CYP3A4, CYP3A5, and CYP3A43 Genotypes and Haplotypes in the Etiology and Severity of Prostate Cancer

[CANCER RESEARCH 64, 8461–8467, November 15, 2004] CYP3A4, CYP3A5, and CYP3A43 Genotypes and Haplotypes in the Etiology and Severity of Prostate Cancer

Charnita Zeigler-Johnson,1 Tara Friebel,1 Amy H. Walker,1 Yiting Wang,1 Elaine Spangler,1 Saarene Panossian,1 Margerie Patacsil,1 Richard Aplenc,1,2 Alan J. Wein,3 S. Bruce Malkowicz,3 and Timothy R. Rebbeck1 1Department of Biostatistics and Epidemiology, 2Department of Pediatrics, and 3Department of Urology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania

ABSTRACT which is less biologically active than testosterone or dihydrotestosterone. CYP3A43 also exhibits testosterone 6␤-hydroxylation in vitro The CYP3A genes reside on chromosome 7q21 in a multigene cluster. and is predominantly expressed in the prostate (7). Variants that affect The enzyme products of CYP3A4 and CYP3A43 are involved in testoster- CYP3A4 activity could therefore alter prostate tumor occurrence or one metabolism. CYP3A4 and CYP3A5 have been associated previously Ј with prostate cancer occurrence and severity. To comprehensively exam- aggressiveness. A variant in the 5 untranslated region of CYP3A4 ine the effects of these genes on prostate cancer occurrence and severity, (denoted CYP3A4*1B) has been associated with prostate cancer in we studied 622 incident prostate cancer cases and 396 controls. Substan- three studies. We reported previously that Caucasian carriers of tial and race-specific linkage disequilibrium was observed between CYP3A4*1B had a higher Tumor-Node-Metastasis stage and Gleason CYP3A4 and CYP3A5 in both races but not between other pairs of loci. We grade than men who did not carry this variant. The effect on tumor found no association of CYP3A5 genotypes with prostate cancer or disease stage was most pronounced in men diagnosed at a relatively old age severity. CYP3A43*3 was associated with family history-positive prostate who reported no family history of prostate cancer. Subsequently, Paris ,confidence inter- et al. (8) reported the same association with tumor grade and stage %95 ,5.86 ؍ cancer (age- and race-adjusted odds ratio val, 1.10–31.16). CYP3A4*1B was associated inversely with the probability also with stronger effects in older men. Tayeb et al. (9) reported that ,0.54 ؍ of having prostate cancer in Caucasians (age-adjusted odds ratio CYP3A4*1B was associated with prostate cancer in men with a history 95% confidence interval, 0.32–0.94). We also observed significant interactions among these loci associated with prostate cancer occurrence and of benign prostatic hyperplasia. Plummer et al. (10) also reported severity. There were statistically significant differences in haplotype fre- strong effects of CYP3A4 and CYP3A5 genotypes with prostate can- quencies involving these three genes in high-stage cases (P < 0.05) com- cer. Kittles et al. (11) reported that the association of prostate cancer pared with controls. The observation that CYP3A4 and CYP3A43 were with CYP3A4 genotypes in African Americans may be the result of associated with prostate cancer, are not in linkage equilibrium, and are population stratification. However, difficulties with the design of this both involved in testosterone metabolism, suggest that both CYP3A4*1B study have raised questions whether population stratification or poor and CYP3A43*3 may influence the probability of having prostate cancer study design could have most strongly influenced this association and disease severity. (12). In combination, these results are consistent with an effect of CYP3A genes on the natural history, and possibly prognosis, of INTRODUCTION prostate cancers. The observation that CYP3A4 genotype is associated with higher clinical stage and grade prostate tumors is consistent with Genes involved in androgen metabolism have been implicated in the hypothesis that CYP3A4 may be associated with androgen-medi- the etiology of prostate cancer. Testosterone is a major determinant of ated increases in prostate cell proliferation or growth. prostate growth and differentiation. There are numerous lines of The CYP3A genes lie in a region of chromosome 7q21-q22 as part evidence that support the role of androgen metabolism in prostate of a multigene family (13), including CYP3A4 (14), CYP3A5 (15), cancer etiology. Circulating levels of androgens have been reported to CYP3A7, CYP3A43 (7, 16–17) in addition to psuedogenes (Fig. 1). be higher in populations at increased prostate cancer risk, including Only CYP3A4, CYP3A5, CYP3A7, and CYP3A43 are expressed in African American men (1), and lower in populations at decreased adults (18). These loci seem to be in linkage disequilibrium (LD; refs prostate cancer risk, including Chinese men (2). Although serum 15 and 19). Therefore, we evaluated genotypes and haplotypes of levels of testosterone do not correlate well with prostate cancer risk CYP3A4, CYP3A5, and CYP3A43 by ethnicity and tumor character- (3–4), serum levels of dihydrotestosterone and other testosterone istics to better understand whether these genes are related to prostate metabolites do correlate with prostate cancer risk (1, 3–4). Clinical cancer. evidence exists that androgens are related to the growth and develop- ment of prostate cancers, and androgen ablation in men with hormone- MATERIALS AND METHODS sensitive prostate tumors reduces tumor size and decreases the associated disease burden (5). This evidence suggests that the metabolism Study Subjects and Data Collection. A sample of 622 incident prostate of testosterone into the more biologically active forms of the hormone cancer cases was identified through Urologic Oncology Clinics at the Univer- may be important in determining prostate cancer risk. sity of Pennsylvania Health System between 1995 and 2002. We confirmed Testosterone bioavailabilty is determined by a number of enzymes, case status by medical records review using a standardized abstraction form. including CYP3A4 and CYP3A43. CYP3A4 is involved in the oxi- Men were excluded from this study if they reported having exposure to finasteride (Proscar) at the time of their prostate cancer diagnosis. Patients who dation of testosterone to 2␤-, 6␤-, or 15␤-hydroxytestosterone (6), were nonincident cases (i.e., those diagnosed Ͼ12 months before the date of study ascertainment), or had a prior diagnosis of cancer at any site except Received 5/13/04; revised 8/9/04; accepted 9/2/04. nonmelanoma skin cancer, were also excluded. The mean age of diagnosis was Grant support: Grants from the Public Health Service (R29-ES08031, R01-CA85074, 62.9 years (SD ϭ 8 years) with a range of 39 to 85 years. and P50-CA105641 to T. R. Rebbeck) and the University of Pennsylvania Cancer Center. The costs of publication of this article were defrayed in part by the payment of page The 396 controls studied here were men attending University of Pennsyl- charges. This article must therefore be hereby marked advertisement in accordance with vania Health System general medicine clinics. These clinics see a patient 18 U.S.C. Section 1734 solely to indicate this fact. population that is demographically similar to those seen in the University of Requests for reprints: Charnita Zeigler-Johnson, Department of Biostatistics and Pennsylvania Health System Urologic Oncology clinics. These men were Epidemiology, University of Pennsylvania School of Medicine, 908 Blockley Hall, 423 Guardian Drive, Philadelphia, PA 19104-6021. E-mail: [email protected]. ascertained concurrently with the prostate cancer cases (i.e., between 1995– ©2004 American Association for Cancer Research. 2002). Controls were excluded from this study if they ever had an elevated 8461

Fig. 1. Gene cluster on Chromosome 7q22. Variants of interest include the following: *1 on CYP3A5, missense mutation at intron 3; *1B on CYP3A4, missense mutation at the 5Јuntranslated region; *3 on CYP3A43, alanine to proline mutation that occurs at exon 10.

prostate-specific antigen test based on age- or race-specific values (20), if they reaction followed by genotype assessment with a Pyrosequencing PSQ 96 had ever had an abnormal digital rectal examination, if they had a previous System (24). The primers used in this amplification included a forward primer cancer diagnosis except nonmelanoma skin cancer, or if they reported having (3A43-F, AGGGATTTGGGAGCTTCACT), a reverse primer (3A43-R, GAG- had exposure to finasteride (Proscar) at the time of study ascertainment. GAGGCATTCTTGCTGAG, which was biotinylated), and a sequencing Analyses adjusted for age and race were also undertaken to account for primer (AGGAGATTGACGCAGTTTTA). The PCR reaction consisted of a residual variation because of these factors. The mean age of controls at the time buccal swab protocol and a Qiagen protocol. In the buccal swab protocol, we ϭ ␮ ␮ ␮ of their clinic visit was 58.6 years (SD 11.3 years) with a range of 22 to 92 used 23.5 L of double-distilled H20, 0.5 L of each PCR primer, 5 Lof ϫ ␮ ␮ years. 10 PCR buffer, 2 L of 25 mmol/L MgCl2,1 L of 10 mmol/L de- A standardized questionnaire and review of medical records were used to oxynucleoside triphosphates, 0.5 ␮L of Platinum Taq (Life Technologies, Inc., obtain risk factor, medical history, and prostate cancer diagnostic information. Grand Island, NY), and 8 ␮L of template DNA. In the Qiagen protocol, we Information collected included prostate cancer occurrences in first- and used the same amount of the reagents, with two exceptions. We used 26.5 ␮L ␮ second-degree relatives; personal history of benign prostatic hyperplasia and of double-distilled H20 and 5 L of template DNA. The temperature profile for vasectomy; previous cancer diagnoses; demographic information such as race, the PCR reaction was one cycle at 95°C for 5 minutes, followed by 20 cycles educational level, and occupation; and prostate cancer screening history. All of 94°C for 30 seconds, 62°C for 30 seconds (Ϫ0.5°C/cycle), and 72°C for 30 study subjects provided informed consent for participation in this research seconds. This procedure was followed by 15 cycles of 94°C for 30 seconds, under a protocol approved by the Committee for Studies Involving Human 52°C for 30 seconds, and 72°C for 30 seconds. Finally, there was one cycle at Subjects at the University of Pennsylvania. 72°C for 5 minutes. We achieved determination of genotypes using the Biosample Collection and Genotype Analysis. Genomic DNA for the resulting 317 bp PCR product using the Pyrosequencing PSQ 96 system with present study was self-collected by each study subject using sterile cheek nucleotide dispensation order ACGCTATAG. swabs (Cyto-Pak Cytosoft Brush, Medical Packaging Corporation, Camarillo, Statistical Methods. We computed allele and genotype frequencies using CA), and processed using either a protocol modified from Richards et al. (21) gene counting methods, and evaluated Hardy-Weinberg equilibrium assuming as described previously (22) or using a Qiagen 9604 robot with the QIAamp 96 random mating using the method of Levene (25). In addition, we evaluated DNA Buccal Swab Biorobot kit (Qiagen, Valencia, CA). The resulting bio- differences in allele and genotype frequencies across ethnic groups by under- samples were used for PCR-based genotype analyses. taking Fisher’s exact tests. Pairwise composite disequilibrium coefficients ⌬, The methods used to determine CYP3A4*1B genotypes have been reported rather than DЈ, were estimated for the three alleles of interest by using the ⌬ϭ ϩ Ј previously by Rebbeck et al. (23). The methods used to analyze CYP3A5*1 following: DAB DA/B for alleles A and B at two loci (26). D was not included a PCR reaction followed by genotype assessment using a Pyrose- computed because we are studying population genotypic data and do not have quencing PSQ 96 system. The primers used in this amplification included a information regarding phase in double heterozygotes. On the basis of the

forward primer for the “wild-type,” CYP3A5*3 (C3A5*3.F1, ACCAC- methods of Weir (26), both DAB and DA/B are constrained by the same CCAGCTTAACGAATG), a reverse primer (C3A5*3.R1, TGACACACAG- maximum/minimum values, because gametic and nongametic frequencies can- CAAGAGTCTCA, which was biotinylated), and a sequencing primer not be negative or greater than corresponding allele frequencies. The maxi- ⌬ (AGAGCTCTTTTGTCTTTCA). Preparation for the PCR reaction consisted mum/minimum values of are, in fact, twice those of DAB and DA/B. of a buccal swab protocol and a Qiagen protocol. In the buccal swab protocol, Accordingly, we defined a normalized measure of ⌬ called ⌬Ј, by dividing ⌬ ␮ ␮ Ј we used 20 L of Eppendorf Master Mix, 10 L of double-distilled H20, 0.5 by its maximum/minimum values. This measure is analogous to D , therefore, ␮L of each PCR primer, and 10 ␮L of template DNA. In the Qiagen protocol, its usage should be subjected to the same caution as DЈ (26–28). Similar to ␮ ␮ ⌬Ј ϩ we used 20 L of Eppendorf Master Mix, 17 L of double-distilled H20, 0.5 D[pime], will have a range of values from -1 to 1 and is not independent ␮L of each PCR primer, and 3 ␮L of template DNA. The temperature profile of allele frequencies. for the PCR reaction was one cycle at 94°C for 5 minutes, followed by 35 Because our initial analyses suggested deviations from Hardy-Weinberg cycles of 94°C for 30 seconds, 59°C for 30 seconds, and 72°C for 30 seconds. proportions for some loci, pairwise disequilibrium computations were made This procedure was followed by one cycle at 72°C for 7 minutes. We achieved without the assumption of Hardy-Weinberg equilibrium. This method is ap- determination of genotypes using the resulting 120 bp PCR product with the propriate for situations in which linkage phase is unknown (29). Then, we Pyrosequencing PSQ 96 system with nucleotide dispensation order CGAC- inferred haplotype frequencies, and we imputed missing data using gene TATC. counting methods that assumed random mating. We undertook all computa- Analysis of CYP3A43*3 (Pro340Ala in exon 10) also included a PCR tions using the GDA software version 1.1 (30) and STATA v.8.0.

Table 1 CYP3A4, CYP3A5, and CYP3A43 allele and genotype frequencies by race and case-control status African American Caucasian (number of individuals or alleles) (number of individuals or alleles)

Gene Group Cases Controls Cases Controls CYP3A4 *1A/*1A 20.8 (16) 28.1 (18) 93.4 (495) 89.1 (205) *1A/*1B 39.0 (30) 39.1 (25) 5.7 (30) 8.7 (20) *1B/*1B 40.3 (31) 32.8 (21) 0.9 (5) 2.2 (5) *1B 0.597 (154) 0.523 (128) 0.038 (1,060) † 0.065 (460) † CYP3A5 *3/*3 11.1 (9) 16.9 (11) 87.6 (438) 91.5 (162) *3/*1 43.2 (35) 38.5 (25) 11.8 (59) 7.3 (13) *1/*1 45.7 (37) 44.6 (29) 0.6 (3) 1.1 (2) *1 0.673 (162) 0.639 (130) 0.065 (1,000) 0.048 (354) CYP3A43 *1/*1 52.8 (28) 56.5 (26) 89.9 (347) 88.7 (133) *1/*3 43.4 (23) 39.1 (18) 9.6 (37) 11.3 (17) *3/*3 3.8 (2) 4.4 (2) 0.5 (2) 0 *3 0.255 (106) 0.239 (92) 0.053 (772) 0.057 (300) † Indicates statistically significant deviation from Hardy Weinberg proportions. 8462

Table 2 Linkage disequilibrium of CYP3A genes in African and European Americans: CYP3A43*3 by ethnicity and case-control status. As has been reported composite disequilibrium coefficients and exact significance level not assuming HWE previously (22), we observed significant differences in the distribution Pair-wise comparison ⌬ˆ Ј͓⌬ˆ ͔ (exact P value) of alleles at CYP3A4 by race, with higher frequencies of the African CYP3A4*1B allele in African Americans compared with Caucasians Group Locus 1 Locus 2 Caucasian American for both cases and controls (P Ͻ 0.0001). In addition, we report Cases CYP3A4*1B CYP3A5*1 0.313 ͓0.021͔ 0.450 ͓0.175͔ significant differences in the frequency of alleles at CYP3A5 (P Ͻ 0.001) (P Ͻ 0.001) (P Ͻ 0.0001) and CYP3A43 (P Ͻ 0.0001), with CYP3A5*1 and CYP3A4*1B CYP3A43*3 Ϫ0.030 ͓Ϫ0.00012͔ 0.393 ͓0.076͔ (P ϭ 0.672) (P ϭ 0.106) CYP3A43*3 allele frequencies being significantly higher in African CYP3A43*3 CYP3A5*1 Ϫ0.213 ͓Ϫ0.0014͔ 0.244 ͓0.038͔ Americans than in Caucasians. Also, we observed significant devia- ϭ ϭ (P 1) (P 0.510) CYP3A4 Controls CYP3A4*1B CYP3A5*1 0.216 ͓0.039͔ 0.277 ͓0.112͔ tions from Hardy-Weinberg equilibrium in Caucasians for . (P Ͻ 0.001) (P ϭ 0.003) We observed significant LD between CYP3A4*1B and CYP3A5*1 CYP3A4*1B CYP3A43*3 Ϫ1 ͓Ϫ0.007͔ 0.405 ͓0.089͔ in cases and controls, for African Americans and Caucasians (Table (P ϭ 0.785) (P ϭ 0.045) CYP3A43*3 CYP3A5*1 Ϫ0.500 ͓Ϫ0.005͔ 0.113 ͓0.019͔ 2). Borderline significant disequilibrium between CYP3A4*1B and (P ϭ 0.682) (P ϭ 0.348) CYP3A43*3 was observed only in African-Americans. We did not observe statistically significant LD in any other group. The estimate of LD between CYP3A4*1B and CYP3A5*1 was higher in African For genotype-disease associations, we considered univariate and genotype Americans than Caucasians for both cases and controls. However, the effects and pairwise interactions involving CYP3A4, CYP3A5, and CYP3A43. magnitude of LD between these two loci was similar for cases and For all genes, we combined putative risk alleles based on functional or allele controls within each ethnic group. frequency information into binary genotype classes. We also considered these Case-Control Associations. As shown in Table 3, we observed no loci together by comparing pairwise multiplicative interactions of all genotype combinations. We undertook genotype-disease associations using uncondi- effect of CYP3A5 alone, and we observed no pattern that suggested a tional logistic regression, and we computed odds ratios (ORs) for the entire putative association in our data. sample, as well as stratified by race (i.e., African American or Caucasian). We CYP3A4 seemed to be associated (but not significantly) with an further evaluated whether there were differences in the association of geno- overall decreased odds of disease in all subgroups except African types in organ-confined tumors (i.e., stages T1 and T2) compared with tumors Americans. We observed a statistically significant association be- diagnosed with extracapsular extension or metastasis (i.e., stages T3 and T4). tween CYP3A4 and prostate cancer for Caucasians only [OR ϭ 0.54, Finally, we attempted to identify associations in individuals with a family 95% confidence interval (CI), 0.32–0.94]. Similar effects were noted history of prostate cancer (i.e., at least one first or second degree relative with for both low- and high-stage tumors, although the association in prostate cancer) or were younger than age 60 at diagnosis or time of ascer- high-stage tumors did not reach statistical significance. tainment. All analyses were adjusted for age at the time of diagnosis in cases CYP3A43 showed no obvious pattern of direction across the sub- or time of study ascertainment in controls and race (i.e., African American or Caucasian), except for race-specific analyses, which were adjusted for age groups. However, a positive association with prostate cancer was only. We undertook all statistical analyses for associations using SAS v. 8.01 observed for CYP3A43*3 in men with a family history of prostate and STATA v. 8.0. All P values were based on two-sided hypothesis tests. cancer (OR ϭ 5.86, 95% CI, 1.10–31.16). Again, similar magnitudes We undertook haplotype analyses using the hapipf routine as implemented of effect were observed for low- and high-stage tumors, but neither of in STATA v.6.0. The frequencies of the observed haplotypes were calculated these analyses reached statistical significance. by race (African American and Caucasian) in controls, cases, low-stage cases, When we considered pairwise interactions of CYP3A4*1A/*1A- and high-stage cases. Using the likelihoods (L) obtained for the haplotype CYP3A5*3/*3 versus all other genotypes containing any CYP3A4*1B distribution in each case or control group, we then compared the haplotype or CYP3A5*1 alleles (Table 4), the general effect was protective. We distributions for controls versus all cases, low-stage cases, and high-stage cases ␹2 ϩ observed statistically significant associations with high-stage cases in separately by race using a test of the form 2 {log L(controls) log ϭ L(cases) Ϫ log L(total sample) (31). The distribution of this statistic was the total sample (OR 0.44, 95% CI, 0.22–0.87) and in the subgroup Ͻ ϭ evaluated with a ␹2 test with degrees of freedom equal to the number of that was 60 years of age (OR 0.21, 95% CI, 0.06–0.82). The haplotype classes considered. presence of the CYP3A4*1B-CYP3A5*1 genotypes (i.e., both variants) was positively associated with prostate cancer in African Amer- ϭ RESULTS icans (OR 2.24, 95% CI, 1.03–4.89). No other general pattern suggesting any other association was observed. Allele and Genotype Frequency Distribution. Table 1 presents We observed no strong interactions involving CYP3A5 and the variant allele frequencies for CYP3A4*1B, CYP3A5*1, and CYP3A43. However, the presence of the CYP3A4*1B and

Table 3 Case-control associations of prostate cancer: main effects of CYP3A variants Genotype Group All cases Low stage cases High stage cases Any CYP3A5*1 Total sample 1.03 (0.67–1.59) 1.12 (0.72–1.75) 0.69 (0.36–1.32) Family history positive 0.93 (0.31–2.84) 1.30 (0.36–4.70) 0.40 (0.10–1.57) Early onset 0.92 (0.50–1.68) 1.08 (0.58–2.01) 0.39 (0.12–1.26) African American 1.65 (0.64–4.29) 2.01 (0.70–5.83) 0.91 (0.22–3.77) Caucasian 1.36 (0.75–2.49) 1.45 (0.79–2.68) 1.06 (0.45–2.51) Any CYP3A4*1B Total sample 0.81 (0.45–1.44) 0.65 (0.42–1.00) 0.65 (0.35–1.21) Family history positive 0.41 (0.15–1.10) 0.48 (0.17–1.38) 0.25 (0.06–1.00) Early onset 0.61 (0.33–1.12) 0.69 (0.37–1.30) 0.36 (0.12–1.08) African American 1.50 (0.69–3.27) 1.41 (0.62–3.21) 1.92 (0.49–7.56) Caucasian 0.54 (0.32–0.94) 0.56 (0.32–0.99) 0.54 (0.22–1.29) Any CYP3A43*3 Total sample 0.86 (0.54–1.37) 0.77 (0.47–1.26) 1.16 (0.58–2.31) Family history positive 5.86 (1.10–31.16) 5.34 (0.95–30.19) 9.96 (0.89–110.92) Early onset 0.62 (0.33–1.18) 0.51 (0.25–1.03) 0.94 (0.36–2.45) African American 1.14 (0.51–2.53) 0.85 (0.36–2.00) 3.77 (0.86–16.44) Caucasian 0.93 (0.50–1.72) 0.90 (0.47–1.70) 1.02 (0.41–2.53) NOTE. Models adjusted for age and race. In race-stratified analyses, adjustment was made for age only. 8463

Table 4 Case-control associations of prostate cancer: pairwise interactions among CYP3A variants Genotype Strata All cases Low stage cases High stage cases Any CYP3A4*1B or CYP3A5*1 Total sample 0.71 (0.47–1.07) 0.78 (0.51–1.20) 0.44 (0.22–0.87) Family history positive 0.50 (0.18–1.42) 0.62 (0.19–2.00) 0.26 (0.07–1.01) Early onset 0.71 (0.40–1.26) 0.85 (0.47–1.55) 0.21 (0.06–0.82) African American 0.58 (0.16–2.07) 0.73 (0.18–2.89) 0.34 (0.07–1.73) Caucasian 0.95 (0.56–1.61) 1.04 (0.60–1.78) 0.66 (0.29–1.50) Any CYP3A4*1B and CYP3A5*1 Total sample 0.94 (0.55–1.60) 0.87 (0.50–1.51) 1.10 (0.55–2.20) Family history positive 0.95 (0.28–3.24) 1.22 (0.33–4.60) 0.39 (0.08–1.96) Early onset 0.86 (0.40–1.84) 0.94 (0.43–2.05) 0.61 (0.19–2.01) African American 2.24 (1.03–4.89) 2.14 (0.93–4.92) 2.69 (0.69–10.58) Caucasian 0.70 (0.31–1.59) 0.62 (0.26–1.47) 1.18 (0.42–3.33) Any CYP3A5*1 or CYP3A43*3 Total sample 0.94 (0.62–1.42) 0.95 (0.62–1.50) 0.82 (0.43–1.54) Family history positive 1.49 (0.45–4.92) 1.27 (0.37–4.34) 2.03 (0.47–8.76) Early onset 0.70 (0.39–1.25) 0.69 (0.37–1.27) 0.62 (0.23–1.68) African American 1.98 (0.44–8.85) 1.54 (0.34–6.97) — Caucasian 1.13 (0.69–1.84) 1.17 (0.70–1.93) 0.99 (0.48–2.05) Any CYP3A5*1 and CYP3A43*3 Total sample 0.92 (0.46–1.86) 0.82 (0.39–1.72) 1.24 (0.46–3.34) Family history positive 2.66 (0.40–17.79) 3.41 (0.49–23.80) — Early onset 0.51 (0.20–1.33) 0.51 (0.18–1.42) 0.53 (0.12–2.34) African American 1.36 (0.60–3.07) 1.12 (0.47–2.67) 2.93 (0.73–11.72) Caucasian — — — Any CYP3A4*1B or CYP3A43*3 Total sample 0.69 (0.44–1.06) 0.65 (0.41–1.02) 0.82 (0.43–1.57) Family history 0.99 (0.34–2.92) 0.83 (0.27–2.54) 1.69 (0.39–7.33) Early onset 0.64 (0.34–1.17) 0.59 (0.31–1.12) 0.67 (0.25–1.84) African American 1.51 (0.47–4.85) 1.03 (0.31–3.40) — Caucasian 0.72 (0.44–1.20) 0.71 (0.42–1.20) 0.81 (0.39–1.69) Any CYP3A4*1B and CYP3A43*3 Total sample 0.58 (0.27–1.22) 0.45 (0.20–1.01) 1.14 (0.42–3.11) Family history 3.62 (0.34–38.88) 4.71 (0.42–52.31) — Early onset 0.13 (0.04–0.46) 0.07 (0.01–0.37) 0.29 (0.06–1.47) African American 0.87 (0.37–2.04) 0.63 (0.25–1.61) 2.47 (0.62–9.94) Caucasian — — — NOTE. Models adjusted for age and race. In race-stratified analyses, adjustment was for age only.

CYP3A43*3 was largely protective. There was an inverse association that a biological interaction of CYP3A4*1B and CYP3A43*3 may in men with at least one variant on each gene who happened to be Ͻ60 exist in Caucasians, because they are not in LD. In African Ameri- years of age (OR ϭ 0.13, 95% CI, 0.04–0.46 for the total sample and cans, the greatest case-control differences were observed for haplo- OR ϭ 0.07, 95% CI, 0.01–0.37 for low-stage cases). types 3 and 4 (i.e., when CYP3A4*1B on a background of Tables 5 and 6 present haplotype frequencies by case-control status CYP3A5*3). Because CYP3A4*1B and CYP3A5*1 are in LD, it is not for Caucasians (Table 5), and African Americans (Table 6). Eight clear whether CYP3A4 or CYP3A5 or both genes are causatively haplotypes were estimated in our data. Although the same haplotypes associated with prostate cancer. were estimated to occur in both African Americans and Caucasians, the frequency distribution of these haplotypes was substantially dif- DISCUSSION ferent in the two ethnic groups. The only statistically significant association observed was between the haplotype distribution in high- The present study confirms previous reports of an association stage cases compared with controls. By inspection, differences occur between CYP3A4*1B and prostate cancer occurrence and severity in the frequency of most haplotypes (particularly common haplotypes (9–10, 23). A novel aspect of this report is that CYP3A43 is also 3 and 5, and possibly rarer haplotypes 6, 7, and 8). Haplotype 1 was associated with prostate cancer, particularly in the context of family the most prevalent haplotype in Caucasian controls (frequency, 0.84), history-positive disease. CYP3A4 is expressed preferentially in the whereas haplotype 7 was the most common haplotype in African prostate and is involved in testosterone metabolism (7). CYP3A43 is Americans (frequency, 0.28). Haplotypes that contained a alternatively spliced (7, 16) and can create mRNA hybrids with CYP3A4*1B allele tended to occur at a lower frequency among cases CYP3A4 (12). This evidence for a biological interaction between compared with controls. This suggests that the primary association CYP3A4 and CYP3A43, in addition to their overlapping substrate with disease may be in carriers of CYP3A4*1B overall. By inspection specificity for testosterone is of potential relevance to the observation among haplotypes with a frequency Ͼ1%, the largest case-control made here of interactions between CYP3A4 and CYP3A43 in prostate differences were seen for haplotypes 3 and 7 in Caucasians (i.e., when cancer etiology and severity. CYP3A4*1B and CYP3A43*3 appear together). These results suggest This report provides information about the allelic, genotypic, and

Table 5 Comparison of haplotype frequencies by case-control status in Caucasians Low stage Haplotype CYP3A5 CYP3A4 CYP3A43 Total sample Controls All cases cases High stage cases 1 *3 *1A *3 0.857 0.838 0.870 0.853 0.916 2 *3 *1A *1 0.054 0.058 0.051 0.056 0.051 3 *3 *1B *3 0.024 0.038 0.016 0.015 Ͻ0.001 4 *3 *1B *1 0.002 0.003 Ͻ0.001 0.001 Ͻ0.001 5 *1 *1A *3 0.039 0.030 0.044 0.057 0.011 6 *1 *1A *1 Ͻ0.001 0.002 Ͻ0.001 Ͻ0.001 Ͻ0.001 7 *1 *1B *3 0.021 0.030 0.015 0.016 0.018 8 *1 *1B *1 0.002 0.002 0.003 0.001 0.005 ␹2 ϭ ␹2 ϭ ␹2 ϭ 8 15.186 8 14.324 8 17.486 P Ͻ 0.10 P Ͻ 0.10 P Ͻ 0.05 NOTE. ␹2 values represents comparisons with control sample. 8464

Table 6 Comparison of haplotype frequencies by case-control status in African Americans Haplotype CYP3A5 CYP3A4 CYP3A43 Total sample Controls All cases Low stage cases High stage cases 1 *3 *1A *3 0.250 0.247 0.259 0.236 0.119 2 *3 *1A *1 0.021 0.025 0.014 Ͻ0.001 0.108 3 *3 *1B *3 0.051 0.064 0.031 0.027 Ͻ0.001 4 *3 *1B *1 0.032 0.044 0.012 0.037 Ͻ0.001 5 *1 *1A *3 0.101 0.098 0.104 0.149 Ͻ0.001 6 *1 *1A *1 0.041 0.045 0.034 0.049 0.045 7 *1 *1B *3 0.307 0.278 0.349 0.338 0.517 8 *1 *1B *1 0.195 0.198 0.196 0.164 0.210 ␹2 ϭ ␹2 ϭ ␹2 ϭ 8 6.172 8 4.686 8 11.002 P Ͻ 0.75 P Ͻ 0.90 P Ͻ 0.25 NOTE. ␹2 values represents comparisons with control sample. haplotypic distributions at the CYP3A locus. Previous reports sug- association of CYP3A4 and prostate cancer in an African American gested that LD exists at this locus (15). Our data also indicate that LD sample. Before correction, a strong association was observed with exists at the CYP3A locus but that this LD is negligible or nonexistent CYP3A4*1B in samples of both Caucasians and African ancestry. between some loci. The only consistent LD observed across case- However, after correction with random, unlinked markers, the asso- control or racial groups was between CYP3A4*1B and CYP3A5*1. ciation disappeared in the populations of African ancestry. Our asso- This observation is supported by similar findings of Plummer et al. ciations were primarily observed in Caucasians, in which population (10) and Keuhl et al. (15). Linkage disequilibrium between CYP3A4 stratification is established not to confer significant bias (37–38). and CYP3A5 suggests that associations at one locus could be the result In addition, we report a significant association of CYP3A4 and of causative effects at the other locus. However, it is most likely that CYP3A43 with occurrence of prostate cancer. Although CYP3A5*1 CYP3A4 or another variant in LD is causatively associated with had no effect on disease occurrence alone, CYP3A43 increased risk of prostate cancer, as CYP3A5 alone did not confer significant risk or disease in men with a family history of disease, and CYP3A4*1B had protection in our analysis. an overall protective effect. It is unclear why CYP3A43 is associated The role of CYP3A5 in the metabolism of hormones or other with prostate cancer when examined alone. The CYP3A43*3 allele putative prostate carcinogens is not as well understood as that for rarely has been studied, and there is not enough basic science about CYP3A4. CYP3A5*1 is the only CYP3A5 allele to date that produces the gene or this specific variant to suggest why there is a connection high levels of full-length CYP3A5 mRNA and expresses CYP3A5 to family history of disease. However, one might speculate that this (15). The more common CYP3A5 polymorphism in Caucasians, variant is more commonly inherited in men who have a family history CYP3A5*3, produces an aberrantly spliced mRNA with a premature of prostate cancer and may be a candidate hereditary gene for prostate stop codon. Therefore, there is ample reason to believe that the cancer. CYP3A5 alleles studied here could have a functionally meaningful Our results regarding CYP3A4*1B are consistent with previous effect on disease etiology. CYP3A5*1 has been inversely associated reports suggesting significant associations between the variant and the with prostate cancer (10), which was not replicated here. However, we occurrence and severity of prostate cancer (8–9, 23). In concordance did observe nonsignificant inverse associations with CYP3A5*1 in with the present results, Plummer et al. (10) observed an inverse family history-positive or early-onset high-stage cancers. Because of association between CYP3A4*1B and prostate cancer risk. Unfortu- the relatively small numbers of observations in that analysis, it is nately, we had limited ability to obtain statistical significance in some possible that the present study was underpowered to detect associa- subgroups because of small sample size. tions with CYP3A5*1. Therefore, additional large studies of In general, our results showing disease associations with CYP3A4 CYP3A5*1 should be undertaken to confirm the results of Plummer et and CYP3A43 are consistent with knowledge of gene and allele al. (10). function in these genes. CYP3A4 and CYP3A43 are involved in the In addition to LD with CYP3A5, we observed deviations from metabolic deactivation (hydroxylation) of testosterone (6–7). Hardy-Weinberg equilibrium for CYP3A4 in Caucasian cases and CYP3A43 is preferentially expressed in the prostate (7). However, the controls. This information further supports the hypothesis that function of CYP3A4*1B has been controversial. In addition to epide- CYP3A4*1B may be associated with prostate cancer etiology; a num- miologic evidence that CYP3A4*1B is associated with prostate cancer, ber of authors have suggested deviations from Hardy-Weinberg pro- the basic science literature has not consistently supported a function- portions may arise if a deficiency of one allele is seen in cases and/or ally significant effect. A number of authors have studied the relation- controls (32–34). In our data, there was a statistically significant ship of CYP3A4 expression or function of CYP3A4*1B (39–45). deficit of CYP3A4*1B alleles in cases and a statistically significant Most of these authors concluded that no biologically meaningful deficit of CYP3A4*1A alleles in controls. These data are consistent effects existed given the small magnitude of effects that were ob- with the deviations from expected proportions that may arise if served. However, almost all studies have reported consistent eleva- CYP3A4*1B was associated with disease risk. tions in expression associated with CYP3A4*1B in the range of We also report that CYP3A4, CYP3A5, and CYP3A43 allele fre- 20–200% increase over the consensus CYP3A4*1A. Although it is quencies and LD among these genes differ between African Ameri- possible that this magnitude of effects will not confer clinically cans and Caucasians. Specifically, there are substantially higher var- meaningful effects on drug disposition, it is not clear whether this iant CYP3A allele frequencies in Africans or African Americans phenotypic perturbation is sufficient to alter metabolism of exposures compared with other ethnicities (35). Because there is also strong (e.g., steroid hormones) that may confer disease risk over the lifetime evidence that baseline prostate cancer risks also differ by ethnicity of an individual. For example, a 20% greater metabolism of testos- (36), the conditions for population stratification (i.e., confounding by terone by CYP3A4*1B over the course of a man’s lifetime may be ethnicity) may be met. Therefore, all analyses were adjusted for major sufficient to increase prostate cancer risk and therefore explain epi- ethnic group (in addition to age) in which these differences exist. demiologic associations between CYP3A4*1B and prostate cancer. If Kittles et al. (11) evaluated potential population stratification for an so, the hypothesized direction of the metabolic effect of CYP3A4*1B 8465

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2004 American Association for Cancer Research. CYP3A AND PROSTATE CANCER to increase CYP3A4 expression is consistent with the epidemiologic 5. Luke MC, Coffey DS. The male sex assessory tissues. Structure, androgen action and association reported here: CYP3A4 converts testosterone to 2␤-, 6␤-, physiology. In: The physiology of reproduction, second edition. Knobil E, Neill JD, editors. Raven Press, Ltd.: New York; 1994. p. 1435–87. or 15␤-hydroxytestosterone and therefore shunts testosterone away 6. Waxman DJ, Attisano PF, Guengerich PF, Lapenson DP. Human liver microsomal from the more biologically active form of dihydrotestosterone (6). steroid metabolism: identification of the major microsomal steroid 6␤-hydroxylase Genetic variants that are associated with increased CYP3A4 activity, cytochrome P450 enzyme. Arch Biochem Biophys 1988;263:242–436. 7. Domanski TL, Finta C, Halpert JR, Zaphiropoulos PG. cDNA cloning and initial such as CYP3A4*1B, would be expected to decrease prostate cancer characterization of CYP3A43, a novel human cytochrome P450. Mol Pharmacol risk if the effect of the polymorphism is to decrease bioavailability of 2001;59:386–92. dihydrotestosterone. Thus, our observation of an inverse association 8. Paris PL, Kupelian PA, Hall JM, et al. Association between a CYP3A4CYP3A4 genetic variant and clinical presentation in African-American prostate cancer patients. of CYP3A4*1B with prostate cancer is consistent with the expected Cancer Epidemiol Biomark Prev 1999;8:901–5. direction of effect. 9. Tayeb MT, Clark C, Sharp L, et al. CYP3A4CYP3A4 promoter variant is associated When CYP3A4 and CYP3A43 were considered in pairwise interac- with prostate cancer risk in men with benign prostate hyperplasia. Oncol Rep 2002;9:653–5. tions to determine the effect of having genotypes with at least one 10. Plummer SJ, Conti DV, Paris PL, Curran AP, Casey G, Witte JS. CYP3A4CYP3A4 CYP3A4*1B and at least one CYP3A43*3 allele, some effects became and CYP3A5CYP3A5 genotypes, haplotypes, and risk of prostate cancer. Cancer stronger, in particular for early-onset prostate cancer. This is an Epidemiol Biomark Prev 2003;12:928–32. 11. Kittles RA, Chen W, Panguluri RK, et al. CYP3A4-V and prostate cancer in African interesting finding, because it suggests an association that may have Americans: causal or confounding association because of population stratification? its greatest impact in African-Americans. Although only 4% of Cau- Hum Genet 2002;110:553–60. casians carry this allelic combination, it is a more common haplotype 12. Cardon LR, Palmer LJ. Population stratification and spurious allelic association. Lancet 2003;361:598–604. observed in our African-American sample (35%; see Tables 5A and 13. Finta C, Zaphiropoulos PG. The human cytochrome P450 3A locus. Gene evolution 5B) Therefore, a subset of men who carry the CYP3A4*1B and by capture of downstream exons. Gene 2000;260:13–23. CYP3A43*3 combination and are likely African-American are signif- 14. Hashimoto H, Toide K, Kitamura R, et al. Gene structure of CYP3A4, an adult- specific form of cytochrome P450 in human livers, and its transcriptional control. Eur icantly less likely to have been diagnosed with prostate cancer before J Biochem 1993;218:585–95. age 60. The reason for this association is not understood, because 15. Kuehl P, Zhang J, Lin Y, et al. Sequence diversity in CYP3A promoters and African-Americans, in general, are at high risk to be diagnosed with characterization of the genetic basis of polymorphic CYP3A5 expression. Nat Genet 2001;27:383–91. prostate cancer before the age of 60 years. 16. Gellner K, Eiselt R, Hustert E, et al. Genomic organization of the human CYP3A Because CYP3A4*1B and CYP3A43*3 are in linkage equilibrium in locus: identification of a new, inducible CYP3A gene. Pharmacogenetics 2001;11: 111–21. our sample, the joint effect of these two genes is unlikely to be 17. Westlind A, Malmebo S, Johansson I, et al. Cloning and tissue distribution of a novel explained by LD. Thus, our data suggest that CYP3A4 and CYP3A43 human cytochrome p450 of the CYP3A subfamily, CYP3A43. Biochem Biophys Res each exert an independent effect on prostate cancer risk that cannot be Commun 2001;281:1349–55. 18. Koch I, Weil R, Wolbold R, et al. Interindividual variability and tissue-specificity in the explained by LD at each locus. expression of cytochrome P450 3A mRNA. Drug Metab Dispos 2002;30:1108–14. Finally, we also report significant differences in haplotype fre- 19. Wojnowski L, Hustert E, Klein K, et al. Re: modification of clinical presentation of quency distributions by race and case-control status. The observation prostate tumors by a novel genetic variant in CYP3A4CYP3A4. J Natl Cancer Inst (Bethesda) 2002;94:630–1. that the combined CYP3A4-CYP3A5-CYP3A43 haplotype may con- 20. Cooney KA, Strawderman MS, Wojno KJ, et al. Age-specific distribution of serum tain additional information about risk prediction beyond that of prostate-specific antigen in a community-based study of African-American men. CYP3A4 genotypes alone suggests that other genes in this region may Urology 2001;57:91–6. 21. Richards B, Skoletsky J, Shuber AP, et al. Multiplex PCR amplification from the also be involved in the etiology of prostate cancer or that the consid- CFTR gene using DNA prepared from buccal brushes/swabs. Hum Mol Genet eration of haplotypes in this region provides improved statistical 1993;2:159–163. information for studies evaluating prostate cancer risk and progres- 22. Walker AH, Najarian D, White DL, Jaffe JF, Kanetsky PA, Rebbeck TR. Collection of genomic DNA by buccal swabs for polymerase chain reaction-based biomarker sion. assays. Environ Health Perspect 1999;107:517–20. In conclusion, our results confirm the association of CYP3A4*1B 23. Rebbeck TR, Jaffe JM, Walker AH, Wein AJ, Malkowicz SB. Modification of and prostate cancer occurrence and severity, suggest a role for clinical presentation of prostate tumors by a novel genetic variant in CYP3A4. J Natl Cancer Inst (Bethesda) 1998;90:1225–9. CYP3A43*3 in prostate cancer etiology, and further elucidate the 24. Cauffiez C, Lo-Guidice JM, Chevalier D, et al. First report of a genetic polymorphism relationships of multiple genotypes and haplotypes at the CYP3A of the cytochrome P450 3A43 (CYP3A43) gene: identification of a loss-of-function locus with prostate cancer etiology. Combined with information about variant. Hum Mutat 2004;23:101. 25. Levene H. On a matching problem in genetics. Ann Math Stat 1949;20:91–4. the function of these genes, there is growing evidence that one or more 26. Weir BS. Genetic data analysis II. Sunderland, MA: Sinauer; 1996. of the genes in the CYP3A locus are involved in prostate cancer 27. Lewontin RC. On measures of gametic disequilibrium. Genetics 1988;120:849–52. etiology. 28. Thomson G, Baur MP. Third order linkage disequilibrium. Tissue Antigens 1984;24: 250–5. 29. Schaid DJ. Linkage disequilibrium testing when linkage phase is unknown. Genetics ACKNOWLEDGMENTS 2004;166:505–12. 30. Lewis PO, Zaykin D. GDA (genetic data analysis): computer program for the analysis The authors thank Drs. D. Goldmann, W. Greer, G. W. Crooks, D. A. of allelic data (version 1.1), 2002. Available from http://lewis.eeb.uconn.edu/lew- Horowitz, D. Farhadi, M. D. Cirigliano, M. L. Rusk, V. Weil, S. J. Gluckman, ishome/software.html. 31. Xie X, Ott J. Testing linkage disequilibrium between a disease gene and marker loci. C. Bridges, and C. Guerra for valuable assistance in ascertaining study sub- Am J Hum Genet 1993;53:1107. jects. 32. Feder JN, Gnirke A, Thomas W, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996;13:399–408. 33. Nielsen DM, Ehm MG, Weir BS. Detecting marker-disease association by testing REFERENCES for Hardy-Weinberg disequilibrium at a marker locus. Am J Hum Genet 1998; 1. Ross RK, Bernstein L, Lobo RA, et al. 5-alpha-Reductase activity and risk of prostate 63:1531–40. cancer among Japanese and US white and black males. Lancet 1992;339:887–9. 34. Hoh J, Wille A, Ott J. Trimming, weighting, and grouping SNPs in human case- 2. Lookingbill DP, Demers LM, Wang C, Leung A, Rittmaster RS, Santen RJ. Clinical control association studies. Genome Res 2001;11:2115–9. and biochemical parameters of androgen action in normal healthy Caucasian versus 35. Zeigler-Johnson CM, Walker AH, Mancke B, et al. Ethnic differences in the fre- Chinese subjects. J Clin Endo Metab 1991;72:1242–8. quency of prostate cancer susceptibility alleles at SRD5A2 and CYP3A4. Hum Hered 3. Vatten LJ, Ursin G, Ross RK, et al. Androgens in serum and the risk of prostate 2002;54:13–21. cancer: a nested case-control study from the Janus serum bank in Norway. Cancer 36. Hsing AW, Tsao L, Devesa SS. International trends and patterns of prostate cancer Epidemiol Biomark Prev 1997;6:967–9. incidence and mortality. Int J Cancer 2000;85:60–7. 4. Gann PH, Hennekens CH, Ma J, Longcope C, Stampfer MJ. Prospective study of sex 37. Wacholder S, Rothman N, Caporaso N. Population stratification in epidemiologic hormone levels and risk of prostate cancer. J Natl Cancer Inst (Bethesda) 1996;88: studies of common genetic variants and cancer: quantification of bias. J Natl Cancer 1118–26. Inst (Bethesda) 2000;92:1151–8. 8466

38. Wang Y, Localio R, Rebbeck TR. Evaluating bias due to population stratification in 42. Spurdle AB, Goodwin B, Hodgson E, et al. The CYP3A4*1B polymorphism has no case-control association studies of admixed populations. Genet Epidemiol 2004;27: functional significance and is not associated with risk of breast or ovarian cancer. 14–20. Pharmacogenetics 2002;12:355–66. 39. Westlind A, Lofberg L, Tindberg N, Andersson TB, Ingelman-Sundberg M. Interin- 43. Floyd MD, Gervasini G, Masica AL, et al. Genotype-phenotype associations for dividual differences in hepatic expression of CYP3A4: relationship to genetic poly- common CYP3A4 and CYP3A5 variants in the basal and induced metabolism of morphism in the 5Ј-upstream regulatory region. Biochem Biophys Res Commun midazolam in European- and African-American men and women. Pharmacogenetics 1999;259:201–5. 2003;13:595–606. 40. Amirimani B, Walker AH, Weber BL, Rebbeck TR. RESPONSE: re: modification of 44. Amirimani B, Ning B, Deitz AC, Weber BL, Kadlubar F, Rebbeck TR. Transcrip- clinical presentation of prostate tumors by a novel genetic variant in CYP3A4. J Natl tional activity effects of a CYP3A4 promoter variant. Environ Mol Mutagen 2003; Cancer Inst (Bethesda) 1999;91:1588–90. 42:299–305. 41. Ando Y, Tateishi T, Sekido Y, Yamamoto T, Satoh T, Hasegawa Y. Re: modification 45. Hamzeiy H, Bombail V, Plant N, Gibson G, Goldfarb P. Transcriptional regulation of of clinical presentation of prostate tumors by a novel genetic variant in CYP3A4. cytochrome P4503A4 gene expression: effects of inherited mutations in the 5Ј- J Natl Cancer Inst (Bethesda) 1999;91:1587–90. flanking region. Xenobiotica 2003;33:1085–95.

8467

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2004 American Association for Cancer Research. CYP3A4, CYP3A5, and CYP3A43 Genotypes and Haplotypes in the Etiology and Severity of Prostate Cancer

Charnita Zeigler-Johnson, Tara Friebel, Amy H. Walker, et al.

Cancer Res 2004;64:8461-8467.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/64/22/8461

Cited articles This article cites 42 articles, 8 of which you can access for free at: http://cancerres.aacrjournals.org/content/64/22/8461.full#ref-list-1

Citing articles This article has been cited by 5 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/64/22/8461.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/64/22/8461. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.