Oncogene (2001) 20, 3563 ± 3567 ã 2001 Nature Publishing Group All rights reserved 0950 ± 9232/01 $15.00 www.nature.com/onc SHORT REPORTS The CpG island of the novel tumor suppressor RASSF1A is intensely methylated in primary small cell lung carcinomas

Reinhard Dammann1, Takashi Takahashi2 and Gerd P Pfeifer*,1

1Department of Biology, Beckman Research Institute, City of Hope Cancer Center, Duarte, California 91010, USA; 2Division of Molecular Oncology, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan

Loss of heterozygosity at 3p21.3 occurs in more than include the RB gene (13q), the p53 gene (17p), 90% of small cell lung carcinomas (SCLCs). The Ras and the p16 CDK inhibitor gene (9p). association domain family 1 (RASSF1) gene cloned from Allelic loss at 3p21 is an early event in lung tumor the lung tumor suppressor 3p21.3 consists of two pathogenesis, occurs at the stage of hyperplasia/ major alternative transcripts, RASSF1A and RASSF1C. metaplasia (Sundaresan et al., 1992; Hung et al., Epigenetic inactivation of isoform A (RASSF1A) was 1995; Thiberville et al., 1995; Wistuba et al., 1999), observed in 40% of primary non-small cell lung and as such may be critically involved in tumor carcinomas and in several tumor cell lines. Transfection initiation. Cross-sectional examination of individual of RASSF1A suppressed the growth of lung cancer cells NSCLC tumors showed that all portions of the tumor in vitro and in nude mice. Here we have analysed the shared concordant LOH at 3p despite morphological methylation status of the CpG island promoters of diversity (Yatabe et al., 2000). RASSF1A and RASSF1C in primary SCLCs. In 22 of Homozygous deletions at 3p21.3 have been described 28 SCLCs (=79%) the promoter of RASSF1A was in several cancer cell lines and in primary lung tumors highly methylated at all CpG sites analysed. None of the (Killary et al., 1992; Yamakawa et al., 1993; Wei et al., SCLCs showed evidence for methylation of the CpG 1996; Kok et al., 1997; Todd et al., 1997). Recently, a island of RASSF1C. The results suggest that hyper- region of minimum homozygous deletion was nar- methylation of the CpG island promoter of the rowed to 120 kb using several lung cancer and a breast RASSF1A gene is associated with SCLC pathogenesis. cancer cell line (Sekido et al., 1998). Until now, several Oncogene (2001) 20, 3563 ± 3567. genes located in the 3p21.3-deleted chromosomal region have been isolated as candidates for tumor Keywords: RASSF1; methylation; CpG island; tumor suppressor genes. However, none of the genes located suppressor gene; small cell lung cancer; 3p21 within the 3p21.3 homozygous deletion area was found to be mutated in more than 5 ± 10% of lung tumors (Lerman and Minna, 2000). This supports the assump- Introduction tion that the putative 3p21.3 tumor suppressor gene is inactivated by mechanisms other than mutation of the Lung cancer currently is the leading cause of cancer coding sequence. death in the United States with more than 150 000 Transcriptional silencing by hypermethylation of deaths annually attributed to this disease (Wingo et al., CpG islands containing the promoter regions of tumor 1999). Lung cancers are broadly classi®ed into two suppressor genes is becoming recognized as a common groups: small cell lung cancer (SCLC) and non-small mechanism (Baylin et al., 1998; Jones and Laird, 1999; cell lung cancer (NSCLC), the latter being divided into Baylin and Herman, 2000). Recent studies have the major histological subtypes adenocarcinoma, demonstrated that the CpG islands in the RB, p16, squamous cell carcinoma, and large cell carcinoma. VHL, APC, MLH1,andBRCA1 genes are frequently Losses of heterozygosity (LOH) on arms methylated in a variety of human cancers, but are 3p, 9p, 13q and 17p are among the most frequent usually methylation-free in the corresponding normal alterations in lung tumors (Whang-Peng et al., 1982; tissues (Baylin et al., 1998; Jones and Laird, 1999; Yokota et al., 1987; Naylor et al., 1987; Hibi et al., Baylin and Herman, 2000). CpG islands that are 1992; Kohno and Yokota, 1999; Girard et al., 2000). hypermethylated in lung cancer include those of the However, only a limited number of tumor suppressor p16 gene (Shapiro et al., 1995; Otterson et al., 1995; genes have been identi®ed as potential targets for Merlo et al., 1995; Belinsky et al., 1998), the DNA chromosomal deletion events in these tumors. These repair gene MGMT (Palmisano et al., 2000), the death- associated kinase (Tang et al., 2000), and DMBT1, a candidate tumor suppressor gene located at 10q25.3 ± 26.1 (Wu et al., 1999). Inactivation of tumor *Correspondence: GP Pfeifer Received 5 January 2001; revised 27 February 2001; accepted 15 suppressor genes due to hypermethylation may play an March 2001 important role in carcinogenesis. RASSF1A methylation in lung cancer R Dammann et al 3564 In previous work we have cloned and characterized the Ras association domain family 1A gene (RASS- F1A) located within the 120 kb 3p21.3 minimal homozygous deletion region and found that this gene is epigenetically inactivated in 40% of primary non- small cell lung cancers (Dammann et al., 2000). The RASSF1 protein is 55% homologous to the mamma- lian Ras e€ector Nore1 (Vavvas et al., 1998). Re- expression of RASSF1A in A549 lung cancer cells reduced colony formation, suppressed anchorage-in- dependent growth and inhibited tumor formation in nude mice (Dammann et al., 2000). In the present study we have investigated the methylation status of the RASSF1A gene in primary SCLC samples. Previously, we have observed that all 17 of the 17 analysed SCLC cell lines had lost the expression of RASSF1A and silencing of RASSF1A correlated with hypermethylation of the CpG island promoter sequence (Dammann et al., 2000). However, cell lines are known to have unusually high frequencies of CpG island methylation (Antequera et al., 1990; Jones et al., 1990), which makes an analysis of primary tumors a necessity. To analyse the RASSF1 gene in primary SCLCs, we determined the methylation status of the two CpG islands, in which the alternative RASSF1A and RASSF1C transcripts initiate. We used bisul®te sequencing of genomic DNA (Clark et al., 1994) to determine the methylation status of CpG dinucleo- tides. We analysed 16 CpGs in a 205 bp fragment containing three Sp1 consensus binding sites and the putative transcription and translation initiation sites of RASSF1A. All guanines present after bisul®te sequen- cing in Figure 1 are derived from methylated cytosines on the complementary strand. In Figure 1, one SCLC cell line (H345) shows complete methylation of the Figure 1 Methylation analysis of the RASSF1A gene in primary small cell lung carcinomas. Sequences of PCR products from sequence analysed. Further, we analysed the methyla- bisul®te-treated DNA for the CpG island spanning the RASSF1A tion status of the RASSF1A promoter in 28 primary promoter were obtained from di€erent cancer and normal non-microdissected SCLC samples. Of the 28 samples samples. Methylated cytosines appear as a G signal in the analysed, 22 (=79%) were methylated in the complementary strand (bold Gs). The sequence is shown before and after bisul®te conversion at the top. The position of a TaqI promoter region of RASSF1A. Five matching normal restriction site is underlined. Two Sp1 consensus sites are boxed. tissue samples were available. Several examples, The data shown were obtained by direct sequencing of PCR including two matching tumor and normal tissues, products from bisul®te-treated DNA or from PCR products are shown in Figure 1. One of the normal tissue subcloned into plasmids (two primary tumors and matched samples was methylated, but to a lower degree than normal tissue controls). Small cell lung carcinomas and the corresponding normal lung tissues were obtained from the Aichi the corresponding tumor (25% versus 80%). The Cancer Center Research Institute and the City of Hope National other four normal matching tissue samples were Medical Center. DNA was isolated from tumors, and the unmethylated. In Figure 1, ®ve methylated primary methylation status of the RASSF1A promoter region was small cell lung carcinomas are shown. We estimated determined by a bisul®te genomic sequencing protocol (Clark et al., 1994; Dammann et al., 2000). DNA sequences were ampli®ed from the sequence scans of the uncloned PCR by mixing 100 ng of bisul®te-treated DNA with primers MU379 products that the tumor samples SC-1, SC-3, and (5'-GTTTTGGTAGTTTAATGAGTTTAGGTTTTTT) and SC-7 showed more than 80% bisul®te modi®cation- ML730 (5'-ACCCTCTTCCTCTAACACAATAAAACTAACC) resistant cytosines at all CpGs analysed. In total, more in 100 mMl reaction bu€er containing 200 mM of each dNTP and than 75% of the SCLC samples that were methylated Taq polymerase (Roche Diagnostics Corp.; Indianapolis, IN, USA) and incubating at 958C for 15 s, 558C for 15 s and 748C for contained more than 60% bisul®te-resistant cytosines 30 s, for 20 cycles. A semi-nested PCR was performed using 1/50 at all CpG sequences. This high level of methylation of the initially ampli®ed products and an internal primer ML561 indicates that a large fraction of the tumor cell (5'-CCCCACAATCCCTACACCCAAAT) and primer MU379 population has the promoter of RASSF1A methylated. with similar conditions as described for the preceding PCR ampli®cation, but for 30 cycles. PCR products were initially Since LOH at 3p21.3 occurs in almost 100% of all sequenced directly to obtain average methylation levels and were SCLC tumors (Whang-Peng et al., 1982; Naylor et al., then subcloned for con®rmation 1987; Hibi et al., 1992; Kok et al., 1997; Wistuba et

Oncogene RASSF1A methylation in lung cancer R Dammann et al 3565 al., 2000; Girard et al., 2000; Lindblad-Toh et al., 2000), the remaining allele is silenced by methylation. The high methylation frequency of the RASSF1A promoter correlates well with the high LOH frequen- cies at 3p21.3 generally found in SCLC. Another methodology to analyse the PCR fragments obtained from bisul®te-modi®ed DNA is by further digestion with a restriction enzyme that has a CpG in its recognition sequence (Xiong and Laird, 1997). TaqI (5'TCGA-3')orBstUI (5'CGCG-3') will cut only Figure 2 Methylation analysis of RASSF1A and RASSF1C by previously methylated DNA after bisul®te treatment restriction digestion. PCR products from bisul®te-treated DNA obtained from HeLa cells, primary SCLCs (1 ± 7) and in vitro and PCR. The consensus sequences will be lost by methylated HeLa DNA (Methyl.) were digested (+) or mock- cytosine deamination in unmethylated samples. The digested (7). The sizes of molecular weight markers (M) are analysed 205 bp fragment of RASSF1A contains two shown on the right in base pairs. For the restriction enzyme TaqI restriction sites after bisul®te conversion of CpG analysis of PCR products from bisul®te-treated DNA (Xiong and Laird, 1997), 50 ng of the PCR products were digested with 10 methylated DNA. Restriction digestion of PCR units of TaqI (for RASSF1A) or 10 units of BstUI (for products obtained from DNA methylated at both RASSF1C) according to conditions speci®ed by the manufacturer TaqI sites results in three bands (90, 81 and 34 bp; the of the enzymes (New England Biolabs; Beverly, MA, USA) and two larger ones migrating together). PCR products analysed on 2.2% TBE agarose gels. To determine the obtained from DNA from HeLa cells were unmethy- methylation status of the RASSF1C promoter region, PCR reactions similar to those described in Figure 1 were performed. lated (consistent with expression of RASSF1A in this For the ®rst PCR reaction primers M1305 (5'- cell line; Dammann et al., 2000), whereas in vitro GTTTTTTGTGGTAGGTGGGGTTTG) and M1627 (5'-AATC- methylated HeLa DNA (Methyl.) was digested at these CRAATCCTCTTAACTACAATAACCAC) were used. For the TaqI sites (Figure 2). In Figure 2, we analysed seven nested PCR, the internal primers M1318 (GGTGGGGTTTGTG- AGTGGAGTTT) and M1599 (5'-ACTACTCRTCRTACTACT- primary small cell lung carcinomas by TaqI restriction CCAAATCATTTC) were used (cases SC-1 ± 7). The tumor samples showed approxi- mately 60 ± 95% methylation of the TaqI sites except for sample number SC-2, which was methylated at a level of 30%. For all the analysed SCLCs the results Methylation and LOH are the major loss of function obtained by restriction digestion and direct sequencing pathways for the RASSF1A gene since somatic were practically identical. For almost half of the SCLC mutations appear to be rare in this gene (Dammann cases the methylation levels of these CpG sites were et al., 2000). We have found no mutations in 16 SCLC higher than 80%. cell lines. Epigenetic silencing is a common mechanism For comparison, we analysed the CpG island for loss of tumor suppressor gene function in cancer. promoter of RASSF1C. Expression analysis of Promoter methylation of tumor suppressor genes, such RASSF1C in SCLC cell lines showed no reduction of as p16, and DNA repair genes, such as MGMT,have transcription (Dammann et al., 2000). In order to been detected in DNA from sputum in patients with determine the methylation status of the CpG island squamous cell lung cancer several years before clinical promoter of RASSF1C in primary SCLCs, we diagnosis (Palmisano et al., 2000). A similar methyla- performed restriction analysis of PCR ampli®ed tion analysis of the RASSF1A promoter from sputum bisul®te-modi®ed DNA. The analysed 311 bp promoter of smokers could serve as a sensitive early detection fragment contains 38 CpGs, one Sp1 consensus binding method for small cell lung cancer. This gene may be site and the putative transcription and translation particularly relevant in this type of analysis, since initiation sites of RASSF1C. This methylated fragment RASSF1A promoter hypermethylation is a very has ®ve BstUI sites and digestion results in bands of frequent event, and LOH analysis of the same region 140, 89, 31, 21, 16 and 14 bp. The seven SCLCs with predicts that it might be an early change in the high methylation levels at the CpG island of RASSF1A pathogenesis of lung cancer. showed no evidence for methylation in the CpG island In a recent study, Vos et al. (2000) have shown that of RASSF1C (Figure 2). All analysed SCLCs were RASSF1 binds RAS in a GTP-dependent manner. unmethylated at all CpG sites in the promoter of Over-expression of RASSF1C induced apoptosis (Vos RASSF1C and this was con®rmed by direct sequencing et al., 2000). This pro-apoptotic e€ect of RASSF1C is (data not shown). This shows that methylation of the enhanced by activated RAS and inhibited by dominant RASSF1A CpG island is speci®c for this locus. negative RAS. No epigenetic inactivation of RASSF1C Methylation does not occur on the RASSF1C CpG has so far been shown in lung cancer (Dammann et al., island, which is downstream of the RASSF1A island, 2000; this study). Vos et al. (2000) reported a reduction nor does it occur in the CpG island of the BLU gene, of RASSF1C expression in ovarian tumor cell lines. which is upstream (proximal) of RASSF1A. We did not Since isoforms A and C encode for the identical RAS ®nd any methylation in 20 primary NSCLCs and in 10 association domain, it is possible that RASSF1A binds primary SCLCs in the BLU gene (C-L Chiang, R to RAS in a similar same manner as RASSF1C. Dammann, T Takahashi, GP Pfeifer, unpublished Activated RAS are usually associated with results). growth enhancement and transformation. However,

Oncogene RASSF1A methylation in lung cancer R Dammann et al 3566 RAS also induces growth inhibitory e€ects manifested RASSF1A is close to 80 or 100% by hypermethylation by senescence (Serrano et al., 1997), terminal di€er- and LOH, respectively. This is consistent with the entiation (Bar-Sagi and Feramisco, 1985) or apoptosis possibility that RASSF1A might be the tumor (Mayo et al., 1997; Chen et al., 1998; Downward, 1998; suppressor gene, which is associated with the early Shao et al., 2000). RASSF1 might be responsible for and frequent loss of the 3p21.3 locus in lung cancer the RAS-dependent growth inhibition through its pro- development. apoptotic function (Vos et al., 2000). Loss of RASSF1 expression by methylation in human cancer may shift the balance of RAS activities towards a growth promoting e€ect without the necessity of RAS Acknowledgments activating mutations. Indeed, RAS mutations are This work was supported by a grant from the University of found in less than 1% of SCLCs (Mitsudomi et al., California Tobacco Related Disease Research Program 1991; Wagner et al., 1993), whereas inactivation of (9RT-0175) to GP Pfeifer.

References

Antequera F, Boyes J and Bird A. (1990). Cell, 62, 503 ± 514. Otterson GA, Khleif SN, Chen W, Coxon AB and Kaye FJ. Bar-Sagi D and Feramisco JR. (1985). Cell, 42, 841 ± 848. (1995). Oncogene, 11, 1211 ± 1216. Baylin SB and Herman JG. (2000). Trends Genet., 16, 168 ± Palmisano WA, Divine KK, Saccomanno G, Gilliland FD, 174. Baylin SB, Herman JG and Belinsky SA. (2000). Cancer Baylin SB, Herman JG, Gra€ JR, Vertino PM. and Issa JP. Res., 60, 5954 ± 5958. (1998). Adv. Cancer Res., 72, 141 ± 196. Sekido Y, Ahmadian M, Wistuba II, Latif F, Bader S, Wei Belinsky SA, Nikula KJ, Palmisano WA, Michels R, M-H, Duh F-M, Gazdar AF, Lerman MI and Minna JD. Saccomanno G, Gabrielson E, Baylin SB and Herman (1998). Oncogene, 16, 3151 ± 3157. JG. (1998). Proc. Natl. Acad. Sci. USA, 95, 11891 ± 11896. Serrano,M,LinAW,McCurrachME,BeachDandLowe Chen CY, Liou J, Forman LW and Faller DV. (1998). J. SW (1997). Cell, 88, 593 ± 602. Biol. Chem., 273, 16700 ± 16709. Shao J, Sheng H, DuBois RN and Beauchamp RD. (2000). J. Clark SJ, Harrison J, Paul CL and Frommer M. (1994). Biol. Chem., 275, 22916 ± 22924. Nucleic Acids Res., 22, 2990 ± 2997. Shapiro GI, Park JE, Edwards CD, Mao L, Merlo A, Dammann R, Li C, Yoon JH, Chin PL, Bates S and Pfeifer Sidransky D, Ewen ME and Rollins BJ. (1995). Cancer GP. (2000). Nature Genet., 25, 315 ± 319. Res., 55, 6200 ± 6209. Downward J. (1998). Curr. Opin. Genet. Dev., 8, 49 ± 54. Sundaresan V, Ganly P, Hasleton P, Rudd R, Sinha G, Girard L, Zochbauer-Muller S, Virmani AK, Gazdar AF Bleehen N and Rabbitts P. (1992). Oncogene, 7, 1989 ± and Minna JD. (2000). Cancer Res., 60, 4894 ± 4906. 1997. Hibi K, Takahashi T, Yamakawa K, Ueda R, Sekido Y, Tang X, Khuri FR, Lee JJ, Kemp BL, Liu D, Hong WK and Ariyoshi Y, Suyama M, Takagi H and Nakamura Y. Mao L. (2000). J. Natl. Cancer Inst., 92, 1511 ± 1516. (1992). Oncogene, 7, 445449. Thiberville, L, Payne P, Vielkinds J, LeRiche J, Horsman D, Hung J, Kishimoto Y, Sugio K., Virmani A, McIntire DD, Nouvet G, Palcic B and Lam S. (1995). Cancer Res., 55, Minna JD and Gazdar AF. (1995). JAMA, 273, 558 ± 563. 5133 ± 5139. Jones PA, Wolkowicz MJ, Rideout WM, Gonzales FA, Todd S, Franklin WA, Varella-Garcia M, Kennedy T, Marziasz CM, Coetzee GA and Tapscott SJ. (1990). Proc. Hilliker Jr. CE, Hahner L, Anderson M, Wiest JS, Natl. Acad. Sci. USA, 87, 6117 ± 6121. Drabkin HA and Gemmill RM. (1997). Cancer Res., 57, Jones PA and Laird PW. (1999). Nature Genet., 21, 163 ± 167. 1344 ± 1352. Killary AM, Wolf ME, Giambernardi TA and Naylor SL. Vavvas D, Li X, Avruch J and Zhang X-F. (1998). J. Biol. (1992). Proc. Natl. Acad. Sci. USA, 89, 10877 ± 10881. Chem., 273, 5439 ± 5442. Kohno T and Yokota J. (1999). Carcinogenesis, 20, 1403 ± Vos MD, Ellis CA, Bell A, Birrer MJ and Clark GJ. (2000). J. 1410. Biol. Chem., 275, 35669 ± 35672. Kok K, Naylor SL and Buys CHCM. (1997). Adv. Cancer Wagner SN, Muller R, Boehm J, Putz B, Wunsch PH and Res., 71, 27 ± 92. Ho¯er H. (1993). Virchows Arch. B., 63, 325 ± 329. Lerman MI and Minna JD. (2000). Cancer Res., 60, 6116 ± Wei M-H, Latif F, Bader S, Kashuba V, Chen J-Y, Duh F- 6133. M, Sekido Y, Lee C-C, Geil L, Kuzmin I, Zabarovsky E, Lindblad-Toh K, Tanenbaum DM, Daly MJ, Winchester E, Klein G, Zbar B, Minna JD and Lerman MI. (1996). Lui WO, Villapakkam A, Stanton SE, Larsson C, Hudson Cancer Res., 56, 1487 ± 1492. TJ, Johnson BE, Lander ES and Meyerson M. (2000). Whang-Peng J, Kao-Shan CS, Lee EC, Bunn PA, Carney Nature Biotechnol., 18, 1001 ± 1005. DN, Gazdar AF and Minna JD. (1982). Science, 215, Mayo MW, Wang CY, Cogswell PC, Rogers-Graham KS, 181 ± 182. Lowe SW, Der CJ and Baldwin Jr. AS, (1997). Science, Wingo PA, Ries LA, Giovino GA, Miller DS, Rosenberg 278, 1812 ± 1815. HM, Shopland DR, Thun MJ and Edwards BK. (1999). J. Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger Natl. Cancer Inst.,91, 675 ± 690. PC, Baylin SB and Sidransky D. (1995). Nature Med., 1, Wistuba II., Behrens C, Milchgrub S, Bryant D, Hung J, 686 ± 692. Minna JD and Gazdar AF. (1999). Oncogene, 18, 643 ± Mitsudomi T, Viallet J, Mulshine JL, Linnoila RI, Minna 650. JD. and Gazdar AF. (1991). Oncogene, 6, 1353 ± 1362. Naylor SL, Johnson BE, Minna JD and Sakaguchi AY. (1987). Nature, 329, 451 ± 454.

Oncogene RASSF1A methylation in lung cancer R Dammann et al 3567 WistubaII,BehrensC,VirmaniAK,MeleG,MilchgrubS, Yamakawa K, Takahashi T, Horio Y, Murata Y, Takahashi Girard L, Fondon III, JW, Garner HR, McKay B, Latif F, E, Hibi K, Yokoyama S, Ueda R and Nakamura Y. Lerman MI, Lam S, Gazdar AF and Minna JD. (2000). (1993). Oncogene, 8, 327 ± 330. Cancer Res., 60, 1949 ± 1960. Yatabe Y, Konishi H, Mitsudomi T, Nakamura S and Wu W, Kemp BL, Proctor ML, Gazdar AF, Minna JD, Takahashi T. (2000). Am.J.Pathol.,157, 985 ± 993. Hong WK and Mao L. (1999). Cancer Res., 59, 1846 ± Yokota J, Wada M, Shimosato Y, Terada M and Sugimura 1851. T. (1987). Proc. Natl. Acad. Sci. USA, 84, 9252 ± 9256. Xiong Z and Laird PW. (1997). Nucleic Acids Res., 25, 2532 ± 2534.

Oncogene