DOCSLIB.ORG

Mouse Dhrs4 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Dhrs4 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Dhrs4 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Dhrs4 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Dhrs4 gene (NCBI Reference Sequence: NM_001037938 ; Ensembl: ENSMUSG00000022210 ) is located on Mouse chromosome 14. 8 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 8 (Transcript: ENSMUST00000022821). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Dhrs4 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-158G18 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous mutant mice exhibit a decreased mean serum IgG2a response to ovalbumin challenge when compared with that of controls. Female mutants exhibit an increased depressive-like response during tail suspension testing. Exon 2 starts from about 15.77% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 992 bp, and the size of intron 2 for 3'-loxP site insertion: 5913 bp. The size of effective cKO region: ~678 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 8 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Homology arm Exon of mouse Dhrs4 cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7178bp) | A(26.89% 1930) | C(23.42% 1681) | T(25.26% 1813) | G(24.44% 1754) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. Significant high GC-content regions are found. It may be difficult to construct this targeting vector. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr14 + 55476777 55479776 3000 browser details YourSeq 237 538 1265 3000 83.4% chr17 - 27936497 28276033 339537 browser details YourSeq 236 584 1277 3000 83.5% chr1 + 57877805 57987340 109536 browser details YourSeq 191 989 1338 3000 82.4% chr17 + 29658071 29658432 362 browser details YourSeq 187 975 1359 3000 84.2% chr12 - 12789056 12789440 385 browser details YourSeq 169 995 1296 3000 84.8% chr19 - 26291467 26291778 312 browser details YourSeq 125 577 774 3000 89.4% chr6 + 145261272 145261472 201 browser details YourSeq 123 1015 1350 3000 84.3% chr17 - 33117614 33117951 338 browser details YourSeq 123 595 776 3000 89.3% chr4 + 140900961 140901148 188 browser details YourSeq 123 975 1275 3000 87.3% chr10 + 44270782 44271082 301 browser details YourSeq 120 1110 1357 3000 88.5% chr13 - 112018981 112019234 254 browser details YourSeq 119 576 771 3000 90.0% chr16 + 36496534 36496729 196 browser details YourSeq 117 568 733 3000 87.4% chr11 - 20709102 20709269 168 browser details YourSeq 117 595 774 3000 92.2% chr2 + 157491109 157491294 186 browser details YourSeq 116 584 718 3000 93.3% chr15 - 79009279 79009416 138 browser details YourSeq 116 577 774 3000 89.1% chr4 + 31818963 31819163 201 browser details YourSeq 115 577 773 3000 91.4% chr2 - 128646734 128646959 226 browser details YourSeq 115 584 769 3000 90.8% chr7 + 111418412 111418613 202 browser details YourSeq 112 602 774 3000 85.3% chr12 + 10658013 10658183 171 browser details YourSeq 111 577 774 3000 82.7% chr2 - 76148899 76149081 183 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr14 + 55480455 55483454 3000 browser details YourSeq 974 2002 3000 3000 98.8% chr1 - 15866880 15867878 999 browser details YourSeq 974 2003 3000 3000 98.5% chr3 + 7790687 7791682 996 browser details YourSeq 966 2001 3000 3000 98.0% chr12 - 23162565 23163562 998 browser details YourSeq 965 2002 3000 3000 98.2% chr5 + 3251614 3252611 998 browser details YourSeq 963 2003 3000 3000 97.8% chr4 + 4236962 4237950 989 browser details YourSeq 961 2003 3000 3000 98.3% chr9 - 19210734 19211733 1000 browser details YourSeq 961 2002 3000 3000 98.3% chr9 + 50626280 50627279 1000 browser details YourSeq 960 2002 3000 3000 97.7% chr18 + 87932971 87933961 991 browser details YourSeq 959 2002 3000 3000 97.7% chr18 + 9889169 9890165 997 browser details YourSeq 959 2003 3000 3000 97.7% chr10 + 32960212 32961204 993 browser details YourSeq 959 2002 3000 3000 98.1% chr1 + 60786322 60787321 1000 browser details YourSeq 957 2002 3000 3000 97.6% chr13 - 90290337 90291333 997 browser details YourSeq 957 2003 3000 3000 98.0% chr13 + 23324530 23325525 996 browser details YourSeq 956 1993 3000 3000 97.5% chrX - 38717461 38718467 1007 browser details YourSeq 956 2003 3000 3000 97.5% chr7 - 25574196 25575190 995 browser details YourSeq 954 2003 3000 3000 97.5% chr13 + 94080547 94081533 987 browser details YourSeq 953 2003 3000 3000 97.9% chr2 + 14345370 14346369 1000 browser details YourSeq 949 2002 3000 3000 97.1% chr4 - 10433390 10434376 987 browser details YourSeq 949 2002 3000 3000 97.9% chr2 - 120800803 120801801 999 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Dhrs4 dehydrogenase/reductase (SDR family) member 4 [ Mus musculus (house mouse) ] Gene ID: 28200, updated on 24-Oct-2019 Gene summary Official Symbol Dhrs4 provided by MGI Official Full Name dehydrogenase/reductase (SDR family) member 4 provided by MGI Primary source MGI:MGI:90169 See related Ensembl:ENSMUSG00000022210 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as CR; RRD; NDRD; PHCR; PSCD; mouNRDR; AI043103; AI790593; D14Ucla2 Expression Ubiquitous expression in kidney adult (RPKM 28.9), liver E18 (RPKM 24.8) and 28 other tissues See more Genomic context Location: 14 C3; 14 28.19 cM See Dhrs4 in Genome Data Viewer Exon count: 8 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 14 NC_000080.6 (55478741..55490340) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 14 NC_000080.5 (56097595..56109177) Chromosome 14 - NC_000080.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 8 transcripts Gene: Dhrs4 ENSMUSG00000022210 Description dehydrogenase/reductase (SDR family) member 4 [Source:MGI Symbol;Acc:MGI:90169] Gene Synonyms D14Ucla2, RRD Location Chromosome 14: 55,478,758-55,490,340 forward strand. GRCm38:CM001007.2 About this gene This gene has 8 transcripts (splice variants), 307 orthologues, 13 paralogues, is a member of 1 Ensembl protein family and is associated with 3 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Dhrs4- ENSMUST00000022821.7 1392 279aa ENSMUSP00000022821.6 Protein coding CCDS27111 Q99LB2 TSL:1 201 GENCODE basic APPRIS P1 Dhrs4- ENSMUST00000226168.1 828 216aa ENSMUSP00000154481.1 Protein coding - Q9D2U3 GENCODE basic 202 Dhrs4- ENSMUST00000228353.1 692 194aa ENSMUSP00000153847.1 Protein coding - A0A2I3BPY3 CDS 5' incomplete 208 Dhrs4- ENSMUST00000226298.1 626 76aa ENSMUSP00000154666.1 Protein coding - A0A2I3BRQ8 CDS 5' incomplete 203 Dhrs4- ENSMUST00000226902.1 537 179aa ENSMUSP00000154474.1 Protein coding - A0A2I3BRG8 CDS 5' and 3' 204 incomplete Dhrs4- ENSMUST00000227488.1 498 124aa ENSMUSP00000154006.1 Protein coding - A0A2I3BQ25 CDS 3' incomplete 205 Dhrs4- ENSMUST00000227542.1 831 No - Retained - - - 207 protein intron Dhrs4- ENSMUST00000227513.1 762 No - Retained - - - 206 protein intron Page 6 of 8 https://www.alphaknockout.com 31.58 kb Forward strand 55.47Mb 55.48Mb 55.49Mb 55.50Mb Genes Dhrs4-201 >protein coding Carmil3-212 >nonsense mediated decay (Comprehensive set... Dhrs4-205 >protein coding Dhrs4-207 >retained intron Carmil3-210 >retained intron Dhrs4-202 >protein coding Carmil3-205 >nonsense mediated decay Dhrs4-206 >retained intron Carmil3-201 >protein coding Dhrs4-204 >protein coding Carmil3-209 >retained intron Dhrs4-208 >protein coding Carmil3-208 >retained intron Dhrs4-203 >protein coding Carmil3-206 >lncRNA Carmil3-203 >nonsense mediated decay Carmil3-202 >retained intron Carmil3-211 >retained intron Contigs < AC159002.2 Regulatory Build 55.47Mb 55.48Mb 55.49Mb 55.50Mb Reverse strand 31.58 kb Regulation Legend CTCF Enhancer
Load more

Recommended publications
  • Comprehensive Identification and Characterization of Somatic Copy Number Alterations in Triple‑Negative Breast Cancer
    INTERNATIONAL JOURNAL OF ONCOLOGY 56: 522-530, 2020 Comprehensive identification and characterization of somatic copy number alterations in triple‑negative breast cancer ZAIBING LI1,2*, XIAO ZHANG3*, CHENXIN HOU4, YUQING ZHOU4, JUNLI CHEN1, HAOYANG CAI5, YIFENG YE3, JINPING LIU3 and NING HUANG1 1Department of Pathophysiology, West China School of Basic Medical Sciences and Forensic Medicine, Sichuan University, Chengdu, Sichuan 610041; 2Department of Pathophysiology, School of Basic Medical Science, Southwest Medical University, Luzhou, Sichuan 646000; 3Department of Breast Surgery, Sichuan Provincial People's Hospital, University of Electronic Science and Technology of China, Chengdu, Sichuan 611731; 4West China Medical School, Sichuan University, Chengdu, Sichuan 610041; 5Center of Growth, Metabolism and Aging, Key Laboratory of Bio‑Resources and Eco‑Environment, College of Life Sciences, Sichuan University, Chengdu, Sichuan 610064, P.R. China Received January 30, 2019; Accepted August 30, 2019 DOI: 10.3892/ijo.2019.4950 Abstract. Triple-negative breast cancer (TNBC) accounts hierarchical clustering of tumors resulted in three main for ~15% of all breast cancer diagnoses each year. Patients subgroups that exhibited distinct CNA profiles, which with TNBC tend to have a higher risk for early relapse and may reveal the heterogeneity of molecular mechanisms in a worse prognosis. TNBC is characterized by extensive TNBC subgroups. These results will extend the molecular somatic copy number alterations (CNAs). However, the DNA understanding of TNBC and will facilitate the discovery of CNA profile of TNBC remains to be extensively investigated. therapeutic and diagnostic target candidates. The present study assessed the genomic profile of CNAs in 201 TNBC samples, aiming to identify recurrent CNAs that Introduction may drive the pathogenesis of TNBC.
    [Show full text]
  • Coordinate Regulation of Long Non-Coding Rnas and Protein-Coding Genes in Germ- Free Mice Joseph Dempsey, Angela Zhang and Julia Yue Cui*
    Dempsey et al. BMC Genomics (2018) 19:834 https://doi.org/10.1186/s12864-018-5235-3 RESEARCHARTICLE Open Access Coordinate regulation of long non-coding RNAs and protein-coding genes in germ- free mice Joseph Dempsey, Angela Zhang and Julia Yue Cui* Abstract Background: Long non-coding RNAs (lncRNAs) are increasingly recognized as regulators of tissue-specific cellular functions and have been shown to regulate transcriptional and translational processes, acting as signals, decoys, guides, and scaffolds. It has been suggested that some lncRNAs act in cis to regulate the expression of neighboring protein-coding genes (PCGs) in a mechanism that fine-tunes gene expression. Gut microbiome is increasingly recognized as a regulator of development, inflammation, host metabolic processes, and xenobiotic metabolism. However, there is little known regarding whether the gut microbiome modulates lncRNA gene expression in various host metabolic organs. The goals of this study were to 1) characterize the tissue-specific expression of lncRNAs and 2) identify and annotate lncRNAs differentially regulated in the absence of gut microbiome. Results: Total RNA was isolated from various tissues (liver, duodenum, jejunum, ileum, colon, brown adipose tissue, white adipose tissue, and skeletal muscle) from adult male conventional and germ-free mice (n = 3 per group). RNA-Seq was conducted and reads were mapped to the mouse reference genome (mm10) using HISAT. Transcript abundance and differential expression was determined with Cufflinks using the reference databases NONCODE 2016 for lncRNAs and UCSC mm10 for PCGs. Although the constitutive expression of lncRNAs was ubiquitous within the enterohepatic (liver and intestine) and the peripheral metabolic tissues (fat and muscle) in conventional mice, differential expression of lncRNAs by lack of gut microbiota was highly tissue specific.
    [Show full text]
  • Antisense Afp Transcripts in Mouse Liver and Their Potential Role in Afp Gene Regulation
    University of Kentucky UKnowledge Theses and Dissertations--Microbiology, Microbiology, Immunology, and Molecular Immunology, and Molecular Genetics Genetics 2017 ANTISENSE AFP TRANSCRIPTS IN MOUSE LIVER AND THEIR POTENTIAL ROLE IN AFP GENE REGULATION Maria S. Dixon University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/ETD.2017.356 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Dixon, Maria S., "ANTISENSE AFP TRANSCRIPTS IN MOUSE LIVER AND THEIR POTENTIAL ROLE IN AFP GENE REGULATION" (2017). Theses and Dissertations--Microbiology, Immunology, and Molecular Genetics. 14. https://uknowledge.uky.edu/microbio_etds/14 This Doctoral Dissertation is brought to you for free and open access by the Microbiology, Immunology, and Molecular Genetics at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Microbiology, Immunology, and Molecular Genetics by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • Proteomic Analysis Reveals a Mitochondrial Remodeling of Βtc3 Cells in Response to Nanotopography
    fcell-08-00508 July 29, 2020 Time: 12:23 # 1 ORIGINAL RESEARCH published: 29 July 2020 doi: 10.3389/fcell.2020.00508 Proteomic Analysis Reveals a Mitochondrial Remodeling of bTC3 Cells in Response to Nanotopography Elisa Maffioli1,2†, Alessandra Galli3†, Simona Nonnis1,2, Algerta Marku3, Armando Negri1, Claudio Piazzoni2,4, Paolo Milani2,4, Cristina Lenardi2,4, Carla Perego3* and Gabriella Tedeschi1,2* 1 Department of Veterinary Medicine, University of Milano, Milan, Italy, 2 Centre for Nanostructured Materials and Interfaces, University of Milano, Milan, Italy, 3 Department of Pharmacological and Biomolecular Sciences, University of Milano, Milan, Italy, 4 Department of Physics, University of Milano, Milan, Italy Edited by: Recently, using cluster-assembled zirconia substrates with tailored roughness produced Luisa Pieroni, Santa Lucia Foundation (IRCCS), Italy by supersonic cluster beam deposition, we demonstrated that b cells can sense Reviewed by: nanoscale features of the substrate and can translate these stimuli into a Massimiliano Galluzzi, mechanotransductive pathway capable of preserveing b-cell differentiation and function Chinese Academy of Sciences (CAS), in vitro in long-term cultures of human islets. Using the same proteomic approach, China Geeta Upadhyay, we now focused on the mitochondrial fraction of bTC3 cells grown on the same Uniformed Services University of the zirconia substrates and characterized the morphological and proteomic modifications Health Sciences, United States Gian Maria Fimia, induced by the nanostructure. The results suggest that, in bTC3 cells, mitochondria Sapienza University of Rome, Italy are perturbed by the nanotopography and activate a program involving metabolism *Correspondence: modification and modulation of their interplay with other organelles. Data were confirmed Carla Perego in INS1E, a different b-cell model.
    [Show full text]
  • Epigenetic Regulation of WNT3A Enhancer During Regeneration of Injured Cortical Neurons
    International Journal of Molecular Sciences Article Epigenetic Regulation of WNT3A Enhancer during Regeneration of Injured Cortical Neurons 1, 2, 3 2 1 Chu-Yuan Chang y, Jui-Hung Hung y, Liang-Wei Huang , Joye Li , Ka Shing Fung , Cheng-Fu Kao 4 and Linyi Chen 1,5,* 1 Institute of Molecular Medicine, National Tsing Hua University, Hsinchu 30013, Taiwan; [email protected] (C.-Y.C.); [email protected] (K.S.F.) 2 Department of Computer Science, National Chiao Tung University, Hsinchu 30010, Taiwan; [email protected] (J.-H.H.); [email protected] (J.L.) 3 Department of Life Science, National Tsing Hua University, Hsinchu 30013, Taiwan; [email protected] 4 Institute of Cellular and Organismic Biology, Academia Sinica, Taipei 11574, Taiwan; [email protected] 5 Department of Medical Science, National Tsing Hua University, Hsinchu 30013, Taiwan * Correspondence: [email protected]; Tel.: +886-3-574-2775; Fax: +886-3-571-5934 These authors contributed equally to this work. y Received: 21 February 2020; Accepted: 9 March 2020; Published: 10 March 2020 Abstract: Traumatic brain injury is known to reprogram the epigenome. Chromatin immunoprecipitation-sequencing of histone H3 lysine 27 acetylation (H3K27ac) and tri-methylation of histone H3 at lysine 4 (H3K4me3) marks was performed to address the transcriptional regulation of candidate regeneration-associated genes. In this study, we identify a novel enhancer region for induced WNT3A transcription during regeneration of injured cortical neurons. We further demonstrated an increased mono-methylation of histone H3 at lysine 4 (H3K4me1) modification at this enhancer concomitant with a topological interaction between sub-regions of this enhancer and with promoter of WNT3A gene.
    [Show full text]
  • Examination of Testicular Gene Expression Patterns in Yorkshire Pigs with High and Low Levels of Boar Taint
    Animal Biotechnology, 21: 77–87, 2010 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495390903500607 EXAMINATION OF TESTICULAR GENE EXPRESSION PATTERNS IN YORKSHIRE PIGS WITH HIGH AND LOW LEVELS OF BOAR TAINT Maxwell C. K. Leung, Kiera-Lynne Bowley, and E. James Squires Department of Animal and Poultry Science, University of Guelph, Guelph, Ontario, Canada Boar taint refers to the objectionable odor and flavor in meat of some uncastrated male pigs, which is primarily due to high levels of androstenone, a steroid produced in the testis, and 3-methylindole (skatole) which is produced by bacterial degradation of tryptophan in the intestinal tract. We determined testicular gene expression patterns of Yorkshire pigs with high and low levels of boar taint using swine DNA microarrays with two-color hybridization. The microarrays contained 19486 annotated probes; the expressions of 8719 genes were detected. Fifty-three genes were significantly up-regulated in the high boar taint group and four were significantly down-regulated (p < 0.05; fold change > Æ1.55). Gene ontology (GO) analysis short-listed 11 significant GO terms (p < 0.05), most of which are associated with steroid metabolism and mitochondrial components. Comparing the results of this study with published work on Duroc and Norwegian Landrace boars,1 eleven genes (HSB17B4, FDX1, CYP11A1, DHRS4, PRDX1, CYB5, CYP17A1, FTL, IDI1, SULT2A1, and RDH12) were over-expressed in all three breeds with a high androstenone level. The current findings confirmed a number of candidate genes identified in previous functional studies and suggest several new genes differentially expressed with different levels of boar taint.
    [Show full text]
  • ZBTB33 Is Mutated in Clonal Hematopoiesis and Myelodysplastic Syndromes and Impacts RNA Splicing
    RESEARCH ARTICLE ZBTB33 Is Mutated in Clonal Hematopoiesis and Myelodysplastic Syndromes and Impacts RNA Splicing Ellen M. Beauchamp1,2, Matthew Leventhal1,2, Elsa Bernard3, Emma R. Hoppe4,5,6, Gabriele Todisco7,8, Maria Creignou8, Anna Gallì7, Cecilia A. Castellano1,2, Marie McConkey1,2, Akansha Tarun1,2, Waihay Wong1,2, Monica Schenone2, Caroline Stanclift2, Benjamin Tanenbaum2, Edyta Malolepsza2, Björn Nilsson1,2,9, Alexander G. Bick2,10,11, Joshua S. Weinstock12, Mendy Miller2, Abhishek Niroula1,2, Andrew Dunford2, Amaro Taylor-Weiner2, Timothy Wood2, Alex Barbera2, Shankara Anand2; Bruce M. Psaty13,14, Pinkal Desai15, Michael H. Cho16,17, Andrew D. Johnson18, Ruth Loos19,20; for the NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium; Daniel G. MacArthur2,21,22,23, Monkol Lek2,21,24; for the Exome Aggregation Consortium, Donna S. Neuberg25, Kasper Lage2,26, Steven A. Carr2, Eva Hellstrom-Lindberg8, Luca Malcovati7, Elli Papaemmanuil3, Chip Stewart2, Gad Getz2,27,28, Robert K. Bradley4,5,6, Siddhartha Jaiswal29, and Benjamin L. Ebert1,2,30 Downloaded from https://bloodcancerdiscov.aacrjournals.org by guest on September 30, 2021. Copyright 2021 American Copyright 2021 by AssociationAmerican for Association Cancer Research. for Cancer Research. ABSTRACT Clonal hematopoiesis results from somatic mutations in cancer driver genes in hematopoietic stem cells. We sought to identify novel drivers of clonal expansion using an unbiased analysis of sequencing data from 84,683 persons and identified common mutations in the 5-methylcytosine reader ZBTB33 as well as in YLPM1, SRCAP, and ZNF318. We also identified these mutations at low frequency in patients with myelodysplastic syndrome. Zbtb33-edited mouse hematopoietic stem and progenitor cells exhibited a competitive advantage in vivo and increased genome-wide intron retention.
    [Show full text]
  • The Pdx1 Bound Swi/Snf Chromatin Remodeling Complex Regulates Pancreatic Progenitor Cell Proliferation and Mature Islet Β Cell
    Page 1 of 125 Diabetes The Pdx1 bound Swi/Snf chromatin remodeling complex regulates pancreatic progenitor cell proliferation and mature islet β cell function Jason M. Spaeth1,2, Jin-Hua Liu1, Daniel Peters3, Min Guo1, Anna B. Osipovich1, Fardin Mohammadi3, Nilotpal Roy4, Anil Bhushan4, Mark A. Magnuson1, Matthias Hebrok4, Christopher V. E. Wright3, Roland Stein1,5 1 Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 2 Present address: Department of Pediatrics, Indiana University School of Medicine, Indianapolis, IN 3 Department of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 4 Diabetes Center, Department of Medicine, UCSF, San Francisco, California 5 Corresponding author: [email protected]; (615)322-7026 1 Diabetes Publish Ahead of Print, published online June 14, 2019 Diabetes Page 2 of 125 Abstract Transcription factors positively and/or negatively impact gene expression by recruiting coregulatory factors, which interact through protein-protein binding. Here we demonstrate that mouse pancreas size and islet β cell function are controlled by the ATP-dependent Swi/Snf chromatin remodeling coregulatory complex that physically associates with Pdx1, a diabetes- linked transcription factor essential to pancreatic morphogenesis and adult islet-cell function and maintenance. Early embryonic deletion of just the Swi/Snf Brg1 ATPase subunit reduced multipotent pancreatic progenitor cell proliferation and resulted in pancreas hypoplasia. In contrast, removal of both Swi/Snf ATPase subunits, Brg1 and Brm, was necessary to compromise adult islet β cell activity, which included whole animal glucose intolerance, hyperglycemia and impaired insulin secretion. Notably, lineage-tracing analysis revealed Swi/Snf-deficient β cells lost the ability to produce the mRNAs for insulin and other key metabolic genes without effecting the expression of many essential islet-enriched transcription factors.
    [Show full text]
  • Conclusion ™As Many As 140 Genes Were Significantly Altered by TNF-Α
    Amit Pandey, Neha Munjal and Malabika Datta. Institute of Genomics and Integrative Biology (CSIR), Mall Road, Delhi-110 007, INDIA [email protected] Diabetes mellitus, often simply termed Diabetes, is a syndrome characterized by disordered metabolism and high blood sugar. It is caused due to Diabetes low levels of insulin hormone or from abnormal resistance to insulin in its target tissues. World Health Organization estimates that India will alone have 79.4 million diabetic patients in 2030. One of its major form Type 2 diabetes, is often associated with obesity, hypertension, elevated Muscular Tumorgenesis cholesterol and metabolic syndrome. Changes in life styy,le, such as consumption of high‐calorie diet and lack of exercise, have increased the dystrophy global prevalence not only of diabetes but also of obesity. Type 2 diabetes is characterized by insulin resistance in target tissue, occurs due to several reasons and one of them being the proinflammatory cytokine, TNF‐α. It is also known as the link between diabetes and obesity. High levels of TNF‐α interfere with insulin signaling to cause the effect and to further investigate into the situation, gene transcription profiling was examined in control and TNF‐α treated HepG2 cells. Results indicated that TNF‐α could significantly alter the expression of a significant number TNF-α of genes that were identified to be related to lipid and fat metabolism on one hand and to immunoglobulin receptor activity and IgE binding thereby on the other thereby indicating global dysregulation of fat metabolism and compromise in immune defense mechanism(s) within the Cardiac hepatocyte by TNF‐α.
    [Show full text]
  • Identification of Novel Potential Inhibitors of Pteridine Reductase 1
    molecules Article Identification of Novel Potential Inhibitors of Pteridine Reductase 1 in Trypanosoma brucei via Computational Structure-Based Approaches and in Vitro Inhibition Assays Magambo Phillip Kimuda 1,2,† , Dustin Laming 3,4 , Heinrich C. Hoppe 3,4 and Özlem Tastan Bishop 1,* 1 Research Unit in Bioinformatics (RUBi), Department of Biochemistry and Microbiology, Rhodes University, P.O. Box 94, Grahamstown 6140, South Africa; [email protected] 2 College of Veterinary Medicine, Animal Resources and Biosecurity (COVAB), Makerere University, P.O. Box 7062, Kampala 00256, Uganda 3 Department of Biochemistry and Microbiology, Rhodes University, Grahamstown 6140, South Africa; [email protected] (D.L.); [email protected] (H.C.H.) 4 Centre for Chemico- and Biomedicinal Research, Rhodes University, Grahamstown 6140, South Africa * Correspondence: [email protected]; Tel.: +27-46-603-8072 † Member of the Trypanogen Consortium, www.trypanogen.net. Academic Editor: Tiziano Tuccinardi Received: 12 November 2018; Accepted: 24 December 2018; Published: 1 January 2019 Abstract: Pteridine reductase 1 (PTR1) is a trypanosomatid multifunctional enzyme that provides a mechanism for escape of dihydrofolate reductase (DHFR) inhibition. This is because PTR1 can reduce pterins and folates. Trypanosomes require folates and pterins for survival and are unable to synthesize them de novo. Currently there are no anti-folate based Human African Trypanosomiasis (HAT) chemotherapeutics in use. Thus, successful dual inhibition of Trypanosoma brucei dihydrofolate reductase (TbDHFR) and Trypanosoma brucei pteridine reductase 1 (TbPTR1) has implications in the exploitation of anti-folates. We carried out molecular docking of a ligand library of 5742 compounds against TbPTR1 and identified 18 compounds showing promising binding modes.
    [Show full text]
  • Facteur De Risque Génétique Aux Maladies Inflammatoires De L’Intestin Et Modulateur D’Inflammation
    Université de Montréal MAST3 : facteur de risque génétique aux maladies inflammatoires de l’intestin et modulateur d’inflammation par Catherine Labbé Département de sciences biomédicales Faculté de médecine Thèse présentée à la Faculté de médecine en vue de l’obtention du grade de doctorat en sciences biomédicales 5 août, 2011 © Catherine Labbé, 2011 Université de Montréal Faculté de médecine Cette thèse intitulée : MAST3 : facteur de risque génétique aux maladies inflammatoires de l’intestin et modulateur d’inflammation Présentée par : Catherine Labbé a été évaluée par un jury composé des personnes suivantes : Daniel Sinnett, président-rapporteur John D. Rioux, directeur de recherche Zoha Kibar, membre du jury Yohan Bossé, examinateur externe Gaëtan Mayer, représentant du doyen de la FES i Résumé La maladie de Crohn (MC) et la colite ulcéreuse (CU) sont des maladies inflammatoires chroniques du tube digestif qu’on regroupe sous le terme maladies inflammatoires de l’intestin (MII). Les mécanismes moléculaires menant au développement des MII ne sont pas entièrement connus, mais des études génétiques et fonctionnelles ont permis de mettre en évidence des interactions entre des prédispositions génétiques et des facteurs environnementaux - notamment la flore intestinale – qui contribuent au développement d’une dérégulation de la réponse immunitaire menant à l’inflammation de la muqueuse intestinale. Des études d’association pangénomiques et ciblées ont permis d’identifier plusieurs gènes de susceptibilité aux MII mais les estimations de la contribution de ces gènes à l’héritabilité suggèrent que plusieurs gènes restent à découvrir. Certains d’entre eux peuvent se trouver dans les régions identifiées par des études de liaison génétique.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials 1 Supplementary Figure S1. Expression of BPIFB4 in murine hearts. Representative immunohistochemistry images showing the expression of BPIFB4 in the left ventricle of non-diabetic mice (ND) and diabetic mice (Diab) given vehicle or LAV-BPIFB4. BPIFB4 is shown in green, nuclei are identified by the blue fluorescence of DAPI. Scale bars: 1 mm and 100 μm. 2 Supplementary Table S1 – List of PCR primers. Target gene Primer Sequence NCBI Accession number / Reference Forward AAGTCCCTCACCCTCCCAA Actb [1] Reverse AAGCAATGCTGTCACCTTC Forward TCTAGGCAATGCCGTTCAC Cpt1b [2] Reverse GAGCACATGGGCACCATAC Forward GGAAATGATCAACAAAAAAAGAAGTATTT Acadm (Mcad) [2] Reverse GCCGCCACATCAGA Forward TGATGGTTTGGAGGTTGGGG Acot1 NM_012006.2 Reverse TGAAACTCCATTCCCAGCCC Forward GGTGTCCCGTCTAATGGAGA Hmgcs2 NM_008256.4 Reverse ACACCCAGGATTCACAGAGG Forward CAAGCAGCAACATGGGAAGA Cs [2] Reverse GTCAGGATCAAGAACCGAAGTCT Forward GCCATTGTCAACTGTGCTGA Ucp3 NM_009464.3 Reverse TCCTGAGCCACCATCTTCAG Forward CGTGAGGGCAATGATTTATACCAT Atp5b [2] Reverse TCCTGGTCTCTGAAGTATTCAGCAA Pdk4 Forward CCGCTGTCCATGAAGCA [2] 3 Reverse GCAGAAAAGCAAAGGACGTT Forward AGAGTCCTATGCAGCCCAGA Tomm20 NM_024214.2 Reverse CAAAGCCCCACATCTGTCCT Forward GCCTCAGATCGTCGTAGTGG Drp1 NM_152816.3 Reverse TTCCATGTGGCAGGGTCATT Forward GGGAAGGTGAAGAAGCTTGGA Mfn2 NM_001285920.1 Reverse ACAACTGGAACAGAGGAGAAGTT Forward CGGAAATCATATCCAACCAG [2] Ppargc1a (Pgc1α) Reverse TGAGAACCGCTAGCAAGTTTG Forward AGGCTTGGAAAAATCTGTCTC [2] Tfam Reverse TGCTCTTCCCAAGACTTCATT Forward TGCCCCAGAGCTGTTAATGA Bcl2l1 NM_001289716.1
    [Show full text]