCTAGCCCTACCTCGTAAGAGTTGTG was reported as relative light unitsCCGCTCGAGGCCATTTGCTGGTGTCT (RLUs) using a multidetection microplate 437 reader 60 (BioUCP3 Tek,-P6 Vermont,CTAGCTAGCCACATAGTAGGCACCAAGA VT, USA). TFSEARCH (http://diyhpl.us/~bryan/irc/protocol-online/protocol-CCGCTCGAGGCCATTTGCTGGTGTCT 389 59.3 cache/TFSEARCH.html) and ALGGEN ROMO (http://alggen.lsi.upc.es/) were used to predict the 4.5.transcription Transcription factor Factor binding Proﬁling sites of of UCP3 UCP3 Promoter promoter by Filterregion. Assay For monitoring the activation of multiple TFs of the UCP3 promoter simultaneously, Table 5. The system of experimental group and control group. Promoter-Binding TF Proﬁling Assay II was used according to the protocol provided by Signosis Inc. (Signosis Inc.,Reagent Santa Clara, CA, USA). Experimental Nuclear proteins Group were (μL) isolated Compare from longissimus Group (μL) dorsi using theTF reagents Binding and buffer protocol mix provided by a Nuclear 15 Extraction Kit (Signosis Inc., 15 Santa Clara, CA, USA). AndrogenTF Probe receptor mix (AR) was used to normalize 3 the readings for as a blank 3control (Table5). LuminescenceUCP3 promoter was reported PCR fragment as relative light units (RLUs) 5 using a multidetection microplate 0 reader (Bio Tek, Vermont,Nuclear VT, extract USA). TFSEARCH (http://diyhpl.us/~bryan/irc/protocol-online/protocol- 6 6 cache/TFSEARCH.html)ddH2O and ALGGEN ROMO (http://alggen.lsi.upc.es/)1 were used6 to predict the transcription factorTotal bindingVolume sites of UCP3 promoter region. 30 30

Table 5. The system of experimental group and control group.

Reagent Experimental Group (µL) Compare Group (µL) TF Binding buffer mix 15 15 TF Probe mix 3 3 UCP3 promoter PCR fragment 5 0 Nuclear extract 6 6 ddH2O 1 6 Total Volume 30 30 Int. J. Mol. Sci. 2016, 17, 682 12 of 15

4.6. Construction of Myogenic Regulatory Factors (MRFs) Family and MEF2A Transcription Factors Expression Vectors RNA was isolated from longissimus muscle tissue of Guanling cattle using Trizol (Invitrogen). First strand cDNA was synthesized by the Reverse transcription kit (TransGen Biotech, Beijing, China). The primers of MyoD, Myf5, Myf6, MyoG and MEF2A were designed according to the sequence of NCBI were ampliﬁed from the cDNA of longissimus dorsi (Table6). The MRFs family and MEF2A fragments were excised with restriction enzyme, which were ligated into the pcDNA3.1 (Promega, Madison, WI, USA). Then they were conﬁrmed by dual-enzyme digestion and sequencing. Recombinant expression vectors were pcDNA3.1(+)-MyoD, pcDNA3.1(+)-Myf5, pcDNA3.1(+)-Myf6, pcDNA3.1(+)-Myogenin and pcDNA3.1(+)-MEF2A respectively.

Table 6. Sequences of primers of coding sequence of MRFs family and myocyte-speciﬁc enhancer factor 2A (MEF2A) used for PCR.

Gene Length Forward Primer (51 to 31) Reverse Primer (51 to 31) Symbol (bp) MyoD EcoRI: CCGGAATTCATGGAGCTGCTGTCGC XhoI: CCGCTCGAGTCAGAGCACCTGGTAAAT 975 Myf5 EcoRI: CCGGAATTCATGGACATGATGGACGGCTG XhoI: CCGCTCGAGTCATAGCACATGATAGATG 786 KpnI: EcoRI: Myf6 745 CGGGATCCATGATGATGGACCTTTTTGAAACTGGC CGGAATTCTTACTTCTCCACCACCTCCTCCACGCAG MyoG BamHI: GGGGTACCATGGAGCTGTATGAGACCTCT EcoRI: CGGAATTCTCAGTTTGGTATGGTTTCATCTGG 691 EcoRI: MEF2A XhoI: CCGCTCGAGGTTAGGTCACCCACGCATC 1498 CCGGAATTCATGGGGCGGAAGAAAATACAA

4.7. Analyse Activity of UCP3 Promoter Purification of UCP3 promoter fragments was excised with NheI and XhoI restriction enzyme, and ligated into the pGL3-Basic, pGL3-promoter and PEGFP-N3 (Promega, Madison, WI, USA), respectively. Then they were confirmed by dual-enzyme digestion and sequencing. The C2C12 myoblasts were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). C2C12 myoblasts cells were cultured in DMEM (Hyclone, logan, UT, USA) medium with 10% fetal bovine serum (FBS) (Gibco, Aucland, New Zealand) under normal culture ˝ conditions (5% CO2 at 37 C). C2C12 myoblasts were seeded into 24-well plates at a density of 1 ˆ 105/well. C2C12 myoblasts reached 80% confluence after 18–24 h. Subsequently, C2C12 myoblasts were cultured in OPTI-MEM (500 µL/well) containing of 2 µL of lipofectamine 2000, 0.8 µg of the pGL3-Basic-ucp3-pro and pGL3-promoter-ucp3-pro recombinant vcectors and 0.06 µg of the internal control vector pRL-TK/luciferase reporter plasmid, C2C12 myoblasts was cultured in OPTI-MEM (500 µL/well), after 5 h, the OPTI-MEM medium was removed and replaced by DMEM medium containing 10% FBS. After 24 h transfection, cells were harvested, luciferase activity was measured using the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA), and then the activities of firefly luciferase in pGL3 and Renilla luciferase in pRL-TK were analyzed. Cotransfection of eukaryotic expression vectors of MyoD, Myf5, Myf6, MyoG and MEF2A with UCP3 promoter, C2C12 cells was seeded at the density of 1 ˆ 105/well into 24-well plates using DMEM containing 10% FBS medium. After 18–24 h, the plated cells were transfected with 0.6 µg of pGL3-basic-ucp3-P1 vector, 0.06 µg of the internal control vector pRL-TK, 0.2 µg of the expression vectors of pcDNA3.1(+)-MyoD, pcDNA3.1(+)-Myf5, pcDNA3.1(+)-Myf6, pcDNA3.1(+)-Myogenin and pcDNA3.1(+)-MEF2A, 2 µL of Lipofectamine 2000 using Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, NM, USA) according to the manufacturer’s protocol, and the pcDNA3.1 vectors were cotransfected with pGL3-basic-ucp3-P1, which was the control. After 5 h, the OPTI-MEM medium was replaced by DMEM medium containing 10% FBS. After 24 h transfection, luciferase activity was measured using the same techniques as those described for C2C12 myoblasts cells. Int. J. Mol. Sci. 2016, 17, 682 13 of 15

4.8. The Data Analysis Statistical analyses were performed using SPSS17.0. Data (SPSS statistics 17.0, WinWrap Basic, New York, NY, USA, 2008) were presented as the mean ˘ standard error of the mean. Statistical differences between conditions were assessed using one-way ANOVA, p < 0.05 was considered statistically signiﬁcant.

5. Conclusions The results showed that UCP3 promoter led to tissue-speciﬁc expression in the muscle. The activity of six different lengths of UCP3 promoter were determined using the dual luciferase reporter gene. The results suggest that there may be positive regulatory elements in the region of the UCP3 promoter from ´433 to ´385 bp, and there may be negative regulatory element in the region from ´620 to ´433 bp. Double luciferase assay and PEGFP-N3 recombinant vector results suggested that the region of UCP3 promoter from ´385~+3 bp may be the core promoter region. We successfully screened out that the UCP3 promoter region of Guanling cattle have transcription factor binding sites which include MyoD, TFIID, Pax3, MEF1 and MEF2 binding sites. Co-transfection experiments of the transcription factors found that Myf5, Myf6 and MyoD have a certain positive regulatory role with regard to activity of the UCP3 promoter. The result indicated that the UCP3 promoter may play an important role in the muscle tissue.

Acknowledgments: We would like to thank the research assistants and laboratory technicians who contributed to this study. This study was supported by grants from the national natural science fund of China (31401054), the major projects of Science and Technology in Guizhou Province, China (QK-major projects 2013-6008) and The Plan of Science and Technology in Guizhou Province, China (QKH-NY-2012-3008). Author Contributions: Wei Chen and Houqiang Xu conceived and coordinated the study. Wei Chen and Xiang Chen performed the tissue samples preparation and RNA isolation. Wei Chen and Zhongwei Liu participated in the statistical analysis of data. Wei Chen, Wen Zhang and Dan Xia confirmed the qRT-PCR and analyzed activity of UCP3 promoter. Wei Chen drafted the manuscript. Houqiang Xu, Xiang Chen and Zhongwei Liu reviewed the manuscript. All authors read and approved the final manuscript. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Daniel, R.; Frederic, B. The uncoupling protein homologues: UCP1, UCP2, UCP3, StUCP and AtUCP. Biochem. J. 2000, 345, 161–179. 2. Joseph, H.; Francois, C. Evolutionary history of the UCP gene family: Gene duplication and selection. BMC Evol. Biol. 2008, 8.[CrossRef] 3. Boss, O.; Samec, S.; Dulloo, A.; Seydoux, J.; Muzzin, P.; Giacobino, J.P. Tissue-dependent upregulation of rat uncoupling protein-2 expression in response to fasting or cold. FEBS Lett. 1997, 412, 111–114. [CrossRef] 4. Boss, O.; Samec, S.; Paoloni-Giacobino, A.; Rossier, C.; Dulloo, A.; Seydoux, J.; Muzzin, P.; Giacobino, J.P. Uncoupling protein-3, a new member of the mitochondrial carrier family with tissue specific expression. FEBS Lett. 1997, 408, 39–42. [CrossRef] 5. Solanes, G.; Pedraza, N.; Iglesias, R.; Giralt, M.; Villarroya, F. Functional Relationship between MyoD and Peroxisome Proliferator-Activated Receptor Dependent Regulatory Pathways in the Control of the Human Uncoupling Protein-3 Gene Transcription. Mol. Endocrinol. 2003, 17, 1944–1958. [CrossRef][PubMed] 6. Nowacka-Woszuk, J.; Szczerbal, I.; Fijak-Nowak, H.; Switonski, M. Chromosomal localization of 13 candidate genes for human obesity in the pig genome. J. Appl. Gene 2008, 49, 373–377. [CrossRef][PubMed] 7. Cioffi, F.; Senese, R.; de Lange, P.; Goglia, F.; Lanni, A.; Lombardi, A. Uncoupling proteins: A complex journey to function discovery. Biofactors 2009, 35, 417–428. [CrossRef][PubMed] 8. Nabben, M.; Hoeks, J.; Moonen-Kornips, E.; van Beurden, D.; Briedé, J.J.; Hesselink, M.K. Significance of uncoupling protein 3 in mitochondrial function upon mid- and long-term dietary high-fat exposure. FEBS Lett. 2011, 585, 4010–4017. [CrossRef][PubMed] Int. J. Mol. Sci. 2016, 17, 682 14 of 15

9. Senese, R.; Valli, V.; Moreno, M.; Lombardi, A.; Busiello, R.A.; Cioffi, F. Uncoupling protein 3 expression levels influence insulin sensitivity, fatty acid oxidation, and related signaling pathways. Pflugers Arch. 2011, 461, 153–164. [CrossRef][PubMed] 10. Nabben, M.; van Bree, B.W.; Lenaers, E.; Hoeks, J.; Hesselink, M.K.; Schaart, G.; Gijbels, M.J.; Glatz, J.F.; da Silva, G.J.; de Windt, L.J.; et al. Lack of UCP3 does not affect skeletal muscle mitochondrial function under lipid-challenged conditions, but leads to sudden cardiac death. Basic Res. Cardiol. 2014, 109, 447. [CrossRef] [PubMed] 11. Busiello, R.A.; Savarese, S.; Lombardi, A. Mitochondrial uncoupling proteins and energy metabolism. Front. Physiol. 2015, 6.[CrossRef][PubMed] 12. Goodrich, J.A.; Tjian, R. Unexpected roles for core promoter recog-nition factors in cell-type-specific transcription and gene regulation. Nat. Rev. Genet. 2010, 11, 549–558. [PubMed] 13. Colin, R.L.; Florian, M.; Sean, E.H.; James, G.M.; Jason, D.L. Genome-wide protein-DNA binding dynamics suggest a molecular clutch for transcription factor function. Nature 2012, 484, 251–255. 14. De Lange, P.; Feola, A.; Ragni, M.; Senese, R.; Moreno, M.; Lombardi, A.; Silvestri, E.; Amat, R.; Villarroya, F.; Goglia, F.; et al. Differential 3,5,3-triiodothyronine-mediated regulation of uncoupling protein 3 transcription: Role of fatty acids. Endocrinology 2007, 148, 4064–4072. [CrossRef][PubMed] 15. Zhao, D.; Liu, C.; Jia, M.; Yang, Y.; Ye, F.; Yan, Y. Progress of upstream transcriptional control elements in promoters of skeletal specific genes (in Chinese). Chin. J. Cell Biol. 2012, 34, 500–505. 16. China National Commission of Animal Genetic Resources. Animal Genetic Resources in China Bovines; China Agriculture Press: Beijing, China, 2011; Volume 5, p. 151. 17. Larkin, S.; Mull, E.; Miao, W.; Pittner, R.; Albrandt, K.; Moore, C.; Young, A.; Denaro, M.; Beaumont, K. Regulation of the third member of the uncoupling protein family, UCP3, by cold and thyroid hormone. Biochem. Biophys. Res. Commun. 1997, 240, 222–227. [CrossRef][PubMed] 18. Samec, S.; Seydoux, J.; Dulloo, A.G. Role of UCP homologues in skeletal muscles and brown adipose tissue: Mediators of thermogenesis or regulators of lipids as fuel substrate? FASEB J. 1998, 12, 715–724. [PubMed] 19. Weigle, D.S.; Selfridge, L.E.; Schwartz, M.W.; Seeley, R.J.; Cummings, D.E.; Havel, P.J.; Kuijper, J.L.; BeltrandelRio, H. Elevated free fatty acids induceuncoupling protein 3 expression in muscle: A potential explanation for the effect of fasting. Diabetes 1998, 47, 298–302. [CrossRef][PubMed] 20. Kratky, D.; Strauss, J.G.; Zechner, R. Tissue-specific activity of lipoprotein lipase in skeletal muscle regulates the expression of uncoupling protein 3 in transgenic mouse models. Biochem. J. 2001, 355, 647–652. [CrossRef] [PubMed] 21. Kim, D.; Jitrapakdee, S.; Thompson, M. Differential regulation of the promoter activity of the mouse UCP2 and UCP3 genes by MyoD and myogenin. J. Biochem. Mol. Biol. 2007, 40, 921–927. [CrossRef][PubMed] 22. Girousse, A.; Tavernier, G.; Tiraby, C.; Lichtenstein, L.; Iacovoni, J.S.; Mairal, A.; Villarroya, F.; Langin, D. Transcription of the human uncoupling protein 3 gene is governed by a complex interplay between the promoter and intronic sequences. Diabetologia 2009, 52, 1638–1646. [CrossRef][PubMed] 23. Ho, P.W.; Ho, J.W.; Liu, H.F.; So, D.H.; Tse, Z.H.; Chan, K.H.; Ramsden, D.B.; Ho, S.L. Mitochondrial neuronal uncoupling proteins: A target for potential disease-modification in Parkinson’s disease. Transl. Neurodegener. 2012, 1, 3–12. [CrossRef][PubMed] 24. Villarroya, F.; Iglesias, R.; Giralt, M. PPARs in the control of uncoupling proteins gene expression. PPAR Res. 2007, 12.[CrossRef][PubMed] 25. Buckingham, M.; Bajard, L.; Chang, T.; Daubas, P.; Hadchouel, J.; Meilhac, S.; Montarras, D.; Rocancourt, D.; Relaix, F. The formation of skeletal muscle: From somite to limb. J. Anat. 2003, 202, 59–68. [CrossRef] [PubMed] 26. Boutet, S.C.; Biressi, S.; Iori, K.; Natu, V.; Rando, T.A. Taf1 regulates Pax3 protein by monoubiquitination in skeletal muscle progenitors. Mol. Cell 2010, 40, 749–761. [CrossRef][PubMed] 27. Gros, J.; Manceau, M.; Thomé, V.; Marcelle, C. A common somitic origin for embryonic muscle progenitors and satellite cells. Nature 2005, 435, 954–958. [CrossRef][PubMed] 28. Relaix, F.; Rocancourt, D.; Mansouri, A.; Buckingham, M. A Pax3/Pax7-dependent population of skeletal muscle progenitor cells. Nature 2005, 435, 948–953. [CrossRef][PubMed] 29. Dodou, E.; Xu, S.M.; Black, B.L. MEF2c is activated directly by MyoGenic basic helix-loop-helixproteins during skeletal muscle development in vivo. Mech. Dev. 2003, 120, 1021–1032. [CrossRef] 30. Hennebry, A.; Berry, C.; Siriett, V. Myostatin regµlates fiber-type composition of skeletal muscle by regµlating MEF2 and MyoD gene expression. Am. J. Physiol. Cell Physiol. 2009, 296, C525–C534. [CrossRef][PubMed] Int. J. Mol. Sci. 2016, 17, 682 15 of 15

31. Jung, S.Y.; Ko, Y.G. TRIM72, a novel negative feedback regµlator of MyoGenesis, is transcriptionally activated by the synergism of MyoD (or MyoGenin) and MEF2. Biochem. Biophys. Res. Commun. 2010, 396, 238–245. [CrossRef][PubMed] 32. Bryantsev, A.L.; Baker, P.W.; Lovato, T.L. Differential requirements for Myocyte Enhancer Factor-2 during adult MyoGenesis in Drosophila. Dev. Biol. 2012, 361, 191–207. [CrossRef][PubMed] 33. Wang, Q.; Cao, Y.; Li, S.; Tong, H.; Xing, X.; Li, G.; Yan, Y. Cloning and preliminary functional analysis of bovine MyoG promoter (in Chinese). Acta Vet. Zootech. Sin. 2012, 43, 37–43. 34. Potthoff, M.J.; Olson, E.N. MEF2: A central regulator of diverse developmental programs. Development 2007, 134, 4131–4140. [CrossRef][PubMed] 35. Yan, C.; Xia, X.; He, J.; Ren, Z.; Xu, D.; Xiong, Y.; Zuo, B. MyoD is a novel activator of porcine FIT1 gene by interacting with the canonical E-box element during myogenesis. Int. J. Mol. Sci. 2015, 16, 25014–25030. [CrossRef][PubMed] 36. Hoffmann, C.; Zimmermann, A.; Hinney, A.; Volckmar, A.L.; Jarrett, H.W.; Fromme, T.; Klingenspor, M. A novel SP1/SP3 dependent intronic enhancer governing transcription of the UCP3 gene in brown adipocytes. PLoS ONE 2013, 8, e83426. [CrossRef][PubMed] 37. Udagawa, C.; Tada, N.; Asano, J.; Ishioka, K.; Ochiai, K.; Bonkobara, M.; Tsuchida, S.; Omi, T. The genetic association study between polymorphisms in uncoupling protein 2 and uncoupling protein 3 and metabolic data in dogs. BMC Res. Notes 2014, 7, 904. [CrossRef][PubMed]

© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).