Supplementary Material for Manuscript - CAN-10-1313

14

13

12

11 hsa-miR-191 HCC tissue

10

9

8 8 9 10 11 12 13 14 Liver adjacent tissue

Figure S1: miRNAs expression in tissues from HCC patients, comparing the expression in the tumors to the adjacent tissue. miR-191 expression in highlighted.

100000

10000

1000

anti-miR-191 miR-191

100 100 1000 10000 100000 untreated cells

Figure S2: The figure shows miRs expression of SNU-423 cells, comparing the expression of anti-miR-191 treated cells to control cells. The inhibition of miR-191 in the treated cells is evident, while there is little change in the expression of other miRs.

120

100 anti-mir-191 80 control

60

40

20 % Proliferation %

0 10 100 1000 -20 anti-miR (nM)

Figure S3: This figure shows the inhibition of cell proliferation in SNU-423 cells treated with anti-miR-191 comparing to cells treated with a control anti-miR.

Figure S4: qRT-PCR results for miR-191 and several other miRs in HepG2 cells, comparing the expression in cells treated with anti-miR-191 and control cells.

Figure S5: Molecular Structure of MOE anti-miR-191:

O O Base

OCH O O 3 O P S O O Base

O O OCH3 Sequence of anti-miR-191: ACAAGTGCCTTCACTGCAGT

Tumor

140 120 100 80 60

Weight (mg) Weight 40 20 0 control anti-miR-191

Figure S6: This figure shows the results of a repeated Orthtopic xenograft experiment, showing the same significant reduction in tumor weight as was seen in the first experiment. The fold change of tumor weight between the group of mice treated with a control anti-miR and the group that was treated with anti-miR-191 was 2.5 with p=0.022.

Figure S7: The figure shows images of Orthotopic HCC xenograft at different time points. On the left is the orthotopic tumor at day 21 after xeno-transplantation, and on the right is the tumor at day 30. Tumors are shown from establishment experiment from untreated animals.

Figure S8: This figure shows the excision process of tumors from the Orthotopic xenograft HCC model. On the left is the liver before excision in the animal. The middle image shows the whole liver before excision of the tumor, and on the right is the image of both the tumor and liver after excision.

A B

Anti-miR-191 (PI=30%) Anti-miR-NC (PI=43%) C D

Anti-miR-191 (PI=16%) Anti-miR-NC (PI=63%)

Figure S9: Immunohistochemistry staining of Ki67 in tumors taken from the orthotopic xenograft model in mice, from groups treated with anti-miR-191 or control anti-miR. Stained cells showing the proliferation marker are more abundant in the control treated animals. Images A and B represent the differences between anti-miR-191 and anti-miR-NC respectively of the mean values of the samples, while images C and D represent the extreme values of the two groups.

Table of up-regulated genes after anti-miR-191 treatment comparing to treatment with control anti-miR:

Accession Gene name p-value fold-change ENST0000038676 --- 0.002 15.66 0 NM_000499 CYP1A1 0.0011 14.95 NM_020801 ARRDC3 0.0007 9.82 NM_004417 DUSP1 0.001 9.4 EU126604 KPNA7 0.0023 8.74 ENST0000031437 --- 0.00053 8.41 1 NM_001945 HBEGF 0.00094 7.37 NM_002229 JUNB 0.002 7.25 ENST0000037998 LOC388022 0.00088 7.04 1 NM_001031716 OBFC2A 0.0022 6.71 NM_145039 MGC16385 0.00019 6.7 NM_002309 LIF 0.00061 6.7 NM_001124 ADM 0.0014 6.53 NM_001040619 ATF3 0.00094 6.49 NM_024847 TMC7 0.00046 6.05 NM_019096 GTPBP2 0.0019 5.84 NM_003548 HIST2H4A 0.0018 5.71 NM_031459 SESN2 0.002 5.57 NM_001300 KLF6 0.00026 5.37 AK023048 FLJ12986 0.0025 5.07 NM_021724 NR1D1 0.0022 4.9 BC039295 FAM126B 0.0013 4.87 NM_001964 EGR1 0.0011 4.64 NM_020307 CCNL1 0.0018 4.45 NM_004040 RHOB 0.00066 4.38 NM_020127 TUFT1 0.0015 4.33 NM_005904 SMAD7 0.0013 4.31 NM_015508 TIPARP 0.000018 4.31 NM_004723 ARHGEF2 0.00053 4.28 NM_016201 AMOTL2 0.0023 4.2 NM_001002914 KCTD11 0.0015 4.15 NM_004925 AQP3 0.00065 4.1 NM_021913 AXL 0.00095 3.97 NM_005401 PTPN14 0.0014 3.85 NM_005194 CEBPB 0.0017 3.76 BC105107 DNAH17 0.0013 3.74 NM_203403 C9orf150 0.00081 3.72 NM_020529 NFKBIA 0.0013 3.65 NM_025130 HKDC1 0.002 3.58 NM_152751 C10orf30 0.002 3.5 NM_025106 SPSB1 0.0011 3.43 NM_002467 MYC 0.00066 3.36 NM_203411 TMEM88 0.0018 3.34 NM_022817 PER2 0.0021 3.33 BC052236 C19orf21 0.000087 3.32 NM_173354 SNF1LK 0.00028 3.29 NM_001001555 GRB10 0.00062 3.21 NM_182507 KRT80 0.0015 3.19 NM_001481 GAS8 0.00084 3.11 NM_020317 C1orf63 0.00013 3.07 NM_005253 FOSL2 0.0019 3.06 ENST0000027256 SNRPA1 0.0013 3.06 7 NM_002842 PTPRH 0.00032 3.06 NM_006572 GNA13 0.00083 3.05 NM_015213 RAB6IP1 0.0019 3.05 NM_000418 IL4R 0.0003 3.02 NM_177455 BHLHB8 0.00081 3 NM_005778 RBM5 0.00018 2.99 NM_003955 SOCS3 0.00043 2.98 NM_001570 IRAK2 0.0022 2.93 NM_002714 PPP1R10 0.0019 2.8 NM_002359 MAFG 0.0015 2.71 NM_003567 BCAR3 0.00099 2.69 NM_004431 EPHA2 0.00067 2.68 NM_005902 SMAD3 0.0013 2.68 NM_003897 IER3 0.0002 2.66 NM_002502 NFKB2 0.00034 2.61 NM_020429 SMURF1 0.002 2.6 NM_002608 PDGFB 0.0024 2.58 NM_003983 SLC7A6 0.0012 2.57 NM_019058 DDIT4 0.00013 2.56 NM_015037 KIAA0913 0.0013 2.52 NM_013382 POMT2 0.00035 2.51 NM_006509 RELB 0.00092 2.49 NM_022755 IPPK 0.00029 2.46 NM_006468 POLR3C 0.00081 2.46 NR_002936 LOC222699 0.0015 2.45 NM_001806 CEBPG 0.00011 2.45 NM_021158 TRIB3 0.0013 2.43 NM_003610 RAE1 0.0017 2.42 NM_033141 MAP3K9 0.00038 2.38 NM_016084 RASD1 0.00085 2.37 NM_020899 ZBTB4 0.00001 2.35 NM_024741 ZNF408 0.0017 2.35 NM_001034841 LOC162073 0.0017 2.35 NM_024599 RHBDF2 0.00052 2.35 NM_032440 LCOR 0.00097 2.35 NM_001102426 TBC1D8 0.0019 2.34 NM_020639 RIPK4 0.001 2.34 NM_004468 FHL3 0.00088 2.33 NM_015318 ARHGEF18 0.00097 2.32 NM_025090 USP36 0.00068 2.31 NM_016626 MEX3C 0.001 2.29 ENST0000038771 --- 0.0024 2.27 7 NM_006190 ORC2L 0.0012 2.23 NM_005860 FSTL3 0.00048 2.21 ENST0000032249 LOC100132139 0.00087 2.19 5 NM_003107 SOX4 0.00022 2.18 NM_145804 ABTB2 0.0001 2.16 NM_020870 SH3RF1 0.0008 2.16 NM_018133 MSL2L1 0.0011 2.13 NM_015179 RRP12 0.00067 2.13 NM_005550 KIFC3 0.0011 2.12 NM_152287 ZNF276 0.002 2.12 NM_024297 PHF23 0.00093 2.11 NM_173079 RUNDC1 0.0023 2.11 NM_033397 KIAA1754 0.00058 2.1 NM_032772 ZNF503 0.0018 2.08 BC066911 LOC93622 0.00092 2.06 NM_016823 CRK 0.0013 2.05 NM_021009 UBC 0.0011 2.03 NM_194278 C14orf43 0.0016 2.03 NR_003109 TRSPAP1 0.0014 2.02 NM_001433 ERN1 0.000023 2.02 NM_001081461 JMJD6 0.00093 2.02 NM_153006 NAGS 0.0021 2 NM_152879 DGKD 0.001 2 NM_025083 EDC3 0.00098 1.98 NM_015133 MAPK8IP3 0.0013 1.97 NM_015085 GARNL4 0.0013 1.95 NM_025112 ZXDC 0.0024 1.95 NM_002627 PFKP 0.00017 1.9 NM_134269 SMTN 0.0016 1.9 NM_001039775 AIM1L 0.0019 1.9 NM_025077 TOE1 0.0013 1.88 NM_016545 IER5 0.0023 1.87 NM_016733 LIMK2 0.0012 1.86 NM_018994 FBXO42 0.0024 1.86 NM_004053 BYSL 0.00032 1.85 NM_175609 ARFGAP1 0.0022 1.84 NM_004514 FOXK2 0.00016 1.84 NM_005803 FLOT1 0.00058 1.81 NM_001012661 SLC3A2 0.002 1.8 NM_014371 AKAP8L 0.0018 1.79 NM_004860 FXR2 0.00028 1.79 NM_015846 MBD1 0.00046 1.78 NM_014577 BRD1 0.00063 1.77 NM_000201 ICAM1 0.00049 1.77 NM_005318 H1F0 0.0013 1.77 NM_013260 SAP30BP 0.0024 1.76 NM_199054 MKNK2 0.0017 1.75 NM_015062 PPRC1 0.0021 1.71 NM_014727 MLL4 0.00054 1.7 NM_032178 SLC7A6OS 0.0015 1.7 NM_003935 TOP3B 0.0023 1.69 NM_005081 ZNF142 0.00069 1.68 BC019311 C20orf4 0.0018 1.67 NM_016151 TAOK2 0.00097 1.65 NM_001105079 FBRS 0.002 1.64 NM_006133 DAGLA 0.0023 1.62 NM_003904 ZNF259 0.002 1.61 NM_000021 PSEN1 0.00049 1.61 NR_003700 PI4KAP2 0.00035 1.6 NM_001001342 BLOC1S2 0.0022 1.6 NM_019594 LRRC8A 0.0016 1.59 NM_020845 PITPNM2 0.0017 1.55 NM_006302 GCS1 0.0018 1.55 NM_021729 VPS11 0.00041 1.55 NM_002999 SDC4 0.0002 1.54 NM_001171 ABCC6 0.0021 1.53 NM_014323 PATZ1 0.0014 1.48 NM_006106 YAP1 0.00034 1.47 NM_014292 CBX6 0.000091 1.46 NM_014931 SAPS1 0.0023 1.46 NM_018216 PANK4 0.0019 1.46 NM_078481 CD97 0.0019 1.44 NM_198321 GALNT10 0.001 1.43 NM_004712 HGS 0.0023 1.43 NM_015353 KCTD2 0.0018 1.43 NM_022051 EGLN1 0.002 1.4 U38980 PMS2L11 0.0021 1.4 NM_005529 HSPG2 0.0017 1.39 NM_014902 DLGAP4 0.000007 1.37 5 NM_138615 DHX30 0.00054 1.37 NM_001707 BCL7B 0.0015 1.35 NM_177401 MIDN 0.002 1.33 NM_005779 LHFPL2 0.00063 1.32 NM_032656 DHX37 0.0024 1.32 NM_013403 STRN4 0.0024 1.28 NM_178580 HM13 0.0021 1.27 NM_004759 MAPKAPK2 0.0002 1.27 NM_001080495 TNRC18 0.0023 1.23 NM_001114600 C1orf144 0.0011 1.15 ENST0000032908 FKSG30 0.0025 1.1 1