DOCSLIB.ORG

GSTM4 Is a Microsatellite-Containing EWS&Sol;FLI Target Involved in Ewing&Apos;S Sarcoma Oncogenesis and Therapeutic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
GSTM4 Is a Microsatellite-Containing EWS&Sol;FLI Target Involved in Ewing&Apos;S Sarcoma Oncogenesis and Therapeutic Oncogene (2009) 28, 4126–4132 & 2009 Macmillan Publishers Limited All rights reserved 0950-9232/09 $32.00 www.nature.com/onc SHORT COMMUNICATION GSTM4 is a microsatellite-containing EWS/FLI target involved in Ewing’s sarcoma oncogenesis and therapeutic resistance W Luo1,2, K Gangwal1,2, S Sankar1,2, KM Boucher1, D Thomas3 and SL Lessnick1,2,4 1Department of Oncological Sciences, University of Utah School of Medicine, Salt Lake City, UT, USA; 2The Center for Children’s Cancer Research, Huntsman Cancer Institute, University of Utah, Salt Lake City, UT, USA; 3Department of Pathology, University of Michigan, Ann Arbor, MI, USA and 4Division of Pediatric Hematology/Oncology, University of Utah School of Medicine, Salt Lake City, UT, USA Ewing’s sarcoma is a malignant bone-associated tumor of Most cases of Ewing’s sarcoma harbor recurrent children and young adults. Most cases of Ewing’s sarcoma chromosomal translocations, the most common express the EWS/FLI fusion protein. EWS/FLI functions of which encodes the EWS/FLI fusion oncoprotein as an aberrant ETS-type transcription factor and serves (Delattre et al., 1992). EWS/FLI requires both its strong as the master regulator of Ewing’s sarcoma-transformed transcriptional activation domain (derived from EWS) phenotype. We recently showed that EWS/FLI regulates and its ETS-type DNA-binding domain (derived from one of its key targets, NR0B1, through a GGAA- FLI) for oncogenic function (May et al., 1993a, b). A microsatellite in its promoter. Whether other critical variety of studies have identified a large number of EWS/FLI targets are also regulated by GGAA-micro- EWS/FLI-regulated genes (Prieur et al., 2004; Smith satellites was unknown. In this study, we combined et al., 2006). However, only a handful of these genes transcriptional analysis, whole genome localization data, have been shown to participate in Ewing’s sarcoma and RNA interference knockdown to identify glutathione oncogenesis. It seems likely that other EWS/FLI- S-transferase M4 (GSTM4) as a critical EWS/FLI target regulated genes will be involved in oncogenic transfor- gene in Ewing’s sarcoma. We found that EWS/FLI mation or other cancer-relevant phenotypes, such as directly binds the GSTM4 promoter, and regulates invasion, migration, angiogenesis or drug resistance. GSTM4 expression through a GGAA-microsatellite in One of the challenges, however, for identifying which its promoter. Reduction of GSTM4 levels caused a loss of EWS/FLI targets participate in cancer-relevant pheno- oncogenic transformation. Furthermore, reduction of types is the complexity of assays required to assess many GSTM4 resulted in an increased sensitivity of Ewing’s of these phenotypes, which precludes the development sarcoma cells to chemotherapeutic agents, suggesting a of high-throughput screening approaches. An alternate role for this protein in drug resistance. Consistent with this approach, then, is to limit the number of gene products hypothesis, patients with Ewing’s sarcoma whose tumors to be assessed in a lower-throughput screening assays, had higher levels of GSTM4 expression had worse for example, by comparing microarray profiles across outcomes than those with lower expression levels. These multiple different experiments (Kinsey et al., 2006; data show that GSTM4 contributes to the cancerous Hancock and Lessnick, 2008), or by identifying which behavior of Ewing’s sarcoma and define a wider role for genes are ‘direct’ EWS/FLI targets (Gangwal et al., GGAA-microsatellites in EWS/FLI function than pre- 2008). viously appreciated. These data also suggest a novel We recently showed that EWS/FLI uses a GGAA- therapeutic resistance mechanism, in which the central microsatellite to regulate NR0B1, a gene that is required oncogenic abnormality directly regulates a resistance for oncogenic transformation in Ewing’s sarcoma cells gene. (Kinsey et al., 2006; Gangwal et al., 2008). During the Oncogene (2009) 28, 4126–4132; doi:10.1038/onc.2009.262; course of these studies, we identified thousands of published online 31 August 2009 GGAA-microsatellite-containing genes, suggesting that at least a portion of these might be regulated by direct Keywords: Ewing’s sarcoma; EWS/FLI; GSTM4; trans- binding of EWS/FLI to their promoters. We further formation hypothesized that other GGAA-microsatellite-contain- ing genes might also be required for oncogenic transformation, or other cancer-relevant phenotypes (Gangwal and Lessnick, 2008). To evaluate this hypothesis, we now compare three Correspondence: Dr SL Lessnick, Center for Children’s Cancer data sets we had previously generated to identify genes Research, Huntsman Cancer Institute, 2000 Circle of Hope, Room that might be directly regulated by EWS/FLI though 4242, Salt Lake City, UT 84112, USA. E-mail: [email protected] GGAA-microsatellites. These data sets included (i) the Received 25 March 2009; revised 20 July 2009; accepted 28 July 2009; transcriptional profile of EWS/FLI in Ewing’s sarcoma published online 31 August 2009 cells (produced by comparing patient-derived Ewing’s GSTM4 in Ewing’s sarcoma W Luo et al 4127 sarcoma cells with retroviral-mediated RNA interfer- GSTM4 has a high level of amino-acid sequence ence (RNAi) constructs targeting EWS/FLI with those identity, but distinct physiochemical properties and harboring control constructs; Kinsey et al., 2006; Smith tissue distributions, as compared with other GSTMs et al., 2006), (ii) genome-wide localization data of EWS/ (Comstock et al., 1993, 1994). GSTM4 does not show FLI in Ewing’s sarcoma cells (produced by ‘ChIP-chip’ comparable activity with the standard GST substrate experiments; Gangwal et al., 2008) and (iii) comprehen- and its specific substrates have yet to be identified. GST sive mapping data of GGAA-microsatellites in the genes are known to be highly polymorphic to accom- human genome (produced computationally; Gangwal modate an increasing number of foreign compounds et al., 2008). Through these cross-platform comparisons, (Hayes and Strange, 2000). This polymorphism can we identified genes that have all of the characteristics we change an individual’s susceptibility to disease and sought. These genes include previously identified EWS/ responsiveness to therapeutic drugs. For instance, a FLI targets such as NR0B1, FCGRT and CAV1 (Tirado T2517C polymorphism in GSTM4 was shown to et al., 2006; Gangwal et al., 2008). In addition, we associate with an increased risk of developing lung identified glutathione S-transferase mu 4 (GSTM4)asa cancer (Liloglou et al., 2002). The mechanistic basis for potential new EWS/FLI target gene in Ewing’s sarcoma. this association is currently unknown. Glutathione S-transferases (GST) are detoxification To evaluate the role of EWS/FLI in regulating enzymes which inactivate a variety of endogenous and GSTM4, we first extracted the GSTM4 data from our exogenous reactive compounds by conjugation to transcriptional profiling studies (Kinsey et al., 2006; glutathione. At present, eight distinct classes (alpha, Smith et al., 2006). In these studies, two different kappa, mu, omega, sigma, theta, pi and zeta) of soluble retroviral RNAi constructs targeting the 30-UTR of and six membrane-bound GSTs have been identified. endogenous EWS/FLI (EF-2-RNAi and EF-4-RNAi) GSTM4 belongs to the mu class of soluble forms. were introduced into patient-derived Ewing’s sarcoma 300 2000 AAAGAAAGAAAGAAAAGAAAGAAAG l * e 1.2 AAAGAAAGAAAGAAAGAAAGAAAGA v 250 AAGAAAGAAAAGAAAGAAAGAAAGA e l * o AAGAAAGAAAGAAAGAAAGAAAGAA i n 1 t 1900 AGAAAGAAAGGAAAGAAAGAAAAGA o p i 200 i r s AAGAAAGAAAGGAAAGAAAGAAAGA c 0.8 s AAGAAGGAAGGAAGGAAGGAAGGAA s e r 150 n GGAAGGAAGGAAGGGAAGGAAGGAA p a 0.6 r x 1800 GGAAGGAAGGAAGGAAGGAAGGAAG t e GAAGGATACCCAGAAGCTTCTAAAA 4 100 0.4 TGAGGAAAGCACAGATAATCTGGTG M T GACCATCCAGGAAGGATAATTGATT 0.2 S 50 1700 TCTCTCATACAAGATGCAATTCCCA G Relative0 n TAGTAGGAATAAAACAAGATATATG 0 i i Ai Ai NA NA RN RN -R -R c- 2- uc -2 Lu F- L EF E GSTM4 GSTM4 microsatelite * 14 TC71 12 HEK293 10 * microsatelite * t 12 * 10 n 8 e 10 m 8 e c 6 n 8 a 6 h n 4 6 e d 4 l 4 control control o 2 vector vector F 2 2 Relative luciferase activity Relative luciferase activity 0 0 I 0 FL S1 1 i i i i tor A or A S/ T LK A A A A c N ct N W E E RN RN RN RN ve cD ve cD E 2- 2- ty LI ty LI F- F- p /F p /F E ERG- E ERG- Em S Em S EW EW Figure 1 GSTM4 is regulated by EWS/FLI binding to a GGAA-microsatellite in its promoter in Ewing’s sarcoma. (a) GSTM4 transcriptional profiling data extracted from Smith et al., 2006. EF-2-RNAi is a retroviral construct targeting EWS/FLI, while luc-RNAi is a negative control construct. In this and subsequent panels, columns indicate the mean of triplicate samples; error bars indicate the s.d.; asterisks indicate Po0.05. (b) Quantitative reverse transcription–PCR results for GSTM4 RNA levels from A673 Ewing’s sarcoma cells infected with the indicated retroviral RNAi constructs and selected in puromycin (primer sequences available upon request). (c) Partial sequence of GSTM4 promoter with GGAA-microsatellite indicated. (d) Luciferase assays using a pGL3- promoter luciferase vector (Promega Corporation, Madison, WI, USA) containing the GSTM4 GGAA-microsatellite, or an empty control vector, co-transfected into TC71 Ewing’s sarcoma cells with the EWS/FLI RNAi construct (EF-2-RNAi), or a negative control construct (ERG-RNAi). Luciferase activities were determined as previously described (Gangwal et al., 2008). (e) Luciferase assays using a pGL3-promoter luciferase vector containing the GSTM4 GGAA-microsatellite, or an empty control vector, co-transfected into HEK293 cells with an EWS/FLI cDNA expression vector, or an empty negative control construct (Gangwal et al., 2008). (f) Chromatin immunoprecipitation of the GGAA-microsatellite-containing region of the GSTM4 promoter from A673 cells was carried out by using antibodies against FLI (which recognizes EWS/FLI), ETS1 or ELK1 (see Gangwal et al., 2008 for experimental details; primer sequences available upon request).
Load more

Recommended publications
  • Systems and Chemical Biology Approaches to Study Cell Function and Response to Toxins
    Dissertation submitted to the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany for the degree of Doctor of Natural Sciences Presented by MSc. Yingying Jiang born in Shandong, China Oral-examination: Systems and chemical biology approaches to study cell function and response to toxins Referees: Prof. Dr. Rob Russell Prof. Dr. Stefan Wölfl CONTRIBUTIONS The chapter III of this thesis was submitted for publishing under the title “Drug mechanism predominates over toxicity mechanisms in drug induced gene expression” by Yingying Jiang, Tobias C. Fuchs, Kristina Erdeljan, Bojana Lazerevic, Philip Hewitt, Gordana Apic & Robert B. Russell. For chapter III, text phrases, selected tables, figures are based on this submitted manuscript that has been originally written by myself. i ABSTRACT Toxicity is one of the main causes of failure during drug discovery, and of withdrawal once drugs reached the market. Prediction of potential toxicities in the early stage of drug development has thus become of great interest to reduce such costly failures. Since toxicity results from chemical perturbation of biological systems, we combined biological and chemical strategies to help understand and ultimately predict drug toxicities. First, we proposed a systematic strategy to predict and understand the mechanistic interpretation of drug toxicities based on chemical fragments. Fragments frequently found in chemicals with certain toxicities were defined as structural alerts for use in prediction. Some of the predictions were supported with mechanistic interpretation by integrating fragment- chemical, chemical-protein, protein-protein interactions and gene expression data. Next, we systematically deciphered the mechanisms of drug actions and toxicities by analyzing the associations of drugs’ chemical features, biological features and their gene expression profiles from the TG-GATEs database.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • GSTM4 (1-218, His-Tag) Human Protein – AR09587PU-L | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AR09587PU-L GSTM4 (1-218, His-tag) Human Protein Product data: Product Type: Recombinant Proteins Description: GSTM4 (1-218, His-tag) human recombinant protein, 0.5 mg Species: Human Expression Host: E. coli Tag: His-tag Predicted MW: 27.7 kDa Concentration: lot specific Purity: >95% by SDS - PAGE Buffer: Presentation State: Purified State: Liquid purified protein Buffer System: 20 mM Tris-HCl buffer (pH 8.0) containing 1 mM DTT, 10% glycerol, 50 mM NaCl Preparation: Liquid purified protein Protein Description: Recombinant human GSTM4 protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. Storage: Store undiluted at 2-8°C for up to two weeks or (in aliquots) at -20°C or -70°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. RefSeq: NP_000841 Locus ID: 2948 UniProt ID: Q03013, A0A140VKE3 Cytogenetics: 1p13.3 Synonyms: GSTM4-4; GTM4 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 GSTM4 (1-218, His-tag) Human Protein – AR09587PU-L Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta.
    [Show full text]
  • Snps in Genes Coding for ROS Metabolism and Signalling in Association with Docetaxel Clearance
    The Pharmacogenomics Journal (2010) 10, 513–523 & 2010 Macmillan Publishers Limited. All rights reserved 1470-269X/10 www.nature.com/tpj ORIGINAL ARTICLE SNPs in genes coding for ROS metabolism and signalling in association with docetaxel clearance H Edvardsen1,2, PF Brunsvig3, The dose of docetaxel is currently calculated based on body surface area 1,4 5 and does not reflect the pharmacokinetic, metabolic potential or genetic H Solvang , A Tsalenko , background of the patients. The influence of genetic variation on the 6 7 A Andersen , A-C Syvanen , clearance of docetaxel was analysed in a two-stage analysis. In step one, 583 Z Yakhini5, A-L Børresen-Dale1,2, single-nucleotide polymorphisms (SNPs) in 203 genes were genotyped on H Olsen6, S Aamdal3 and samples from 24 patients with locally advanced non-small cell lung cancer. 1,2 We found that many of the genes harbour several SNPs associated with VN Kristensen clearance of docetaxel. Most notably these were four SNPs in EGF, three SNPs 1Department of Genetics, Institute of Cancer in PRDX4 and XPC, and two SNPs in GSTA4, TGFBR2, TNFAIP2, BCL2, DPYD Research, Oslo University Hospital Radiumhospitalet, and EGFR. The multiple SNPs per gene suggested the existence of common Oslo, Norway; 2Institute of Clinical Medicine, haplotypes associated with clearance. These were confirmed with detailed 3 University of Oslo, Oslo, Norway; Cancer Clinic, haplotype analysis. On the basis of analysis of variance (ANOVA), quantitative Oslo University Hospital Radiumhospitalet, Oslo, Norway; 4Institute of
    [Show full text]
  • Protein Sequence Comparison and Protein Evolution Tutorial
    Protein sequence comparison and Protein evolution Tutorial - ISMB2000 William R. Pearson∗ Department of Biochemistry and Molecular Genetics, Jordan Hall, Box 800733 University of Virginia, Charlottesville, VA 22908, USA October, 2001 Contents 1 Introduction 2 1.1 Evolutionary time scales . 4 1.2 Similarity, Ancestry and Structure . 6 1.3 Modes of Evolution . 8 1.3.1 Conventional divergence from a common ancestor . 8 1.3.2 Sequence similarity and homology, the H+ ATPase . 10 1.3.3 Protein families diverge at different rates . 16 1.3.4 Mosaic proteins . 18 1.4 Introns Early/Late . 18 1.5 DNA vs Protein comparison . 19 2 Alignment methods 22 2.1 Algorithms . 22 2.2 Dynamic Programming Algorithms . 25 2.3 Heuristic Algorithms . 27 ∗FAX: (804) 924-5069; email: [email protected] 1 2.3.1 BLAST . 29 2.3.2 FASTA . 29 3 The statistics of sequence similarity scores 30 3.1 Sequence alignments without gaps . 31 3.2 Scoring matrices . 31 3.3 Empirical statistics for alignments with gaps . 35 3.4 Statistical significance by random shuffling . 36 4 Identifying distantly related protein sequences 36 4.1 Serine proteases . 37 4.2 Glutathione S-transferases . 42 4.3 G-protein-coupled receptors . 43 5 Repeated structures in proteins 46 6 Summary 48 References 50 7 Suggested Reading 52 7.1 General Protein evolution . 52 7.1.1 Introns Early/Late . 52 7.2 Alignment methods . 52 7.2.1 Algorithms . 52 7.2.2 Scoring methods . 53 7.3 Evaluating matches - statistics of similarity scores . 53 1 Introduction The concurrent development of molecular cloning techniques, DNA sequencing methods, rapid sequence comparison algorithms, and computer workstations has revolutionized the role of biological sequence comparison in molecular biology.
    [Show full text]
  • HHS Public Access Author Manuscript
    HHS Public Access Author manuscript Author Manuscript Author ManuscriptBirth Defects Author Manuscript Res A Clin Author Manuscript Mol Teratol. Author manuscript; available in PMC 2015 February 18. Published in final edited form as: Birth Defects Res A Clin Mol Teratol. 2014 February ; 100(2): 116–126. doi:10.1002/bdra.23225. Conotruncal Heart Defects and Common Variants in Maternal and Fetal Genes in Folate, Homocysteine and Transsulfuration Pathways Charlotte A. Hobbs, MD, PhD1, Mario A. Cleves, PhD1, Stewart L. MacLeod, PhD1, Stephen W. Erickson, PhD1, Xinyu Tang, PhD1, Jingyun Li, MS1, Ming Li, PhD1, Todd Nick, PhD1, Sadia Malik, MD, MPH1, and the National Birth Defects Prevention Study 1Department of Pediatrics, College of Medicine, University of Arkansas for Medical Sciences, Arkansas Children’s Hospital Research Institute, Little Rock, Arkansas, USA Abstract Background—We investigated the association between conotruncal heart defects (CTDs) and maternal and fetal single nucleotide polymorphisms (SNPs) in 60 genes in the folate, homocysteine and pathways. We also investigated whether periconceptional maternal folic acid supplementation modified associations between CTDs and SNPs. Methods—Participants were enrolled in the National Birth Defects Prevention Study between 1997 and 2007. DNA samples from 616 case-parental triads affected by CTDs and 1,645 control- parental triads were genotyped using an Illumina® Golden Gate custom SNP panel. A hybrid design analysis, optimizing data from case and control trios, was used to identify maternal and fetal SNPs associated with CTDs. Results—Among 921 SNPs, 17 maternal and 17 fetal SNPs had a Bayesian false-discovery probability (BFDP) of <0.8. Ten of the 17 maternal SNPs and 2 of the 17 fetal SNPs were found within the glutamate-cysteine ligase, catalytic subunit (GCLC) gene.
    [Show full text]
  • SUPPORTING INFORMATION for Regulation of Gene Expression By
    SUPPORTING INFORMATION for Regulation of gene expression by the BLM helicase correlates with the presence of G4 motifs Giang Huong Nguyen1,2, Weiliang Tang3, Ana I. Robles1, Richard P. Beyer4, Lucas T. Gray5, Judith A. Welsh1, Aaron J. Schetter1, Kensuke Kumamoto1,6, Xin Wei Wang1, Ian D. Hickson2,7, Nancy Maizels5, 3,8 1 Raymond J. Monnat, Jr. and Curtis C. Harris 1Laboratory of Human Carcinogenesis, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, U.S.A; 2Department of Medical Oncology, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, University of Oxford, Oxford, U.K.; 3Department of Pathology, University of Washington, Seattle, WA U.S.A.; 4 Center for Ecogenetics and Environmental Health, University of Washington, Seattle, WA U.S.A.; 5Department of Immunology and Department of Biochemistry, University of Washington, Seattle, WA U.S.A.; 6Department of Organ Regulatory Surgery, Fukushima Medical University, Fukushima, Japan; 7Cellular and Molecular Medicine, Nordea Center for Healthy Aging, University of Copenhagen, Denmark; 8Department of Genome Sciences, University of WA, Seattle, WA U.S.A. SI Index: Supporting Information for this manuscript includes the following 19 items. A more detailed Materials and Methods section is followed by 18 Tables and Figures in order of their appearance in the manuscript text: 1) SI Materials and Methods 2) Figure S1. Study design and experimental workflow. 3) Figure S2. Immunoblot verification of BLM depletion from human fibroblasts. 4) Figure S3. PCA of mRNA and miRNA expression in BLM-depleted human fibroblasts. 5) Figure S4. qPCR confirmation of mRNA array data. 6) Table S1. BS patient and control detail.
    [Show full text]
  • Transcriptome Profiling Reveals the Complexity of Pirfenidone Effects in IPF
    ERJ Express. Published on August 30, 2018 as doi: 10.1183/13993003.00564-2018 Early View Original article Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska, Anna Gungl, Jochen Wilhelm, Leigh M. Marsh, Helene Thekkekara Puthenparampil, Katharina Sinn, Miroslava Didiasova, Walter Klepetko, Djuro Kosanovic, Ralph T. Schermuly, Lukasz Wujak, Benjamin Weiss, Liliana Schaefer, Marc Schneider, Michael Kreuter, Andrea Olschewski, Werner Seeger, Horst Olschewski, Malgorzata Wygrecka Please cite this article as: Kwapiszewska G, Gungl A, Wilhelm J, et al. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF. Eur Respir J 2018; in press (https://doi.org/10.1183/13993003.00564-2018). This manuscript has recently been accepted for publication in the European Respiratory Journal. It is published here in its accepted form prior to copyediting and typesetting by our production team. After these production processes are complete and the authors have approved the resulting proofs, the article will move to the latest issue of the ERJ online. Copyright ©ERS 2018 Copyright 2018 by the European Respiratory Society. Transcriptome profiling reveals the complexity of pirfenidone effects in IPF Grazyna Kwapiszewska1,2, Anna Gungl2, Jochen Wilhelm3†, Leigh M. Marsh1, Helene Thekkekara Puthenparampil1, Katharina Sinn4, Miroslava Didiasova5, Walter Klepetko4, Djuro Kosanovic3, Ralph T. Schermuly3†, Lukasz Wujak5, Benjamin Weiss6, Liliana Schaefer7, Marc Schneider8†, Michael Kreuter8†, Andrea Olschewski1,
    [Show full text]
  • A Personalized Genomics Approach of the Prostate Cancer
    cells Article A Personalized Genomics Approach of the Prostate Cancer Sanda Iacobas 1 and Dumitru A. Iacobas 2,* 1 Department of Pathology, New York Medical College, Valhalla, NY 10595, USA; [email protected] 2 Personalized Genomics Laboratory, Center for Computational Systems Biology, Roy G Perry College of Engineering, Prairie View A&M University, Prairie View, TX 77446, USA * Correspondence: [email protected]; Tel.: +1-936-261-9926 Abstract: Decades of research identified genomic similarities among prostate cancer patients and proposed general solutions for diagnostic and treatments. However, each human is a dynamic unique with never repeatable transcriptomic topology and no gene therapy is good for everybody. Therefore, we propose the Genomic Fabric Paradigm (GFP) as a personalized alternative to the biomarkers approach. Here, GFP is applied to three (one primary—“A”, and two secondary—“B” & “C”) cancer nodules and the surrounding normal tissue (“N”) from a surgically removed prostate tumor. GFP proved for the first time that, in addition to the expression levels, cancer alters also the cellular control of the gene expression fluctuations and remodels their networking. Substantial differences among the profiled regions were found in the pathways of P53-signaling, apoptosis, prostate cancer, block of differentiation, evading apoptosis, immortality, insensitivity to anti-growth signals, proliferation, resistance to chemotherapy, and sustained angiogenesis. ENTPD2, AP5M1 BAIAP2L1, and TOR1A were identified as the master regulators of the “A”, “B”, “C”, and “N” regions, and potential consequences of ENTPD2 manipulation were analyzed. The study shows that GFP can fully characterize the transcriptomic complexity of a heterogeneous prostate tumor and identify the most influential genes in each cancer nodule.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Table 1. Characteristics of the Organ Donors and Human Islet Preparations Used for RNA-Seq
    SUPPLEMENTARY DATA Supplementary Table 1. Characteristics of the organ donors and human islet preparations used for RNA-seq and independent confirmation and mechanistic studies. Gender Age BMI Cause of death Purity (years) (kg/m2) (%) F 77 23.8 Trauma 45 M 36 26.3 CVD 51 M 77 25.2 CVD 62 F 46 22.5 CVD 60 M 40 26.2 Trauma 34 M 59 26.7 NA 58 M 51 26.2 Trauma 54 F 79 29.7 CH 21 M 68 27.5 CH 42 F 76 25.4 CH 30 F 75 29.4 CVD 24 F 73 30.0 CVD 16 M 63 NA NA 46 F 64 23.4 CH 76 M 69 25.1 CH 68 F 23 19.7 Trauma 70 M 47 27.7 CVD 48 F 65 24.6 CH 58 F 87 21.5 Trauma 61 F 72 23.9 CH 62 M 69 25 CVD 85 M 85 25.5 CH 39 M 59 27.7 Trauma 56 F 76 19.5 CH 35 F 50 20.2 CH 70 F 42 23 CVD 48 M 52 24.5 CH 60 F 79 27.5 CH 89 M 56 24.7 Cerebral ischemia 47 M 69 24.2 CVD 57 F 79 28.1 Trauma 61 M 79 23.7 NA 13 M 82 23 CH 61 M 32 NA NA 75 F 23 22.5 Cardiac arrest 46 M 51 NA Trauma 37 Abbreviations: F: Female; M: Male; BMI: Body mass index; CVD: Cardiovascular disease; CH: Cerebral hemorrhage.
    [Show full text]
  • Acquisition of Inverted GSTM Exons by an Intron of Primate GSTM5 Gene
    Journal of Human Genetics (2009) 54, 271–276 & 2009 The Japan Society of Human Genetics All rights reserved 1434-5161/09 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Acquisition of inverted GSTM exons by an intron of primate GSTM5 gene Yong Wang and Frederick CC Leung The human GSTM gene family is composed of five gene members, GSTM1–5, and plays an important role in detoxification. In this study, the human GSTM5 gene was found to have a long inverted repeat (LIR) in intron 5. The LIR is able to form a stem-loop structure with a 31-bp stem and a 9-nt loop. The intronic LIR was also identified in other primates but not in non-primates. The human and chimpanzee LIRs had undergone compensating mutations that make the stem loop more stable, suggesting a functional role for the LIR. Sequence homology showed that the LIR was actually a part of inverted exons acquired by the intron. Results of phylogenetic analysis indicate that the inverted exons were derived from exon 5 of GSTM4 and exon 5 of GSTM1. The intronic LIR and inverted GSTM exons can probably introduce complexity in the expression of GSTM gene family. Journal of Human Genetics (2009) 54, 271–276; doi:10.1038/jhg.2009.23; published online 20 March 2009 Keywords: GSTM; inverted repeat; primate; intronic stem loop INTRODUCTION expression profile. Although most of the genes were well characterized, Inverted repeats (IRs) are unstable motifs capable of inducing recom- the variations in introns had not yet been surveyed sufficiently. Recent bination, gene amplifications and rearrangements in a genome.1–5 On reports have shown the importance of intronic conserved ele- the other hand, a considerable number of IRs are functional elements ments.23,24 in eukaryotes.
    [Show full text]
  • GSTM4 (NM 000850) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC202097 GSTM4 (NM_000850) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GSTM4 (NM_000850) Human Tagged ORF Clone Tag: Myc-DDK Symbol: GSTM4 Synonyms: GSTM4-4; GTM4 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC202097 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCATGACACTGGGGTACTGGGACATCCGCGGGCTGGCCCACGCCATCCGCCTGCTCCTGGAATACA CAGACTCAAGCTACGAGGAAAAGAAGTATACGATGGGGGACGCTCCTGACTATGACAGAAGCCAGTGGCT GAATGAAAAATTCAAGCTGGGCCTGGACTTTCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATC ACCCAGAGCAACGCCATCCTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGGAGACAGAAGAGGAGA AGATTCGTGTGGACATTTTGGAGAACCAGGCTATGGACGTCTCCAATCAGCTGGCCAGAGTCTGCTACAG CCCTGACTTTGAGAAACTGAAGCCAGAATACTTGGAGGAACTTCCTACAATGATGCAGCACTTCTCACAG TTCCTGGGGAAGAGGCCATGGTTTGTTGGAGACAAGATCACCTTTGTAGATTTCCTCGCCTATGATGTCC TTGACCTCCACCGTATATTTGAGCCCAACTGCTTGGACGCCTTCCCAAATCTGAAGGACTTCATCTCCCG CTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCCAGCCGCTTCCTCCCAAAACCTCTGTACACA AGGGTGGCTGTCTGGGGCAACAAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies,
    [Show full text]