(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/178820 Al 19 October 2017 (19.10.2017) P O P C T

(51) International Patent Classification: (72) Inventors: VASUDEVAN, Dr. Sridhar; c/o Oxford Uni A61K 31/44 (2006.01) A61K 31/519 (2006.01) versity Innovation Limited, Buxton Court, 3 West Way, A61K 31/4439 (2006.01) A61K 31/53 (2006.01) Botley Oxford OX2 0JB (GB). JAGANNATH, Dr. Aarti; A61K 31/505 (2006.01) A61P 43/00 (2006.01) c/o Oxford University Innovation Limited, Buxton Court, 3 A61K 31/517 (2006.01) West Way, Botley Oxford OX2 0JB (GB). FOSTER, Prof Russell; c/o Oxford University Innovation Limited, Buxton (21) International Application Number: Court, 3 West Way, Botley Oxford OX2 0JB (GB). PCT/GB20 17/05 1029 (74) Agent: BARKER BRETTELL LLP; 100 Hagley Road, (22) International Filing Date: Edgbaston, Birmingham West Midlands B16 8QQ (GB). 12 April 2017 (12.04.2017) (81) Designated States (unless otherwise indicated, for every (25) Filing Language: English kind of national protection available): AE, AG, AL, AM, (26) Publication Language: English AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, (30) Priority Data: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, 1606622.7 15 April 2016 (15.04.2016) GB HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KH, KN, (71) Applicant: OXFORD UNIVERSITY INNOVATION KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, LIMITED [GB/GB]; Buxton Court, 3 West way, Botley MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, Oxford OX2 0JB (GB). NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS,

[Continued on nextpage]

(54) Title: ADENOSINE RECEPTOR MODULATORS FOR THE TREATMENT OF CIRCADIAN RHYTHM DISORDERS

Figure 1 Figure 1 (57) Abstract: The present invention relates continued A to the use of adenosine receptor modulators to affect the circadian rhythm, in particular,

"Λ to the use of such modulators for the treat ment of circadian rhythm disorders. In par ticular, the invention relates to a com posi hr) tion com prising at least one selective aden osine receptor modulator, wherein said composition modulates two or three, but not

al 1of adenosine receptor subtypes Ai, A 2A , A 2B and/or A for use in the treatment of cir cadian rhythm disorders or for modulating a biological clock.

1 ° Figure 1 Π n continued a WO 2017/178820 Al III I II II 11 I I 11 III III III 11 I III lllll 11 111 llll 11llll

RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT,

TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, VN, ZA, ZM, ZW. SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, (84) Designated States (unless otherwise indicated, for every GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). kind of regional protection available): ARIPO (BW, GH, Published: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, — with international search report (Art. 21(3)) TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, ADENOSINE RECEPTOR MODULATORS FOR THE TREATMENT OF CIRCADIAN RHYTHM DISORDERS

The present inventio n rel ates t o the use of adenosi ne receptor modulators t o affect the circad ian rhyth m, in particu lar, t o the use of such modulators for the treatm ent of circad ian rhyth m disorders. In particu lar, the inventio n rel ates t o a com positio n co mprisi ng at least one sel ective adenosi ne receptor modulator, wherei n sa id co mposition modulates two or t hree, but not all of adenosi ne receptor su btypes Ai,

A2A, A2B and/or A3 for use in the treatm ent of circad ian rhyth m disorders or for modulati ng a biol ogica l clock.

Almost all orga nism s on Ea rth apply an intern al biol ogica l tim er t o antici pate cha nges that acco mpany the daily sol ar cycl e. The possessio n of such an interna l tim er allows orga nism s t o inherently "know" where in the daily sol ar cycle they are, absent of externa l cues. Such intern ally generated daily rhyth ms are called "circad ian rhyth ms", and are endogenous t o the orga nism .

The mecha nism s underlyi ng circad ian rhyth ms involve circad ian oscil latio ns in processes such as gene expression and protei n modificatio ns. A core clock control s t hese circad ian osci llations by sign al generation .

The mammalia n circad ian clock in the bra in conveys 24-ho ur rhyth micity t o rest- activity cycl es, tem peratu re, sleep, and virtua lly all other behaviou ral and physiol ogica l processes. The impositio n of an interna l tem pora l fra mework is an essentia l part of an orga nism' s biol ogy; it allows all of t he interna l processes t o work in harmony, such as gene expressio n, cel l divisio n and meta bol ism. In order for su ch rhyth ms t o be ada ptive, they must be synch ron ised, or entra ined, t o the externa l environ ment, pred ominantly prod uced by the 24 hour light/d ark cycl e due t o the rotation of the Ea rth, and/or t o other entra ining sign als, known as "tim e givers" or zeitgebers.

It is key that circad ian rhyth ms are generated intern ally by t he orga nism, and are not driven by the externa l environ ment. However, these endogenous circad ian rhyth ms are adj usted by environ menta l signa ls, such that they are synch ron ised t o t he externa l cycl e or clock.

In the absence of externa l cues or sign als, the endogenous circad ian rhyth m in a human on average runs sl ightly longer t han 24 hours. Th is may be the case in tota lly blind su bjects who are lacki ng conscious light perception, where the com plete absence of detection of the light/d ark cycle may be sufficient f or the clock t o run free of adj ustm ent based on externa l signa ls. In these cases, the circad ian rhyth m may req uire rea lign ment, such that the interna l clock is running at the sa me tim e as the externa l one.

The interna l circad ian clock has its own tim e, known as circad ian t ime (CT); w hich is a sta nda rd of t ime based on the free-ru nning period of a rhyth m (oscil latio n). Th is may or may not be align ed with the externa l/environ menta l t ime. CT is effectively the interna l tim e (either for the whol e clock or the rel eva nt tissue) . Time rel ative t o the externa l envi ron ment is denoted as ZT or Zeitgeber t ime. Under entra ined cond itio ns,

CTO = ZTO = sta rt of the light phase (typ ica lly 6 or 7 am) and under free-ru nning co nditions, CTO in a human wou ld be the tim e at w hich the onset of activity occu rs.

Determ ining the CT of a tissu e or ind ivid ual is possibl e via testing, as discu ssed later.

The mecha nism underlyi ng the clock is a ubiq uito us cel l auto nom ous tra nscri ption- tra nsl ation feed back loop (TTF L) in w hich the tra nscri ption f actors CLOCK and BMALl drive the expression of Period (Perl/2) and Cryptochrome (Cryl/2), whose protei n prod ucts in t urn feed back t o inhibit CLOC K and BMALl resu lti ng in a negative feed back loop with in a 24 hou r period .

Each individ ual cel l of an orga nism has an individ ual cel lular clock. Individ ual cel lula r clocks are mainta ined in synch rony by a master pacem aker in the su prach iasmatic nuclei (SCN ) in the hypotha lamus. In order t o ada pt t o the externa l 24 hour worl d, the clock must receive and respo nd t o signa ls that provide tem pora l cues

(zeitgebers) . Zeitgebers modulate the tem pora l expression pattern of clock genes such as Perl/2 (Schwa rtz et al., Proc Natl Aca d Sci U S A 108, 17219-17 224, 20 11) t o set the phase, amplitude and period of oscil latio n of t he molecu lar clock. Light, w hich signa ls the dawn-d usk cycl e, drives cAM P response element binding factor (C EB)- mediated tra nscri ption of Per gen es. However, circad ian clocks t hrough out t he body receive inputs from numerous sou rces incl uding food, glucocorticoids and tem peratu re. The molecu la r clock receives envi ronmenta l input t hrough liga nds t hat bind t o cel l-su rface and nucl ear receptors and activate down strea m signa lling pathways t hat co nverge on the TTF L. While a few of t hese pathways are known (e.g.

NMDA receptors signa l light input t o the SCN ), t he majority rem ain unknown .

It is possibl e for cel ls and/or tissues of the body t o have a circad ian rhyth m that has de-synch ron ised with the centra l or SC N rhyth m. In t his scen ario, the cel ls and/o r tissues are running with a diffe rent rhyth m t o t he rest of t he body. Th is can resu lt in pathol ogies devel opi ng in those cel ls and tissues, sin ce inapprop riately tim ed physiologica l processes are underta ken .

For exa mple, it has bee n shown t hat a "fa ulty" or misa ligned circad ian clock in pancreatic tissues may be rel ated t o the devel opm ent of diabetes. (Disru ption of the clock com ponents CLOC K and BMAL1 leads t o hypo ins ulinaem ia and diabetes,

March eva et al, Natu re, 466, 627-63 1, July 20 10) .

When an interna l de-synch rony occu rs between a person's biol ogica l clock and t heir environ menta l 24-hou r sch edule, a grou p of pathol ogies known as circad ian rhyth m disorders can occu r. This de-synch ron isation can occu r in the SC N, and t hus the circad ian rhyth m of the who le body, or can occu r in selected tissues peri phera l t o the

SC N as descri bed above. It is possi ble for either centra l or peri phera l de- synch ron isation t o occu r without any manifest sym pto ms. Where the circad ian rhyth m of a su bject is not synch ron ised t o the extern al/enviro nmenta l clock, it can be sa id t o be free-ru nning. Ulti mately, sin ce a free-ru nning clock can be up t o one hou r longer tha n the externa l clock in illustration, every 12 days, the su bject's circad ian rhyth m will be co mpletely anti phase t o the outside world, and will experience extrem e jet-l ag sym ptom s.

Where the circad ian rhyth m and the extern al/enviro nmenta l clock are de- synch ron ised, t his can have many physiologica l and behaviou ral impacts. Several circad ian rhyth m dysfu nctio ns may resu lt from the lack of synch rony with the externa l clock.

In som e insta nces, de-synch ron isatio n of a person's SC N circad ian rhyth m may be detected sin ce the rest-activity rhyth m cha nges . The t imings of rest and activity can be measu red usi ng an actim etry senso r, for exa mple. A correl atio n has been shown between the non-entra ined drift in the circad ian pha se and t he non-24-h com ponent of t he rest-activity rhyth m in subjects whe n wrist actigra phy data analysed . There is a possib ility that ch ron ic circad ian misa lign ment cou ld also resu lt in adve rse meta bol ic, cogn itive, and emotiona l co nseq uences in su bjects with Non-24 diso rde r

(Em ens, Jonatha n S. et al. " Non-24-H our Disorder in Blind Individ uals Revisited :

Varia bility and the Infl uence of Envi ron menta l Time Cu es." Sl eep 36. 7 (2013) : 109 1-

1100. PMC. Web. 7 Apr. 20 17) .

Circad ian rhyth m misa lign ment or dysfu nctions may be introd uced into an individ ual, such as t hrough pha rmacologica l intervention . For exa mple, it has been shown that som e cancer treatm ents are capable of alteri ng the circad ian rhyth m (Ortiz-Tudel a E., et al, Int. J Ca ncer. 2014 Jun l ;134( l l ):2717-25 .) Such dysfu nctions in the circad ia n rhyth m may be co rrelated with poo rer outcom es for treatm ent, and t hus it is importa nt that these are recogn ised and add ressed . In converse, it is also known that som e protei ns t argeted by pharmacol ogica l agents are expressed only during certa in t imes of day and t his may be out of the patient's wake tim e (e.g. 3am). Under t his circu msta nce it wou ld be of use t o alter the circa dia n rhyth ms t o align t he " drug- t ime" t o the wake tim e.

Circad ian rhyth m misa lign ment may also occu r when individ uals travel across tim e zones. Jet lag, also descri bed as desynch ronosis and circad ian dysrhyth mia, is a physiol ogica l con dition w hich resu lts from rapid long-d ista nce tra ns-m erid ian (east- west or west-east) travel .

Fu rther, circad ian rhyth m misa lign ment may occu r for sh ift workers, who are worki ng in the even ing and overn ight, sin ce they are active during their norm al rest cycle.

Sh ift work disorder is a recogn ised circad ian rhyth m diso rder. Certa in circad ian rhyth m disorders may be circad ian rhyth m sleep diso rders, where the misa lign ment of the circad ian clock manifests in the tim ing of sleep, w hich itself is determ ined from the rest-activity rhyth m.

Cu rrent methods of treatm ent of circad ian rhyth m disorders pri marily centre arou nd bright light thera py and t he use of melato nin recepto r agon ists . These meth ods have t heir drawbacks; they are not uniform ly effective, for exa mple, melaton in has not been shown t o have any effect in Adva nced Sl eep Phase Synd rom e or jet-lag in westwa rd travel, and mixed outcom es are observed with Sh ift Work Disorder and non-24h sleep disord ers. Bright light thera py req uires exposu re t o high level s of light

(2,500- 10,000 lux) at precise tim e win dows each day (reviewed in Zee et al. , 2013,

Circad ian rhyth m abno rma lities. Co nti nuum: Lifel ong Lea rning in Neurol ogy, 19( 1,

Sl eep Diso rders), 132- 147) and for the su bject t o be sighted .

The present inventio n uses the adenosi ne signa lling pathway, a novel and uncha racterized clock-regu latory pathway, as a t arget for thera peutic purposes.

More particu larly, the present inventio n t akes adva ntage of modulati ng at least two adenosi ne receptors, t o uti lise the adenosi ne sign alling pathway t o alter and/o r rea lign the circad ian rhyth m of an individ ual. The present invento rs have rea lised that t o be phys iol ogica lly rel evant and also t olera ble t o the su bject, treatm ent t o move or sh ift a circad ian rhyth m (fo r whatever reason ) req uires the modificatio n of at least two adenosi ne receptor su btypes. This is desira ble; sin ce it wou ld appea r that different adenosi ne receptor su btypes may modulate the circad ian rhyth m via different pathways, and that the cu mulative effect is much more pro misi ng t han singl e receptor modulation . The resu lts incl uded here dem onstrate t hat at least the

A receptor and the A 2A receptor util ise different signa lling pathways, and t hat t he co mbination of modulato rs at these recepto rs sel ectively is adva ntageous in modifying, sh ifti ng or movi ng the circad ian clock or rhyth m of an individ ual. It can been seen from the Figu res and Exa mples that it is only possib le t o induce Perl and

Per2 expression by t argeting two aden osi ne receptor su btypes, in the exa mples these are the A receptor and the A 2A receptor. As used herein, adenosi ne receptors and ade nosi ne receptor su btypes refer t o the Ai, A2A, A 2b and/or A3 receptors or recepto r su btypes.

Modifyi ng a sol e aden osin e receptor su btype using a sol e experi menta l thera peutic is not desi rable, sin ce it has a less potent effect on the circad ian clock, and is f urtherm ore associated with more risk of serious side effects from the treatm ent.

Fo r exa mple, clinica l tria ls for t he use of sel ective A recepto r antagon ists have bee n halted due t o the su bjects sufferi ng seizu res. Therefore, the use of A recepto r antagon ists t o modify the circad ian rhyth m would be co nsidered by t hose in the art t o be co ntra-i ndicated by the risk of serious sid e effects, and t hus the use of these wou ld not be t hera peutica lly rel evant. Moreover, it is also not t hera peutica lly rel evant t o modify all of the aden osi ne receptor su bytpes. Modifyi ng all of the su btypes leads t o unwa nted side effects, sin ce adenosi ne receptors are so ubiq uito usly exp ressed t hrougho ut different tissu es and may have many physiologica l roles. Therefore, the use of caffei ne, w hich antagon ises all types of adenosi ne receptors (A s): Ai, A2A, A3, and A2B, and similar com pou nds falls outside the scope of t his invention . Many of the earliest adenosi ne receptor modulato rs develo ped also wou ld modulate all of the receptor su btypes. Such co mpounds incl ude CGS 15943 .

This latter co mpound can bind t o all fou r adenosin e receptors 3. As such, t his co mpou nd falls outside of the scope of the present invention .

Acco rding t o a f irst aspect the invention provid es an adenosi ne receptor modulator for use in the treatm ent of circad ian rhyth m disord ers.

An adenosi ne receptor modulator refers t o a modulator w hich acts as an agon ist, inverse agon ist or an antagon ist of the aden osi ne receptor. The modulator is prefera bly an antagon ist or inverse agon ist.

An 'adenosi ne recepto r' is a class of purigen ic G protei n-cou pled receptors with adenosi ne as an endogenous liga nd. These receptors are widely distrib uted t hroughout the body and are divided into fou r su bcl asses, w hich incl ude Ai, A2A, A2B and A3 adenosi ne receptors. Adenosi ne f unctions as a signa lling molecu le t hrough the activatio n of t hese fou r disti nct ade nosi ne recepto rs, w hich are widely expressed and have been implicated in severa l biologica l f unctions, both physiol ogica l and pathol ogica l. Aden osine receptors occu r as fou r different su btypes of GPC s, with the Gs co upled A 2A and A2B receptor su btypes and the Gi co upled A and A3 receptor su btypes. Differentia l expression of these receptors can lead t o very different downstrea m effects of adenosine signa lling t hrough diverse effectors.

The adenosi ne receptor t argeted by the modulator or co mposition of the invention may be any adenosi ne receptor, present in any tissue. The adenosi ne receptor may be in the bra in, most nota bly in the hypotha lamus, and most particu larly in the su prach iasm atic nucleus (SC N). The adenosine receptor may be in tissues peri phera l t o the bra in. Tissu e peri phera l t o the bra in may incl ude any cel l type, tissue or orga n w hich does not form part of the bra in. These may be, without limitation : blood and immune system cel ls, bone marrow cel ls, epith elial or ski n cel ls, germ cel ls, co ntractil e and muscl e cel ls, neu ron s, hormo ne-secreting cel ls and secretory cel ls.

These may also be from muscl e, epithel ia l, co nnective and nervous tissue types, more specifica lly tissue or orga ns from the ca rdiovascu lar system, lungs, hea rt, circu latory system, immune or lym phatic system, sto mach, pancreas, liver, spl een, sm all or large intesti ne, reprod uctive tissues, kid neys, bladder or urinary system, muscl e, bone marrow, ski n, endocri ne system or peri phera l nervous system .

The modulator may have good affi nity for the Ai, A2A, A 2b and/or A3 adenosin e receptors, but not all fou r receptor su btypes. Thus, the modulato r w ill have affi nity for and bind t o two or t hree of the Ai, A2A, A2B and/or A3 adenosine receptors, but w ill not bind t o all of t hem. Prefera bly, the modulator w ill have affin ity for and bind t o two of the receptor su btypes, and not have affin ity or bind t o the rem aining two su btypes. The modulator may have affin ity, prefera bly a good affi nity for the A receptor. The modulator may have affi nity, prefera bly a good affi nity for the A2A or

A2B receptor. The modulator may have affin ity, prefera bly a good affin ity for the A2A receptor. The modulator may have affi nity, prefera bly a good affi nity for the A2B receptor. The modulator may have affi nity, prefera bly a good affi nity for the A3 receptor. The modulator may have an affi nity, prefera bly a good affi nity for the A receptor and any one or two of the A2A, A2B and/or A3 receptor su btypes. The modulator may have an affi nity, prefera bly a good affi nity for the A2A receptor and any one or two of the Ai, A and/or A receptor su btypes. The modulator may have 2B 3 an affi nity, prefera bly a good affi nity for the A receptor and any one or two of the 2B

Ai, A 2A and/or A3 receptor su btypes. The modulator may have an affi nity, prefera bly a good affi nity for the A receptor and any one or two of the Ai, and/or A 3 A 2A 2B receptor su btypes. Affi nity may be defi ned as t he ability of the modulato r t o bind t o the cognate recepto r, and be measu red using occu pancy of the receptor. Good affi nity for a receptor in t his co ntext means t hat above about 25% of the recepto rs are occu pied by the modulator. A desi rable affi nity for the recepto r may be in the regio n of 15%-90% recepto r occu pancy, 15% t o 80% occu pancy, 20% t o 70% occu pancy, prefera bly 20% t o 50% occu pancy or 20% t o 40% occu pancy. Affi nity may f urther be defi ned as the proba bility of the modulator occu pyi ng the receptor at any given insta nt.

The modulator or sel ective mod ulato r may bin d t o its cognate adenosi ne receptor via any appropriate mecha nism, incl ud ing allosterica lly or orthosterica lly.

The modulator is prefera bly a sel ective modulator. This modulator may be sel ective for one, two or t hree adenosi ne receptor su btypes, but does not have affi nity for all fou r su btypes. A sel ective modulator is prefera bly sel ective for one or two adenosine receptor su btypes only. Thus, non-sel ective adenosi ne receptor modulators that modulate all of the receptor su btypes do not fall with in the scope of t his aspect of the invention .

In som e embod iments, it is preferred that a com position is provided as the adenosi ne receptor modulator, sa id co mposition co mprisi ng at least one sel ective adenosi ne recepto r modulato r, wherei n sa id com positio n modulates two or t hree, but not all of adenosi ne receptor su btypes Ai, A , A and/or A . It is t hus preferred t o modulate 2A 2B 3 two or t hree, but not all of aden osine receptor su btypes Ai, A , A and/o r A in t he 2A 2B 3 uses and methods of the invention . Optiona lly, the co mpositio n co mprises one or two sel ective adenos ine recepto r modulators that act at eithe r one or two adenosi ne receptor su btypes. These sel ective aden osi ne receptor modulato rs do not have affi nity for the other two receptor su btypes, and prefera bly do not bind or interact at all at these receptors. In som e embod iments, it is preferred t hat the co mpositio n modulates A and A 2A su btypes. embod co and/or A2B receptor In another iment, the mpositio n prefera bly modulates A and A 2A receptor su btypes. In any of these embod iments, it is preferred that none of the other adenosi ne receptor su btypes are modulated . The other receptor su btypes are t hose not specified or listed - i.e. for a specific modulation of the A and receptor su btypes, it is preferred that the A and/or A A 2A 2B 3 receptor su btypes are not modulated . It is preferred t hat a co mpos itio n or sel ective modulator binds only to the A and A receptor su btypes and not to the A and/or 2A 2B

A3 receptor su btypes. Optio nally, the com position can co mprise one sel ective ne od is sel A nd su adenosi m ulato r that ective for the a A2A receptor btypes.

In som e embod iments, the sel ective adenosi ne receptor modulator may have at least

20% affi nity, or at least 30% affi nity, or at least 40% affi nity or at least 50% affi nity or at least 60% affin ity or at least 70% affi nity or at least 80% affin ity or at least 90% affi nity or more for one, two or t hree of the Ai, A , A and A adenosi ne receptors, 2A 2B 3 with the proviso t hat the sel ective adenosi ne receptor modulator or com positio n does not have affi nity for all fou r recepto r su btypes . It is preferred t hat the selective adenosi ne modulator has affi nity for only two receptor su btypes, i.e. it is a dual antago nist or inverse agon ist. The sel ective aden osi ne receptor modulato r may have a unique or specific affin ity for each of its cogn ate receptors. For exa mple, a sel ective adenosi ne receptor modulator may have a 50% affi nity for the A aden osi ne

55% receptor and a affi nity for the A2A adenosine receptor.

In one embod iment, the sel ective adenosi ne recepto r modulator may have at least

20% affi nity, or at least 30% affi nity, or at least 40% affi nity or at least 50% affin ity or at least 60% affin ity or at least 70% affi nity or at least 80% affin ity or at least 90% affi nity or more for t he A adenosi ne receptor. The sel ective modulato r may have a

25% affi nity or more for the A adenosi ne receptor. Preferably, the modulator has

50-70% affi nity for the A adenosi ne receptor. The use of a sel ective aden osi ne receptor modulator aga inst the A receptor alone does not fall with in the scope of t his invention . At least one other adenosi ne receptor must also be modified, eith er by the sa me com pou nd, or by a com bination of sel ective modulators. In another embod iment, the sel ective aden osi ne receptor modulator may have at least 20% affi nity, or at least 30% affi nity, or at least 40% affi nity or at least 50% affi nity or at least 60% affi nity or at least 70% affi nity or at least 80% affi nity or at least 90% affi nity or more for the A 2A receptor. Prefera bly, the adenosi ne receptor modulator has at least 30% affi nity for the A 2A adenosi ne receptor. The sel ective modulator may have a 25% affin ity or more for the A 2A adenosi ne receptor.

Prefera bly, the modulator has 50-70% affi nity for the A 2A aden osi ne receptor. The use of a sel ective adenosi ne receptor modulato r aga inst the A2A receptor alone does not fall with in the scope of t his invention . At least one other adenosi ne recepto r must also be modified, either by the sa me co mpou nd, or by a co mbinatio n of selective mod ulators.

In another embod iment, the sel ective aden osi ne receptor modulator may have at least 20% affi nity, or at least 30% affi nity, or at least 40% affi nity or at least 50% affi nity or at least 60% affi nity or at least 70% affi nity or at least 80% affi nity or at least 90% affi nity or more for t he A2B rece ptor. The sel ective modulato r may have a

25% affi nity or more for the A2B adenosi ne receptor. The sel ective aden osi ne receptor modulator may have at least 30% affi nity for the A2B adenosi ne receptor.

Prefera bly, the modulator has 50-70% affi nity for the A2B adenosine receptor.

In yet anoth er embod iment, t he sel ective adenosin e receptor modulato r may have at least 20% affi nity, or at least 30% affi nity, or at least 40% affi nity or at least 50% affi nity or at least 60% affi nity or at least 70% affi nity or at least 80% affi nity or at least 90% affi nity or more for the A3 adenosi ne receptor. The sel ective modulator may have a 25% affi nity or more for the A3 adenosine receptor. Prefera bly, t he modulator has 50-70% affin ity for the A3 adenosine receptor.

In one aspect of the invention, there is provided a co mposition w hich co mprises one or more sel ective adenosi ne receptor modulators ("sel ective modulator" ). For exa mple, the co mposition may co mprise 1, 2 or 3 sel ective adenosi ne receptor modulators, prefera bly 2, each of w hich is specific for a particu lar adenosi ne receptor su btype. Each of the sel ective modulators can be defi ned as descri bed above, and each may have a different affi nity for t heir cogn ate receptor. One sel ective adenosi ne receptor modulator can be used in the co mpositio n t hat is sel ective for two adenosi ne receptor su btypes, in co mbination with a secon d sel ective adenosi ne receptor modulator t hat is sel ective for a t hird aden osi ne recepto r subtype. Alternatively, t hree individ ual sel ective modulato rs cou ld be used, each of which modulate a different adenosi ne receptor.

Affi nity as used herei n may co rrel ate with receptor occu pancy, such t hat an affin ity of at least 20% wou ld co rrel ate with an occu pancy of at least 20%, t hat is, at least

20% of the expressed receptor is occu pied by the modulator. Receptor occu pancy can be quantified by routine methods, incl uding flow cyto metry assays and rad iol iga nd binding assays. Occu pancy of at least about 25% is desi rable t o indicate t hat the modulato r has a good affin ity t o the receptor.

It is a preferred featu re of the inventio n that som e, but not all of the aden osi ne receptor su btypes are modified . Where it is desired that a particu lar or specified adenosi ne receptor su btype is not modified, t hat modulator or co mpositio n has limited or no affi nity for t hat adenosi ne receptor su btype. This means t hat the adenosi ne receptor modulator or co mpositio n shows less tha n 10% affin ity, prefera bly less tha n 9, 8, 7, 6, 5, 4, 3, 2 or 1 % affi nity for the specified aden osi ne receptor su btype. In a preferred embod iment, the adenosi ne receptor modulator or co mposition shows no affi nity for the specified adenosi ne recepto r su btype. The adenosi ne receptor modulator prefera bly does not bind t o or interact with t he specified receptor su btype. The "specified" receptor su btype can be identified by omission . For exa mple, if a sel ective modulator is descri bed as acti ng sel ectively at the A and adenosi ne recepto rs, t hen by its natu re, it does not act at the A and A 2A 2B A adenosi ne recepto rs. The modulator of the inventio n may be a modulator of A , 3 2A A and/or A adenosi ne recepto rs. It is preferred in t his embod iment t hat the 2B 3 modulator is not a modulato r of the A adenosine receptor.

The sel ective modulator of the inventio n may be a modulator of Ai, A and/or A 2A 2B ade nosi ne receptors. It is preferred in t his embod iment that the sel ective modulator is not a modulator of the A3 adenosine receptor. The sel ective modulato r of t he invention may be a mod ulator of A and A 2A adenosi ne recepto rs. It is preferred in t his embod iment that the sel ective modulator is not a modulator of t he A2B or A3 adenosine receptors.

In an aspect of the inventio n the modulator, sel ective modulator or co mposition is intended t o modulate aden osi ne recepto rs in the bra in, prefera bly in the hypotha lamus, optio nally in t he SC N.

In another aspect of the invention, the modulator, sel ective modulator or co mposition is intended t o modulate adenosi ne receptors in the lung. This may be used t o manage or treat asth ma.

In anoth er aspect of t he inventio n, it is inte nded t o modulate ade nos ine receptors in the pancreas. This may be used t o manage or treat diabetes.

In a f urther aspect of the invention, it is intend ed t o modulate the aden osi ne receptors in a specific cel l type, tissue type or orga n. This may be any cel l type, tissue type or orga n. Exem plary cel l types incl ude but are not limited t o: blood and immune system cel ls, bone marrow cel ls, epith elial or ski n cel ls, germ cel ls, co ntractil e and muscl e cel ls, neu ron s, hormo ne-secreting cel ls and secretory cel ls.

These may also be from muscl e, epithel ia l, co nnective and nervous tissue types, more specifica lly tissue or orga ns from the ca rdiovascu lar system, lungs, hea rt, circu latory system, immune or lym phatic system, sto mach, pancreas, liver, sp leen, sm all or large intesti ne, reprod uctive tissues, kid neys, bladder or urinary system, muscl e, bone marrow, ski n, endocri ne system or peri phera l nervous system .

In one aspect, the invention provides a co mpos ition com prisi ng at least one sel ective adenosi ne receptor modulator, wherei n sa id co mposition modulates two or t hree, but not all of adenosi ne receptor su btypes Ai, A2A, A 2b and/or A3 for use in the treatm ent of circad ian rhyth m disorders or for modulati ng a biol ogica l clock.

Optio nally, the co mpositio n is sel ective for A and A2A adenosi ne receptors. It is preferred in t his embod iment t hat the com positio n does not com prise a modulator of the A or A adenosi ne receptors. 2B 3

A sel ective adenosi ne receptor modulator is as descri bed here previously. Si milarly, a circad ian rhyth m disord er and modulatio n of a biol ogica l clock are as defin ed herei n.

It may be des ira ble t o modulate a biol ogica l clock, also known as a circa dian clock, in situations where the individ ual' s circad ian rhyth m is not otherwise distu rbed . It has been fou nd t hat the tim ings of som e pha rma col ogica l interventions are importa nt in rel ation t o t heir effectiveness, as they may t arget a particu lar cel lular f unction that occu rs at that "circad ian t ime: CT" . For exa mple, it has bee n found that CT 15 (10p m if synch ron ised with the externa l clock) may be an effective tim e t o administer certa in chemothera py drugs (Levi Fet al, Circad ian tim ing in cancer treatm ents. Annu

Rev Pha rmacol Toxicol . 20 10; 50: 377-42 1.) This is not a socia lly accepta ble tim e for the patient or physicia n t o be administeri ng drugs. Therefore, it is possib le t o modulate t heir biol ogica l clock, su ch that it is put out of synch rony with the extern al clock. Thus, the administratio n of sel ective modulator or co mposition may be used t o sh ift the biol ogica l clock t o bri ng the effective CT tim e for treatm ent t o a better externa l tim e.

Alternative rea sons t o modulate the biol ogica l clock may include internatio nal travel, prepa ration for sh ift work, or other socia l, non-hea lth related reasons for wish ing t o modify the rest-activity cycl es.

Thus, t he present inventio n encom passes non-m edica l methods of treatm ent, such as a method of modulati ng a biol ogica l clock com prisi ng the administratio n of a co mposition co mprisi ng at least one sel ective adenosi ne receptor modulator, wherei n sa id co mposition modulates two or t hree, but not all of aden osi ne recepto r su su btypes Ai, A 2A, A 2b and/o r A3. Option ally two adenosi ne recepto r btypes are modulated . Method s of medica l treatm ent a method of modulati ng a biol ogica l clock or treating a circad ian rhyth m disord er or dysfu nction, com pris ing t he ad ministration of a co mposition com prisi ng at least one sel ective adenosi ne receptor modulator, wherei n sa id co mposition modulates two or t hree, but not all of aden osi ne recepto r su btypes Ai, A , and/or A are also encom passed where allowa ble. 2A A 2b 3

Fu rther, the present inventio n incl udes a co mpositio n co mprisi ng at least one sel ective adenosi ne receptor modulato r, wherei n said com positio n mod ulates two or t hree, but not all of adenosi ne receptor su btypes Ai, A , and/or A for use in 2A A 2b 3 circad ia rea ign co is sel n l ment. Optiona lly, the mpositio n ective for A and A2A adenosi ne receptors. It is preferred in t his embod iment t hat the co mpositio n does not co mprise a modulator of the A or A adenosi ne receptors. 2B 3

Add itiona lly, the present inventio n extends t o a method of rea lign ment of the circad ian rhyth m com prisi ng the once a day administratio n of a com pou nd co mprisi ng at least one sel ective adenosi ne receptor modulator, wherei n sa id co mposition modulates two or t hree, but not all of adenosi ne receptor su btypes Ai,

A , A and/or A . Optio nally, the co mposition is sel ective for A and A adenosi ne 2A 2B 3 2A recepto rs. It is preferred in t his embod iment t hat the com position does not co mprise a modulato r of the A or A adenosine receptors. 2B 3

The present inventio n also incl udes a co mpositio n co mprisi ng at least one sel ective aden osi ne receptor modulator, wherei n sa id co mposition mod ulates two or t hree but not all of adenosi ne receptor su btypes Ai, A , A and/or A for use in circad ian 2A 2B 3 rea lign ment or adj ustm ent by administratio n once a day. Optio nally, the co is sel aden osi ne is is mposition ective for A and A2A receptors. It preferred in t h embod iment that the co mposition does not com prise a modulator of the A or A 2B 3 adenosi ne receptors.

It is preferred for all aspects and embod iments of the inventio n t hat the modulator, sel ective modulator or co mposition is administered once a day. This once a day administratio n sends a powerfu l signa l t o alter the circad ian rhyth m, and repeated administrations with in a 24 hou r period shou ld not be necessa ry or desira ble.

The tim ing of t his singl e administratio n alters the circad ian rhyth m or clock profou ndly. In order t o adva nce the circad ian rhyth m or biol ogica l clock of an individ ual (or a cel l, tissue or orga n t hereof) accord ing t o any aspect or embod iment of the invention, it is preferred t o administer the modulator, sel ective modulator or co mpositio n betwee n about CT4 t o 8, prefera bly between CT5 and 7, or at CT6. To "adva nce" the circad ian rhyth m means t o bri ng the rhyth m forwa rds in the externa l day.

In order t o del ay the circad ian rhyth m of an individ ual (or a cel l, tissue or orga n thereof) accord ing t o any aspect or embod iment of the invention, it is preferred t o administer the modulator, sel ective modulator or co mpositio n between about CT14 t o 18, prefera bly between CT15 and 17, or at CT16. To "del ay" the circad ian rhyth m means t o push the rhyth m backwa rds in the externa l day.

The modulator, sel ective modulato r or com position of the inventio n may res ult in an increase in Perl gene expression after administratio n t o a su bject. Prefera bly the increase is observed at least 2 t o 6 hours after administration, prefera bly at least 4 hours after administratio n. The increase in Perl expression may be about 10%, about

20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about

90%, about 100% or more increase in expression co mpared t o in a su bject witho ut the administratio n of the modulator. The increase in Perl expression may be determ ined at the NA or the protei n level .

The modulator, sel ective modulato r or co mposition of the inventio n may resu lt in an increase in Per2 gene expression after administratio n t o a su bject. Prefera bly the increase is observed at least 2 t o 6 hours after administration, prefera bly at least 4 hou rs after administration . The increase in Per2 expression may be about 10%, about

20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about

90%, about 100% or more increase in expression co mpared t o in a su bject witho ut the administration of the modulator. The increase in Per2 expression may be determ ined at the RNA or t he protein level .

An increase in both Perl and Per2 gene expression may be observed, and is desira ble. In som e embod iments, aden osi ne receptor modulators, sel ective modulators or co mpositions in accorda nce with the present inventio n may be used to treat, alleviate, ameliorate, rel ieve, del ay onset of, inhibit progressio n of, red uce severity of, and/or red uce inciden ce of one or more sym ptom s or featu res of a circad ia n rhyth m disorder.

In som e embod iments, aden osi ne receptor modulators, sel ective modulators or co mpositions in accorda nce with the present inventio n may be used to treat, alleviate, ameliorate, rel ieve, del ay onset of, inhibit progressio n of, red uce severity of, and/or red uce inciden ce of one or more sym ptom s or featu res of a circad ia n rhyth m dysfu nction .

In som e embod iments, adenosi ne receptor modulators, sel ective modulator or co mposition in accorda nce with the present inventio n may be used for modulati ng a biol ogica l clock or circa dian rea lign ment. Modulatio n of the clock may occu r when it is desi red to t ake a circad ian clock out of align ment with the current externa l clock, and rea lign ment may be used to put it back into the co rrect align ment with the externa l clock. Either or both may be req uired when assisti ng the effective t iming of pha rmacologica l or oth er thera peutic interventions.

The circad ian rhyth m disorder may be a circad ia n rhyth m sleep disorder, or a circad ian rhyth m dysfu nction . The circad ian rhyth m sleep disorder may incl ude, but is not limited to, jet-l ag disord er or rapid t ime zone change syn drom e, del ayed sleep- phase disorder, adva nced sleep-phase disorder, Irregu lar sleep wake rhyth mic diso rder, non-24-ho ur sleep wake diso rder, sh ift-work diso rder, or disru ptive circad ian rhyth ms. The circad ian rhyth m disorder may be non-24-ho ur sleep wake disorder in anophth almic su bjects. The circad ian rhyth m disorder may be sh ift-wo rk disorder. The circad ian rhyth m disorder may be jet-l ag disorder. The circad ian rhyth m disorder may be adva nced sleep phase disord er.

The circad ian rhyth m dysfu nctio n may be any detected desynch ron isatio n of the SC N circad ian rhyth m or individ ual peri phera l tissue circad ian rhyth m, which are prefera bly not presenting as a circad ian rhythm sleep disorder. It is possib le t o detect desynch ron isation of a circad ian rhyth m with the externa l clock by various means. For exa mple, an actim etry sensor or simila r can be used t o monitor periods of rest and activity. Other appro priate measu rem ents can be horm one levels, blood pressu re, hea rt rate and the like. For specific tiss ues, measu rem ents of meta bolites, hormo ne levels, gene expressio n or protei n mod ification can give an indicatio n of the circad ian rhyth m in that tissu e, cel ls or orga n. These tissu es, cel ls and orga ns are as defi ned previously.

The ade nos ine receptor antago nist may be any agent t hat inhibits or antagon izes the adenosi ne receptor. Si mila rly an adenosi ne receptor agon ist may be any agent that activates or acts as an agon ist t o the aden osi ne receptor. Such an antago nist or agon ist may be a sm all molecu le, a peptide, a protei n, an NA thera py, such as an si RNA, or an anti body or anti body fragment, particu larly a monoclona l anti body.

Prefera bly, the antago nist or agon ist is a sm all molecu le.

The sel ective adenosi ne receptor antago nist may be any agent t hat inhibits or antagon izes the specified adenosi ne receptor. Si milarly a selective adenosi ne receptor inverse agon ist may be any agent that acts at a constitutively active adenosi ne receptor t o decrease the activity below the basa l level of the aden osi ne receptor. The basa l level of activity is measu red in the absence of adenosi ne.

Antagon ists and inverse ago nists can, therefore, have a similar effect t o decrease the activity of the receptor in relatio n t o the natu ral liga nd, adenosi ne.

Such an antagon ist, agon ist or inverse agon ist may be a sm all molecu le, a peptide, a polypeptid e, a protei n, a non -cod ing RNA, such as a short hairpi n RNA (sh RNA), antisense RNA (as RNA), micro RNA (miRNA), sm all interferi ng RNA (si RNA), tra n s acting RNA (tasi RNA), antagom irs, apta mers, miRNA sponges, and any oth er f unctiona l RNA, or an antibody, antibody fragm ent or derivative of an anti body, particu larly a monoclona l antibody. Prefera bly, the antagon ist or inverse agon ist is a sm all molecu le.

The ago nist, inverse ago nist or antago nist may be a rep urposed known molecu le or a novel molecu le. Exem plary adenosi ne receptor agon ists and antagon ists incl ude: l-Deoxy-l- [6-[( (3- lodophenyl )methyl )amino]-9H-pu rin-9-yl ]-N -methyl - -D- ribofu ranurona mide, N -(3-l odobenzyl )adenosi ne-5'-N -methyl urona mide, also known as IB-M eca and is an A3 adenosin e receptor agon ist

2-[ [6-Am ino-3, 5-d icya no-4-[4-(cyclo propyl methoxy) phenyl ]-2-pyrid inyl]th

aceta mide, also known as BAY-606583 and is an A2B receptor agon ist

3-[4-[2-[ [6-a mino-9-[( 2R, 3R,4S, 5S)-5-(ethylca rba moyl )-3,4-d ihyd roxy-oxol an-

2-yl ] purin-2-yl] amino] ethyl ]phenyl ]propa noic acid, also known as CGS2 1680

and is an A 2A receptor agon ist. 2-a mino-8-[2-(4-m orpho linyl )ethoxy] -4-phenyl -5 H-indeno [l ,2-d] pyrim idin-5-

one, also known as JNJ40255293 and is an A2A/AI receptor antagon ist.

8-[(f)-2-(3,4-d imethoxyphenyl )vinyl ]-l,3-d iethyl -7-m ethyl -3,7-d ihyd ro-lH- purine-2,6-d ione, also known as Istradefyl line and is an A2A recepto r antagon ist.

4-( 2-(7-a mino-2-(fu ran-2-yl )-[ l ,2,4]triazol o[l ,5-a] [l,3,5]triazi n-5- yla mino)ethyl )phenol, also known as ZM 241385 and is an A 2A recepto r antagon ist. 9-Ch loro-2-( 2-fu ranyl )-5-( (phenyl acetyl )amino)-[ 1, 2,4]triazolo [l,5-c] quinazol ine, also known as M RS-12 20 and is an A3 receptor antagon ist.

3-[(4-a mino-3-m ethyl phenyl )methyl ]-7-fu ran-2-yltriazol o[5,4-d] pyrim idin-5- amine, also known as vipadena nt and is an A 2A receptor antagon ist. 2-( 2-Fu ranyl )-7-[ 2-[4- [4-( 2-m eth oxyethoxy) phenyl ]-l-pi perazi nyI] ethyl ]7H- pyrazol o[4, 3-e] [l ,2,4] triazol o[l ,5-c] pyri midine-5-a mine, also known as prelad ena nt and is an A 2A recepto r antagon ist.

4-hyd roxy-/V - (4-m ethoxy-7-m orpho linobenzo [d]th iazol -2-yl )-4- methyl piperid ine-l-ca rboxa mide, also known as tozadena nt and is an A 2A receptor antagon ist. 2-butyl-9-methyl-8-(triazol-2-yl)purin-6-amine (ST-1535) is a A2Areceptor antagonist.

- (6- Ami no-9-methyl-8-(2H-l,2,3-triazol-2-yl)-9H-purin-2-yl)buta n-2- one

(ST4206) and is a A 2A receptor antagonist.

Preferred are dual-ta rgeti ng sel ective adenosine receptor modulators, such as ST-

1535 and JNJ40255 293. Optiona lly, the sel ective adenosi ne receptor modulator is

JNJ40255293. These are sel ective A 2A/AI receptor antagon ists.

In an aspect of the invention, the modulator or sel ective adenosine modulato r is not caffei ne, since caffei ne works as a nonselective modulator of aden osi ne receptors (Ai, A2a, A2b and A3). Caffeine is not recom mended by hea lth care professiona ls w here a su bject is havi ng difficu lties in t heir rest-activity cycles. Indeed, if the t iming of sleep for an individ ual is an issu e, t hey are reco mmended t o avoid sti mulants su ch as caffei ne altogeth er. Other nonselective antago nists or inverse agon ists are simila rly not recom mended .

The scope of the inventio n embraces all pha rmaceutica lly accepta ble sa lt forms of adenosi ne receptor antagon ists, inverse agon ists and agon ists, incl uding any of t he above-descri bed specific co mpou nds, w hich may be form ed, e.g., by protonation of an ato m carryi ng an electron lon e pair w hich is su sceptibl e t o protonation, such as an amino grou p, with an inorga nic or orga nic acid, or as a sa lt of a carboxyl ic acid gro up with a physiol ogica lly accepta ble cation as they are wel l-kn own in t he art. Exem plary base add ition sa lts co mprise, for exa mple: alkali meta l sa lts such as sod ium or potassiu m sa lts; alkaline earth meta l sa lts such as calcium or magnesi um sa lts; zinc sa lts; ammonium sa lts; aliphatic amine sa lts such as trim ethyl amine, triethyl amine, dicycloh exyl amine, etha no lamine, dietha nola mine, trietha no lamine, proca ine sa lts, megl umine sa lts, ethyl ened iamine sa lts, or choline sa lts; aralkyl amine sa lts such as

Ν,Ν-dibenzyl ethyl enediamine sa lts, benzath ine sa lts, beneth amine sa lts; heterocycl ic arom atic amine sa lts such as pyrid ine sa lts, pico line sa lts, quinol ine sa lts or isoq uinol ine sa lts; quaterna ry ammonium sa lts such as tetra methyl ammonium sa lts, tetraethyl ammonium sa lts, benzyltrim ethyl ammonium sa lts, benzyltriethyla mmonium sa lts, benzyltri butyla mmonium sa lts, methyltrioctyla mmonium sa lts or tetra butyla mmonium sa lts; and basic amino acid sa lts such as argi nine sa lts, lysi ne sa lts, or histid ine sa lts. Exem pla ry acid add ition sa lts co mprise, for exa mple: minera l acid sa lts such as hyd roch loride, hyd rob rom ide, hyd roiod ide, su lfate sa lts, nitrate sa lts, phosphate sa lts (such as, e.g., phosph ate, hyd rogen phosphate, or dihyd rogen phosph ate sa lts), carbonate sa lts, hyd rogenca rbo nate sa lts or perch lorate sa lts; orga nic acid sa lts such as acetate, propionate, butyrate, penta noate, hexa noate, hepta noate, octa noate, cycl openta nep ropion ate, deca noate, undeca noate, oleate, stea rate, lactate, maleate, oxa late, f umarate, t artrate, malate, citrate, succinate, glyco late, nicotinate, benzoate, sa licyl ate, ascorbate, or pamoate (em bonate) sa lts; su lfo nate sa lts such as metha nesu lfo nate (mesylate), etha nesu lfonate (esylate), 2-hyd roxyetha nesu lfonate (iseth ionate), benzenesu lfon ate (besyl ate), p-to luenesu lfonate (tosylate), 2- naphtha lenesu lfo nate (napsyl ate), 3-ph enyl su lfo nate, or camphorsu lfonate sa lts; and acid ic amino acid sa lts su ch as aspa rtate or gluta mate sa lts.

Also incl uded with in the scope of pha rmaceutica lly accepta ble co mpositions are co- crysta llised com ponents. Co-crysta ls are multi-com ponent crysta ls based on hyd rogen bond ing interactions without the tra nsfer of hyd rogen ions t o form sa lts.

Co-crysta ls have been descri bed of vario us orga nic su bsta nces and given variou s names, such as add itio n co mpou nds, molecu lar co mplexes, and heterom olecu lar co- crysta ls. Multi-com ponent crysta lline materia ls like co-crysta ls offer the prospect of optim ised physica l pro perties. Co-crysta lline sa lts are also envisaged .

A peptide may include a co mpound co nta ining two or more amino acids in w hich the carboxyl grou p of one acid is linked t o the amino grou p of the other.

An si RNA is a nucl eic acid that is a short, 15-50 base pairs and prefera bly 21-25 base pairs, double stra nded ribon ucleic acid . The term nucleic acid is a term of art that refers t o a polymer conta ining at least two nucl eotid es. Natu ral nucleotides conta in a deoxyri bose (DNA) or ribose (RNA) gro up, a phosphate grou p, and a base. Bases incl ude purines and pyri midines, w hich f urth er incl ude the natu ral com pou nds aden ine, thym ine, guanine, cytosi ne, uracil, inosine, and natu ral analogues. Synthetic derivatives of purines and pyri midines include, but are not limited to, modificatio ns w hich place new reactive grou ps on the base such as, but not limited to, amines, alcohol s, t hiol s, carboxylates, and alkyl halides. The term base enco mpasses any of the known base analogues of DNA and RNA incl uding, but not limited to, 4- acety Icytosi ne, 8-hyd roxy-N 6-m ethyl adenosine, azi rid inylcytosi ne, pseudoisocytosine, 5-(ca rboxyhyd roxyl methyl ) uracil, 5-fl uorou raci l, 5-bro mouraci l,

5-ca rboxymethyla minomethyl -2-th iou raci l, 5-ca rboxym ethyla minom ethyl uracil, dihyd rou raci l, inosin e, N6-isopentenyladen ine, 1-m ethyl aden ine, 1- methyl pseud ouraci l, 1-m ethylgu anine, 1-m ethyl inosi ne, 2,2-d imethylgua nine, 2- methyl aden ine, 2-m ethylgu anine, 3-m ethyl cytosine, 5-m ethyl cytosi ne, N6- methyl aden ine, 7-m ethylgu anine, 5-m ethyl amino methyl uraci l, 5- methoxya minomethyl -2-th iou raci l, beta-D-m annosylq ueosine, 5'- methoxyca rbonyl methyl uraci l, 5-m ethoxyu raci l, 2-m ethylth io-N 6- iso pentenyl aden ine, uraci l-5-oxyacetic acid methylester, uraci l-5-oxyacetic acid, oxybutoxosi ne, pseudo uraci l, queosi ne, 2-th iocytosin e, 5-m ethyl -2-th iou raci l, 2- t hiou raci l, 4-th iou raci l, 5-m ethyl uraci l, N-uraci l-5-oxyacetic acid methylester, uracil-

5-oxyacetic acid, pseudo uraci l, queosi ne, 2-th iocytosin e, and 2,6-d iaminop urine.

Nucl eotides are the monom eric units of nucleic acid polym ers and are linked together t hrough the phosp hate grou ps in natu ral polyn ucl eotides. Natu ral polyn ucl eotides have a ribose-phosphate backbon e. Artificia l or synth etic polyn ucl eotides are polym erized in vitro and co nta in the sa me or simila r bases but may conta in a backbo ne of a type other tha n the natu ral ribose-phosphate backbone.

These backbones incl ude, but are not limited t o: PNAs (peptide nucleic acid s), phosph oroth ioates, phosphorod iamidates, morp hol inos, and other varia nts of the phosphate backbon e of natu ral polyn ucleotides.

The si RNA conta ins seq uence that is identica l or nea rly identica l t o a portion of a gene. RNA may be polymerized in vitro, recom bin ant RNA, co nta in chimeric seq uences, or derivatives of these grou ps. The si RNA may conta in ribon ucleotides, deoxyri bon ucleotides, synth etic nucl eotides, or any su ita ble co mbinatio n such that expression of t he t arget gene is inhibited . The RNA is prefera bly double stra nded, but may be single, tri ple, or quad ruple stra nded . An exa mple of a singl e stra nd si RNA is an si RNA with a hairpin loo p.

A protei n refers herei n t o a linea r series of greater tha n 2 amino acid resid ues co nnected one t o another as in a polypeptide. A "thera peutic" effect of the protei n in atten uating or preventi ng the disease state can be accom plished by the protei n either stayi ng with in the cel l, rem aining attached t o the cel l in the membra ne, or bei ng secreted and dissociated from the cel l where it can enter the genera l circu lation and blood .

The term "antibody" enco mpasses polycl ona l or monoclona l anti bod ies, natu ral, synthetic or reco mbina nt antibod ies, camel id singl e-dom ain anti bod ies, chimeric antibod ies such as a humanized anti bod ies, and the fragm ents thereof (e.g. Fa b'2, Fa b, Fv, scFv) havi ng reta ined t heir abil ity t o act as agon ist or antagon ist of an adenosi ne receptor.

The modulators, sel ective modulators or com positio ns of the inventio n may also be provided as pro-d rugs or any other bioprecu rso r which are converted in use into the active agents.

It will be appreciated that the term "treatm ent" and "treati ng" as used herein means the management and care of a su bject for the purpose of co mbating a cond ition, such as a disease or a disorder. The term is inten ded t o incl ude the f ull spectru m of treatm ents for a given con dition from which the su bject is sufferi ng, such as administratio n of the adenosi ne receptor modulator t o alleviate the sym ptom s or co mplications, t o del ay the progressio n of the disease, disorder or cond ition, t o alleviate or rel ief the sym ptom s and co mplications, and/o r t o cure or eliminate the disease, disorder or con dition as wel l as t o prevent the co ndition, whe rei n prevention is t o be understood as the management and care of a su bject for the purpose of co mbating the disease, co ndition, or disorder and incl udes the administratio n of the adenosi ne recepto r modulato rs t o prevent the onset of t he sym ptom s or co mplications. The su bject t o be treated is prefera bly a mammal, in particu lar a human, but it may also incl ude animals, such as dogs, cats, horses, cows, sheep and pigs.

Acco rding t o a f urther aspect the inventio n provides the use of an aden osi ne receptor modulator, sel ective modulator or co mpositio n accord ing t o the invention in the manufactu re of a med ica ment for the treatm ent of circad ian rhyth m disorders.

The circad ian rhyth m disord er may be a circad ian rhyth m dysfu nctio n or a circad ia n rhyth m slee p disorder. As used herei n, circad ian rhyth m dysfu nctio ns do not incl ude circad ian rhyth m sleep diso rders.

Accord ing t o a f urther aspect, the inventio n provides a use of the adenos ine receptor modulato r, sel ective modulator or com positio n accord ing t o the inventio n in the treatm ent of circad ian misa lign ment. Acco rding t o a yet f urther aspect, the inventio n provides a use of the adenosi ne receptor modulator, sel ective modulator or co mpositio n accord ing t o the invention for modifyi ng a biol ogica l clock. The modulation may be t o del ay or adva nce the biol ogica l clock with respect t o t he externa l or environ menta l clock depen ding on the t iming of the drug administratio n.

The inventio n also provides a pha rmaceutica l co mposition co mprisi ng an adenosi ne receptor modulator, sel ective modulator or co mpositio n accord ing t o the invention and a pharmaceutica lly accepta ble carrier.

Pha rmace utica l com position s t o be used com prise a thera peutica lly effective amount of an adenosi ne receptor modulator, sel ective modulator or co mpositio n or a pha rmaceutica lly accepta ble sa lt or other form thereof, together with one or more pha rmaceutica lly accepta ble exci pients, such as carriers, diluents, f illers, disintegra nts, lubricati ng agents, binders, co lora nts, pigm ents, sta bilizers, preservatives, antioxida nts, and/o r sol ubility enhancers.

The pha rmaceutica l co mpositions can be form ulated by tech niques known in the art, such as the tech niques publish ed in Rem ington 's Pha rmaceutica l Sciences, 20th

Ed ition . The pha rmaceutica l co mpositio ns can be form ulated as dosage form s for ora l, parentera l, such as intra muscu lar, intravenous, su bcuta neous, intraderm al, intra arteria l, intraca rdial, recta l, nasa l, t opica l, aeroso l or vagi nal ad ministration . The pha rmaceutica l co mpositio n may be form ulated as a dosage form for oral administratio n.

Dosage form s for ora l administratio n incl ude coated and uncoated t ablets, soft gelati n capsu les, hard gelati n ca psu les, lozenges, troches, sol utions, emulsions, suspensions, syru ps, elixi rs, powders and gra nules for reconstitution, dispersi ble powders and gra nules, medicated gums, chewi ng t ablets and effervescent t ablets.

Dosage form s for parentera l administratio n incl ude sol utions, emulsio ns, suspensions, dispersio ns and powders and gra nules for reconstitution . Em ulsio ns are a preferred dosage form for parentera l administration . Dosage form s for recta l and vagi nal administration incl ude su ppositories and ovu la. Dosage form s for nasa l administratio n can be administered via inhalation and insufflation, for exa mple by a metered inhaler. Dosage form s for t opica l administratio n incl ude crea ms, gel s, ointm ents, sa lves, patches and tra nsd erm al del ivery system s.

The adenosi ne receptor modulator, sel ective modulato r, co mposition or the above- descri bed pha rmaceutica l co mpositions com prisi ng one or more adenosi ne recepto r agon ists/i nverse agon ists/a ntagon ists may be administered t o the su bject by any co nvenient route of administration, whether system ica lly/peri phera lly or at the site of desi red action, incl uding but not limited t o one or more of: ora l (e.g., as a t ablet, capsu le, or as an ingestibl e sol ution ), t opica l (e.g., tra nsderm al, intra nasa l, ocu lar, bucca l, and su blingua l), parentera l (e.g., usi ng injection tech niques or infu sion tech niq ues, and incl uding, for exa mple, by inj ection, e.g., su bcuta neo us, intraderm al, intra muscu lar, intravenous, intraa rteria l, intraca rdiac, intratheca l, intraspi nal, intraca psu lar, su bca psu lar, intrao rbita l, intra perito nea l, intratrachea l, su bcuticu lar, intra articu lar, su barach noid, or intrastern al by, e.g., implant of a depot, for exa mple, su bcuta neou sly or intra muscu larly), pulmona ry (e.g., by inhalatio n or insuffl atio n thera py usi ng, e.g., an aerosol, e.g., t hrough mouth or nose), gastroi ntesti nal, intra uteri ne, intra ocu lar, su bcuta neous, ophtha lmic (incl uding intravitrea l or intraca mera l), recta l, and vagi nal.

If the modulators, sel ective modulators, co mpositio ns or the pha rmaceutica l co mpositions are administered parentera lly, t hen exa mples of such administratio n incl ude one or more of: intravenou sly, intraa rteria lly, intra perito nea lly, intratheca lly, intraventricu larly, intra ureth rally, intrasterna lly, intraca rdially, intracra nially, intra muscu larly or su bcuta neously, and/or by usi ng infusio n tech niques. Fo r parentera l administration, the com pou nds are best used in the form of a steri le aqueous sol ution which may co nta in other su bsta nces, for exa mple, enough sa lts or glucose t o make the sol ution isoto nic with blood . The aqueous sol utio ns shou ld be su ita bly buffered (prefera bly t o a pH of fro m 3 t o 9), if necessa ry. The prepa ratio n of su ita ble parentera l form ulatio ns under steril e co nditio ns is read ily accom plished by sta ndard pharmaceutica l tech niques wel l known in t he art. The modulators or pha rmaceutica l com position s can also be administered ora lly in the form of t ablets, ca psu les, ovu les, elixi rs, sol utio ns or suspensions, w hich may co nta in f lavou ring or co lou ring agents, for immed iate-, del ayed-, modified-, susta ined-, pulsed- or co ntro lled-rel ease applicatio ns.

The t ablets may conta in excipients such as microcrysta lline cel lulose, lactose, sod ium citrate, calcium carbo nate, dibasic calcium phosp hate and glycin e, disi ntegra nts such as sta rch (prefera bly co rn, potato or t apioca sta rch ), sod ium sta rch glyco late, crosca rmellose sod ium and certa in com plex silicates, and gra nulatio n binders such as polyvinyl pyrrol idone, hyd roxypropyl methylcel lulose (HPMC), hyd roxypropylcel lulose

(HPC), sucrose, gelati n and acacia . Add ition ally, lubricati ng agents such as magnesi um stea rate, stea ric acid, glyceryl behenate and t alc may be incl uded . Sol id co mpositions of a simila r type may also be employed as f illers in gel ati n ca psu les.

Preferred exci pients in t his rega rd incl ude lactose, sta rch, a cel lulose, or high molecu lar weight polyethyl ene glycols. For aqueous suspensions and/or elixi rs, the agent may be co mbined with variou s sweeten ing or f lavou ring agents, co lou ring matter or dyes, with emulsifyi ng and/o r sus pen ding agents and with diluents su ch as water, eth anol, pro pylene glycol and glyceri n, and com bin ations t hereof.

Alternatively, the modulators, sel ective modulators, co mpositions or pha rmaceutica l com positions can be administered in t he form of a su pposito ry or pessa ry, or may be applied t opica lly in the form of a gel, hyd rogel, lotion, sol ution, crea m, ointm ent or dusting powder. They may also be derma lly or tra nsderm ally administered, for exa mple, by the use of a ski n patch .

The modulators, sel ective modulators, co mpositio ns or pha rmaceutica l com position s may also be administered by susta ined rel ease system s. Su ita ble exa mples of susta ined-rel ease co mpositions incl ude sem i-perm eable polym er matrices in the form of sha ped articl es, e.g., fil ms, or microca psu les. Susta ined-rel ease matrices include, e.g., polylactides ( US 3,773,9 19 ), co polym ers of L-gl uta mic acid and gamma-ethyl -L-gl uta mate (Sid man, U. et al., 1983), poly( 2-hyd roxyethyl methacryl ate) (La nger, . et al. , 198 1; La nger, R. et al., 1982), ethyl ene vinyl acetate (La nger, . et al., 198 1; La nger, R. et al., 1982 ) or poly-D-(-)-3-hyd roxybutyric acid

(EP133988 ). Susta ined-rel ease pha rmaceutica l co mpositio ns also incl ude liposom ally entra pped co mpou nds. Li posom es conta ining an EG FR inhibitor/a ntagon ist can be prepa red by methods known in the art, such as, e.g., the methods descri bed in any one of: DE3 21812 1 ; Epstei n et al., 1985; Hwa ng et al., 1980; EP005 2322 ; EP0036676

; EP088046 ; EP0143949 ; EP014264 1 ; JP 83-1 18008 ; U S 4,485, 045 and US 4,544,545

; and EP0102324.

The modulators, sel ective modulators, co mpositio ns or pha rmaceutica l com position s may also be administered by the pulmonary route, recta l routes, or the ocu lar route.

For ophtha lmic use, they can be formulated as micron ized suspensions in isoto nic, pH adj usted, steri le sa line, or, prefera bly, as sol utions in isoton ic, pH adj usted, steri le sa line, optio nally in co mbinatio n with a preservative such as a benza lkon ium ch loride. Alternatively, they may be form ulated in an ointm ent such as petrolatu m.

It is also envisaged t o prepa re dry powder form ulatio ns of the modulators, sel ective modulators, co mpositions or pha rmaceutica l co mpositions for pulmonary administration, particu larly inhalation . Such dry powders may be prepa red by sp ray dryi ng under con ditions w hich resu lt in a su bsta ntia lly amorphous glassy or a su bsta ntia lly crysta lline bioactive powder. Accord ingly, dry powders of the EG FR inhibito rs/a ntago nists can be made acco rding t o the emulsificatio n/spray dryi ng process discl osed in W099/164 19 or WO01/85 136. Spray dryi ng of sol utio n form ulations of the com pou nds of the present inventio n is carried out, for exa mple, as descri bed genera lly in the "Spray Drying Ha ndbook", 5th ed., K. Masters, John

Wil ey & Sons, Inc. , NY, NY (199 1 ), and in WO 97/41833 or WO 03/05341 1.

For t opica l appl icatio n t o the skin, the modulators, sel ective modulators, co mpositions or pha rmaceutica l co mpositio ns can be form ulated as a su ita ble ointm ent conta ining the active com pou nd sus pend ed or dissolved in, for exa mple, a mixtu re with one or more of the fol lowi ng: minera l oil, liquid petrol atu m, w hite petrol atu m, pro pyl ene glycol, emulsifying wax and water. Altern atively, they can be form ulated as a su ita ble lotion or crea m, suspen ded or dissolved in, for exa mple, a mixtu re of one or more of the fol lowi ng: minera l oil, sorb ita n monostea rate, a polyethyl ene glycol, liq uid paraffin, polysorbate 60, cetyl esters wax, 2- octyldodeca nol, benzyl alco hol and water.

Typica lly, a physicia n will determ ine t he actua l dosage which will be most su ita ble for an individ ual su bject. The specific dose level and freq uen cy of dosage for any particu lar individ ual su bject may be varied and will depend upon a variety of factors incl uding the activity of t he specific com pou nd employed, the meta bol ic sta bility and length of action of that com pou nd, the age, body weight, general hea lth, sex, diet, mode and t ime of administratio n, rate of excretion, drug co mbin ation, the severity of t he particu lar cond ition, and the ind ivid ual su bject undergoing thera py.

The pha rmaceutica l co mposition may conta in an exci pient t o facil itate tra nsport across the blood bra in barrier. As used herei n, the 'bl ood-bra in barrier' or ' BBB' refers t o the barrier between the peri phera l circu latio n and the bra in and the sp inal cord which is form ed by tight j unctions with in the bra in capil lary endothel ial plasm a membra nes, creating an extrem ely tight barrier t hat restricts the tra nsport of molecu les into the bra in. The exci pient which faci litates tra nsport across the blood bra in barrier refers t o a su bsta nce t hat is capable of disru pti ng or penetrating the blood bra in barrier. The amount of exci pient administered with the aden osi ne receptor modulator is the amount effective t o disru pt the blood bra in barrier and allow the adenosi ne receptor modulator t o enter the bra in.

In a preferred embod iment, the modulators, sel ective modulators, co mpositions or pha rmaceutica l co mposition s may be administered by the oral route.

The modulators, sel ective modulators, co mpositio ns or pha rmaceutica l co mpositions may also be administered by t he intra nasa l route. Adva ntages of the intra nasa l route incl ude :

-unlike parentera l administration, the intra nasa l administratio n is not invasive, is genera lly wel l tol erated and is easy t o self-m anage;

-unlike what happens afte r oral ad ministratio n, t he substa nce administered does not have t o pass t hrough the digestive system of the gastroi ntestina l tract or undergo hepatic meta bolization; -the available area of nasa l mucosa for abso rptio n is rel atively large and easi ly accessibl e;

- and given that dwel l tim e of the su bsta nce in the nose is short, the haematic co ncentration pea k is quickly reached and t his can be tim e by tim e control led.

In a f urther aspect, the inventio n provides a method for treating or preventi ng circad ian rhyth m diso rders, the method com prisi ng administering t o a su bject in need t hereof a thera peutica lly effective amount of an adenosin e recepto r modulator, selective mod ulators, co mposition or a pha rmaceutica l com position of the inventio n.

An effective amount is dose is the amou nt that over a period of tim e of treatment, which may be, e.g. 1 day or multi ple weeks, resu lts in entra inment of the patient t o a

24 hour circad ian rhyth m. The effective amount may be req uired as multi ple doses over 24 hours or as one administration .

The daily dose of an adenosi ne receptor modulator, sel ective modulator or co mposition of the inventio n will, in genera l, be in the range of about 0.1 mg t o about lOOOmg, e.g. about lmg t o about lOOmg, about 10 mg t o about 100 mg or about 20 mg t o about 50 mg.

For the prevention or treatm ent of j et-l ag in su bjects travel ling eastwa rds, the adenosi ne receptor antago nist may be t aken during the day, prefera bly between about 7 am and about 2 pm.

The adenosi ne recepto r agon ist may be t aken very early in the morn ing, prefera bly between about 4am t o about 7am for t he prevention or treatm ent of j et-l ag diso rde r in su bjects travel ling eastwa rds.

It is preferred that the tim e of administration is dictated by the Circad ian Time (CT) of the rhyth m t o be modified . The CT can be determ ined as mentio ned previously by vario us assays and observations. For adva ncing the biologica l clock or circad ian rhyth m, it is preferred t hat administratio n is at sel ective modulator or com positio n between about CT4 t o 8, prefe rably betwee n CT5 and 7, or at CT6. To "adva nce" the circad ian rhyth m means t o bring the rhyth m forwa rds in the externa l day.

In order t o del ay the circad ian rhyth m of an individ ual (or a cel l, tissue or orga n thereof) accord ing t o any aspect or embod iment of the invention, it is preferred t o administer the modulator, sel ective modulator or co mpositio n between about CT14 t o 18, prefera bly between CT15 and 17, or at CT16. To "del ay" the circad ian rhyth m means t o push t he rhyth m backwa rds in the extern al day.

The present inventio n particu larly may rel ate t o a co mpositio n com prisi ng at least one sel ective adenosi ne receptor modulator, whe rei n sa id co mposition antago nises

the A and A 2 A adenosi ne receptors, for use in the treatm ent of circad ian rhyth m disorders or circad ian rhyth m dysfu nctions, for modulati ng a biol ogica l clock or for treating circad ian misa lign ment. In t his aspect of the invention, the sel ective modulato r or modulato rs have a limited or no affi nity for the A2 B and/or A3 aden osi ne receptors.

The present inventio n can be carried out in co nj unctio n with other treatm ent approaches, e.g. in co mbination with a second or multi ple other active pha rmaceutica l agents, incl uding but not limited t o other agents t hat affect insom nia, sleep-wa ke patterns, vigi lance, depression, or psych otic episod es.

It may be desi rable t o com bine treatm ent with t he modulator, sel ective modulator or co mpositions of the inventio n with other pha rmacologica l or t hera peutic interventions. These interventions may be most effective, or have the least side effects, at a particu lar CT or win dow of CT. Exa mples of such inventio ns incl ude antica ncer t hera py, cardiovascu lar, respi rato ry, anti-i nfl ammatory, immunosu ppressive, antiepi leptic, antipyretic, analgesic, antim alaria l, antibiotic, antiseptic, mood sta bilizing, horm one replaci ng, contraceptive or any other t hera py.

It w ill be appreciated that optio nal featu res applica ble t o one aspect or embod iment of the inventio n can be used in any co mbination, and in any number. Moreover, they can also be used with any of the other aspects or embod iments of the inventio n in any co mbinatio n and in any number. This includes, but is not limited to, t he depende nt cla ims fro m any claim being used as depen dent claims for any other cla im in t he claims of t his application .

The inventio n wil l be f urther descri bed, by means of non-l imiti ng exa mple only, with reference t o the fol lowi ng figu res and experim enta l exa mples.

Figu re lA-l - dem onstrate t hat adenosi ne receptor agon ists activate clock gene expression in U20S cel ls.

Figu re 1A - shows Per2::Luc U20S cel ls treated with IB-M ECA with the tim e of appl ication ind icated by the arrow.

Figu re I B - dem onstrates t hat IB-M ECA increases intracel lular second messenger cAM P in a dose respon sive manner.

Figu re 1C - dem onstrates that IB-M ECA increases tra nscri ption driven by the C EB, as indicated by the CRE::Luc reporter.

Figure ID- dem onstrates cAM P ind uction by adenosi ne receptor agon ists.

Figu re IE- dem onstrates CRE B ind uction by several adenosi ne receptor agon ists,

Forskol in was incl uded as a positive control .

Figu re IF- dem onstrates dose respon sive period lengthen ing in IB-M ECA treated

U20S cel ls.

Figu re 1G- dem onstrates dose respon sive period lengthen ing in BAY606583 treated

U20S cel ls.

Figu re 1H- dem onstrates that Perl mRNA levels are elevated after IB-M ECA appl ication in U20S cel ls as measu red by qPC R. Figu re II- dem onstrates that Per2 m NA levels are elevated after IB-M ECA appl ication in U20S cel ls as measu red by qPC R.

Figu re 1 J - dem onstrates that si RNA-m ediated knockdown of individ ual adenosi ne receptors (Ad ora l - siAl, blue, Adora 2b - siA2 B) alters circad ian period in oppos ite directions.

Figu re I K - Individ ual traces from si RNA knockdown shown here, knockdown of all adenosi ne receptors (siA) severely dampen ing rhyth ms. Also shown are the knockdown of the different recepto r su btypes individ ually and the effect on rhyth ms.

Figu re 1L - dem onstrates reception expressio n levels of Adoral, 2a and 2b in U20S cel ls.

Figu re 1M- dem onstrates that period elo ngation in Per2::Luc U20S cel ls shows a tight co rrelation with the levels of CRE::Luc inductio n.

Figu re 2A-C - dem onstrates in vivo the ability of adenosi ne receptor agon ists t o phase sh ift circad ian rhyth ms and modulate the effect of light on the centra l circad ian clock.

Figure 2A - dem onstrates normal phase sh ifti ng of circa dian activity in response t o a light pulse in the early part of the morn ing. Animals were mainta ined in a 12h light

(wh ite) 12h dark (grey) cycle and veh icle was administered j ust before a 30m in 400 lux light pulse (wh ite bar) at tim e CT 22 (or 10 hou rs after lights off) . All light cues were then rem oved to allow the animals free running clock to express. A gap in t he lines on the day after the light pulse was administered ind icates a phase sh ift.

Figu re 2 B - dem onstrates atten uated phase sh ifti ng of circad ian activity in res pon se to a light pulse in the early part of the morn ing. Animals were mainta ined in a 12h light (wh ite) 12h dark (grey) cycle and IB-M ECA (lmg/kg) was administered j ust before a 30m in 400 lux light pulse (wh ite bar) at tim e CT 22 (or 10 hou rs after lights off) . Figu re 2C - dem onstrates a su mmary of the phase sh ifti ng data, n=6, IB-M ECA atten uates the phase-sh ifti ng effect of light administered at t ime CT22 .

Figu re 3A-K - dem onstrates that adenosi ne receptor antagon ists modulate circad ia n rhyth ms and clock gen e expressio n in U20S cel ls.

Figu re 3A - dem onstrates Per2::Luc U20S cel ls treated with JNJ40255293 with the t ime of appl icatio n indicated by the arrow. Period length ening was observed .

Figu re 3 B - dem onstrates t hat none of the aden osi ne receptor antago nists tested induce expression from CRE-el ements, as indicated by a CRE::Luc reporter (Fo rskol in used as positive control ). Drugs tested at 30u M.

Figu re 3C - dem onstrates t hat none of the adenosin e receptor antago nists tested induce cAM P prod uction, as indicated by a cAM P-G LO reporter (Forskolin used as positive control ). Drugs tested at 30u M.

Figu re 3D - dem onstrates dose responsive period lengthen ing in JNJ40255293 treated U20S cel ls.

Figu re 3 E - dem onstrates dose respon sive period lengthen ing in Istra defyl line treated U20S cel ls.

Figu re 3 F - dem onstrates dose responsive period lengthen ing in M RS 1220 treated

U20S cel ls.

Figu re 3G - dem onstrates dose responsive period lengthen ing in ZM 241385 treated

U20S cel ls.

Figu re 3H - To test that the period lengthen ing effect of adenosi ne receptor antagon ism was due t o action on aden osi ne recepto rs, all adenosi ne receptors expressed in U20S cel ls were knocked down and it was fou nd that the effect of

CGS 15943 (Axl) was lost.

Figu re 3 1 - To understa nd the tra nscriptio n factor responsi ble for the observed cha nges in rhyth m, STAR-PRO M screen ing was cond ucted and nucleic acid sign atu res switched on by JNJ40255293 (inside the box) were identified .

Figu re 3 J - dem onstrates t hat Perl mRNA level s are elevated after JNJ40255 293 appl ication in U20S cel ls as measu red by qPC R.

Figu re 3 K - dem onstrates Per2 mRNA level s are elevated after JNJ40255293 appl ication in U20S cel ls as measu red by qPC R.

Figu re 4A-K- dem onstrates t hat in vivo adenosine receptor antagon ists phase sh ift circad ian rhyth ms and enhance re-entra inment in a jet-l ag protocol .

Figu re 4A - dem onstrates a co ntrol animal rel eased from entra ined co nditio ns t o free-ru n. Actogra ms from C57 BI/6 male mice (80+ days) hou sed in a 12h-l ight 12h- dark cycle (400 lux) . Sta ble entra inment as indicated by onset of activity (black) during the dark part of the cycle (grey) . Animals were administered Vehicl e (A) or

JNJ40255293, 5 mg/kg intra perito nial injection (B) (arrow, 6h after the onset of light) .

Figu re 4 B - dem onstrates a JNJ40255293 treated animal (sta r) in an identica l set up as Figu re 4A. JNJ40255293 induced a phase adva nce, indicated by the adva nce in activity (d iagona l line) after the animals are housed in co nsta nt dark (grey) .

Figu re 4 C - dem onstrates the phase sh ift induced by administratio n of the indicated drug (IB-M ECA l mg/kg, JNJ40255 293 5mg/kg and CGS 15943 5mg/kg) at tim e ZT6 .

Figu re 4 D - dem onstrates the phase sh ift induced by administratio n of the indicated drug (IB-M ECA l mg/kg, JNJ40255 293 5mg/kg and CGS 15943 5mg/kg) at tim e CT16 . Figu re 4 E - dem onstrates re-entra inment in a jet-l ag protoco l in a co ntrol veh icl e- treated animal. The sa me protocol as Figu re 4A and 4B was ado pted, except rath er tha n rel ease the animals into co nsta nt dark afte r drug administration s, the light-da rk cycle was adva nced 6h t o simulate an eastwa rd f light and an adva nce of 6 t ime zon es. The veh icl e treated animals (E) adva nced their activity grad ually each day.

Figu re 4 F - dem onstrates re-entra inment in a jet-l ag protocol in a JNJ40255 293

(5mg/kg) treated animal. The sa me protoco l as Figu re 4 E was adopted . The drug- treated animals adva nced thei r activity much more rapid ly tha n the contro ls.

Figu re 4G - dem onstrates the dose response curve for re-entra inment in a jet-l ag protocol, JNJ40255293 dose respo nsively enhanced re-entra inment.

Figu re 4 H - dem onstrates that Perl m NA levels are elevated with in the SCN after

JNJ40255 293 administration in the periphery (intra-periton ially) .

Figu re 4 1 - dem onstrates t hat Per2 mRNA levels are elevated with in the SC N after

JNJ40255293 ad ministration in the peri phery (intra-periton ially) .

Figu re 4 J - shows the Per2::Luc rhyth ms from SC N expl ants from Per2::Lu c tra nsgen ic amimals. JNJ40255293 (lOu M) add ed at the arrow.

Figu re 4 K - dem onstrates the administratio n of 5mg/kg JNJ40255293 and onsets of activity measu red .

Figures 5A t o E show that aden osi ne receptor antago nists/ inverse agon ists regu late cel lular clocks via a CREB-in depen dent sign alling pathway, implicati ng another signa lling system . Experim enta l work here is cond ucted with JNJ40255293.

Figu re 5A- dem onstrates that JNJ40255293 does not elevate cAM P levels in U20S cel ls. Figu re 5B- shows that JNJ40255293 does not increase signa ls from the CRE::Lu c reporter in contrast t o t he positive control Forskol in.

Figu re 5C- dem onstrates robu st increases in Perl and Per2 mRNA are seen after treatment with lOu M JNJ40255293 when appl ied t o U20S cel l cultu res.

Figu re 5D- shows that treatm ent with lOu M JNJ40255293 lead s t o increases in period length in Bma ll ::Luc reporter U20S cel ls w hich revert t o norma l rhyth ms after washout of drug.

Figu re 5 E- dem onstrates that a dose-responsive increases in period length are observed .

Figures 6A t o F - depicts data t hat shows t hat adenosi ne receptor antago nists that t arget two or more receptors elevate expressio n of both Perl and Per2, antagon ists t hat act on only singl e receptors do not have t his effect.

Figu re 6(D) - shows the effect of JNJ40255293 is mediated by adenosi ne receptors with dose-respon sive period lengthen ing in Per2 ::Luc U20S cel ls;

Figu re 6 (A) t o ( F) - dem onstrate t he level s of Perl and Per2 detected after treatment with (C, D) JNJ40552 13 (E, F) KW3902 and KW6002 and (G, H) PSB0788. Mixed A2A/ A antagon ists such as JN J 4055 213 induce the expressio n of Perl and Per2 in U20S cel ls, but not specific A (KW3902), A2A (KW6002) or A2B(PSB) antagon ists.

Figu re 7A t o C - shows that the STAR-PRO M approach revea ls a novel signa lling pathway downstrea m of adenosi ne recepto r inhibitio n that co nverges on the circad ian clock.

Figures 7A and B- dem onstrate Upregu latio n of Fos mRNA (7A) and cJ un (7 B) after treatm ent with lOu M JNJ40255293. Figu re 7C - shows the activity of Seq3 after knockdown of A PI (com posed of FOS and

JUN) when co mpared with a non-ta rgeting si NA (si NT) and ind uction by

JNJ40255293 (lOu M ) co mpared with DM SO.

Figure 8A-C - show that t he SC N sensitive t o adenosine recepto r antago nists.

Figu re 8 A and B - show Perl (A) and Per2 (B) mRNA level s increase with in t he SCN 4h after intra peritonea l injection of JNJ40255293.

Figu re 8 C - is an in vivo reco rding from SCN electrode implanted animals show a marked phase sh ift of SC N electrica l activity on intra peritonea l injectio n of

JNJ40255 293 (5mg/kg) .

Figu re 9A t o C - dem onstrate t hat circad ian beh avio ural assays show efficacy of

A1/A2A dual antago nists at modifying circad ian rhyth ms.

Figu re 9A -th is plots the phase sh ifts, w hich were measu red by the difference between the two measu res of onset (pre and post injectio n of rel evant agent)

JNJ40255293 (A1/A2A antagon ist) causes the largest phase sh ifts co mpared with either caffeine, KW6002 or t he agon ist IB-M ECA.

Figu re 9 B - dem onstrates t hat JNJ40255293 is more efficient at re-entra inment tha n cu rrent sta nda rd of care (Hetl ioz ).

Figu re 9 C - dem onstrates t hat JNJ40255293 is more efficient tha n eith er a specific A2A antagon ist KW6002 or a specific Al antagon ist KW3902.

Figu re 10A - C -dem onstrates that aden osi ne sign alling regu lates the sensitivity of t he circad ian clock t o light.

Figu re 10A - dem onstrates t hat sleep deprivatio n parad oxica lly increases Per2 expressio n with in t he cortex. Figu re 10B - these are ind ivid ual actogra ms w hich su pport t he data shown in Figu res

5A t o H. The vario us agents appl ied t o the animals are label led .

Figu re IOC - t his dem onstrates that the Ai/A 2A antagon ist JNJ40255293 also enhances phase-sh ifts in response t o light at CT16, unlike the non-specific agon ist IB-

M ECA.

Exam ples

Materia ls and M ethods

Anima l Studies

Animals were housed under a reversed 12:12 LD cycl e (400 lux fro m w hite LE D lamps) with food and water ad libitu m. For phase-sh ifti ng stud ies, C57 BI/6 mice were mainta ined on running wheel s in light tight cha mbers on a 12:12 LD cycle (400 lux fro m w hite LE D lamps) and injected with drug at t he ind icated t ime poi nts. The drugs were form ulated in a veh icl e consisti ng of 5% Kol ipho r-H S15 (Sigm a-Ald rich, UK) 5%

Cycl odextra n (Sigm a-Ald rich, UK) in 0.9% sa line. This veh icl e was w armed t o 37°C and the indicated drugs kept at a lOOx stock in DM SO and mixed at the appropriate con centration t o be administered at approxi mately 300u l intra peritonea l injectio n

(n=6 t o 10). Where the tim e poi nt of injectio n was in the dark, the proced ure was cond ucted under dim red light. Where measu ring phase-sh ifti ng, the mice were then placed in DD and allowed t o free run for 14 days in DD, running wheel activity data was co llected and analysed on Clockl ab (Acti metrics, Wil mette, IL) . For jet-l ag stud ies, mice were mainta ined on running wheels in light tight cha mbers on a 12:12

LD cycle (400 lux from w hite L ED lamps) and injected with drugs as above at ZT6 and the LD cycl e was sh ifted 6 hours in adva nce. The onset of activity on each day was used t o measu re phase rel ative t o the LD cycl e.

Tissue Col lection

Animals were sacrificed under dim red light by cervica l dislocatio n at 30, 60 and 120 minutes after the onset of the light pulse. The eyes were immediately removed t o prevent any photic sti mulatio n t o the SC N. Sh am-treated mice not given a light pulse were dissected at each tim e poi nt. Bra ins were rem oved and placed into a bra in matrix (Kent Scientific, Torringto n CT, USA) . All proced ures were perform ed in accorda nce with the UK Home Office Animals (Scientific Proced ures) Act 1986 and the Unive rsity of Oxford's Pol icy on the Use of Animals in Scientific Resea rch . (PPL

70/6382 and 30/28 12) . Animals were sacrificed via Sched ule 1 meth ods in accorda nce with the UK Home Office Animals (Scientific Proced ures) Act 1986 .

SCN Tissue Col lection : Animals were housed under a 12 :12 LD cycl e for 2 weeks with food and water ad libitum. Animals then received either a drug injection with a alteration in the light dark cycle as descri bed in the experi ment and at set poi nts fol lowi ng drug administratio n were sacrificed by cervica l disl ocation . Sha m-treated mice not given a light pulse were dissected at each tim e poi nt. Bra ins were rem oved and placed into a bra in matrix (Kent Scientific, Torri ngto n CT, USA) . Per2 ::Luc tra nsgen ic animals (as reported in Yoo et al, Proc Natl Acad Sci U S A. 2004 Apr

13; 101 (15) :5339-46) were obtai ned from Prof. Joseph Takahash i, Northwestern University.

Fo r punches for mRNA/p rotei n analysis : A ski n graft blade (Swa nn-M orton, Sh effiel d,

UK) was positioned at Bregm a -0. 10m m. A seco nd blade was placed 1m m (Bregm a -

1. 10) cauda l from the f irst, and a 1m m t hick bra in sl ice was dissected . SC N punches were t aken usi ng a sa mple corer (1m m interna l diameter, Fi ne Science Too ls GmbH,

Heid elberg, Germ any) from the bra in sl ice (n=4), flas h frozen on dry ice and sto red at

-80°C prior t o RNA extraction .

Fo r SC N slice cu ltu re: The bra in was gently cut into a cu be preservi ng the integrity of the SC N and cut into 200u M sl ices in ice-col d oxygen ated Hanks Ba lanced Sa lt

Sol ution conta ining ΙΟΟη Μ M K80 1 (Sigm a-Ald rich ). The SC N was microd issected and tra nsferred t o membra ne f ilter (Millicel I Cel l Cu ltu re Insert, 30 mm, hyd rophilic PTF E,

0.4 µιη , M illipore) and cultu red in 300u L DM EM prepa red as deta iled in the Per2::Luc Assay.

Phase Shifting: C57 BI/6 male mice (80 days or older) were mainta ined on running wheels in light tight cha mbers on a 12:12 LD cycl e (100 lux fro m w hite L ED lamps) on sta ble entra inment, were rel eased in co mplete darkness. At set t imes as indicated in the experim ents, the animals received an intra perito nea l injection (300u l) of drug co nstituted in steril e sa line with 5% Cycl odextri n (Sigm a-Ald rich ) and 5% Kol ipho r

(Sigm a-Al drich ) and t hen allowed t o free run in DD, running whee l activity data were co llected and analysed on Cl ockl ab (Actim etrics, W ilmette, IL) .

Re-entrain ment: C57 BI/6 male mice (80 days or older) were mainta ined on running wheel s in light tight cha mbers on a 12:12 LD cycle (100 lux from w hite LED lam ps) and injected with drugs as above at ZT6. The LD cycle was immediately adva nced by

6h. Onset of activity on each day was used t o measu re phase relative t o the LD cycl e, data analysed on Clockl ab.

RNA extraction and sam ple prepa ration

Tota l RNA was extracted usi ng the micro RNeasy co lumn method (Qjagen, Hilden,

Germ any) . Qua lity and quantity of RNA were measu red usi ng an Agil ent Bioa nalyzer and a Nanod roplOOO (Thermo Fisher Scientific, Waltha m, MA USA), respective ly.

Qua ntitative PCR (qPCR)

RNA sa mples were prepa red as descri bed for microa rray hybrid isation . cDNA w as synthesized with a qScri pt cDNA synth esis kit (Qua nta Biosciences, Gaithers burg,

M D), and quantitative PC R (q PC R) was co nducted with Sybr green I and an SDS7700 t herma l cycler (Appl ied Biosystems, Foster City, CA) . Relative quantification of tra nscri pt level s was done as descri bed previo usly (Peirso n et al., Nucl eic Acids Res.

2003 Jul 15;3 1(14) :e73. ). The geom etric mean of a minimum of t hree hou sekeepi ng genes was used for norm alization (Ga pdh, ActB, GusB and Rps9 f or exa mple) .

Prim er seq uences below and fro m Jaga nnath et al., Cel l. 2013 Aug 29; 154(5 ):1100- 11.

Table 1: Prim er Seq uences

Adora l For TGCCAGCTTTGGTGACCTTG

Adora l Rev GCCTGGAAAGCTGAGATGGA

Adora2a For GGACTGTGACATGGAGCAGG

Adora 2a Rev TTCTGGCAGCAGCATCATGG

Adora3 For TCGCTGTGGACCGATACTTG

Adora3 Rev AGAGCCACATGACTGGAAGG RNAi si RNA seq uences are as fol lows; Non-ta rgeting siRNA: 5' CU UACGCUGAG UACUUCGA 3' .

Table 2: si RNA seq uences :

Cel l Lines and Cu ltu re

Cel ls from the U20S (HTB-96) line were obta ined, tested and identified . The cel ls were cultu red in T-75 f lasks, in Du lbecco's modified Eagle medium (DMEM) su ppl emented with 10% foeta l bovi ne seru m (FBS) and 1% pen ici llin-streptomyci n

(P/S) at 37°C in a humidified atm osphe re at 5% C0 2. The cel ls were su bcu ltu red every 2 t o 4 days in a 1:2 t o 1:6 ratio, in accorda nce with the ATCC reco mmendations. The cel ls were cou nted usi ng a haemocytom eter, and t heir via bil ity in a cultu re was mainta ined at above 95%, measu red with a Presto Bl ue excl usio n assay accord ing t o the manufactu rer's specifications. Cel ls were tra nsfected with si RNAs (typ ica lly at

50n M co ncentrations, seq uences as previously listed ), the CRE::Luc

(pGL4. 29[luc2 P/C RE/Hygro] Vecto r, encod ing Luc2 P luciferi n under the co ntrol of a strong cAM P response element (CRE) prom oter co nta ining 3 CRE elements with in its seq uence; Prom ega ) reporter vector or cAM P-G LOSensor plasm id (Prom ega ) as per manufactu rer's instructio ns usi ng either Li pofecta mine RNAim ax (Invitrogen ) or

Li pofecta mine3000 (Invitrogen ).

Pe r2 ::Luc ce ll based circadia n assays U20S cel ls sta bly tra nsfected with a Per2 ::Luc reporter were cu ltu red in DM EM su pplem ented with 10% FBS. For si RNA- and drug-based experim ents, cel ls were seed ed at 5,000 per wel l into w hite 384 wel l plates and tra nsfected with 20n M si RNA the next day. 2 days later, the cel ls were synch ron ized with ΙΟΟη Μ dexa methasone and the medium was repl aced with phenol -red free DMEM su ppl emented with B-27 and ΙΟΟµΜ luciferi n potassiu m sa lt, req uisite drugs form ulated in DMSO as a lOOOx stock was added, and t hen sea led. Per2::Luc rhyth ms were recorded from a BMG

La btech Fl uosta r Omega plate reader mainta ined at 36°C and read ings t aken from each wel l every hou r. Data were then analysed usi ng either Multicycl e or Brass rhyth m analysis softwa re.

Pe r2 ::Luc Ci rcadia n Assays:

Period 2::Luciferase (Per2 ::Luc) sta ble U20S tra nsfects were cu ltu red, as descri bed above. A Grei ner Bio-O ne 384 Wel l Pl ate (Po lystyrene, F-bottom ), was then seeded at

6000 cel ls per 50 µ Ι wel l. Fol lowi ng a 24 hou r period, the cel ls were treated with

0.1% dexa methaso ne, a glucoco rticoid hormo ne analogue known t o reset intracel lular circad ian rhyth ms, for 1 hour. Su bseq uently, the dexa methasone- co nta ining medium was rem oved, the cel ls were washed with PBS and luciferi n and test drug conta ining medium was added . The cel ls were then assayed for luminescen ce over a period of 96 hou rs in the BMG FLU Osta r OPTI MA Micro plate

Reader t o observe the period icity and amplitude of the luminescence values.

STAR-PROM assay

This was cond ucted as previously reported in Gerber et al., Cel l. 2013 Jan

31; 152(3) :492-503. Briefly, U20S cel ls were cultu red in 6-wel l plates and tra nsfected with lug of the STAR-PRO M plasm id library (libra ry structu re as in above reference) .

RNA was extracted at set tim e poi nts and seq uenced for the barcoded luciferase co nstructs and analysed with Galaxy (https ://use.ga laxy.o rg).

CRE-Luc Vector Tra nsfection

At 60-80% confl uence and >90% via bility, the U20S cel ls in the T-75 f lask were washed twice with 6 ml phosph ate-buffered sa line (PBS) and su bseq uently treated with 4 ml of Tryp L E ™ Exp ress trypsi n rep lacem ent sol ution for 10 minutes. A Grei ner Bio-One 96 Wel l Plate (wh ite, TC treated ), was then seeded at 8000 cel ls per wel l.

Fo llowi ng 24 hou rs, the cel ls were tra nsfected at 50-70% co nfl uency with C E-l uc

Vector generated in-ho use with Viafect tra nsfection reagent at 1:4 ratio (lOOng

DNA/wel l) following manufactu rers reco mmendations.

CRE-Luc Luciferase Assay

24 hours after tra nsfection, the medium in the 96 wel l plate was cha nged t o a seru m- free medium with 1 mM luciferi n. The cel ls were then incu bated in seru m sta rvatio n cond ition s for 6-8 hours, t his was opti mised t o yiel d the greatest sign al stre ngth and lowest noise when assayed with forskol in control . Fo llowi ng the incu batio n period, the CRE-Luc U20S cel ls were treated with the appro priate drug and the ir luminescen ce values were measu red after 6 hou rs in the BMG FLU Osta r OPTI MA

Micropl ate Read er. For com parative experim ents, drug concentrations of 10 µ Μ were used as they were fou nd t o be opti mal for keepi ng cel l toxicity bel ow 5%, meas ured with the Presto Bl ue excl usion assay. Unless stated otherwise, forsko lin was used as a positive co ntro l, and 1% DMSO was used as a negative control .

cAM P GloSensor Assay

The GloSenso r ™ cAM P Assay (Prom ega ) was used for detecting cha nges in the intracel lular level s of cAM P. Initia lly, a Grei ner Bio-One 96 Wel l Plate (wh ite, TC treated ) was seed ed at 8000 cel ls per 100 µ Ι wel l, as descri bed above. After 24 hours, the cel ls were tra nsfected with the pGloSensor™ cAM P Pl asm id usi ng the Viafect tra nsfection reagent as above. Between 24 and 48 hours later, allowi ng for the accu mulation of the biosenso r, the med ium in the 96 well plate was cha nged t o C0 2-

Indepen dent Medium su ppl emented with Gluta MAX™ (Life Technologies), 10% feta l bovi ne seru m and 2% GloSenso r ™ cAM P Reagent. The plate was then stood for 2 hou rs at room tem peratu re t o equilibrate. Fo llowi ng the incu bation period, the cel ls were treated with rel evant drugs and thei r luminescence values were measu red after

20 minutes in the BMG FLU Osta r OPTI MA Micropl ate Reader, with forsko lin as a positive co ntrol, and DMSO as a negative control .

Statistics Statistica l analyses and dose-response curves were perform ed by the use of Graph

Pad Prism 5.0 softwa re. Two-ta iled Stud ent's t-test was used t o calcu late the P values for unpaired, hom oscedastic co mparisons, with the P values <0. 05 bei ng considered statistica lly sign ifica nt. * P < 0.05, * * P< 0.0 1, * * * p< 0.001. A NOVAs were used t o perform multi ple co mparisons. Error bars on the gra phs indicate one sta ndard error of the mean (SEM). In addition, all resu lts are presented in the form of averageiS EM.

Resu lts and discussion

Adenosi ne receptor agonists activate gene clock expression in U20S cel ls

U20S cel l lines treated with the adenosi ne receptor agon ist IB-M ECA show increases in period and amplitude of the cel lular clock as reported by the Per2 ::Lucife rase construct (Figu re 1A) . In add ition t o a dose dependent increase in circad ian period,

IB-M ECA caused a co ncu rrent increase in the seco nd messenger cycl ic AM P (cAM P) level s (Figu re I B) and activation of the cAM P respon se element-bi nding factor (C EB) as indicated by the CRE::Luc reporter co nstruct (Figu re 1C) . These experi ments were repeated with othe r aden osi ne rece ptor ago nists (1-5 as deta iled in Figu re I D and E) and similar increases in cAM P level s and CRE::Luc were observed (Figu re I D and I E).

IB-M ECA induced dose-dependent period length increases (Figu re I F) resu lti ng rapid expression of the clock genes Perl/2 expression (Figu re 1H). Si milar increases in period length were observed with BAY606583 (Figu re 1G).

Adenosi ne receptor agonists phase shift ci rcadia n rhyth m s and modu late the effect of light on the centra l circadian clock

C57 BI/6 male mice (80+ days) were housed in a 12h-l ight 12h-da rk cycle (400 lux) .

Sta ble entra inment was ind icated by the onset of activity (green ) during the dark part of the cycle (grey) . Animals were administered Veh icl e (Figu re 2A) or IB-M ECA, 1 mg/kg intra-perito nially (Figu re 2B) fol lowed by a light pulse at ZT22 (indicated by the arrow, 22h after the onset of light) . The resu lts shown in Figu re 2A dem onstrate that a light pulse at CT22 normally induced a phase adva nce, indicated by the adva nce in activity (point of intersection of t he two black lines is adva nced ) after t he animals were housed in con sta nt dark (grey) . Resu lts shown in Figu re 2B show that the phase adva nce was lost when IB-M ECA was administered (point of intersection of the black lines rem ains at the day at w hich the animals were rel eased into DD, indicati ng no phase sh ift) . Data su mmarized in (Figu re 2C) . Resu lts shown in Figu re

2D dem onstrate t hat in the absence of a light pulse, IB-M ECA elicited a phase del ay when administered at CT2 2, w hilst the veh icle and antagon ist induced no sign ifica nt cha nge in phase.

Adenosine rece ptor antagonists mod ulate circadian rhythms and clock gene expression in U20S cel ls.

As the adenosi ne receptor agon ists activated the circad ian gene Perl/2 expression, we hypothesised these effects were as a resu lt of adenosi ne receptor activation . By extension we antici pated these effects t o be blocked by the pan-adenosi ne receptor antagon ist CGS 15943(9-ch loro-2-(fu ran-2-yl )-[ l ,2,4]triazo lo[l,5-c] quinazo lin-5- amine) . However, multi ple adenosi ne receptor antago nists Istradefyl line,

JNJ40255293, M RS 1220 and ZM 241385 su rprisi ngly and unexpected ly increased circad ian period length in a dose dependent manner (Figu re 3A-G )). Figu re 3A shows that period lengthen ing was observed in Per2::Luc U20S cel ls treated with

JNJ40255293 (the tim e of appl icatio n bei ng ind icated by the arrow and doses as indicated ). As the cAM P cou ld have increased as a conseq uence of antago nisi ng Al receptor (Gi cou pled ), the alterations in cAM P as a conseq uence of Al receptor blockade in U20S cel ls was evaluated . Resu lts shown in Figu res 3B and 3 C dem onstrate t hat none of the adenosi ne receptor antago nists increased the intracel lular cAM P or CRE B activation in U20S cel ls. However, dose responsive period lengthen ing was observed as shown in Figu res 3D-H in JNJ40255 293, istradefyl line, M RS 1220 and ZM 24 1385-treated U20S cel ls respectively. In order t o verify that the observed effects were due t o actio n on adenosi ne receptors, the Ai,

A2A, A2B adenosi ne receptors in U20S cel ls were knocked down usi ng si RNA and the effects of the antago nists were evaluated . Figu re 3H, shows the effects of the antagon ists were abol ished co nfi rming that the observed effect on period is indeed t hrough action on adenosi ne receptors.

The absence of the CRE::Luc respo nse indicates an altern ative tra nscriptiona l pathway culminati ng in clock gene expression . To identify t his pathway, STAR-PRO M screen ing was cond ucted (as descri bed in Gerber et al., 20 13, Cel l and in co llaboration with Prof. Ulrich Sch ibl er, Geneva ). This system co mprises a library of synthetic prom oter elements drivi ng luciferase expression and can be used t o identify new tra nscriptiona l elem ents activated by drugs or treatm ents. JNJ40255293 activated the exp ressio n of severa l repo rter co nstructs as high lighted by the grey box in Figu re 31.

Resu lts shown in Figu res 3 J and 3K show that Perl and Per2 mRNA level s respectively were elevated after JNJ40255293 application (30u M) in U20S cel ls.

Adenosine rece ptor antagonists phase shift ci rcadia n rhythms and enhance entrain ment in a jet-lag protocol

C57 BI/6 male mice (80+ days) were housed in a 12h-l ight 12h-da rk cycle (400 lux) .

Sta ble entra inment was indicated by the onset of activity (black) during the dark part of the cycl e (grey) . Animals were ad ministe red Veh icl e (Figu re 4A) or JNJ40255293, 5 mg/kg intra periton ial injection (Figu re 4B) (indicated by the arrow, 6h after the onset of light) . JNJ40255293 induced a phase adva nce, indicated by the adva nce in activity

(diagona l line) after the animals were housed in consta nt dark (grey) . Data su mmarized in (C) . Si milarly, JNJ40255293 was administered at CT16 (ci rcad ian t ime

16 or 16h after the onset of light) and resu lted in a phase delay, ind icating t he sa me drug wou ld have different effects on circad ian phase at different t imes, similar t o light (Figu re 4E) . The same protocol as above was followed as for Figu res 4A and 4B, with the exception t hat rather t han a rel ease of the animals into consta nt dark afte r drug administrations, the light-da rk cycle was adva nced 6h t o simulate an eastwa rd f light and an adva nce of 6 t ime zones. The veh icl e treated animals (Figu re 4E) adva nced t heir activity grad ually each day, and in co ntrast the JNJ40255293 treated animals (Figu re 4F) sh ifted rapid ly. The resu lts shown in Figu re 4G show enhancem ent of re-entra inment was observed for both JNJ40255293 (Figu re 4G).

Resu lts shown in Figu res 4 H and 4 1 show that Perl and Per2 mRNA level s respectively were elevated with in t he SC N after administration of JNJ40255293 in the peri phery (intra-periton ially), indicati ng the drug' s centra l effect. Resu lts shown in

Figu res 4 J and 4 K are fro m experim ents where animals were housed in co nsta nt dark and at CT16 or 4 hours after su bj ective dusk received either veh icl e or 5mg/kg

JNJ40255293 or lmg/kg IB-M ECA (data not shown ) and onsets of activity measu red . Phase sh ifts were measu red by the differen ce between the two measu res of onset

(pre and post injection ) and plotted . JNJ40255293 at t his t ime ca uses a phase delay.

Adenosine receptor antagonists/inverse agonists regu late ce llular clocks via a novel signa lling pathway.

Figu res 5A-E and 6A t o H deta il the effect of adenosin e receptor antago nists on the cel lular clock. W hilst w e expected the opposite from antagon ists t han the ago nists,

w e were su rprised t o f ind t hat antago nists of A / A 2 A receptors such as JNJ40255293 prod uced large dose-dependent increases in period length . We observed littl e if any increases in cAM P (50% increase at 30u M ), certa inly not t o the level s req uired t o elicit cha nges in circad ian period . Correspo ndingly, w e saw no cha nges in CREB phosph oryl atio n or signa l for CRE::Luc reporters, but observed sign ifica ntly increased

Perl/2 tra nscriptio n at 4h post-d rug treatm ent (th us with a sign ifica ntly different tim e cou rse as the ago nists) and cha nges in period length . These f ind ings implicate a nove l CREB-i ndependent tra nscri ptiona l axis downstrea m of adenosi ne receptors t hat causes a del ayed ind uction Perl/2 tra nscription . Mixed AI/A 2A antagon ists ach ieved t his effect (e.g. JNJ40255293) but neither A specific not A 2A/A 2B specific antago nists were able t o repl icate t his effect. In order t o identify the novel tra nscri ptiona l axis

downstrea m of A / A 2 A antagon ism that converged on the clock, w e employed the unbiased tra nscri ption factor screen ing approach BC-STARPRO M/30u M JNJ40255293 sign ifica ntly increased the reporter signa l from 8 clones, 7 of w hich were pred icted t o conta in Fos-rel ated tra nscri ption facto r bind ing site. We isol ated clone3, w hich w e fou nd respon ded t o a panel of different antagon ists incl ud ing JNJ40255293. The DNA seq uence conta ining the prom oter regio n of clo ne 3 was used t o pull down protei n binding partners from a nuclea r extract of cel ls treated with JNJ40255293 and the isolated protei ns seq uenced usi ng mass spectrom etry. A few tra nscri ption facto rs were enriched in the CGS-treated sa mples, incl uding JunD and Fosl 2.

Correspond ingly, si RNA-m ediated silen cing of Fos sign ifica ntly red uced the respo nse of clon e3 t o CGS 15943. Ana lysis of the Perl and Per2 prom oters revea led co nserved

Fos :J un bin ding site with in thei r pro moters (data not shown ).

Fig 5: (A) JNJ40255293 does not elevate cAM P level s in U20S cel ls or (B) increase phosphoryl ation of CREB, in co ntrast t o the positive controls Forskol in of IB-M ECA. (C) Robust increases in Perl and Per2 mRNA are seen after treatm ent with lOu M

JNJ40255293, lead ing t o (D) increases in period length in Bm al l ::Luc reporter U20S cel ls w hich revert t o norma l rhyth ms after washout of drug. (E) Dose-responsive increases in period length are observed . Figu re 6A t o H show that multi ple aden osi ne receptor antago nists pertu rb circad ian rhyth ms in U20S cel ls in a CREB-i ndependent manner.

The STAR-PROM approach revea ls a nove l signa lli ng pathway downstrea m of ade nosi ne rece ptor inhibition that converges on the circadia n clock.

This is dem onstrated in Figu res 7A t o E and 31. Figu re 7C shows the activity of Seq3 after knockdown of Fos (si Fos) when co mpared with a non -ta rgeti ng si RNA (si NT) and ind uction by JNJ40255293 co mpared with DMSO . This dem onstrates an alte rnate pathway lead ing from the mixed antagon ists t o Perl/2. The specific expression of one reporter t hat co nta ins the sa me tra nscriptiona l binding element as fou nd in

Per2. The upper line represents the ind uction of expression of the clone on treatm ent with JNJ40255293 and the lower lines represent the sa me after silenci ng of the candidate tra nscriptio n factor A PI (consisti ng of the su bunits Fos and Jun).

These data co nfirm t hat A PI is respon sibl e for the tra nscriptio n of Perl/2 after treatment with JNJ40255293.

The SCN expresses Adenosine receptors and is sensitive to adenosine receptor antagonists/inverse agonists.

We then extended our work t o the centra l pacem aker and fou nd that JNJ40255 293 increased period length in isolated Per2::Luc SC N slice cu ltu res. Intra perito nea l injections of JNJ40255293 increased Perl and Per2 expression . Figu re 8A t o C depicts these resu lts.

Ci rcadia n behaviou ral assays show efficacy of A1/A2A dual antagonists at modifying ci rcadian rhyth ms.

Figu re 9 A t o C show gra phs that represent the speed of entra inment of mice treated a singl e intra peritonea l injection of the drugs JNJ40255293 (5mg/kg), Tasim elteo n

(5mg/kg) KW6002 (l mg/kg) and KW3902 (lmg/kg) . The light dark cycl e was adva nced by six hou rs after the injectio n at ZT6 and the phase of onset of activity (marki ng circa dian t ime in the animals) w as plotted . Veh icle treated animals typ ica lly too k 5-6 days t o retu rn t o basel ine, w hile JNJ40255293 clea rly adva nced entra inment more potently tha n Tasimelteon, KW6002 (specific A 2A antagon ist) or KW3902 (specific A antagon ist) .

Adenosine signa lling regu lates the sensitivity of the ci rcadia n clock to light.

We investigated the physiologica l rel evance of our f indings t o the sleep axis. We pred icted t hat sleep dep rivation w ould increase level s of extracel lula r adenosi ne and that t his wou ld decrease clock gene expression . We fou nd that as pred icted, sleep deprivatio n decreases Perl/2 expression with in the SC N, consistent with increased adenosi ne-Ai sign alling and that t his decrease was reversed by administratio n of

JNJ40255293 and mimicked by administration of an A agon ist. An A 2A specific ago nist CGS2 1680 had the opposite effect and increased Perl/2 expression (data not shown ).

We also found as previou sly reported, that slee p deprivation increased Perl/2 with in t he co rtex, and that t his increase was more due t o the stress-gl ucocorticoid signa lling axis as administratio n of mifepristone blunted t his response (data not shown ). The implication of these fin dings is that adenosin e level s (presu mably infl uenced by sleep history) ca n infl uen ce circad ian responses. We tested t his in the co ntext of circad ian- phase sh ifts t o light. We hypothes ised that A antago nists wou ld enhance the effects of light, whereas AI agon ists wou ld inhibit the phase-sh ifti ng effect of light. This is indeed what w e fou nd, that w e were able t o alter the depths of the two arms of the light PRC by modulati ng adenosi ne signa lling. The implicatio ns of t his f inding cou ld expl ain the different light PRCs in noctu rna l versus diurna l animals

The data in figu re 10 A t o 10 C shows that sleep deprivatio n parad oxica lly increases

Per2 expression with in t he cortex. Individ ual actogra ms (10B) su pports t he assertion that aden osi ne signa lling regu lates the sensitivity of the circad ian clock t o light. IOC

shows t hat the A / A 2 A antagon ist JNJ40255 293 also enhances phase-sh ifts in res pon se t o light at CT16, unlike the non-specific agon ist IB-M ECA.

The experi ments deta iled in Figu res 1-10 descri be the effect of adenosi ne recepto r modulators and adenosi ne sign alling on circad ian clock f unction . Through both canonica l (CR EB-based ) and novel pathways, drugs t argeting the adenosi ne recepto r system activate clock gene expression and provide a zeitgeber or t ime-givi ng message t o the circad ian clock. This can be used t o reset, i.e. t o adva nce or delay the phase and period of the circad ian clock in vitro and also in vivo. These resu lts su pport the use of adenosi ne receptor modulators as chronom odulatory co mpounds, particu larly where at least two adenosi ne receptors are mod ulated in t andem .

All docu ments mentioned herei n are incorporated by reference.

Oth er embod iments are intentio nally with in t he sco pe of the invention as defi ned by t he appended claims. CLAI M S

1. An adenosine receptor modulator for use in the treatment of circadian rhythm disorders.

2. A composition comprising at least one selective adenosine receptor modulator, wherein said composition modulates two or three, but not all of adenosine receptor subtypes

Ai, A2A, A2B and/or A3 for use in the treatment of circadian rhythm disorders or for modulating a biological clock.

3. The adenosine receptor modulator of claim 1 or the composition of claim 2 wherein said circadian rhythm disorder is a circadian rhythm dysfunction.

4. A composition comprising at least one selective adenosine receptor modulator, wherein said composition modulates two or three, but not all of adenosine receptor subtypes

Ai, A2A, A2B and/or A3 for use in circadian realignment.

5. A method of realignment of the circadian rhythm comprising the once a day administration of a compound comprising at least one selective adenosine receptor modulator, wherein said composition modulates two or three, but not all of adenosine receptor subtypes Ai, A2A, A2B and/or A3.

6. A composition comprising at least one selective adenosine receptor modulator, wherein said composition modulates two or three but not all of adenosine receptor subtypes

Ai, A2A, A2B and/or A3 for use in circadian realignment or adjustment by administration once a day.

7. The composition of claim 6 or method of claim 5 wherein administration is at Circadian

Time 4 t o 8, preferably at Circadian Time 6.

8. The composition of claim 6 or method of claim 5 wherein administration is Circadian

Time 14 t o 18, preferably at Circadian Time 16.

9. The composition of any one of claims 2 to 4 or 6 to 8 or the method of any one of claims 5, 7 or 8, wherein said composition modulates A and A2A and/or A2B, preferably A and A . 10. The composition of any one of claims 2 t o 4 or 6 to 8 or the method of claims 5, 7 or 8, wherein said composition comprises a single adenosine receptor modulator which selectively modulates two adenosine receptor subtypes, preferably A and A 2A-

11. An adenosine receptor modulator according to claim 1 or 3, a composition as claimed in any one of claims 2 to 5 or 7 t o 10, or a method as claimed in claims 5, 7 or 8, wherein the adenosine receptor modulator is an agonist, antagonist or inverse agonist of said adenosine receptor, preferably an antagonist or inverse agonist.

12. An adenosine receptor modulator according to claim 1 or 3, a composition as claimed in any one of claims 2 to 5 or 7 t o 10, or a method as claimed in claims 5, 7 or 8, wherein the adenosine receptor modulator is an antagonist.

13. An adenosine receptor modulator according to claim 1 or 3, a composition as claimed in any one of claims 2 to 5 or 7 t o 10, or a method as claimed in claims 5, 7 or 8, wherein the adenosine receptor modulator is a small molecule, a peptide, a protein, an aptamer, a non- coding NA, or an antibody or antibody fragment.

14. An adenosine receptor modulator according to claim 1 or 3, a composition as claimed in any one of claims 2 to 5 or 7 to 10, or a method as claimed in claims 5, 7 or 8, wherein the adenosine receptor modulator or selective adenosine receptor modulator is selected from :

1-Deoxy-l-[6-[((3-lodophenyl)methyl)amino]-9H-purin-9-yl]-N-methyl - -D- ribofuranuronamide, N6-(3-lodobenzyl)adenosine-5'-N-methyluronamide;

- 2-[[6-Amino-3,5-dicyano-4-[4-(cyclopropylmethoxy)phenyl]-2-pyridinyl]thio]- acetamide;

3-[4-[2-[ [6-amino-9-[(2R,3R,4S,5S)-5-(ethylcarbamoyl)-3,4-dihydroxy-oxolan-2- yl]purin-2-yl]amino]ethyl]phenyl]propanoic acid;

2-amino-8-[2-(4-morpholinyl)ethoxy]-4-phenyl-5H-indeno[l,2-d]pyrimidin-5-one;

- 8-[(E)-2-(3,4-dimethoxyphenyl)vinyl]-l,3-diethyl-7-methyl-3,7-dihydro-lH-purine-2,6- dione;

4-(2-(7-amino-2-(furan-2-yl)-[l,2,4]triazolo[l,5-a] [l,3,5]triazin-5-ylamino)ethyl)phenol;

9-Chloro-2-(2-furanyl)-5-((phenylacetyl)amino)-[l,2,4]triazolo[l,5-c]quinazoline; 3-[(4-amino-3-methylphenyl)methyl]-7-furan-2-yltriazolo[5,4-d]pyrimidin-^

2-(2-Furanyl)-7-[2-[4-[4-(2-methoxyethoxy)phenyl]-l-piperazinyl]ethyl]7H- pyrazolo[4,3-e] [l,2,4]triazolo[l,5-c]pyrimidine-5-amine;

4-hydroxy-N - (4-methoxy-7-morpholinobenzo [d]thiazol-2-yl)-4-methylpiperidine-l- carboxamide;

2-butyl-9-methyl-8-(triazol-2-yl)purin-6-amine; or

(6- Amino-9-methyl-8-(2H-l,2,3-triazol-2-yl)-9H-purin-2-yl)butan-2- one.

15. An adenosine receptor modulator according to claim 1 or 3, a composition as claimed in any one of claims 2 to 5 or 7 t o 10, or a method as claimed in claims 5, 7 or 8, wherein the specific adenosine receptor modulator has at least 30% affinity, or at least 40% affinity, or at least 50% affinity or more for one, two or three, but not all of the adenosine receptor subtypes

16. An adenosine receptor modulator according to claim 1 or 3, a composition as claimed in any one of claims 2 t o 5 or 7 to 10, or a method as claimed in claims 5, 7 or 8, wherein the specific adenosine receptor modulator has at least 60% affinity or more for one, two or three, but not all of the adenosine receptor subtypes Ai, A2A, A 2b and/or A3, preferably A and A2A.

17. An adenosine receptor modulator according to claim 1 or 3, a composition as claimed in any one of claims 2 to 5 or 7 t o 10, or a method as claimed in claims 5, 7 or 8, wherein the modulator results in an increase in Perl or Per2 gene expression after administration t o a subject.

18. An adenosine receptor modulator, composition or method according to claim 17, wherein the increase in Perl or Per2 gene expression is observed at least 2 to 6 hours after administration.

19. An adenosine receptor modulator, composition or method according to claim 18, wherein the increase in Perl or Per2 gene expression is observed at least 4 hours after administration.

20. An adenosine receptor modulator, composition or method according to any one of claims 17 to 19, wherein the increase in Perl or Per2 gene expression is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about

100% or more increase in expression compared to in a subject without the administration of the modulator.

21. A pharmaceutical composition comprising an adenosine receptor modulator according to claim 1 or 3, a composition as claimed in any one of claims 2 to 5 or 7 to 10 and a pharmaceutically acceptable carrier.

22. The adenosine receptor modulator or composition of claim 3 wherein said circadian rhythm dysfunction occurs in peripheral tissues.

23. The adenosine receptor modulator or composition of claim 3 wherein said circadian rhythm dysfunction occurs in the cardiovascular system, lungs, heart, circulatory system, immune or lymphatic system, stomach, pancreas, liver, spleen, small or large intestine, reproductive tissues, kidneys, bladder or urinary system, muscle, bone marrow, skin, endocrine system or peripheral nervous system.

INTERNATIONAL SEARCH REPORT International application No PCT/GB2017/051029

A. CLASSIFICATION O F SUBJECT MATTER INV. A61K31/44 A61K31/4439 A61K31/505 A61K31/517 A61K31/519 A61K31/53 A61P43/0Q ADD. According to International Patent Classification (IPC) or to both national classification and IPC

B. FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) A61K A61P

Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched

Electronic data base consulted during the international search (name of data base and, where practicable, search terms used)

EPO-Internal WPI Data, BIOSIS, EMBASE

C. DOCUMENTS CONSIDERED TO BE RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

EP 1 921 077 Al (KYOWA HAKKO KOGYO KK I - 4 , [JP] 14 May 2008 (2008-05-14) II- 13 , 15 , 16, 21-23 page 2 , paragraph 8 1-23 page 13, paragraph 37 - paragraph 38 page 87; example 1 page 89, paragraph 237 - paragraph 238 c l aims 30-33

/ -

X Further documents are listed in the continuation of Box C. See patent family annex.

* Special categories of cited documents : "T" later document published after the international filing date or priority date and not in conflict with the application but cited to understand "A" document defining the general state of the art which is not considered the principle or theory underlying the invention to be of particular relevance "E" earlier application or patent but published on or after the international "X" document of particular relevance; the claimed invention cannot be filing date considered novel or cannot be considered to involve an inventive "L" document which may throw doubts on priority claim(s) orwhich is step when the document is taken alone cited to establish the publication date of another citation or other " document of particular relevance; the claimed invention cannot be special reason (as specified) considered to involve an inventive step when the document is "O" document referring to a n oral disclosure, use, exhibition or other combined with one or more other such documents, such combination means being obvious to a person skilled in the art "P" document published prior to the international filing date but later than the priority date claimed "&" document member of the same patent family

Date of the actual completion of the international search Date of mailing of the international search report

28 June 2017 07/07/2017

Name and mailing address of the ISA/ Authorized officer European Patent Office, P.B. 5818 Patentlaan 2 NL - 2280 HV Rijswijk Tel. (+31-70) 340-2040, Fax: (+31-70) 340-3016 Young, Astri d INTERNATIONAL SEARCH REPORT International application No PCT/GB2017/051029

C(Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

Y CHRISTINA L RUBY ET AL: "Adenosi nergi c 1-23 Regul ation of Stri atal Cl ock Gene Expression and Ethanol Intake Duri ng Constant Light" , NEUROPSYCHOPHARMACOLOGY. , vol . 39, no. 10, 23 Apri l 2014 (2014-04-23) , pages 2432-2440, XP055385664, US ISSN : 0893-133X, DOI : 10. 1038/npp.2014.94 page 2432 , left-hand col umn - right-hand col umn, paragraph 1 Pharmacol ogi cal treatment; page 2434 Di scussion; page 2435

Y HESTER C. VAN DI EPEN ET AL: "Caffeine 1-23 i ncreases l ight responsiveness of the mouse c i rcadi an pacemaker" , EUROPEAN JOURNAL OF NEUROSCI ENCE. , vol . 40, no. 10, 5 September 2014 (2014-09-05) , pages 3504-3511 , XP055385694, GB ISSN : 0953-816X, DOI : 10. 1111/ejn . 12715 Di scussion; page 3507 - page 3508, left-hand col umn, paragraph 1

Y JOHN R. ATACK ET AL: "JNJ-40255293, a 1-23 Novel Adenosi ne A 2A / A 1 Antagoni st wi t h Effi cacy i n Precl i ni cal Model s of Parki nson ' s Di sease" , ACS CHEMICAL NEUROSCI ENCE, vol . 5 , no. 10, 15 October 2014 (2014-10-15) , pages 1005-1019 , XP055385677, US ISSN : 1948-7193, DOI : 10. 1021/cn5001606 page 1007 , r i ght-hand col umn , paragraph 2 abstract INTERNATIONAL SEARCH REPORT International application No Information on patent family members PCT/GB2017/051029

Patent document Publication Patent family Publication cited in search report date member(s) date

EP 1921077 A l 14-05-2008 CA 2617817 A l 08-02-2007 EP 1921077 A l 14-05-2008 P 5121453 B2 16- 01-2013 JP WO20O7015528 A l 19-02-2009 T 2 74 434 A 01-11-2007 US 2010152162 A l 17- 06-2010 WO 2007015528 A l 08-02-2007