DOCSLIB.ORG

Identification of Novel Substrates of Lrrk2, a Parkinson's Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Novel Substrates of Lrrk2, a Parkinson's Disease IDENTIFICATION OF NOVEL SUBSTRATES OF LRRK2, A PARKINSON’S DISEASE ASSOCIATED KINASE By CAROLINE H. LEE Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Adviser: Dr. Shu G. Chen Department of Biochemistry CASE WESTERN RESERVE UNIVERSITY May 2014 Case Western Reserve University School of Graduate Studies We hereby approve the thesis/dissertation of CAROLINE H. LEE Candidate for the degree of Doctor of Philosophy Committee Chair Dr. Michael E. Harris Committee Members Dr. Shu G. Chen Dr. Robert Petersen Dr. Hung-ying Kao Dr. Neena Singh Date of Defense December 18, 2013 *We also certify that written approval has been obtained for any proprietary material contained therein. 1 Table of Contents Table of Contents ...................................................................................................................... 2 List of Tables .............................................................................................................................. 4 List of Figures ............................................................................................................................. 5 List of Abbreviations ............................................................................................................... 6 Acknowledgements .................................................................................................................. 7 Abstract ..................................................................................................................................... 10 Chapter 1: Review .................................................................................................................. 12 Parkinson’s Disease ........................................................................................................................ 13 Clinical features of Parkinson’s disease and its prevalence ............................................................ 13 Pathological features of Parkinson’s disease ........................................................................................ 13 Genetics of Parkinson’s disease ............................................................................................................... 14 Leucine­rich repeat kinase 2 (LRRK2) ..................................................................................... 16 Prevalence of LRRK2 mutations in PD ................................................................................................. 16 LRRK2-associated neuropathology ........................................................................................................ 17 Structure of LRRK2 ..................................................................................................................................... 18 Biological function of LRRK2 ................................................................................................................. 19 Animal models of LRRK2­linked PD ......................................................................................... 21 Identifying substrates of LRRK2 ................................................................................................ 22 Chemical genetic approach ........................................................................................................................ 22 Current findings on proposed substrates ................................................................................................ 24 Chapter 2: Chemical Genetic Identification of LRRK2 Substrates ........................ 28 Abstract ............................................................................................................................................... 29 Introduction ...................................................................................................................................... 29 Experimental Procedures ............................................................................................................. 32 Generation of analog-sensitive LRRK2 variants ................................................................................ 32 Immunoprecipitation of flag-tagged LRRK2 ....................................................................................... 33 In vitro kinase assay ..................................................................................................................................... 33 Indirect competition assay .......................................................................................................................... 34 Synthesis of N6-cPe-ATPγS using Ynk1p ............................................................................................ 34 In vivo Substrate labeling using digitonin ............................................................................................. 35 Immunoprecipitation of in vivo labeled substrates ............................................................................. 36 Mass spectrometry analysis ....................................................................................................................... 36 Generation of flag-tagged eIF4G1 variants .......................................................................................... 37 Results ................................................................................................................................................. 38 Characterization of analog-sensitive LRRK2 ...................................................................................... 38 In vivo substrate phosphorylation by AS-G2019S.............................................................................. 41 Global analysis of potential LRRK2 substrates ................................................................................... 43 Validation of eIF4G1 as a LRRK2 substrate ........................................................................................ 44 Discussion .......................................................................................................................................... 45 Chapter 3: Future Directions ............................................................................................. 51 2 Tables ......................................................................................................................................... 58 Table 1. LRRK2 mutations and clinical phenotypes, as reported in various populations. ....................................................................................................................................... 59 Table 2. List of small molecule LRRK2 inhibitors. There are several LRRK2 inhibitors with different molecular structures. ................................................................... 59 Table 3. List of proposed LRRK2 substrates. ......................................................................... 60 Figures ....................................................................................................................................... 61 Figure 1................................................................................................................................................ 62 Figure 2................................................................................................................................................ 62 Figure 3................................................................................................................................................ 63 Figure 4................................................................................................................................................ 64 Figure 5................................................................................................................................................ 65 Figure 6................................................................................................................................................ 66 Figure 7................................................................................................................................................ 67 Figure 8................................................................................................................................................ 68 Figure 9................................................................................................................................................ 70 Figure 10 ............................................................................................................................................. 71 Figure 11 ............................................................................................................................................. 72 Appendix ................................................................................................................................... 73 Appendix I .......................................................................................................................................... 74 References ................................................................................................................................ 81 3 List of Tables Table 1. LRRK2 mutations and clinical phenotypes…………………………………60 Table 2. List of small molecule LRRK2 inhibitors…………………………………...60 Table 3. List of proposed LRRK2 substrates…………………………………………61 4 List of Figures Figure 1. Lewy bodies in PD brains………......................................................................63
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • LRRK2 at the Crossroad of Aging and Parkinson's Disease
    G C A T T A C G G C A T genes Review LRRK2 at the Crossroad of Aging and Parkinson’s Disease Eun-Mi Hur 1 and Byoung Dae Lee 2,3,* 1 Department of Neuroscience, College of Veterinary Medicine, Research Institute for Veterinary Science and BK21 Four Future Veterinary Medicine Leading Education & Research Center, Seoul National University, Seoul 08826, Korea; [email protected] 2 Department of Physiology, Kyung Hee University School of Medicine, Seoul 02447, Korea 3 Department of Neuroscience, Kyung Hee University, Seoul 02447, Korea * Correspondence: [email protected]; Tel.: +82-2-961-9381 Abstract: Parkinson’s disease (PD) is a heterogeneous neurodegenerative disease characterized by the progressive loss of dopaminergic neurons in the substantia nigra pars compacta and the widespread occurrence of proteinaceous inclusions known as Lewy bodies and Lewy neurites. The etiology of PD is still far from clear, but aging has been considered as the highest risk factor influencing the clinical presentations and the progression of PD. Accumulating evidence suggests that aging and PD induce common changes in multiple cellular functions, including redox imbalance, mitochondria dysfunction, and impaired proteostasis. Age-dependent deteriorations in cellular dysfunction may predispose individuals to PD, and cellular damages caused by genetic and/or environmental risk factors of PD may be exaggerated by aging. Mutations in the LRRK2 gene cause late-onset, autosomal dominant PD and comprise the most common genetic causes of both familial and sporadic PD. LRRK2-linked PD patients show clinical and pathological features indistinguishable from idiopathic PD patients. Here, we review cellular dysfunctions shared by aging and PD-associated LRRK2 mutations and discuss how the interplay between the two might play a role in PD pathologies.
    [Show full text]
  • Dynamic Molecular Linkers of the Genome: the First Decade of SMC Proteins
    Downloaded from genesdev.cshlp.org on October 8, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Dynamic molecular linkers of the genome: the first decade of SMC proteins Ana Losada1 and Tatsuya Hirano2,3 1Spanish National Cancer Center (CNIO), Madrid E-28029, Spain; 2Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA Structural maintenance of chromosomes (SMC) proteins in eukaryotes. The proposed actions of cohesin and con- are chromosomal ATPases, highly conserved from bac- densins offer a plausible, if not complete, explanation for teria to humans, that play fundamental roles in many the sudden appearance of thread-like “substances” (the aspects of higher-order chromosome organization and chromosomes) and their longitudinal splitting during dynamics. In eukaryotes, SMC1 and SMC3 act as the mitosis, first described by Walther Flemming (1882). core of the cohesin complexes that mediate sister chro- Remarkably, SMC proteins are conserved among the matid cohesion, whereas SMC2 and SMC4 function as three phyla of life, indicating that the basic strategy of the core of the condensin complexes that are essential chromosome organization may be evolutionarily con- for chromosome assembly and segregation. Another served from bacteria to humans. An emerging theme is complex containing SMC5 and SMC6 is implicated in that SMC proteins are dynamic molecular linkers of the DNA repair and checkpoint responses. The SMC com- genome that actively fold, tether, and manipulate DNA plexes form unique ring- or V-shaped structures with strands. Their diverse functions range far beyond chro- long coiled-coil arms, and function as ATP-modulated, mosome segregation, and involve nearly all aspects of dynamic molecular linkers of the genome.
    [Show full text]
  • Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug
    cancers Article Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug Response Genes in Pediatric Acute Myeloid Leukemia David G.J. Cucchi 1 , Costa Bachas 1 , Marry M. van den Heuvel-Eibrink 2,3, Susan T.C.J.M. Arentsen-Peters 3, Zinia J. Kwidama 1, Gerrit J. Schuurhuis 1, Yehuda G. Assaraf 4, Valérie de Haas 3 , Gertjan J.L. Kaspers 3,5 and Jacqueline Cloos 1,* 1 Hematology, Cancer Center Amsterdam, Amsterdam UMC, Vrije Universiteit Amsterdam, 1081 HV Amsterdam, The Netherlands; [email protected] (D.G.J.C.); [email protected] (C.B.); [email protected] (Z.J.K.); [email protected] (G.J.S.) 2 Department of Pediatric Oncology/Hematology, Erasmus MC–Sophia Children’s Hospital, 3015 CN Rotterdam, The Netherlands; [email protected] 3 Princess Máxima Center for Pediatric Oncology, 3584 CS Utrecht, The Netherlands; [email protected] (S.T.C.J.M.A.-P.); [email protected] (V.d.H.); [email protected] (G.J.L.K.) 4 The Fred Wyszkowski Cancer Research, Laboratory, Department of Biology, Technion-Israel Institute of Technology, 3200003 Haifa, Israel; [email protected] 5 Emma’s Children’s Hospital, Amsterdam UMC, Vrije Universiteit Amsterdam, Pediatric Oncology, 1081 HV Amsterdam, The Netherlands * Correspondence: [email protected] Received: 21 April 2020; Accepted: 12 May 2020; Published: 15 May 2020 Abstract: Novel treatment strategies are of paramount importance to improve clinical outcomes in pediatric AML. Since chemotherapy is likely to remain the cornerstone of curative treatment of AML, insights in the molecular mechanisms that determine its cytotoxic effects could aid further treatment optimization.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Building the Interphase Nucleus: a Study on the Kinetics of 3D Chromosome Formation, Temporal Relation to Active Transcription, and the Role of Nuclear Rnas
    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2020-07-28 Building the Interphase Nucleus: A study on the kinetics of 3D chromosome formation, temporal relation to active transcription, and the role of nuclear RNAs Kristin N. Abramo University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Bioinformatics Commons, Cell Biology Commons, Computational Biology Commons, Genomics Commons, Laboratory and Basic Science Research Commons, Molecular Biology Commons, Molecular Genetics Commons, and the Systems Biology Commons Repository Citation Abramo KN. (2020). Building the Interphase Nucleus: A study on the kinetics of 3D chromosome formation, temporal relation to active transcription, and the role of nuclear RNAs. GSBS Dissertations and Theses. https://doi.org/10.13028/a9gd-gw44. Retrieved from https://escholarship.umassmed.edu/ gsbs_diss/1099 Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial 4.0 License This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. BUILDING THE INTERPHASE NUCLEUS: A STUDY ON THE KINETICS OF 3D CHROMOSOME FORMATION, TEMPORAL RELATION TO ACTIVE TRANSCRIPTION, AND THE ROLE OF NUCLEAR RNAS A Dissertation Presented By KRISTIN N. ABRAMO Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSPOPHY July 28, 2020 Program in Systems Biology, Interdisciplinary Graduate Program BUILDING THE INTERPHASE NUCLEUS: A STUDY ON THE KINETICS OF 3D CHROMOSOME FORMATION, TEMPORAL RELATION TO ACTIVE TRANSCRIPTION, AND THE ROLE OF NUCLEAR RNAS A Dissertation Presented By KRISTIN N.
    [Show full text]
  • Understanding Molecular Functions of the SMC5/6 Complex
    G C A T T A C G G C A T genes Review Scaffolding for Repair: Understanding Molecular Functions of the SMC5/6 Complex Mariana Diaz 1,2 and Ales Pecinka 1,* ID 1 Institute of Experimental Botany of the Czech Academy of Sciences (IEB), Centre of the Region Haná for Biotechnological and Agricultural Research, Šlechtitelu˚ 31, 77900 Olomouc-Holice, Czech Republic 2 Max Planck Institute for Plant Breeding Research (MPIPZ), Carl-von-Linné-Weg 10, 50829 Cologne, Germany; [email protected] * Correspondence: [email protected]; Tel.: +420-585-238-709 Received: 15 November 2017; Accepted: 4 January 2018; Published: 12 January 2018 Abstract: Chromosome organization, dynamics and stability are required for successful passage through cellular generations and transmission of genetic information to offspring. The key components involved are Structural maintenance of chromosomes (SMC) complexes. Cohesin complex ensures proper chromatid alignment, condensin complex chromosome condensation and the SMC5/6 complex is specialized in the maintenance of genome stability. Here we summarize recent knowledge on the composition and molecular functions of SMC5/6 complex. SMC5/6 complex was originally identified based on the sensitivity of its mutants to genotoxic stress but there is increasing number of studies demonstrating its roles in the control of DNA replication, sister chromatid resolution and genomic location-dependent promotion or suppression of homologous recombination. Some of these functions appear to be due to a very dynamic interaction with cohesin or other repair complexes. Studies in Arabidopsis indicate that, besides its canonical function in repair of damaged DNA, the SMC5/6 complex plays important roles in regulating plant development, abiotic stress responses, suppression of autoimmune responses and sexual reproduction.
    [Show full text]
  • Pleiotropic Effects for Parkin and LRRK2 in Leprosy Type-1 Reactions and Parkinson’S Disease
    Pleiotropic effects for Parkin and LRRK2 in leprosy type-1 reactions and Parkinson’s disease Vinicius M. Favaa,b,1,2, Yong Zhong Xua,b, Guillaume Lettrec,d, Nguyen Van Thuce, Marianna Orlovaa,b, Vu Hong Thaie, Shao Taof,g, Nathalie Croteauh, Mohamed A. Eldeebi, Emma J. MacDougalli, Geison Cambrij, Ramanuj Lahirik, Linda Adamsk, Edward A. Foni, Jean-François Trempeh, Aurélie Cobatl,m, Alexandre Alcaïsl,m, Laurent Abell,m,n, and Erwin Schurra,b,o,1,2 aProgram in Infectious Diseases and Immunity in Global Health, The Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A3J1; bMcGill International TB Centre, Montreal, QC, Canada H4A 3J1; cMontreal Heart Institute, Montreal, QC, Canada H1T 1C8; dDepartment of Medicine, Faculty of Medicine, Université de Montréal, Montréal, QC, Canada H3T 1J4; eHospital for Dermato-Venereology, District 3, Ho Chi Minh City, Vietnam; fDivision of Experimental Medicine, Faculty of Medicine, McGill University, Montreal, QC, Canada H3G 2M1; gThe Translational Research in Respiratory Diseases Program, The Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; hCentre for Structural Biology, Department of Pharmacology & Therapeutics, McGill University, Montreal, QC, Canada H3G 1Y6; iMcGill Parkinson Program, Neurodegenerative Diseases Group, Department of Neurology and Neurosurgery, Montreal Neurological Institute, McGill University, Montreal, QC, Canada H3A 2B4; jGraduate Program in Health Sciences, Pontifícia Universidade Católica do Paraná, Curitiba, PR, 80215-901, Brazil; kNational Hansen’s Disease Program, Health Resources and Services Administration, Baton Rouge, LA 70803; lLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Institut National de la Santé et de la Recherche Médicale 1163, 75015 Paris, France; mImagine Institute, Paris Descartes-Sorbonne Paris Cité University, 75015 Paris, France; nSt.
    [Show full text]
  • Integrative Survival-Based Molecular Profiling of Human Pancreatic Cancer
    Published OnlineFirst January 18, 2012; DOI: 10.1158/1078-0432.CCR-11-1539 Clinical Cancer Imaging, Diagnosis, Prognosis Research Integrative Survival-Based Molecular Profiling of Human Pancreatic Cancer Timothy R. Donahue1,2,3,4, Linh M. Tran2,3, Reginald Hill2,3, Yunfeng Li2,3, Anne Kovochich5, Joseph H. Calvopina3, Sanjeet G. Patel1, Nanping Wu2,3, Antreas Hindoyan2,3, James J. Farrell6, Xinmin Li5, David W. Dawson4,5, and Hong Wu2,3,4,7 Abstract Purpose: To carry out an integrative profile of human pancreatic ductal adenocarcinoma (PDAC) to identify prognosis-significant genes and their related pathways. Experimental Design: A concordant survival-based whole genome in silico array analysis of DNA copy number, and mRNA and miRNA expression in 25 early-stage PDAC was carried out. A novel composite score simultaneously integrated gene expression with regulatory mechanisms to identify the signature genes with the most levels of prognosis-significant evidence. The predominant signaling pathways were determined via a pathway-based approach. Independent patient cohorts (n ¼ 148 and 42) were then used as in vitro validation of the array findings. Results: The composite score identified 171 genes in which expressions were able to define two prognosis subgroups (P ¼ 3.8e-5). Eighty-eight percent (151 of 171) of the genes were regulated by prognosis-significant miRNAs. The phosphoinositide 3-kinase/AKT pathway and SRC signaling were densely populated by prognosis-significant genes and driven by genomic amplification of SRC and miRNA regulation of p85a and CBL. On tissue microarray validation (n ¼ 148), p85a protein expression was associated with improved survival for all patients (P ¼ 0.02), and activated P-SRC (Y418) was associated shorter survival for patients with low-grade histology tumors (P ¼ 0.04).
    [Show full text]
  • LRRK2) Inhibitors Using a Crystallographic Surrogate Derived from Checkpoint Kinase 1 (CHK1
    This is a repository copy of Design of Leucine-Rich Repeat Kinase 2 (LRRK2) Inhibitors Using a Crystallographic Surrogate Derived from Checkpoint Kinase 1 (CHK1). White Rose Research Online URL for this paper: https://eprints.whiterose.ac.uk/130583/ Version: Accepted Version Article: Williamson, Douglas S., Smith, Garrick P., Acheson-Dossang, Pamela et al. (20 more authors) (2017) Design of Leucine-Rich Repeat Kinase 2 (LRRK2) Inhibitors Using a Crystallographic Surrogate Derived from Checkpoint Kinase 1 (CHK1). JOURNAL OF MEDICINAL CHEMISTRY. pp. 8945-8962. ISSN 0022-2623 https://doi.org/10.1021/acs.jmedchem.7b01186 Reuse Items deposited in White Rose Research Online are protected by copyright, with all rights reserved unless indicated otherwise. They may be downloaded and/or printed for private study, or other acts as permitted by national copyright laws. The publisher or other rights holders may allow further reproduction and re-use of the full text version. This is indicated by the licence information on the White Rose Research Online record for the item. Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ Design of LRRK2 inhibitors using a CHK1-derived crystallographic surrogate Douglas S. Williamson,†* Garrick P. Smith,‡ Pamela Acheson-Dossang,† Simon T. Bedford,† Victoria Chell,† I-Jen Chen,† Justus C. A. Daechsel,‡ Zoe Daniels,† Laurent David,‡ Pawel Dokurno,† Morten Hentzer,‡ Martin C. Herzig,‡ Roderick E.
    [Show full text]
  • NATURAL KILLER CELLS, HYPOXIA, and EPIGENETIC REGULATION of HEMOCHORIAL PLACENTATION by Damayanti Chakraborty Submitted to the G
    NATURAL KILLER CELLS, HYPOXIA, AND EPIGENETIC REGULATION OF HEMOCHORIAL PLACENTATION BY Damayanti Chakraborty Submitted to the graduate degree program in Pathology and Laboratory Medicine and the Graduate Faculty of the University of Kansas in partial fulfillment ofthe requirements for the degree of Doctor of Philosophy. ________________________________ Chair: Michael J. Soares, Ph.D. ________________________________ Jay Vivian, Ph.D. ________________________________ Patrick Fields, Ph.D. ________________________________ Soumen Paul, Ph.D. ________________________________ Michael Wolfe, Ph.D. ________________________________ Adam J. Krieg, Ph.D. Date Defended: 04/01/2013 The Dissertation Committee for Damayanti Chakraborty certifies that this is the approved version of the following dissertation: NATURAL KILLER CELLS, HYPOXIA, AND EPIGENETIC REGULATION OF HEMOCHORIAL PLACENTATION ________________________________ Chair: Michael J. Soares, Ph.D. Date approved: 04/01/2013 ii ABSTRACT During the establishment of pregnancy, uterine stromal cells differentiate into decidual cells and recruit natural killer (NK) cells. These NK cells are characterized by low cytotoxicity and distinct cytokine production. In rodent as well as in human pregnancy, the uterine NK cells peak in number around mid-gestation after which they decline. NK cells associate with uterine spiral arteries and are implicated in pregnancy associated vascular remodeling processes and potentially in modulating trophoblast invasion. Failure of trophoblast invasion and vascular remodeling has been shown to be associated with pathological conditions like preeclampsia syndrome, hypertension in mother and/or fetal growth restriction. We hypothesize that NK cells fundamentally contribute to the organization of the placentation site. In order to study the in vivo role of NK cells during pregnancy, gestation stage- specific NK cell depletion was performed in rats using anti asialo GM1 antibodies.
    [Show full text]
  • Antigen-Specific Memory CD4 T Cells Coordinated Changes in DNA
    Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021 is online at: average * The Journal of Immunology The Journal of Immunology published online 18 March 2013 from submission to initial decision 4 weeks from acceptance to publication http://www.jimmunol.org/content/early/2013/03/17/jimmun ol.1202267 Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto, Katsumi Ogoshi, Atsushi Sasaki, Jun Abe, Wei Qu, Yoichiro Nakatani, Budrul Ahsan, Kenshiro Oshima, Francis H. W. Shand, Akio Ametani, Yutaka Suzuki, Shuichi Kaneko, Takashi Wada, Masahira Hattori, Sumio Sugano, Shinichi Morishita and Kouji Matsushima J Immunol Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Author Choice option Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Freely available online through http://www.jimmunol.org/content/suppl/2013/03/18/jimmunol.120226 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Author Choice Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 24, 2021. Published March 18, 2013, doi:10.4049/jimmunol.1202267 The Journal of Immunology Coordinated Changes in DNA Methylation in Antigen-Specific Memory CD4 T Cells Shin-ichi Hashimoto,*,†,‡ Katsumi Ogoshi,* Atsushi Sasaki,† Jun Abe,* Wei Qu,† Yoichiro Nakatani,† Budrul Ahsan,x Kenshiro Oshima,† Francis H.
    [Show full text]