DOCSLIB.ORG

Saprolegniaceae Identified on Amphibian Eggs Throughout the Pacific Northwest, USA, by Internal Transcribed Spacer Sequences and Phylogenetic Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Saprolegniaceae Identified on Amphibian Eggs Throughout the Pacific Northwest, USA, by Internal Transcribed Spacer Sequences and Phylogenetic Analysis Mycoioia, 100(2), 2008, pp. 171-180. 2008 by The Mycological Society of America, Lawrence, KS 66044-8897 Issued 3 June 2008 Saprolegniaceae identified on amphibian eggs throughout the Pacific Northwest, USA, by internal transcribed spacer sequences and phylogenetic analysis Jill E. Petrisko Key words: Achiya, amphibian decline, egg, lake, Department of Biological Sciences, Idaho .SIate Leptolegnia, University, Pocatello, Idaho 83209 oomycete, Saprolegnia /irax, S. semihypo- gy na Christopher A. Pearl USGS Forest and Rangeland Ecosystem Science center, 3200 SWJe/jerson Way, Corvallis, Oregon 97331 INTRODUCTION David S. Pilliod The Saprolegniaceae (Saprolegniales, Oomycota) be- long to kingdom Chromista (sensu Aldo Leopold Wilderness Research Institute, USDA Cavalier-Smith Forest Service Rocky Mountain Research Station, 1997). These organisms often are referred to as Missoula, Montana 59801 oornycetes or "water molds" and can be found on Peter P. Sheridan decaying animal and plant debris in freshwater habitats worldwide. They can occur on adult fish and on the Charles F. Williams eggs of fish and amphibians (Hoffman 1967, Czeczuga Charles R. Peterson et al 1998). The family Saprolegniaceae has 19 genera Department oJ Biological Sciences, Ida/to State University, Pocatello, Idaho 83209 and roughly 150 species (Dick 1973). Identification of Saprolegniaceae traditionally has R. Bruce Bury relied on the observation of morphological features USGS Forest and Rangeland Ecosystem Science center, (Seymour 1970, but see Hulvey et al 2007). Genera of 3200 .SWJe[Jersoii Way, Corvallis Oregon 97331 the Saprolegniaceae have been differentiated by their method of zoospore release (Seymour 1970, Daugh- erty et al 1998). Species identification has been more Abstract: We assessed the diversity and phylogeny of challenging because it has required presence of the Saprolegniaceae on amphibian eggs from the Pacific sexual structures, the oogonia and antheridia. More Northwest, with particular focus on Saroiegniaferax, recently molecular identification has been accom- a species implicated in high egg mortality. We plished with selected Saprolegniaceae using the identified isolates from eggs of six amphibians with internal transcribed spacer (ITS) and 5.8S regions the internal transcribed spacer (ITS) and 5.8S gene of ribosomal DNA (rDNA) (Molina et al 1995, Leclerc regions and BLAST of the GenBank database. We et al 2000). The most complete molecular phylogeny identified 68 sequences as Saprolegniaceae and 43 of this frsmily to date identified 10 genera and 40 sequences as true fungi from at least nine genera. Our species through analyses of ITS and the large phylogenetic analysis of the Saprolegniaceae included ribosomal subunit (LSU) (Leclerc et al 2000). isolates within the genera Saprolegnia, Achlya and There have been relatively few published field Leptolegnia. Our phylogenvgrouped S. semihypogyna investigations of Saprolegniaceae diversity and ecolo- with Achlya rather than with the Saprolegnia reference gy. This is particularly true in the Pacific Northwest, sequences. We found only one isolate that grouped USA, which is a region where Saprolegnia closely with has been S. ferax, and this came from a hatchery- identified as a potential pathogen on amphibians that raised salmon (Idaho) that we sampled opportunisti- have experienced local declines (Kiesecker and cally. We had representatives of 7-12 species and Blaustein 1995). For example Blaustein et al (1994) three genera of Saprolegniaceae on our amphibian suggested Saprolegnia ferax was responsible for eggs. Further work on the ecological roles of different mortality of nearly 95% of western toad (Bufo boreas) species of Saprolegniaceae is needed to clarify their eggs at one site in Oregon. Despite these claims that potential importance in amphibian egg mortality and S. feraxis a pathogenic water mold of amphibian eggs. potential links to population declines. no studies have attempted to document which species of oomycetes occur on the eggs of North American Accepted for publication 8 November 2007. amphibians and whether egg mortality is uniquely Co rresponding author. E-mail: [email protected] Phone: associated with S. ferax. (208) 529-8376. Current address: University of Idaho, 1776 Science Center Drive, Suite 205, Idaho Fails, ID 83402. As a result of concern over observed amphibian egg 2 Current address: USGS Forest and Rangeland Ecosystem Science mortality and the difficulty of identifying taxa Center, Snake River Field Station, 970 Lusk St., Boise, ID 83706 niicroscopicallv, we sought to ideniif- Ootfl\ccirs In 172 MYC0L0GIA cultured from amphibian eggs from around the outgrow an bacteria in the culture. In cases where the Pacific Northwest with ITS and 5.8S rRNA gene filamentous growth was slower bacteria were evident on the sequences. We compared sequences of Saprolegnia- original PDA plate. When bacteria and filamentous growth ceae cultured from amphibian eggs to reference were present together in culture, successive hvphal transfers cultures from the American Type Culture Collection were used to obtain a pure filamentous culture. We obtained three Saprolegniaceae isolates from the (ATCC) and published sequences from GenBank. ATCC (10801 University Blvd., Manassas, Virginia 20110- The information from this survey should be of value 2209 USA): Saprolegniaferax (Grm.uthtusen) Thuret (ATCC to mycologists and amphibian biologists who are 26116), Saprolegnia parasitica Coker (ATCC 22284) and interested in the distribution of oomycetes and their Ac/i/ta americana Humphrey (ATCC 22599). We cultured ecological relationships with amphibians. and sequenced the ATCC isolates in the same manner as the egg and fish samples. MATERLLS AND METHODS DNA extraction, PR a mpizJi cation, and sequencing.—We extracted DNA from each filamentous organism using a Collection of qg samples—In 2001-2003 we collected egg procedure adapted from Griffith and Shaw (1998) for DNA samples (n = 200) of six pond-breeding amphibian species isolation from Phytophthora infestans. This process uses a from the Pacific Northwest, USA (Saprolegniaceae samples modified extraction huller (100 mM Tris-HCL, 1.4 M NaCl, TABLE 1). We coded sample numbers based on physiograph- 2% CTAB and 20 mM EDTA sodium salt pH 8.0) and a ic provinces: IS = Snake River Plain in southern Idaho; IM chloroform extraction technique. Precipitation of DNA was = Bitterroot Mountains of Idaho and western Montana; OE completed with isopropanol and centrifugation at 17000 X = Blue Mountains of eastern Oregon; OW = Cascade We confirmed the DNA was intact by running each Range and Willamette Basin of western Oregon; WA = g Cascade Range around Mount Rainier, Washington sample on 1.2% agarose gels. Samples were stored at 4 C until use in the polymerase chain reaction (PCR). (FIG. 1). The six amphibians included the long-toed salamander (Amliystoma macrodactylum), Pacific tree frog The ITS1 and ITS2 regions and the intermediate 5.8S (Pseudacris regilla), northern red-legged frog (Rana auro- ribosomal gene were amplified using the primers ITS1 ra), Cascades frog (R. cascadae), Columbia spotted frog (R. (5 TCCGTA(;(;TGAACCTGCGG 3) and ITS4 (5 luteiventris) and Oregon spotted frog (R. pretiosa). For all TCCTCCGCTTATTGATATGC 3) (White et al 1990) in a sampled amphibian egg masses, we collected equivalent 50 nmole concentration (HPLC purified) from Operon numbers of health y eggs and eggs that appeared diseased (QIAGEN). We performed PCR reactions in a 50 fIL volume (with white or gray hyphal nimbus, FIG. 2) in sterile 2 oz. using the HotStarTaq Master Mix Kit (QIAGEN) and a final polypropylene containers filled with surrounding pond I iM concentration of each primer. The final template water. Because several Saprolegnia species first were isolated DNA concentration used for each reaction was 10 ng/oL. from salmonids, we opportunistically collected three sam- We performed PCR amplifications with an Applied Biosys- ples from fish in southern Idaho: rainbow trout (Onco- tems 2400 thermocycler (Applied Biosystems). The PCR rhynchus mykiss) eggs from a hatchery and scale scrapings temperature profile was an initial activation at 95 C for from a dead rainbow trout (0. mykiss) and a hatchery-raised is min followed by 30 cycles with target temperatures at Chinook salmon (0. tshawtscha). 94 C, 54 C and 72 C each for 1 mm. A final extension at 72 C for 10 min completed the run. We analyzed PCR Culturing of osganisms from egg samples—Samples were products by electrophoresis on 1.2% agarose gels and shipped in coolers and stored at 4 C at the laboratory. stained the gels with ethidium bromide (50 isg/oL) to Because we did not want to exclude the growth of any confirm the presence of the PCR product. PCR products Saprolegniaceae species, we chose to use a nonselective were directly purified with the MinEltite PCR Purification media for our culturing procedure. We did not sterilize egg Kit (QIAGEN) for sequencing. Purified PCR products were samples because there is some indication that oomycetes sequenced with big dye terminator primers in the 3100 can grow on the outside of eggs (e.g. Czeczuga et al 1998, Genetic Analyzer (Applied Biosystems) at the Molecular Green 1999). We did not exclude any filamentous micro- Core Facility at Idaho State University at Pocatello. organisms in the culturing process so we used a nonselective media, potato-dextrose agar (PDA). PDA plates were made Alignment and phtlogenetic ana1sis.—We used PHRED from 24 g of potato dextrose (Difco)
Load more

Recommended publications
  • Molecular Identification of Fungi
    Molecular Identification of Fungi Youssuf Gherbawy l Kerstin Voigt Editors Molecular Identification of Fungi Editors Prof. Dr. Youssuf Gherbawy Dr. Kerstin Voigt South Valley University University of Jena Faculty of Science School of Biology and Pharmacy Department of Botany Institute of Microbiology 83523 Qena, Egypt Neugasse 25 [email protected] 07743 Jena, Germany [email protected] ISBN 978-3-642-05041-1 e-ISBN 978-3-642-05042-8 DOI 10.1007/978-3-642-05042-8 Springer Heidelberg Dordrecht London New York Library of Congress Control Number: 2009938949 # Springer-Verlag Berlin Heidelberg 2010 This work is subject to copyright. All rights are reserved, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilm or in any other way, and storage in data banks. Duplication of this publication or parts thereof is permitted only under the provisions of the German Copyright Law of September 9, 1965, in its current version, and permission for use must always be obtained from Springer. Violations are liable to prosecution under the German Copyright Law. The use of general descriptive names, registered names, trademarks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. Cover design: WMXDesign GmbH, Heidelberg, Germany, kindly supported by ‘leopardy.com’ Printed on acid-free paper Springer is part of Springer Science+Business Media (www.springer.com) Dedicated to Prof. Lajos Ferenczy (1930–2004) microbiologist, mycologist and member of the Hungarian Academy of Sciences, one of the most outstanding Hungarian biologists of the twentieth century Preface Fungi comprise a vast variety of microorganisms and are numerically among the most abundant eukaryotes on Earth’s biosphere.
    [Show full text]
  • Saprolegnia Species in Norwegian Salmon Hatcheries: Field Survey Identifies S
    Vol. 114: 189–198, 2015 DISEASES OF AQUATIC ORGANISMS Published June 3 doi: 10.3354/dao02863 Dis Aquat Org OPENPEN ACCESSCCESS Saprolegnia species in Norwegian salmon hatcheries: field survey identifies S. diclina sub-clade IIIB as the dominating taxon E. Thoen1, T. Vrålstad1, E. Rolén1, R. Kristensen1, Ø. Evensen2, I. Skaar1,* 1Norwegian Veterinary Institute, PO Box 750 Sentrum, 0106 Oslo, Norway 2Norwegian University of Life Sciences, PO Box 8146 Dep., 0033 Oslo, Norway ABSTRACT: Saprolegnia isolates within the recognized clades encompassing the taxa S. parasit- ica and S. diclina act as opportunist and aggressive pathogens to both fish and their eggs. They are responsible for significant economic losses in aquaculture, particularly in salmonid hatcheries. However, the identity, distribution and pathogenic significance of involved species often remain unexplored. In this study, 89 Saprolegnia isolates were recovered from water, eggs and salmon tis- sue samples that originated from salmon (Salmo salar) hatcheries along the coast of Norway. The cultures were characterized morphologically and molecularly in order to provide an overview of the species composition of Saprolegnia spp. present in Norwegian salmon hatcheries. We demon- strate that S. diclina clearly dominated and contributed to 79% of the recovered isolates. Parsi- mony analyses of the nuclear ribosomal internal transcribed spacer (ITS) region split these isolates into 2 strongly supported sub-clades, S. diclina sub-clade IIIA and IIIB, where sub-clade IIIB accounted for 66% of all isolates. A minor portion of the isolates constituted other taxa that were either conspecific or showed strong affinity to S. parasitica, S. ferax, S. hypogyna and Scoliolegnia asterophora.
    [Show full text]
  • The Taxonomy and Biology of Phytophthora and Pythium
    Journal of Bacteriology & Mycology: Open Access Review Article Open Access The taxonomy and biology of Phytophthora and Pythium Abstract Volume 6 Issue 1 - 2018 The genera Phytophthora and Pythium include many economically important species Hon H Ho which have been placed in Kingdom Chromista or Kingdom Straminipila, distinct from Department of Biology, State University of New York, USA Kingdom Fungi. Their taxonomic problems, basic biology and economic importance have been reviewed. Morphologically, both genera are very similar in having coenocytic, hyaline Correspondence: Hon H Ho, Professor of Biology, State and freely branching mycelia, oogonia with usually single oospores but the definitive University of New York, New Paltz, NY 12561, USA, differentiation between them lies in the mode of zoospore differentiation and discharge. Email [email protected] In Phytophthora, the zoospores are differentiated within the sporangium proper and when mature, released in an evanescent vesicle at the sporangial apex, whereas in Pythium, the Received: January 23, 2018 | Published: February 12, 2018 protoplast of a sporangium is transferred usually through an exit tube to a thin vesicle outside the sporangium where zoospores are differentiated and released upon the rupture of the vesicle. Many species of Phytophthora are destructive pathogens of especially dicotyledonous woody trees, shrubs and herbaceous plants whereas Pythium species attacked primarily monocotyledonous herbaceous plants, whereas some cause diseases in fishes, red algae and mammals including humans. However, several mycoparasitic and entomopathogenic species of Pythium have been utilized respectively, to successfully control other plant pathogenic fungi and harmful insects including mosquitoes while the others utilized to produce valuable chemicals for pharmacy and food industry.
    [Show full text]
  • Ajb205620.Pdf
    AMERICAN JOURNAL OF BOTANY VOL. VIII MAY, 1921 NO·5 ISOACHLYA, A NEW GENUS OF THE SAPROLEGNIACEAEI C. H. KAUFFMAN (Received for publication December 29, 1920) Isoachlya Kauffman gen. nov. Hyphae rather stout or slender. Zoo­ sporangia formed from their tips, oval, pyriform, ventricose-clavate, the later ones (secondary) arising either by cymose or pseudo-cymose arrange­ ment as in Achlya, or by internal proliferation as in Saprolegnia, both modes occuring earlier or later in the development of one and the same species, or frequently on the same main hypha. Zoospores diplanetic, as in Saproleg­ nia, escaping and swarming separately, and after encystment swarming the second time before the formation of a germ tube. Oogonia terminal or toru­ lose, occasionally intercalary. Oospores with centric contents, the spores filling the oogonium incompletely. Antheridia present or few to none. The genus is characterized and distinguished, in the main, by the presence of the cymose or Achlya mode of formation of secondary sporangia, coupled with diplanetic zoospores. The following species naturally fall within its boundaries: I. Isoachlya toruloides Kauffman and Coker sp. nov. 2. Isoachlya paradoxa (Coker) comb. nov. Achlya paradoxa Coker. Mycologia 6: 285. 1914. 3. Isoachlya monilifera (de Bary) comb. nov. Saprolegnia monilifera de Bary. Bot. Zeit. 16: 629. 1888. Isoachlya toruloides Kauffman and Coker sp. nov. Hyphae rather slender and short, 18-20" in diameter, later ones fre­ quently smaller, straight and scarcely branched. Zoosporangia oval, pyriform, clavate-pyriform, more rarely elongated-pyriform, with a more or less distinct papilla; secondary sporangia, during the early and vigorous develdpment, all cymosely arranged by successive basipetal formation, sometimes from the walls of earlier ones, later secondary sporangial initials appearing by internal proliferation as in Saprolegnia; zoospores diplanetic, capable of escaping and swarming separately, encysting after coming to 1 After this paper was in the hands of the editor, a letter from Prof.
    [Show full text]
  • Differentiation and Pathogenicity Within the Saprolegniaceae
    Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 680 _____________________________ _____________________________ Differentiation and Pathogenicity within the Saprolegniaceae Studies on Physiology and Gene Expression Patterns in Saprolegnia parasitica and Aphanomyces astaci BY GUNNAR ANDERSSON ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2001 Dissertation for the Degree of Doctor of Philosophy in Physiological Mycology presented at Uppsala University in 2002 Abstract Andersson, M. G. 2001. Differentiation and Pathogenicity within the Saprolegniaceae. Studies on Physiology and Gene Expression Patterns in Saprolegnia parasitica and Aphanomyces astaci. Acta Universitatis Upsaliensis. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 680, 41 pp. Uppsala. ISBN 91-554-5203-5. Saprolegnia parasitica and Aphanomyces astaci are parasitic water moulds belonging to the Oomycetes. Despite their importance as parasites they are very little studied at the molecular level and the work described in this thesis was aimed at increasing the molecular knowledge of these organisms by cloning and characterising genes of potential importance for reproduction and pathogenicity. Stage-specific transcripts from Saprolegnia parasitica were isolated by differential display RT-PCR. One of the markers, puf1 encodes a putative mRNA binding protein which may be involved in post-transcriptional regulation of gene expression. S. parasitica puf1 is expressed exclusively in spore cysts that have not been determined for germination or repeated zoospore emergence indicating that the cyst stage has two phases, of about equal duration, which are physiologically and transcriptionally distinct. A similar expression pattern is observed in Aphanomyces spp. with different regulation of spore development and in the transcript is detected in both primary and secondary cysts.
    [Show full text]
  • The Classification of Lower Organisms
    The Classification of Lower Organisms Ernst Hkinrich Haickei, in 1874 From Rolschc (1906). By permission of Macrae Smith Company. C f3 The Classification of LOWER ORGANISMS By HERBERT FAULKNER COPELAND \ PACIFIC ^.,^,kfi^..^ BOOKS PALO ALTO, CALIFORNIA Copyright 1956 by Herbert F. Copeland Library of Congress Catalog Card Number 56-7944 Published by PACIFIC BOOKS Palo Alto, California Printed and bound in the United States of America CONTENTS Chapter Page I. Introduction 1 II. An Essay on Nomenclature 6 III. Kingdom Mychota 12 Phylum Archezoa 17 Class 1. Schizophyta 18 Order 1. Schizosporea 18 Order 2. Actinomycetalea 24 Order 3. Caulobacterialea 25 Class 2. Myxoschizomycetes 27 Order 1. Myxobactralea 27 Order 2. Spirochaetalea 28 Class 3. Archiplastidea 29 Order 1. Rhodobacteria 31 Order 2. Sphaerotilalea 33 Order 3. Coccogonea 33 Order 4. Gloiophycea 33 IV. Kingdom Protoctista 37 V. Phylum Rhodophyta 40 Class 1. Bangialea 41 Order Bangiacea 41 Class 2. Heterocarpea 44 Order 1. Cryptospermea 47 Order 2. Sphaerococcoidea 47 Order 3. Gelidialea 49 Order 4. Furccllariea 50 Order 5. Coeloblastea 51 Order 6. Floridea 51 VI. Phylum Phaeophyta 53 Class 1. Heterokonta 55 Order 1. Ochromonadalea 57 Order 2. Silicoflagellata 61 Order 3. Vaucheriacea 63 Order 4. Choanoflagellata 67 Order 5. Hyphochytrialea 69 Class 2. Bacillariacea 69 Order 1. Disciformia 73 Order 2. Diatomea 74 Class 3. Oomycetes 76 Order 1. Saprolegnina 77 Order 2. Peronosporina 80 Order 3. Lagenidialea 81 Class 4. Melanophycea 82 Order 1 . Phaeozoosporea 86 Order 2. Sphacelarialea 86 Order 3. Dictyotea 86 Order 4. Sporochnoidea 87 V ly Chapter Page Orders. Cutlerialea 88 Order 6.
    [Show full text]
  • Connecticut Aquatic Nuisance Species Management Plan
    CONNECTICUT AQUATIC NUISANCE SPECIES MANAGEMENT PLAN Connecticut Aquatic Nuisance Species Working Group TABLE OF CONTENTS Table of Contents 3 Acknowledgements 5 Executive Summary 6 1. INTRODUCTION 10 1.1. Scope of the ANS Problem in Connecticut 10 1.2. Relationship with other ANS Plans 10 1.3. The Development of the CT ANS Plan (Process and Participants) 11 1.3.1. The CT ANS Sub-Committees 11 1.3.2. Scientific Review Process 12 1.3.3. Public Review Process 12 1.3.4. Agency Review Process 12 2. PROBLEM DEFINITION AND RANKING 13 2.1. History and Biogeography of ANS in CT 13 2.2. Current and Potential Impacts of ANS in CT 15 2.2.1. Economic Impacts 16 2.2.2. Biodiversity and Ecosystem Impacts 19 2.3. Priority Aquatic Nuisance Species 19 2.3.1. Established ANS Priority Species or Species Groups 21 2.3.2. Potentially Threatening ANS Priority Species or Species Groups 23 2.4. Priority Vectors 23 2.5. Priorities for Action 23 3. EXISTING AUTHORITIES AND PROGRAMS 30 3.1. International Authorities and Programs 30 3.2. Federal Authorities and Programs 31 3.3. Regional Authorities and Programs 37 3.4. State Authorities and Programs 39 3.5. Local Authorities and Programs 45 4. GOALS 47 3 5. OBJECTIVES, STRATEGIES, AND ACTIONS 48 6. IMPLEMENTATION TABLE 72 7. PROGRAM MONITORING AND EVALUATION 80 Glossary* 81 Appendix A. Listings of Known Non-Native ANS and Potential ANS in Connecticut 83 Appendix B. Descriptions of Species Identified as ANS or Potential ANS 93 Appendix C.
    [Show full text]
  • Synopsis of Freshwater Crayfish Diseases and Commensal Organisms Brett .F Edgerton James Cook University, [email protected]
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications from the Harold W. Manter Parasitology, Harold W. Manter Laboratory of Laboratory of Parasitology 3-2002 Synopsis of Freshwater Crayfish Diseases and Commensal Organisms Brett .F Edgerton James Cook University, [email protected] Louis H. Evans Curtin University of Technology Frances J. Stephens Curtin University of Technology Robin M. Overstreet Gulf Coast Research Laboratory, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/parasitologyfacpubs Part of the Aquaculture and Fisheries Commons, and the Parasitology Commons Edgerton, Brett .;F Evans, Louis H.; Stephens, Frances J.; and Overstreet, Robin M., "Synopsis of Freshwater Crayfish Diseases and Commensal Organisms" (2002). Faculty Publications from the Harold W. Manter Laboratory of Parasitology. 884. https://digitalcommons.unl.edu/parasitologyfacpubs/884 This Article is brought to you for free and open access by the Parasitology, Harold W. Manter Laboratory of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications from the Harold W. Manter Laboratory of Parasitology by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Published in Aquaculture 206:1–2 (March 2002), pp. 57–135; doi: 10.1016/S0044-8486(01)00865-1 Copyright © 2002 Elsevier Science. Creative Commons Attribution Non-Commercial No Deriva- tives License. Accepted October 18, 2001; published online November 30, 2001. Synopsis of Freshwater Crayfish Diseases and Commensal Organisms Brett F. Edgerton,1 Louis H. Evans,2 Frances J. Stephens,2 and Robin M. Overstreet3 1. Department of Microbiology and Immunology, James Cook University, Townsville, QLD 4810, Australia 2.
    [Show full text]
  • The Effect of Malchite Green As a Fungicide
    THE EFFECT OF MALACHITE GREEN AS A FUNGICIDE RICHARD MARTIN Department of Zoology, The Ohio State University, Columbus, Ohio $210 ABSTRACT A series of tests with malachite green, used at various concentrations and treatment durations, were made on six species of watermolds known to be parasitic on fish and/or fish eggs. The tests indicate that these species have markedly different tolerances to the dye. While a treatment of as little as 1 ppm of malachite green for five minutes was effec- tive for Saprolegnia parasitica, it took 10 ppm for five minutes to control Achlya ambi- sexualis and Allomyces macrogynus, and 15 ppm for one hour to control Achlya oblongata. INTRODUCTION The occurrence of parasitic fungi constitutes a chronic problem in fish hatcheries and aquaria. Fish suffering from stress and injury may become infected by fungi, resulting in considerable economic loss, particularly where valuable aquarium and cultured fish are involved. Nigrelli (1943) reported that over 45 deaths in one year were incurred among fishes at the New York Aquarium due to infestations by unidentified species of the genus Saprolegnia. Many fish hatcheries have serious problems with fungal infections of fish and fish eggs (Glen L. Hoffman, 196 X personal communication). The most common treatment for parasitized fish and fish eggs is malachite green oxalate. This aniline dye is used as a dip or flush to eliminate or prevent the growth of fungi. Many studies have been made to try and determine the most effective concentrations for fungicidal-fungistatic effects. Prominent among them is that of O'Donnell (1941), who found that a 10-30-second dip in 67 ppm (1:15,000) malachite green was effective and non-toxic to 18 species of fish.
    [Show full text]
  • Meeting Program
    Oomycete Molecular Genetics Network Meeting March 10 to March 12 2013 Asilomar Conference Grounds Pacific Grove, CA Oomycete Molecular Genetics Network Meeting March 10 to March 12, 2013 Asilomar Conference Grounds Pacific Grove, CA The Oomycete Molecular Genetics Research Network was initially funded by an NSF Research Coordination Network grant in 2001. The purpose of our annual meeting is to promote communication and collaboration, and minimize duplication of effort within the worldwide Oomycete molecular genetics community. The oomycete molecular genetics community now numbers well over one hundred labs from across the world, and papers on oomycetes attract a readership that goes well beyond the community itself. The Oomycete Molecular Genetics Conference alternates between USA and Eurasia, and returns this year to Asilomar, California. This year’s meeting will cover some of the latest research on Effector Biology, Genomics and Oomycete evolution and population biology. With over 100 attendees expected, this meeting represents the largest network meeting held in the US. Committee Chairs John McDowell Mark Gijzen Associate Professor Research Scientist Plant Pathology, Physiology and Weed Science Agriculture and Agri-food Canada Virginia Tech, Blacksburg, VA 24061 London ON, Canada NSV4T3 Meeting Logistics Facilities Coordinator Joel Shuman Paul Morris Project Manager Professor, Biological Sciences Plant Pathology, Physiology and Weed Science Bowling Green State University Virginia Tech, Blacksburg, VA24061 Bowling Green, OH 43403 Cover: Confocal image of GFP-expressing Phytophthora sojae at 12h after inoculation of soybean hypocotyls. Image courtesy of Kai-Tao from the lab of Yuanchao Wang, Nanjing Agricultural University, Nanjing, China. Meeting Sponsors This meeting is supported in part by NSF grant MCB-0639226 to Brett Tyler OMGN 2013 Program Location: Talks will be held at Kiln on Sunday Morning and at Fred Farr for all other sessions.
    [Show full text]
  • A Robust Metaproteomics Pipeline for a Holistic Taxonomic and Functional
    bioRxiv preprint doi: https://doi.org/10.1101/667428; this version posted June 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 2 Title: A robust metaproteomics pipeline for a holistic taxonomic and functional 3 characterization of microbial communities from marine particles 4 Authors: Doreen Schultz,1 Daniela Zühlke,1 Jörg Bernhardt,1 Thomas Ben Francis,2 Dirk 5 Albrecht,1 Claudia Hirschfeld,1 Stephanie Markert,3 and Katharina Riedel 1* 6 7 Addresses: 1 Institute of Microbiology, University of Greifswald, Greifswald, Germany. 8 2 Max-Planck Institute for Marine Microbiology, Bremen, Germany. 9 3 Institute of Pharmacy, University of Greifswald, Greifswald, Germany. 10 11 *Corresponding author mailing address: Institute of Microbiology, Center for Functional 12 Genomics of Microbes (C_FunGene), University of Greifswald, Felix-Hausdorff-Straße 8, DE- 13 17487 Greifswald, Germany. E-mail [email protected]; Tel (+49) 3834 420 5900 14 15 Running title: Metaproteomic pipeline to analyse marine particles 1 bioRxiv preprint doi: https://doi.org/10.1101/667428; this version posted June 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 16 Originality-Significance Statement 17 Marine particles consist of organic particulate matter (e.g. phyto- or zooplankton) and 18 particle-associated (PA) microbial communities, which are often embedded in a sugary 19 matrix. A significant fraction of the decaying algal biomass in marine ecosystems is expected 20 to be mineralized by PA heterotrophic communities, which are thus greatly contributing to 21 large-scale carbon fluxes.
    [Show full text]
  • Pathogenicity of Fungus
    Pathogenicity mechanism of fungi Oomycetes • The Oomycetes are one of the most important groups of fish pathogens. • They resemble fungi, they are in fact more closely related to golden-brown algae, thus are not ‘true fungi’. • They are classified as Stramenopiles, which also includes the golden-brown algae and diatoms. • They are filamentous, heterotrophic, and can reproduce both sexually and asexually. • Taxonomically oomycetes are divided into three subclasses: 1. Saprolegniomycetidae, 2. Hipidiomycetidae 3. Peronosporomycetidae A B Fig:A- Saprolegnia spp, B- Saprolegnia infection in fish • Most fish and animal pathogenic oomycetes belong to the Saprolegniomycetidae, which has two orders: 1. Saprolegniales 2. Leptomitales. • Within the Saprolegniales, three main genera, 1. Saprolegnia 2. Achlya 3. Aphanomyces All are able to infect fish or shellfish. Saprolegniaceae are known as ‘water moulds’ or cotton moulds. Habits of Saprolegnia • Saprolegnia is tolerant to a wide range of temperature, 3–33 °C but is more prevalent in lower temperatures. • Found most frequently in freshwater, it will also tolerate brackish water and even moist soil. • Saprolegnia filaments (hyphae) are long with rounded ends, containing the zoospores. • When the mass of hyphae grows large enough in size to be seen without use of a microscope, it can be called a mycelium. • Colonies are generally white in color, though they may turn grey under the presence of bacteria or other debris which has become caught in the fibrous mass. Characteristics of infection • Saprolegnia is generally a secondary pathogen. • It most frequently targets fish, both in the wild and in tank environments. • Through necrosis of the skin, Saprolegnia will spread across the surface of its host as a cotton-like film.
    [Show full text]