The Role of Microtubule-Associated Protein 1S (MAP1S) in Regulating Pathological Cardiac Hypertrophy

The role of microtubule-associated protein 1S (MAP1S) in regulating pathological cardiac hypertrophy

A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health

2018 Mohammed Ali Najai

School of Medical Sciences Division of Cardiovascular Sciences

Table of Contents

List of figures……………………………………………………………………….7 List of tables………………………….…………… ………..……………………..10 Abstract…………………………..……...……………… ………….……………..11 Declaration………………………..……...……………… ………………………..13 Copyright statement……………..…………...…………… …….………………..14 Acknowledgements…………...…..………………………… ……...…………..…15 Author………………………………...………………………….…………………16 Abbreviations……………………………………...………….……………………17 1 Introduction ...... 21 1.1 Heart failure ...... 21 1.2 The pathophysiological process leading to heart failure...... 21 1.2.1 Cardiac hypertrophy ...... 21 1.2.2 Fibrosis ...... 25 1.2.3 Inflammation ...... 25 1.2.4 Cell death ...... 27 1.2.4.1 Apoptosis ...... 28 1.2.4.2 Necrosis ...... 29 1.2.5 Autophagy ...... 29 1.2.5.1 Process of autophagy ...... 32 1.2.5.2 Leading causes of autophagy ...... 35 1.2.5.2.1 Starvation...... 35 1.2.5.2.2 Stress response ...... 35 1.2.5.2.3 Pathogen infection ...... 35 1.3.1 Cellular mechanisms leading to autophagy ...... 36 1.3.2 The role of autophagy in cardiac hypertrophy and HF ...... 36 1.4.1 Microtubule-associated proteins (MAP) ...... 37 1.4.2 Expression and isoforms of MAP1 family ...... 38 1.4.3 Gene organization and structure of MAP1 ...... 39 1.4.4 Interaction and function of MAP1 ...... 39 1.4.5 The function of MAP1 family in the heart ...... 40

1.4.6 MAP1S ...... 43 1.4.7 The role of MAP1S in suppressing tumorigenesis and other pathologies ..44 1.4.8 The role of microtubule-associated protein 1S (MAP1S) in autophagy .....45 1.5 HYPOTHESIS AND AIMS ...... 47 1.5.1 Hypothesis ...... 47 1.5.2 Aims ...... 47 2. MATERIALS AND METHODS ...... 49 2.1 MAP1S knockout mice ...... 49 2.2. DNA extraction...... 51 2.3 Mice genotyping using polymerase chain reaction (PCR) ...... 51 2.4 Gel electrophoresis analysis ...... 53 2.5 Transverse aortic constriction (TAC) and sham surgery ...... 54 2.6 Echocardiography for hypertrophy-induced mice ...... 56 2.7 RNA extraction...... 58 2.8 Measurement of DNA and RNA concentration ...... 59 2.9 Gene expression quantification by quantitative PCR (qPCR) ...... 59 2.10 Protein extraction from mice heart tissues ...... 61 2.11 Measurement of protein concentration ...... 62 2.12 Western blot ...... 62 2.13 Preparing heart cross-sections for haematoxylin and eosin and Masson’s trichrome staining ...... 65 2.13.1 Haematoxylin and eosin stain for detecting cardiomyocytes morphology ...... 67 2.13.2 Masson’s trichrome staining for detecting fibrosis formation ...... 67 2.14 PathScan Intracellular Signalling Array ...... 68 2.15 Mitochondria structure analysis by electron transmission microscopy ...... 70 2.16 H9c2 cardiomyoblast cell culture ...... 71 2.17 Protein extraction from H9C2 cells ...... 71 2.18 GFP-LC3 adenovirus generation ...... 71 2.19 Knockdown of MAP1S gene using small interfering RNA (siRNA) ...... 73 2.20 Stimulation of autophagy in H9C2 cells ...... 75 2.21 Luciferase assay...... 76 2.22 Immunofluorescence ...... 76 2.23 Detection of mitochondria using MitoTracker...... 77

2.24 Statistical analysis ...... 77 3 The role of MAP1S in modulating cardiac hypertrophy ...... 79 3.1 Introduction...... 79 3.1.1 Cardiac hypertrophy and tumour suppressors ...... 79 3.1.2 The tumour suppressor MAP1S and hypertrophy ...... 80 3.2 Hypothesis ...... 82 3.3 Aims ...... 82 3.4 Results ...... 83 3.4.1 Demonstrating MAP1S ablation (global knockout) in mice ...... 83 3.4.2 MAP1S protein expression in mouse hearts ...... 83 3.4.3 Cardiac phenotype in MAP1S null mice after 2 weeks of TAC...... 84 -/- 3.4.4 Echocardiographic analysis (ECG) of MAP1S mice after 2 weeks TAC .86 3.4.5 Cardiac function in MAP1S knockout mice after 2 weeks TAC ...... 87 3.4.6 Histological analysis ...... 90 -/- 3.4.6.1 Cardiomyocyte cross-sectional area (CSA) in MAP1S mice after 2 weeks TAC ...... 90 3.4.6.2 Histological analysis of the fibrosis level in MAP1S-/- mice hearts after 2 weeks TAC ...... 92 3.4.7 Gene expression of cardiac hypertrophy and fibrosis markers ...... 94 3.4.7.1 Gene expression of cardiac hypertrophy markers ANP and BNP ...... 95 3.4.7.2 Gene expression of cardiac fibrosis marker COL1A1 and COL3A1 ...... 97 3.5 Discussion ...... 100 3.5.1 Hypertrophic response to TAC in MAP1S knockout mice ...... 100 3.5.2 Echocardiography data of MAP1S null mice following TAC ...... 101 3.5.3 Evaluation of heart function following hypertrophy induction after 2 weeks TAC ...... 102 3.5.4 Cardiac structure in MAP1S-/- mice in response to hypertrophy induced by TAC ...... 102 3.5.5 Evaluation of the fibrosis level that accompanies hypertrophy in response to TAC ...... 103 3.6 Conclusion ...... 103 3.7 Study limitations ...... 104 4. The role of MAP1S in regulating autophagy ...... 106 4.1 Introduction...... 106

4.1.1 Autophagy regulation...... 106 4.1.2 Autophagy and pathology ...... 109 4.1.3 Autophagy and heart remodelling and the possible role of MAP1S in regulating this process ...... 109 4.2 Hypothesis: ...... 111 4.3 Aims: ...... 111 4.4 Results ...... 112 -/- 4.4.1. Expression of autophagy marker LC3 in MAP1S mice after 2 weeks TAC...... 112 4.4.2. The evaluation of autophagy markers Beclin-1 and p62/SQSTM1 in -/- MAP1S mice after 2 weeks TAC...... 115 4.4.3. Knockdown of MAP1S gene using siRNA in H9C2 cells ...... 118 4.4.4. Monitoring the autophagy level using GFP-LC3 reporter in H9C2 cells following treatment with rapamycin and chloroquine ...... 120 4.4.5 Evaluation of the autophagy activity in H9C2 cells following treatment with C2-ceramide and chloroquine...... 123 4.4.6 The effects of MAP1S knockdown on phenylephrine induced cellular hypertrophy...... 126 4.4.7 Evaluation of the expression of hypertrophic marker in response to the PE treatment in H9C2 cells after MAP1S knockdown by siRNA...... 129 4.4.8 Investigation of the role MAP1S in the specific autophagy of mitochondria (mitophagy) ...... 130 4.5 Discussion: ...... 133 4.6 Conclusion: ...... 136 4.7 Study limitation ...... 136 5. Initial study to identify novel signalling pathways regulated by MAP1S ...... 139 5.1 Introduction...... 139 5.2.1 Hypothesis: ...... 141 5.2.2 Aims: ...... 141 5.3 Results ...... 142 5.3.1 Investigation of signalling pathways regulated by MAP1S in cardiac hypertrophy...... 142 5.3.2 Western blot analysis on the expression of STAT3 and BAD in pressure overload hypertrophy mice ...... 146

5.3.3 The effect of MAP1S ablation on the mitochondria structure in MAP1S knockout mice after 2 weeks TAC...... 149 -/- 5.3.4 Detection of the level of the mitophagy-related protein PINK1 in MAP1S mice after two weeks TAC ...... 152 5.3.5 Identification of the anti-apoptotic protein Bcl2 expression in MAP1S depleted mice after 2 weeks of pressure overload hypertrophy by TAC ...... 154 5.3.6 Identification of the pro-apoptotic protein BAX expression in MAP1S depleted mice after 2 weeks of pressure overload hypertrophy by TAC ...... 155 -/- 5.3.7 Analysis of IL-6 expression in MAP1S mice after pressure overload hypertrophy...... 157 5.4 Discussion ...... 159 5.5 Conclusion ...... 161 6 General Discussion ...... 163 6.1 The genetic ablation of MAP1S reduces the hypertrophy response in mice after 2 weeks TAC ...... 164 6.2 The genetic ablation of MAP1S does not influence the heart function in hypertrophy induced mice………………………………………………...……..164

6.3 MAP1S regulates the autophagy process in hypertrophy induced mice ..... 165 6.4 In vitro analysis confirms MAP1S knockdown in the mice reduces the hypertrophy response ...... 166 6.5 The autophagy response in H9C2 after autophagy stimulation ...... 166 6.6 The genetic ablation of MAP1S did not show any changes in the regulation of apoptosis cell death and inflammation in hypertrophy induced mice ...... 167 6.7 MAP1S ablation causes mitochondria damage in TAC-induced mice ...... 168 6.8 CONCLUSION ...... 168 6.9 STUDY LIMITATIONS: ...... 169 6.10 FUTURE DIRECTIONS ...... 169 References ...... 171

Word Count: 33561

List of figures

Figure 1.1: How the hypertrophy response is induced in the cardiomyocyte by external stimulus ...... 22

Figure 1.2: The differences between pathological cardiac hypertrophy and physiological hypertrophy...... 24

Figure 1.3: Cell response to stress in three types of autophagy ...... 31

Figure 1.4: The autophagy process and how the autophagy-related proteins ATG regulate this process……...………………………………………………….34 Figure 1.5: The role of MAP1S in tumorigenesis suppression through autophagy regulation………..……………………………………………………………...…..46 Figure 2.1: The generation of Map1s−/− mouse by Cre–loxP recombination technology…………………………………………………….…………………….50 Figure 2.2: Gel electrophoreses picture showing amplified DNA by PCR against the DNA ladder to identify mice genotype……………………...………………...54

Figure 2.3: Constriction of the aorta by TAC in the mouse heart to induce pressure overload hypertrophy…………………………………..……………….55 Figure 2.4: Image of mouse heart echocardiography in M-mode view illustrating the parameters used in heart morphology evaluation…………………………...57 Figure 2.5: Mice categorised during the experiments and samples collections……………………………………………………………………….…..58 Figure 2.6: The position of each antibody on the slide……...…………………...69 Figure 3.1: Expression of MAP1S in heart extracts of WT and MAP1S-/- mice…………………………………………………………………………………84 Figure 3.2: Analysis of the heart weight/tibia length ratio after 2 weeks TAC…………………………………………………………………………………86 Figure 3.3: Cardiac function parameters of ejection fraction and fractional shortening in MAP1S -/- mice after 2 weeks TAC…………………………….….89 Figure 3.4: Cardiomyocyte cross-sectional area (CSA) using H&E staining after 2 weeks TAC……………………………………………………………….………92 Figure 3.5: Analysis of Masson's trichrome staining…………………………….94

Figure 3.6: Effect of Map1s gene ablation on the expression of hypertrophic markers ANP and BNP……………………………………………………………97 Figure 3.7: Effect of MAP1S ablation on the expression of COL1A1 and COL3A1…………………………………………………………………………….99

Figure 4.1: The main steps in the autophagy process from induction to degradation………………………………………………………………………..107 Figure 4.2: Autophagy regulation by hypoxia, low energy and growth factor pathways…………………………………………………………..………………108 Figure 4.3: Western blot analysis of autophagy marker LC3-II and LC3- I…………………………………………………………………………………….114 Figure 4.4: Beclin-1/Atg6, Lc3/Atg8 and p62 interactions in the autophagy process:…………………………………………………………………………….115 Figure 4.5: Western blot analysis of autophagy markers Beclin-1 and p62/SQSTM1…………………………………………………………………...…118 Figure 4.6: Knockdown of MAP1S protein in H9C2 cells using siRNA……………………………………………………………………………..119 Figure 4.7: LC3-I is conjugate to phosphatidylethanolamine (PE) and forms LC3- II……………………………………………………………………………..120 Figure 4.8: Evaluation of autophagy flux by estimation of autophagosomes numbers using the LC3-GFP adenovirus……………………………………….123 Figure 4.9: Evaluation of the autophagy flux by estimation of autophagosome formation using the LC3-GFP adenovirus………………………………..……125 Figure 4.10: Analysis of the cell size change in H9C2 before and after the treatment with PE………………………………………………………………..128 Figure 4.11: Analysis of BNP expression in H9C2 cells after PE treatment…………………………………………………………………………..130 Figure 4.12: Detection of mitophagy activity in H9C2 cells after autophagy stimulation………………………………………………………………...………132 Figure 5.1: Analysis of the PathScan Intracellular Signalling Array…………144 Figure 5.2: The analysis of phosphorylated STAT3 and phosphorylated BAD expression from the PathScan Array…………….………………………….….145 Figure 5.3: Western blot analysis of phosphorylated STAT3…………………147 Figure 5.4: Western blot analysis of phosphorylated BAD……………………148

-/- Figure 5.5: Mitochondria structure in MAP1S mice heart sections following 2 weeks TAC……………………………...……………………………….…...……151

Figure 5.6: Showing how PINK1 triggers mitophagy induction…………..…..152

Figure 5.7: Western blot analysis of PINK1 expression……………………….153

Figure 5.8: Western blot analysis of Bcl2 expression…………………………..155

-/- Figure 5.9: BAX expression in MAP1S mice after two weeks TAC…….…..156

-/- Figure 5.10: Western blot analysis of IL-6 expression in MAP1S after 2 weeks TAC…………………………………………………………………………..…...158

List of tables

Table 1.1: The best-known pro-inflammatory and anti-inflammatory cytokines that is changed the expression during the development of heart failure………………………………………...……………………………………..27 Table 1.2: The most understood interactions and functions of MAP1 proteins………………………………………………...……………………………42 Table 2.1: Thermocycler steps for the PCR reaction……………………………52 Table 2.2: The sequences of primers used in PCR reaction……………….…….52

Table 2.3: The temperature cycle conditions for RNA conversion to cDNA (reverse transcription reaction)………………………………………….………..60 Table 2.4: The temperature cycle conditions for qPCR…………………………61 Table 2.5: Volumes of solutions that were used to prepare sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDSPAGE)…...…..…………..….64 Table 2.6: Antibodies used in western blot analysis………………...………..….65 Table 2.7: Concentrations and time of solutions used in the Shandon Citadel 2000 tissue processor……………………………………………………………….66 Table 2.8: The 18 antibodies detected in this signalling array……..……...……70 Table 2.9: The titration of GFP-LC3 adenovirus on HEK293 cells…….....……73 Table 3.1: The echocardiography results of wild type and MAP1S-/- knockout mice after 2 weeks TAC……………………………………………………………87

Abstract

A thesis submitted to the University of Manchester by Mohammed Ali Najai for the degree of Doctor of Philosophy entitled The role of microtubule-associated protein 1S (MAP1S) in regulating pathological cardiac hypertrophy July 2018 Cardiac hypertrophy is an important process that may lead to the development of heart failure. Controlling pathological cardiac hypertrophy is important because it can improve the long-term prognosis of heart failure. The aim of this project is to investigate the role of Microtubule-associated protein 1S (MAP1S) in regulating pathological hypertrophy in mice. In non-cardiac cells MAP1S has been shown to regulate autophagy. It is one of the key proteins that regulate autophagy during the development of tumorigenesis to eliminate damaged organelles and proteins that cause oxidative stress and genome instability. Autophagy is a catabolic process and is considered as a survival process because it recycles damaged organelles and misfolded proteins. Autophagy is involved in various diseases including heart diseases; however, the exact role of autophagy in regulating cardiac hypertrophy is not fully understood. MAP1S has previously been identified as an interacting partner of the major autophagy regulator LC3; however, its role in the heart is unknown. In this study I investigated the role of MAP1S in regulating autophagy during cardiac hypertrophy.

To study the role of MAP1S in cardiac hypertrophy I studied mice with global genetic deletion of the Map1s gene (MAP1S−/−). To induce pathological hypertrophy, MAP1S−/− mice were subjected to transverse aortic constriction (TAC) for two weeks. Analysis of heart weight/tibia length ratio showed a significant reduction of hypertrophy in MAP1S−/− mice compared with the WT group. Furthermore, expression of hypertrophic markers ANP and BNP, detected by qPCR, showed higher expression in WT-TAC mice compared to MAP1S−/− TAC mice. However, no significant difference in the cardiac function parameters fractional shortening (FS) and ejection fraction (EF) was observed in MAP1S−/− compared to WT mice after two weeks TAC. To analyse cellular hypertrophy, histological sections of cardiac tissues were also analysed. Consistently, the cardiomyocyte cell surface area was significantly smaller in MAP1S−/− TAC mice compared to the WT-TAC group. Also, the level of interstitial fibrosis detected using Masson's trichrome staining analysis was reduced in MAP1S−/− mice following TAC compared to WT-TAC, but expression levels of fibrosis markers such as COL1A1 and COL3A1 did not show any significant difference between MAP1S−/− TAC mice compared to the WT-TAC group. To investigate the level of autophagy, the expression of autophagy markers was analysed. The expression of the autophagosome formation step markers LC3-I and LC3-II were significantly reduced in MAP1S−/− TAC mice compared to WT-TAC group; however, the level of other autophagy induction markers such as Beclin-1 and P62/SQSTM1 did not show any changes.

To further analyse the role of MAP1S in regulating the formation of autophagosome, in vitro studies was performed using cardiomyoblast cell line (H9C2) with siRNA- mediated knock down of the MAP1S gene. To detect the autophagosome formation, I used adenovirus to express GFP-labelled LC3 in the H9C2 cells and induced autophagy by treating cells with rapamycin and chloroquine. No significant change in the autophagosome formation was observed in MAP1S knock down cells compared to control cells. However, by using MitoTracker to visualize mitochondria, I found that the MAP1S knock down cells showed more co-localization of mitochondria with the autophagosomes, suggesting increase level of damaged mitochondria and the occurrence of mitophagy. Then, to analyse whether this phenotype also occurs in vivo in the TAC model, transmission electron microscopy was used to analyse the mitochondria structure in the heart of MAP1S-/- and WT controls. In consistent with the in vitro data, MAP1S−/− mice showed a higher number of abnormal mitochondria compared to WT controls.

Finally, to investigate whether MAP1S regulates other signalling pathways during pathological hypertrophy PathScan phospho-kinase array was used to detect phosphorylation of eighteen different signalling molecules in MAP1S−/− and WT hearts after sham or TAC treatment. Although, the kinase array data showed slightly different signals of p-STAT3 and p-BAD between knockout and WT, further confirmation by Western blot did not show any significant difference in phosphorylation levels of these proteins.

In conclusion, the ablation of MAP1S reduced the development of pathological cardiac hypertrophy in mice, possibly via the regulation of autophagy in cardiomyocytes.

DECLARATION

I declare that no portion of the work referred to in the thesis has been submitted in support of an application for another degree or qualification of this or any other university or other institute of learning.

Mohammed Ali Najai

School of Medical Sciences Division of Cardiovascular Sciences Faculty of Biology, Medicine and Health

COPYRIGHT STATEMENT i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes. ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made. iii. The ownership of certain Copyright, patents, designs, trademarks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions. iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy (see http://documents.manchester.ac.uk/DocuInfo.aspx?DocID=24420), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see http://www.library.manchester.ac.uk/about/regulations/) and in The University’s policy on Presentation of Theses.

ACKNOWLEGEMENTS

I would like to thank my supervisor Dr. Delvac Oceanady and my co-supervisor Dr. Xin Wang for their support and guidance throughout my PhD program.

Also, I would like to thank Dr. Halina Dobrzynski and Dr. Elizabeth Cartwright for valuable advices and support.

In addition, I would like to express my gratitude to the lab members Dr. Min Zi, Dr. Nicholas Stafford, Mr. Sukhpal Prehar and Mrs. Florence Baudoin for the lab guidance, training and the assistance in the in vivo experiments.

Finally, I would like to thank my sponsor (King Faisal Specialist Hospital & Research Center, Riyadh, Saudi Arabia) for the financial support and my family and friends for their continuous support.

AUTHOR

I graduated from King Saud University in Riyadh in 2006 with a BSc Biochemistry. This degree began my catalyst into the research field at the tertiary level and presented the opportunity to be employed at the Research Centre in King Faisal Specialist Hospital in the Genetics Department for the pass five (5) years. During this tenure at the hospital, I assisted in several projects at the Cardiovascular Pharmacogenetics Lab and participated in a few published papers in cardiovascular genetics field.

I became fascinated by the workings of cardiovascular science and was intrigued by identifying ways to assist patients in overcoming heart failure and other cardiovascular complications. With the aim of finding solutions, I utilised this opportunity afforded by the scholarship to pursue my PhD program at the University of Manchester to further my studies in cardiovascular science. I was able to critically identify a possible defect that would result in heart failure through tumour suppressants regulation and present a possible way for solving this defect.

My objective was to apply transferable skills in critical thinking, research methods and (arriving at solutions), gained throughout my work experience and studies in the research, in the presentation of sound and applicable solutions in the aid of combating heart problems. Research has always been my passion since it presents the challenge of exploring new areas connected to my field that brings awareness and enlarge my knowledge for future practice.

Abbreviation Akt the protein kinase B ANP Atrial natriuretic peptide Apaf1 apoptotic protease activating factor 1 Atg autophagy-related proteins BCA Bicinchoninic acid BHF British Heart Foundation BNP Brain natriuretic peptide CAD Coronary artery disease cDNA Complimentary DNA COL1A1 Collagen 1 alpha 1 COL3A1 Collagen III alpha 1 CVD Cardiovascular disease dIVS Intraventricular septum in diastole dLVD Left ventricular diameter in diastole ECL Enhanced chemi-luminescence EDTA Ethylenediaminetetracetic acid EF Ejection fraction eIF2α eukaryotic initiation factor 2 ERK Extracellular receptor kinase FS Fractional shortening FITC Fluorescein isothiocyanate GAPDH Glyceraldehyde 3-Phosphate Dehydrogenase HEK 293 Human embryonic kidney cell line 293 HF Heart failure HW Heart weight HW/BW Heart weight to body weight ratio HW/TL Heart weight to tibia length ratio IL-1 interleukin 1 IL-6 interleukin 6 IL-10 interleukin 10 IP Intraperitoneal injection

IVS Interventricular septum KO knockout LRPPRC leucine-rich PPR motif-containing LVH Left ventricular hypotrophy MI Myocardial infarction NRCM Neonatal rat cardiomyocytes PBS Phosphate buffered saline PCD programmed cell death PCR polymerase chain reaction PGRP peptidoglycan-recognition protein PI3K Phosphatidylinositol-4,5-bisphosphate 3-kinase PVDF Polyvinylidene fluoride RASSF1A Ras-associated factor 1 A RIPA buffer Radioimmunoprecipitation buffer RT Reverse transcriptase RT-PCR Real time polymerase chain reaction RWT Relative wall thickness SERCA2a Sarcoplasmic reticulum calcium ATPase SEM Standard error of mean SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis STAT Signal transducer and activator of transcription SOCS3 the suppressor of cytokine signalling 3 TAC Transverse aortic constriction TBS Tris-buffered saline TBST Tris buffered saline containing Tween-20 TEMED Tetramethylethylenediamine TL Tibia length TLRs Toll-like receptors TNF-α tumour necrosis factor alpha TOR The target of rapamycin TRAIL TNF-related apoptosis-inducing ligand TNF Tumour necrosis factor ULK1 UNC-51–like kinase

WT Wild type

Chapter 1

1 Introduction 1.1 Heart failure Heart failure (HF) is a complex syndrome that arises when the heart fails to pump enough blood to meet the body's needs for nutrients and oxygen and can occur as a result of cardiac function abnormalities. The British Heart Foundation (BHF) reported that HF affects 750 000 people in the UK alone, and this high rate of HF patients has a significant impact on health-care costs as well as on the economy (Griffiths et al., 2014) . Advances in the diagnosis and management of cardiovascular disease (CVD) in industrialized nations can significantly reduce the mortality rates of CVD patients by more than two-thirds (Nabel & Braunwald., 2012). However, HF diagnosis and management still need improvement, and a heart transplant remains the most effective option in the advanced stages of HF (Wang, et al., 2014). Despite all the medical care and research efforts, the prognosis of HF remains poor and the underlying molecular mechanisms are not fully understood. HF is a final result of pathological cardiac hypertrophy, which is accompanied by contractile dysfunction and several cellular changes, such as the development of fibrosis, inflammation and cell death (Biondi- Zoccai et al., 2013).

1.2 The pathophysiological process leading to heart failure

As heart failure is the final stage of verity of pathological conditions, it is necessary to prevent the development of heart failure by controlling the pathological process leading to heart failure. So far, several pathologies have been identified that can accompany or lead to heart failure, such as long-term pathological hypertrophy, cell death, fibrosis and inflammation. This study will review and explain the regulation of pathological cardiac hypertrophy, fibrosis, inflammation, cell death, and autophagy as HF-related disorders.

1.2.1 Cardiac hypertrophy Cardiac hypertrophy is a compensatory mechanism occurring in response to increased workload and stress. Enlargement of the heart occurs when the heart muscle attempts to adapt to a high heart workload. There are two types of cardiac hypertrophy: physiological cardiac hypertrophy, which occurs during exercise or pregnancy and is not related to cardiac dysfunction, and pathological cardiac hypertrophy, which occurs

21 in response to cardiac dysfunction or following a myocardial infarction. Several medical conditions accompany pathological cardiac hypertrophy, such as inflammatory diseases, heart injury and cardiomyopathy. In cardiac hypertrophy, cardiomyocytes enlarge, increasing the thickness of the ventricular walls as a response to an elevated workload as well as injury (Kehat & Molkentin., 2010).

______Figure 1.1: How the hypertrophy response is induced in the cardiomyocyte by external stimulus (Carreño et al., 2006).

So far, two types of pathological cardiac hypertrophy have been identified, namely concentric and eccentric hypertrophy. Concentric hypertrophy occurs in response to chronic pressure overload, which leads to an increased thickness of the ventricular

22 walls accompanied by a decrease in the ventricular capacity. While in the eccentric hypertrophy the volume overload leads to a thinning of the ventricle walls and an increase in the ventricular capacity. In concentric hypertrophy the contractile unit, the sarcomeres, assemble in parallel and increase ventricular stiffness and wall thickness, with an increase in cardiac fibroblasts that causes fibrosis. In eccentric hypertrophy, abnormal sarcomeres cause cell elongation (Wakatsuki, et al., 2004).

Eccentric hypertrophy occurs following a myocardial infarction, when the Infarcted areas become dilated and thinner. As a result, the heart geometry and shape change and the heart become more spherical, with thinner walls and an increased ventricular size (Chrysohoou et al., 2009). Pathological cardiac hypertrophy leads to HF because the changes in the ventricles are accompanied by molecular and cellular changes, such as the re-expression of foetal genes, the enlargement of myocytes without real proliferation, modifications in the level of the expression of proteins that are connected to excitation-contraction coupling, and a variation in myocyte energy and metabolism. Also, cardiac hypertrophy is accompanied by extracellular matrix (ECM) remodelling as well as necrosis or apoptosis, which lead to myocyte death. These changes cause systolic and/or diastolic dysfunction and myocyte lengthening and dilation, which cause dilated heart failure (Kehat & Molkentin., 2010).

Physiological hypertrophy grouped into eccentric or concentric hypertrophy. Eccentric hypertrophy is induced by large muscle movement due to exercise such as swimming or running, which increases the volume overload. Meanwhile, concentric hypertrophy is induced by muscle tension, which causes pressure overload, this occurs for instance during weight lifting exercises. However, Physiological hypertrophy, however, is reversible and under normal circumstances does not result in cardiac dysfunction, nor does it lead to heart failure (McMullen & Jennings., 2007).

The hypertrophy response can be regulated by both pro-hypertrophy and anti- hypertrophy factors. The transcriptional regulation is one of the mechanisms that is known to be involved in the hypertrophy response. For example, for the pro- hypertrophy mechanisms, the down-regulation of MYH6 transcription encourages the up regulation of JAK-STAT pathway by up regulating the transcriptional JAK2 which triggers fetal genes expression. On the other hand, in anti-hypertrophic response, the up regulation of ACE2 and HDAC5 by the down regulation of immediate early genes

(IEGs), FOS and EGR1 displayed a protective role in cardiac hypertrophy patients (Gennebäck et al., 2012).

Figure 1.2: The differences between pathological cardiac hypertrophy and physiological hypertrophy.

1.2.2 Fibrosis

The fibrosis process is important in organ pathology since fibrosis plays a major role in several diseases and abnormalities (Khan & Sheppard., 2006). Cardiac tissues consist of contractile cells (myocytes) and non-contractile cells, namely the endothelial cells and fibroblasts. Fibroblasts are considered as one of the important sources of growth factors and pro-inflammatory cytokine in the heart. Fibrosis occurs upon activation of cardiac fibroblasts to increase collagen production and deposition (Martin et al., 2014). Fibroblasts interact with myocytes by paracrine signalling (a cell-cell communication), which is important for myocardium contraction. Paracrine signalling is a signal from cell-to-nearby cell to induce modification in behaviour or regulation through paracrine factors which bind to specific receptors on the target cell. Several signalling proteins including Wnt family, Hedgehog family, TGF-β superfamily and Fibroblast growth factor (FGF) family can initiate Paracrine signal for deferent cell response. When Paracrine proteins are secreted from the source cells they generate gradient consecration allowing the target cell to respond depending on the distance in concentration-dependent manner (Roy & Kornberg., 2015). During fibrosis, the excess of collagen deposition interrupts fibroblast and myocyte interactions and results in changes in the electrical conductivity of myocytes and causes contractile dysfunction (Gaudesius et al., 2003; LaFramboise et al., 2007). Fibrosis is responsible for diastolic dysfunction and can cause the myocardium to become less compliant (Martin et al., 2014). There are two types of fibrosis that occur in the heart: reparative fibrosis and reactive fibrosis. Reparative fibrosis occurs following a heart injury or cell death and results in extracellular matrix (ECM) deposition at the scar formation, while reactive fibrosis occurs when ECM is deposited around vessels and in the interstitium without cell death or direct injury (Creemers & Pinto., 2011).

1.2.3 Inflammation

HF is usually accompanied by the development of inflammation and changes in the expression of pro-inflammatory and anti-inflammatory cytokines. The balance between pro-inflammatory and anti-inflammatory cytokines could determine how inflammation contributes to the HF progression (Oikonomou et al., 2011). Table 1.1 lists the best-known pro-inflammatory and anti-inflammatory cytokines. The most important cytokines that play a role in the progression of HF are tumour necrosis factor alpha (TNF-α), interleukin 1 (IL-1), and interleukin 6 (IL-6). IL-1 is a

25 pro-inflammatory cytokine involved in cardiac hypertrophy and myocardial apoptosis and has been identified in dilated cardiomyopathy patients (Anker & von Haehling., 2004). TNF-α is a pro-inflammatory cytokine which can be produced in cardiomyocytes, and its expression is increased during HF (Oikonomou et al., 2011). The pro-inflammatory interleukin 6 (IL-6) levels is a significant indication of HF, particularly in elderly people (Vasan et al., 2003). Also, the pro-inflammatory interleukins IL-6 l and TNF-α level in the plasma are found to be high in HF patients with dysfunctions of the left atrial and abnormal ventricular systolic and diastolic functions (Chrysohoou et al., 2009). The most important anti-inflammatory cytokine is interleukin 10 (IL-10), which induces the downregulation of TNF-α, IL-1 and IL-6 (Anker & von Haehling., 2004).

Pro-inflammatory Anti-inflammatory Pro and anti- cytokines cytokines inflammatory cytokines

TNF-α IL-10 Adiponectin

sTNFR1 IL-13 Resistin sTNFR2 IL-18 sFas CD40L

TRAIL Activin A Pentraxin-3 RANTES CRP IL-6 Cardiotrophin-1 IL-8 MCP-1 MIP-1a IL-1β

Table 1.1: The best-known pro-inflammatory and anti-inflammatory cytokines that is changed the expression during the development of heart failure (Oikonomou et al., 2011).

1.2.4 Cell death

HF displays a high cell death rate, which is affected by several factors such as inflammation, oxidative stress, and the circulation of abnormal neurohormones (Braunwald., 2013; Konstantinidis., et al 2012). Cell death can be indicated by a loss of plasma membrane integrity, phagocytosis by neighbouring cells, and cellular fragmentation (Whelan et al., 2010), and can be classified into apoptosis, necrosis and autophagic cell death (Chiong et al., 2011).

1.2.4.1 Apoptosis

Apoptosis is defined as the process of programmed cell death (PCD). Apoptosis is a highly regulated process that is essential for postnatal life and tissue homeostasis through the monitoring of cell damage. Apoptosis plays a major role in maintaining the balance between pro-death and pro-survival signals in the cell (van Empel et al., 2005). Apoptosis has been found to be increased in normal conditions, such as aging, as well as in pathological conditions such as cardiac hypertrophy. The cell death by apoptosis is characterised by cytoplasmic shrinkage and fragmentation of nucleus and DNA. The disruption or acceleration of apoptosis could lead to a variety of diseases such as cardiomyopathy, which leads to HF (Whelan et al., 2010). Apoptosis in the cell, including cardiac myocytes, is controlled by extrinsic and intrinsic pathways (Chiong et al., 2011). The extrinsic pathway is initiated by receptors on the cell surface, while the initiation of the intrinsic pathway involves mitochondria and endoplasmic reticulum (ER). Both pathways eventually activate caspases (Whelan et al., 2010), which are cysteine proteases that hydrolyse peptide bonds. The main roles of caspases are cellular termination and the amplifying of apoptotic signalling (Pop & Salvesen, 2009; Whelan et al., 2010). The extrinsic pathway is stimulated by the transmembrane protein FAS ligand, TNF, or TNF-related apoptosis-inducing ligand (TRAIL) receptor I. Overexpression of TNF in cardiomyocytes has been reported to cause dilated cardiomyopathy and HF in transgenic mice. The activation of extrinsic apoptotic pathway occurs as a result of BCL2-interacting protein (BID) cleavage by casp-8- dependent to truncated BID (t-BID), and the C-terminal of t-BID translocate to the outer membrane of mitochondria to activate this pathway (Chiong et al., 2011).

The low expression of apoptotic protease activating factor 1 (Apaf1) in cardiac myocytes contributes to strict caspase (casp) activity, which is controlled by X-linked inhibitors of apoptosis protein (XIAP) (Potts et al., 2005). In cardiomyocytes, cytochrome C (cyto c) levels in the cytosol are not enough to induce apoptosis, and no apoptosis was identified after direct microinjection of cyto c into the cardiomyocytes of a heart with cardiomyopathy (Scheubel et al., 2002).

1.2.4.2 Necrosis

Although necrosis is defined as an unregulated form of cell death, it could be regulated by death receptor activation and caspase inhibition, which are important in myocardial infarction (MI), HF and stroke. However, the percentage of regulated versus unregulated necrosis is unknown (Whelan et al., 2010). The loss of cardiomyocytes by necrosis was identified in HF, and associated with an overload of Ca2+ (Nakayama et al., 2007). The most prominent characteristics of necrosis are plasma membrane dysfunction and deficiency in cellular ATP, which result in the swelling of the cell and its organelles, such as mitochondria. Necrosis causes an inflammatory response because it releases cellular contents into the extracellular space (Whelan et al., 2010). In myocardial infarction, the most prominent type of cell death is myocardial necrosis. Myocardial necrosis has also been found in Ca2+-induced mitochondrial damage (Konstantinidis et al., 2012; Mudd & Kass., 2008).

Autophagy is cytoprotective process, which is important for cardiomyocytes. Recently, it has been reported that autophagy has a role to play in the pathology of cardiac hypertrophy (Nakai et al., 2007).

1.2.5 Autophagy Autophagy is cytoprotective process, which is important for cardiomyocytes, it has been reported that autophagy has a role to play in the pathology of cardiac hypertrophy (Nakai et al., 2007). In contrast with necrosis and apoptosis, autophagy is a cells survival mechanism in which damaged organelles, dysfunctional proteins and lipids are intracellularly recycled (He & Klionsky., 2009). Autophagy (self-digestion) is a catabolic process that results in the degradation of the cell components comprising dysfunctional organelles and proteins. Autophagy starts by creating a double- membrane (autophagosome) around the target material to fuse it with lysosomes for degradation or digestion by lysosomal hydrolases. Once the autophagosome fuses with the lysosome, the degradation takes place and the remaining macromolecules are returned to the cytosol to be reused in protein synthesis during nutrient deprivation (Yorimitsu & Klionsky., 2005). In another definition, autophagy is a cell survival process in response to cell stress induced by conditions such as starvation, infection, ER stress and dysfunction. This process is essential for cell homeostasis and plays a main role in diseases like neurodegeneration, cancer, and infectious diseases (He &

Klionsky., 2009). The autophagy process occurs in mammalian cells in one of three ways: macroautophagy, microautophagy, and chaperone-mediated autophagy. Macroautophagy occurs through the formation of double-membrane vesicles called autophagosomes around damaged or unused substrates to transfer them to lysosomes for degradation; see Figure 1.3 (Levine & Kroemer., 2008). Microautophagy occurs when the substrates of the cytoplasm are directly engulfed by lysosomes. Microautophagy is related to the quality of cell functions and can be induced by rapamycin or starvation in a non-selective process of lysosomal degradation. The microautophagy process directly sequesters cytoplasmic cargo using autophagic tubes and transports it for degradation by invagination into lysosomes (Li et al., 2012; Whelan et al., 2010). The chaperone-mediated autophagy is a selective degradation process which requires the cytosolic chaperone heat shock cognate protein 70 (Hsc70). The target protein has to contain binding sites to Hsc70, which allow the target protein to bind to a chaperone and to be transferred to a lysosome (Whelan et al., 2010). Chaperone-mediated autophagy occurs when a chaperone protein binds to a target protein and facilitates its transportation through the membrane of a lysosome by changing its shape to the unfolded form. Chaperone-mediated autophagy is well characterized in higher eukaryotes (Massey et al., 2004).

The upregulation of autophagy is induced by several factors, such as infection, oxidative stress, and protein accumulation (Díaz-Troya., 2008; Levine & Kroemer., 2008).

Figure 1.3: Cell response to stress in three types of autophagy; (a) the first type is chaperone-mediated autophagy, whereby the key molecule is chaperone protein HSC 70, which recognizes and binds the target protein to form a substrate-chaperone complex, which can be identified by the lysosomal membrane receptor LAMP-2A, to inter the lysosome for degradation; (b) the second type of autophagy is macroautophagy, which starts by creating a phagophore around dysfunctional proteins and organelles to form the autophagosome, which fuses with the lysosome for degradation; (c) the third type of autophagy is microautophagy, which is when the lysosome engulfs the substrate directly for degradation (Sánchez-Pérez et al,. 2012).

1.2.5.1 Process of autophagy

Autophagy is a complex process which is controlled by autophagy-related proteins (Atg). So far, 32 autophagy-related proteins have been identified through genetic screening in yeast. The process includes four main stages: induction, nucleation, expansion and maturation/retrieval; see Figure 1.4 A (Wang et al., 2010). The target of rapamycin (TOR) is a central regulator of the autophagic process. During normal nutrient conditions, Class I phosphoinositide 3-kinase (PI3K) phosphorylates the protein kinase B (Akt), and TOR is activated by the phosphorylated Akt to inhibit the induction of autophagy by inhibiting Atg1 interaction with Atg13 (Kamada et al., 2000; Wang et al., 2010).

During low levels of nutrients, autophagy is induced when Atg13 binds Atg1 and Atg17 for the induction stage. The Atg1-Atg13-Atg17 complex has been found in yeast and mammalian cells with only slight differences in its features. Under normal nutrient conditions, mammalian TOR (mTOR) inhibits autophagy by interacting with Atg1 UNC-51–like kinase (ULK1), Atg13, and focal adhesion kinase family interacting protein of 200 kD (FIP200) complex. In particular, mTOR phosphorylates ULK1 and ATG13 for autophagy inhibition. Meanwhile, during starvation ULK1 is activated as a result of mTOR dissociation, which phosphorylates ATG13 and FIP200 to stimulate autophagy (Chan., 2009).

After autophagy initiation the nucleation step starts through the Class III PI3K complex, which forms an assembly site to encourage nucleation. Also, the lipid kinase Vps34 is essential for nucleation, which attaches to the membrane of the phagophore via the protein kinase Vps15. The activity of Class III PI3K (Vps34) kinase in this complex is regulated by Beclin 1/ATG6 and ATG14, and this lipid kinase complex is essential for autophagosome formation.

Autophagosome formation requires two ubiquitin-like systems. In the first system, the ubiquitin E1-like enzyme, ATG7, activates ATG12 and transfers it to the ubiquitin E2- like enzyme, ATG10. After that, ATG5 binds ATG12 to form the ATG12-ATG5 complex, which interacts with ATG16 (Wang et al., 2010).

In the second ubiquitin-like system, LC3 (ATG8) exposes a C-terminal glycine after cleavage by ATG4 to form LC3-I, which is activated by the E1-like enzyme, ATG7.

Then, LC3-I is transferred by the E2-like enzyme, ATG3, to attach to the phosphatidylethanolamines (PE) molecule on the phagophore membrane and form LC3-II. The level of LC3-II is usually used to monitor autophagy activity (Xie & Klionsky., 2007).

After autophagosome maturation, the ATG proteins are recycled via a pathway involving ATG2, ATG9, and ATG18. Ultimately, the formation of the autolysosome, that is, the fusion of the autophagosome with the lysosome, is for the purpose of degradation. In the lysosome, the acid hydrolases degrades the autophagosome membrane and surrounding cargo, resulting in sugars, amino acids, and lipids, which are released to the cytosol via permeases; see Figure 1.4 B (Wang et al., 2010).

Figure 1.4: The autophagy process and how the autophagy-related proteins ATG regulate this process. A) The diagram shows the general autophagy process. B) The inhibition of TOR kinase stimulates the autophagy process by ATG13, ATG1 and ATG17 complex. After the induction of autophagy, the nucleation of the autophagosome is induced by the class III PI3K complex, which consists of Vps15, class III PI3K, ATG14 and ATG6 (Beclin). For the autophagosome formation and expansion, two ubiquitin-like systems are initiated; one produces the ATG16-ATG5- ATG12 complex and the other produces the LC3-II-PE complex. Finally, the autophagosome fuses with the lysosome, which contains hydrolases, to form the autolysosome, which can degrade the engulfed cargo to recycle dysfunctional proteins and organelles (Wang et al., 2010).

1.2.5.2 Leading causes of autophagy 1.2.5.2.1 Starvation Starvation of nutrients is an essential stimulator of autophagy. Autophagy is basically induced in glucose deprivation conditions by inhibiting mTORC1 through AMP- activated protein kinase (AMPK) activation. Not only glucose starvation but also amino acid starvation can regulate autophagy. In yeast, several proteins have been identified that can regulate the selective autophagy which is induced by glucose deprivation. One of these proteins is the GTP-binding protein (Ras2), which blocks the degradation of fructose-1,6-bisphosphatase. In another example of autophagic degradation of peroxisomes (pexophagy), the G protein-coupled receptor (Gpr1) and (Gpa2) proteins are involved in the glucose sensing. In addition to mTORC1 inhibition, several proteins can regulate and induce autophagy, such as AMPK, tumour suppressor protein (p53) and cyclin-dependent kinase inhibitor (p27KIP1) (Moruno et al., 2012).

1.2.5.2.2 Stress response

The cell can respond to extracellular and intracellular stresses by inducing autophagy. Oxidative stress, hypoxia, expression of aggregate-prone proteins, glucose deprivation, and Ca2+ efflux from the endoplasmic reticulum (ER) all induce stress. The ER stress is one kind of cell stress that induces autophagy. The ER acts as an intracellular Ca2+ reservoir and facilitates folding of proteins and movement (He & Klionsky., 2009; Yorimitsuet al., 2006). Hypoxia is an incident of low level of oxygen that arises in several pathological conditions, such as cardiovascular ischemia, brain injuries, and tumours. Mitochondrial autophagy (mitophagy) is an adaptive response by cells during hypoxia. Mitophagy plays a major role in the maintenance of cell integrity and decreases the reactive oxygen species (ROS) level, since a major source of ROS is the mitochondria. When the level of ROS increases, this induces cell damage through a process known as oxidative stress inducing autophagy (Azad et al., 2008).

1.2.5.2.3 Pathogen infection Autophagy is an essential degradation process that is involved in pathogen elimination and is suggested to be a TOR-independent process. Mammalian cells induce autophagy as an adaptive immunity response against bacteria (Wang et al., 2009). In Drosophila,

35 the peptidoglycan-recognition protein (PGRP) is essential in microbe detection. Immune cells contain the PGRP receptors, which recognize the intracellular bacteria that activate autophagy. Furthermore, mammalian cells induced autophagy in response to the activation of antivirus signalling pathways, such as the eukaryotic initiation factor 2 (eIF2α) kinase signalling pathway. Mammalian cells activate the signalling of Toll-like receptors (TLRs), which are localized at the endosomes and cell surface, and these TLRs stimulate autophagy during adaptive immunity. The transcription of genes responsible for inflammation, antiviral immune responses, and the stimulation of T cells is activated by the TLR signalling. For example, autophagy is induced by viral ssRNA (single-stranded RNA) through the receptor TLR7 (He & Klionsky., 2009).

1.3.1 Cellular mechanisms leading to autophagy

TOR plays an important role in regulating cell growth and nutrient sensing. TOR is considered as a downstream regulator for ATP levels, insulin signalling and growth factor receptor signalling. Downstream of the growth factor receptor signalling, Akt kinase and PI3-kinase signalling are activated by TOR in normal nutrient conditions and increase protein translation and ribosomal protein expression to encourage growth. During growth-promoting conditions, TOR inhibits autophagy through the inhibition of Atg1 kinase activity (Glick et al., 2010).

In addition to the role of cAMP-dependent protein kinase A (PKA) in the signalling pathways regulating autophagy in response to a low level of ATP, there are several other proteins that can induce autophagy, such as p53, p27KIP1 or AMPK. Autophagy can be activated in response to reactive oxygen species (ROS), extracellular signal- regulated protein kinase (ERK), c-Jun amino-terminal kinase (JNK) or p38, IkB kinase (IKK ) and forkhead class O (FOXO ) proteins (Moruno et al., 2012).

1.3.2 The role of autophagy in cardiac hypertrophy and HF

Autophagy is an essential process in cardiomyocytes, as in other mammalian cells, and any dysfunction in the autophagy process can lead to diseases. For example, an Atg5 deletion in cardiomyocytes inhibits autophagy, which causes cardiac hypertrophy (Nakai et al., 2007). Rapamycin activates autophagy to prevent ventricular hypertrophy due to pressure overload or thyroid hormone treatment. Autophagy occurs during ventricular hypertrophy to reduce the ventricular mass through protein degradation, and insufficient autophagic activity can cause abnormal aggregation of

36 proteins, which leads to increased oxidative stress and cell death. In contrast, the high level of autophagy in heart failure increases cell death and loss of myocytes which in turn increase the risk of heart failure (De Meyeret al., 2010). In addition to autophagy, aggregations of toxic and damaged proteins can be characterized in a variety of diseases, such as amyotrophic lateral sclerosis, Parkinson’s disease and Alzheimer’s disease (Martinet, et al., 2009). In the heart, protein aggregation is caused by a wide range of cardiovascular stress types, which stimulate cardiomyocyte autophagy (Tannous et al., 2008). In heart diseases such as cardiomyopathies, the activation of autophagy is considered a protective mechanism that removes misfolded and damaged proteins (Weekes et al., 2003). In load-induced heart failure, a positive correlation between the aggregation of ubiquitinated proteins and autophagic activity has been observed (Zhu et al., 2007). In cardiac hypertrophy, the high autophagic activity accelerates the conversion from a hypertrophied ventricle to ventricular failure (De Meyeret al., 2010).

1.4.1 Microtubule-associated proteins (MAP)

Two decades ago, the classical microtubule–associated proteins MAP1, MAP2, and MAPs Tau were discovered in a vertebrate brain when they were co-purified with microtubules. The enzymatically active MAPs and structural MAPs were classified under the MAPs proteins family. Microtubule motors and the microtubule severing protein katanin are examples of enzymatically active MAPs, whereas the stable tubule STOP protein family is an example of structural MAPs (Halpain & Dehmelt., 2006). MAP1 family proteins are known as typical microtubule-associated proteins (MAPs) that bind along the microtubule lattice in the cell. MAP1 proteins are expressed mainly in neurons, and the MAP1 family is essential for the structure and maturity of axons and dendrites. There are three types of MAP1 family proteins found in mammalians cells: MAP1A, MAP1B and MAP1S. In contrast, only one type of MAP1 proteins, known as Futsch, is found in Drosophila. MAP1A and MAP1B are required for microtubule stabilization (Tomasiewicz & Wood., 1999), while MAP1S mediates the aggregation of mitochondria, resulting in cell death and enhanced autophagy (Liu et al., 2012).

MAP1A and MAP1B interact with other components of the cell, such as filamentous actin and signalling proteins (Halpain & Dehmelt., 2006). The MAP2/Tau family of

37 microtubule-associated proteins consists of MAP2, MAP4, Tau and their isoforms. MAP4 is expressed in many different cells and is missing in neurons, while MAP2 and Tau are mainly expressed in axons and dendrites (Dehmelt & Halpain., 2005). It has been suggested that MAP2 and Tau play a role in neuronal migration and process outgrowth (Halpain & Dehmelt., 2006). The MAP2/Tau family plays several roles in addition to its microtubule stabilizing activity. For example, MAP2 interacts with microtubules and F-actin, playing a critical role in neuromorphogenic processes. Also, MAP4 is an important protein which plays a role in microtubule-stabilizing. One study reported that the phosphorylation of MAP4 by cell division cycle2 (CDC2) kinase regulates microtubule dynamics at mitosis. This phosphorylation reduces the microtubule-stabilizing ability of MAP4 (Ookata et al., 1997). In addition, Tau has been reported to be implicated in dementias and Alzheimer’s diseases (Dehmelt & Halpain., 2005).

1.4.2 Expression and isoforms of MAP1 family

MAP1 family proteins are expressed mainly in premature neurons. MAP1B expression is reduced in mature neurons, while the expression of MAP1A is not. MAP1A is highly expressed in neuron dendrites while MAP1B is highly expressed in neuron axons. MAP1S is found in a wide range of tissues in addition to neurons (Halpain & Dehmelt., 2006; Orbán-Németh et al., 2005; Schoenfeld et al., 1989). MAP1B is highly expressed at birth in mice brains and decreases after a few days, while MAP1A expression is very low at birth and increases postnatal. MAP1S is highly expressed at birth and remains high postnatal (Riederer., 2007). The MAP1 family is expressed in most vertebrates’ genomes. The genome of bony fish contains the three MAP1 proteins isoforms but with less size (Tomasiewicz & Wood, 1999). MAP1 family proteins are not expressed in the most primitive organisms and in Caenorhabditis elegans. However, Drosophila melanogaster contains one protein that displays features that are close to MAP1A and MAP1B, called Futsch. Futsch has different isoforms and is expected to be an orthologue of MAP1 proteins, specifically MAP1A and MAP1B (Hummel et al., 2000).

1.4.3 Gene organization and structure of MAP1

MAP1 family proteins are synthesized and cleaved in a tissue-specific manner to heavy (HC) and light chains (LC) chains which interact to form MAP protein complex. The function of the light chain is to bind to actin to stabilize microtubules while the heavy chain regulates the activity of the light chain. Heavy and light chains of each member of MAP1 proteins have different sizes. The HC for MAP1A is 350 KDa, the HC for MAP1B is 300 KDa, and the HC for MAP1S is 100 KDa. The light chain of MAP1B (LC1) is 32 KDa, the MAP1A light chain (LC2) is 28 KDa and the light chain of MAP1S (LC1) is 26 KDa (Halpain & Dehmelt., 2006).

MAP1 family protein structure has been identified, although not completely; however, studies using electron microscopy have proposed that MAP1A is a flexible elongated protein, while MAP1B is an elongated protein with terminal, rod-shaped, and round globular domains (Shiomura & Hirokawa., 1987). An unpublished observation suggests that MAP1A and MAP1B unfold in mammals (Halpain & Dehmelt., 2006).

Although there is a variety of polarities and charges in the amino acids that form microtubule binding sites or domains, all light chains (LC, LC1, LC2, and LC3) bind to the microtubules directly. MAP1A and MAP1B light chains bind not only to the microtubules but also to F-actin through their C-terminus. The heavy chains in MAP1A and MAP1B require an extra sequence to bind to the microtubule, and that affects the light chain binding activity to the microtubule (Halpain & Dehmelt., 2006). MAP1B light chain (LC1) binding activity to the microtubule could be decreased by MAP1B heavy chain interactions because the LC1 binding activity is affected by the MAP1B heavy chain or differential phosphorylation. The binding activity of MAP1B is less than the binding activity of MAP2 (Tögel et al., 1998; Vandecandelaere et al., 1996).

1.4.4 Interaction and function of MAP1

Microtubules are an important component of the eukaryotic cell. They have flexible and mechanical properties and are involved in cell activities, including mitosis and cell movement (Felgner et al., 1997). MAP1A and MAP1B are thought to play a role in stabilizing the microtubules. In vitro and in vivo studies show that MAP1B plays the main role in microtubule stability during axonal growth. MAP1B is phosphorylated by

39 glycogen synthase kinase-3 (GSK3) at Ser 1260 and Thr 1265 residues, which are phosphorylated particularly in growing axons (Goold et al., 1999; Trivedi., 2005). This phosphorylation makes the microtubule more sensitive to depolymerizing agents and reduces depolymerisation rates which mediate the stabilization of the microtubule. Another study indicated that c-Jun N-terminal kinase (JNK) could be involved in MAP1B phosphorylation. It has been suggested that MAP1A is essential in the mitogen-activated protein (MAP) kinase pathway during dendritic remodelling (Chang et al., 2003; Halpain & Dehmelt., 2006).

MAP2/Tau heterologous expression produces microtubule bundles with a straight and rigid form, while MAP1B produces bundles with a wavy appearance. The phenotype could be severely affected as a result of the inhibition of MAP1B and MAP2 or Tau at the same time, but a single knockout of one of them alone would produce fewer phenotypes (Halpain & Dehmelt., 2006). Several proteins interact with the MAP1 protein family and LC3 to accomplish specific functions in the cell, and any defect in these interactions can result in the development of some diseases, like neurodegenerative disease (Table 1.2) (Halpain & Dehmelt., 2006). For example, MAP1B interaction with a gigaxonin protein is expected to play a role in the development of giant axonal neuropathy (Allen et al., 2005). MAP1A interacts with postsynaptic density protein 95 (PSD-95). When the MAP1A-PSD95 interaction is inhibited or decreased as a result of a mutation, this can affect or result in loss of synaptic function (Ikeda et al., 2002).

1.4.5 The function of MAP1 family in the heart

In addition to the role of MAPs in neurodegenerative disease, it is also involved in cardiac regulation. One study reported Tau is important protein for heart function. Hence, the loss of Tau protein impairs the performance of the cardiovascular system (Betrie et al., 2017). Furthermore, MAP4 is another microtubule-associated protein that plays a role in the heart specifically in relation to cardiac hypertrophy response. The decrease in the phosphorylation of MAP4 defects the cardiomyocyte microtubules stabilization through AMPK signalling. Inducing pressure overload using transverse aortic constriction (TAC) in AMPK depleted mice reduced the phosphorylation of MAP4 which caused contractile dysfunction (Fassett et al., 2013).

Also, a recent study revealed that MAP4 phosphorylation in cardiac remodelling using MI patient and TAC induced mice, suggested this phosphorylation regulated by p38/MAPK signalling pathway (Li et al., 2018).

Interaction partners of MAP1 family proteins Interacting protein Proposed function of the interaction MAP1A Stabilization of microtubules Microtubules Integration of microtubule and F-actin cytoskeletons F-actin Enhancement of Rap1 GTPase activity and cell adhesion EPAC Linking of DISC1 to microtubules; pathogenesis of schizophrenia DISC1 Linking of PSD-93 to microtubules PSD-93 Interaction with and phosphorylation of the MAP1A light CK1& chain LC2

BKCa potassium In vitro association of the channel with the cytoskeleton

Channel MAP1B Microtubules Stabilization of microtubules F-actin Integration of microtubule and F-actin cytoskeletons Mapmodulin Modulation of neurite extension Gigaxonin Stabilization of microtubules by MAP1B; control of MAP1B light chain degradation; potential role in giant axonal neuropathy Myelin-associated Enhanced MAP1B expression and phosphorylation glycoprotein GABA(C) receptor Linking of GABA(C) receptors to the cytoskeleton FMR1 Interaction with MAP1B mRNA and repression of its translation ee3 Alteration of the stability or folding of ee3 LIS1 Interference with the LIS1-dynein interaction

GRIP1 Localization of AMPA receptors to synaptic sites LC3 Microtubules Regulation of the microtubule binding of MAP1A and MAP1B; Caldendrin transduction of calcium signals. MAP1S Microtubules Stabilization of microtubules F-actin Integration of microtubule and F-actin cytoskeletons RASSF1A Regulation of mitotic progression ______Table 1.2: The most understood interactions and functions of MAP1 proteins. (Halpain & Dehmelt., 2006).

1.4.6 MAP1S

Microtubule-associated protein 1S (MAP1S) is also called VCY2IP1, or C19ORF5 according to the sequence data bank. Although MAP1S is the shortest protein in the MAP1 family, MAP1S still includes three hallmark domains, namely MH1, MH2 and MH3, like other MAP1 proteins. Because MAP1S has a smaller molecular weight than other MAP1 family protein members, its discovery was late, coming after the discovery of MAP1A and MAP1B (Orbán-Németh et al., 2005; Tögel et al., 1998).

The sequencing of human and mouse genomes has shown that the MAP1S gene contains seven exons, like MAP1A and MAP1B. However, there is a variation in the size of MAP1S and other MAP1 family members, because the length of the exon 5 sequence is different, while the rest of exons have almost the same length. In the human genome, MAP1S is located in chromosome 19 (19p13.12) and in the mouse genome it is located in chromosome 8 (Orbán-Németh et al., 2005).

One study suggested some MAP1S interaction with VCY2 protein and LRPPRC, but more information on MAP1S is needed to identify other functions of this protein (Liu et al., 2002). The MAP1S structure contains sites called hallmark domains, namely MH1, MH2 and MH3, as with the other MAP1 proteins MAP1A and MAP1B. However, MAP1A and MAP1B showed more similarity to each other in the amino acid sequence. Nevertheless, some regions of MAP1B showed some resemblance to MAP1S, such as the location between positions 1568 and 1592 of the amino acid sequence (aa) in MAP1B, which corresponds to location 615-639 of the aa sequence in MAP1S by 86%. Also, the region between 2075-2090 aa in the MAP1B sequence is 81% identical to the region between positions 663-678 in the MAP1S amino acid sequence. Generally, the MAP1S sequence in humans has a 63% identity with the mouse sequence, whereby the differences in the sequence between human and mouse come from insertions of additional amino acids (80 aa) into the human sequence, most of them in exon 5 (Orbán-Németh et al., 2005).

MAP1S is expressed in most mouse tissues and shows a little up-regulation in brain tissues during the postnatal period. Wong et al. (2004) reported that the highest expression of MAP1S was found in the testis, brain, heart, lung and kidney tissues. In another study using affinity purified antibodies to detect the MAP1S heavy chain (anti- HC), two bands of MAP1S were found; one of 120 KDa, which is the uncleaved full-

43 length polyprotein, and a second band of 100 KDa, which is the heavy chain. The level of expression of cleaved heavy chains and uncleaved (full-length) heavy chains varies in the brain, lung, heart and spleen, while the testis, kidney and liver tissues express similar levels of cleaved and uncleaved heavy chains. Most of the detected MAP1S heavy chain protein in the brain was cleaved, whereas the uncleaved heavy chain protein was mainly expressed in the heart, spleen and lung tissues (Orbán-Németh et al., 2005). The light chain in MAP1A and MAP1B has specific binding sites to microtubules and actin, and MAP1S also binds to them (Noiges et al., 2002; Tögel et al., 1998).

1.4.7 The role of MAP1S in suppressing tumorigenesis and other pathologies

MAP1S links mitochondria with microtubules. MAP1S contributes in autophagosome formation during autophagy by bridging the autophagy machinery with microtubules and mitochondria. MAP1S enhances autophagy to suppress tumorigenesis by eliminating damaged organelles and p62-associated aggresomes, which cause oxidative stress and genome instability. The role of MAP1S in tumour suppression by autophagy is to bind the dysfunctional mitochondria through leucine-rich PPR motif- containing (LRPPRC) and to transfer dysfunctional mitochondria into the autophagosome by interaction with LC3-II. Also, MAP1S interacts with the mitophagy-related proteins PARKIN and PINK1 (Liu et al., 2012). The tumour suppressor Ras-association domain family protein 1A (RASSF1A) is an inhibitor of cardiac hypertrophy. RASSF1A inhibits the pro-hypertrophic Raf1-ERK1/2 pathway (Oceandy et al., 2009). MAP1S is a main interacting molecule of RASSF1A, which bridges autophagosomes to microtubules and healthy mitochondria to microtubules for trafficking (Liu et al., 2012). In inflammation, MAP1S shows an interaction with the interleukin-6 (IL-6) signalling pathway. MAP1S ablation inhibits IL-6 signalling by inhibiting the signal transducer and activator of transcription 3 (STAT3), which is a result of the interaction with the suppressor of cytokine signalling 3 (SOCS3) (Zou et al., 2008). Also, in the programmed cell death apoptosis the upregulation of MAP1S has been found, which inhibits the apoptosis through the Wnt/b-catenin signalling pathway (Bai et al., 2017). As MAP1S is known as a tumour suppressor that interacts with the hypertrophy inhibitor RASSF1A, it is suggested that MAP1S plays a role in the heart remodelling.

MAP1S is an autophagy regulator during pathology, which has been found in liver tumour-induced mice (Liu et al., 2012). From this finding it is suggested that MAP1S might play a role in cardiac remodelling, such as cardiac hypertrophy, due to its interaction with the hypertrophy inhibitor RASSF1A. Also, MAP1S as autophagy regulator is expected to regulate the hypertrophy response through autophagy regulation. Furthermore, MAP1S has shown more interaction with some pathological condition pathways, such as inflammation and cell death. Based on these accumulated findings, it is important to investigate whether MAP1S can regulate other pathways during the development of cardiac remodelling, such as cardiac hypertrophy.

1.4.8 The role of microtubule-associated protein 1S (MAP1S) in autophagy Microtubule-associated protein 1S (MAP1S) is one homologue of the distributed microtubule-associated protein 1 (MAP1) family, which is involved in mitotic abnormalities, cell death and microtubule dynamics. MAP1S is expressed in most cells, including the cardiomyocytes. MAP1S is the major interactive partner of the tumour-suppressing Ras-association domain family 1 isoform A (RASSF1A) and mitochondrion-associated Leucine-rich PPR-motif containing protein (LRPPRC) (Liu et al., 2012). MAP1S can interact with NADH dehydrogenase subunit 1 (ND1) and cytochrome c oxidase I (COX-I). MAP1S plays an important role in autophagy for autophagosomal biogenesis and degradation (Xie et al., 2011). In mice, ablation of the MAP1S gene shows a decrease in the levels of cyclin-dependent kinase inhibitor 1B (P27) and B-cell CLL/lymphoma 2 or xL (Bcl-2/xL) proteins. Ablation of MAP1S results in the accumulation of defective mitochondria accompanied by defects in the response to nutritive stress and genome instability (Liu et al., 2012).

Since the MAP1S autophagy regulator and the process of autophagy have been shown to be involved in the hypertrophy response, it is imperative that the role of MAP1S in cardiomyocyte autophagy is elucidated. Before discussing the MAP1S protein in detail the next part gives an overview of the general family, of which the protein is a member.

A) C) MAP1S bridges healthy MAP1S interacts with external LC3-II and mitochondrion to microtubules for bridges autophagosomes to microtubules trafficking, with the assistance of for trafficking with the assistance of RASSF1A RASSF1A;

LRRRRC MAP1S RASSF1 RASSF1 MAP1S LC3-II

Autophagosome Healthy Mitochondrion Microtubule

LRRRRC MAP1S LC3-II

Autophagosome Dysfunctional mitochondrion

B) MAP1S binds to mitochondrion-associated LRPPRC and docks a dysfunctional mitochondrion into an autophagosome through the interaction with internal LC3-II. ______Figure 1.5: The role of MAP1S in tumorigenesis suppression through autophagy regulation. A) MAP1S interacts with RASSF1A to link a healthy mitochondrion with microtubules to facilitate trafficking. B) MAP1S interacts with mitochondrion- associated LRPPRC and internal LC3-II to dock a damaged mitochondrion into an autophagosome. C) After autophagosome formation, the MAP1S links the autophagosome to a microtubule by interaction with external LC3-II to facilitate trafficking (Liu et al., 2012).

1.5 HYPOTHESIS AND AIMS

1.5.1 Hypothesis

MAP1S knockout mice display abnormal mitochondria in their cardiomyocytes, which may affect autophagy, a key process in the development of pathological cardiac hypertrophy. Therefore, I hypothesize that the ablation of MAP1S modifies the hypertrophic response due to its effect on autophagy regulation.

1.5.2 Aims

1) To investigate the role of MAP1S during the development of hypertrophy. This aim will be achieved by subjecting MAP1S knockout mice to transverse aortic constriction (TAC).

2) To investigate the role of MAP1S in autophagy during the development of cellular hypertrophy. This aim will be achieved using a cellular model, and siRNA will be used to knock down MAP1S in cardiac myoblast cell line (H9C2 cells).

3) To investigate novel signalling pathways that might be regulated by MAP1S during the development of cardiac hypertrophy.

Chapter 2

2. MATERIALS AND METHODS 2.1 MAP1S knockout mice In order to study the role of MAP1S in the development of heart remodelling, it is important to produce MAP1S knockout mice which can be used in the molecular analysis. MAP1S knockout mice were kindly provided by Dr Leyuan Liu (Texas, USA) (Xie et al., 2011). These mice were MAP1S global KO mice generated using -/- Cre–loxP recombination technology. To produce (MAP1S ) mice by Cre–loxP recombination technology, mice with an insertion of loxP sites Flanking exon 4 and exon 5 were crossed with transgenic Nestin Cre mice to remove MAP1S in the germline, as shown in the figure 2.1 (Xie et al., 2011). Three mouse genotypes were obtained as a result, namely wild type, MAP1S knockout and heterozygous mice. The wild type and MAP1S knockout male mice were used in the experiments while the male and female heterozygous mice were used for the breeding. The strain background of all mice used in experiments was (C57BL/6), and male mice were used in all experiments except for the mitochondrial analysis, where two female mice were used as sham due to the limitations of mice breeding. The use of female mice was avoided in the experiments because the oestrogen level in female mice may interfere with the hypertrophy response as it reduces the hypertrophy response (Pedram et al., 2008; Xin et al., 2002). These mice were housed in the BSF Animal Unit, University of Manchester. All animal experiments were conducted according to the United Kingdom Animals (Scientific Procedures) Act of 1986 and were approved by the University of Manchester Ethics Committee.

______Figure 2.1: The generation of Map1s−/− mouse by Cre–loxP recombination technology. The figure shows the MAP1S gene in wild type mice (Map1s+), which show all exons, the floxed allele (Map1sf), and the null allele (Map1s−) with the deletion of exons 4 and 5. The Cre enzyme and its target sequence loxP are shown in the graph. Also, Frt, the target sequence for the Flippase enzyme, is shown in the figure. For the negative and positive selection, the thymidine kinase and neomycin resistance on the TK and PGKneo cassettes, respectively, are shown. Finally, the primer position on the MAP1S gene Pneo, P31, and P32 were used to determine mice genotyping (Xie et al., 2011).

2.2. DNA extraction

In order to distinguish the MAP1S knockout mice from the wild type mice, DNA was extracted from mouse skin tissues (ear snips) for the genotyping. Following ear snips collection, the samples were incubated at 56°C overnight in 200μl lysis buffer (0.5% SDS, 50 mM Tris-HCl pH 8, and 100 mM EDTA) and 10μl of Proteinase K (10 mg/ml) for digestion. The samples were then centrifuged at 15493 xg for 10 min to precipitate the digested proteins, and then the supernatant containing the DNA was transferred to a new tube for DNA precipitation. DNA in the supernatant was precipitated using 200μl of propan-2-ol and was inverted for a few seconds. Then samples were incubated in ice for 30 minutes before they were centrifuged at 15493 xg for 5 minutes and the supernatant was removed. The remaining DNA pellet was washed using 200μl of 70% ethanol and then centrifuged for 5 minutes at 15493 xg. Washing with 70% ethanol was repeated up to 3 times, depending on the purity of the DNA, and after centrifugation and removal of the ethanol the pellet was left to dry at room temperature for 10 min. Finally, the DNA pellet was dissolved in TE buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA pH 8) using a volume of 50 to 200μl, depending on the DNA pellet size, and then the DNA samples were stored at 20°C. The extracted DNA in this study was used only for genotyping.

2.3 Mice genotyping using polymerase chain reaction (PCR) Polymerase chain reaction (PCR) is common technique used to amplify a specific region of the DNA sequence to be analysed. For the mice genotyping, the PCR product was visualized by gel electrophoreses. The analysis of the PCR product was used to confirm the genotype of the mice: wild type (WT), knockout (KO) or heterozygous (HT). WT and KO male mice were used in the experiments, while HT male and female mice were used for mice breeding. The PCR reaction was performed using a 2X ReddyMix PCR Master Mix (Thermo Scientific). This PCR Master Mix contains 0.625 U ThermoPrime Taq DNA polymerase enzyme, 0.2 mM free deoxy ribonucleotide triphosphate (dNTPs) and reaction buffer. The total volume of PCR reaction 30μl was prepared by adding 15μl of 2X ReddyMix PCR Master Mix and 0.9μl of 100μM of each primer (Sigma) as shown in tabl.2.1, 10μl of nuclease free water, 0.3μl of 25 mM magnesium acetate and 2μl of 50 ng/μl DNA template. The mixture was run in a thermocycler machine (MJ Research PTC-200, applied biosystems) for 30 cycles. The PCR reaction conditions in the thermocycler are shown

51 in table 2.1 After the PCR reaction run in the thermocycler, the gel electrophoreses analysis was performed.

Thermocycling steps Temperatures Time

Enzyme activation 95 ºC 10 min

1 cycle

Denaturation 94 ºC 45 Sec

Annealing 60 ºC 1 min

Extension 72 ºC 2 min

30 cycles

Final extension 72c 10 min

1 cycle

4 ºC forever

______Table 2.1: Thermocycler steps for the PCR reaction

Primers used for genotyping

flox P31 FW CACCTGCCTAAGCCATCTGTGTC

P32 RV CTCAGTCTGTCTGAGACAAGGTC

Pneo RV GGTAGAATTGGTCGAGGTCGAC

______Table 2.2: The sequences of primers used in PCR reaction

2.4 Gel electrophoresis analysis

Gel electrophoresis was used to analyse the amplified DNA fragments depending on their size. The PCR product separation on the gel, according the product size, determines the mouse genotype. The electrophoresis was performed in a 2% agarose gel (2g of agarose powder in 100μl of 1X TAE buffer (Tris-acetic acid and Ethylenediaminetetraacetic acid (EDTA)) stained with 0.25μM ethidium bromide. The samples were run in the gel along with the DNA ladder HyperLadder™ I (Bioline) for 30 minutes at 90 volts in 1X TAE buffer. The ChemiDoc™ XRS+ imaging system (Bio-Rad) was used for DNA visualization under ultraviolet light (UV) to identify the genotype as bands, as shown in figure 2.2.

______Figure 2.2: Gel electrophoreses picture showing amplified DNA by PCR against the DNA ladder to identify mice genotype

2.5 Transverse aortic constriction (TAC) and sham surgery

Transverse aortic constriction (TAC) is one of the most common experimental models used to induce cardiac pressure overload hypertrophy and heart failure in mice. TAC induces a pathological response in mouse hearts as a cardiac hypertrophy and increases cardiac contractility, and long-term TAC causes heart failure.

The TAC procedure was performed under general anaesthesia by 3% isoflurane, supplemented by 1% oxygen, while for analgesia 0.1 mg/kg IP injection of buprenorphine was used.

Prior to TAC and sham surgery, the mice were induced by 5% isoflurane for intubation and placed on a heating pad at 37°C. After anaesthesia for TAC surgery, the mice were shaved in the chest area and the chest cavity was cut open under artificial ventilation with 1% oxygen and 3% isoflurane to maintain the anaesthesia during the surgery. As demonstrated in figure 2.3, a 7-0 silk suture was used for the ligation of the transverse aorta; this was wound around a 27-gauge needle that lay across the arch point between the left common carotid artery and the brachiocephalic trunk then the needle was withdrawn. After aorta constriction the mouse chest was closed by suturing, and the mouse was incubated in 30°C with an IP injection of 0.1 mg/kg buprenorphine for analgesia. To induce hypertrophy by TAC, 8-10 weeks-old male mice were exposed to TAC for two weeks. Sham surgery mice used as control were exposed to the same surgical procedure as in TAC without the aorta ligation.

______Figure 2.3: Constriction of the aorta by TAC in the mouse heart to induce pressure overload hypertrophy.

2.6 Echocardiography for hypertrophy-induced mice

After two weeks of TAC and sham surgery, the echocardiography for mice was performed under anaesthesia by1.5% isoflurane and then reduced to 1% of isoflurane during the Echo measurement. To perform the echocardiography on the MAP1S knockout mice in this project, an Acuson Sequoia C256 ultrasound instrument fitted with a 14 MHz transducer (Siemens) was used. Echocardiography was performed to assess the heart functions, chamber dimensions and wall thickness in the mice after TAC and sham surgeries.

The measurements of two captured images in M-mode view were taken for at last three heart cycles, as shown in figure 2.4, in order to calculate the parameters which estimate cardiac function and structure. From the images the measurement of the left ventricle end-diastolic (dLVD) and end-systolic (sLVD) diameters, interventricular septum (IVS) and posterior wall (PW) thicknesses were obtained, as seen in the figure 2.4. From these values the remaining cardiac function and wall thickness parameters of fractional shortening (FS %), ejection fraction (EF %), relative wall thickness (RWT) and left ventricular mass (LVM) were calculated using the below formulas:

Fractional shortening (FS %): [(dLVD- sLVD/ dLVD)] x 100 Relative wall thickness (RWT): (dIVS + dPW) / dLVD Left ventricular mass (LVM): 1.055 x[(dLVD + dPW + dIVS)3 – dLVD3] (1.055: the specific gravity of the myocardium (g/ml)). Ejection fraction (EF %): [(EDV-ESV)/EDV] x 100 (EDV: end-diastolic volume, ESV: end systolic volume)

After two weeks of TAC, mice echocardiography measurements were taken, after which mice were sacrificed by cervical dislocation and samples of protein, RNA and fixed tissues were taken for molecular and histological analyses, as shown in figure 2.5 B. For all experiments mice were sorted to four groups, namely WT TAC, WT Sham, KO TAC and KO Sham, as shown in figure 2.5 A. The TAC and sham procedures were performed by Dr Min Zi and Mr Sukhpal Prehar in our small animal cardiac unit in the BSF. We followed a procedure which has been established and is routinely used in our laboratory (Oceandy et al., 2009).

______Figure 2.4: Image of mouse heart echocardiography in M-mode view illustrating the parameters used in heart morphology evaluation. As shown in the image, the parameters obtained are left ventricular diameter in systole (sLVD) and diastole (dLVD), interventricular septum thickness in systole (sIVS) and diastole (dIVS), posterior wall thickness in systole (sPW) and diastole (dPW).

Wild type mice MAP1S knockout mice

WT TAC WT Sham KO TAC KO Sham

______Figure 2.5: Mice categorised during the experiments and samples collections. A) The diagram explains how the mice were classified into four groups, namely wild type sham, wild type TAC, knockout sham and knockout TAC, during the experiments. B) Diagram illustrates how the mice heart was cut and each part used for specific experiments. The transverse sections were used for histology, the proteins were used for western blot and the RNA was used for qPCR.

2.7 RNA extraction

RNA was extracted from the heart tissue that was collected from the mice hearts, as shown in figure 2.5. The heart tissues samples were placed in tubes with 500μl of TRIzol reagent (Invitrogen) and then manually homogenised using a Dounce homogeniser. After homogenisation, the tubes were incubated in ice for 10 minutes. Following the incubation, 200μl of chloroform was added to the homogenate and the tubes were inverted and then centrifuged at 15493 xg for 15 minutes at 4°C to form two layers. The clear upper layer containing RNA was transferred to new Eppendorf tubes with 500μl of isopropanol; the tubes were gently inverted and then incubated in ice for 10 minutes, before centrifuging at 15493 xg for 10 minutes to precipitate the RNA. Following the precipitation, 70% ethanol was used to wash the RNA pellets in the same manner as described for the DNA extraction. Finally, the RNA pellets were dried at room temperature for 10 minutes and re-suspended in 30-50μl RNase free water depending on pellet size for 10 minutes at room temperature and then stored at -80°C.

2.8 Measurement of DNA and RNA concentration

The measurement of the DNA and RNA concentration and purity was performed using a NanoDrop spectrophotometer ND-1000 (Thermo Scientific). Nucleic acids have a specific wavelength absorbance, so the quantity in the sample can be calculated and the ratio of absorbance at 260/280 nm is used to assess the purity of the extracted DNA and RNA. The optical ratio for pure DNA is 1.8 and for pure RNA it is 2.0. To quantify the DNA and RNA, 1.5μl of the sample used was compared to a blank sample. The extracted DNA was used for mice genotyping using PCR and gel electrophoresis while the RNA was used for gene expression analysis by qPCR.

2.9 Gene expression quantification by quantitative PCR (qPCR)

The quantitative polymerase chain reaction (qPCR) or real-time polymerase chain reaction is a common method which is used to detect the amplification of a gene of interest during the PCR cycles. In this project, the extracted RNA from mice hearts was used to estimate the expression of the gene of interest. In order to achieve the gene expression analysis from the extracted RNA, complementary DNA (cDNA) was produced from the mRNA by a reverse transcription reaction, followed by the amplification of the target gene and then the quantification of its expression by comparison with the expression of the housekeeping gene glyceraldehydes 3- phosphate dehydrogenase (GAPDH). In order to quantify the mRNA expression of a target gene the mRNA was converted to a single stranded complimentary DNA (cDNA) via reverse transcription. Reverse transcriptases (RTs) generate cDNA template from RNA template using primer complementary to the 3' end of the RNA template to direct cDNA strand synthesis. For the reverse transcription reaction, the high-capacity cDNA reverse transcription kit (Applied Biosystems) was used to convert RNA and to produce cDNA. The reverse transcription reaction master mix was prepared using 2μl of RT buffer, 0.8μl of dNTP mix, 2μl of RT random primers, 1μl of Multiscribe Reverse Transcriptase, 1μl of RNA inhibitor and 3.2μl of nuclease free water. 10μl of the 2μg/μl RNA diluted sample was added to 10μl of the master mix and placed in the thermocycler (MJ Research PTC- 200, Applied Biosystems) under the conditions shown in table 2.3. The real time PCR or quantitative PCR (qPCR) was performed in a 7500 Fast Real Time PCR machine (Applied Biosystems) to amplify the gene of interest using

59 produced cDNA. A mixture of 1:20 dilution of cDNA, qPCR mix SYBR Green (Agilent Technologies) and specific primers (Qiagen) were used in the qPCR reaction. For each qPCR reaction, 10μl mixture was prepared using 5μl of qPCR SYBR Green master mix, 1μl of cDNA, 1μl of primer and 3μl DEPC water. The qPCR reaction was prepared in 96-well plates with triplicates of each sample, in addition to the three controls samples, which are mixture without cDNA, mixture without primers and mixture without reverse transcriptase enzyme. Following the plate run on the qPCR instrument, the delta-delta CT method was used to evaluate the gene expression.

Thermocycling steps Temperatures (ºC) Time

1 25 10 min

2 37 2 hours

3 85 5 min

4 4 ºC forever

______Table 2.3: The temperature cycle conditions for RNA conversion to cDNA (reverse transcription reaction)

The qPCR Temperatures Time temperature cycle conditions steps

Enzyme activation 50c 2 min

Denaturation 95c 10 min

1 cycle

Annealing 95c 15 sec

60c 1 min

40 cycles

Final extension 72c 10 min

1 cycle

Melt curve 95c 15 sec

60c 1min

95c 30 sec

60c 15 sec

1 cycle

______Table 2.4: The temperature cycle conditions for qPCR

2.10 Protein extraction from mice heart tissues Protein was extracted from frozen heart tissues which were cut as shown in figure 2.5 B. The tissues were collected directly after the mice had been sacrificed, then the tissues were washed using phosphate buffered saline (PBS) before being frozen in liquid nitrogen. The tissue can be stored at -80 °C before protein extraction. For the protein extraction, 300-500μl of RIPA buffer (1% IGEPAL CA-630, 0.1% SDS, 1x PBS, 0.5% sodium deoxycholate, 500 ng/ml leupeptin, 0.5 mM PMSF, 2.5μg/ml pepstatin A, 1μg/ml aprotinin) was added to the tissue depending on the

61 tissue amount and the homogenate volume obtained. Tissues samples were homogenised manually using a Dounce homogeniser, then the samples were left on ice for 5 minutes. To precipitate large fractions, samples were centrifuged for 5 minutes at 825 xg at 4 °C then supernatant was transferred to a new tube and stored at -80 °C.

2.11 Measurement of protein concentration A bicinchoninic acid (BCA) assay kit (Pierce) was used to estimate the concentration of the extracted protein. The BCA kit has detergents compatible with the detergents in the RIPA buffer which was used for protein extraction. The Pierce BCA protein assay kit is based on the colorimetric detection of reduced Cu+1 from Cu+2 by digested proteins under alkaline conditions. Every two molecules of the bicinchoninic acid bind to one Cu+1 cuprous ion, producing a purple coloured solution which has absorbance at 562 nm. To quantify the samples’ protein, the absorbance in each sample was compared to a standard of known concentration (BCA protein 0-2mg/ml in RIPA buffer). For the reaction, a 1:10 dilution of each sample in triplicate was prepared in a 96-well plate along with the standard reaction. To complete the reaction, the plate was incubated at 37 °C for 30 minutes and then measured using an optical plate reader (Thermo Labsystems). The mean of the triplicate readings for each sample was calculated to prepare samples before they were used in the experiments.

2.12 Western blot Western blot, or protein immunoblot, is a common molecular analysis technique which is used to quantify the level of the target protein using specific antibodies to this protein in a sample of whole cell proteins lysate. For protein western blot analysis, 30-50μg protein samples (30μg of protein extracted from the tissue culture and 50μg of protein extracted from the mice heart tissues) were used in this study. For protein separation, sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDSPAGE) was used and the protein samples were run through two gels, a stacking gel and a separation gel. The stacking gel was prepared as shown in table 2.5, which is standard for all proteins, while separation gel was prepared as shown in table 2.5 depending on the molecular weight of the target protein. Samples were prepared by mixing an equal volume of 2x Laemmli buffer (Sigma Aldrich) and a protein sample. To prepare a 30μl volume reaction, 15μl of protein

62 sample and 15μl of Laemmli buffer were mixed and then heated to 95 °C for 3-5 minutes. After the gel was prepared and placed in the running tank with Tris glycine buffer (0.25 M glycine, 0.1% SDS, 25 mM Tris Base), the samples and the marker (precision plus protein dual colour standards Bio-Rad) were loaded into the stacking gel. The gels were run in an electrophoresis tank with the Tris glycine running buffer at 127 V for 90-120 minutes depending on the acrylamide concentration in the running gel because an increase in the acrylamide concentration in the gel increases the running time. After running the gel, a polyvinylidene fluoride membrane (PVDF) (Millipore) was used to transfer the protein bands from the gel. Two methods were used for the transfer stage, namely wet transfer and semi-dray transfer, depending on the molecular weight of the protein of interest. Wet transfer was used for large proteins (over 100kDa size), while semi-dry transfer was used for small proteins (less than 50kDa). In both transfer methods, methanol was used to initiate the PVDF membrane for 5 minutes also the membrane and the gel were sandwiched between the filter paper and the running time was 2 hours at a current of 200 mA and 30 volt. In the wet transfer method, the tank was filled with the transfer buffer (25 mM Tris base, 0.25 M glycine, 20% methanol). In order to prevent the non-specific binding of the antibodies to the PVDF membrane the membrane was incubated in a blocking buffer for 2 hours at room temperature or overnight at 4 °C depending on the antibody manufacture instructions. Two blocking buffers were used, 0.5-5% non-fat dried milk (Sigma Aldrich) or 0.5-5% bovine serum albumin (BSA) (Sigma Aldrich) following the manufacturer’s instructions for each antibody. Both were prepared by diluting 0.5-5 g non-fat dried milk or BSA in 100 ml TBS buffer (Tris-buffered saline with 10 mM Tris base and 150 mM NaCl). After membrane blocking, the membrane was incubated for 2 hours at room temperature or overnight at 4 °C in the primary antibody. The primary antibody was prepared by diluting the antibody 1:100-1000 in TBST, according to the antibody manufacturer’s instructions. After primary antibody incubation, the membrane was washed for 10 minutes with TBST (Tris-buffered saline with 10 mM Tris base, 150 mM NaCl and 0.05% Tween-20) 3 times, and incubated for 2 hours at room temperature in horseradish peroxidise (HRP)-linked secondary antibody anti-mouse IgG-HRP or anti- rabbit IgG-HRP (Cell Signalling Technology). The dilution of the secondary antibodies was 1:4000-1:5000 in TBST and after the secondary antibody incubation the membrane was washed 3 times for 10 minutes in TBST. For the detection enhanced

63 chemiluminescence (ECL), a reagent (GE healthcare) and the digital imaging system (ChemiDoc XRS+ imaging system Bio-Rad) were used. The ECL detection reagent was prepared by adding 1 ml of stable peroxide solution and 1 ml of enhanced luminol solution with 1μl/ml H2O2 for 2 minutes. For the detection of the housekeeping gene protein, the membrane was stripped of secondary antibodies using a stripping buffer (0.1 M glycine solution, pH 2.5) for 30 minutes. The membrane was washed 3 times with TBST for 10 minutes before it was incubated with the control antibody (GAPDH or beta actin), which was diluted 1:5000 in TBST, and an image analyser was used to detect the protein bands using western blotting reagents. To estimate the level of the target protein expression, the bands were normalized using the control bands (GAPDH or beta actin) obtained in the same sample using Image J software.

SDS-polyacrylamide gel electrophoreses

Stacking gel Separation gel

(%) Acrylamide Stander 8% 10% 12% 15% Protein size (KDa) Stander 40-140 20-80 15-70 10-80 H2O 0.68 2.3 2 1.7 1.2 30% acrylamide 0.17 1.3 1.7 2 2.5 mix 1.5 M Tris (pH8.8) 0.13 1.3 1.3 1.3 1.3 10% SDS 0.01 0.05 0.05 0.05 0.05 10% APS 0.01 0.05 0.05 0.05 0.05 TEMED 0.001 0.003 0.002 0.002 0.002 ______Table 2.5: Volumes of solutions that were used to prepare sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDSPAGE)

Primary antibodies used for western blot Antibody Manufacturer Dilution LC3 Novus Biologicals 1:1000 P62 Santa Cruz Biotechnology 1:500 BCLIN Santa Cruz Biotechnology 1:500 STAT3 Cell Signalling Technology 1:1000 Pospho- STAT3 Cell Signalling Technology 1:1000 BAD Cell Signalling Technology 1:1000 IL-6 Santa Cruz Biotechnology 1:500 Bcl2 Santa Cruz Biotechnology 1:500 BAX Santa Cruz Biotechnology 1:500

Secondary antibodies used for western blot Antibody Manufacturer Dilution Anti-rabbit IgG-HRP Cell Signalling Technology 1:5000 Anti-mouse IgG-HRP Cell Signalling Technology 1:5000

______Table 2.6: Antibodies used in western blot analysis

2.13 Preparing heart cross-sections for haematoxylin and eosin and Masson’s trichrome staining

For the histological analysis after cervical dislocation, the mice hearts were cut and the middle part (transverse section) was used for histology, as shown in figure 2.5. B, while the other parts used protein and RNA analysis. To prepare the tissues for histological analysis, heart tissues were fixed in a 4% paraformaldehyde solution at 4 °C for 48-72 hours. Then, the tissues were placed in histology cartridges to dehydrate them using a Shandon Citadel 2000 tissue processor overnight. The Shandon Citadel

2000 tissue processor uses different concentrations of industrial methylated spirits (IMS), as shown in table 2.7, for the tissue dehydration as well as xylene and molten- wax. Next, the heart tissues were incubated at 65 °C in oven (Quaviac) under 5 inches Hg pressure for 30 minutes. For embedding, the tissues were covered with paraffin wax and then frozen to form blocks. For sectioning, a microtome was used to cut blocks into 5μm thick sections, which were placed in a 40 ºC water bath and then mounted onto poly-L-lysine coated microscope slides. After embedding and sectioning, the slides containing tissues sections were dried in oven overnight at 37 °C.

Steps Solutions and concentration Time (hours)

1 IMS 50% 1.5

2 IMS 70% 1

3 IMS 99% 1

4 IMS 99% 1

5 IMS 99% 1

6 IMS 99% 1.5

7 IMS 99% 1.5

8 Xylene 1.5

9 Xylene 1.5

10 Xylene 1.5

11 Molten wax 1.5

12 Molten wax 1.5

______Table 2.7: Concentration and time of solutions were used in the Shandon Citadel 2000 tissue processor.

2.13.1 Haematoxylin and eosin stain for detecting cardiomyocytes morphology

Haematoxylin and eosin staining (H&E) is a common method which is used to stain cells for histological analysis. This method was used to evaluate the cell size of the cardiomyocytes in hypertrophy-induced mice by TAC. For haematoxylin and eosin staining, the slides were heated on the heat block for 1 minute then immersed in xylene for 5 minutes 3 times to dissolve and remove the excess wax. Subsequently, the sections were rehydrated using graded concentrations of industrial methylated spirit (IMS) (100%, 90% and 70%) for 2 minutes in each, then rinsed under tap water for 5 minutes. After the rehydration, the prepared slides were immersed in haematoxylin (Sigma) for 5 minutes to stain the nuclei a dark blue colour. The stained slides were then rinsed under running tap water, followed by differentiation with acid alcohol (1% HCL in 70% ethanol) for 5 seconds to decrease non-specific background colouration, and another rinse under running tap water for 5 minutes. Subsequently, the slides were dropped in eosin (Sigma) for 5 minutes to stain the cytoplasm with a pink colour and rinsed under running tap water for 5 minutes. The sections were dehydrated using graded concentrations of IMS (90%, 95%, and 100%) for 2 minutes for each one. Finally, the slides were cleared in xylene for 5 minutes 3 times and cover slipped after mounting with the mounting medium DPX Distyrene, plasticizer and xylene (Sigma). The slides were placed in a fume hood overnight to dry and then the imaging was performed using the Pannoramic slide scanner (3DHISTECH). For the cross-sectional area measurement, the Pannoramic Viewer software was used and the mean value of the size of 100 cells per section was considered.

2.13.2 Masson’s trichrome staining for detecting fibrosis formation Masson’s trichrome staining was used to evaluate the fibrosis level in the heart tissue sections, which is considered as sign for cardiac remodelling. The sections were prepared for staining by heating the slides on the heat block for 5 minutes, after which then slides were immersed in xylene for 5 minutes 3 times. After removing the excess wax by xylene, sections were placed in graded concentrations of (IMS) (100%, 90% and 70%) for 5 minutes each for the rehydration. After rehydration, the slides were rinsed under tap water for 5 minutes then placed in Bouin’s fixative at room temperature for 2 hours. The slides were then rinsed under tap water for 5 minutes, followed by haematoxylin staining for 5 minutes to stain the nuclei a blue colour. The

67 stained sections were washed under running tap water for 5 minutes to remove the excess haematoxylin. After the excess haematoxylin had been removed, the slides were differentiated in acid alcohol for 5 seconds, followed by washing under running warm water for 5 minutes. The slides were then placed in the red solution (0.1% ponceau fuchsin in 1% acetic acid, 0.9 % Biebrich scarlet) for 10 minutes to stain the cardiomyocytes a red colour, and then they were washed with distilled water. For fibrosis differentiation the sections were placed in 5% phosphomolybdic acid (GCC diagnostics) for 15 minutes and then washed under tap water. To stain the collagen, the slides were placed in aniline blue (GCC diagnostics) for 10 minutes and then washed with distilled water. After that the slides were placed in 1% acetic acid for 2 minutes and washed with distilled water. Finally, the sections were dehydrated using graded concentrations of IMS (90%, 95%, and 100%) for 2 minutes for each one and then mounted with DPX Distyrene, plasticizer and xylene (Sigma). Imaging was performed using the Pannoramic slide scanner (3DHISTECH) and for analysis the Pannoramic Viewer software was used to estimate the fibrosis percentage in each section.

2.14 PathScan Intracellular Signalling Array The PathScan Intracellular Signalling Array (Cell Signalling) was used to study the possible signalling pathways altered by the MAP1S gene knockout. This array contains 18 different antibodies attached to a coverslip. To perform the experiment, the slides were incubated with 100μl blocking buffer (supplied in the kit) on a shaker at room temperature for 15 minutes. The blocking buffer was then removed from the slide and 50μl of the 0.2 mg/ml protein samples were added and incubated at room temperature on the shaker for 2 hours. Using the (1X) array washing buffer, which was provided with the kit, 100μl was added to each well and incubated on the shaker at room temperature for 5 minutes for a total of 4 times. After the washing, 75μl of (1X) detection antibody cocktail was added to each well and incubated at room temperature on the shaker for 1 hour and then washed the same as in the previous steps. Before the detection, 75μl (1X) HRP-linked Streptavidin was added to the wells and incubated on the shaker at room temperature for 30 minutes and then washed for 5 minutes 4 times. Finally, for the detection the slides were covered with LumiGLO and peroxide reagent in a plastic dish for 2 minutes. The digital imaging system ChemiDoc XRS+ imaging

68 system (Bio-Rad) was used to capture the images and Image J software was used for the analysis.

______Figure 2.6: The position of each antibody on the slide.

______Table 2.8: The 18 antibodies detected in this signalling array

2.15 Mitochondria structure analysis by electron transmission microscopy Transmission electron microscopy was carried out to analyse mitochondria structure in heart tissue. Heart tissues were collected from mice, and then they were immediately fixed in 2.5% glutaraldehyde and 0.1M HEPES buffer (pH 7.2) containing 4% formaldehyde. Following the tissue fixation, the tissues were processed in 0.1 M cacodylate buffer (pH 7.2) with 1% osmium tetroxide and 1.5% potassium ferrocyanide for 1 hour before treatment with 0.1 M cacodylate buffer (pH 7.2) and 1% uranyl acetate for 1 hour and then treated with 1% uranyl acetate for 1 hour. After the fixation and treatment, the tissues were dehydrated using ethanol and then

70 embedded in TAAB 812 resin and polymerised at 60 ºC for 24 hours. Finally, a Reichert Ultracut ultramicrotome was used to cut the tissue sections, which were then examined with an FEI Tecnai 12 Biotwin microscope at 100 kV accelerating voltage. A Gatan Orius SC1000 CCD camera was used to take images of the sample sections at random areas. The tissue sections’ preparation and imaging were processed by Dr Aleksandr Mironov at the bioimaging facility at Manchester University.

2.16 H9c2 cardiomyoblast cell culture

The cardiomyoblast H9C2 Rat cells were used for in vitro analysis. To maintain the cells, Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) were used with 1% non-essential amino acids, 10% foetal bovine serum (FBS) and 1% penicillin/streptomycin. The cells were split when they were 80-90% confluent in 175 mL flask. For split cells, the old media was removed and then the cells were washed with phosphate buffered saline (PBS) three times. Trypsin was used to detach the cells from the flask 5 ml for 5 minutes at 37 °C. Finally, 10 ml of maintenance media was added to the flask and the whole solution was divided into three new flasks, with 20 ml of media in each flask.

2.17 Protein extraction from H9C2 cells

The cells were plated in 6-wells plate at the density of 100,000 cells per well for 72 hours. To harvest protein from the cells they were washed with PBS 3 times, after which 100µl of RIPA buffer was added to each well. The plate was then incubated at 4 °C on the shaker for 20 minutes. Cell scrapers were used to collect the mixture from the plate wells and the mixture was transferred to Eppendorf tubes followed by centrifuging at 825 xg for 10 minutes. After centrifugation, the supernatant, which contained the protein, was removed to a new tube and quantified using the BCA assay, as described above, and then stored at -80 °C.

2.18 GFP-LC3 adenovirus generation

To generate adenovirus expressing GFP-LC3, pAd/CMV/V5-Dest vector (Invitrogen) was used. The GFP-LC3 cDNA was kindly provided by Dr Tamotsu Yoshimori (National Institute for Basic Biology, Okazaki, Japan). The GFP-LC3 cDNA was cloned into the pAd/CMV/V5-DEST vector and was then transfected into HEK 293 cells to amplify this recombinant adenovirus. The HEK 293 cells transfection by the

71 plasmid was performed using a lipofectamine reagent (Invitrogen). First HEK 293 cells were plated in T75 flask with the maintenance media Dulbecco’s Modified Eagle Medium (DMEM) (Invitrogen) with 1% non-essential amino acids, 10% foetal bovine serum (FBS) and 1% penicillin/streptomycin; these were changed every two days until the cells become confluent. To transfect cells, 500μl OptiMEM medium (Invitrogen) containing 10μg of pAd-GFP-LC3 plasmid and 20μl lipofectamine reagent was added to the confluent cells with new maintenance media in a T75 flask. After this, the cells were placed in the incubator at 5 % CO2 and 37 °C and the media was changed every 48 hours until the adenoviral plaques became visible, after which the cells were transferred from the flask to a new tube. The mixture was centrifuged for 10 minutes at 1729 xg, and then the supernatant was removed and the pellet was pipetted in 500μl of PBS. The mixture was frozen at 80°C for 90 minutes then defrosted in a 37 °C water bath for 10 minutes three times. The homogenate was removed to new tube with 1 ml of 100% chloroform and inverted for 2 minutes and then centrifuged at 1729 xg for 10 minutes. Finally, the supernatant was removed to new tube which contained the GFP- LC3 adenovirus and stored at -80 °C. The GFP-LC3 adenovirus was generated by Dr. Delvac Oceandy.

For GFP-LC3 adenovirus titration, varied dilutions of the stocks (1x10-2 - 7.63x10-12) in triplicate were used to determine plaque forming unit (PFU). In 96 wells plate 5x 103 HEK 293 cells were plated in each well with 100μl of media for 24 hours. The media was then replaced by 100μl of fresh media contain the GFP-LC3 adenovirus dilutions which were incubated until forth day then the media was replaced and plaque formation was monitored for one week. The plaque formation indicates the highest adenovirus infection. The plaque formation unit PFU was used to quantify multiplicity of infection (MOI) which refers to ratio of infectious virions to cells. In the autophagy estimation experiments the H9C2 cells were infected with GFP-LC3 adenovirus an MOI of 25.

Well number Dilution PFU/ml Well number Dilution PFU/ml

1 1x10-2 1x103 13 3.9x10-9 2.56x109

2 1x10-3 1x104 14 1.95x10-9 5.12x109

3 1x10-4 1x105 15 9.77x10-10 1.02x1010

4 1x10-5 1x106 16 4.88x10-10 2.05x1010

5 1x10-6 1x107 17 2.44x10-10 4.1x1010

6 5x10-7 2x107 18 1.22x10-10 8.19x1010

7 2.5x10-7 4x107 19 6.1x10-11 1.64x1011

8 1.25x10-7 8x107 20 3.05x10-11 3.28x1011

9 6.25x10-8 1.6x108 21 1.53x10-11 6.55x1011

10 3.12x10-8 3.2x108 22 7.63x10-12 1.31x10-2

11 1.56x10-8 6.4x108 23 Control control

12 7.81x10-9 1.28x109

______Table 2.9 The titration of GFP-LC3 adenovirus on HEK293 cells.

2.19 Knockdown of MAP1S gene using small interfering RNA (siRNA)

Small interfering RNA (siRNA), or short interfering RNA, is a short sequence of around 20-25 base pairs of double stranded RNA which interferes with the expression of the gene of interest. The siRNA contains complementary nucleotide sequences of the target gene mRNA after transcription, which degrades it to stop the translation of the gene.

To knock down the MAP1S gene in H9C2 cells, siRNA (Sigma-Aldrich) was used and control siRNA (Sigma-Aldrich) was used to create a baseline to compare the results. The rat cardio myoblast H9C2 cell line was used for all in vitro experiments and siRNA was used to knock down the MAP1S gene in the H9C2 cells. To knock down the MAP1S gene, Dharma-Fect transfection reagent (Dharmacon) and OptiMEM medium

(Invitrogen) were used to transfect cells with siRNA following the manufacturer’s instructions.

The aim of knocking down the MAP1S gene in a cellular model is to study the role of MAP1S in autophagy regulation using different molecular analysis such as protein immunoblot and immunofluorescence. For the protein immunoblot, 6-well plates were used to culture cells, while for immunofluorescence 24-well plates and cover slips were used.

For the protein immunoblot, cells were cultured in a 6-well plate at a density of 100,000 cells per well with 2000μl of maintenance media for 24 hours before transfection with siRNA. After 24 hours, the maintenance media was changed with 1600μl of new maintenance media and then transfected with 400μl of transfection reagent and siRNA mixture per well. This mixture was prepared by adding 200μl of diluted siRNA (10μl of 5mM siRNA and 190μl of OptiMEM medium) to 200 μl of diluted transfection reagent (5μl Dharma-Fect transfection reagent with 195μl of OptiMEM medium) in one tube. The mixture was incubated at room temperature for 20 minutes before cell transfection. After transfection, the cells were incubated at 37 °C, 5% CO2 for 72 hours, then the cells were washed with PBS and protein was extracted as described for the protein extraction in the H9C2 section.

Meanwhile, for the immunofluorescence and fluorescence microscopy analysis, 24- well plates and cover slips were used. First coverslips were washed with ethanol and PBS, respectively, and then coated with poly-l-lysine. To coat cover slips with poly-l- lysine, 400μl of poly-l-lysine was used for each cover slip; these were then incubated under UV light overnight before the cells were seeded. After the cover slips were coated with poly-l-lysine the cells cultured at density of 20000 cells per well in maintenance medium at 37 °C, 5% CO2 for 24 hours, then the old media was changed with 800μl of new maintenance media and transfected with 200μl of transfection reagent and siRNA mixture per well. The siRNA mixture was prepared in the same manner as described for the 6-well plate. After transfection, the cells were incubated for 72 hours and then the cover slips were washed with PBS and collected for fluorescence microscopy analysis.

2.20 Stimulation of autophagy in H9C2 cells

Autophagy is a catabolic process in the lifecycle of the cell which recycles dysfunctional components to be reused by the cell. Autophagy can be induced in vivo and in vitro in several ways, such as starvation and inhibition of the mammalian target of rapamycin (mTOR) pathway. The mTOR is a protein kinase which is involved in the regulation of different processes in the cell, such as proliferation and growth. The macrolide compound rapamycin is one of the most common inhibitors of the mTOR pathway, which increases the autophagy flux in the cell. Rapamycin was used to induce autophagy in vitro with a lysosomotropic agent called chloroquine. Chloroquine blocks autophagy at the stage of the autophagosome fusion with lysosome by increasing the PH in the lysosomes, which inhibits the lysosomal enzymes. After autophagy stimulation by these two treatments, autophagy flux can be measured by evaluating the level of LC3-II, which indicates autophagosome formation. To label the LC3 in H9C2 cells, the cells were transduced with GFP-LC3 adenovirus to enable quantification of autophagic puncta by the snapshot fluorescent microscope. A high level of LC3-II means that a high number of autophagosomes has formed, as an indicator for the increase in autophagy flux. The cells were cultured at density of 20,000 cells per well on poly-l-lysine (sigma) coated coverslips in a 24-well plate for 72 hours after transfection with MAP1S siRNA and control siRNA, as described in the siRNA transfection section. This was followed by Ad-GFP-LC3 transduction overnight and then autophagy stimulation with 5mM of rapamycin (Sigma) and 3mM of chloroquine (Acros Organic) for 2 hours. Afterwards, the coverslips were washed by PBS and fixed with 4% formaldehyde for 20 minutes. To stain the nuclei, DAPI (Invitrogen) was used before the coverslip was transferred to slides on a VECTASHIELD mounting medium (Vector Laboratories) and images were obtained using an Olympus BX51 fluorescent microscope at 60X magnification. The GFP puncta, which are the autophagy activity indicator, were counted using ImageJ software.

To stimulate autophagy using another autophagy inducer, 50μM of C2-ceramide (sigma) was used with 3mM of chloroquine for 5 hours, and then the cells were prepared for imaging using the same method as described for rapamycin and chloroquine imaging.

2.21 Luciferase assay

The luciferase reporter assay is commonly used to evaluate the gene expression of a specific gene at the transcriptional level. H9C2 cells were seeded at a density of 20,000 cells per well in a 24-well plate and were then transfected by MAP1S siRNA and control siRNA for 72 hours. After that the transfected cells were treated with 20ng of BNP luciferase reporter vector and 50µM of PE per well for 72 hours. The luciferase enzymes convert luciferin to oxyluciferin, which emits a light that indicates the transcriptional activity of BNP, while the PE treatment was used to induce a hypertrophy response in the cellular model. After the treatment, the cells were washed in PBS and lysed with cell culture lysis buffer (Promega) for 20 minutes on the shaker. Finally, 20μl of the cell lysate from each well was used for the reading using a luminometer (Berthold Technologies Lumat LB 9507). Each sample dispensed 50μl of the luciferase substrate luciferin (Promega) and readings for each sample were taken in triplicate.

2.22 Immunofluorescence

Immunofluorescence microscopy was used in this study to stain the H9C2 in order to measure the cell surface area in the image obtained by fluorescent microscope. The H9C2 cells were treated with phenylephrine (PE) to induce cellular hypertrophy after MAP1S knockdown using siRNA.

Using a 24-well plate, the cells were plated on poly-l-lysine coated coverslips at a density of 20,000 cells per well. Once the cells become 80% confluent they were transfected with the siRNA and control siRNA for 72 hours before being treated with 50 µM PE for 24 hours. After the treatment, the cells were washed with PBS and then fixed with 4% paraformaldehyde for 20 minutes. The cells were washed with PBS before being treated for 10 minutes with 0.1 % Triton-X and then washed again with PBS. For the blocking, the cells were incubated with 1 % BSA overnight. The primary antibody α-actinin at a 1:200 dilution was used for 2 hours followed by washing 3 times with PBS. The secondary antibody FITC conjugated anti-rat was used for 2 hours and then the cells were washed with PBS 3 times. Finally, the nuclei were stained with DAPI (Invitrogen) for 5 minutes and then washed and the coverslips were collected for imaging on slides with VECTASHIELD mounting medium (Vector Laboratories)

76 using an Olympus BX51 fluorescent microscope, as described for GFP-LC3 imaging, and ImageJ software was used for the image analysis.

2.23 Detection of mitochondria using MitoTracker

MitoTracker was used to analyse whether the GFP-LC3 puncta co-localise with the mitochondria. To culture the H9C2 cells, 20,000 cells per well were plated in a 24- well plate and then transfected with siRNA and control siRNA for 72 hours. The cells were transfected with GFP-LC3 adenovirus, as described in GFP-LC3 section. After the GFP-LC3 adenovirus treatment the cells were washed with PBS before the incubation with 100nM MitoTracker (Invitrogen) for 30 minutes. The MitoTracker was prepared by dissolving the tube powder in anhydrous dimethylsulfoxide (DMSO). Finally, the imaging and the analysis were performed as described for the GFP-LC3 analysis.

2.24 Statistical analysis The analysis of all the data was conducted using Excel (Microsoft) and GraphPad Prism Software. The results were presented as mean ± standard error of mean (SEM), p value and n number. A P value of p < 0.05 was considered significant, and the n number refers to mice number or the independent experiments in the in vitro experiments. Two-way ANOVA and student’s unpaired t-test were used in the data analysis.

Chapter 3

3 The role of MAP1S in modulating cardiac hypertrophy 3.1 Introduction 3.1.1 Cardiac hypertrophy and tumour suppressors

Cardiac hypertrophy or heart enlargement is a compensatory response to an increase in stress and workload. Pathological cardiac hypertrophy is a maladaptive response to heart stress and dysfunction, and long-term pathological cardiac hypertrophy may lead to heart failure. Pathological cardiac hypertrophy accompanies numerous pathological conditions and diseases, such as heart injury and inflammatory diseases (Kehat & Molkentin., 2010). Genetic disorders can also play a role in the development of cardiac hypertrophy and cardiac remodelling. Several genes can influence heart remodelling directly or by regulating other pathways that have a direct effect on cardiac function and structure. For example, the constant activation of protein kinase B (Akt) causes mitochondrial dysfunctions, which encourage left ventricle hypertrophy (LVH) (Wende et al., 2015).

Tumour suppressor genes also have an influence on cardiac hypertrophy progression. One of these tumour suppressors is the tumour necrosis factor-induced protein 3 (A20), which plays a protective role against cardiac hypertrophy and improves heart function by inhibiting the transformation of the growth factor-β–activated kinase 1–dependent signalling pathway (Huang et al., 2010). Another tumour suppressor gene that plays a role in the development of cardiac hypertrophy is the phosphatase and tensin homolog (PTEN). Inactive or dysfunctional PTEN proteins cause cardiac hypertrophy which is characterised by an increase in cardiomyocyte cell size and the activity of protein kinase B (Akt) (Schwartzbauer & Robbins., 2001). The Ras-association domain family 1 isoform A (RASSF1A) is another tumour suppressor that plays a role in cardiac hypertrophy as an inhibitor of pressure overload-induced hypertrophy. The finding in this observation was that a deficiency of RASSF1A stimulates a hypertrophy response in cardiomyocytes by remodelling the extracellular regulated kinase 1/2 (ERK1/2) pathway, which is a key player in cardiac hypertrophy response (Oceandy et al., 2009; Zhang et al., 2003). One of the main proteins interacting with RASSF1A is the microtubule-associated protein 1S (MAP1S), which is also a tumour suppressor. MAP1S regulates tumours through the autophagy process during the development of a tumour (Liu et al., 2012). Although MAP1S is the main molecule interacting with

79 the tumour suppressor and hypertrophy inhibitor RASSF1A, currently no study has investigated whether MAP1S could play a role in cardiac remodelling. This project continues to explore and investigate the role of tumour suppressors in pathological processes in the heart, such as pathological cardiac hypertrophy. In vivo and in vitro approaches were used in this study to investigate the role of MAP1S in the progression of cardiac hypertrophy.

3.1.2 The tumour suppressor MAP1S and hypertrophy

Microtubule-associated proteins (MAPs) are a group of proteins in the cell that regulate microtubule dynamics and stability (Maiato et al., 2004). Microtubule- associated protein 1S (MAP1S), also called as VCY2IP1 or C19ORF5, is the smallest form in the MAPs protein family. MAP1S has the same three hallmark domains of MH1, MH2 and MH3 as other MAP1 proteins (Orbán-Németh et al., 2005; Tögel et al., 1998). MAP1S can be cleaved to release heavy chain (HC) (100 KDa) proteins and light chain (LC) (26 KDa) proteins. This molecule is relatively conserved between humans and mice: the difference in the sequence of the MAP1S gene between mice and humans is the insertion of 80 amino acids in the human sequence located in Exon 5, but the rest of the MAP1S gene sequence in mice is 63% identical with that of the human sequence (Halpain & Dehmelt, 2006). The MAP1S protein is expressed in the heart as in other organs in the body and interacts with deferent proteins for deferent functions in the cell, such as cytochrome c oxidase I (COX-I) and NADH dehydrogenase subunit 1 (ND1). One of the most important interactions of MAP1S is the interaction with the tumour-suppressing Ras-association domain family 1 isoform A (RASSF1A) and the mitochondrion-associated Leucine-rich PPR-motif containing protein (LRPPRC) which is important for autophagosomal biogenesis and degradation ( Xie et al., 2011).

MAP1S plays an important role in the development of tumorigenesis by regulating autophagy. One study shows that MAP1S stimulates autophagy during the development of liver tumour in mice (Liu et al., 2012). Autophagy decreases genome instability by eliminating the accumulated dysfunction proteins and cell components that initiate DNA double strand breaks (DSB) ( Xie et al., 2011). Also, the genetic ablation of the Map1s gene in mice has shown several changes in the expression of some proteins that are involved in other functions in the cell. MAP1S ablation reduces

80 the expression of cyclin-dependent kinase inhibitor 1B (P27) and B-cell CLL/lymphoma 2 (Bcl2) and causes an accumulation of abnormal mitochondria (Xie et al., 2011). Again, MAP1S as a tumour suppressor which has a specific interaction with the hypertrophy regulator RASSF1A might regulate some of the pathological processes of the heart, such as pathological hypertrophy.

3.2 Hypothesis

The ablation of MAP1S modifies cardiac hypertrophic response due to its effect on autophagy regulation.

3.3 Aims

1- To confirm the expression of the MAP1S protein in the mouse heart and to confirm the ablation of the Map1s gene in the knockout mice.

2- To examine the influence of MAP1S genetic ablation on mice heart function following induction of cardiac hypertrophy by transverse aortic constriction (TAC).

3- To investigate the effect of MAP1S ablation on the gene expression of the hypertrophy markers atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP).

4- To study the impact of MAP1S ablation on cardiomyocyte cell size after TAC or sham surgery using histological analysis.

5- To estimate the fibrosis level using the histological analysis and qPCR to quantify collagen gene expression.

3.4 Results 3.4.1 Demonstrating MAP1S ablation (global knockout) in mice Genotyping was used to identify wild type and knockout mice and sort them into groups for in vivo and in vitro experiments and molecular analysis. For genotyping, DNA was extracted from skin tissues (ear snips), which were collected from the mice prior to TAC and Sham surgery. Polymerase chain reaction (PCR) was used to amplify the specific sequence using primers that identify the Map1s gene and the Map1s null gene, or both of them in heterozygous mice. Gel electrophoresis was used to determine the PCR product and genotyping for the mice, which can be distinguished by the size of the amplified sequence by PCR as bands on the agarose gel. For electrophoresis, 2% agarose gel was used with ethidium bromide for the DNA staining to be readable under UV light. MAP1S knockout mice were kindly provided by Dr Leyuan Liu (Texas, USA). Cre–loxP technology was used to create the MAP1S knockout mice by crossing mice with an insertion of loxP sites flanking exon 4 and exon 5 with transgenic mice expressing Cre recombinases, as shown in figure 3.1 (Liu, et al., 2012). The results of crossing these mice are wild type, MAP1S knockout and homozygous mice. Through gel electrophoresis, the genotyping was obtained as a band at ~ 200bp for wild type mice, a band at ~ 300bp for MAP1S knockout mice, and both bands for homozygous mice as shown in figure. 3.1 B.

3.4.2 MAP1S protein expression in mouse hearts

The MAP1S protein, like other microtubule-associated protein families, is expressed mainly in the brain but also in other organs such as kidney, lung, testis and heart tissues (Orbán-Németh et al., 2005). Western blot analysis was used to confirm the expression of MAP1S protein in mice heart tissues. The protein was harvested from the mice heart tissues as described in the methodology chapter. The heart tissues were collected from each mouse directly after the animal was scarified. Specific antibody was used to detect the MAP1S protein in the protein samples that were extracted from the mice heart tissues. As shown in figure 3.2. MAP1S protein was completely absent in the hearts of MAP1S-/- mice.

______

Figure 3.1: Expression of MAP1S in heart extracts of WT and MAP1S-/- mice. Western blot was used to detect the presence of MAP1S using protein extracted from the mice heart tissues. MAP1S antibody detected protein bands in wild type mice samples, while no bands were detected in the MAP1S knockout mice.

3.4.3 Cardiac phenotype in MAP1S null mice after 2 weeks of TAC

In order to induce cardiac hypertrophy in mice, MAP1S-/- and WT controls were subjected to TAC surgery for 2 weeks. For control, sham operation was performed in both MAP1S-/- and WT mice for the same period of TAC. The cardiac hypertrophy features and parameters were analysed after 2 weeks. The ratio of heart weight to tibia length (HW/TL) was determined to investigate the effect of the ablation of the Map1s gene on the hypertrophy response. The increase in heart size is one of the features of pressure overload hypertrophy. Wild type mice showed an increase in HW/TL ratio by ~52% (WT TAC: 9.1 ± 0.63 versus WT Sham: 6 ± 0.23 mg/mm, p=0.0006). However, the HW/TL ratio of the MAP1S knockout mice was only moderately increased (by ~26%) after TAC compared to the knockout Sham mice, (KO TAC: 7.18 ± 0.46 versus KO Sham: 5.7 ± 0.2 mg/mm, P= ns). Importantly, when comparing between WT-TAC group vs MAP1S-/--TAC group the wild type mice displayed a significantly higher HW/TL ratio compared to knockout mice (WT TAC: 9.1 ± 0.63 versus KO TAC: 7.18 ± 0.46 mg/mm, P=0.028). This reduction in the HW/TL ratio in MAP1S knockout mice suggests a decrease in the hypertrophic response due to the absence of MAP1S. This finding supports the hypothesis that MAP1S plays a role in the hypertrophy response and this role is vital in the cardiac remodelling mechanism. The heart weight

84 body weight (HW/BW) ratio analysis followed the same trend as the HW/TL ratio, namely an increase in the heart weight of wild type and MAP1S knockout mice after TAC compared to Sham mice. However, wild type TAC mice showed a higher HW/BW ratio compared to MAP1S knockout TAC mice, but this was not statistically significant (WT TAC: 7.63 ± 0.5 versus KO TAC: 6.48 ± 0.55 mg/g, P=0.24).

HW/TL ** *

ns ns 10

Sham )

m 8 TAC

g 6

(

L 4

T /

W 2 H

0 WT MAP1S-/-

HW/BW * ns 10 ns * Sham

) 8 TAC

g m

( 4

B /

W 2 H

0 WT MAP1S-/-

______Figure 3.2: Analysis of the heart weight/tibia length ratio after 2 weeks TAC. A) The HW/TL ratio of wild type mice after TAC significantly increased compared to that of wild type sham mice (WT TAC: 9.1 ± 0.63 versus WT Sham: 6 ± 0.23 mg/mm, p=0.0006). MAP1S knockout mice displayed an increase in the HW/TL ratio after TAC compared to Sham mice, but this was not significant (KO TAC: 7.18 ± 0.46 versus KO Sham: 5.7 ± 0.2 mg/mm, P= ns). The HW/TL ratio after TAC in the wild type mice was higher than in the MAP1S knockout mice (WT TAC: 9.1 ± 0.63 versus KO TAC: 7.18 ± 0.46 mg/mm, P=0.028). B) The HW/BW ratio increased in the wild type mice after TAC compared to the knockout TAC mice, but this was not significant (WT TAC: 7.63 ± 0.5 versus KO TAC: 6.48 ± 0.55 mg/g, P=0.24). Results are shown as mean ± SEM; P *< 0.05; N= 5-7

-/- 3.4.4 Echocardiographic analysis (ECG) of MAP1S mice after 2 weeks TAC Echocardiography was performed on the mice after 2 weeks TAC and Sham surgery to study the effect of the genetic ablation of MAP1S on the heart morphology, structure and function. The echocardiography data analysis shows that there were no significant changes in the echo parameters after 2 weeks TAC, whether for wild type or MAP1S knockout mice. However, some echo parameters, such as left ventricular mass (LV mass) and relative wall thickness (RWT), show slight yet not significant changes following the trend in HW/TL ratio, whereby MAP1S -/- mice show less hypertrophy in response to TAC.

Echocardiography WT KO P Value

WT Sham KO Sham WT TAC Sham Parameter TAC Sham TAC VS VS VS

WT TAC KO TAC KO TAC dIVS (mm) 0.8 ± 0.03 1.12 ± 0.1 0.9 ± 0.03 1 ± 0 0.027 0.33 0.9

sIVS (mm) 1.39 ± 0.1 1.6 ± 0.06 1.45 ± 0.1 1.6 ± 0.1 0.22 0.77 0.9

dPW (mm) 0.7 ± 0.03 0.9 ± 0.07 0.7 ± 0.02 0.8 ± 0.05 0.09 0.92 0.2

sPW (mm) 1.1 ± 0.05 1.2 ± 0.05 1.12 ± 1.1 1.14 ± 0.1 0.7 0.99 0.94

RWT 0.38 ± 0.02 0.52 ± 0.1 0.42 ± 0.02 0.5 ± 0.04 0.11 0.57 0.98

LV mass (mg) 116.4 ± 4.8 162.2 ± 24 107.6 ± 7 127.3 ± 0.33 0.89 0.53 22.1

sLVD 4.2 ± 0.13 4.1 ± 0.34 3.9 ± 0.1 3.8 ± 0.3 0.99 0.99 0.81

dLVD 2.8 ± 0.2 2.9 ± 0.4 2.6 ± 0.1 2.5 ± 0.4 0.99 0.99 0.83

______Table 3.1: The echocardiography results of wild type and MAP1S-/- knockout mice after 2 weeks TAC. There are no significant changes in the chamber size parameters sLVD and dLVD. Also, the wall thickness parameters dIVS, sIVS, dPW, sPW, RWT and LV mass show no significant differences between wild type and MAP1S -/- mice after TAC. Results are shown as mean ± SEM; p; N= 5-7.

Wall thickness parameters: dIVS: diastolic interventricular septal thickness, sIVS: systolic interventricular septal thickness, dPW: diastolic LV posterior wall thickness, sPW: systolic LV posterior wall thickness, RWT: relative wall thickness, LV mass: left ventricular mass

Chamber size parameters: dLVD: left ventricle diastolic diameter, sLVD: left ventricle systolic diameter

3.4.5 Cardiac function in MAP1S knockout mice after 2 weeks TAC

To study the effect of MAP1S ablation on mice following TAC, echocardiography data was used to assess the heart function. Specifically, the calculation of the ejection fraction (EF) and fraction shortening (FS %) parameters was used to assess the heart function. EF is the evaluation of the percentage of blood that is pumped out from the left ventricle at each contraction, while fractional shortening is the ratio of the

87 shortening between the end-diastole and end-systole diameter of the left ventricle. These two values are calculated using the following equations: FS % = [(dLVD-sLVD)/dLVD] x 100 EF % = [(EDV-ESV)/EDV] x100 Generally, the mice did not show any significant changes in the heart function, whether wild type or MAP1S-/- mice, after 2 weeks TAC surgery. The ablation of the Map1s gene did not interfere with the heart function when there was no hypertrophy response, as there was no difference between the wild type sham mice and MAP1S -/- sham mice in ejection fraction (WT Sham: 68.9 ± 3.4 versus KO Sham: 67.7 ± 0.2 %, P= ns) and fraction shortening (WT Sham: 32.7 ± 2.5versus KO Sham: 32.1 ± 3.5 %, P= ns). However, the function in wild type mice decreased slightly, but this was not statistically significant, as a response after TAC surgery compared to the Sham group and knockout mice, whereby the knockout mice showed the opposite trend, but this was also not statistically significant (Ejection fraction (WT TAC: 63.68 ± 6 versus KO TAC: 69.2 ± 7.1 %, P=ns) and fraction shortening (WT TAC: 30.3 ± 6 versus KO TAC: 34.7 ± 4.8 %, P=ns)). Overall inn terms of heart function, the MAP1S ablation didn’t produce any significant changes. A)

EF ns ns

ns ns t

a 80

e Sham

t TAC

r 60

h 40

d 20

c e

j 0 E WT MAP1S-/-

FS% ns ns ns ns

% 40

g Sham

n i

n TAC

e 30

o h

S 20

a n

o 10

a r

F 0 WT MAP1S-/-

______Figure 3.3: Cardiac function parameters of ejection fraction and fractional shortening in MAP1S -/- mice after 2 weeks TAC. A) No significant changes in ejection fraction values in wild type and MAP1S knockout mice after TAC compared to Sham mice (WT TAC: 63.68 ± 6 versus WT Sham: 68.9 ± 3.4 %, p=ns), (KO TAC: 69.2 ± 7.1 versus KO Sham: 67.7 ± 0.2 %, P= ns). Also, comparing wild type TAC mice to MAP1S knockout TAC mice, TAC led to a slight, but not significant, decrease in the wild type TAC mice ejection fraction values (WT TAC: 63.68 ± 6 versus KO TAC: 69.2 ± 7.1 %, P=ns). B) No significant changes in fractional shortening values in wild type TAC or MAP1S -/- TAC mice compared to sham mice (WT TAC: 30.3 ± 4.1 versus WT Sham: 32.7 ± 2.5 %, p=ns), (KO TAC: 34.7 ± 4.8 versus KO Sham: 32.1 ± 3.5 %, P= ns). Wild type mice after TAC showed a slight, but not significant, decrease in fraction shortening compared to knockout TAC mice (WT TAC: 30.3 ± 6 versus KO TAC: 34.7 ± 4.8 %, P=ns). Results are shown as mean ± SEM; P; N= 5-7

3.4.6 Histological analysis

Histological analysis was used to characterise the cellular changes and heart structure in MAP1S-/- mice after 2 weeks TAC as well as to study the MAP1S ablation effect on the cardiomyocyte hypertrophy response induced by TAC surgery. Haematoxylin and eosin staining was used to stain the histological sections. Slides were then scanned using light microscopy (Axioplan 2); subsequently, the images were analysed using the Pannoramic viewer software to determine the cardiomyocyte cell size. Furthermore, histological analysis was used to evaluate the fibrosis level that accompanied the development of cardiac hypertrophy. Masson's trichrome staining of the heart sections was used to evaluate the fibrosis level using the same method described for the cell size analysis.

-/- 3.4.6.1 Cardiomyocyte cross-sectional area (CSA) in MAP1S mice after 2 weeks TAC Cardiomyocyte growth and changes in size are considered as response by the heart against stress, and the enlargement of individual cardiomyocytes is one of the features of cardiac hypertrophy. The cardiomyocyte cross-sectional area was measured in MAP1S knockout mice and in wild type mice after TAC. Haematoxylin and eosin stained histological sections were used for this analysis. For each mouse a mean value of 100 cells was obtained. The wild type Sham mice showed a greater cell size compared to MAP1S-/- Sham mice, but this was not significant (WT Sham: 225.2 ± 17.4 versus KO Sham: 191.1 ± 7.34 μm2, P= ns). The size of the cardiomyocytes in the wild type and the MAP1S knockout mice after TAC increased more than in the Sham (control) mice in response to the hypertrophy induction. However, the cardiomyocyte size in wild type mice was increased compared to the Sham group as a response to 2 weeks TAC, but this was not statistically significant (WT TAC: 264.5 ± 13.4 versus WT Sham: 225.2 ± 17.4 μm2, p=0.14). Also, the MAP1S-/- TAC mice displayed a slight increase, but this was not significant, in the mean of cardiomyocyte size compared to the MAP1S knockout Sham group (KO TAC: 215.2 ± 4.8 versus KO Sham: 191.1 ± 7.34 μm2, P= ns). However, both wild type and knockout mice developed an increase in the cardiomyocyte size after TAC, but the MAP1S-/- mice showed less response to TAC than wild type mice. As shown in figure 3.5, wild type TAC mice showed a significantly larger cardiomyocyte size compared to the MAP1S

90 knockout TAC group (WT TAC: 264.5 ± 13.4 versus KO TAC: 215.2 ± 8.4 μm2, P=0.039).

WT KO

TAC

Sham

Cardiomyocyte cross-sectional area ns * ns ns 300

Sham )

2 TAC

μ (

200

n 100

e M

0 WT MAP1S-/-

______Figure 3.4: Cardiomyocyte cross-sectional area (CSA) using H&E staining after 2 weeks TAC. A) Representative picture of the histological sections for the cardiomyocyte cross-sectional area from each group; scale bars are 50μm area for each group. B) The mean of 100 cells size calculated for each section using Pannoramic software and the graph presenting the mean cell sizes for each group. Results are shown as mean ± SEM; P *< 0.05; N= 5-7.

3.4.6.2 Histological analysis of the fibrosis level in MAP1S-/- mice hearts after 2 weeks TAC

The development of fibrosis is an important process that is associated with several organ pathologies and abnormalities, such as cardiac hypertrophy. Fibroblasts in the heart are one of the sources of pro-inflammatory cytokine and growth factors, and cardiac fibroblast activation leads to an increase in collagen production and deposition (Khan & Sheppard., 2006; Martin et al., 2014). This increase in the fibroblast activity and collagen production may lead to myocardial stiffness, which can cause contractile dysfunction. To quantify the fibrosis level after TAC using histological analyses, Masson’s trichrome staining was performed. Pannoramic viewer software was used to calculate

92 the fibrosis percentage in mice hearts after TAC. By comparing wild type Sham and MAP1S knockout Sham mice, no differences in the fibrosis levels were observed, and neither groups developed a significant level of fibrosis (WT Sham: 0.8 ± 0.55 versus KO Sham: 0.3 ± 0.1 %, P= ns). However, the analysis of the data illustrates that the mice displayed significantly more fibrosis in their hearts after TAC surgery. In response to 2 weeks TAC as a hypertrophy induction, wild type TAC mice showed a greater percentage of fibrosis compared to wild type Sham mice (WT TAC: 6.1 ± 1.02 versus WT Sham: 0.8 ± 0.55 %, p=0.004). Also, the MAP1S knockout TAC mice showed more fibrosis, but this was not significant, compared to MAP1S knockout Sham mice (KO TAC: 2.7 ± 0.1 versus KO Sham: 0.3 ± 0.1 %, P= 0.22). However, both the wild type and knockout mice developed more cardiac fibrosis after TAC, although the wild type mice showed a greater fibrosis percentage compared to the MAP1S-/- mice (WT TAC: 6.1 ± 1.02 versus KO TAC: 2.7 ± 0.1 %, P=0.045). This finding illustrates that the MAP1S protein plays a role in cardiac remodelling and that Map1s gene deletion decreases the hypertrophy response. The higher level of fibrosis in wild type mice is further evidence that MAP1S is required for the development of cardiac remodelling. A)

WT KO

Sham

TAC

Fibrosis ** * 8 ns ns Sham

a TAC e

r 6

s 4

r b

i 2 F

0 WT MAP1S-/-

______Figure 3.5: Analysis of Masson's trichrome staining. A) Representative image of the cross-section area of each group, illustrating the level of fibrosis in blue; scale bar for the pictures = 1000 µm. B) The level of fibrosis calculated using the Pannoramic viewer software; wild type and knockout mice show more fibrosis after 2 weeks TAC versus control groups (WT TAC: 6.1 ± 1.02 versus WT Sham: 0.8 ± 0.55 %, p=0.004), (KO TAC: 2.7 ± 0.1 versus KO Sham: 0.3 ± 0.1 %, P= ns). Wild types mice after TAC displayed more fibrosis versus knockout mice after TAC (WT TAC: 6.1 ± 1.02 versus KO TAC: 2.7 ± 0.1 %, P=0.045). Results are shown as mean ± SEM; P *< 0.05; N= 5-7

3.4.7 Gene expression of cardiac hypertrophy and fibrosis markers

To validate the influence of the MAP1S protein with cardiac remodelling specifically in the development of cardiac hypertrophy, qPCR was used to quantify the gene expression of hypertrophy markers. Atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) are known as markers for cardiac dysfunction, and an increase in the expression of ANP and BNP accompanies several cardiac pathological conditions, such as cardiac hypertrophy. Furthermore, qPCR was used to detect the

94 changes in the expression of genes related to fibrosis including collagen I alpha 1 (COL1A1) and collagen III alpha 1(COL3A1) after hypertrophy induction by 2 weeks TAC.

3.4.7.1 Gene expression of cardiac hypertrophy markers ANP and BNP

ANP and BNP are hormones produced by cardiomyocytes and secreted at different sites in the heart. ANP is mainly secreted from the atria, while BNP is secreted from the ventricles; however, in the case of severe heart failure, ANP is secreted from the ventricles (Yoshimura, Yasue, & Ogawa, 2001). ANP and BNP are involved in electrolyte fluid homeostasis, and the stretching of the cardiac wall stimulates their release into the plasma (Biondo et al., 2003). To investigate the influence of MAP1S on the expression of ANP and BNP, the analysis of the qPCR results shows that there are no differences in the BNP expression between wild type Sham and MAP1S knockout Sham mice, which means that there is no influence by MAP1S deletion when there is no hypertrophy induction by TAC (WT Sham 1.15 ± 0.27 versus KO Sham: 1.1 ± 0.43 fold change, P=ns). The expression of BNP was significantly elevated in wild type mice after hypertrophy induction through two weeks TAC compared to Sham mice (WT TAC: 4.9 ± 0.87 versus WT Sham: 1.15 ± 0.27 fold change, p=0.0009). Also, MAP1S-/- mice have a slightly higher expression of BNP after TAC compared to the Sham group, but the difference is not statistically significant (KO TAC: 1.9 ± 0.49 versus KO Sham: 1.1 ± 0.43 fold change, P= ns). However, both wild type and MAP1S knockout mice increase the expression of BNP in response to TAC, although wild type mice show a higher BNP expression compared to MAP1S knockout mice after TAC (WT TAC: 4.9 ± 0.87 versus KO TAC: 1.9 ± 0.49 fold change, P=0.0074). This finding illustrates that the Map1s gene ablation reduces the response to TAC significantly by supressing the increase in the expression of fetal cardiac gene BNP during the induction of hypertrophy.

Also, the analysis of the ANP expression in the mice hearts showed the same trend as the BNP expression, although the result was not statistically significant. The ratio of ANP expression was elevated in wild type mice after two weeks TAC compared to Sham mice, but this was not statistically significant (WT TAC: 3.64 ± 0.52 versus WT Sham: 1.84 ± 0.58 fold change, p=ns). Wild type TAC mice displayed a higher

95 expression of ANP than knockout TAC mice, but this was not statistically significant (WT TAC: 3.64 ± 0.52 versus KO TAC: 1.82 ± 0.64 fold change, P=ns).

ANP

ns ns

n 5 o

i ns ns Sham s

s 4

e TAC

r p

x 3

N 2

e v

i 1

a l

e 0 R WT MAP1S-/-

BNP 8 *** ** Sham

n ns

o ns i TAC

s 6

x e

e 2

l e

R 0 WT MAP1S-/-

______Figure 3.6: Effect of Map1s gene ablation on the expression of hypertrophic markers ANP and BNP. A) QPCR results for ANP gene expression normalized to (GAPDH) showed a slight but not significant difference between wild type and knockout mice (WT TAC: 3.64 ± 0.52 versus KO TAC: 1.82 ± 0.64 fold change, P=ns). B) BNP gene expression showed a significant higher expression after TAC in wild type mice than in MAP1S knockout mice (WT TAC: 4.9 ± 0.87 versus KO TAC: 1.9 ± 0.49 fold change, P=0.0074). Results are shown as mean ± SEM; P ** < 0.01; N=5-7

3.4.7.2 Gene expression of cardiac fibrosis marker COL1A1 and COL3A1 qPCR was used to detect the cardiac fibrosis level in MAP1S-/- mice after TAC by determining changes in the expression of collagen, type I, alpha1 (COL1A1) and collagen, type III, alpha1 (COL3A1). The result of wild type and MAP1S-/- mice followed the same trend as the result obtained from histology to detect fibrosis after TAC; however, it was statistically not significant. The expression of COL1A1 in wild type mice increased significantly after hypertrophy induction by TAC (WT TAC: 9.1 ± 2.5 versus WT Sham: 0.9 ± 0.13 fold change, p=0.0055). Also, MAP1S knockout mice showed an increase in COL1A1 expression after TAC, but this was not statistically significant (KO TAC: 3.7 ± 1.1 versus KO Sham: 0.9 ± 0.18 fold change,

P= ns). In addition, wild type mice displayed a higher expression of COL1A1 than MAP1S-/- mice after TAC, but this was not statistically significant (WT TAC: 9.1 ± 2.52 versus KO TAC: 3.7 ± 1.1 fold change, P=0.07). The expression of COL3A1 followed the same trend as for COL1A1 expression, but this was not statistically significant. COL3A1 expression in wild type mice after TAC was increased in comparison to control mice (WT TAC: 5.2 ± 2.24 versus WT Sham: 0.8 ± 0.18 fold change, p=0.008). Also, MAP1S knockout mice showed an increase after TAC in COL3A1 expression, which was slight and not statistically significant (KO TAC: 3.3 ± 1.1 versus KO Sham: 1.7 ± 0.6 fold change, P= ns). However, wild type mice displayed a higher expression of COL3A1 after TAC, but this was not statistically significant (WT TAC: 5.2 ± 2.24 versus KO TAC: 3.3 ± 1.1 fold change, P=ns).

CoL1A1

n ** P=0.07

15 o i Sham s ns

s ns

e TAC

r p

x 10

1 l

o 5

t a l 0 e -/-

R WT MAP1S

CoL3A1 n

o ns ns i

s 8 ns

s ns Sham

e r

p TAC

A 4

o C

t a

l 0

e WT MAP1S-/- R

______Figure 3.7: Effect of MAP1S ablation on the expression of COL1A1 and COL3A1. A) The graph presents the qPCR results of COL1A1 mRNA expression compared to (GAPDH); wild type mice showed a greater increase after TAC compared to knockout mice after TAC, but this was not statistically significant (WT TAC: 9.1 ± 2.52 versus KO TAC: 3.7 ± 1.1 fold change, P=0.07). B) The expression of the COL3A1 gene was slightly higher but not significant in wild type mice compared to MAP1S-/- mice after TAC (WT TAC: 5.2 ± 2.24 versus KO TAC: 3.3 ± 1.1 fold change, P=ns). Results are shown as mean ± SEM; P; N=5-7

3.5 Discussion

Cardiac hypertrophy is an adaptive response which results from a stimulus or a complex of stimuli, and in the long term this process may become maladaptive, leading to heart failure. Heart failure is one of the main reasons of morbidity and mortality among patients, and the administration and control of the hypertrophy response prior to the heart failure stage has become a promising therapeutic strategy. The regression of hypertrophy is a protective goal in preventing heart failure, as some studies have shown that the hypertrophy mechanism could be a reversible process. However, it is unknown through which pathways the progression of cardiac hypertrophy can be effectively stopped or slowed or even reversed. Several studies have provided evidence that pathological cardiac hypertrophy is a reversible process and that it is possible to restore heart function and recovery. One study showed that Simvastatin (a hypolipidemic drug) encourages hypertrophy regression, reduces cardiac fibrosis and increases the heart function in rabbits (Patel et al., 2001). Also, the treatment of the granulocyte colony-stimulating factor causes a regression of cardiac fibrosis and increases the heart function after hypertrophy induced by TAC (Szardien et al., 2012). Tumour suppressor proteins have also been shown to an influence on some heart abnormalities, such as cardiac hypertrophy. For example, a deficiency of tumour suppressor Ras-association domain family 1 isoform A (RASSF1A) encourages a hypertrophy response through extracellular regulated kinase 1/2 (ERK1/2) pathway (Oceandy et al., 2009). The importance of studying the role of MAP1S in cardiac pathology drives the continuation of the investigation into the involvement of tumour suppressors in cardiac remodelling as the MAP1S protein is expected to be a cardiac pathology regulator. The MAP1S protein is a tumour suppressor and a major interacting protein with RASSF1A, the hypertrophy inhibitor (Liu et al., 2012). To investigate the role of MAP1S in the development of cardiac hypertrophy, MAP1S knockout and control mice were exposed to TAC for 2 weeks. In vivo and in vitro analysis of wild type and MAP1S knockout mice after TAC showed that MAP1S is involved in the development of hypertrophy response.

3.5.1 Hypertrophic response to TAC in MAP1S knockout mice

The first evidence of the influence of MAP1S in the development of a cardiac hypertrophy response is the evaluation of the heart weight to tibia length (HW/TL). Although knockout mice responded to TAC surgery and showed an increase in the

100

HW/TL ratio after TAC compared to control mice, MAP1S-/- mice displayed less heart weight compared to wild type TAC mice, which indicates that MAP1S genetic ablation significantly reduces the hypertrophy response following TAC. Furthermore, the ratio of heart weight to body weight (HW/BW) follows the same trend as in HW/TL, with an increase in heart weight of wild type and knockout mice after TAC, but the changes are not statistically significant. The ratio of HW/BW after TAC in wild type mice increased more than in MAP1S-/- mice, but this was not significant. However, HW/TL is considered to be a more accurate hypertrophy parameter, as HW/BW can be affected by mouse age, which leads to an instability in the body weight (Yin et al., 1982). Also, another explanation is that in hypertrophy there may be an accumulation of fluid that causes oedema and hence increases BW. This will reduce the HW/BW ratio and make it less accurate than the HW/TL.

3.5.2 Echocardiography data of MAP1S null mice following TAC To continue investigating the effect of the genetic ablation of MAP1S on the hypertrophic response, which was induced by TAC for 2 weeks, an echocardiography analysis was performed in this study to characterise the cardiac phenotype in the mice after TAC. The analysis of the echocardiography parameters of MAP1S-/- and wild type mice did not show any significant changes in echo parameters as a response to TAC. The chamber size parameters of left ventricle diameter in diastole (dLVD) and left ventricle diameter in systole (sLVD) did not show any changes in response to TAC. In addition, the wall thickness parameters of intraventricular septum in diastole (dIVS), intraventricular septum in systole (sIVS), posterior wall thickness in diastole (dPW), posterior wall thickness in systole, (sPW), left ventricular mass (LV mass) and relative wall thickness (RWT) were analysed for wild type and MAP1S-/- mice, but they did not show any significant changes after 2 weeks TAC. However, some wall thickness parameters, such as RWT and LV mass, followed the same trend as in the HW/TL analysis, but this was not statistically significant. Two weeks of TAC is a short period of hypertrophy induction, and the findings in this study suggest that 2 weeks TAC is not enough to show more hypertrophy phenotype features in this strain of mice, because the echocardiography parameters in the wild type did not respond to TAC. One study using C57BL/6 male reported that systolic dysfunction was detected noticeably from the fourth week of TAC suggesting this process time-dependent (Liao et al., 2002).

101

3.5.3 Evaluation of heart function following hypertrophy induction after 2 weeks TAC

The heart function parameters ejection fraction (EF) and fractional shortening (FS) were assessed to monitor heart function after hypertrophy induction through 2 weeks TAC. The results obtained from this study showed no significant differences in the heart function in wild type or MAP1S-/- mice in response to hypertrophy induced by 2 weeks TAC. From this finding it is not clear if MAP1S ablation could influence the heart functions in the hypertrophy response as WT sham mice did not show any change in response to TAC. However, The 2 weeks of TAC is an acute model and no deterioration of function at this stage was expected (Souders et al., 2012).

3.5.4 Cardiac structure in MAP1S-/- mice in response to hypertrophy induced by TAC The heart response to pressure overload by a change in the cardiac structure, and the enlargement of the cardiomyocyte size is the main indicator of cardiac hypertrophy. The analysis of the histological cross-sectional area of the cardiomyocytes of MAP1S null mice shows that the average cell size in MAP1S-/- mice is smaller than in wild type mice in response to TAC, which illustrates that MAP1S genetic ablation reduces the response to the induction of hypertrophy induced by TAC. Also, an evaluation of the gene expression of hypertrophy markers was used to validate MAP1S influence in hypertrophy response, which was detected by a change in the cardiomyocyte cell size as a result of MAP1S ablation. The evaluation of BNP gene expression showed an increase in BNP expression in wild type and MAP1S-/- mice in response to TAC, but interestingly MAP1S-/- mice displayed less expression of BNP compared to wild type TAC mice. This finding is further evidence of the interference of MAP1S in the hypertrophy response, suggesting that MAP1S reduces the high expression of BNP that accompanies cardiac hypertrophy. Furthermore, the qPCR result of the ANP expression showed an increase after TAC in both wild type mice and MAP1S knockout mice, with a higher expression in the wild type, which follows the same tendency as with the BNP gene expression, but this was not statistically significant. Although the expression of ANP follows the same trend of the changes of the BNP expression in MAP1S-/- and wild type mice, it was not significant, similar to the echo data analysis; this suggests that 2 weeks is not enough to induce changes in all hypertrophy features in the mice strain that was used in this study. In addition, an increase in the number of

102 mice used in the experiments would be a further solution to give a clearer picture of the influence of MAP1S on the development of cardiac hypertrophy.

3.5.5 Evaluation of the fibrosis level that accompanies hypertrophy in response to TAC

The development of fibrosis is one of the most common pathological features accompanying cardiac hypertrophy, and the increase in the fibrosis level causes myocardial stiffness, which leads to contractility dysfunction. A histological analysis of Masson's trichrome staining showed more fibrosis in wild type and MAP1S knockout mice in response to 2 weeks TAC. However, the wild type mice developed more fibrosis in their hearts than the MAP1S-/- mice in response to hypertrophy induced by TAC. Furthermore, the gene expression of COL1A1 and COL3A1 increased in the mice in response to TAC, with a higher expression in wild type mice compared to MAP1S knockout mice, but the result is not statistically significant although it has the same tendency as the histological analysis, whereby MAP1S-/- mice developed less fibrosis compared to wild type mice. This finding suggests that MAP1S might influence other processes that accompany the cardiac hypertrophy response as well as regulate some molecular pathways that are initiated during the hypertrophy induction, such as the development of fibrosis.

3.6 Conclusion

The data presented in this chapter of the study showed some evidence that MAP1S could be involved in the development of cardiac hypertrophy. MAP1S genetic ablation in mice reduces some cardiac hypertrophy features, this suggests that MAP1S genetic ablation probably involved in the cardiac hypertrophy induced by 2 weeks TAC. MAP1S knockout mice showed a reduction in the response to 2 weeks TAC regarding the HW/TL ratio, cardiomyocyte cell size, gene expression of BNP, and fibrosis level compared to the response in wild type TAC mice suggesting MAP1S could play a role in cardiac remodelling.

Moreover, the findings from the other hypertrophy features of HW/BW ratio, mRNA of ANP expression and the expression of mRNA of collagen, type I, alpha1 (COL1A1) and collagen, type III, alpha1 (COL3A1) did not show significant change in the Knockout mice compared to Sham Mice. Another finding from this study is that MAP1S genetic ablation in mice did not have any influence on heart function, as the

103 analysis of the echo parameters did not show any changes in response to hypertrophy induction by TAC.

From the finding in this chapter it is suggested that an increase in the number of mice in the experiments as well as an increase in the length of the hypertrophy induction by TAC might provide more conclusive results.

3.7 Study limitations

The aim of this study is to characterise cardiac remodelling in MAP1S null mice after inducing cardiac hypertrophy using TAC. In this study, mice were exposed to TAC for 2 weeks to induce hypertrophy. The mice reacted to this TAC by displaying some cardiac hypertrophy features, but not all hypertrophy features increased significantly after TAC in wild type mice. A highly significant development of cardiac hypertrophy phenotype in wild type mice in response to TAC would enable an evaluation of the exact effects and influence of MAP1S in the development of hypertrophy. One suggestion to improve the development of hypertrophy induction is to increase the exposure time of the mice to TAC to more than 2 weeks, but not over the long term to avoid developing a heart failure model. Also, the limitation on the available number of mice used in the experiment was another issue, and an increase in the number of mice would decrease the variation of the results obtained. Finally, it is suggested that further studies use another strain of mice to validate the findings and support the theory of the influence of MAP1S on the development of cardiac hypertrophy.

104

Chapter 4

105

4. The role of MAP1S in regulating autophagy 4.1 Introduction 4.1.1 Autophagy regulation

Autophagy is a natural catabolic process in which the cell recycles the cytoplasm components of dysfunctional proteins and organelles. Autophagy is a regulated process under normal conditions and is a key mechanism for cell survival; however, autophagy experiences upregulation or downregulation in a variety of cell stress and pathological conditions, such as starvation, aging, tumour suppression and cell death (Mizushima., 2007). The first clear characterization of autophagy was presented by Christian De Duve in 1974, and after the discovery of this process, it was investigated in depth in a number of studies to determine the proteins involved in this mechanism (Deter & De Duve, 1967) . A genetic screening study was accomplished by Yoshinori Oshumi in 1993 and was the first to detect 15 genes that regulate the autophagy process. Of these so-called autophagy-related genes (ATG), 41 molecules have been identified so far (Harnett et al., 2017) . Each ATG plays a specific role in the autophagy process, which basically consists of four main stages: induction, nucleation, expansion and lysosome fusion/degradation, as shown in figure 4.1 (Wang et al., 2010). Briefly, the autophagy process starts when the stimulus triggers the autophagy induction, which is when the phagophore is created and then expands, surrounding the unwanted components of proteins and organelles to form the autophagosome. The autophagosome then fuses with the lysosome to form the autolysosome, where the degradation takes place through lysosomal acid proteases. The cargo is then released to the cytoplasm to be reused in the cell (Glick et al., 2010).

106

Figure 4.1: The main steps in the autophagy process from induction to degradation.

Regardless of the stimulus that initiated the autophagy, the target of rapamycin (TOR) is the main molecule that plays a role in the induction and initiation of the autophagy process. TOR, or the TOR orthologue in mammalian cells (mTOR), is a serine/threonine kinase which is an autophagy inhibitor. Several stress conditions can trigger autophagy by inhibiting mTOR, such as hypoxia and low energy sources in the cell, as shown in figure 4.1.2 (Glick et al., 2010). Protein synthesis and calcium signalling pathways have also been identified as autophagy regulators (Allen et al., 2005).

107

Figure 4.2: Autophagy regulation by hypoxia, low energy and growth factor pathways. Growth factor signalling inhibits autophagy by activating mTOR. Growth factors and insulin receptors (IRS1) initiate AKT through PI3-kinases, which leads to an inhibition of sclerosis proteins 1 and 2 (TSC1/TSC2). TSC1/TSC2 complex inhibition increases the activity of Ras homologue enriched in the brain (Rheb), which encourages mTOR activity to inhibit autophagy. Autophagy can be stimulated by low energy and hypoxia through mTOR inhibition. Hypoxia triggers autophagy through the activation of REDD1 (regulated in development and DNA damage responses 1), which inhibits Rheb, leading to mTOR inhibition. A low level of ATP inhabits mTOR by activating AMP-activated protein kinase (AMPK). AMPK activates TSC1–TSC2, which inhibits mTOR through Rheb GTPase inhibition (Glick et al., 2010).

108

4.1.2 Autophagy and pathology

Since autophagy was discovered, several studies have tried to understand the mechanism of this process in depth and identify any therapeutic potential of this process. Although several studies have shown clear evidence of the influence of autophagy on a variety of pathological conditions and diseases, it is controversial as to whether a high level or a low level of autophagy is beneficial in some pathological conditions. Autophagy dysfunction has been identified in several pathologies, such as cancer, cardiovascular disease and neurodegenerative disorders (Petibone et al., 2017). A number of compounds are involved in autophagy flux regulation, whether inhibitors or activators, and have been used for clinical applications. As an example, the autophagy activators that have shown prospective clinical applications include rapamycin, also known as Sirolimus, which is an mTOR inhibitor that increases the autophagy flux. A soluble rapamycin ester was used to treat a patient with mantle cell lymphoma (Galimberti et al., 2010). Also, activated autophagy using rapamycin in flies and mice has shown a protective role against Huntington’s disease (an inherited disease that causes cell death in the brain nerve) (Ravikumar et al., 2004). Autophagy inhibitors, such as chloroquine, have also shown some therapeutic potential as well as clinical applications. Chloroquine is an autophagy inhibitor which blocks autophagy at the lysosome cargo degradation stage by increasing the PH level in lysosomes, and chloroquine has been used as an efficient anti-malarial agent (Homewood et al., 1972). Also, the autophagy inhibitor chloroquine has been used to treat rheumatoid arthritis (Rainsford et al., 2015). Autophagy is generally considered to be a tumour suppression mechanism, and a genetic disorder of several autophagy-related genes (ATGs) has been identified playing role in cancer. For instance, Beclin-1 encourages autophagy to inhibit tumour development in cancer of human breast cells (MCF7) (Liang et al., 1999).

4.1.3 Autophagy and heart remodelling and the possible role of MAP1S in regulating this process The autophagy process plays a role in heart pathology as well as other organs’ pathology and diseases. Several studies have shown that autophagy has an influence on heart remodelling. Cardiac hypertrophy is one of the forms of heart remodelling that has been suggested to be regulated by autophagy. Upregulation or downregulation of autophagy-related genes ATGs have been found to accompany or even cause the

109 development of cardiac hypertrophy. For example, autophagy disruption in mice induced by deficient Atg5 causes cardiac hypertrophy and dysfunction in contractility (Nakai et al., 2007), while the upregulation of autophagy by sustained Atg7 in mice decreases cardiac hypertrophy and fibrosis (Bhuiyan et al., 2013; Li et al., 2015). MAP1S is known as an autophagy regulator and as well as a tumour suppressor. MAP1S plays a role in autophagy during the development of cancer, and the genetic ablation of MAP1S increases the development of cancer induced in mice livers using diethylnitrosamine (DEN) (Liu et al., 2012). The autophagy flux is dramatically decreased in MAP1S knockout mice accompanied by tumour development. This study suggests that MAP1S is an essential molecule for the autophagy process which encourages autophagy to reduce genome instability by removing dysfunctional proteins and organelles (Liu et al., 2012). The third chapter of this study presents some evidence to show that MAP1S is involved in the development of the cardiac hypertrophy response in mice. As MAP1S is an autophagy regulator, it is expected that the role of MAP1S in cardiac hypertrophy is through the autophagy pathway. This chapter aims to determine whether autophagy is the pathway through which MAP1S regulates cardiac hypertrophy.

110

4.2 Hypothesis:

MAP1S regulates autophagy both in vivo in the mouse heart and in vitro in cardiac myoblast cell line H9c2.

4.3 Aims:

1) To identify the autophagy level in MAP1S knockout mice hearts after 2 weeks TAC.

2) To monitor the autophagy flux in cardio myoblast cell line H9C2 cells after knocking down the MAP1S gene using siRNA.

3) To investigate the effect of MAP1S knock down in H9C2 cells on cell size after cellular hypertrophy induced by phenylephrine treatment.

4) To investigate the effect of MAP1S ablation on the structure of the mitochondria using MitoTracker.

111

4.4 Results

-/- 4.4.1. Expression of autophagy marker LC3 in MAP1S mice after 2 weeks TAC. In order to investigate the role of MAP1S in the autophagy process in hypertrophy- induced mice, autophagy flux was measured in the mice by analysing the autophagy marker LC3. The conversion of LC3-I to LC3-II is the most commonly used method to monitor autophagy flux. A high level of LC3-II is an indicator for an increase in autophagy activity. The results obtained from this study show a higher level of -/- autophagy in wild type and MAP1S mice after inducing hypertrophy by TAC. Western blot analysis, by normalizing the level of LC3-II to Beta actin, shows that there is no difference in the autophagy level between wild type and MAP1S knockout mice when no hypertrophy has been induced by TAC (WT Sham: 0.99 ± 0.05 versus KO Sham: 0.84 ± 0.15 fold change, P= 0.9). Wild type mice showed an increase in the level of autophagy after TAC compared to control mice (WT TAC: 1.49 ± 0.25 versus WT Sham: 0.99 ± 0.05 fold change, p=0.3). Meanwhile, MAP1S knockout mice after hypertrophy induction by TAC did not show a significant increase in LC3-II compared to control mice (KO TAC: 1.07 ± 0.24 versus KO Sham: 0.84 ± 0.15 fold change, P= 0.8). The autophagy level in wild type mice after TAC increased compared to that of knockout mice TAC; however, this was statistically not significant (WT TAC: 1.49 ± 0.25 versus KO TAC: 1.07 ± 0.46 fold change, P=0.4). The level of LC3-I was also normalised to Beta actin expression using western blot analysis. Wild type mice showed a higher level of LC3-I after TAC compared to control mice (WT TAC: 2.12 -/- ± 0.2 versus WT Sham: 1 ± 0.01 fold change, p=0.0005). However, MAP1S mice did not show any significant increase in LC3-I expression after TAC compared to control mice (KO TAC: 1.22 ± 0.12 versus KO Sham: 1.01 ± 0.14 fold change, P= 0.7). Significantly the level of LC3-I in wild type mice after TAC increased compared to MAP1S knockout mice following TAC (WT TAC: 2.12 ± 0.2 versus KO TAC: 1.22 ± 0.12 fold change, P=0.0032).

112

LC3I/beta acctin

*** **

n 2.5 ns ns o

i Sham

s s

e 2.0 TAC

r p

x 1.5

I -

3 1.0

v 0.5

a l e 0.0 R WT MAP1S-/-

LC3II/beta acctin

ns ns

n o i 2.0

s ns ns Sham

s e r TAC

p 1.5

I I

- 1.0

e 0.5

a l

e 0.0 -/- R WT MAP1S

113

n LC3-II/LC3-I

o i

s 1.5 ns ns

s Sham e

r ns ns

p TAC x

E 1.0

C L

0.5

a l

e 0.0 -/- R WT MAP1S

______Figure 4.3: Western blot analysis of autophagy marker LC3-II and LC3-I. A) Results of the western blot analysis for LC3-I expression normalized to Beta actin. Wild type mice after TAC show a significant increase in LC3-I level compared to knockout mice after TAC (WT TAC: 2.12 ± 0.2 versus KO TAC: 1.22 ± 0.12 fold change, P=0.0032). B) Wild type mice have a higher level of LC3-II expression after TAC compared to MAP1S knockout mice after TAC, but this is not statistically significant (WT TAC: 1.49 ± 0.25 versus KO TAC: 1.07 ± 0.46 fold change, P=0.4).C) LC3-I expression normalized to LC3-II and no significant change between Wild type and knockout mice after TAC. D) Image from the western blot analysis illustrates the expressions of LC3-I and LC3-II which are normalized to Beta actin expression. Results shown as mean ± SEM; P** < 0.01; N= 5-7.

114

4.4.2. The evaluation of autophagy markers Beclin-1 and -/- p62/SQSTM1 in MAP1S mice after 2 weeks TAC.

The autophagy flux was also monitored in MAP1S-depleted mice by western blot analysis using Beclin-1 and p62/sqstm1 antibodies. Beclin-1 is an important protein which is involved in the autophagy induction process. The level of Beclin-1 increases during the initiation of autophagy by cell stress stimulus and is an indicator of autophagy activity (Kang et al., 2011). Meanwhile, the level of the P62 protein increases as a result of autophagy inhibition or dysfunction. The autophagy process degrades and removes P62 as well as dysfunctional proteins, and P62 aggregation is an indicator for inhibited or uncompleted autophagy (Bjørkøy et al., 2005).

______

Figure 4.4: Beclin-1/Atg6, Lc3/Atg8 and p62 interactions in the autophagy process: in the autophagy process the initiation is regulated by Beclin 1-Vps34/ class 3 PI3 kinase complex. Atg7 and LC3 complex regulates the autophagosomes membrane expansion. P62 facilitates the recognition of polyubiquitin aggregates for the degradation in the autolysosoms.

115

To detect the level of the autophagy-related protein Beclin-1 after hypertrophy induction using TAC, western blot analysis was used. The results obtained show that there was no significant change in the level of Beclin-1 between wild type and knockout mice when there was no hypertrophy induction by TAC (WT Sham: 1 ± 0.25 versus KO Sham: 1.24 ± 0.22 fold change, P= 0.9). The level of Beclin-1 increased in -/- wild type and MAP1S mice after TAC, but this was statistically not significant. In wild type mice the protein expression of Beclin-1 was slightly elevated compared to that of control mice (WT TAC: 1.7 ± 0.6 versus WT Sham: 1 ± 0.25 fold change, -/- p=0.8). Also, MAP1S mice showed a higher level of Beclin-1 after TAC, but this was not significant (KO TAC: 1.99 ± 0.5 versus KO Sham: 1.2 ± 0.22 fold change, P= 0.6). -/- Although wild type mice and MAP1S mice expressed more Beclin-1 after TAC, there was no significant difference in the level of the increase (WT TAC: 1.74 ± 0.6 versus KO TAC: 1.99 ± 0.5 fold change, P=0.9). This finding suggests that hypertrophy stress induced by TAC leads to a slight increase in the autophagy level in wild type and knockout mice. As Beclin-1 is important in autophagy, specifically in the induction step, MAP1S has no clear effect on the induction of autophagy.

The second marker for autophagy is p62/SQSTM1, which is used to monitor the autophagosomes’ fusion with lysosomes as well as the degradation step. The western blot results showed a different tendency in the level of p62/SQSTM1 between wild type and knockout mice. The knockout mice displayed a higher level of p62/SQSTM compared to wildtype mice even without TAC; however, this increase was not significant (WT Sham: 1 ± 0.24 versus KO Sham: 2.26 ± 0.71 fold change, P= 0.6). Also the level of p62/SQSTM increased, but not significantly in the wild type mice after TAC compared to the control mice (WT TAC: 2.47 ± 0.88 versus WT Sham: 1 ± 0.24 fold change, p=0.5). Meanwhile, MAP1S knockout mice after TAC showed no significant increase in the level of p62/SQSTM compared to sham mice (KO TAC: 2.48 ± 0.73 versus KO Sham: 2.26 ± 0.71 fold change, P= 0.9). Finally, the wild type -/- and MAP1S mice expressed almost the same level of p62/SQSTM in response to TAC (WT TAC: 2.47 ± 0.88 versus KO TAC: 2.48 ± 0.73 fold change, P=0.9).

116

A) .

BECN1/GAPDH ns ns

n 3 o

i ns ns Sham s

s TAC

e r

p 2

N C

E 1

t a l 0 e -/-

R WT MAP1S

P62/GAPDH ns ns

n 4

o ns ns

i Sham s

s TAC

e 3

x E

e 1

a l

e 0 R WT MAP1S-/-

117

______Figure 4.5: Western blot analysis of autophagy markers Beclin-1 and p62/SQSTM1. A) Western blot analysis of Beclin-1 expression normalized to GAPDH. There was no significant difference in the level of Beclin-1 between wildtype and knockout mice after TAC (WT TAC: 1.74 ± 0.6 versus KO TAC: 1.99 ± 0.5 fold change, P=0.9). B) Also, the expression of p62/SQSTM in wildtype and knockout mice did not show any significant differences (WT TAC: 2.47 ± 0.88 versus KO TAC: 2.48 ± 0.73 fold change, P=0.9).C) Image of the western blot illustrates the expressions of Beclin-1 and p62/SQSTM1, which are normalized to GAPDH expression. Results shown as mean ± SEM; P; N= 5-7.

4.4.3. Knockdown of MAP1S gene using siRNA in H9C2 cells

The cell cultures used in this study to validate the results were obtained from in vivo analysis. The cardiomyoblasts H9c2 is common cellular model, which can proliferate and be used in place of cardiomyocytes extracted from animals. Unlike cardiomyocytes, which must be freshly extracted for each experiment, H9c2 cells line can be proliferated and maintained in cell culture media, allowing it to be used over several experiments.

In order to study the effect of MAP1S on autophagy activity in the H9C2 cell line, siRNA was used to knockdown the expression of the MAP1S protein. Western blot analysis was used to evaluate the MAP1S expression in protein extracted from the cells after transfection with control and MAP1S siRNA. Protein bands obtained from the western blot analysis showed that siRNA reduced the expression of the MAP1S protein by ~30-40%. Although the siRNA did not completely ablate MAP1S expression in H9c2 cells this model will still be used to evaluate the effects of MAP1S deficiency.

118

MAP1S

n 1.5

r p

x 1.0

P A

M 0.5

l e

R 0.0 l o A tr N n iR o s C

______Figure 4.6: Knockdown of MAP1S protein in H9C2 cells using siRNA. A) Western blot image illustrates that siRNA knockdown the MAP1S gene in protein extracted from H9C2 cells after transfection with siRNA. The level of MAP1S expression was normalized to Beta Actin. B) The graph shows that MAP1S siRNA knockdown the expression of MAP1S protein by around 30-40 %.

119

4.4.4. Monitoring the autophagy level using GFP-LC3 reporter in H9C2 cells following treatment with rapamycin and chloroquine

The cardio myoblast cell line (H9C2) was used to track the autophagy flux in the cellular model. The cells were transfected with MAP1S and control siRNA for 72 hours using a Dharma-Fect transfection reagent (Dharmacon) following the manufacturer’s instructions, and then subjected to a transduction with GFP-LC3 adenovirus for 12 hours. GFP-LC3 is a genetic tool to monitor autophagic flux. GFP-LC3 method can be used to transfect the cells with GFP-LC3 adenovirus. Following transfection, the engineered adenoviruses are used to label the LC3II protein, which is involved in autophagosomes formation. The label commonly used is the green fluorescent protein (GFP) that can be easily identified using fluorescent microscopy. The number of the GFP-LC3 puncta is a sign of the autophagy activity. For autophagy stimulation, 5mM of rapamycin and 3mM of chloroquine were used for 2 hours. Rapamycin triggers the induction of the autophagy process by suppressing the autophagy inhibitor mTOR, while chloroquine blocks the process after the autophagosomes’ formation step, which prevents the fusion of the autophagosomes with lysosomes for degradation and leads to an accumulation of autophagosomes.

______Figure 4.7: LC3-I is conjugate to phosphatidylethanolamine (PE) and forms LC3- II. The LC3-I to LC3-II conversion is an indicator of autophagy activity which can be detected by GFP-LC3 as green puncta using a fluorescent microscope. LC3-I is a cytosolic form of the LC3 which is accumulated which indicated fewer autophagosome whereas LC3-II bind to the autophagosom membranes and distributed in the cytosol indicating a higher level of autophagosome.

120

The results obtained from the H9C2 cells after the stimulation of autophagosome formation using rapamycin and chloroquine show that autophagy flux increased compared to the control cells. The number of GFP-LC3 puncta increased in the control and siRNA transfected cells after treatment with rapamycin and chloroquine compared to the untreated cells. Initially, the cells transfected with MAP1S siRNA and the control siRNA did not show a significant number of GFP-LC3 puncta when there was no autophagy stimulation by rapamycin and chloroquine and comparing them to each other showed no significant differences (siRNA: 3.1±0.25 versus control: 3.01±0.19 puncta per cell; p=ns). The autophagy flux increased significantly in the control siRNA transfected cells after autophagy stimulation by rapamycin and chloroquine compared to untreated cells (control: 3.01±0.19 versus control + treatment: 9.2±0.8 puncta per cell; p= 0.0001). Also, the number of LC3-GFP puncta in the MAP1S knockdown cells by MAP1S siRNA increased after treatment with rapamycin and chloroquine compared to the untreated cells (siRNA: 3.1±0.25 versus siRNA + treatment: 7.3±0.18 puncta per cell; p=0.008). However, both control and MAP1S siRNA transfected cell groups showed higher numbers of GFP-LC3 puncta after autophagy stimulation by rapamycin and chloroquine, whereby the control group showed slightly more GFP- LC3 puncta, but this was not significant (control + treatment: 9.2±0.82 versus siRNA + treatment: 7.3±0.18 puncta per cell; p=0.063). The analysis of this finding shows that there is more autophagosome formation in cells that have been transfected with control siRNA, but not at a significant level.

121

122

GFP-LC3

l l

e **** ns

r 15

e ns ***

m o

s 10

t u

A 5

b m

u 0 N t t C C S S

______

Figure 4.8: Evaluation of autophagy flux by estimation of autophagosomes numbers using the LC3-GFP adenovirus. A) H9C2 cells transfected with adenovirus express LC3 labelled with GFP and DAPI was used to stain the nuclei blue. Presentative image of each group illustrates the number of autophagosome as green puncta. Images were obtained using a Olympus fluorescent microscope; scale bar = 75μm. B) ImageJ software was used to analyse the images and the mean of 100 cells for three coverslips per group in the three independent experiments was considered.

C = Control; S = siRNA; T = Treatment with (rapamycin + chloroquine); N= 3

4.4.5 Evaluation of the autophagy activity in H9C2 cells following treatment with C2-ceramide and chloroquine.

Several methods were used to induce autophagy in the cellular model. To investigate the role of MAP1S in autophagy-induced cells, C2-ceramide was used to induce an autophagic response in H9C2 cells. C2-ceramide induces autophagy and increases the expression of the autophagy-related protein LC3-II (Zhu, et al., 2014).

After optimizing, the H9C2 cells were treated with 50μM and 3mM of chloroquine for 5 hours to induce autophagy. No significant differences were observed between the siRNA and control transfected cells without autophagy stimulation through C2-

123 ceramide and chloroquine treatment (siRNA: 3.58±0.17 versus control: 2.38±0.7 puncta per cell; p=ns). However, the treatment significantly induced autophagy in the siRNA control transfected cells (control: 2.38 ±0.7 versus control + treatment: 7.79±0.55 puncta per cell; p=0.0003). Also, the autophagy level was slightly increased in the MAP1S siRNA transfected cells after C2-ceramide and chloroquine treatment (siRNA: 3.58±0.17 versus siRNA + treatment: 5.68±0.33 puncta per cell; p=ns). Even though the siRNA and control transfected cells displayed a higher autophagy activity in response to the autophagy stimulation, the control cells showed a slight increase, but not significant, in the autophagy activity compared to the siRNA transfected cells (control + treatment: 7.79±0.551 versus siRNA + treatment: 5.68±0.33 puncta per cell; p=0.07).

124

l GFP-LC3

r *** ns

e p ns ns

s 10

m o

s 8

g a

h 6

u A

e 2

m u

N 0 t t C C S S

______

Figure 4.9: Evaluation of the autophagy flux by estimation of autophagosome formation using the LC3-GFP adenovirus. A) H9C2 cells transfected with virus express LC3 labelled with GFP and DAPI was used to stain the nuclei blue. A) Presentative image of each group illustrates the number of autophagosomes as green puncta. Images were obtained using an Olympus fluorescent microscope; scale bar = 75 μm. B) ImageJ software was used to analyse the images and the mean of 100 cells three times for three independent experiments was considered.

C = Control; S = siRNA; T = Treatment with (C2-ceramide + chloroquine); N= 3

125

4.4.6 The effects of MAP1S knockdown on phenylephrine induced cellular hypertrophy.

In order to investigate the role of MAP1S in the hypertrophy response in H9c2 cells, phenylephrine (PE) was used to induce hypertrophy. PE is an alpha-1 adrenergic agonist which encourages vessel constriction and causes a hypertrophy phenotype in the cellular model by modulating of the extracellular signal-regulated kinase (ERK) signalling pathway (King et al., 1998; Yue et al., 2000). By optimizing H9C2 for a range of PE concentrations, the best dose of PE was determined at 50μM used for 72 hours. To visualize the H9C2 cells under the fluorescent microscope, the primary antibody α-actinin and the secondary antibody fluorescein isothiocyanate (FITC) were used, while DAPI (4',6-diamidino-2-phenylindole) was used to stain the nuclei. ImageJ software was used to measure the cell size before and after treatment with PE. The analysis of the results revealed no difference in the cell size between the control and siRNA transfected cells without treatment (siRNA: 0.86±0.27 versus control: 1±1.01 fold change; p=ns). A slight increase in the siRNA control transfected cells after PE treatment was detected in comparison to the control without treatment (control: 1 ±1.01 versus control + treatment: 1.09±0.025 fold change; p= ns). Also, the siRNA transfected cells showed an increase in cell size after treatment, but this was not significant (siRNA: 0.86±0.27 versus siRNA + treatment: 1.01±0.07 fold change; p= ns). No significant differences in cell size were observed between the control and siRNA transfected cells after treatment with PE (control + treatment: 1.09±0.251 versus siRNA + treatment: 1.01±0.07 fold change; p=ns).

126

127

H9C2 Cell size

ns ns

l o

r 1.5 ns ns

S 1.0

n a

h 0.5

o f 0.0 E E C P S P + + C S

______

Figure 4.10: Analysis of the cell size change in H9C2 before and after the treatment with PE. A) Presentative image of each group shows the cell surface stained with green and the nuclei with blue. Images were obtained using an Olympus fluorescent microscope; scale bar = 75 μm. B) ImageJ software was used to analyse the images and the mean of 100 cells was considered for each coverslip; there were three coverslips for each group in the three independent experiments. Results shown as mean ± SEM; P; N= 3 independent experiments.

C = Control; S = siRNA; T = Treatment with (PE); N= 3

128

4.4.7 Evaluation of the expression of hypertrophic marker in response to the PE treatment in H9C2 cells after MAP1S knockdown by siRNA.

For a further investigation to track the impact of MAP1S gene knockdown on the hypertrophy response induced by PE in H9C2 cells in the cellular model, the Luciferase Reporter Assay was used to monitor the activity of BNP promoter, a known hypertrophic marker. The Luciferase Reporter Assay, as explained in the methods chapter, is commonly used to evaluate the gene expression of a specific gene at the transcriptional level. In our reporter construct, the Luciferase gene was cloned downstream of BNP promoter and have been inserted into an adenovirus vector. H9C2 cells were seeded at a density of 20000 cells per well in a 24-well plate and transfected with control and MAP1S siRNA for 72 hours plus BNP luciferase reporter vector for 24 hours. Cells were treated with PE three times at 24-hour intervals. No significant differences in BNP luciferase activity were detected between the control and MAP1S siRNA transfected cells without PE treatment (siRNA: 1.18±0.13 versus control: 1.02±0.13 fold change; p=ns). Significantly, BNP luciferase activity increased in the control transfected cells after treatment with PE compared to the control cells without treatment (control: 1.02±0.13 versus control + treatment: 2.1±0.035 fold change; p= 0.0091). Meanwhile, the MAP1S siRNA transfected cells showed no significant increase in BNP luciferase activity after PE treatment (siRNA: 1.18±0.13 versus siRNA + treatment: 1.02±0.14 fold change; p= ns). Finally, the siRNA control transfected cells after PE treatment displayed a higher BNP luciferase activity compared to the MAP1S siRNA transfected cells after treatment with PE (control + treatment: 2.1±0.035 versus siRNA + treatment: 1.02±0.14 fold change; p=0.0059). The analysis of the results reveals a significant correlation between BNP luciferase activity and PE treatment in the siRNA control transfected cells, while there was no change in BNP luciferase activity in the MAP1S siRNA transfected cells in response to the PE treatment.

129

BNP Expression

** ** y

t 3 ns ns

s 2

e c

i 1

N B

0 P P C N S N B B + + C S

______Figure 4.11: Analysis of BNP expression in H9C2 cells after PE treatment. Luciferase assay revealed that control siRNA transfected cells display higher BNP expression (control + treatment: 2.1±0.035 versus siRNA + treatment: 1.02±0.14 fold change; p=0.0059). Results shown as mean ± SEM; P** < 0.01; N= 3

4.4.8 Investigation of the role MAP1S in the specific autophagy of mitochondria (mitophagy) Mitochondria play a vital role in cell energy production and cell death. Mitophagy is a selective form of the autophagy process and is the removal of damaged mitochondria. Mitophagy consists of two main steps: the induction, which is similar to general autophagy induction, and the introduction of the defective mitochondria to the selective autophagic degradation (Ding & Yin, 2012) . To study the impact of MAP1S genetic ablation on the activity of mitophagy, the MitoTracker probe (red) was used to stain mitochondria after autophagy stimulation. H9C2 cells were transfected with control and MAP1S siRNA for 72 hours, then with LC3-GFP adenovirus overnight. Also, 5mM of rapamycin and 3mM of chloroquine per coverslip were used for 2 hours to stimulate autophagy. By optimizing the MitoTracker probe, 200nM per coverslip

130

for 30 minutes was used to stain mitochondria in the H9C2 cells. The analysis of the fluorescent microscope images reveals that MAP1S siRNA transfected cells display a higher level of mitophagy compared to control cells. As shown in figure 4.4.6, mitochondria stained by red and the green dots represent autophagosomes while the yellow dots show the fusion of the damaged mitochondria with autophagosomes. The images show that the MAP1S siRNA transfected cells display more damaged mitochondria and more mitophagy after autophagy stimulation by rapamycin and chloroquine.

Control siRNA MAP1S

No Treatment

Treatment

131

MitoTracker

e c

ns **

e p

8 ns **

m o

s 6

p o

t 4

r 2

m u

N 0 t t C C S S

______Figure 4.12 Detection of mitophagy activity in H9C2 cells after autophagy stimulation. A) Representative images of mitochondria in H9C2 cells after autophagy stimulation by 5mM rapamycin and 3mM chloroquine. Mitochondria were stained red with the MitoTracker probe, DAPI used to stain the nuclei blue and LC3-GFP adenovirus transfection was used to monitor autophagosome formation. The green puncta represent autophagosoms and yellow dots represent mitophagy. B) H9C2 cells showed more mitophagy after autophagy stimulation in MAP1S siRNA infected cells compared to control cells (control + treatment: 2.1±0.045 versus siRNA + treatment: 6.25±0.56 fold change; p=0.0041). Results shown as mean ± SEM; P** < 0.01; N= 3

Treatment = Treatment with rapamycin and chloroquine), Control = H9C2 cells transfected with control siRNA, siRNA = H9C2 cells transfected with MAP1S siRNA.

132

4.5 Discussion:

As autophagy is an important process that is involved in several pathological processes as well as in normal physiological conditions, it is important to investigate the influence of this process on the hypertrophy response. Autophagy is a complicated process which could be selective for specific organelles, such as mitochondria (mitophagy), which is an indicator of damaged mitochondria (Glick et al., 2010). The theory in this study proposes that MAP1S is involved in autophagy and that it could also be involved in a specific form of autophagy (mitophagy). Previous studies have suggested that MAP1S regulates autophagy stimulated in mouse liver cells. MAP1S encourages autophagy to suppress tumours by removing dysfunctional cell components and decreasing genome instability (Liu et al., 2012). Three markers were used to investigate the impact of the genetic ablation of the MAP1S gene on the autophagy flux in hypertrophy-induced mice. The first marker is the LC3 antibody, which is used to evaluate the level of LC3-I and LC3-II expression in protein extracted from mice hearts after hypertrophy induction by TAC. The conversion of LC3-I to LC3-II is a sign of autophagosomes formation, and a high level of LC3-II is an indicator of autophagy activity. Results obtained from this study indicate that LC3-I expression in wild type mice is significantly higher than in MAP1S knockout mice in response to TAC. Also, the expression of LC3-II in response to TAC was higher in wild type mice compared to MAP1S knockout mice. While this increase was not significant, it did follow the same trend as LC3-I. This finding suggests that MAP1S knockout reduced autophagic process in TAC stimulated hearts in mice. The second autophagy marker used in this study was the Beclin-1 antibody, which is an essential protein for the autophagy induction stage. The increase in Beclin-1 protein expression is an indicator of the activity of autophagy, specifically at the induction stage. In this study, the level of Beclin-1 in mice after TAC did not show any significant changes, however a slight increase was observed in wild type mice compared to MAP1S knockout mice. This finding suggests that the influence of MAP1S is not related the induction step of autophagy process. The third marker for autophagy used in this study was the P62 antibody, which detects autophagy activity at the degradation stage. Defective autophagy leads to an accumulation of the P62 protein as a result of the incomplete autophagy process. The result obtained in this study did not show any significant changes in mice hearts after

133

TAC. However, there is a trend towards an increase of P62 protein in knockout mice as indicator of low autophagy activity, either before or after TAC, compared to wild type Sham mice. The explanation for this finding is that MAP1S genetic ablation has a direct effect on LC3-I as well as LC3-II and that the conversion from LC3-I to LC3- II is required for autophagosome formation. However, the level of autophagy in this study was measured in the mice after two weeks of TAC, while the autophagy activity occurs between 2 to 12 hours after the autophagy stimulation and after 12 hours the autophagy activity starts to decrease (Shirakabe et al., 2016). To validate the findings from the mice hearts after TAC, the cardio myoblast cell line H9C2 was used with autophagy stimulation by rapamycin and chloroquine, while siRNA transfection was used to reduce MAP1S expression. Also, LC3-GFP adenovirus transduction was used to detect autophagy activity in H9C2 cells. The results showed that the rapamycin and chloroquine treatment induced autophagy into the H9C2 cells. The control transfected cells showed a slight increase in the autophagy level; however, no significant differences were observed from this result. The explanation of this finding is that knockout the MAP1S gene has a clear effect on MAP1S at the level of autophagy as showed in the MAP1S mic knockout mice, while knock down MAP1S by siRNA in H9C2 cells is insufficient to show the influence of the MAP1S protein on the autophagy process. An explanation of this observation is that the reduction in MAP1S achieved siRNA was only 40%, which is partial ablation of MAP1S, while the MAP1S ablation in the mice is a global gene knock out, so the influence of MAP1S is more obvious in the results obtained from the MAP1S knockout mice. The ceramide is sphingolipid known as pro-apoptotic and acts as an autophagy inducer by downregulating the autophagy inhibitor mTOR (Zhu et al., 2014). In this study the C2-ceramidewas used to stimulate the autophagy in H9C2 cells together with chloroquine, and the results followed the same trend as the rapamycin and chloroquine treatment, namely a slight increase in the control siRNA transfected cells compared to MAP1S siRNA transfected cells, but this was not significant.

As the level of autophagy was also detected in H9C2, the hypertrophy response in H9C2 cells was observed after hypertrophy stimulation using PE treatment. A calculation of the mean of cell size and the level of BNP expression was performed to

134 investigate the effect of the MAP1S knock down on the hypertrophy response in H9C2 cells. The Luciferase Reporter Assay was used to evaluate the expression of the hypertrophy marker BNP. The results showed a significant increase in BNP expression in the control siRNA transfected cells compared to MAP1S siRNA transfected cells after PE treatment. This finding suggests that knockdown MAP1S in H9C2 cells reduces the hypertrophy response, and the reduced BNP expression is evidence that MAP1S regulates the hypertrophy response. This finding confirms the finding from chapter 4, namely that MAP1S reduces the expression of BNP in mice hearts after hypertrophy induced by TAC. Also, the calculation of cell size was performed after treatment with PE to study the role of MAP1S in the hypertrophy response in a cellular model. The analysis of H9C2 cell size after treatment with PE showed that there are no significant changes in the cell size between the control and MAP1S siRNA transfected cells. The explanation for this is PE known as a cell death inducer (Xue et al., 2014), which might cause the loss of the cells that respond to PE and measurement not include the cells that increased the size because of lose them in coverslip washing steps. MAP1S has a clear influence in autophagy regulation; however, this influence needs to be confirmed using adult mouse cardiomyocytes cell line, as some markers show the same trend yet without significant values. Although MAP1S is involved in autophagy, this involvement appears to be specific to mitochondria-selective autophagy. Mitochondria autophagy (mitophagy) is the form of autophagy in which MAP1S is expected to regulate the hypertrophy response. MitoTracker was used to stain mitochondria in the H9C2 cells to detect damage and the fusion with autophagosomes. The images from this experiment show more damaged mitochondria in the MAP1S siRNA transfected cells and more fusion with autophagosomes, as an indicator of a high level of mitophagy. This finding suggests that MAP1S genetic ablation causes damage to mitochondria, could be a source of cell stress.

135

4.6 Conclusion:

The importance of MAP1S in regulating pathology through autophagy was reported in cancer induced in mice livers. This role is expected to exist in other pathologies, such as pathological cardiac hypertrophy. In this study, MAP1S was investigated in cardiac hypertrophy induced mice to identify the role of MAP1S in cardiac remodelling. The results from chapter 3 illustrate that MAP1S plays a role in the hypertrophy response and the cardiac hypertrophy was reduced in MAP1S-depleted mice. The mechanism of the reduction of the hypertrophy response is expected to be through the downregulation of autophagy in MAP1S knockout mice. This chapter tried to detect the autophagy level in MAP1S-depleted mice after TAC to determine whether the reduction in the hypertrophy response is related to autophagy downregulation. The reduction in the expression of LC3-1 and LC3-II is one piece of evidence of the influence of MAP1S in the regulation of autophagy. This finding explains the reduction in the hypertrophy response in MAP1S knockout mice. However, there are changes in the expression of other autophagy markers, Beclin-1 and P62/SQSTM1 proteins, but these are not significant. Also, Mitotraker staining showed that the role of MAP1S in autophagy is more specific to mitochondria autophagy (mitophagy). From the finding in this chapter, it is suggested that MAP1S regulates the hypertrophy response through autophagy, and the MAP1S influence on this process is expected to be an interaction with LC3-I and LC3-II.

4.7 Study limitation

Some autophagy markers showed a significant downregulation of autophagy in MAP1S-depleted mice, while others did not show any clear changes, which mean the role of MAP1S is specific in part or at a stage of this process. To find the exact step or molecules that are affected by MAP1S ablation, it is important to conduct a comprehensive investigation to screen all autophagy proteins to identify at which stage of the process the effect of MAP1S ablation occurs. Also, to validate the finding of this study, it is important use another cell lines. Furthermore, it is possible to stimulate the autophagy flux in the cellular model using another method to induce autophagy, such as starvation, to validate the findings in this study. Finally, as previous study reported that the highest level of autophagy activity in the first 2 hours for up to 12 hours after TAC it is more accurate to detect the autophagy changes as a result of

136

MAP1S ablation within this period of TAC or to detect the autophagy over gradual time after TAC from the first hour up to 14 days.

137

Chapter 5

138

5. Initial study to identify novel signalling pathways regulated by MAP1S 5.1 Introduction

The study described in this chapter was designed to identify novel mechanism on how the MAP1S protein regulates the cardiac hypertrophy response and through which pathway this regulation occurs. Several studies have reported MAP1S influence in numerous pathology developments, but little is known about the mechanism underlying the process. The two previous chapters of this thesis showed the role of MAP1S in the development of cardiac hypertrophy and suggested that this process might be through regulation of autophagy. Since the role of MAP1S in the heart is relatively unknown this chapter investigates the possible novel pathways that might be regulated by MAP1S during the development of cardiac hypertrophy. Recent studies have shown that the MAP1S protein can regulate other pathways in several pathological conditions. In addition to autophagy, MAP1S plays a role in the development of fibrosis and the inflammation response. Also, apoptosis, which is a form of cell death, is also suggested to be regulated by MAP1S ( Xu et al., 2016; Zou et al., 2008., Bai et al., 2017).

A previous study has reported that genetic ablation of MAP1S plays a role in the development of fibrosis in kidney. The finding of the study is that defective autophagy, as a result of MAP1S ablation, leads to an accumulation of fibronectin, which increases the renal fibrosis in mice (Xu et al., 2016). Another study reported the influence of MAP1S on the pro-inflammatory mediator interleukin-1 (IL-6) signalling pathway. The finding in this study is that MAP1S knockdown leads to the inhibition of the IL-6 signalling pathway by downregulating the signal transducer and activator of transcription 3 (STAT3) activity through a specific interaction with the suppressor of cytokine signalling 3 (SOCS3) (Zou et al., 2008). Also, a recent study has shown the role of MAP1S in regulating apoptosis. This study has suggested that the upregulation of MAP1S in intestinal epithelial cells during the development of Crohn's disease (inflammatory bowel disease) inhibits apoptosis, specifically the expression of the active-caspase 3 via the stem cell pluripotency regulator Wnt/b-catenin signalling pathway (Bai et al., 2017).

139

According to the evidence described in the chapters 3 and 4 of this thesis and the findings from the previous studies, the ablation of MAP1S is expected to regulate other pathways in addition to the regulation of autophagy. This chapter will explore this possibility.

140

5.2.1 Hypothesis:

MAP1S may regulate other signalling pathway in the heart such as the inflammation or apoptosis pathway that in turn will contribute to the regulation of cardiac hypertrophy.

5.2.2 Aims:

1- To investigate signalling pathways that might be regulated by MAP1S ablation in the setting of cardiac hypertrophy induced by TAC.

141

5.3 Results

5.3.1 Investigation of signalling pathways regulated by MAP1S in cardiac hypertrophy

In order to investigate the effect of MAP1S ablation on other signalling pathways, the PathScan Intracellular Signalling Array (Cell Signalling) was used. This array slide was used to detect 18 phosphorylated signalling molecules simultaneously in the same protein sample. The slide contains duplicates of target-specific captured antibodies. All phosphorylated proteins scanned in this experiment are shown in table 5.1 A. This slide enables the running of 16 protein samples from mice, whereby five wild type after TAC, five MAP1S knockout after TAC, three wild type sham, and three MAP1S knockout sham were examined. In this experiment different pathways were analysed to detect any changes in the regulation of any molecule in this pathways as a result of MAP1S ablation in the mice after TAC. The analysis showed strong signals of two signalling molecules, namely STAT3 and BAD. STAT3 is involved in inflammation and hypertrophic growth, while BAD is a pro-apoptotic protein.

As shown in Figure 5.2 A, signal density analysis showed a significant increase in the level of phosphorylated STAT3 in MAP1S knockout mice sham compared to wild type sham mice (WT Sham: 0.66 ± 0.3 versus KO Sham: 1.63 ± 0.15 fold change, p= 0.033). Also, there was a trend of increase level of phospho-STAT3 in wild type mice after TAC compared to WT-sham mice (WT TAC: 1.4 ± 0.299 versus WT Sham: 0.66 ± 0.3 fold change, p=ns). Meanwhile, MAP1S knockout mice showed less expression of phosphorylated STAT3 after TAC, but this was not significant (KO TAC: 0.99 ± 0.1 versus KO Sham: 1.63 ± 0.15 fold change, p=ns). Finally, knockout mice after TAC display lower phosphorylated STAT3 expression compared to wild type mice after TAC but this was not statistically significant (WT TAC: 1.4 ± 0.299 versus KO TAC: 0.99 ± 0.1 fold change, p=ns).

In Figure 5.2 B signal density analysis of the phosphorylated BAD expression showed no significant difference in all four groups of mice. There was no significant change between wild type and MAP1S knockout mice when there was no hypertrophy induction by TAC (WT Sham: 1 ± 0.125 versus KO Sham: 1.124± 0.135 fold change, p=ns). Also, wild type mice did not show any increase in phosphorylated BAD after TAC (WT TAC: 1.104 ± 0.145 versus WT Sham: 1 ± 0.125 fold change, p=ns).

142

Meanwhile, MAP1S knockout mice showed a slight increase after TAC but this is not statistically significant (KO TAC: 1.33 ± 0.1 versus KO Sham: 1.124 ± 0.13 fold change, p=ns). Finally, by comparing wild type TAC to MAP1S knockout TAC mice, a slight increase but not significant in phosphorylated BAD expression was detected in knockout TAC mice (WT TAC: 1.014 ± 0.145 versus KO TAC: 1.33 ± 0.1 fold change, p=ns).

143

______

Figure 5.1: Analysis of the PathScan Intracellular Signalling Array. A) The table lists the antibodies that were scanned in the protein samples for all mice groups. B) The diagram shows the antibodies’ position on the slide as each number refers to a specific antibody in the table. C) Presentative images of each group illustrate the positive control expression in the samples and the phosphorylated STAT3 and phosphorylated BAD expression. N=3-5

STAT3 ns ns

l 2.0 * ns

o Sham

r t

n TAC

o 1.5

S V

1.0

g n

a 0.5

d l

o 0.0 f WT MAP1S-/-

144

BAD ns ns ns ns

l 1.5 o

r Sham

t n

o TAC

. 1.0

e g

n 0.5

d l

o 0.0 f WT MAP1S-/-

______

Figure 5.2: The analysis of phosphorylated STAT3 and phosphorylated BAD expression from the PathScan Array. A) The expression of phosphorylated STAT3 was detected as high in wild type TAC mice and MAP1S knockout sham mice as compared to control (wild type sham) expression. B) The expression of phosphorylated BAD showed a slight increase in MAP1S knockout mice after TAC, but this was not significant. N=3-5

145

5.3.2 Western blot analysis on the expression of STAT3 and BAD in pressure overload hypertrophy mice

In order to confirm the results obtained from PathScan Antibody array, in particular for the analysis of STAT3 and BAD expressions, western blot analysis was used. The western blot will provide a more accurate analysis for the changes in STAT3 and BAD expression.

The western blot analysis for phosphorylated STAT3 in the mice showed a trend of increase phospho/total-STAT3 level in knockout sham mice compared to wild type sham mice, but this was statistically not significant (WT Sham: 0.8 ± 0.25 versus KO Sham: 1.58± 0.46 fold change, p=ns). Meanwhile, the wild type mice after TAC did not show any significant changes compared to the wild type sham mice (WT TAC: 0.9 ± 0.194 versus WT Sham: 0.87 ± 0.25 fold change, p=ns). Finally, there was no difference in the level of phosphorylated STAT3 after TAC between wild type and knockout mice (WT TAC: 0.9 ± 0.194 versus KO TAC: 0.72 ± 0.24 fold change, p=ns) Figure 5.3.

Figure 5.4 shows the analysis of BAD expression using western blot. Band density analysis revealed that there was no significant difference in the expression of phosphorylated/total BAD in all groups tested.

146

P-STAT3/STAT3

ns ns

n 3 o

i ns ns Sham

s s

e TAC

r p

x 2

T S

- 1

a l

e 0 -/- R WT MAP1S

B) WT Sham WT TAC KO Sham KO TAC

Phosphorylated STAT3 ~ 79 kDa

Total STAT3 ~ 79 kDa ______

Figure 5.3: Western blot analysis of phosphorylated STAT3. A) The graph presents the expression of phosphorylated STAT3 in the mice groups normalised to GAPDH. The level of phosphorylated STAT3 was higher in knockout mice compared to wild type sham mice, but this was statistically not significant (WT Sham: 0.82 ± 0.39 versus KO Sham: 1.78± 0.49 fold change, P=0.67). B) Image of western blot bands illustrates phosphorylated STAT3 and GAPDH expression. Results shown as mean ± SEM; P; N= 5-7

147

P-BAD/beta actin

ns ns

n 3 o

i ns ns Sham

s s

e TAC

r p

x 2

B -

P 1

a l

e 0 R WT MAP1S-/-

WT Sham WT TAC KO Sham KO TAC

Phosphorylated BAD ~ 23 kDa

β-actin ~ 42 kDa

______

Figure 5.4: Western blot analysis of phosphorylated BAD. A) The graph presents the expression of phosphorylated BAD in the mice groups normalised to β-actin. No significant change was detected and the highest level of phosphorylated BAD was detected in wild type mice after TAC. Wild type TAC mice displayed higher phosphorylated BAD expression compared to wild type sham mice, but this was statistically not significant (WT TAC: 2.07 ± 0.44 versus WT Sham: 0.95 ± 0.19 fold change, P=0.29). B) Presentative image of western blot membrane illustrates bands of phosphorylated BAD and β-actin. Results shown as mean ± SEM; P; N= 5-7

148

5.3.3 The effect of MAP1S ablation on the mitochondria structure in MAP1S knockout mice after 2 weeks TAC.

MAP1S ablation altered autophagy regulation in the heart based on data presented in chapter 4 of this thesis, which confirms the findings in a previous study (Liu et al., 2012). Importantly, MAP1S knockout mice displayed abnormal mitochondria, as reported in previous study (Xie et al., 2011); therefore, it is important to investigate mitochondria structure in the hypertrophy model in mice. To examine mitochondria structure in mouse heart after TAC, transmission electron microscopy was conducted.

The analysis of the mitochondria size reveals that mitochondria size has increased in the knockout mice sham compared with wild type sham mice, but this is not statistically significant (WT Sham: 1 ± 0.07 versus KO Sham: 1.39 ± 0.03 μm2, P=0.06). The wild type mice showed a significant increase in mitochondria size in response to TAC as compared to the control sham mice (WT Sham: 1 ± 0.07 versus WT TAC: 1.45 ± 0.16 μm2, P=0.034). Meanwhile, the TAC did not increase the mitochondria size in MAP1S knockout mice compared to knockout sham mice (KO Sham: 1.39 ± 0.034 versus KO TAC: 1.22 ± 0.02 μm2, P=ns). Also, no significant difference in the mitochondria size was observed between wild type and knockout mice after TAC (WT TAC: 1.45 ± 0.16 versus KO TAC: 1.22± 0.02 μm2, P=ns) figure 5.5 B.

The quantification of mitochondria with abnormal structure showed a significant increase in the level of damaged mitochondria in the MAP1S knockout mice even without TAC (WT Sham: 8.55 ± 1.01 versus KO Sham: 27.07 ± 3.17 %, P=0.0028). Also, TAC induced more damaged mitochondria in wild type mice compared to control sham mice (WT Sham: 8.55 ± 1.01 versus WT TAC: 24.2 ± 2.03 %, P=0.0079). Further, the TAC increased the number of damaged mitochondria in MAP1S knockout compared to sham mice, but this was not significant (KO Sham: 27.07 ± 3.17 versus KO TAC: 31.12 ± 2.85 %, P=ns). Finally, knockout TAC mice displayed more damaged mitochondria than wild type TAC mice, but this was not significant (WT TAC: 24.2 ± 2.03 versus KO TAC: 31.12 ± 2.85 %, P=ns) figure 5.5 C.

149

WT Sham WT TAC

KO Sham KO TAC

150

Abnormal mitochondria

** ns % ** ns

a 40 i

r Sham d

n TAC

o 30

o t

i 20

a 10

o n

b 0 -/- A WT MAP1S

Damaged mitochondria

______-/- Figure 5.5: Mitochondria structure in MAP1S mice heart sections following 2 weeks TAC. A) Representative images of transmission electron microscopy for all groups; scale bars = 0.5μm. B) Quantification of the mitochondria size by measuring the mean of 100 mitochondria from 5-7 images for each mouse and four mice for each group were analysed. B) The percentage of abnormal mitochondria in 400-600 mitochondria from 5-7 images for each mouse. C) Representative images of abnormal mitochondria that are considered in the quantification graph. Results shown as mean ± SEM; *P <0.05; **P <0.001; N= 4.

151

5.3.4 Detection of the level of the mitophagy-related protein PINK1 -/- in MAP1S mice after two weeks TAC

PTEN-induced putative kinase 1 (PINK1) is an important protein which is linked to damaged mitochondria and to the increase of the mitophagy flux. In healthy mitochondria, PINK1 can enter the inner membrane, while in damaged mitochondria PINK1 merely accumulates on the outer membrane of the mitochondria due to the impaired membrane potential. The accumulated PINK1 phosphorylates Parkin, which induces the mitophagy induction (Narendra et al,. 2012).

______Figure 5.6: Showing how PINK1 triggers mitophagy induction. In healthy mitochondria, PINK1 is located in the inner membrane, while in the damaged mitochondria PINK1 is accumulated on the outer membrane and binds Parkin, which initiates mitophagy.

As shown in Figure 5.7, the results obtained from western blot analysis for PINK1 expression in protein samples extracted from wild type and MAP1S knockout mice showed no differences in PINK1 expression. At basal condition, the level of PINK1 showed no significant difference between WT and MAP1S KO. Meanwhile, wild type mice did not display any significant changes in the PINK1 expression after TAC compared to sham mice (WT TAC: 1.09 ± 0.067 versus WT Sham: 1 ± 0.034 fold change, P=ns). The expression of PINK1 in MAP1S knockout mice showed a decreasing trend after the induction of hypertrophy by TAC compared to knockout sham mice (KO TAC: 0.98 ± 0.18 versus KO Sham: 1.28 ± 0.175 fold change, P=ns).

152

Finally, no significant differences were found in PINK1 expression between wild type and MAP1S knockout mice after TAC (WT TAC: 1.09 ± 0.067 versus KO TAC: 0.98 ± 0.18 fold change, P=ns).

Pink1/beta actin

ns ns

n o

i 1.5

s Sham

s e

r TAC p

x 1.0

n i

P 0.5

a l

e 0.0 -/- R WT MAP1S

WT Sham WT TAC KO Sham KO TAC

Pink ~ 60 kDa

β-actin ~ 42 kDa

______Figure 5.7: Western blot analysis of PINK1 expression. A) The graph presents the expression of PINK1 in sham and TAC mice. The MAP1S knockout sham mice displayed a higher expression of PINK1 compared to wild type sham mice, but this was not significant (WT Sham: 1 ± 0.034 versus KO Sham: 1.28± 0.175 fold change, P=ns). B) Image of the western blot membrane illustrates PINK1 and β-actin expression. Results shown as mean ± SEM; P; N= 5-7.

153

5.3.5 Identification of the anti-apoptotic protein Bcl2 expression in MAP1S depleted mice after 2 weeks of pressure overload hypertrophy by TAC

As MAP1S ablation in mice induces abnormal mitochondria, the damaged mitochondria can trigger apoptosis. For a further investigation into the effect of MAP1S ablation on the apoptosis level after TAC, western blot analysis was used to evaluate the expression of anti-apoptotic protein B-cell lymphoma 2 (Bcl2). Bcl2 is localized in the mitochondria membrane and inhibits the pro- apoptotic proteins BAX and BAK. Through this inhibiting, the anti-apoptotic protein Bcl2 regulates cell death and survival (Hardwick & Soane., 2013).

Western blot analysis for Bcl2 expression in wild type and knockout mice did not show any significant change, even after TAC. Wild type mice did not display any changes after TAC compared to sham mice (WT Sham: 1 ± 0.04 versus KO Sham: 0.76± 0.1 fold change, P=ns). Meanwhile, MAP1S knockout mice showed a slight increase but not significant in Bcl2 expression after TAC compared to MAP1S knockout sham mice (KO TAC: 0.95 ± 0.15 versus KO Sham: 0.76± 0.1 fold change, P= ns) Figure 5.8.

Bcl2/beta actin

n ns ns o

i 1.5 s

s ns ns Sham e

r TAC p

x 1.0

c B

0.5

a l

e 0.0 R WT MAP1S-/-

154

WT Sham WT TAC KO Sham KO TAC

Bcl2 ~ 26 kDa

β-actin ~ 42 kDa

______

Figure 5.8: Western blot analysis of Bcl2 expression. A) The graph demonstrates that no significant difference in the level of Bcl2 was observed. However, the graph analysis shows an increasing trend but not significant in MAP1S knockout mice after TAC compared to knockout sham mice (KO TAC: 0.95 ± 0.15 versus KO Sham: 0.76± 0.1 fold change, P=ns). B) Image of the western blot bands illustrates the expression of Bcl2 and β-actin. Results shown as mean ± SEM; P; N= 5-7.

5.3.6 Identification of the pro-apoptotic protein BAX expression in MAP1S depleted mice after 2 weeks of pressure overload hypertrophy by TAC

For more investigation of the role of MAP1S in apoptosis in hypertrophy induced mice, an evaluation of BAX expression was performed. BAX is a pro-apoptotic protein and one of the Bcl2 family proteins and plays a role in the cell as an apoptosis activator. In addition to apoptosis, BAX translocation in mitochondria also can lead to mitochondria dysfunction during apoptosis response (Gross et al., 1998).

Generally, no significant changes were observed in BAX expression. However, western blot analysis revealed that there was a slight decrease in BAX expression after TAC in wild type and MAP1S knock out mice. Wild type mice displayed a reduction in BAX expression after TAC compared to wild type sham mice (WT TAC: 0.733 ± 0.11 versus WT Sham: 1 ± 0.052 fold change, P=ns). Also, MAP1S knockout mice displayed a slight reduction in BAX expression (KO TAC: 0.69 ± 0.09 versus KO Sham: 0.89 ± 0.032 fold change, P=ns) Figure 5. 9.

155

BAX/GAPDH

n 1.5 ns ns o

i Sham

s ns ns

s TAC

e r

p 1.0

X A

B 0.5

a l

e 0.0 R WT MAP1S-/-

WT Sham WT TAC KO Sham KO TAC

BAX ~ 21 kDa

GAPDH ~ 37 kDa

______-/- Figure 5.9: BAX expression in MAP1S mice after two weeks TAC. A) The graph presents the western blot analysis of BAX expression normalized to GAPDH. The graph shows that wild type mice displayed a slight decrease in BAX expression after TAC compared to sham mice (WT TAC: 0.733 ± 0.11 versus WT Sham: 1 ± 0.052 fold change, P=ns). Also, the knockout mice showed a reduction in BAX expression, but this was not statistically significant (KO TAC: 0.69 ± 0.09 versus KO Sham: 0.89 ± 0.032 fold change, P= ns). Results shown as mean ± SEM; P; N= 5-7.

156

-/- 5.3.7 Analysis of IL-6 expression in MAP1S mice after pressure overload hypertrophy

Inflammation is one of the processes that accompany the hypertrophy response. Since MAP1S has been associated with IL-6 expression, it is important to analyse IL-6 expression in MAP1S knockout mice after TAC.

Western blot analysis revealed that there was no significant change in IL-6 expression in all of the groups tested.

IL-6/beta actin

ns ns n

o 2.0 i ns ns

s Sham s

e TAC

r 1.5

6 1.0

v 0.5

a l

e 0.0 R WT MAP1S-/-

157

WT Sham WT TAC KO Sham KO TAC

IL-6 ~ 21 kDa

β-actin ~ 42 kDa

-/- Figure 5.10: Western blot analysis of IL-6 expression in MAP1S after 2 weeks TAC. A) The graph shows the increase of IL-6 expression in the wild type mice after TAC; however, this is not significant (WT TAC: 1.32 ± 0.18 versus WT Sham: 1 ± 0.18 fold change, P=ns). Meanwhile, there was no significant change in IL-6 between wild type and knockout mice after TAC (WT TAC: 1.32 ± 0.18 versus KO TAC: 1.29 ± 0.15 fold change, P=ns). B) Western blot images present the IL-6 and the control β-actin protein bands for all mice groups. Results shown as mean ± SEM; P; N= 5-7.

158

5.4 Discussion

This chapter of the thesis aims to determine any potential interactions of MAP1S with other signalling pathways, with an emphasis on pathways that are involved in the hypertrophy response. In chapter 3, clear evidence illustrated that MAP1S regulates the pressure overload-induced hypertrophy in mice. The genetic ablation of MAP1S reduced the hypertrophy response, as indicated by heart weight, cell size and the expression of hypertrophy marker BNP. In chapter 4, the finding was that MAP1S ablation reduces the autophagy response, specifically at the LC3-I to LC3-II conversion step, which is an important stage for autophagosome formation. This chapter of the study continues to investigate any potential pathways that are regulated as a result of MAP1S knockout in pressure overload hypertrophy in mice. To obtain comprehensive results and to understand the role of MAP1S in cardiac hypertrophy regulation, the experiments in this chapter were built upon the findings in the previous two chapters.

In this chapter, the Pathscan array experiment was used to examine the activation of several signalling pathways in hypertrophy-induced mice by analysing the level of phosphorylated proteins. This array detected 18 signalling molecules, as shown in figure 5.1 A, which are involved in several pathological pathways, including cardiac hypertrophy and cancer pathways.

The results showed change in phosphorylated STAT3 and phosphorylated BAD expression in the hypertrophy-induced mice. However, the quantification indicates that this change is not statistically significant. The signal transducer and activator of transcription 3 (STAT3) is a protein that plays a role in the induction of inflammation and which is activated in response to interleukin 6 (IL-6) release; also, this protein is a transcriptional activator that is required for proliferation (Levy & Lee., 2002). The finding was a slight increase of P-STAT3 in the knockout sham mice, but the knockout TAC mice showed no change. This finding was confirmed by western blot analysis and the results show the same trend of a slight increase in the knockout sham mice without any significant change.

The second molecule detected in the hypertrophy-induced mice was P-BAD. Bcl-2- associated death promoter (BAD) is a pro-apoptotic protein in non- phosphorylated form which inhibits the anti-apoptotic BCL-x, Bcl-2, and this

159 inhibition triggers the pro-apoptosis proteins BAX and BAK to initiate apoptosis, while when BAD is phosphorylated it inhibits apoptosis (Peso et al., 1997). Again, this change was not statistically significant, which was confirmed by western blot analysis. The finding was a slight increase of P-BAD in the wild type TAC mice, but this did not reach the level of significance.

-/- Also, the apoptosis regulators Bcl2 and BAX were examined in MAP1S mice to determine whether MAP1S ablation induces more cell death in the mice as this ablation leads to a defect in the autophagy process; this, in turn, leads to an accumulation of the damaged proteins and organelles, which is considered a source of cell stress that initiates apoptosis. The western blot analysis for the anti-apoptotic Bcl2 and the pro-apoptotic BAX did not show any significant response to the MAP1S ablation; this finding suggests that MAP1S ablation does not induce changes in the apoptosis signalling pathway in hypertrophy-induced mice or the hypertrophy response as 2 weeks of TAC is not enough to see significant changes in the expression of apoptosis signalling pathway proteins.

However, apoptosis is a cell death response to stress or is at the basal level in the cell during the normal cell cycle, although there is another form of cell death, namely necrosis, which is mostly related to pathological conditions and diseases. MAP1S ablation might be involved in this form of cell death; this requires further -/- investigations into MAP1S mice and cellular models using MAP1S siRNA.

To continue investigating the role of MAP1S ablation in mice after TAC, it was -/- important to study the structure of mitochondria in MAP1S mice. The damaged mitochondria influence the phosphorylation of STAT3 and play a key role in initiating cell death (Meier et al., 2017; Tait & Green., 2013). Images obtained from transmission -/- electron microscopy showed more damaged mitochondria in MAP1S mice. The -/- result suggests that there are more damaged mitochondria in MAP1S mice, regardless of whether sham or TAC, compared to wild type sham mice. This finding confirms a previous presented study which suggested that MAP1S ablation in mice causes an accumulation of damaged mitochondria in cardiomyocytes (Xie et al., 2011). These dysfunctional mitochondria are expected to increase the mitophagy level in -/- MAP1S mice to remove the damaged mitochondria. For further investigation to

160 determine whether MAP1S ablation influences the mitophagy response, western blot analysis for PINK1 expression was performed. PINK1 is an essential protein which induces the mitophagy induction through Parkin phosphorylation (Narendra et al., 2012).

The mitophagy-related protein PINK1 expression showed no significant differences between the wild type and MAP1S knockout mice, both basally and after TAC. As an explanation for this finding, MAP1S genetic ablation causes defects in the general autophagy process which lead to the accumulation of damaged mitochondria rather than degradation by mitophagy.

For further investigation to determine the effect of MAP1S ablation on inflammation, -/- the pro-inflammatory cytokine interleukin 6 (IL-6) was examined in MAP1S mice. IL-6 is produced by T cells as an immune reaction in the induction of inflammation (Tanaka et al., 2014). In general, there were no significant changes in the level of IL- -/- 6 expression; however, there is a trend of a slight increase in the MAP1S wild type mice compared to sham mice. This finding suggests that MAP1S does not interact with the pathways signalling molecules that were detected in this study; however, it is possible that it interacts with other pathways, which requires further investigation.

5.5 Conclusion The genetic ablation of MAP1S induces damaged mitochondria in mice. Apoptotic cell death is a response related to the accumulation of dysfunctional mitochondria, but the results presented here did not show an alteration of apoptosis markers in the mice after hypertrophy induction by 2 weeks TAC. Also, the inflammation marker IL-6 did not show any influence of MAP1S ablation on the inflammation response. The Pathscan experiment detected several signalling molecules that are involved in different pathways, such as MAPK/Erk cascade, p38 and JNK MAPKs, Stat1 and Stat3, AMPK, Akt, and Caspase-3. MAP1S ablation did not show any significant influence in these molecules and pathways, which means that further investigations are required into more pathways that might be regulated by MAP1S to provide a clearer explanation of how the genetic ablation of MAP1S reduces the hypertrophy response, which is the finding in the first chapter of this study.

161

General Discussion

162

6 General Discussion

Heart failure (HF) is one of the main health problems and leading causes of morbidity and mortality in the UK and worldwide. The normal heart adapts to stress in different ways, and cardiac hypertrophy is one of the heart’s main responses to pressure overload. The heart adapts to the increased workload by increasing its size and pumping capacity. However, in pathological conditions this may lead to the development of heart failure (Griffiths et al., 2014)

The major objective of this study was to find possible pathways that can control the pathologic cardiac hypertrophy response by examining signalling molecules that may be involved in the hypertrophy response. Tumour suppressors are potential proteins that are involved in the hypertrophy response. For example, the tumour suppressor Ras-association domain family protein 1A (RASSF1A) has been identified as a cardiac hypertrophy inhibitor by inhibiting the pro-hypertrophic Raf1-ERK1/2 pathway (Oceandy et al., 2009). MAP1S is a primary interacting molecule of RASSF1A, which encourages the autophagy to inhibit the development of tumorigenesis by eliminating damaged organelles and proteins (Xie et al., 2011) also has been shown to have tumour suppressor activity as well (Liu et al., 2012). Based on this knowledge, I hypothesized that MAP1S may play a role in cardiac hypertrophy. This project aims to identify the role of MAP1S in the development of cardiac remodelling and specifically, in the response to pathological cardiac pressure overload. To achieve this gaol, molecular analysis was carried out on MAP1S-ablated mice after inducing pressure overload through TAC for 2 weeks. Furthermore, in vitro analysis using H9C2 cells after MAP1S knockdown by siRNA was used to validate the findings. The data showed evidence that MAP1S plays a role in the development of cardiac hypertrophy. In addition, the data showed an association between MAP1S ablation and the level of autophagy which is disrupted as a result of the MAP1S ablation. Also, the results showed an association between MAP1S ablation and the changes to the mitochondria structure.

163

6.1 The genetic ablation of MAP1S reduces the hypertrophy response in mice after 2 weeks TAC

First evidence of the role of MAP1S in the development of cardiac hypertrophy was the HW/TL ratio. The HW/TL ratio was significantly higher in the wild type mice compared to MAP1S-ablated mice, which means that the MAP1S ablation reduced the hypertrophy response after TAC. The cardiomyocyte cross-sectional area analysis consistently showed that wild type mice had larger cardiomyocytes than MAP1S knockout mice in response to 2 weeks’ TAC, which is further evidence of the effect of MAP1S ablation on the hypertrophy response. Further investigation into the gene expression level hypertrophic marker BNP supported the previous finding and showed less expression in MAP1S-ablated mice. Expression of ANP was also reduced in knockout mice, although it did not reach statistical significance, possibly due to the low n number.

Furthermore, MAP1S showed an influence on the development of the fibrosis which accompanies the hypertrophy response. The ablation of MAP1S reduces the accumulation of cardiac fibrosis in response to TAC. Masson's trichrome staining of the hypertrophy induced mice revealed that the development of fibrosis after TAC was reduced in MAP1S−/− mice. Previous studies have also reported that MAP1S ablation increases the renal fibrosis in mice (Xu et al., 2016). However, the gene expression for COL1A1 and COL3A1, the fibrosis markers in this study, did not display any significant differences between wild type and knockout mice after TAC, although there was a trend towards reduction in the MAP1S−/− mice. Again, the 2 weeks’ TAC as a short-term hypertrophy response might not have been enough to show significant changes in the expression of the fibrosis marker.

Generally, the obtained data indicate that the hypertrophic response in the wild type mice is greater than in the MAP1S knockout mice.

6.2 The genetic ablation of MAP1S does not influence the heart function in hypertrophy induced mice

Although the genetic ablation of MAP1S reduced the hypertrophy response induced by TAC, the change in the cardiac function was indistinguishable in the mice. Both the MAP1S-/- and wild type mice did not show any changes to the heart function in

164 response to TAC. The result showed no significant changes in the ejection fraction (EF) and fractional shortening (FS) values after TAC. This finding suggests that MAP1S has no direct influence on the heart function. A further explanation could be that the MAP1S effect is indistinguishable because the mice were assessed by echocardiography under anaesthesia, which supresses the heartbeat and blood circulation, making the detection of the changes unobservable. Also, another explanation is that 2 weeks of TAC is not enough to induce changes in the mice heart function. Moreover, the analysis of other echocardiography results, including the chamber size and the wall thickness parameters, did not show any significant changes.

6.3 MAP1S regulates the autophagy process in hypertrophy induced mice

MAP1S is known as a tumour suppressor which interacts with several proteins and signalling pathways that are important in the regulation of cell growth. MAP1S interacts with RASSF1A and leucine-rich PPR motif-containing protein (LRPPRC) in the development of tumours. MAP1S bridges autophagosomes and healthy mitochondria to microtubules for trafficking and binds the dysfunctional mitochondria through LRPPRC to transfer dysfunctional mitochondria into autophagosomes via interactions with LC3-II. Moreover, MAP1S interacts with the mitophagy-related proteins PARKIN and PINK1 (Liu et al., 2012; Xie et al., 2011). The results of this study confirm that MAP1S is an autophagy regulator. The level of the autophagy markers LC3-I and LC3-II was reduced in the MAP1S−/− mice after TAC, which is an autophagy inducer (Shirakabe et al., 2016). This finding confirms the fact that MAP1S ablation reduces the autophagy activity and it is related to interaction with the autophagy-related protein LC3 (Xie et al., 2011). The LC3-I conversion to LC3-II is an important step in autophagosome formation during the autophagy process. Recent study reported that TAC induces the autophagy activation which is protective mechanism against the pressure overloud and the downregulation of autophagy lead to mitochondrial dysfunction and HF (Shirakabe et al., 2016). The finding in our study confirms that autophagy response to pressure overloud by TAC but the MAP1S ablation reduced this response. Also, this reduction companied by mitochondrial dysfunction was confirmed in our study, but the development of HF need more investigation.

165

Using other autophagy markers, Beclin-1 and p62/SQSTM1, in the hypertrophy induced mice in this study did not show any significant changes. These two autophagy markers detect the autophagy activity at different stages of the process. The increase in Beclin-1 level is an indicator of the initiation stage of autophagy (Kang et al., 2011). Meanwhile, the P62 accumulation is an indicator for the degradation stage of the autophagy process (Bjørkøy et al., 2005). The findings in this study suggest that MAP1S has no influence on these autophagy related proteins and the role of MAP1S is expected to be in the autophagosomes formation stage through interaction with the autophagy related protein LC3.

6.4 In vitro analysis confirms MAP1S knockdown in the mice reduces the hypertrophy response

The cardiomyoblast H9C2 cell was used in this study to validate the findings from the in vivo results. Phenylephrine (PE) was used to induce the hypertrophy response in H9C2 cells, and MAP1S siRNA was used to knock down the MAP1S gene in the cells. PE is an alpha-1 adrenergic agonist which is known to induce hypertrophy phenotype in the cellular model (King et al., 1998). The siRNA reduced the MAP1S expression in H9C2 cells by around 30-40%, which was confirmed by western blot analysis.

Using a luciferase reporter assay to detect the BNP expression in the H9C2 cells after hypertrophy induction by PE treatment showed that the MAP1S knockdown reduced the BNP expression. The BNP expression was reduced significantly in the MAP1S siRNA transfected cells compared to control siRNA transfected cells, which confirms the finding in the hypertrophy induced mice.

6.5 The autophagy response in H9C2 after autophagy stimulation In this study the autophagy response was detected in H9C2 cells using GFP-LC3 adenovirus transfection, which labels the autophagosomes with a green colour as an indicator of autophagy activity. For the autophagy stimulation, rapamycin and chloroquine were used. The results did not show any significant changes between MAP1S siRNA transfected cells and the control siRNA transfected cells in the autophagy activity. Also, using another autophagy inducer, C2-ceramide, did not show any significant change. This finding indicates that MAP1S does not have any influence in

166 the autophagy activity in H9C2. This suggests that H9C2 might not be the right cell model to detect the autophagy flux or because the knockdown of the MAP1S gene using siRNA is not enough to produce the effect as the MAP1S siRNA reduces the expression of MAP1S by only 30-40%.

6.6 The genetic ablation of MAP1S did not show any changes in the regulation of apoptosis cell death and inflammation in hypertrophy induced mice

Previous studies have shown that MAP1S can interfere with different pathways and interacts with signalling molecules. In addition to the regulation of cell growth in the setting of cancer development, MAP1S has a role in pathological processes such as inﬂammation. The pro-hypertrophic cytokine IL-6 can stimulate STAT1 and STAT3 activity, while the SOCS3 protein is an inhibitor of STATs and a potential down- regulator of the IL-6 pathways. MAP1S is an interacting protein of SOCS3, which can increase its translocation and change its localization from the nucleus to the cytoplasm in the cell. Moreover, SOCS3 is an inhibitor of STAT3; however, in a MAP1S deﬁcient macrophage, this inhibition has been found to be delayed (Zou et al., 2008). Also, MAP1S upregulation in intestinal epithelial cells inhibits apoptosis through the Wnt/b-catenin signalling pathway (Bai et al., 2017). in order to find a novel interacting molecule with MAP1S during the development of cardiac hypertrophy, the antibody array was used to detect 18 phosphorylated signalling molecules, which are shown in the table figure 5.3.1 A in chapter 5. However, two phosphorylated proteins, p-STAT3 and p-BAD, showed a slight increase in MAP1S−/− mice, although the quantification showed this change to be not significant. The western blot, as a reliable technique for the quantification, was used to evaluate the expression of these two proteins but the results were still not significant.

From this finding it can be seen that the results from this study show no association between MAP1S and these 18 phosphorylated signalling molecules in hypertrophy induced mice and more signalling molecules that might interact with MAP1S need to be studied.

167

6.7 MAP1S ablation causes mitochondria damage in TAC-induced mice

The mitochondria are important organelles in cardiac muscles cells as the energy demand is high. Not only are mitochondria a source of energy, damage to these organelles can also lead to the initiation of other pathways such as cell death (Tait & Green., 2013).

In this study the mitochondria structure in TAC-induced mice was analysed using -/- transmission electron microscopy. MAP1S mice showed more mitochondria structure abnormalities, specifically after the hypertrophy response. This finding suggests that MAP1S might convert the hypertrophy response to heart failure as a result of a lack of energy; however, this requires further investigation. This finding is consistent with a previous study that reported the accumulation of damaged mitochondria as a result of MAP1S ablation in mice (Xie et al., 2011). Also, the structure of mitochondria was investigated in H9C2 after MAP1S knockdown using siRNA. The result showed more fusion between the mitochondria fragments and GFP- LC3 labelled autophagosomes, suggesting more damaged mitochondria, which potentially increases the mitophagy level. To detect the mitophagy level the expression level of Pink1 was performed using western blot analysis. Pink1 induces the mitophagy initiation by phosphorylating Parkin (Narendra et al., 2012). In the hypertrophy induced mice, no change in the mitophagy level was found. The explanation for this although MAP1S ablation cause mitochondria damage but this ablation also defects the general autophagy process including mitophagy.

6.8 CONCLUSION

There is clear evidence showing that MAP1S plays a role in the regulation of pressure overload cardiac hypertrophy. MAP1S is involved in the hypertrophy response and the ablation of this protein, which reduces the hypertrophy response in hypertrophy induced mice. Autophagy is a possible process causing this reduction in the hypertrophy response, and the MAP1S involved in this regulation as well as the mechanism require further investigation. Also, MAP1S is an essential molecule for mitochondria stability and MAP1S ablation causes mitochondria abnormalities in the structure and might include the function. This mitochondria abnormality might initiate other signalling pathway, such as apoptosis and inflammation, but in the hypertrophy

168 response there was no significant change in these pathways in the short hypertrophy response induced by 2 weeks of TAC.

6.9 STUDY LIMITATIONS:

This study was designed to examine the role of MAP1S in cardiac remodelling using TAC to induce pressure overload hypertrophy. Also, a cellular model using H9C2 cells was used to confirm the finding that was obtained from the in vivo analysis.

In this study, the main process needed to be investigated was autophagy, with mice exposed to TAC to induce the hypertrophy response, which increases the autophagy activity. A direct induction of autophagy in mice, using starvation or rapamycin injection, is a possible option to induce autophagy during TAC to ensure the autophagy induction in the mice. Also, increasing the TAC period to up to 4 weeks TAC is another option for the study of the influence of MAP1S in the heart function, as 2 weeks TAC did not induce any change in the heart function in this study.

The cellular model in this study is limited as only one cell model (H9C2) was used to investigate autophagy and hypertrophy induction. Neonatal rat cardiomyocytes (NRCM) represent another cellular model that can be used to confirm the results obtained from the in vivo experiments. Another limitation in using the cellular model to induce hypertrophy and autophagy simultaneously in the cells is cell death because the treatment and transfection with many reagents; for example, for the GFP-LC3 analysis to induce hypertrophy and autophagy the cells need to be transfected by siRNA and GFP-LC3 adenovirus and then treated by PE and treated by rapamycin and chloroquine. This number of transfections and treatments lead to cell death before the time of the analysis.

6.10 FUTURE DIRECTIONS In this study, the findings in chapter 3 indicate that MAP1S reduces the hypertrophy response; this finding requires further investigation to determine the exact mechanism of MAP1S regulation in cardiac remodelling. For a further investigation of the role of MAP1S, an increase in the TAC period to 4 weeks is important to enable change to be induced in the mice heart function and structure in order to study the role of MAP1S in the development of cardiac hypertrophy.

169

Furthermore, to study how MAP1S regulates autophagy, autophagy can be induced in mice by direct injection of rapamycin or starvation during the induction of pressure overload by TAC to explore the effect on the heart function and structure. In addition, with the HF model by long-term TAC is possible model to study the role of MAP1S, which will enable a determination of the influence of MAP1S in heart remodelling using in vivo evaluation as well as an investigation into cell death in the HF mice model using different quantitative and qualitative methods. Meanwhile, in vitro analysis using NRCM cells can be used to validate the results obtained from the in vivo analysis. Also, autophagy stimulation of more than one autophagy inducer must be used to induce the autophagy in the cells, such as starvation or Tat-Beclin 1. Moreover, it is important to investigate different autophagy-related proteins (ATG) from all five stage of the autophagy process using western blot analysis or qPCR to identify ATG that has been affected by the MAP1S ablation and at which stage exactly MAP1S regulates this process. A further direction would be trying to overexpress MAP1S in a cellular model to determine whether MAP1S overexpression increases the hypertrophy response as the knockout reduces it or whether MAP1S overexpression interacts with other signalling pathways.

170

References

Allen, E., Ding, J., Wang, W., Pramanik, S., Chou, J., Yau, V., & Yang, Y. (2005). Gigaxonin-controlled degradation of MAP1B light chain is critical to neuronal survival. Nature, 438, 224–228.

Anker, S. D., & von Haehling, S. (2004). Inflammatory mediators in chronic heart failure: an overview. Heart (British Cardiac Society), 90, 464–470.

Azad, M. B., Chen, Y., Henson, E. S., Cizeau, J., McMillan-Ward, E., Israels, S. J., & Gibson, S. B. (2008). Hypoxia induces autophagic cell death in apoptosis- competent cells through a mechanism involving BNIP3. Autophagy, 4, 195– 204.

Bai, W., Bai, J., Li, Y., Tian, D., & Shi, R. (2017). Microtubule-associated protein 1S-related autophagy inhibits apoptosis of intestinal epithelial cells via Wnt/β- catenin signaling in Crohn’s disease. Biochemical and Biophysical Research Communications, 485, 635–642.

Betrie, A. B., Aytonb, S., Bushb, A. I., Angusa, J. A., Leic, P., Wrighta, C. E. (2017). Evidence of a Cardiovascular Function for Microtubule-Associated Protein Tau. Journal of Alzheimer’s Disease, 56, 849–860.

Bhuiyan, M. S., Pattison, J. S., Osinska, H., James, J., Gulick, J., McLendon, P. M., Hill, J. A., Sadoshima, J., Robbins, J. (2013). Enhanced autophagy ameliorates cardiac proteinopathy. Journal of Clinical Investigation, 123, 5284–5297.

Biondi-Zoccai, G., De Falco, E., Peruzzi, M., Cavarretta, E., Mancone, M., Leoni, O., Caristo, ME., Lotrionte ,M., Marullo, AG.,, Amodeo, A., Pacini, L., Calogero, A., Petrozza, V., Chimenti, I., D'Ascenzo, F., Frati, G. (2013). A novel closed-chest porcine model of chronic ischemic heart failure suitable for experimental research in cardiovascular disease. BioMed Research International, 2013, 410631.

Biondo, A. W., Ehrhart, E. J., Sisson, D. D., Bulmer, B. J., De Morais, H. S. A., & Solter, P. F. (2003). Immunohistochemistry of atrial and brain natriuretic peptides in control cats and cats with hypertrophic cardiomyopathy. Veterinary Pathology, 40, 501–506.

171

Bjorkoy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Overvatn, A., Stenmark, H., Johansen, T. (2005). p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. The Journal of Cell Biology, 171, 603–614.

Braunwald, E. (2013). Heart Failure. JACC. Heart Failure, 1, 1–20.

Carreño, J. E., Apablaza, F., Ocaranza, M. P., & Jalil, J. E. (2006). Cardiac Hypertrophy : Molecular and Cellular Events. Rev Esp Cardiol. , 59, 473–486.

Chan, E. Y. (2009). mTORC1 phosphorylates the ULK1-mAtg13-FIP200 autophagy regulatory complex. Science Signaling, 2, pe51.

Chang, L., Jones, Y., Ellisman, M. H., Goldstein, L. S. B., & Karin, M. (2003). JNK1 is required for maintenance of neuronal microtubules and controls phosphorylation of microtubule-associated proteins. Developmental Cell, 4, 521–533.

Chiong, M., Wang, Z. V, Pedrozo, Z., Cao, D. J., Troncoso, R., Ibacache,

M., Criollo, A., Nemchenko, A., Hill, JA., Lavandero, S. (2011). Cardiomyocyte death: mechanisms and translational implications. Cell Death & Disease, 2, e244.

Chrysohoou, C., Pitsavos, C., Barbetseas, J., Kotroyiannis, I., Brili, S., Vasiliadou,

K., Papadimitriou, L., Stefanadis, C. (2009). Chronic systemic inflammation accompanies impaired ventricular diastolic function, detected by Doppler imaging, in patients with newly diagnosed systolic heart failure (Hellenic Heart Failure Study). Heart and Vessels, 24, 22–26.

Creemers, E. E., & Pinto, Y. M. (2011). Molecular mechanisms that control interstitial fibrosis in the pressure-overloaded heart. Cardiovascular Research, 89, 265–272.

De Meyer, G. R. Y., De Keulenaer, G. W., & Martinet, W. (2010). Role of autophagy in heart failure associated with aging. Heart Failure Reviews, 15, 423–430.

Dehmelt, L., & Halpain, S. (2005). The MAP2/Tau family of microtubule-associated

172

proteins. Genome Biology, 6, 204. del Peso, L., Gonzalez-garcia, M., Page, C., Herrera, R., & Nuiiez, G. (1997). Interleukin-3 Induced Phosphorylation of BAD Through the Protein Kinase Akt. Science, 278, 687–689.

Deter, R. L., & De Duve, C. (1967). Influence of glucagon, an inducer of cellular autophagy, on some physical properties of rat liver lysosomes. The Journal of Cell Biology, 33, 437–449.

Díaz-Troya, S., Pérez-Pérez, M. E., Florencio, F. J., & Crespo, J. L. (2008). The role of TOR in autophagy regulation from yeast to plants and mammals. Autophagy, 4, 851–865.

Ding, W. X., & Yin, X. M. (2012). Mitophagy: Mechanisms, pathophysiological

roles, and analysis. Biological Chemistry, 393, 547-564.

Felgner, H., Frank, R., Biernat, J., Mandelkow, E. M., Mandelkow, E., Ludin, B., Matus, A., Schliwa, M. (1997). Domains of neuronal microtubule-associated proteins and flexural rigidity of microtubules. The Journal of Cell Biology, 138, 1067–1075.

Galimberti, S., Petrini, M., Samad, N., & Younes, A. (2010). Temsirolimus in the treatment of relapsed or refractory mantle cell lymphoma. OncoTargets and Therapy, 2, 181–189.

Gaudesius, G., Miragoli, M., Thomas, S. P., & Rohr, S. (2003). Coupling of cardiac electrical activity over extended distances by fibroblasts of cardiac origin. Circulation Research, 93, 421–428.

G ennebäck, N., Wikström, G., Hellman, U., Samuel, J., Waldenström, A., Mörner, S. (2012). Transcriptional regulation of cardiac genes balance pro- and anti- hypertrophic mechanisms in hypertrophic cardiomyopathy. Cardiogenetics, 1, 2:e5.

Glick, D., Barth, S., & Macleod, K. (2010). Autophagy: cellular and molecular mechanisms. The Journal of Pathology, 221, 3–12.

Goold, R. G., Owen, R., & Gordon-Weeks, P. R. (1999). Glycogen synthase kinase

173

3beta phosphorylation of microtubule-associated protein 1B regulates the stability of microtubules in growth cones. Journal of Cell Science, 112, 3373– 3384.

Griffiths, A., Paracha, N., Davies, A., Branscombe, N., Cowie, M. R., & Sculpher, M. (2014). The cost effectiveness of ivabradine in the treatment of chronic heart failure from the U.K. National Health Service perspective. Heart (British Cardiac Society), 100, 1031–1036.

Gross, A., Jockel, J., Wei, M., & Korsmeyer, S. (1998). Enforced dimerization of BAXresults in its translocation,mitochondrial dysfunction and apoptosis. Embo Journal, 17, 3878–3885.

Halpain, S., & Dehmelt, L. (2006). The MAP1 family of microtubule-associated proteins. Genome Biology, 7, 224.

Hardwick, J. M., & Soane, L. (2013). Multiple Functions of BCL-2 Family Proteins. Cold Spring Harbor Perspectives in Biology, 5, a008722–a008722.

Harnett, M. M., Pineda, M. A., Latr, P., Eason, R. J., & Langsley, G. (2017). From Christian de Duve to Yoshinori Ohsumi: More to autophagy than just dining at home. Biomedical Journal, 40, 9–22.

He, C., & Klionsky, D. J. (2009). Regulation mechanisms and signaling pathways of autophagy. Annual Review of Genetics, 43, 67–93.

He Huang, Q.-Z. T., & F, Ai-Bing Wang, Manyin Chen, Heng Zhou, Chen Liu, Hong Jiang, Qinglin Yang, Zhou-Yan Biana, Xue Baia, Li-Hua Zhu, L. W. and H. L. (2010). Tumor Suppressor A20 Protects against Cardiac Hypertrophy and Fibrosis through Blocking TAK1-Dependent Signaling. Hypertension, 56, 232– 239.

Homewood, C. A., Warhurst, D. C., Peters, W., & Baggaley, V. C. (1972). Lysosomes, pH and the anti-malarial action of chloroquine [9]. Nature, 235, 50–

174

52.

Hummel, T., Krukkert, K., Roos, J., Davis, G., & Klämbt, C. (2000). Drosophila Futsch/22C10 is a MAP1B-like protein required for dendritic and axonal development. Neuron, 26, 357–370.

Ikeda, A., Zheng, Q. Y., Zuberi, A. R., Johnson, K. R., Naggert, J. K., & Nishina, P. M. (2002). Microtubule-associated protein 1A is a modifier of tubby hearing (moth1). Nature Genetics, 30, 401–405.

Fassett, J. T., Hu, X., Xu, X., Lu, Z., Zhang, P., Chen, Y., Bache, R. J. (2013). AMPK attenuates microtubule proliferation in cardiac hypertrophy. American Jornal of Physiology Heart Circulation Physiology, 304, H749–H758.

Kamada, Y., Funakoshi, T., Shintani, T., Nagano, K., Ohsumi, M., & Ohsumi, Y. (2000). Tor-mediated induction of autophagy via an Apg1 protein kinase complex. The Journal of Cell Biology, 150, 1507–1513.

Kang, R., Zeh, H. J., Lotze, M. T., & Tang, D. (2011). The Beclin 1 network regulates autophagy and apoptosis. Cell Death and Differentiation, 18, 571–

Kehat, I., & Molkentin, J. D. (2010). Molecular pathways underlying cardiac remodeling during pathophysiological stimulation. Circulation, 122, 2727– 2735.

Khan, R., & Sheppard, R. (2006). Fibrosis in heart disease: understanding the role of transforming growth factor-beta in cardiomyopathy, valvular disease and arrhythmia. Immunology, 118, 10–24.

King, K. L., Winer, J., Phillips, D. M., Quach, J., Williams, P. M., & Mather, J. P. (1998). Phenylephrine, endothelin, prostaglandin F(2α), and leukemia inhibitory factor induce different cardiac hypertrophy phenotypes in vitro. Endocrine, 9, 45–55.

Konstantinidis, K., Whelan, R. S., & Kitsis, R. N. (2012). Mechanisms of cell death in heart disease. Arteriosclerosis, Thrombosis, and Vascular Biology, 32, 1552– 1562.

LaFramboise, W. A., Scalise, D., Stoodley, P., Graner, S. R., Guthrie, R. D.,

175

Magovern, J. A., & Becich, M. J. (2007). Cardiac fibroblasts influence cardiomyocyte phenotype in vitro. American Journal of Physiology. Cell Physiology, 292, C1799-808.

Levine, B., & Kroemer, G. (2008). Autophagy in the pathogenesis of disease. Cell, 132, 27–42.

Levy, D. E., & Lee, C. K. (2002). What does Stat3 do?. Journal of Clinical Investigation, 109, 1143–1148.

Li, L., Zhang, Q., Zhang, X., Zhang, J., Wang, X., Ren, J., Jia, J., Zhang, D., Jiang X., Zhang, J., Mei, H., Chen, B., Hu, J., Huang, Y. (2018). Microtubule associated protein 4 phosphorylation leads to pathological cardiac remodeling in mice. EBioMedicine, 37, 221-235.

Li, W., Li, J., & Bao, J. (2012). Microautophagy: lesser-known self-eating. Cellular and Molecular Life Sciences : CMLS, 69, 1125–1136.

Li, Z., Wang, J., & Yang, X. (2015). Functions of autophagy in pathological cardiac hypertrophy. International Journal of Biological Sciences, 11, 672–678.

Liang, X. H., Jackson, S., Seaman, M., Brown, K., Kempkes, B., Hibshoosh, H., & Levine, B. (1999). Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature, 402, 672–676.

Liao, Y., Ishikura, F., Beppu, S., Asakura, M., Takashima, S., Asanuma, H.,Sanada, S., Kim, J., Ogita, H., Kuzuya, T., Node, K.,Kitakaze, M.,Hori, M. (2002). Echocardiographic assessment of LV hypertrophy and function in aortic-banded mice: necropsy validation. American Journal of Physiology - Heart and Circulatory Physiology, 282, H1703–H1708.

Liu, L., Amy, V., Liu, G., & McKeehan, W. L. (2002). Novel complex integrating mitochondria and the microtubular cytoskeleton with chromosome remodeling and tumor suppressor RASSF1 deduced by in silico homology analysis, interaction cloning in yeast, and colocalization in cultured cells. In Vitro Cellular & Developmental Biology. Animal, 38, 582–594.

Liu, L., McKeehan, W. L., Wang, F., & Xie, R. (2012). MAP1S enhances autophagy

176

to suppress tumorigenesis. Autophagy, 8, 278–280.

Maiato, H., Sampaio, P., & Sunkel, C. E. (2004). Microtubule-associated proteins and their essential roles during mitosis. International Review of Cytology, 241, 53–153.

Martin, T. P., Lawan, A., Robinson, E., Grieve, D. J., Plevin, R., Paul, A., & Currie, S. (2014). Adult cardiac fibroblast proliferation is modulated by calcium/calmodulin-dependent protein kinase II in normal and hypertrophied hearts. Pflügers Archiv : European Journal of Physiology, 466, 319–330.

Martinet, W., Agostinis, P., Vanhoecke, B., Dewaele, M., & De Meyer, G. R. Y. (2009). Autophagy in disease: a double-edged sword with therapeutic potential. Clinical Science (London, England : 1979), 116, 697–712.

Massey, A., Kiffin, R., & Cuervo, A. M. (2004). Pathophysiology of chaperone- mediated autophagy. The International Journal of Biochemistry & Cell Biology, 36, 2420–2434.

McMullen, J. R., & Jennings, G. L. (2007). Differences between pathological and physiological cardiac hypertrophy: Novel therapeutic strategies to treat heart failure. Clinical and Experimental Pharmacology and Physiology, 34, 255–262.

Meier, J. A., Hyun, M., Cantwell, M., Raza, A., Mertens, C., Raje, V., Sisler, J., Torres-odio, s., Gispert, S., Shaw, P., Baumann, H., Bandyopadhyay, D., Takabe, K., Larner, A. C. (2017). Stress-induced dynamic regulation of mitochondrial STAT3 and its association with cyclophilin D reduce mitochondrial ROS production. Science Signaling, 10 472-472.

Mizushima, N. (2007). Autophagy : process and function, 2861–2873.

Moruno, F., Pérez-Jiménez, E., & Knecht, E. (2012). Regulation of autophagy by glucose in Mammalian cells. Cells, 1, 372–395.

Mudd, J. O., & Kass, D. A. (2008). Tackling heart failure in the twenty-first century. Nature, 451, 919–928.

Nabel, E. G., & Braunwald, E. (2012). A tale of coronary artery disease and myocardial infarction. The New England Journal of Medicine, 366, 54–63.

177

Nakai, A., Yamaguchi, O., Takeda, T., Higuchi, Y., Hikoso, S., Taniike, M., Omiya, S., Mizote, I., Matsumura, Y., Asahi, M.,, Nishida, K., Hori, M., Mizushima, N., Otsu, K. (2007). The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress. Nature Medicine, 13, 619–624.

Nakayama, H., Chen, X., Baines, C. P., Klevitsky, R., Zhang, X., Zhang, H., Jaleel, N., Chua, B. H., Hewett T.E., Robbins, J., Houser, S. R., Molkentin, J. D. (2007). Ca2+- and mitochondrial-dependent cardiomyocyte necrosis as a primary mediator of heart failure. The Journal of Clinical Investigation, 117, 2431–2444.

Narendra, D., Walker, J. E., & Youle, R. (2012). Mitochondrial quality control mediated by PINK1 and Parkin: Links to parkinsonism. Cold Spring Harbor Perspectives in Biology, 4(11).

Noiges, R., Eichinger, R., Kutschera, W., Fischer, I., Nemeth, Z., Wiche, G., & Propst, F. (2002). Microtubule-associated protein 1A (MAP1A) and MAP1B: light chains determine distinct functional properties. The Journal of Neuroscience, 22, 2106–2114.

Oceandy, D., Pickard, A., Prehar, S., Zi, M., Mohamed, T. M. A., Stanley, P.

J., Nadif, R., Tommasi, S., Pfeifer, GP., Armesilla. A.L., Cartwright, E.J., Neyses, L. (2009). Tumor suppressor ras-association domain family 1 Isoform A Is a novel regulator of cardiac hypertrophy. Circulation, 120, 607–616.

Oikonomou, E., Tousoulis, D., Siasos, G., Zaromitidou, M., Papavassiliou, A. G., & Stefanadis, C. (2011). The role of inflammation in heart failure: new therapeutic approaches. Hellenic Journal of Cardiology, 52, 30–40. Retrieved from

Ookata, K., Hisanaga, S., Sugita, M., Okuyama, A., Murofushi, H., Kitazawa, H., Chari, S., Bulinski, J. C., Kishimoto, T. (1997) MAP4 Is the in Vivo Substrate for CDC2 Kinase in HeLa Cells: Identification of an M-Phase Specific and a Cell Cycle-Independent Phosphorylation Site in MAP4. Biochemistry, 36, 15873-15883.

Orbán-Németh, Z., Simader, H., Badurek, S., Tranciková, A., & Propst, F. (2005). Microtubule-associated protein 1S, a short and ubiquitously expressed member

178

of the microtubule-associated protein 1 family. The Journal of Biological Chemistry, 280, 2257–2265.

Pedram, A., Razandi, M., Lubahn, D., Liu, J., Vannan, M., & Levin, E. R. (2008). Estrogen inhibits cardiac hypertrophy: Role of estrogen receptor-β to inhibit calcineurin. Endocrinology, 149, 3361–3369.

Petibone, D. M., Majeed, W., & Casciano, D. A. (2017). Autophagy function and its relationship to pathology, clinical applications, drug metabolism and toxicity. Journal of Applied Toxicology, 37, 23–37.

Pop, C., & Salvesen, G. S. (2009). Human caspases: activation, specificity, and regulation. The Journal of Biological Chemistry, 284, 21777–21781.

Potts, M. B., Vaughn, A. E., McDonough, H., Patterson, C., & Deshmukh, M. (2005). Reduced Apaf-1 levels in cardiomyocytes engage strict regulation of apoptosis by endogenous XIAP. The Journal of Cell Biology, 171, 925–930.

Rainsford, K. D., Parke, A. L., Clifford-Rashotte, M., & Kean, W. F. (2015). Therapy and pharmacological properties of hydroxychloroquine and chloroquine in treatment of systemic lupus erythematosus, rheumatoid arthritis and related diseases. Inflammopharmacology, 23, 231–269.

Rajnikant Patel, Sherif F. Nagueh, Natalie Tsybouleva, Maha Abdellatif, Silvia Lutucuta, Helen A. Kopelen, Miguel A. Quinones, William A. Zoghbi, Mark L. Entman, R. R. and A. J. M. (2001). Simvastatin Induces Regression of Cardiac Hypertrophy and Fibrosis and Improves Cardiac Function in a Transgenic Rabbit Model of Human Hypertrophic Cardiomyopathy Rajnikant. Circulation, 104, 317–324.

Ravikumar, B., Vacher, C., Berger, Z., Davies, J. E., Luo, S., Oroz, L. G., Scaravilli, F., Easton, D. F., Duden, R., O’Kane, K. G., Rubinsztein, D. C. (2004). Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nature Genetics, 36, 585–595.

Riederer, B. M. (2007). Microtubule-associated protein 1B, a growth-associated and phosphorylated scaffold protein. Brain Research Bulletin, 71, 541–558.

179

Roy, S., & Kornberg, T. B. (2015). Paracrine signaling mediated at cell-cell contacts. Bioessays, 37, 25-33.

Sánchez-Pérez, A. M., Claramonte-Clausell, B., Sánchez-Andrés, J. V., & Herrero, M. T. (2012). Parkinson’s disease and autophagy. Parkinson’s Disease, 2012, 429524.

Scheubel, R. J., Bartling, B., Simm, A., Silber, R. E., Drogaris, K., Darmer, D., & Holtz, J. (2002). Apoptotic pathway activation from mitochondria and death receptors without caspase-3 cleavage in failing human myocardium: fragile balance of myocyte survival. Journal of the American College of Cardiology, 39, 481–488.

Schoenfeld, T. a, McKerracher, L., Obar, R., & Vallee, R. B. (1989). MAP 1A and MAP 1B are structurally related microtubule associated proteins with distinct developmental patterns in the CNS. The Journal of Neuroscience : The Official Journal of the Society for Neuroscience, 9, 1712–1730.

Schwartzbauer, G., & Robbins, J. (2001). The Tumor Suppressor Gene PTEN Can Regulate Cardiac Hypertrophy and Survival. Journal of Biological Chemistry, 276, 35786–35793.

Shiomura, Y., & Hirokawa, N. (1987). The molecular structure of microtubule- associated protein 1A (MAP1A) in vivo and in vitro. An immunoelectron microscopy and quick-freeze, deep-etch study. The Journal of Neuroscience : The Official Journal of the Society for Neuroscience, 7, 1461–1469.

Shirakabe, A., Zhai, P., Ikeda, Y., Saito, T., Maejima, Y., Hsu, C. P., Nomura, M., Egashira, K., Levine, B., Sadoshima, J. (2016). Drp1-dependent mitochondrial autophagy plays a protective role against pressure overload-induced mitochondrial dysfunction and heart failure. Circulation, 133, 1249–1263.

Souders, C. A., Borg, T. K., Banerjee, I., & Baudino, T. A. (2012). Pressure overload induces early morphological changes in the heart. American Journal of Pathology, 181, 1226–1235.

Szardien, S., Nef, H. M., Voss, S., Troidl, C., Liebetrau, C., Hoffmann, J., Rauch, M., Mayer, K., Kimmich, K., Rolf, A., Rixe, J., Troidl, K., Kojonazarov,

180

B., Schermuly, R.T., Kostin,, S., Elsässer, A., Hamm, C.W., Möllmann, H. (2012). Regression of cardiac hypertrophy by granulocyte colony-stimulating factor-stimulated interleukin-1β synthesis. European Heart Journal, 33, 595– 605.

Tait, S., & Green, D. (2013). Mitochondrial regulation of cell death. Cold Spring Harbor Perspectives in Biology, 5, 1–15.

Tanaka, T., Narazaki, M., & Kishimoto, T. (2014). IL-6 in Inflammation, Immunity, and Disease. Cold Spring Harbor Perspectives in Biology, 6, a016295–a016295.

Tannous, P., Zhu, H., Nemchenko, A., Berry, J. M., Johnstone, J. L., Shelton, J.

M., Shelton, J.M., Miller, F.J. Jr., Rothermel, B.A., Hill, J. A. (2008). Intracellular protein aggregation is a proximal trigger of cardiomyocyte autophagy. Circulation, 117, 3070–3078.

Tögel, M., Wiche, G., & Propst, F. (1998). Novel features of the light chain of microtubule-associated protein MAP1B: microtubule stabilization, self interaction, actin filament binding, and regulation by the heavy chain. The Journal of Cell Biology, 143(3), 695–707.

Tomasiewicz, H. G., & Wood, J. G. (1999). Characterization of microtubule- associated proteins in teleosts. Cell Motility and the Cytoskeleton, 44, 155–167.

Trivedi, N., Marsh, P., Goold, R. G., Wood-Kaczmar, A., & Gordon-Weeks, P. R. (2005). Glycogen synthase kinase-3beta phosphorylation of MAP1B at Ser1260 and Thr1265 is spatially restricted to growing axons. Journal of Cell Science, 118, 993–1005. van Empel, V. P. M., Bertrand, A. T. a, Hofstra, L., Crijns, H. J., Doevendans, P. a, & De Windt, L. J. (2005). Myocyte apoptosis in heart failure. Cardiovascular Research, 67, 21–29.

Vandecandelaere, A., Pedrotti, B., Utton, M. A., Calvert, R. A., & Bayley, P. M. (1996). Differences in the regulation of microtubule dynamics by microtubule- associated proteins MAP1B and MAP2. Cell Motility and the Cytoskeleton, 35, 134–146.

181

Vasan, R. S., Sullivan, L. M., Roubenoff, R., Dinarello, C. A., Harris, T., Benjamin, E. J., Sawyer, D. B., Levy, D., Wilson, P.W., D’Agostino, R. B. (2003). Inflammatory markers and risk of heart failure in elderly subjects without prior myocardial infarction: the Framingham Heart Study. Circulation, 107, 1486– 1491.

Wakatsuki, T., Schlessinger, J., & Elson, E. L. (2004). The biochemical response of the heart to hypertension and exercise. Trends in Biochemical Sciences, 29, 609–617.

Wang, Z. V, Rothermel, B. a, & Hill, J. a. (2010). Autophagy in hypertensive heart disease. The Journal of Biological Chemistry, 285, 8509–8514. 3

Wang, Y., Weiss, L. M., & Orlofsky, A. (2009). Host cell autophagy Is induced by toxoplasma gondii and contributes to parasite growth. Journal of Biological Chemistry, 284, 1694–1701.

Wang, Y., Yang, Y., & Ai, X. (2014). Heart Failure. The Scientific World Journal, 18(2), 3–4.

Weekes, J., Morrison, K., Mullen, A., Wait, R., Barton, P., & Dunn, M. J. (2003). Hyperubiquitination of proteins in dilated cardiomyopathy. Proteomics, 3, 208– 216.

Wende, A. R., O’Neill, B. T., Bugger, H., Riehle, C., Tuinei, J., Buchanan, J., Tsushima, K., Wang, L., Caro, P., Guo, A., Sloan, C., Kim, B. J., Wang, X., Pereira, R. O., McCrory, M. A., Nye, B. G., Benavides, G. A., Darley-Usmar, V. M., Shioi, T., Weimer, B. C., Abel, E. D. (2015). Enhanced Cardiac Akt/Protein Kinase B Signaling Contributes to Pathological Cardiac Hypertrophy in Part by Impairing Mitochondrial Function via Transcriptional Repression of Mitochondrion-Targeted Nuclear Genes. Molecular and Cellular Biology, 35, 831–846.

Whelan, R. S., Kaplinskiy, V., & Kitsis, R. N. (2010). Cell death in the pathogenesis of heart disease: mechanisms and significance. Annual Review of Physiology, 72, 19–44.

Xie, R., Nguyen, S., McKeehan, K., Wang, F., McKeehan, W. L., & Liu, L. (2011a).

182

Microtubule-associated protein 1S (MAP1S) bridges autophagic components with microtubules and mitochondria to affect autophagosomal biogenesis and degradation. The Journal of Biological Chemistry, 286, 10367–10377.

Xie, R., Nguyen, S., McKeehan, K., Wang, F., McKeehan, W. L., & Liu, L. (2011b). Microtubule-associated protein 1S (MAP1S) bridges autophagic components with microtubules and mitochondria to affect autophagosomal biogenesis and degradation. The Journal of Biological Chemistry, 286, 10367–10377.

Xie, R., Wang, F., McKeehan, W., & Liu, L. (2011). Autophagy enhanced by microtubule-and mitochondrion-associated MAP1S suppresses genome instability and hepatocarcinogenesis. Cancer Research, 71, 7537–7546.

Xie, Z., & Klionsky, D. J. (2007). Autophagosome formation: core machinery and adaptations. Nature Cell Biology, 9, 1102–1109.

Xin, H., Senbonmatsu, T., Cheng, D., Wang, Y.X., Copello, J. A., Ji, G.J., Collier, ML., Deng, K.Y., Jeyakumar, L.H., Magnuson, M.A., Inagami, T., Kotlikoff, M.I., Magnuson, M. A. (2002). Oestrogen protects FKBP12. 6 null mice from cardiac hypertrophy. Nature, 416, 334–338.

Xu, G., Yue, F., Huang, H., He, Y., Li, X., Zhao, H.,Su, Z., Jiang, X., Li, W.,Zou, J., Chen Q., Liu, L. (2016). Defects in MAP1S-mediated autophagy turnover of fibronectin cause renal fibrosis. Aging, 8(5), 977–985. https://doi.org/10.18632/aging.100957

Xue, L., Li, M., Chen, T., Sun, H., Zhu, J., Li, X.,Wu, F.,Wang, B., Chen, Y. (2014). PE-induced apoptosis in SMMC-7721 cells: Involvement of Erk and Stat signalling pathways. International Journal of Molecular Medicine, 34, 119– 129.

Yin, F. C., Spurgeon, H. A., Rakusan, K., Weisfeldt, M. L., & Lakatta, E. G. (1982). Use of tibial length to quantify cardiac hypertrophy: application in the aging rat. The American Journal of Physiology, 243, H941-7.

Yorimitsu, T., & Klionsky, D. J. (2005). Autophagy: molecular machinery for self- eating. Cell Death and Differentiation, 12, 1542–1552.

183

Yorimitsu, T., Nair, U., Yang, Z., & Klionsky, D. J. (2006). Endoplasmic reticulum stress triggers autophagy. The Journal of Biological Chemistry, 281, 30299– 30304.

Yoshimura, M., Yasue, H., & Ogawa, H. (2001). Pathophysiological significance and clinical application of ANP and BNP in patients with heart, 735, 730–735.

Yue, T. L., Gu, J. L., Wang, C., Reith, A. D., Lee, J. C., Mirabile, R. C., Kreutz, R., Wang, Y., Maleeff, B., Parsons, A.A., Ohlstein, E. H. (2000). Extracellular signal-regulated kinase plays an essential role in hypertrophic agonists, endothelin-1 and phenylephrine-induced cardiomyocyte hypertrophy. Journal of Biological Chemistry, 275, 37895–37901.

Zhang, W., Elimban, V., Nijjar, M. S., Gupta, S. K., & Dhalla, N. S. (2003). Role of mitogen-activated protein kinase in cardiac hypertrophy and heart failure. Experimental and Clinical Cardiology, 8, 173–183.

Zhu, H., Tannous, P., Johnstone, J. L., Kong, Y., Shelton, J. M., Richardson, J. A., … Hill, J. A. (2007). Cardiac autophagy is a maladaptive response to hemodynamic stress. The Journal of Clinical Investigation, 117, 1782–1793.

Zhu, W., Wang, X., Zhou, Y., & Wang, H. (2014). C2-ceramide induces cell death and protective autophagy in head and neck squamous cell carcinoma cells. International Journal of Molecular Sciences, 15, 3336–3355.

Zou, T., Ouyang, L., Chen, L., Dong, W., Qiao, H., Liu, Y., & Qi, Y. (2008). The role of microtubule-associated protein 1S in SOCS3 regulation of IL-6 signaling. FEBS Letters, 582, 4015–4022.

184