Helional Induces Ca2+ Decrease and Serotonin Secretion of QGP-1 Cells
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity. -
Database Tool the Systematic Annotation of the Three Main GPCR
Database, Vol. 2010, Article ID baq018, doi:10.1093/database/baq018 ............................................................................................................................................................................................................................................................................................. Database tool The systematic annotation of the three main Downloaded from https://academic.oup.com/database/article-abstract/doi/10.1093/database/baq018/406672 by guest on 15 January 2019 GPCR families in Reactome Bijay Jassal1, Steven Jupe1, Michael Caudy2, Ewan Birney1, Lincoln Stein2, Henning Hermjakob1 and Peter D’Eustachio3,* 1European Bioinformatics Institute, Hinxton, Cambridge, CB10 1SD, UK, 2Ontario Institute for Cancer Research, Toronto, ON M5G 0A3, Canada and 3New York University School of Medicine, New York, NY 10016, USA *Corresponding author: Tel: +212 263 5779; Fax: +212 263 8166; Email: [email protected] Submitted 14 April 2010; Revised 14 June 2010; Accepted 13 July 2010 ............................................................................................................................................................................................................................................................................................. Reactome is an open-source, freely available database of human biological pathways and processes. A major goal of our work is to provide an integrated view of cellular signalling processes that spans from ligand–receptor -
OR2AG1 (NM 001004489) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC214778 OR2AG1 (NM_001004489) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: OR2AG1 (NM_001004489) Human Tagged ORF Clone Tag: Myc-DDK Symbol: OR2AG1 Synonyms: OR2AG3; OR11-79 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC214778 representing NM_001004489 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCTCTGGAACTTCACCTTGGGAAGTGGCTTCATTTTGGTGGGGATTCTGAATGACAGTGGGTCTC CTGAACTGCTCTGTGCTACAATTACAATCCTATACTTGTTGGCCCTGATCAGCAATGGCCTACTGCTCCT GGCTATCACCATGGAAGCCCGGCTCCACATGCCCATGTACCTCCTGCTTGGGCAGCTCTCTCTCATGGAC CTCCTGTTCACATCTGTTGTCACTCCCAAGGCCCTTGCGGACTTTCTGCGCAGAGAAAACACCATCTCCT TTGGAGGCTGTGCCCTTCAGATGTTCCTGGCACTGACAATGGGTGGTGCTGAGGACCTCCTACTGGCCTT CATGGCCTATGACAGGTATGTGGCCATTTGTCATCCTCTGACATACATGACCCTCATGAGCTCAAGAGCC TGCTGGCTCATGGTGGCCACGTCCTGGATCCTGGCATCCCTAAGTGCCCTAATATATACCGTGTATACCA TGCACTATCCCTTCTGCAGGGCCCAGGAGATCAGGCATCTTCTCTGTGAGATCCCACACTTGCTGAAGGT GGCCTGTGCTGATACCTCCAGATATGAGCTCATGGTATATGTGATGGGTGTGACCTTCCTGATTCCCTCT CTTGCTGCTATACTGGCCTCCTATACACAAATTCTACTCACTGTGCTCCATATGCCATCAAATGAGGGGA GGAAGAAAGCCCTTGTCACCTGCTCTTCCCACCTGACTGTGGTTGGGATGTTCTATGGAGCTGCCACATT CATGTATGTCTTGCCCAGTTCCTTCCACAGCACCAGACAAGACAACATCATCTCTGTTTTCTACACAATT GTCACTCCAGCCCTGAATCCACTCATCTACAGCCTGAGGAATAAGGAGGTCATGCGGGCCTTGAGGAGGG -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Produktinformation
Produktinformation Diagnostik & molekulare Diagnostik Laborgeräte & Service Zellkultur & Verbrauchsmaterial Forschungsprodukte & Biochemikalien Weitere Information auf den folgenden Seiten! See the following pages for more information! Lieferung & Zahlungsart Lieferung: frei Haus Bestellung auf Rechnung SZABO-SCANDIC Lieferung: € 10,- HandelsgmbH & Co KG Erstbestellung Vorauskassa Quellenstraße 110, A-1100 Wien T. +43(0)1 489 3961-0 Zuschläge F. +43(0)1 489 3961-7 [email protected] • Mindermengenzuschlag www.szabo-scandic.com • Trockeneiszuschlag • Gefahrgutzuschlag linkedin.com/company/szaboscandic • Expressversand facebook.com/szaboscandic SANTA CRUZ BIOTECHNOLOGY, INC. OR2M5 siRNA (h): sc-88564 BACKGROUND STORAGE AND RESUSPENSION Olfactory receptors are G protein-coupled receptor proteins that localize to the Store lyophilized siRNA duplex at -20° C with desiccant. Stable for at least cilia of olfactory sensory neurons where they display affinity for and bind to one year from the date of shipment. Once resuspended, store at -20° C, a variety of odor molecules. The genes encoding olfactory receptors comprise avoid contact with RNAses and repeated freeze thaw cycles. the largest family in the human genome. The binding of olfactory receptor Resuspend lyophilized siRNA duplex in 330 µl of the RNAse-free water proteins to odor molecules triggers a signal transduction cascade that leads provided. Resuspension of the siRNA duplex in 330 µl of RNAse-free water to the production of cAMP via an olfactory-enriched adenylate cyclase. This makes a 10 µM solution in a 10 µM Tris-HCl, pH 8.0, 20 mM NaCl, 1 mM event ultimately leads to transmission of action potentials to the brain and EDTA buffered solution. the subsequent perception of smell. -
Kras, Braf, Erbb2, Tp53
Supplementary Table 1. SBT-EOC cases used for molecular analyses Fresh Frozen Tissue FFPE Tissue Tumour HRM Case ID PCR-Seq HRM component Oncomap (KRAS, BRAF, CNV GE CNV IHC (NRAS) (TP53 Only) ERBB2, TP53) Paired Cases 15043 SBT & INV √ √ √ √ √ √ 65662 SBT & INV √ √ √ √ √ 65661 SBT & INV √ √ √ √ √ √ 9128 SBT & INV √ √ √ √ √ 2044 SBT & INV √ √ √ √ √ 3960 SBT & INV √ √ √ √ √ 5899 SBT & INV √ √ √ √ √ 65663 SBT & INV √ √ √ Inv √ √ √ 65666 SBT √ Inv √ √ √ √ √ 65664 SBT √ √ √ Inv √ √ √ √ √ 15060 SBT √ √ √ Inv √ √ √ √ √ 65665 SBT √ √ √ Inv √ √ √ √ √ 65668 SBT √ √ √ Inv √ √ √ √ 65667 SBT √ √ √ Inv √ √ √ √ 15018 SBT √ Inv √ √ √ √ 15071 SBT √ Inv √ √ √ √ 65670 SBT √ Inv √ √ √ 8982 SBT √ Unpaired Cases 15046 Inv √ √ √ 15014 Inv √ √ √ 65671 Inv √ √ √ 65672 SBT √ √ √ 65673 Inv √ √ √ 65674 Inv √ √ √ 65675 Inv √ √ √ 65676 Inv √ √ √ 65677 Inv √ √ √ 65678 Inv √ √ √ 65679 Inv √ √ √ Fresh Frozen Tissue FFPE Tissue Tumour HRM Case ID PCR-Seq HRM component Oncomap (KRAS, BRAF, CNV GE CNV IHC (NRAS) (TP53 Only) ERBB2, TP53) 65680 Inv √ √ √ 5349 Inv √ √ √ 7957 Inv √ √ √ 8395 Inv √ √ √ 8390 Inv √ √ 2110 Inv √ √ 6328 Inv √ √ 9125 Inv √ √ 9221 Inv √ √ 10701 Inv √ √ 1072 Inv √ √ 11266 Inv √ √ 11368 Inv √ √ √ 12237 Inv √ √ 2064 Inv √ √ 3539 Inv √ √ 2189 Inv √ √ √ 5711 Inv √ √ 6251 Inv √ √ 6582 Inv √ √ 7200 SBT √ √ √ 8633 Inv √ √ √ 9579 Inv √ √ 10740 Inv √ √ 11766 Inv √ √ 3958 Inv √ √ 4723 Inv √ √ 6244 Inv √ √ √ 7716 Inv √ √ SBT-EOC, serous carcinoma with adjacent borderline regions; SBT, serous borderline component of SBT- EOC; Inv, invasive component of SBT-EOC; -
Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A. -
A Rose Extract Protects the Skin Against Stress Mediators: a Potential Role of Olfactory Receptors
Supplementary data A Rose extract protects the skin against stress mediators: a potential role of olfactory receptors Romain Duroux 1,*, Anne Mandeau 1, Gaelle Guiraudie-Capraz 2, Yannick Quesnel 3 and Estelle Loing 4 1 IFF-Lucas Meyer Cosmetics, Toulouse, France 2 Aix-Marseille University, CNRS, INP, Marseille, France 3 ChemCom S.A., Brussels, Belgium 4 IFF-Lucas Meyer Cosmetics, Quebec, Canada * Correspondence: [email protected] Supplemental methods Keratinocytes cell culture and skin explants Skin organ cultures were prepared from tissues samples derived from volunteers undergoing routine therapeutic procedures, in collaboration with Alphenyx (Marseille). For this study, skin samples were derived from abdominal or breast tissues of healthy women (30-40 years old). Samples were received 1 day post-surgery and used directly for microdissection or cell extraction. Microdissected human skin was cultured at 37°C under 5% CO2, in DMEM (Dutscher, #L0060-500) plus 10% FBS (Sigma Aldrich, #F7524), 1% Penicillin/Streptomycin (Sigma Aldrich, #P0781-100), and 1% of minimum medium non-essential amino acids 10X (Gibco, #11140-035). For keratinocyte culture, cells were isolated from human skin epidermis. Briefly, skin samples were cut into small pieces and immersed in Thermolysin (Sigma Aldrich, #T7902-100mg) at 4°C overnight. Epidermis was then carefully detached from dermis before being incubated with Trypsin-EDTA for 15 minutes at 37°C. Trypsin inhibitor was next added, the mixture centrifuged and the supernatant discarded before adding KGM2 Medium (Promocell, #C- 20011) with 1% Penicillin/Streptomycin (Sigma Aldrich, #P0781-100). NHEK were then maintained in culture at 37 °C under 5 % CO2 and 95 % relative humidity. -
An Evolutionary Based Strategy for Predicting Rational Mutations in G Protein-Coupled Receptors
Ecology and Evolutionary Biology 2021; 6(3): 53-77 http://www.sciencepublishinggroup.com/j/eeb doi: 10.11648/j.eeb.20210603.11 ISSN: 2575-3789 (Print); ISSN: 2575-3762 (Online) An Evolutionary Based Strategy for Predicting Rational Mutations in G Protein-Coupled Receptors Miguel Angel Fuertes*, Carlos Alonso Department of Microbiology, Centre for Molecular Biology “Severo Ochoa”, Spanish National Research Council and Autonomous University, Madrid, Spain Email address: *Corresponding author To cite this article: Miguel Angel Fuertes, Carlos Alonso. An Evolutionary Based Strategy for Predicting Rational Mutations in G Protein-Coupled Receptors. Ecology and Evolutionary Biology. Vol. 6, No. 3, 2021, pp. 53-77. doi: 10.11648/j.eeb.20210603.11 Received: April 24, 2021; Accepted: May 11, 2021; Published: July 13, 2021 Abstract: Capturing conserved patterns in genes and proteins is important for inferring phenotype prediction and evolutionary analysis. The study is focused on the conserved patterns of the G protein-coupled receptors, an important superfamily of receptors. Olfactory receptors represent more than 2% of our genome and constitute the largest family of G protein-coupled receptors, a key class of drug targets. As no crystallographic structures are available, mechanistic studies rely on the use of molecular dynamic modelling combined with site-directed mutagenesis data. In this paper, we hypothesized that human-mouse orthologs coding for G protein-coupled receptors maintain, at speciation events, shared compositional structures independent, to some extent, of their percent identity as reveals a method based in the categorization of nucleotide triplets by their gross composition. The data support the consistency of the hypothesis, showing in ortholog G protein-coupled receptors the presence of emergent shared compositional structures preserved at speciation events. -
The Odorant Receptor OR2W3 on Airway Smooth Muscle Evokes Bronchodilation Via a Cooperative Chemosensory Tradeoff Between TMEM16A and CFTR
The odorant receptor OR2W3 on airway smooth muscle evokes bronchodilation via a cooperative chemosensory tradeoff between TMEM16A and CFTR Jessie Huanga,1,2, Hong Lama,1, Cynthia Koziol-Whiteb,c, Nathachit Limjunyawongd, Donghwa Kime, Nicholas Kimb, Nikhil Karmacharyac, Premraj Rajkumarf, Danielle Firera, Nicholas M. Dalesiog, Joseph Judec, Richard C. Kurtenh, Jennifer L. Pluznickf, Deepak A. Deshpandei, Raymond B. Penni, Stephen B. Liggette,j, Reynold A. Panettieri Jrc, Xinzhong Dongd,k, and Steven S. Anb,c,2 aDepartment of Environmental Health and Engineering, The Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205; bDepartment of Pharmacology, Rutgers-Robert Wood Johnson Medical School, The State University of New Jersey, Piscataway, NJ 08854; cRutgers Institute for Translational Medicine and Science, New Brunswick, NJ 08901; dSolomon H. Snyder Department of Neuroscience, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; eCenter for Personalized Medicine, Morsani College of Medicine, University of South Florida, Tampa, FL 33612; fDepartment of Physiology, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; gDepartment of Anesthesiology and Critical Care Medicine, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; hDepartment of Physiology and Biophysics, University of Arkansas for Medical Sciences, Little Rock, AR 72205; iDivision of Pulmonary and Critical Care Medicine, Department of Medicine, Center for Translational Medicine, Jane and Leonard Korman -
Genome-Wide Transcriptome Analysis of Laminar Tissue During the Early Stages of Experimentally Induced Equine Laminitis
GENOME-WIDE TRANSCRIPTOME ANALYSIS OF LAMINAR TISSUE DURING THE EARLY STAGES OF EXPERIMENTALLY INDUCED EQUINE LAMINITIS A Dissertation by JIXIN WANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY December 2010 Major Subject: Biomedical Sciences GENOME-WIDE TRANSCRIPTOME ANALYSIS OF LAMINAR TISSUE DURING THE EARLY STAGES OF EXPERIMENTALLY INDUCED EQUINE LAMINITIS A Dissertation by JIXIN WANG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, Bhanu P. Chowdhary Committee Members, Terje Raudsepp Paul B. Samollow Loren C. Skow Penny K. Riggs Head of Department, Evelyn Tiffany-Castiglioni December 2010 Major Subject: Biomedical Sciences iii ABSTRACT Genome-wide Transcriptome Analysis of Laminar Tissue During the Early Stages of Experimentally Induced Equine Laminitis. (December 2010) Jixin Wang, B.S., Tarim University of Agricultural Reclamation; M.S., South China Agricultural University; M.S., Texas A&M University Chair of Advisory Committee: Dr. Bhanu P. Chowdhary Equine laminitis is a debilitating disease that causes extreme sufferring in afflicted horses and often results in a lifetime of chronic pain. The exact sequence of pathophysiological events culminating in laminitis has not yet been characterized, and this is reflected in the lack of any consistently effective therapeutic strategy. For these reasons, we used a newly developed 21,000 element equine-specific whole-genome oligoarray to perform transcriptomic analysis on laminar tissue from horses with experimentally induced models of laminitis: carbohydrate overload (CHO), hyperinsulinaemia (HI), and oligofructose (OF). -
Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation
Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v