DOCSLIB.ORG

Actinosynnemataceae Fam. Nov

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

8278 International Journal ofSystematic and Evolutionary Microbiology (2000), 50, 331-336 Printed in Great Britain Phylogenetic analysis of Saccharothrix and related taxa: proposal for Actinosynnemataceae fam. nov. David P. Labeda' and Reiner M. Kroppenstedt2 Author for correspondence: David P. Labeda. Tel: + I 3096816397. Fax: + 13096816672. e-mail: dlabeda:(rsunca.ncaur.usda.gov 1 Microbial Properties Partial sequences for 165 rONA were determined for strains of the genus Research Unit, National Saccharothrix, including most described species, as well as strains of the Center for Agricultural Utilization Research, described species of the related genera Kutzneria, Actinokineospora and Agricultural Research Actinosynnema. These were aligned with published sequences for other Service, US Department of species of these genera, as well as those of the genera'Actinoalloteichus', Agriculture, 1815 N. University Street, Peoria, ,Asiosporangium" Lentzea, Kutzneria, Streptoalloteichus and representative IL61604, USA taxa from other actinomycete families. Phylogenetic analysis of the sequence 2 DSMZ-Germany Collection data showed that species of the genera Actinokineospora, Actinosynnema, of Microorganisms and Lentzea and Saccharothrix are members of the same clade, and distinct from Cell Cultures, the Pseudonocardiaceae. It is proposed that a new family be created within the Braunschweig, Germany class Actinobacteria for these genera, to be called the Actinosynnemataceae on the basis of the oldest described genus within this family, Actinosynnema Hasegawa et al. The chemotaxonomic properties of all the genera to be placed within the new family have similar cell wall type (type III), whole-cell sugars (generally galactose although mannose and rhamnose may be present), phospholipid type (Pit) and menaquinones [MK-9(H 4 ) predominant]. Keywords: Saccharothrix. actinomycetes. Actinosynnemataceae fam. nov. INTRODUCTION (Stackebrandt et al., 1997), members of the genus Saccharothrix are again loosely grouped with the The genus Saccharothrix was described (Labeda et al., Pseudonocardiaceae. Yassin et al. (1995) noted the 1984) to accommodate actinomycete strains that mor­ close phylogenetic relationship of their new genus phologically resemble the genus Nocardiopsis, but that Lentzea to members of the genera Actinosynnellla. can be chemotaxonomically differentiated from mem­ Kutzneria and Saccharothrix. In order to clarify the bers of this genus based on type III cell wall chemistry phylogenetic position of this genus, as well as to study (Illeso-diaminopimelic acid, lIleso-DAP), rhamnose its phylogenetic continuity, 16S rDNA sequence data and galactose as diagnostic whole-cell sugars, a type were determined for representative type strains of PH phospholipid pattern (phosphatidylethanolamine species of Saccharothrix and allied genera selected as key diagnostic phospholipid), and presence of MK­ from the ARS Culture Collection. 9 (H4) as the predominant menaquinone. The actual phylogenetic position of this genus has not been METHODS certain, although it was suggested by Warwick et al. (1994), on the basis of a phylogenetic study of 16S Strains, cultivation and maintenance. All strains included in rRNA sequences, that this genus should be placed this study are held in the ARS Culture Collection (NRRL), phylogenetically with the Pseudonocardiaceae. In the National Center for Agricultural Utilization Research. str~ins recent proposal for the hierarchic classification of Peoria. IL. USA. The selected for this are shown in actinomycete taxa in the new class Actinobacteria Table 1. Primary storage ofstrains is as lyophilized ampules of mycelial and spore suspensions in sterile beef serum held at 4 dc. Working stock cultures were maintained on slants of ATCC Medium~No. 172 (Cote et al., 1984) and stored at Abbreviation: DAP, diaminopimelic acid. 4°C until needed. Biomass for extraction of DNA was The GenBank accession numbers forthe 165 rONA sequences determined in grown as 7 d streak cultures on ATCC Medium 172 agar this paper are AF114797-AFl1481 5. plates. 01165 331 D. P. Labeda and R. M. Kroppenstedt Table 1. Strains for which 16S rONA sequence data were determined in this study Strain GenBank no. Aclinokineo.ljJora diospyrosa NRRL B-240471' (= IFa 15665'1') AFI14797 AClinokineospora globicalena NRRL B-240481' (= IFa 156641') AFI14798 AClinokineospora inagensis NRRL B-2405QT (= IFa 156631') AFI14799 AClinokineospora riparia NRRL B-1 64321' AFI14802 AClino:>ynnema prelioslllll subsp. prelioslllll NRRL B-1606QT AFI14800 KlIlzneria kofilensis NRRL B-24061 l' (= JCM 3151'1") AFI14801 Saccharolhrix aerocolonigenes NRRL B-32981' AFl14804 Saccharolhrix allslraliensis NRRL 112391' AFl14803 Saccharolhrix coerllleojilsca NRRL B-16115"'" (= ATCC 351081' = DSM 436791') AFl14805 SaccharoillrLy cryophilis NRRL B-162381' AFI14806 Saccharolhrix espanaensis NRRL 157641' AFI14807 Saccharolhrixflava NRRL B-1613j1' (= ATCC 295331' = DSM 438851') AFl14808 Saccharoillrix longispora NRRL B-161161' (= ATCC 351091' = DSM 437491') AFl14809 Saccharolhrix syringae NRRL B-16468 1' (= DSM 438861') AFl14812 Saccharolhrix lexasensis NRRL B-16107 AFl14815 Saccharolhrix lexasensis NRRL B-161341' AFI14814 Saccharolhrix waywayandensis NRRL B-161591' AFI14813 Saccharolhrix species NRRL B-16108 AFI14810 SaccharOlhrix species NRRL B-16133 AFI14811 Chemotaxonomic analysis. The chemotaxonomic profile of CAAGGCCC]. Sequencing reaction mixtures were purified Lenlzea albidocapi/lala was determined using previously as recommended by Applied Biosystems and were electro­ described methods (Grund & KroppenstedL 1989) for phoresed on a 6 % (wIv) polyacrylamide sequencing gel for menaquinones, fatty acids and whole-cell sugars. 9 h using either a 373A or 377 model automated DNA sequence'i- (Applied Biosystems). DNA extraction. Genomic DNA was isolated and purified by a modification ofthe procedure of Rainey el al. (1996). Cells Phylogenetic analysis. The 16S rDNA sequences obtained in scraped from solid growth media (I-2100pfuls) were placed this study were manually aligned \vith actinomycete ref­ in a 1·5 ml microfuge tube with a small amount of 0·1 mm erence sequences obtained from the Ribosomal Database zirconia/silica beads (Biospec Products) and were ground Project (Maidak el al., 1994) and GenBank. Many of the with a conical disposable pestle (Kontes Glass Company). reference sequences obtained from the databases were partial The homogenate was suspended in 400 ~d saline-EDTA sequences and thus the data set used for analysis consisted of buffer (150 mM NaCL 10 mM EDTA: pH 8'0), 1O)l1 1% the sequences generated in this study and actinomycete (wIv) proteinase K and 10)l1 25 % (v.rjv) SDS was added, reference sequences contained information for 1384 nucleo­ mixed and incubated at 55-60°C for 10 min. The resulting tide positions. The programs contained in the PHYLIP preparation \vas extracted sequentially with an equal volume package of Felsenstein (1993) were used to calculate evol­ of phenoL and an equal volume of chloroform. DNA \vas utionary distances by the method of Kimura (1980), and recovered from the aqueous phase by using a Prep-A-Gene linkages by the neighbour-joining method of Saitou & Nei kit (Bio-Rad). The purified DNA was eluted from the (1987). The topographies of the trees resulting from these binding matrix in 30 )ll sterile distilled water. analyses were evaluated by bootstrap analysis of the data with 100 resamplings. The sequences were also subjected to Amplification and direct sequencing of the 165 rRNA gene. likelihood analysis using fastDNAml (Olsen el al., 1994) and The 16S rDNA \vas amplified by the PCR according to the PAUP 3.1 (Swofford, 1993) was used for parsimony analysis. method of Rainey el al. (1996) using the primers 27f Evolutionary trees \vere displayed and printed using version (GAGTTTGATCCTGGCTCAG) and 15251' (AGAAA­ 1.5 of the TREEVIEW program of Page (1996). GGAGGTGATCCAGCC). PCR products were purified and concentrated using a Gene-Clean II kit (Bio 10 I) and Nucleotide sequence accession numbers. The 16S rDNA \vere eluted into 30 JlI sterile distilled water. The sequencing sequences determined in this study have been deposited in reactions were performed with a PRISM Ready-Reaction the GenBank database under the accession numbers shown DyeDeoxy terminator cycle sequencing kit by using Ampli­ in Table 1. The accession numbers for the sequences of the Taq FS (Applied Biosystems) and a Perkin-Elmer Cetus strains used as representatives of the main actinomycete model 2400 thermal cycler according to the protocol and groups are as follows: 'Aclinoalloleichus cyanogriseus' IFO thermal profile recommended by Applied Biosystems. The 14455, AB006178: AClinomadura kijaniala DSM 437641' sequencing primers used \vere: 343r (CTGCTGCCTCCC­ (1' = type strain), X97890; AClinomadura madurae DSM GTA), 357f (TACGGGAGGCAGCAG), 519r [G(T/A)­ 430671', X97889: AClinoplanes phi/ippinensis DSM 430191', ATTACCGCGGC(T/G)GCTG], 536f[CAGC(C/A)GCC­ X93187: AClinosvnnema mirum DSM 438271', X84447: GCGGTAAT(T/A)C], 803f (ATTAGATACCCTGGTA­ Amycolatopsis medilerranei ATCC 136851' (= DSM 433041' G), 907r (CCGTCAATTCATTTGAGTTT), 1114f (GCA­ = IFO 134151' = IMET 765P), X76957: Amycolalopsis ACGAGCGCAACCC) and 13851' [CGGTGTGT(A/G)- melhanolica NCIB 119461', X54274; Amycolalopsis orienlalis 332 International Journal ofSystematic and Evolutionary Microbiology 50 Actinosynnelllataceae fam. nov. T T DSM 40040 (= NCIMB 9378 ), X76958 Arthrobacter DISCUSSION T globi(orlllis DSM 20124
Recommended publications
  • Successful Drug Discovery Informed by Actinobacterial Systematics

    Successful Drug Discovery Informed by Actinobacterial Systematics

    Successful Drug Discovery Informed by Actinobacterial Systematics Verrucosispora HPLC-DAD analysis of culture filtrate Structures of Abyssomicins Biological activity T DAD1, 7.382 (196 mAU,Up2) of 002-0101.D V. maris AB-18-032 mAU CH3 CH3 T extract H3C H3C Antibacterial activity (MIC): S. leeuwenhoekii C34 maris AB-18-032 175 mAU DAD1 A, Sig=210,10 150 C DAD1 B, Sig=230,10 O O DAD1 C, Sig=260,20 125 7 7 500 Rt 7.4 min DAD1 D, Sig=280,20 O O O O Growth inhibition of Gram-positive bacteria DAD1 , Sig=310,20 100 Abyssomicins DAD1 F, Sig=360,40 C 75 DAD1 G, Sig=435,40 Staphylococcus aureus (MRSA) 4 µg/ml DAD1 H, Sig=500,40 50 400 O O 25 O O Staphylococcus aureus (iVRSA) 13 µg/ml 0 CH CH3 300 400 500 nm 3 DAD1, 7.446 (300 mAU,Dn1) of 002-0101.D 300 mAU Mode of action: C HO atrop-C HO 250 atrop-C CH3 CH3 CH3 CH3 200 H C H C H C inhibitior of pABA biosynthesis 200 Rt 7.5 min H3C 3 3 3 Proximicin A Proximicin 150 HO O HO O O O O O O O O O A 100 O covalent binding to Cys263 of PabB 100 N 50 O O HO O O Sea of Japan B O O N O O (4-amino-4-deoxychorismate synthase) by 0 CH CH3 CH3 CH3 3 300 400 500 nm HO HO HO HO Michael addition -289 m 0 B D G H 2 4 6 8 10 12 14 16 min Newcastle Michael Goodfellow, School of Biology, University Newcastle University, Newcastle upon Tyne Atacama Desert In This Talk I will Consider: • Actinobacteria as a key group in the search for new therapeutic drugs.
  • Genomic and Phylogenomic Insights Into the Family Streptomycetaceae Lead

    Genomic and Phylogenomic Insights Into the Family Streptomycetaceae Lead

    1 Supplementary Material 2 Genomic and phylogenomic insights into the family Streptomycetaceae lead 3 to proposal of Charcoactinosporaceae fam. nov. and 8 novel genera with 4 emended descriptions of Streptomyces calvus 5 Munusamy Madhaiyan1, †, *, Venkatakrishnan Sivaraj Saravanan2, †, Wah-Seng See-Too3, † 6 1Temasek Life Sciences Laboratory, 1 Research Link, National University of Singapore, 7 Singapore 117604; 2Department of Microbiology, Indira Gandhi College of Arts and Science, 8 Kathirkamam 605009, Pondicherry, India; 3Division of Genetics and Molecular Biology, 9 Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, 10 Malaysia 1 11 Table S3. List of the core genes in the genome used for phylogenomic analysis. NCBI Protein Accession Gene WP_074993204.1 NUDIX hydrolase WP_070028582.1 YggS family pyridoxal phosphate-dependent enzyme WP_074992763.1 ParB/RepB/Spo0J family partition protein WP_070022023.1 lipoyl(octanoyl) transferase LipB WP_070025151.1 FABP family protein WP_070027039.1 heat-inducible transcriptional repressor HrcA WP_074992865.1 folate-binding protein YgfZ WP_074992658.1 recombination protein RecR WP_074991826.1 HIT domain-containing protein WP_070024163.1 adenylosuccinate synthase WP_009190566.1 anti-sigma regulatory factor WP_071828679.1 preprotein translocase subunit SecG WP_070026304.1 50S ribosomal protein L13 WP_009190144.1 30S ribosomal protein S5 WP_014674378.1 30S ribosomal protein S8 WP_070026314.1 50S ribosomal protein L5 WP_009300593.1 30S ribosomal protein S13 WP_003998809.1
  • Download (831Kb)

    Download (831Kb)

    Kent Academic Repository Full text document (pdf) Citation for published version Wichner, Dominik and Idris, Hamidah and Houssen, Wael E and McEwan, Andrew R and Bull, Alan T. and Asenjo, Juan A and Goodfellow, Michael and Jaspars, Marcel and Ebel, Rainer and Rateb, Mostafa E (2016) Isolation and anti-HIV-1 integrase activity of lentzeosides A–F from extremotolerant lentzea sp. H45, a strain isolated from a high-altitude Atacama Desert soil. The DOI https://doi.org/10.1038/ja.2016.78 Link to record in KAR https://kar.kent.ac.uk/61946/ Document Version Author's Accepted Manuscript Copyright & reuse Content in the Kent Academic Repository is made available for research purposes. Unless otherwise stated all content is protected by copyright and in the absence of an open licence (eg Creative Commons), permissions for further reuse of content should be sought from the publisher, author or other copyright holder. Versions of research The version in the Kent Academic Repository may differ from the final published version. Users are advised to check http://kar.kent.ac.uk for the status of the paper. Users should always cite the published version of record. Enquiries For any further enquiries regarding the licence status of this document, please contact: [email protected] If you believe this document infringes copyright then please contact the KAR admin team with the take-down information provided at http://kar.kent.ac.uk/contact.html 1 Isolation and Anti-HIV-1 Integrase Activity of Lentzeosides A-F from Extremotolerant 2 Lentzea sp. H45, a strain isolated from a high altitude Atacama Desert soil 3 Running head: Lentzeosides A-F from Extremotolerant Lentzea sp.
  • The Degradative Capabilities of New Amycolatopsis Isolates on Polylactic Acid

    The Degradative Capabilities of New Amycolatopsis Isolates on Polylactic Acid

    microorganisms Article The Degradative Capabilities of New Amycolatopsis Isolates on Polylactic Acid Francesca Decorosi 1,2, Maria Luna Exana 1,2, Francesco Pini 1,2, Alessandra Adessi 1 , Anna Messini 1, Luciana Giovannetti 1,2 and Carlo Viti 1,2,* 1 Department of Agriculture, Food, Environment and Forestry (DAGRI)—University of Florence, Piazzale delle Cascine 18, I50144 Florence, Italy; francesca.decorosi@unifi.it (F.D.); [email protected] (M.L.E.); francesco.pini@unifi.it (F.P.); alessandra.adessi@unifi.it (A.A.); anna.messini@unifi.it (A.M.); luciana.giovannetti@unifi.it (L.G.) 2 Genexpress Laboratory, Department of Agriculture, Food, Environment and Forestry (DAGRI)—University of Florence, Via della Lastruccia 14, I50019 Sesto Fiorentino, Italy * Correspondence: carlo.viti@unifi.it; Tel.: +39-05-5457-3224 Received: 15 October 2019; Accepted: 18 November 2019; Published: 20 November 2019 Abstract: Polylactic acid (PLA), a bioplastic synthesized from lactic acid, has a broad range of applications owing to its excellent proprieties such as a high melting point, good mechanical strength, transparency, and ease of fabrication. However, the safe disposal of PLA is an emerging environmental problem: it resists microbial attack in environmental conditions, and the frequency of PLA-degrading microorganisms in soil is very low. To date, a limited number of PLA-degrading bacteria have been isolated, and most are actinomycetes. In this work, a method for the selection of rare actinomycetes with extracellular proteolytic activity was established, and the technique was used to isolate four mesophilic actinomycetes with the ability to degrade emulsified PLA in agar plates. All four strains—designated SO1.1, SO1.2, SNC, and SST—belong to the genus Amycolatopsis.
  • Pseudonocardia Parietis Sp. Nov., from the Indoor Environment

    Pseudonocardia Parietis Sp. Nov., from the Indoor Environment

    This is an author manuscript that has been accepted for publication in International Journal of Systematic and Evolutionary Microbiology, copyright Society for General Microbiology, but has not been copy-edited, formatted or proofed. Cite this article as appearing in International Journal of Systematic and Evolutionary Microbiology. This version of the manuscript may not be duplicated or reproduced, other than for personal use or within the rule of ‘Fair Use of Copyrighted Materials’ (section 17, Title 17, US Code), without permission from the copyright owner, Society for General Microbiology. The Society for General Microbiology disclaims any responsibility or liability for errors or omissions in this version of the manuscript or in any version derived from it by any other parties. The final copy-edited, published article, which is the version of record, can be found at http://ijs.sgmjournals.org, and is freely available without a subscription 24 months after publication. First published in: Int J Syst Evol Microbiol, 2009. 59(10) 2449-52. doi:10.1099/ijs.0.009993-0 Pseudonocardia parietis sp. nov., from the indoor environment J. Scha¨fer,1 H.-J. Busse2 and P. Ka¨mpfer1 Correspondence 1Institut fu¨r Angewandte Mikrobiologie, Justus-Liebig-Universita¨t Giessen, D-35392 Giessen, P. Ka¨mpfer Germany [email protected] 2Institut fu¨r Bakteriologie, Mykologie und Hygiene, Veterina¨rmedizinische Universita¨t, A-1210 Wien, giessen.de Austria A Gram-positive, rod-shaped, non-endospore-forming, mycelium-forming actinobacterium (04- St-002T) was isolated from the wall of an indoor environment colonized with moulds. On the basis of 16S rRNA gene sequence similarity studies, strain 04-St-002T was shown to belong to the family Pseudonocardiaceae, and to be most closely related to Pseudonocardia antarctica (99.2 %) and Pseudonocardia alni (99.1 %).
  • Transition from Unclassified Ktedonobacterales to Actinobacteria During Amorphous Silica Precipitation in a Quartzite Cave Envir

    Transition from Unclassified Ktedonobacterales to Actinobacteria During Amorphous Silica Precipitation in a Quartzite Cave Envir

    www.nature.com/scientificreports OPEN Transition from unclassifed Ktedonobacterales to Actinobacteria during amorphous silica precipitation in a quartzite cave environment D. Ghezzi1,2, F. Sauro3,4,5, A. Columbu3, C. Carbone6, P.‑Y. Hong7, F. Vergara4,5, J. De Waele3 & M. Cappelletti1* The orthoquartzite Imawarì Yeuta cave hosts exceptional silica speleothems and represents a unique model system to study the geomicrobiology associated to silica amorphization processes under aphotic and stable physical–chemical conditions. In this study, three consecutive evolution steps in the formation of a peculiar blackish coralloid silica speleothem were studied using a combination of morphological, mineralogical/elemental and microbiological analyses. Microbial communities were characterized using Illumina sequencing of 16S rRNA gene and clone library analysis of carbon monoxide dehydrogenase (coxL) and hydrogenase (hypD) genes involved in atmospheric trace gases utilization. The frst stage of the silica amorphization process was dominated by members of a still undescribed microbial lineage belonging to the Ktedonobacterales order, probably involved in the pioneering colonization of quartzitic environments. Actinobacteria of the Pseudonocardiaceae and Acidothermaceae families dominated the intermediate amorphous silica speleothem and the fnal coralloid silica speleothem, respectively. The atmospheric trace gases oxidizers mostly corresponded to the main bacterial taxa present in each speleothem stage. These results provide novel understanding of the microbial community structure accompanying amorphization processes and of coxL and hypD gene expression possibly driving atmospheric trace gases metabolism in dark oligotrophic caves. Silicon is one of the most abundant elements in the Earth’s crust and can be broadly found in the form of silicates, aluminosilicates and silicon dioxide (e.g., quartz, amorphous silica).
  • Marine Rare Actinomycetes: a Promising Source of Structurally Diverse and Unique Novel Natural Products

    Marine Rare Actinomycetes: a Promising Source of Structurally Diverse and Unique Novel Natural Products

    Review Marine Rare Actinomycetes: A Promising Source of Structurally Diverse and Unique Novel Natural Products Ramesh Subramani 1 and Detmer Sipkema 2,* 1 School of Biological and Chemical Sciences, Faculty of Science, Technology & Environment, The University of the South Pacific, Laucala Campus, Private Mail Bag, Suva, Republic of Fiji; [email protected] 2 Laboratory of Microbiology, Wageningen University & Research, Stippeneng 4, 6708 WE Wageningen, The Netherlands * Correspondence: [email protected]; Tel.: +31-317-483113 Received: 7 March 2019; Accepted: 23 April 2019; Published: 26 April 2019 Abstract: Rare actinomycetes are prolific in the marine environment; however, knowledge about their diversity, distribution and biochemistry is limited. Marine rare actinomycetes represent a rather untapped source of chemically diverse secondary metabolites and novel bioactive compounds. In this review, we aim to summarize the present knowledge on the isolation, diversity, distribution and natural product discovery of marine rare actinomycetes reported from mid-2013 to 2017. A total of 97 new species, representing 9 novel genera and belonging to 27 families of marine rare actinomycetes have been reported, with the highest numbers of novel isolates from the families Pseudonocardiaceae, Demequinaceae, Micromonosporaceae and Nocardioidaceae. Additionally, this study reviewed 167 new bioactive compounds produced by 58 different rare actinomycete species representing 24 genera. Most of the compounds produced by the marine rare actinomycetes present antibacterial, antifungal, antiparasitic, anticancer or antimalarial activities. The highest numbers of natural products were derived from the genera Nocardiopsis, Micromonospora, Salinispora and Pseudonocardia. Members of the genus Micromonospora were revealed to be the richest source of chemically diverse and unique bioactive natural products.
  • 1 Supplementary Material a Major Clade of Prokaryotes with Ancient

    1 Supplementary Material a Major Clade of Prokaryotes with Ancient

    Supplementary Material A major clade of prokaryotes with ancient adaptations to life on land Fabia U. Battistuzzi and S. Blair Hedges Data assembly and phylogenetic analyses Protein data set: Amino acid sequences of 25 protein-coding genes (“proteins”) were concatenated in an alignment of 18,586 amino acid sites and 283 species. These proteins included: 15 ribosomal proteins (RPL1, 2, 3, 5, 6, 11, 13, 16; RPS2, 3, 4, 5, 7, 9, 11), four genes (RNA polymerase alpha, beta, and gamma subunits, Transcription antitermination factor NusG) from the functional category of Transcription, three proteins (Elongation factor G, Elongation factor Tu, Translation initiation factor IF2) of the Translation, Ribosomal Structure and Biogenesis functional category, one protein (DNA polymerase III, beta subunit) of the DNA Replication, Recombination and repair category, one protein (Preprotein translocase SecY) of the Cell Motility and Secretion category, and one protein (O-sialoglycoprotein endopeptidase) of the Posttranslational Modification, Protein Turnover, Chaperones category, as annotated in the Cluster of Orthologous Groups (COG) (Tatusov et al. 2001). After removal of multiple strains of the same species, GBlocks 0.91b (Castresana 2000) was applied to each protein in the concatenation to delete poorly aligned sites (i.e., sites with gaps in more than 50% of the species and conserved in less than 50% of the species) with the following parameters: minimum number of sequences for a conserved position: 110, minimum number of sequences for a flank position: 110, maximum number of contiguous non-conserved positions: 32000, allowed gap positions: with half. The signal-to-noise ratio was determined by altering the “minimum length of a block” parameter.
  • Complete Genome Sequence of Jiangella Gansuensis Strain YIM 002T (DSM 44835T), the Type Species of the Genus Jiangella and Source of New Antibiotic Compounds

    Complete Genome Sequence of Jiangella Gansuensis Strain YIM 002T (DSM 44835T), the Type Species of the Genus Jiangella and Source of New Antibiotic Compounds

    UC Davis UC Davis Previously Published Works Title Complete genome sequence of Jiangella gansuensis strain YIM 002T (DSM 44835T), the type species of the genus Jiangella and source of new antibiotic compounds. Permalink https://escholarship.org/uc/item/34s6p01n Journal Standards in genomic sciences, 12(1) ISSN 1944-3277 Authors Jiao, Jian-Yu Carro, Lorena Liu, Lan et al. Publication Date 2017 DOI 10.1186/s40793-017-0226-6 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Jiao et al. Standards in Genomic Sciences (2017) 12:21 DOI 10.1186/s40793-017-0226-6 SHORTGENOMEREPORT Open Access Complete genome sequence of Jiangella gansuensis strain YIM 002T (DSM 44835T), the type species of the genus Jiangella and source of new antibiotic compounds Jian-Yu Jiao1, Lorena Carro2, Lan Liu1, Xiao-Yang Gao3, Xiao-Tong Zhang1, Wael N. Hozzein4,12, Alla Lapidus5,6, Marcel Huntemann7, T. B. K. Reddy7, Neha Varghese7, Michalis Hadjithomas7, Natalia N. Ivanova7, Markus Göker8, Manoj Pillay9, Jonathan A. Eisen10, Tanja Woyke7, Hans-Peter Klenk2,8*, Nikos C. Kyrpides7,11 and Wen-Jun Li1,13* Abstract Jiangella gansuensis strain YIM 002T is the type strain of the type species of the genus Jiangella, which is at the present time composed of five species, and was isolated from desert soil sample in Gansu Province (China). The five strains of this genus are clustered in a monophyletic group when closer actinobacterial genera are used to infer a 16S rRNA gene sequence phylogeny. The study of this genome is part of the Genomic Encyclopedia of Bacteria and Archaea project, and here we describe the complete genome sequence and annotation of this taxon.
  • Pseudonocardia Asaccharolytica Sp. Nov. and Pseudonocardia Sulfidoxydans Sp

    Pseudonocardia Asaccharolytica Sp. Nov. and Pseudonocardia Sulfidoxydans Sp

    International Journal of Systematic Bacteriology (1998), 48, 441-449 Printed in Great Britain Pseudonocardia asaccharolytica sp. nov. and Pseudonocardia sulfidoxydans sp. nov., two new dimethyl disulf ide-degrading actinomycetes and emended description of the genus Pseudonocardia Katrin Reichert,’ Andre Lipski,’ Silke Pradella,2 Erko Stackebrandt2 and Karlheinz Altendorf’ Author for correspondence: Andre Lipski. Fax: +49 541 969 2870. e-mail : Lipski@sfbbiol .biologie.uni-osnabrueck.de 1 Abteilung Mikrobiologie, Seven bacterial strains capable of oxidizing methyl sulfides were isolated from Universitat Osnabruck, experimental biofilters filled with tree-bark compost. The isolates could be Fachbereich BiologieKhemie, D-49069 divided into two groups according to their method of methyl sulfide Osnabruck, Germany degradation. Four isolates could use only dimethyl disulfide as the sole source * Deutsche Sammlung von of energy and three strains were able to use dimethyl sulfide and dimethyl Mikroorganismen und disulfide. Oxidation of the methyl sulfides by both groups led to the Zellkulturen GmbH, stoichiometric formation of sulfate. Chemotaxonomic, morphological, Mascheroder Weg 1b, D-38124 Braunschweig, physiological and phylogenetic properties identified all isolates as members of Germany the genus Pseudonocardia. The absence of phosphatidylcholine from the polar lipid pattern, as well as results of 16s rDNA analyses, led to the proposal of two new species, Pseudonocadia asaccharolytica sp. nov. and Pseudonocardia sulfidoxydans sp. nov.
  • Microbiome and Metagenome Analysis Reveals Huanglongbing Affects the Abundance of Citrus Rhizosphere Bacteria Associated with Resistance and Energy Metabolism

    Microbiome and Metagenome Analysis Reveals Huanglongbing Affects the Abundance of Citrus Rhizosphere Bacteria Associated with Resistance and Energy Metabolism

    horticulturae Article Microbiome and Metagenome Analysis Reveals Huanglongbing Affects the Abundance of Citrus Rhizosphere Bacteria Associated with Resistance and Energy Metabolism Hongfei Li 1, Fang Song 1 , Xiaoxiao Wu 2, Chongling Deng 2, Qiang Xu 1 , Shu’ang Peng 1 and Zhiyong Pan 1,* 1 Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan 430070, China; [email protected] (H.L.); [email protected] (F.S.); [email protected] (Q.X.); [email protected] (S.P.) 2 Guangxi Academy of Specialty Crops/Guangxi Citrus Breeding and Cultivation Research Center of Engineering Technology, Guilin 541004, China; [email protected] (X.W.); [email protected] (C.D.) * Correspondence: [email protected] Abstract: The plant rhizosphere microbiome is known to play a vital role in plant health by com- peting with pathogens or inducing plant resistance. This study aims to investigate rhizosphere microorganisms responsive to a devastating citrus disease caused by ‘Candidatus Liberibacter asiaticus’ (CLas) infection, by using 16S rRNA sequencing and metagenome technologies. The results show that 30 rhizosphere and 14 root bacterial genera were significantly affected by CLas infection, including 9 plant resistance-associated bacterial genera. Among these, Amycolatopsis, Sphingopyxis, Chryseobac- terium, Flavobacterium, Ralstonia, Stenotrophomonas, Duganella, and Streptacidiphilus were considerably Citation: Li, H.; Song, F.; Xu, Q.; enriched in CLas-infected roots, while Rhizobium was significantly decreased. Metagenome analysis Peng, S.; Pan, Z.; Wu, X.; Deng, C. revealed that the abundance of genes involved in carbohydrate metabolism, such as glycolysis, starch Microbiome and Metagenome and sucrose metabolism, amino sugar and nucleotide sugar metabolism, was significantly reduced Analysis Reveals Huanglongbing in the CLas-infected citrus rhizosphere microbial community.
  • Isolation and Anti-HIV-1 Integrase Activity of Lentzeosides A–F from Extremotolerant Lentzea Sp

    Isolation and Anti-HIV-1 Integrase Activity of Lentzeosides A–F from Extremotolerant Lentzea Sp

    The Journal of Antibiotics (2017) 70, 448–453 & 2017 Japan Antibiotics Research Association All rights reserved 0021-8820/17 www.nature.com/ja ORIGINAL ARTICLE Isolation and anti-HIV-1 integrase activity of lentzeosides A–F from extremotolerant lentzea sp. H45, a strain isolated from a high-altitude Atacama Desert soil Dominik Wichner1,2, Hamidah Idris3, Wael E Houssen1,4,5, Andrew R McEwan1,4, Alan T Bull6, Juan A Asenjo7, Michael Goodfellow3, Marcel Jaspars1, Rainer Ebel1 and Mostafa E Rateb1,8,9 The extremotolerant isolate H45 was one of several actinomycetes isolated from a high-altitude Atacama Desert soil collected in northwest Chile. The isolate was identified as a new Lentzea sp. using a combination of chemotaxonomic, morphological and phylogenetic properties. Large scale fermentation of the strain in two different media followed by chromatographic purification led to the isolation of six new diene and monoene glycosides named lentzeosides A–F, together with the known compound (Z)-3-hexenyl glucoside. The structures of the new compounds were confirmed by HRESIMS and NMR analyses. Compounds 1–6 displayed moderate inhibitory activity against HIV integrase. The Journal of Antibiotics (2017) 70, 448–453; doi:10.1038/ja.2016.78; published online 29 June 2016 INTRODUCTION extreme hyper-arid soils.8,9 Biological and genome-guided screening of Natural products are known to be a rich source of diverse chemical some of these actinomycetes has led to the isolation and characteriza- scaffolds for drug discovery. However, their use has diminished in the tion of new natural products belonging to diverse structural classes past two decades, mainly due to technical barriers when screening and exhibiting various biological activities, as exemplified by the natural products in high-throughput assays against molecular targets antimicrobial chaxamycins and chaxalactins isolated from Streptomyces and to their limited availability for clinical trials.1 In addition, the leeuwenhoekii C34T, the abenquines from Streptomyces sp.