© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. interfering with the viral lifecycle, and many new DAA drugs are are drugs DAA new many and lifecycle, viral the with interfering on focused have advancements therapeutic success, this Following patients; the exact rate is dependent on both virus of and host factors 56–95% to improved have rates cure viral therapy, ribavirin and Samantha Badil Massachusetts, USA Massachusetts, (D.P.B.). of Molecular Genetics and Microbiology, Center for Virology, Duke University Medical Center, Durham, North Carolina, USA (S.M.H.); Cambridge, Sanofi-Genzyme, 6 Medicine and Genetics Program, University of Arkansas for Medical Sciences, and The Central Arkansas Veterans Healthcare System, Little Rock, Arkansas, USA. 4 Program, Laboratory of Experimental Immunology, Leidos Biomedical Research–Frederick, Frederick National Laboratory for Cancer Research, Frederick, Maryland, USA. 1 (DAA), to antiviral pegIFN- a of type inhibitors, direct-acting tease patients of 40% than fewer in response IFN- (pegIFN- pegylated with treatment combination was infection HCV chronic for care of standard the Previously, exists. currently vaccine type I and III IFNs during HCV infection. data collectively define a novel cross-regulation between miRNAs can suppress type III IFN family members, these expression of myosins over HCV infection alone. Since these of HCV-infected hepatocytes with type I IFN increased IFN-stimulated genes and a decrease in HCV load. Treatment exogenous type I IFN, as measured by a marked increase in Additionally, inhibition rescued the antiviral response to during HCV infection increased expression of IFNAR1. IFNAR1. Inhibition of these miRNAs by using miRNA inhibitors down-regulating expression of the type I IFN receptor chain, IFN signaling in HCV-infected hepatocytes by directly show that miR-208b and miR-499a-5p also dampen type I gene family, to support viral persistence. In this study, we IFNL2 miRNAs, along with AU-rich-element-mediated decay, suppress encoded by myosin genes in infected hepatocytes of two host microRNAs (miRNAs), miR-208b and miR-499a-5p, We recently demonstrated that HCV induces aberrant expression progress to cirrhosis and liver cancer in 2–10% of patients and 60–80% of cases persist as a chronic infection that will Hepatitis C virus (HCV) infects 200 million people globally, Michael Gale Jr Abigail Jarret interferon-mediated antiviral signaling Hepatitis-C-virus-induced microRNAs dampen nature medicine nature Received 1 July; accepted 15 September; published online 14 November 2016; Present Present addresses: Molecular and Cellular Biology Program, Department of Microbiology, University of Washington, Seattle, Washington, USA (A.P.M.); Department Ragon Institute of General Massachusetts Hospital, Institute Massachusetts of Technology and Harvard University, Boston, USA. Massachusetts, Department of Immunology, University of Washington, Seattle, Washington, USA. HCV HCV is a hepatotropicsingle-stranded RNA virus against which no and α ) and ribavirin, which produced a sustained virological virological sustained a produced which ribavirin, and ) IFNL3 1 , Adelle P McFarland 1

, members of the type III interferon (IFN) 1 & Ram Savan , Rochelle C Joslyn advance online publication online advance 7 These These authors contributed equally to this work. should Correspondence be addressed to R.S. ( 1 5 . With the addition of pro of addition the With . 1 1 , , Darren P Baker 6 , 7 , Stacy M Horner

4 . These

1–

2 3 6– , . 6

α α , Mary Carrington 9 - 1 . d

, o 6 2 i Biogen-Idec Biogen-Idec Inc., Cambridge, USA. Massachusetts, , : 7 1 the high cost of DAA treatments might limit the availability of these these of availability the limit might DAA of treatments cost high the patients of subset a in results dramatic produced have ribavirin, with times some inhibitors, polymerase RNA and protease HCV of binations trials clinical in currently that that creates variant frameshift dinucleotide a is rs368234815, variants, these of SNPs tag primary the with disequilibrium linkage in ants therapy single- of HCV clearance natural with associate three identified have (SNPs) near polymorphisms the antiviral nucleotide genotype. studies host and association load viral Genome-wide baseline genotype, viral including treatment. IFN I type ( 3 lambda feron HCV therapies have IFN-based but failed why also suggests the inter expression. This novel not mechanism only provides insight into why that by HCV I type dampens targeting IFN signaling I of therapy. IFN type to failure employs the In study,lead this which we show HCV that mechanisms the identify to critical is it Hence, proven fully be to remains death—also hepato and/or carcinoma failure, cellular liver decompensation, hepatic for risk at highest are the who infection, advanced with those as patients—such some worldwide therapies by HCV-induced miRNAs, miR-208b and miR-499a-5p. IFN miR-499a-5p. and miR-208b miRNAs, HCV-induced by AU-rich element-mediated decay and regulation post-transcriptional of expression increases rs4803217) (G/G, ing IFNL3 3 the in located rs4803217, tified We iden elucidated. fully be to yet has correlation this behind nism of expression , Alison Kell 0 . Several viral and host factors are predictive of HCV clearance, clearance, HCV of predictive are factors host and viral Several 1 0 IFNL3 3 8 , as a functional SNP that determines HCV clearance by alter clearance HCV determines that SNP a , functional as / 14 n 1 m 0 , 16– . However, the emergence of resistant HCV variants and and variants HCV resistant of emergence the However, . expression . 4 IFNL4 2 1 8 1 . Ensuing studies have since identified four genetic vari IFNL4 1 1 , Johannes Schwerk 3 IFNL3 , , a gene of upstream , 4 11– , Curt H Hagedorn correlates with viral persistence. The mecha The persistence. viral with correlates 4 . We further showed that the protective allele allele protective the that showed We . further 1 3 ) genotype correlates with the outcome of of outcome the with correlates genotype ) . The usefulness of . The DAA-based usefulness for therapies 6 , 1 0 . More recently, interferon-free com interferon-free recently, More . [email protected] ′ untranslated region (3 region untranslated IFNL3 1 14 , MeeAe Hong , 3 1 5 Cancer Cancer and Inflammation 5 IFNL3 , and patient response to response patient and (ref.

). by escaping both both escaping by 2 5 2 Department Department of IFNL3 ). ). Paradoxically, IFNAR1 s r e t t e l 1 19– ′ gene that UTR) of of UTR) , mRNA 2 λ 1 . One One . 3 is a is 3 1 3  ------.

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. c ( experiments more or three of representative experiment one from are Data h. 48 at assayed inhibitor NC with transfected cells ( was quantification relative for sample for expression Gene inh. NC or inh myomiR with transfected cells Huh7 HCV-infected in expression for nucleotides and underlined are regions 3 the of sites numerous to bind which miR-499a-5p, and β IFN- with treated then h and 48 for (NC) inhibitor control non-targeting or inh) (myomiR miR-499a-5p and miR-208b against inhibitors with transfected of 1 Figure the with those than therapy this to respond to to likely less response are allele patient of predictor strongest pegIFN- the also is genotype therapies. IFN and host virus, between interplay the about understood be to remains much how as well as HCV infection, in signaling IFN of complexity the underlines disparity This pegIFN- to response with correlate negatively to shown been has therapy IFN before livers HCV-infected in expression ISG cells adjacent and HCV-infected in activity antiviral and subsequent ISG expression high with correlates that the favorable demonstrated human hepatocytes lated genes (ISGs). A recent study using potent antiviral that cytokine induces expression of interferon-stimu s r e t t e l  Student’s , for 6 h. ( 6 h. for

′ g UTR. p(A) UTR. eod t aiiy o rdc ntrl laac o HCV, of clearance natural predict to ability its Beyond MYH7 , box and whisker plots show median values (line), 50th percentile values (box outline) and minimum and maximum values (whiskers)). Unpaired Unpaired (whiskers)). values maximum and minimum and outline) (box values percentile 50th (line), values median show plots whisker and , box a MYH7 mRNA (fold)

100 and and Inhibition of miR-208b and miR-499a-5p during HCV infection improves hepatocyte response to IFN- to response hepatocyte improves infection HCV during miR-499a-5p and miR-208b of Inhibition α 25 50 75 t 0 c -test was used for all statistical comparisons; * comparisons; statistical all for used was -test plus ribavirin therapy: patients with the unfavorable unfavorable the with patients therapy: ribavirin plus ) HCV viral titer and copy number from samples in in samples from number copy and titer viral ) HCV n , poly(A) site. ( site. , poly(A) MYH7B Mock ***

HCV in Huh7 cells infected with HCV MOI 1.0 for 48 h. ( h. 48 for 1.0 MOI HCV with infected cells Huh7 in f e d IFNAR1 mRNA (fold) 0.0 0.5 1.0 1.5 2.0 miR-208b 3’-UGUUUGGAAAACAAGCAGAAUA-5’ e MYH7B mRNA (fold) ) Sequence alignment of miR-208b and miR-499a-5p and their binding sites in the the in sites binding their and miR-499a-5p and miR-208b of alignment ) Sequence

NC 0 1 2 3 4 5 6 3680 5’ 2999 5’ IFNAR

myomiR inh 325 5’ Mock ** 1 *** 2 a

3 3 -UGGCGCGCGCCUGUUGUCUUAG- -UUUCACUUGUGUUUUGUCUUAA- -ACCCACCUGAUGUAGGUCUUAU- – . In contrast, the magnitude of of magnitude the contrast, In . ′ c UT HCV ex vivo ) mock-infected cells transfected with myomiR inhibitors or NC inhibitor assayed at 48 h or ( h or 48 at assayed inhibitor NC or inhibitors myomiR with transfected cells ) mock-infected IFNAR1 IFNAR2 mRNA (fold) R 0.0 0.5 1.0 1.5 HCV-infected primary b 3 MX1 mRNA (%) ′ 100 150 UTR are indicated. ( indicated. are UTR NC myomiR inh 50 0 IFNAR1 0.5 kb IFNL3 P HCV +IFN- < 0.05, ** < 0.05, α ** b therapy . . ( 3 genotype genotype ′ d 3’ 3701 3’ 3020 3’ 346 UTR. ( UTR. , IFNL3 β miR-208b e g

) RNA hybrid analysis was used to show miRNA–target interactions for miR-208b miR-208b for interactions miRNA–target show to used was analysis hybrid ) RNA % of maximum P NC 100 < 0.01, *** < 0.01, 2 20 40 60 80 OAS1 mRNA (%) 4 0 - d . b 100 150 200

f miR-499a-5p 3’-UUUGUAGUGACGUUCAGAAUU ) Schematic of miR-208b and miR-499a-5p binding sites on the the on sites binding miR-499a-5p and miR-208b of ) Schematic ) Levels of of ) Levels 50 ) Expression of ISGs ISGs of ) Expression 0 myomiR inh Since these clinical observations, studies have demonstrated that that demonstrated have vitro in studies observations, clinical these Since had intermediate or low hepatic hepatic low or therapy IFN intermediate to had respond not did or relapsed who patients whereas hepatic high IFNAR1 IFNAR1 of expression the them among therapy, pegIFN- of success the with correlate that pathway unknown. are this guiding mechanisms the yet infection, during pathways these of regulation pegIFN- to response and type allele favorable HCV +IFN- miR-499a-5p 10 Factors have been identified within the type I IFN signaling signaling IFN I type the within identified been have Factors 1 NC 3681 5’ 2175 5’ ** 325 5’- P * IFNAR1 10 < 0.001. HCV infection or treatment of hepatocyte cells with a HCV a HCV with cells hepatocyte of treatment or infection HCV IFNAR1 and and is a subunit of the type I IFN receptor composed of of composed receptor IFN I type the of subunit a is 2 β myomiR inh -UCACUUGUGUUUUGUCUUAAA- -UGUUGGUCAGGCUGGUCUUGG- 10 UGGCGCGCGCCUGUGUCUUAG IFNAR2 3 PKR mRNA (%) IFNAR1 and and 100 150 advance online publication online advance 50 14 10 MX1 0 , 16– 4 IFNAR2 HCV +IFN- a – , , 1 chains. Studies have found that patients with with patients that found have Studies chains. c OAS1 8 mRNA responded better to IFN therapy, therapy, IFN to better responded mRNA , . This association between between association This . f IFNAR1 (MFI) ** was assessed using qPCR, and the reference reference the and qPCR, using assessed was 1.0 1.5 2.0 2.5 3.0 mRNA and ( and mRNA and and × × × × × β 10 10 10 10 10 β α 3 3 3 3 3 by increasing IFNAR1. ( IFNAR1. increasing by p(A) PKR c therapy suggests a possible cross- possible a suggests therapy -

IFNAR1 NC inh -3’ 345 IFNAR1 5’

3’ 3701 3’ 2195 FFU/mL n myomiR inh 1,000 1,500 in HCV-infected Huh7 cells cells Huh7 HCV-infected in 500 ** 0 g * NC inh ) IFNAR1 surface protein protein surface ) IFNAR1 3 myomiR inh mRNA, respectively mRNA, ′ IFNAR1 UTR; miRNA–target seed seed miRNA–target UTR; * a , HCV +IFN- b

, f nature medicine nature , mean , mean 5

HCV copies (10 ) liver the in 12 15 f α 6 9 0 3 ) HCV-infected ) HCV-infected

NC inh ribavirin and IFNL3 a β

) Expression ) Expression myomiR inh ± IFNAR1 s.e.m.; s.e.m.; ** geno 27– 25

, 2 3 6 1 - . .

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. mean mean ( or group per replicates four with experiments two of representative experiment ( from are Data NC. of % mRNA as expressed and change fold NC to normalized IFN- IU/mL 500 with stimulated mimic NC or mimics forms. phosphorylated their IFN- IU/mL 500 with stimulated and mimic NC or mimics myomiR with h (myomiR); 14.1 and (NC) 100%. as set 0 h, at that to relative time over remaining mRNA as IFNAR2 ( (pLV-499a-5p). (pLV-208b) miR-499a-5p or miR-208b overexpressing stably cells HepG2 in expression protein surface ( non-significant. ns, cells. NC-transfected was expression relative for sample Reference (NC). mimic a control or (myomiRs) mimics both IFNAR2 2 Figure decreased explains that mechanism a infection, HCV during expression surface IFNAR1 regulating mechanism one levels protein IFNAR1 decreases indirectly that cells in hepatoma response stress reticulum endoplasmic or protein unfolded the induces replicon subgenomic nature medicine nature Student’s ± s.e.m.; s.e.m.; mRNA in HepG2 cells transfected with myomiR mimics or NC mimic and treated with actinomycin D to arrest new transcription, presented presented transcription, new arrest D to actinomycin with treated and mimic NC or mimics myomiR with transfected cells HepG2 in mRNA of a mixture miR-499a-5p, miR-208b, for mimics with transfected Huh7 or PH5CH8, HepG2, lines cell hepatocyte the in expression mRNA

myomiR overexpression reduces IFNAR1 expression, dampening downstream Jak-STAT signaling and induction of ISGs. ( ISGs. of induction and Jak-STAT signaling downstream dampening expression, IFNAR1 reduces overexpression myomiR t d -test ( -test my omiR mims b IFN- b , c , pS pS , c β ST ST g pJ pT b a , -actin β TAT TAT

, box and whisker plot shows median values (line) and minimum and maximum values (whiskers)). One-way ANOVA ( ANOVA One-way (whiskers)). values maximum and minimum and (line) values median shows plot whisker and , box J e T AT AT ak1 ak1 yk2 yk2 ) was used for statistical comparison, * comparison, statistical for used ) was % RNA of NC advance online publication online advance 12 10 2 1 2 1 % of maximum 20 40 60 80 100 0 0 0 20 40 60 80 32 0

miR-208b , β IFNAR2 miR-499a-5pNC 3 + – 3 -actin was run as a loading control. ( control. a loading as run was -actin . While these data provide insight into into insight provide data these While . Ctrl ** 0

′ my omiRs ** 10 , 9.9 h (NC) and 10.5 h (myomiR). * h (myomiR). 10.5 and h (NC) , 9.9 ** HepG2 pL 3 IFNA V- miR-208b

208b miR-499a-5p

+ – + – NC R1 15 10 my ′ 4 omiRs pL V- 10 499a β 5 for 6 h. Relative quantification was computed using the respective unstimulated cells then then cells unstimulated respective the using computed was quantification Relative 6 h. for 30

% RNA of NC IFNAR1 ′

12 IFNAR1 (MFI) 10 20 40 60 80 3.0 3.0 6.0 9.0 1.2 0 0 0 P

< 0.05, ** < 0.05,

× × × × miR-208b

miR-499a-5pNC IFNAR1 10 10 10 10 + – *** mRNA mRNA 0 e 3 4 3 3 R ) Expression of ISGs ISGs of ) Expression 60 my 2 Ctrl ** ′ pLV-208b omiRs ≥ PH5CH8 ** 0.63 for all curve fits. Half-lives (50% mRNA remaining): remaining): mRNA (50% Half-lives fits. curve all for 0.63 β for 0, 15, 30, or 60 min. Blot was probed for STAT1, for probed STAT2,was Blot Tyk2 min. 60 Jak1, or and 30, 15, 0, for P P IFNAR2 * = 0.0003 ( = 0.0003 p miR-208b < 0.01, *** < 0.01, LV- miR-499a-5pNC 499a machinery to complementary sequences in the 3 the in sequences complementary to machinery expression. IFNAR1 reduces directly that factor HCV-specific a indicated has study Moreover, no described. be to yet has patients infected HCV in levels ** ns c a % MX1 mRNA e my miRNAs regulate gene expression by guiding mRNA degradation degradation mRNA guiding by expression gene regulate miRNAs – ) one experiment of four experiments with similar results, ( results, similar with experiments four of experiment ) one 10 omiRs e 20 40 60 80 ) one experiment of two experiments with similar results ( results similar with experiments two of experiment ) one 0 0 IFN- c F

P % mRNA remaining test). ( test). MX1 β < 0.001. 100 75 25 50

** % RNA of NC , , 12 10 * 6 4 2 0 20 40 60 80 OAS1 0 0 0 d ) Immunoblot of lysates from HepG2 cells transfected transfected cells HepG2 from lysates of ) Immunoblot

IFNAR1 miR-208b miR-499a-5pNC and and

% OAS1 mRNA * my 10 Post-Act D(h) 20 40 60 80

PKR omiRs NC 0 0 0 8 * * Huh7

in HepG2 cells transfected with myomiR myomiR with transfected cells HepG2 in miR-208b miR-499a-5p myomiR NC NC my ** 4 2 omiR ns

IFNAR2 my omiRs 8 6 c ) Stability of of ) Stability % PKR mRNA 10 20 40 60 80 0 0 a IFNAR1 ′ ) ) UTR of mRNAs of UTR IFNAR1 * IFNAR1 s r e t t e l a b ) or unpaired unpaired ) or , 34.5 h , 34.5 ) IFNAR1 ) IFNAR1 b a ) one ) one and and , c and and , e , 3 4  . © 2016 Nature America, Inc., part of Springer Nature. All rights reserved. LNA inhibitor with a non-targeting sequence that does not bind to to bind not does that sequence non-targeting a with inhibitor LNA (ref. Huh7 line cell hepatoma the of infection HCV during 5p miR-499a- and miR-208b endogenous inhibit to inhibitors (LNA) acid nucleic locked characterized previously we used signaling, IFN pathway. signaling I IFN type the in effectors targeted myomiRs pegIFN- peutic depends on the host response to endogenous type I IFNs and/or thera as a surrogate readout for myomiR expression that demonstrates This miRNAs in liver biopsies from patients chronically infected with HCV. of MYH7B genes parental respective their of expression with lates corre myomiRs these of expression that shown have myofibers in ( 7B ( 7 chain heavy myosin genes, ing of myosin-encod introns two the in “myomiRs” are encoded as they to tion miRNAs in may genes pathways these addi multiple target signaling immune innate within that Wehypothesized liver. the in expressed (ref. miR-499a-5p and miR-208b of expression induces infection HCV that We demonstrated previously by determined ( ( from are ( of expression and lysed were cells transfection, h post 48 ( qPCR. by measured IFN- IU/mL 100 or PBS with treated h later 24 and plated were replicon HCV bicistronic JFH-1-derived harboring cells Huh7 or respectively) cells Huh7-HP and (Huh7-K2040 replicons RNA HCV subgenomic (HP) passage number, copy of expression 3 Figure s r e t t e l  Huh7 (NC). control as a non-targeting used was miRNA any known a a

, ( cells, ) mock-infected To investigate the effects of HCV-induced myomiRs on type I type on myomiRs HCV-induced of effects the investigate To d MYH7 ) or unpaired Student’s Student’s unpaired ) or MYH7B

IFNL2 3 Myosin induction is dependent on viral replication. ( replication. viral on dependent is induction Myosin a 5 and and . We found a significant correlation between transcript levels – c c a

) one experiment representative of two or three experiments or ( or experiments three or two of representative experiment ) one MYH7 mRNA (fold) ), respectively ), MYH7 MYH7 1,00 F and and 100 MYH7B -test. * -test.

10 MYH7 mRNA (fold) α 0 1 100 150 200 250 300 350 , we were interested in determining whether these these whether determining in interested were we , 50 and and and and 0 d

IFNL3 JFH1 ) PH5CH8 cells were transfected with with transfected were cells ) PH5CH8 P

(–) < 0.05, ** < 0.05, MYH7B with their intronic pri-miRNAs and mature mature and pri-miRNAs intronic their with b MYH7B MYH7

) untreated HCV-infected cells, ( cells, HCV-infected ) untreated K2040

0.5 HCV MOI t -test ( -test . miR-208b and miR-499a-5p are termed termed are miR-499a-5p and miR-208b . 3 5

1 . Studies of miR-208b and miR-499a-5p miR-499a-5p and miR-208b of Studies . H27HP was assessed. ( assessed. was expression were assessed 24 h post treatment. ( treatment. h post 24 assessed were expression

2 and and b , P

10 c < 0.01, *** < 0.01, ) was used for statistical comparison. Welch’s correction was applied to samples in ( in samples to applied was Welch’s correction comparison. statistical for used ) was MYH7 MYH7B 4

), two miRNAs not normally normally not miRNAs two ), MYH7B mRNA (fold) MYH7B mRNA (fold) 10 20 30 0

10 15 ) and myosin heavy chain chain heavy myosin and )

0 5

expression can be used used be can expression JFH1

(–) b PBS 4 P ) Huh7 cells infected with HCV for 24 h were treated with increasing doses of NS5B inhibitor. Viral Viral inhibitor. NS5B of doses increasing with treated h were 24 for HCV with infected cells ) Huh7 . . Since HCV clearance < 0.001.

0.5 K2040 HCV MO

1 IFN- MYH7

H27HP 1 2 c I ) unstimulated Huh7.5 cells, or ( or cells, Huh7.5 ) unstimulated β in vitro in a

0 MYH7 ) Huh7 cells were infected with increasing MOIs of virus or mock-infected for 48 h and h and 48 for mock-infected or virus of MOIs increasing with infected were cells ) Huh7 and and transcribed full-length HCV RNA genomes of JFH1, JC1 or H77D HCV viral strains. strains. viral HCV H77D or JC1 JFH1, of genomes RNA HCV full-length transcribed 4 NS5B inh b

MYH7B MX1 mRNA (fold) 1,000 and and ). A ). 100 ( 0.1 µ 10

β 6 M) 1 Viral copy number (10 ) . 24 h later cells were lysed and expression of of expression and lysed were cells h later . 24 - - - - 12 16

JFH1 0 4 8 d was assessed by qPCR. Reference sample for relative quantification was was quantification relative for sample Reference qPCR. by assessed was ) four biological replicates pooled ( pooled replicates biological ) four these findings suggested that myomiR-regulated factor(s) influenced influenced that factor(s) myomiR-regulated suggested findings these myo ( of miRs presence the in IFN I type of ISG in downstream was seen expression difference the and effect, measurable no had IFNs III cells IFN- with treated mock-infected or inhibitors with treated cells HCV-infected β IFN- and infection HCV on dependent was inhibitors the of ( effect number copy RNA and titer correlated viral in cells decreases with inhibitor-transfected myomiR in Increased expression control. ISG non-targeting the to myo the compared with inhibitors treated miR cells in higher significantly was ISGs these IFN- lowing ( by (encoded Mx GTPase ISGs were ( study genes previous our in myosin documented as infection parental following induced their and that miR-499a-5p confirmed We miR-208b, induction. IFN for important receptor nition pathogen-recog essential an helicase gene), the of (retinoic-acid-inducible RIG-I downstream signaling disrupts HCV as signaling, IFN- IFN- with treated inhibi then NC and an HCV, or with infected inhibitors tor, myomiR with transfected were cells Fig. 1 Fig. OAS1 treatment, as there was no difference in ISG expression in either either in expression ISG in difference no was there as treatment, 1 0 K2040 HCV (MOI1) c ) Huh7 cells harboring the Con1-derived bicistronic K2040 or high- or K2040 bicistronic Con1-derived the harboring cells ) Huh7 β ** was used to mimic therapeutic and paracrine type I IFN IFN I type paracrine and therapeutic mimic to used was Supplementary Text 1 Supplementary ) and the translational inhibitor inhibitor translational the and ) a

H27HP * , , Supplementary Fig. 1a Fig. Supplementary ** 2 * β d tmlto ( stimulation ) untreated mock-transfected (PBS) PH5CH8 cells. Data Data cells. PH5CH8 (PBS) mock-transfected ) untreated advance online publication online advance

d MYH7 mRNA (fold) β

MYH7 mRNA (fold) 100 150 200 ( 50 10 0 Supplementary Fig. 1b Fig. Supplementary 20 40 60 80 0 0

PBS 1 0 HCV (MOI1)

JFH1 i. 1 Fig. ; ;

MX1 JC1 Supplementary Fig. 2a Fig. Supplementary ** a 2 H77D * – ** d ). As expected, expression of the the of expression expected, As ). ; mean ; mean * ), ), 2 b ). Interestingly, induction of of induction Interestingly, ). MYH7 ′ MYH7B mRNA (fold) -5 10 c MYH7B mRNA (fold) 0 2 4 6 8 ) with unequal variance as variance unequal ) with PKR ′ 0. 0. 1. 1. 2. 2. oligoadenylate synthetase synthetase oligoadenylate ± 0 5 0 5 0 5 s.e.m.). One-way ANOVA One-way s.e.m.). , , 1 0 HCV (MOI1) , MYH7B

c PBS were all induced fol induced all were ). In this system, type type system, this In ).

JFH1 *** nature medicine nature

JC1 and and *** * H77D 2 β – Fig. 1 Fig. ** . Exogenous Exogenous . e MX1 ). Together ). c was was ). The The ). 4 - - - - -

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. that miR-208b and miR-499a-5p antagonized type I IFN signaling signaling IFN I type antagonized miR-499a-5p and miR-208b that ( miR-499a-5p or miR-208b overexpressing cells HepG2 into luciferase fected decreased observed We 3 IFNAR1 the when gene. expression luciferase firefly 3 the IFNAR1 of human the cloned we where assay reporter luciferase a firefly used we miR-499a-5p, and by miR-208b ( cells mimic-treated to control pSTAT1compared induction and ISG ( infection reduced and showed also HCV mimics myomiR the with in transfected cells seen that to similar pattern a In nit. subu IFNAR1 the of expression reduced specifically miR-499a-5p, and miR-208b myomiRs, HCV-induced the that demonstrated This in its 3 its in expression of ( cells NC-transfected than expression surface higher had cells significantly tor-transfected myomiR-inhibi that We discovered cells. Huh7 HCV-infected into inhibitor NC an or inhibitors myomiR transfected we further, this regulate may myomiRs these that suggests This ( miR-499a-5p and miR-208b both for (MREs) elements the that revealed analysis Computational myomiRs. by these targeted be livers infected way. reduced that Given that myomiRs may target hypothesized an upstream we in effector the type I IFN path infection, HCV during ISGs antiviral multiple of response. anti-HCV the improved inhibition IFN- to responsiveness hepatocyte * comparisons, statistical Student’s Unpaired (whiskers)). values minimum/maximum and outline) (box values percentile 50th (line), values median ( experiments three or two of representative experiment one from are Data cells. HCV-infected number, copy viral IFN- of 4 Figure nature medicine nature Supplementary Fig. 1f Fig. Supplementary Supplementary Text 2 Text Supplementary As our data revealed that myomiR inhibition increased expression expression increased that myomiR inhibition As our revealed data IFNAR1 c a FFU/mL β 10,000 ′ , , (

UTR, was unaffected by the myomiR inhibitors ( inhibitors myomiR the by unaffected was UTR, 1,000 Type I but not type III IFNs amplify myosin expression. Huh7 cells infected with HCV MOI 1.0 for 24 h were treated with ( with treated h were 24 for 1.0 MOI HCV with infected cells Huh7 expression. myosin amplify IFNs III Type type not I but 100 (IU/mL) b 10 ) 31 IU/mL IFN- IU/mL ) 31 IFN- 6

3 Viral copy number (10 ) Unstim 12 16 IFNAR2 ′ 0 4 8 β UTR harbors multiple predicted miRNA recognition recognition miRNA predicted multiple harbors UTR HCV 27– 3 MYH7 HCV (MOI1) 3 0 1

IFN- , we investigated whether whether investigated we , *** advance online publication online advance α *** , , which does not harbor MREs for the myomiRs 1 , , P MYH7B ). Taken together, these observations reveal reveal observations these Taken ). together, , , < 0.05, ** < 0.05, IFNAR1 125 *** β Fig. 2a Fig.

, , ( MYH7 (fold) 1,000 c 200 400 600 800 ) 100 ng/mL of IFN- of ng/mL ) 100 ′ 0 ( UTR luciferase construct was trans was construct luciferase UTR MYH7 mRNA (fold) a mRNA has been reported in HCV- reported mRNA been has – Mock 1,000 – e 200 400 600 800 c P β ). To confirm Toconfirm ). *** ) and ) and

< 0.01, *** < 0.01, Unstim 0 and, importantly, that myomiR myomiR that importantly, and, HCV *** HCV (MOI1) IFN- 3 0 OAS1 α *** IFNAR1 1 IFNAR1 Fig. 1f Fig. ( 125 MYH7B (fold) *** P b ′ IFNAR1 12 16 α UTR downstream downstream UTR < 0.001. IU, international units; FFU, focus-forming units. focus-forming FFU, units; international IU, < 0.001. ) expression were assessed. Reference sample for relative quantification was unstimulated unstimulated was quantification relative for sample Reference assessed. were ) expression 0 4 8 or ( or IFNAR1 Mock

mRNA and cell , d g Unstim mRNA could could mRNA MYH7B mRNA (fold) ) 100 ng/mL of IFN- of ng/mL ) 100 ). In contrast, ). In contrast, HCV 10 12 ** 0 2 4 6 8 . . To explore Fig. 1d Fig.

targeting targeting IFN- Fig. 1 Fig. HCV (MOI1) Fig. 1 Fig. α 3 0 * 1 d , b

e 6 f Viral copy number (10 ) ), ), ). ). ). ). 125 - - - - 10 12 14

0 2 4 6 8

infected Huh7 cells reduced viral titer and copy number ( number copy and titer viral reduced Like cells Huh7 infected expression. myosin HCV- of treatment IFN I reduce type prolonged treatment, inhibitor also NS5B would treatment IFN that replication. viral on dependent was expression ( expression myosin to induce sufficient was entry of viral absence the in replication viral that observed also we system, replicon HCV the and load viral reduces and replication genome viral blocks that (NS5B) polymerase RNA RNA-dependent HCV of a with Huh7 2 cells ( (MOI) infection of multiplicity the with correlated cells Huh7 HCV-infected JFH1 in We infection. that have observed also data to date suggest that myomiR/myosin induction is specific to HCV Huh7 Dengue virus-infected cells ( poly(I:C) or HCV 3 the with stimulation following induced are they Westwith nor virus, infection or Huh7 during Nile Sendai virus cells study. current the in expression myomiR for readouts surrogate of expression used we genes, parental their with miR-499a-5p and miR-208b of expression between correlation could lead to the discovery of new antiviral targets. As there is a regulation strong and induction myomiR understanding that reasoned we HCV, against response antiviral the to central are which pathways, expression. ISG and down-regulating by destabilizing (–) Supplementary TextSupplementary 3 λ

IFN- b As type I and type III IFNs inhibit HCV replication, we reasoned reasoned we replication, HCV inhibit IFNs III type and I type As IFN III type and I type the of components targeted myomiRs As We previously showed that We that showed previously HCV (MOI1) 1, IFN- 1,

** MYH7 mRNA (fold) IFN- MYH7B IFN- β HCV 100 150 200 50 ** λ 0 IFN- 1 β λ λ – – –

2 or IFN- 2 or IFN- 2 4 + – induction in a dose-dependent fashion ( fashion in a dose-dependent induction . In addition, we did not observe myosin expression in in expression myosin observe not did we addition, In . λ3 * a – + d ; mean ; mean Fig. 3 Fig.

′ MYH7 mRNA (fold) λ + + -C-methyladenosine nucleoside analog inhibitor inhibitor analog nucleoside -C-methyladenosine 1,000 3 or 30 IU/mL of IFN- of IU/mL 30 3 or 200 400 600 800 0 , , a MYH7B mRNA (fold) ± Fig. Fig. 3c ). Interestingly, treatment of HCV-infected HCV-infected of treatment Interestingly, ). 10 15 20 s.e.m., s.e.m., (–) 0 5 IFN- HCV (MOI1) *** – – –

MYH7 IFN- β , + – d λ1 c

). These ). data These that suggested myosin IFN- ; box and whisker plots show show plots whisker and ; box Supplementary Fig. 3b Supplementary λ IFN- 2 + and MYH7 IFNAR1 λ3 + + β t MYH7B -test was used for all all for used was -test . 24 h post treatment, treatment, h post . 24

36 MYH7B mRNA (fold) OAS1 mRNA (fold) and 10 12 14 10 20 30 40 , MYH7 3 0 2 4 6 8 0 , leading to dampened to dampened , leading 7 also blocked blocked also (–) – – – MYH7B a are not induced in are not induced

) increasing doses doses ) increasing IFN- HCV (MOI1) + – ** and and

IFN- β s r e t t e l Fig. 3 Fig. λ ′ 1 +

UTR PAMPUTR IFN- expression expression MYH7B ). ). Thus, all

λ + + Fig. 4a Fig. IFN- 2 b ). ). Using

λ MYH7 3

– as as c  ;

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. Contract No. HHSN261200800001E (M.C.). The content of this publication publication this of content The (M.C.). under HHSN261200800001E No. Research, Contract Cancer for Laboratory National Frederick federal the with from part in funds or whole in funded been has project CA148068 This and (M.G.), (C.H.H.). AI40035 AI060389, (R.S.), AI108765 of grants Institutes Health National by and (R.S.) Washington of University Royalty Fund, Immunology, Research of Department the by partly funded was project This o Note: Any Supplementary Information and Source Data files are available in the the v in available are references associated any and Methods Me pathways. signaling IFN III type and I type between cross-talk data add to our understanding of HCV immune evasion strategies and I and type III IFN during signaling HCV Collectively, infection. these of variant risk target also myomiRs these that finding previous our with together results Taking these signaling. IFN I type and duction pro IFN III type endogenous by DAA increasing regimens IFN-free pegIFN- for IFN- that suggests this effects; adverse have as shown it 2 pegIFN- phase to trials be as effective Currently, IFN- myomiRs. these of induction IFN bypass will therapies IFN-based III type that possibility the raising expression, myomiR with III type IFNs HCV-infected hepatocytes did not induce myosin/ prolonged I type IFN stimulation by induced be can which IFNs, III type of production the including signaling, IFN I type secondary to response cellular the blunt to tion myomiRs may feedback. func signaling I IFN of terms type in esting inter also is myomiRexpression, for readout surrogate a expression, myosin/myomiR ( increase expression IFNs I type that found we that sidering contherapies, relevant during IFN-based particularly would This be ( signaling IFN I type III and production IFN type regulate consequently which myomiRs, increase can IFNs connect the type I and III IFN pathways genes during HCV infection myosin as type of I expression ( augment to HCV with synergize not ( expression amplified also replicons HCV harbor that Huh7-JFH1 and Huh7-HP Huh7-K2040, lines cell Huh7 the of treatment IFN I type of regulation the in compared to a suggesting cells, untreated role infected for I type IFNs IFN- 3c Fig. Supplementary s r e t t e l  Health of Department the of policies or views the reflect necessarily not does hepatocyte production of type III IFNs and responsiveness to myomiR pegIFN-inhibition could aid in a multistep fashion by increasing both expression of data and our previous observation that inhibition of myomiRs rescues response to type I IFN, resulting in decreased viral load. Based on these antiviral the amplified and IFNAR1 of expression rescued inhibitors IFN. During HCV infection of hepatocytes, we observed that myomiR IFNAR1 surface expression and dampen the antiviral response to type of I repression miRNA transcript. miR-499a-5p, decrease IFNAR1 expression by destabilizing its mRNA A Supplementary Supplementary Text 4 n e

ck l r It is remarkable that unlike treatment with type I IFNs, treatment of Here we have shown that the HCV-induced myomiRs, miR-208b and i n s th i e nowle o β

λ v n dramatically increased e -based therapy is in phase 3 clinical trials, and results from from results and trials, clinical 3 phase in is therapy -based od r

s o i o f

n s t

h o dgm α Fig. 3 Fig. Fig. Fig. f e

IFNL2 t

39 h p IFNL3 e a ,

4 p p ent 0 4 a . myomiR inhibition may also benefit patients on on patients benefit also may inhibition myomiR . e c p ). The ability of type I IFNs to amplify myosin myosin amplify to IFNs I type of ability The ). r ). However, unlike type I IFNs, type III IFNs did did IFNs III type IFNs, I type unlike However, ). e and the risk allele of MYH7 . r

s . , we conclude that myomiRs suppress both type type both suppress myomiRs that , we conclude , , ). However, treatment with either IFN- either with treatment However, ). Fig. Fig. 4a ( Fig. 4a Fig. MYH7 – d 3 IFNAR1 8 ). ). These data suggest that myomiRs ( – expression in HCV-infected cells Supplementary Fig. 4 Supplementary c ). In line with this observation, observation, this with In ). line λ IFNL3 may be a viable replacement replacement may a be viable was sufficient to decrease decrease to sufficient was Supplementary Text 5 Supplementary during HCV infection, IFNL2 α with fewer fewer with ). and the the and MYH7 o

n α l i or or ). n α e - - - - .

3. 2. 1. r at online available is information permissions and Reprints v The authors declare competing interests:financial details are available in the provided intellectual input. an employee of Biogen Idec and owns company stock. C.H.H., M.C. and M.G. preparations. D.P.B. provided reagents and reviewed the manuscript. D.P.B. was experiments. A.J., S.M.H., A.K. and S.B. performed infections and flow cytometry manuscript. directed R.S. the study. A.J., A.P.M., J.S., R.C.J. and M.H. performed A.J., A.P.M., and the designed R.S. study. A.J. analyzed the data and wrote the feedback and manuscript. the on discussions the for labs Savan and Gale the and and Stone A. support; Lim, C. experimental for Kropp L. and Ozarkar S. Y. Loo, strains, viral JC1 respectively; and H77D the providing generously for Rice C. We thank and Lemon Research. S. Cancer for Center and Lab, National of Program Frederick NIH, Research the Intramural the by part in supported was Research This Government. US the by endorsement imply organizations or commercial products, names, trade of mention does nor Services, Human and 7. 6. 5. 4. 23. 22. 21. 20. 19. 18. 17. 16. 15. 14. 13. 12. 11. 10. 9. 8. C AU e e O p

r s r

T MP hpr, .. Fnli L & le, .. lbl pdmooy f eaii C virus C hepatitis of epidemiology Global M.J. Alter, & L. Finelli, C.W., Shepard, carcinoma. hepatocellular virus. C hepatitis of Lavanchy,epidemiology and Evolving D. hepatitis viral of Epidemiology H.B. El-Serag, Ghany, M.G., Nelson, D.R., Strader, D.B., Thomas, D.L. & Seeff, L.B. An update An L.B. Seeff, & D.L. Thomas, D.B., Strader, all? D.R., Nelson, fits M.G., Ghany, pill C—one hepatitis for therapies Novel T. Hahn, von & M.P. Manns, Liang, T.J. & Ghany, M.G. Current and future therapies for hepatitis C virus infection. McFarland, A.P. Afdhal, N. Afdhal, E. Lawitz, 107–115 (2011). 107–115 Gastroenterology n ramn o gntp 1 hoi hptts vrs neto: 01 practice 2011 infection: virus Diseases. Liver of C Study the for hepatitis Association American the by chronic guideline 1 genotype of treatment on Discov. Drug Rev. Nat. Med. J. Engl. N. (2014). 72–79 microRNAs. virus-induced C hepatitis and elements AU-rich by infection. N. Engl. J. Med. J. Engl. N. Med. J. Engl. N. 54 haa, T. Sheahan, L. Prokunina-Olsson, V.Pedergnana, J. Iulio, di M. Castellarnau, de Y.Tanaka, V. Suppiah, D. Ge, D.L. Thomas, A. Rauch, antiviral direct-acting HCV T. Asselah, & P. Marcellin, P., Halfon, C R., Schinazi, hepatitis chronic of treatment the for inhibitors Protease B.L. Pearlman, in C Treatinghepatitis M.H. Nguyen, & L.R. Roberts, M., Barry, C.R., Jayasekera, challenges. and strategies, toolbox, the therapies: C hepatitis New Pawlotsky,J.M. (2014). permissiveness. virus C hepatitis and responses virus. Genet. Nat. C hepatitis of clearance impaired with associated is IFNL4 gene interferon virus. C hepatitis of clearance spontaneous in involved region minimal kilobases 20 the clearance. virus C hepatitis spontaneous patients. coinfected interferon- pegylated to response predict C. hepatitis chronic (2009). 1105–1109 for therapy ribavirin and interferon-alpha therapy. ribavirin and interferon-alpha clearance. viral virus. C hepatitis study. (2010). 1345.e1–1345.e7 association 1338–1345, genome-wide a failure: treatment and (2014). combinations. interferon-free best the agents: (2012). care. of standard new the infection: genotype-1 countries. lower-income Gastroenterology i i n o H t n , 1433–1444 (2011). 1433–1444 , s O

ET / o i n R R C f

PLoS One PLoS d t I h e N t al. et e x ONT G G FI .

Lancet Infect. Dis. Infect. Lancet p h et al. et et al. et et al. et t al. et

t al. et a t 45 m p eei vrain n L8 peit hptts treatment-induced C hepatitis predicts IL28B in variation Genetic t al. et t al. et e N l RIBU t al. et , 164–171 (2013). 164–171 , . r advance online publication online advance et al. et Ledipasvir and sofosbuvir for untreated HCV genotype 1 infection. 1 genotype HCV untreated for sofosbuvir and Ledipasvir et al. Sofosbuvir for previously untreated chronic hepatitis C infection. C hepatitis chronic untreated previously for Sofosbuvir Nature Genetic variation in IL28B is associated with chronic hepatitis C hepatitis chronic with associated is IL28B in variation Genetic

.

A

eoewd ascain f L8 wt rsos t pegylated to response with IL28B of association Genome-wide 142 7 146 siaig h nt otiuin f nelui-8 vrain to variation interleukin-28B of contribution net the Estimating 370 368 368 Nature N , e38578 (2012). e38578 , L8 i ascae wt rsos t crnc eaii C hepatitis chronic to response with associated is IL28B nefrn aba lee peit nae niia immune antiviral innate predict alleles lambda Interferon CIA eei vrain n L8 ad pnaeu cerne of clearance spontaneous and IL28B in variation Genetic PLoS One PLoS Analysis of IL28B variants in an Egyptian population defines population Egyptian an in variants IL28B of Analysis The favorable IFNL3 genotype escapes mRNA decay mediated T , 1264–1273.e1 (2012). 1264–1273.e1 , , 1176–1192 (2014). 1176–1192 , t al. et , 1889–1898 (2014). 1889–1898 , (2013). 1878–1887 , (2013). 1907–1917 , t al. et

I 12 461 ON N. Engl. J. Med. J. Engl. N.

L 461 I , 595–610 (2013). 595–610 , eihrn te nelui 2B ains ht better that variants 28B interleukin the Deciphering vrat ptem f FL (L8) raig new a creating (IL28B) IFNL3 of upstream variant A NTE S , 399–401 (2009). 399–401 ,

, 798–801 (2009). 798–801 , 5

, 558–567 (2005). 558–567 , 7 R , e31016 (2012). e31016 , E S T Nat. Genet. Nat. S

Hepatology 370 α n rbvrn hrp i HCV/HIV-1 in therapy ribavirin and , 1869–1871 (2014). 1869–1871 , ie Int. Liver Lancet Infect. Dis. Infect. Lancet el ot Microbe Host Cell

41

53 , 1100–1104 (2009). 1100–1104 , Clin. Microbiol. Infect. Microbiol. Clin.

, 1446–1454 (2011). 1446–1454 ,

h nature medicine nature 34 t Gastroenterology t p Spl 1, 69–78 1), (Suppl. : / Nat. Immunol. Nat. / w a. Genet. Nat. w

w

15 12 . n a 190–202 ,

, 717–728 , Hepatology t u

r e o

. n c 138

l

o i 17 41 15 n

m e , , , , /

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. 31. 30. 29. 28. 27. 26. 25. 24. nature medicine nature

oia K. Morita, K. Morita, J. Mathai, R. Fukuda, R. Fukuda, T.M. Welzel, X.S. He, M. Honda, 135–140 (1998). 135–140 infection. virus C hepatitis 2b or 2a with genotype patients chronic in therapy interferon after outcome predict may liver the in mRNA) C. hepatitis chronic (1999). with 359–365 patients in response interferon of therapy. IFN to response with correlates biopsies liver C hepatitis chronic 1a/I genotype predominantly with liver. the in mRNA receptor interferon-alpha Hepatol. of J. amount the with associated is therapy. interferon of effectiveness to relation virus: C hepatitis with associated diseases liver chronic trial. cirrhosis against treatment long-term Hepatology antiviral C hepatitis the in infection pegylated interferon-Alpha2a plus ribavirin for treatment of chronic hepatitis C virus C. hepatitis race. by chronic modified is and outcome treatment for therapy IFN of outcome the Gastroenterology and 28B interleukin et al. et et al. et

et al. et t al. et 49 26 t al. et t al. et t al. et t al. et Global transcriptional response to interferon is a determinant of HCV of determinant a is interferon to response transcriptional Global , 1847–1858 (2009). 1847–1858 , , 455–461 (1997). 455–461 , Expression of interferon receptor genes in the liver as a predictor a as liver the in genes receptor interferon of Expression

IFN-alpha receptor mRNA expression in a United States sample States United a in expression mRNA receptor IFN-alpha xrsin f nefrn eetr ee (FA1 n IFNAR2 and (IFNAR1 genes receptor interferon of Expression 139 eai IG xrsin s soitd ih eei vrain in variation genetic with associated is expression ISG Hepatic fetvns o itreo-lh teay n hoi hptts C hepatitis chronic in therapy interferon-alpha of Effectiveness xrsin f nefrnapa eetr RA n h lvr in liver the in mRNA receptor interferon-alpha of Expression J. Gastroenterol. J. ains n nefrnapa aha gns n rsos to response and genes pathway interferon-alpha in Variants

, 499–509 (2010). 499–509 , advance online publication online advance J. Interferon Cytokine Res. Cytokine Interferon J.

31 , 806–811 (1996). 806–811 , Hepatology

19 . ln Gastroenterol. Clin. J. , 1011–1018 (1999). 1011–1018 ,

44 , 352–359 (2006). 352–359 ,

. e. Virol. Med. J.

26 58 , ,

40. 39. 38. 37. 36. 35. 34. 33. 32.

Muir, A.J. Muir, S. Zeuzem, Ank, N. Eldrup, A.B. Liu, S. van Rooij, E. Schwerk, J., Jarret, A.P., Joslyn, R.C. & Savan, R. Landscape of post-transcriptional P.K.Chandra, J. Liu, treatment of chronic HCV infection. HCV chronic of treatment 12. (2011). week through IIB phase Emerage (G1/2/3/4): patients HCV in PEGIFNa-2A versus toleraility and safety improved with response infections virus select against activity antiviral vivo. potent in displays and IFNs and 47 replication. RNA virus C hepatitis of inhibitors as ribonucleosides Renilla expressing chimera virus C hepatitis luciferase. infectious an with structure RNA performance. muscle and expression (2015). infection. virus C hepatitis during regulation gene signaling. receptor. interferon I type the Microbe Host of Cell degradation phosphorylation-dependent via , 5284–5297 (2004). 5284–5297 , et al. et et al. et al. J. Virol. J. Am. J. Pathos. J. Am. et al. et Antiviral Res. Antiviral Measuring antiviral activity of benzimidazole molecules that alter IRES Virus-induced unfolded protein response attenuates antiviral defenses antiviral attenuates response protein unfolded Virus-induced et al. t al. et et al. Lambda interferon (IFN-lambda), a type III IFN, is induced by viruses et al. et

A randomized phase 2b study of peginterferon lambda-1a for the for lambda-1a peginterferon of study 2b phase randomized A 80 Structure-activity relationship of heterobase-modified 2

A family of microRNAs encoded by myosin genes governs myosin eyae Itreo-aba PGF-) hw spro viral superior shows (PEGIFN-L) Interferon-Lambda Pegylated 5 , 4501–4509 (2006). 4501–4509 , HCV infection selectively impairs type I but not type III IFN III type not but I type impairs selectively infection HCV , 72–83 (2009). 72–83 ,

89 184 , 54–63 (2011). 54–63 , , 214–229 (2014). 214–229 , J. Hepatol. J. Dev. Cell Dev.

17

61 , 662–673 (2009). 662–673 , , 1238–1246 (2014). 1238–1246 , ur Oi. Virol. Opin. Curr. . Hepatol. J. s r e t t e l

54 J. Med. Chem. Med. J. S538–S539 ,

12 ′ -C-methyl 75–84 , 

© 2016 Nature America, Inc., part of Springer Nature. All rights reserved. were stimulated 48 h post-transfection with mimics and whole-cell extracts extracts whole-cell and mimics with post-transfection h 48 stimulated were IFN- human of (Dharmacon). reagent transfection 4 5-10 using transfected were inhibitors or mimics of were cells mimics/inhibitors, of at of × a 2-3 10 density seeded transfection For (NC). control targeting was miR-499a-5p non- a as used was of miRNA human known no bind to sequence predicted and mutated seed the which in control inhibitor LNA A miRNA target their of inhibition 80% consistent a showed inhibitors LNA custom These miR-499a-5p. or developed miR-208b we either for systems, specific our inhibitors LNA in 40% of efficacy marginal had (Dharmacon) from purchased Dharmacon.were genes, As commerciallymammalian availableknown any inhibitors to bind of miR-208bnot does and miR-499a-5pthat mimic (NC) control non-targeting a as well as mimic, miR-499a-5p stimulations. mimic, and transfections inhibitor and mimic miRNA endogenous control. was byoptimized using a primer with a lower Tm. SNORD38B as an was used miR-208bLNA primer The detection. for pooled were (miRBase) isomiRs 5p Three LNA primers to (Exiqon) designed the detect most common miR-499a- and SYBR qPCR master mix (Life Technologies) was used for quantitative PCR. CURY LNA Universal RT according to the manufacturer’s instructions(Qiagen) or (Exiqon),by using the Trizol method. miRNA-RT was carried out using miR to normalized were levels sion the using with out system ViiA7 qPCR carried was qPCR protocol. manufacturer’s the to according method (Qiagen). qPCR was outcarried TRIzol using the QuantiTectthe RTusing kit by (Qiagen) or (Qiagen) kit Mini RNeasy using extracted was RNA RNA isolation, reverse transcription and quantification of gene expression. the overlaps which of site restriction the ated by restriction fragment length polymorphism using the enzyme 5 5 forward PCR, by fied Clontech). The genomic region surrounding the was DNA genomic cells, from extracted Huh7-wt/cas9 and Huh7- selected in accessed. was targeting gene efficiency successful confirm transduction To before selection under addi week an for tional cultured were cells and media the to added was puromycin of 2 to according 48 the manufacturer’sh transfection, post instructions. CaPO the using transfected was gRNA-cas9 10 transfection. before day the dish cm 10 10 × 3 plasmids, CRISPR–cas9 of transfection For cas9 alone or with either were cells transfected In-Fusion enzyme mix To(Clontech). generate knock out of using vector pRRL-U6-empty-gRNA-MND-Cas9-t2A-Puro the in promoter 5 system. CRISPR–Cas9 with knockout IFNLR1 CO 5% in °C at 37 incubated were cells All no inactivation). heat (Hyclone, FBS 10% and L-Glutamine, 2mM NEAA, MEM 1× pyruvate, 2 with DMEM in cultured were cells replicon 2 5p), or a non-targeting control miRNA were cultured in complete DMEM with cells overexpressing miR-208b (pLV-miR-208b), miR-499a-5p HepG2 (pLV-miR-499a- (Mediatech). penicillin-streptomycin-glutamine 1% and Atlanta Biologicals) (FBS; FBS heat-inactivated 10% containing media (Sigma) DMEM con mycoplasma in complete for were cultured cells PH5CH8 Huh7, Huh7.5, HepG2, negative tamination. tested lines cell all and stimuli, to response on their based was line ATCC.cell confirmed of The identity hepatocyte each conditions. culture Cell O nature medicine nature ′ ′ µ -TTGTTGTACAGGTC CTGTTTCTTCAGG-3 -GCTCTCCCACCCGTAGACGG-3 NLIN For all stimulations done on mimic- or inhibitor-transfected cells, 500 IU/mL Kit Mini miRNeasy with extracted was analysis miRNA for RNA Total g/mL puromycin dihydrochloride. Huh7-K2040, Huh7-HP and Huh7-JFH1 E M E TH β was used. For immunoblot analysis of HepG2 cells, cells cells cells, HepG2 of analysis immunoblot For used. was OD S HepG2 and PH5CH8 cell lines were obtained from from obtained were lines cell PH5CH8 and HepG2 ′ Taq -GGTCCCAAAGCTAGGGAGGG-3 Man reagents (Life Technologies). Gene expres Gene Technologies). (Life Man reagents 5 cells/well of a 6-well plate, and 20-40 nM/well nM/well and of plate, 20-40 a 6-well cells/well HPRT for all cell types. cell all for ′ ) was cloned downstream of the U6 U6 the of downstream cloned was ) IFNLR1 IFNLR1 µ g of either cas9 alone or or alone cas9 either of g 4 IFNLR1 transfection kit (Invitrogen) (Invitrogen) kit transfection IFNLR1 µ

IFNLR1 CRISPR targeting site. targeting CRISPR −/− ′ g/mL G418, 1mM sodium sodium 1mM G418, g/mL . . PCR products were evalu 6 cells (NucleoSpin Tissue; cells were seeded onto a onto seeded were cells µ l/well of DharmaFECT DharmaFECT of l/well gRNA-Cas9 plasmids. target site was ampli guide RNA (gRNA, RNA (gRNA, guide IFNLR1 2 . ′ and reverse reverse and miR-208b miR-208b Hyp in Huh7, IFNLR1 µ g g /mL 166II, 166II, 4 ------.

at a Multiplicity of Infection (MOI) of 1.0 for 3 h and then the media was was media the then and h 3 for 1.0 of (MOI) Infection of virus Multiplicity a with at inoculated were previously cells described inhibitor-transfected infections, previously HCV For as titrated, infectivity and propagated infection. HCV website. manufacturer’s the on provided is antibodies of Validation Signaling). (Cell or Jak1 (Tyr1022/1023), Tyk2, phospho-Jak1 (Tyr1054/1055), phospho-Tyk2 STAT2, (Tyr690), phospho-STAT2 STAT1, STAT1(Tyr701), (Tris-Buffered Saline and Tween 20) or 5% non-fat TBST milk in in TBST for BSA phospho- 5% in dilution antibody recommended the using probed then were membranes The Scientific). (Thermo membranes PVDF to transferred analysis. Immunoblot specified the at toxicity overt any show HepG2 at h. 8 not concentration analysis. did qPCR ActD for with processed treated and cells post-treatment h 8 and 6 4, 2, 0, at taken were Samples transfection. post h 48 D Actinomycin of cells/mL mRNA stability. IFN- infection. IFN- post h 36 HCV-infected cells, the for and inhibitors/mimics with transfection post h 48 stimulated were cells cells, HepG2 mimic-transfected or cells Huh7 HCV-infected in expression ISG For min. 60 and 30, 15, 0, at collected were 41. legends. figure the in described and analyses statistical for used and pooled were replicate biological each from replicates technical of averages the replicates, biological pooled using data For legends. figure in was replicates of noted used for with analyses technical experiments statistical by determined variance, unequal with samples For Software. 6 Prism GraphPad using done were ses analysis. Statistical supernatant. of FFU/mL as expressed and counted were units focal and ing, VECTOR VIP Peroxidase Substrate Kit was stain to used (SK-4600) visualize secondary. HRP-conjugated appropriate the then antibody, NS5A anti-HCV and were cells with an with incubated paraformaldehyde fixed post-inoculum h 48 DMEM. complete with supplemented and PBS with twice washed were 24 well for plates. incubated Cells 2 h, then supernatant was removed and cells 100-fold in complete DMEM and used to 100 infect 8 × 10 where assay (FFU) titer. viral HCV transfection. post h 48 harvested were 1.125 using 2.25 and well (Mirus) per reagent Boost transfected was RNA HCV of ng 200 day 10 × 1.5 of density a at cells seeded PH5CH8 were transfection, RNA HCV For purity. for check to gel dehyde formal 1% a on run was RNA sample resulting the and removed were otides samples nucle were DNAse unincorporated transcription, Following treated, vitro in for by used was product linearized linearized The were purified. and viruses digest enzyme HCV restriction H77D or JC1 JFH1, of sequences cDNA and transfections. HCV RNA transcription RNA ( of curve standard a to comparison by calculated was number copy The Technologies). Life (Pa03453408_s1, UTR the with qPCR quantitative using measured was number copy RNA HCV times. indicated Trizolusing were or harvested Cells RLT at replaced. the (Qiagen) buffer lysis

ozlz G, fne, . Baa, . Srkr R Slcin f n pia RNA optimal an of Selection R. Striker, & R. Brazas, L., Pfannes, G., Gonzalez, J. Virol. Methods Virol. J. transfection reagent and comparison to electroporation for the delivery of viral RNA. λ 3 3 were purchased from R&D Systems. Supplementary Fig. 1e Fig. Supplementary transcription using the T7 MEGAscript kit (Life technologies). technologies). (Life kit MEGAscript T7 the using transcription α Taq and IFN- Cell culture-adapted HCV JFH1 genotype 2A strain was was strain 2A genotype JFH1 HCV culture-adapted Cell Mimic-transfected HepG2 cells were treated with 10 with were treated cells HepG2 Mimic-transfected HCV viral titer was measured using a focus-forming unit unit focus-forming a using measured was titer viral HCV

Man Fast Virus 1-step kit and primers specific for the 5 the for specific primers and kit 1-step Virus Fast Man 145 Unpaired Student’s Unpaired 30-60 30-60 , 14–21 (2007). 14–21 , F β µ -test, Welch’s-test, Mean was applied. correction were purchased from PBL, and IFN- l of cell supernatant was serially diluted 10 to to 10 diluted serially was supernatant cell of l µ ). g of lysates were subjected to SDS-PAGE and to subjected were lysates of g µ l TransIT-mRNA reagent (Mirus) reagent TransIT-mRNA l 5 cells/well in a 12 well plate. The next next The plate. well 12 a in cells/well in vitro- in t -test and one-way ANOVAanaly one-way and -test Plasmids containing full-length full-length containing Plasmids transcribed full-length HCV HCV full-length transcribed 4 Huh-7.5 cells per well in doi: 10.1038/nm.4211 λ β 1, IFN- -actin (13E5) (13E5) -actin µ l mRNA mRNA l 4 ± 1 µ λ . Cells Cells . s.e.m. s.e.m. g/10 2 and 3 9 6 - - - - ′ .