Metalloprotein Engineering with Unnatural Amino Acids: Application in Functional Heme-Copper Oxidase and Azurin

METALLOPROTEIN ENGINEERING WITH UNNATURAL AMINO ACIDS: APPLICATION IN FUNCTIONAL HEME-COPPER OXIDASE AND AZURIN

YANG YU

DISSERTATION

Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biophysics and Computational Biology in the Graduate College of the University of Illinois at Urbana-Champaign, 2014

Urbana, Illinois

Doctoral Committee:

Professor Yi Lu, Chair Professor Robert B. Gennis Professor Martin H.M. Gruebele Professor Zaida Luthey-Schulten

Abstract Metalloproteins, proteins with metal ion cofactors, are estimated to make up more than a third of total proteome. They involve in key biological processes such as photosynthesis, respiration, and nitrogen fixation. The important roles and potential applications of metalloprotein urges the need for metalloprotein engineering. The advent of modern molecular biology provides us the ability to mutate certain amino acid in metalloproteins to all other natural amino acids through site-directed mutagenesis. However, site-directed mutagenesis is restricted to 20 natural amino acids, only half of which could coordinate to metal. Incorporation of unnatural amino acids greatly expands the toolbox of bioinorganic chemists. Several methods for unnatural amino acid incorporation have been developed, including cavity complementation, total synthesis, native chemical ligation, expressed protein ligation and amber suppression. They all have their own advantages and disadvantages.

Heme copper oxidases (HCOs) catalyzes reduction of O2 to H2O and harvest energy at the end of respiration chain. The enzyme plays a pivotal role in aerobic respiration and thus is important for life on earth. The oxygen reduction reaction is catalyzed in a dinuclear center which is composed of a heme and a copper ion coordinated with three histidines. Besides that, there is a conserved tyrosine residue which forms a post-translational modified His-Tyr cross-link with one of the three histidines at CuB site. Due to the fact that HCO is a large membrane protein with multiple metal cofactors, it is difficult to study and there are many unsolved questions. In particular, since His-Tyr cross-link forms simultaneously in vivo, it has been difficult to directly probe the effect of cross-link. Based on a model protein system developed in our lab, we have been able to use amber suppression method to incorporate an unnatural amino acid that mimics cross-linked His-Tyr. The new protein, termed imiTyr-

CuBMb, is able to perform O2 reduction reaction three times as fast as protein without cross-link and in a much cleaner fashion.

Tyrosine is a conserved redox-active amino acid that plays important roles in heme-copper oxidases. Despite the widely proposed mechanism that involves a tyrosyl radical, its direct observation under O2 reduction condition remains elusive. Using a functional oxidase model in myoglobin called F33Y-CuBMb, we observed of radical under H2O2 reaction condition by electron paramagnetic resonance (EPR) spectroscopy. Simulation of X- and Q-band EPR spectra suggested this radical is a tyrosyl radical, while natural amino acid mutagenesis and unnatural amino acid incorporation proved this radical is at Tyr33, the active site Tyr in F33Y-CuBMb. Freeze quench technique was used to trap the same radical under O2 reduction condition, confirming the active site Tyr works as electron and proton donor in the reaction. Furthermore, through incorporation of a series of Tyr analogues, effect of pKa and redox potential of Tyr on enzymatic activity was explored.

Native HCOs have efficient electron transfer pathway toward binuclear center. In order to increase the electron transfer rate toward our protein model, the physiological electron transfer partner, cyt b5 was used as electron donor. Mutations were introduced to Mb to increase interaction between engineered Mb and cyt b5. The resulting system has faster electron transfer and significantly improve O2 consumption rate.

Azurin is a Type 1 copper protein involved in biological electron transfer. The copper ion in azurin is coordinated by two histidines and one cysteine in equatorial position and methionine, backbone oxygen of glycine at axial position. The methionine and cysteine have been replaced by unnatural amino acids using expressed protein ligation. His117 is believed to play important role in electron transfer and redox potential tuning. This amino acid was replaced with a series of His analogues to explore the effect of pKa of His in redox potential.

Azurin, as well as other Type 1 copper proteins, has Greek key β barrel scaffold. Circular permutation, a method that changes amino acid sequence of a protein with little perturbation to its three dimensional structure, was carried out in azurin. The resulting mutants were characterized structurally and spectroscopically.

iii

To my parents and my whole family who always supported me and encouraged me to pursue my dream

Acknowledgements There are many people without whom this research would not be possible. First I wish to thank my advisor, Dr. Yi Lu. Without his guidance, teaching and support throughout the years, I would not be a qualified scientist. I also wish to thank my committee members for their years of guidance. In particular, Robert Gennis taught me various aspects of heme-copper oxidases and allowed me to use his instrument, including oxygen electrode and stopped flow spectrometer for my research. Martin Gruebele and Zan Schulten were on my advisory committee, qualifying committee and are always willing to answer my questions.

Thank you to all the past and current members of Lu group with whom I enjoyed doing research with and had a lot of fun outside the lab. In particular I wish to thank Dr. Nicholas Marshall and Dr. Kevin Clark for training and mentoring me in my early graduate career. I also thank other group members I worked with on these and other projects, including: Dr. Arnab Mukherjee, Dr. Kyle Miner, Dr. Zhou Dai, Parisa Hosseinzadeh, Chang Cui, and Igor Petrik. I am grateful for the discussions with Dr. Saumen Chakraborty, Dr. Jing Liu, Shiliang Tian and Dr. Tiffany Wilson.

I would also like to thank my collaborators outside the group. I had close collaboration with Professor Jiangyun Wang and his group. He gave me tremendous help not only in offering the system for unnatural amino acid incorporation, but also in providing great insight in the heme-copper oxidase mimic. I am indebted to Professor Mark Nilges for his guidance and support on EPR, from experiment setup to data analysis and interpretation. I appreciate his patience for guiding a novice like me into the EPR field. I would like to thank Professor Ninian Blackburn and Kelly Chacon from Oregon Health and Science University, Dr. Erik Farquhar from Case Western Reserve University and Brookhaven National Lab for their help in X-ray absorption spectroscopy experiment. I would like to thank National Synchrotron Light Source, Stanford Synchrotron Light Source and their staffs for XAS beam time. I would like to thank Dr. Hanlin Ouyang for his discussion and offering of native HCO for my study.

Finally, thank you to my parents and the whole family. I always know you are behind me even I am half a world away. You are my source of faith and strength in pursuing an advanced degree and being a good person.

Table of Contents List of Figures ...... x

List of Tables ...... xiii

Chapter 1 Unnatural Amino Acids for Metalloprotein Engineering ...... 1

1.1 Metalloproteins ...... 1

1.2 Methods for Metalloprotein Study ...... 1

1.3 Metalloprotein Design by Incorporating Unnatural Amino Acids ...... 2

1.3.1 Cavity complementation ...... 2

1.3.2 Synthesis and semi-synthesis ...... 3

1.3.3 Amber suppression and other biological methods ...... 7

1.4 Summary ...... 9

1.5 References ...... 10

Chapter 2 Incorporation of imiTyr in CuBMb to Mimic Post-Translational Modified His- Tyr Cross-Link for Better Oxidase Activity ...... 17

2.1 Introduction ...... 17

2.2 Materials and Methods ...... 20

2.3 Results and Discussion ...... 22

2.3.1 Molecular dynamics simulation of mutants with imiTyr ...... 22

2.3.2 Oxidase activity ...... 23

2.4 Summary ...... 26

2.5 References ...... 27

Chapter 3 Tyrosine as Proton-Coupled Electron Transfer Center in Functional Heme- Copper Oxidase ...... 32

3.1 Introduction ...... 32

3.2 Materials and Methods ...... 33

vii

3.2.1 General ...... 33

3.2.2 UV-vis and EPR spectroscopic studies ...... 33

3.3 Results and Discussion ...... 35

3.3.1 Tyrosyl radical formed in F33Y-CuBMb after H2O2 treatment ...... 35

3.3.2 Power saturation behavior of the observed radical ...... 42

3.3.3 Tyr mutations reveal origin of radical ...... 43

3.3.4 Unnatural amino acids as probe to locate origin of radical ...... 44

3.3.5 Tyrosyl radical generated in F33Y-CuBMb after reaction with O2 ...... 54

3.3.6 pKa and reduction potential of Tyr affect oxidase activity ...... 56

3.4 Summary ...... 62

3.5 References ...... 62

Chapter 4 Improve Oxidase Activity by Engineering Electron Transfer Pathway ...... 70

4.1 Introduction ...... 70

4.2 Materials and Methods ...... 72

4.2.1 Gene construction ...... 72

4.2.2 Protein expression and purification ...... 72

4.2.3 Stopped flow UV-vis absorbance ...... 74

4.2.4 O2 consumption assay ...... 75

4.3 Results and Discussion ...... 75

4.3.1 UV-vis spectroscopy of proteins ...... 75

4.3.2 Size exclusion chromatography to determine protein-protein interaction ...... 77

4.3.3 Stopped-flow for electron transfer between cyt b5 and Mb ...... 78

4.3.4 Oxidase activity ...... 79

4.4 Summary ...... 81

4.5 References ...... 81

viii

Chapter 5 Explore the Role of Equatorial His in Redox Potential Tuning of Azurin ...... 85

5.1 Introduction ...... 85

5.1.1 Type 1 copper proteins ...... 85

5.1.2 Mutagenesis of copper ligands ...... 90

5.1.3 Unnatural amino acids to probe ...... 93

5.2 Materials and Methods ...... 95

5.2.1 General ...... 95

5.2.2 Peptides ...... 96

5.2.3 Expressed protein ligation ...... 96

5.2.4 Electrochemical study ...... 98

5.3 Results and Discussion ...... 98

5.3.1 Azurins with His analogues retain Type 1 characters ...... 98

5.3.2 Reduction potential of azurin mutants showed correlation with pKa of His .. 101

5.4 Summary ...... 104

5.5 References ...... 104

Chapter 6 Circular Permutation of Azurin ...... 117

6.1 Introduction ...... 117

6.2 Materials and Methods ...... 120

6.3 Results and Discussion ...... 122

6.3.1 Rational design of construct ...... 122

6.3.2 Overall structure of circular permutated protein is not perturbed...... 124

6.3.3 Circular permutated proteins retain type I characters ...... 129

6.4 Summary ...... 133

6.5 References ...... 134

List of Figures

Figure 1.1 Mechanisms of native chemical ligation and expressed protein ligation...... 5 Figure 1.2 Expressed protein ligation in Azurin...... 7 Figure 2.1 Crystal structure of cytochrome c oxidase...... 18 Figure 2.2 A) Binuclear center of bovine CcO. B) Overlay of crystal structure of F33Y-

CuBMb and computer model of imiTyr-CuBMb. C) Structure of His-Tyr cross-link analogue amino acid, imiTyr...... 20 Figure 2.3 Structure of L29H/F33ImTyrF43A Mb...... 23

Figure 2.4 (A) Rates of oxygen reduction to form either water or H2O2 catalyzed by 6 μM

WT Mb, F33YCuBMb, or imiTyr-CuBMb. (B) O2 reduction turnover number catalyzed by imiTyr-CuBMb or F33Y-CuBMb...... 25

Figure 3.1 A radical generated after F33Y-CuBMb reacted with H2O2...... 36 Figure 3.2 Spin quantification using TEMPO...... 36

Figure 3.3 X-band EPR spectra of WT Mb, CuBMb and F33Y-CuBMb in absence and in presence of 1 Eq H2O2...... 38

Figure 3.4 X-band (a) and Q-band (b) EPR spectra of F33Y-CuBMb after H2O2 treatment...... 39

Figure 3.5 X-band (A) and Q-band (B) EPR spectra of H2O2-reacted F33Y-CuBMb. . .. 40

Figure 3.6 Second derivatives of X-band (A) and Q-band (B) spectra of F33Y-CuBMb after H2O2 treatment...... 42 Figure 3.7 Plot of relative signal vs. power and fitting for power saturation experiment at 10 K (A) and 30 K (B)...... 43

Figure 3.8 Experimental and simulated EPR spectra of A) F33Y-CuBMband B)

F33Y/Y103/146/151F-CuBMb after H2O2 treatment...... 44

Figure 3.9 Active site of F33Y-CuBMb and various Tyr analogs used in this study...... 45

Figure 3.10 Electrospray mass spectrometry of F33ClTyr-CuBMb, F33Cl2Tyr-CuBMb and

F33F2Tyr-CuBMb...... 46

Figure 3.11 UV-vis spectra of ferric and deoxy form of F33Y-CuBMb (A), F33ClY-CuBMb

(B), F33F2Y-CuBMb (C), F33F2Y-CuBMb (D) and F33OMeY-CuBMb (E) respectively. .. 48

List of Figures cont'd

Figure 3.12 EPR spectrum of various myoglobin variants after reaction with H2O2. Experimental spectra were shown in black solid line while simulated spectra in red dashed line...... 50

Figure 3.13 ESI-QToF mass spectrometry of F33ClY-CuBMb and F33D2ClY-CuBMb. .. 53

Figure 3.14 EPR spectra of F33Y-CuBMb reacted with H2O2 and O2...... 55

Figure 3.15 EPR spectra of ferrous F33Y-CuBMb with or without treatment of O2, ferric

F33Y-CuBMb and O2 bound WT Mb...... 55

Figure 3.16 pKa of Tyr and Tyr analogs...... 57 Figure 3.17 Rates of oxygen reduction to form either water or ROS catalyzed by 6μM of

WT Mb, Phe33Tyr-CuBMb, Phe33ClY-CuBMb, Phe33Cl2Y-CuBMb, Phe33F2Y- CuBMbor Phe33OMeY-CuBMb...... 60

Figure 3.18 The oxidase activities of proteins are correlated with pKa of Tyr...... 61

Figure 3.19 O2-reduction turnover number by Phe33OMeY-CuBMb measured during the stepwise addition of O2...... 61

Figure 4.1 Cofactors involved in electron transfer in (A) aa3 oxidases from Bos taurus,

(B) cbb3 type oxidases from Pseudomonas stutzeri and (C) engineered electron transfer pathway from NADH to Mb...... 70

Figure 4.2 UV-vis spectra of as-purified and reduced NADH-cyt b5 reductase...... 76

Figure 4.3 UV-vis spectra of ferric and ferrous cyt b5...... 76

Figure 4.4 Analytical size-exclusion chromatography of engineered Mb and cyt b5...... 77

Figure 4.5 Stopped-flow UV-vis absorption spectra of A) 5 μM ferrous cyt b5 and 5μM

G65Y-CuBMb over 50 s, B) 5μM ferrous cyt b5 and 5μM G65Y-CuBMb(+6) over 10 s. . 78

Figure 4.6 O2 consumption of F33Y-CuBMb(+6), G65Y- CuBMb(+6), and Mb(+6). Typical condition: 1 mM NADH, 0.16 μM NADH-cyt b5 reductase, 5 μM cyt b5, 0.25 μM F33Y-

CuBMb(+6) and G65Y- CuBMb(+6), 0.025 μM Mb(+6)...... 79

Figure 4.7 Oxidase activity of G65Y-CuBMb(+6) under optimized condition, in comparison with that of cbb3 oxidase from Vibrio cholera at similar condition...... 80 Figure 5.1 Crystal structures of the T1 copper proteins...... 88 Figure 5.2 Electronic absorption (A) and EPR (B) spectra of Azurin...... 89

List of Figures cont'd

Figure 5.3 H-bonding around Cys112 (A) and other ligands (B) of azurin...... 90 Figure 5.4 Unnatural amino acids incorporated into azurin by EPL method...... 94 Figure 5.5 Histidine and histidine analogues...... 95 Figure 5.6 UV-Vis spectra of holo azurin with histidine and histidine analogues incorporated...... 99 Figure 5.7 X-band EPR spectra of holo azurin with histidine and histidine analogues incorporated...... 100 Figure 5.8 Reduction potential of azurin is correlated with pKa on histidine...... 102

Figure 5.9 Graph of calculated ΔIE versus ΔpKa...... 103 Figure 6.1 Aligned structure of 8 Type-1 copper proteins using Multiseq...... 118 Figure 6.2 Sequence alignment of 8 T1 copper proteins based on structure...... 119 Figure 6.3 Schematic view of overall fold of azurin and circular permutation site...... 120 Figure 6.4 Simulation of cpAz1 and cpAz2...... 123 Figure 6.5 Sequence alignment of azurin, cpaz1 and cpaz2...... 124 Figure 6.6 Guanidine denaturation curves of all proteins...... 125 Figure 6.7 crystal structures of WT azurin and cpAz2. (A) Overlay of the structures. (B) Comparison of Cu sites...... 128 Figure 6.8 Copper binding site formed between two monomers of cpAz2...... 128 Figure 6.9 (A) Electronic absorption spectra of cpAz1 and cpAz2, and (B) EPR spectra of WT Azurin, cpAz1 and cpAz2 and simulated spectra of cpAz1 and cpAz2...... 130 Figure 6.10 Fourier transform and EXAFS for the WT azurin, cpAz1 and cpAz2...... 132

xii

List of Tables Table 2.1 Distance between Copper ion and N on imidazole ring, measured from MD simulated structure...... 22

Table 2.2 Rate of O2 reduction toward production of H2O and H2O2 for WT Mb, F33YCuBMb, or imiTyr-CuBMb...... 24 Table 3.1 Spin quantification using TEMPO...... 37

Table 3.2 Simulated EPR parameters for the tyrosyl radical species in F33Y-CuBMb and tyrosyl radical in RNR...... 40

Table 3.3 Simulated EPR parameters for both species in H2O2-reacted F33Y-CuBMb. 41 Table 3.4 UV-vis Features of myoglobin mutants with Tyr and Tyr analogs at 33 position...... 47 Table 3.5 Simulated EPR parameters...... 51 Table 3.6 Line widths used in EPR simulation...... 51

Table 3.7 Experimental and predicted pKa of phenols...... 58 Table 3.8 Peak potential of amino acids at different pH measured by CV or reported previously...... 58 Table 3.9 Rate of oxygen reduction for different proteins...... 59 Table 5.1 Properties of T1 copper proteins...... 86 Table 5.2 Properties of azurin mutants with His analogues...... 99 Table 5.3 Simulated EPR parameters...... 101 Table 5.4 DFT energy of deprotonation and ionization energies...... 103 Table 6.1 Thermodynamic stability parameter of azurin and mutants...... 126 Table 6.2 Data collection and refinement statistics...... 126 Table 6.3 Distances between ligands and copper for cpAz2...... 129 Table 6.4 Spectroscopic properties, reduction potentials of WT Azurin, cpAz1 and cpAz2...... 131 Table 6.5 EXAFS fitting parameters...... 133

xiii

Chapter 1 Unnatural Amino Acids for Metalloprotein Engineering1

1.1 Metalloproteins

Metalloproteins, proteins with metal ion cofactors, are estimated to make up more than a third of total proteome.1 In addition to their wide existence, metalloproteins play important roles in key biological processes, such as photosynthesis2,3, aerobic or anaerobic respiration4, nitrogen fixation5-7, O2 transport and storage8,9, transcription regulation10. Many of these processes are not only crucial for living organisms, but also frontiers of bio-energy research.

1.2 Methods for Metalloprotein Study

Metal ions, especially transition metal ions, give metalloproteins rich spectroscopic features. A set of spectroscopic methods are routinely used in characterization of metalloproteins. These methods include UV-vis spectroscopy, electron paramagnetic resonance (EPR) spectroscopy, X-ray absorption spectroscopy (XAS), Mössbauer spectroscopy and resonance Raman spectroscopy.11 There are other commonly used methods for protein characterization that can be applied to metalloprotein study as well, such as circular dichroism, fluorescence spectroscopy, mass spectrometry, X-ray crystallography, various chromatography methods and computational methods such as density function theory (DFT) and molecular dynamics simulation. These methods provide important information of metalloprotein, from overall structure and folding to specific bond and electronic environment around metal center.

Before structural and spectroscopic characterization, a key step for metalloprotein engineering and design is to precisely position desired functional groups in defined positions. For small molecule mimics of metalloproteins, this can be easily achieved during chemical synthesis. For metalloproteins, genes encoding proteins can

1 Portions of this chapter are previously published and are here reproduced with permission from Elsevier for Lu, Y., Chakraborty, S., Miner, K. D., Wilson, T. D., Mukherjee, A., Yu, Y., Liu, J., and Marshall, N. M. (2013) 3.19 - Metalloprotein Design, In Comprehensive Inorganic Chemistry II (Second Edition) (Reedijk, J., and Poeppelmeier, K., Eds.), pp 565-593, Elsevier, Amsterdam. 1 be altered in a process called mutagenesis, changing amino acids in the proteins. With knowledge of protein structures, mutagenesis could lead to position of functional group on amino acids into certain positions.

1.3 Metalloprotein Design by Incorporating Unnatural Amino Acids

With the advent of modern molecular biology, mutagenesis to natural amino acids has been a powerful technique for metalloprotein design. However, when limited to the proteinogenic amino acids, the toolbox of bioinorganic chemists is limited to only 20 options for mutations to make. This limitation is exacerbated when one considers less than half of these amino acids are capable of coordinating to metal ions. To expand this toolbox, various methods have been developed for incorporating unnatural amino acids with different unnatural side chains or even backbone groups. According to how the unnatural elements are incorporated into polypeptide chain, these methods can be divided into three categories, cavity complementation, synthetic or semisynthetic methods, or biological methods.

1.3.1 Cavity complementation

Arguably the simplest way to incorporate unnatural moieties into a protein is through cavity complementation, which works by creating a cavity in protein by mutation to amino acid with smaller side chains, like Gly. External ligands, such as imidazole or its derivatives thereof can then be added to solution to fill the cavity. This method can be used to study the effect of different ligands of appropriate size without any further need for protein modification. As such, a wide variety of small molecules can be screened in a relatively short amount of time. Canters and coworkers have demonstrated this method in Type 1 copper protein azurin. By mutating the equatorial histidine to glycine, they were able to create an open binding site, and adding different external ligands was seen to convert between Type 1 and Type 2 copper sites, or alter the redox properties of the protein.12,13 Barrick, Boxer and coworkers have made a cavity by mutating proximal His93 to Gly and complemented with various N, O and S containing ligands.14,15 Addition of sulfur ligand will give protein cytochrome P450-like absorption spectrum while phenolic ligands will give catalase-like spectrum.15 Goodin

2 and coworkers have made a cavity mutation His175Gly in the proximal site of cytochrome c peroxidase. Although external imidazole could coordinate with heme at the cavity, the enzymatic activity is only partially restored(~5%).16 Watanabe and coworkers have designed a myoglobin with Try filled into cavity to realize the P450 type aromatic compound hydroxylation activity.17,18 Cavity complementation provides an easy, flexible way to incorporate external ligand. However, unlike other methods, the ligand is not covalently attached in cavity complementation, which means that large excesses of ligand are typically needed. The molecule of interest must also be able to diffuse to the site of interest without interfering with other portions of the protein.

1.3.2 Synthesis and semi-synthesis

In total synthesis the whole polypeptide chains are assembled from amino acid monomers by solid phase peptide synthesis.19 This method gives great flexibility in types and positions of unnatural amino acids to be incorporated. However, due to the accumulation of errors and loss of yield from each round of synthesis, only proteins of 50 amino acids or less can be synthesized reliably.19 Due to the limitation in peptide length, total synthesis of peptides has been most extensively utilized in de novo protein design and is therefore covered in the previous sections of this text.

To overcome the size limitation of total synthesis method, various ligation methods were developed to ligate two or more short peptides into a full length protein by chemoselective or enzymatic reactions.19,20 Native chemical ligation (NCL) is most popular due to its mild conditions (neutral pH, aqueous solution) and because a native peptide bond is formed after ligation.20 In order to conjugate to separate peptides, NCL utilizes a chemoselective transthioesterification reaction that can re-arrange to a native peptide bond through a spontaneous acyl transfer. As shown in Figure 1.1, an N terminal cysteine thiol on one peptide is reversibly captured by a thioester from the C terminus of another peptide, followed by spontaneous S->N acyl shift from the N terminus of one peptide to form a native peptide bond.21 The major disadvantage of NCL is that it requires a thiol or selenol containing amino acid at the site of ligation. Introduction of an extra cysteine for ligation could interfere with metal binding or characterization, or result in undesirable disulfide formation. Recent developments,

3 including using an auxiliary thiol instead of Cys22, desulfurization or deselenization after ligation23,24 and ligation using phosphate instead of thiolate25 have the potential to overcome this limitation. To date, however, desulfurization or deselenization techniques are non-specific and will affect any thiol or selenol containing amino acid in the protein, and other ligation methods like those using phosphate do not yet approach the same yields of the thiol based ligation. Synthesis of peptide thioesters traditionally uses Boc chemistry which requires specialized equipment. To alleviate this need for specialized equipment new resins have been developed to synthesize peptide thioesters in high yield using milder Fmoc chemistry.26

The use of NCL for metalloprotein design has been demonstrated in different proteins including cytochrome b562, high potential iron proteins (HiPIPs) and rubredoxin. Low et al. replaced the highly conserved Tyr10 of rubredoxin with substituted tyrosine analogues with different electron withdrawing/donating ability. The correlation between the Hammett σp values with the reduction potentials indicated the role of tyrosine in tuning the reduction potential of rubredoxin.27 Low and colleagues have also used NCL to demonstrate reduction potential tuning by replacing the axial ligand of the heme in cytochrome b56228 and by altering a backbone amide-Cys hydrogen bond in HiPIP.22

Figure 1.1 Mechanisms of native chemical ligation and expressed protein ligation.29

Expressed protein ligation (EPL) is a semi-synthetic method based on native chemical ligation.29-31 In EPL, intein, a self-splicing protein domain, is used to produce a thioester containing peptide for native chemical ligation. The main advantage of this technique is that the thioester containing peptide can be recombinantly expressed, thereby negating the need to synthesize the thioester and allowing for much larger pieces of a protein to be produced through traditional expression methods. As shown in Figure 1.1, the N terminal part of a target protein is fused with an intein domain, which is then expressed as a fusion to a purification tag, such as GST. The engineered intein is able to cleave the N terminal peptide off the fusion. This reaction is naturally reversible, but the protein fragment of interest can be intercepted in the presence of external thiols. The resulting protein fragment will then contain a thioester and can then react with another peptide with an N terminal Cys to complete an NCL reaction.32 If designed

5 properly, only a short peptide containing the unnatural amino acid near the C terminal end of the target protein will need to be synthesized while the majority of the protein is recombinant expressed. As with NCL, EPL also requires a thiol or selenol containing amino acid at the site of ligation.

Several examples of the utility of EPL in studying and engineering proteins are now published. For example, Berg et al. have changed arginine, which is known to interact with DNA, to citrulline, which has a similar size but different hydrogen binding pattern. The varied hydrogen bonding patterns preferred by citrulline allowed this mutant to recognize adenine instead of guanine.33 Lu group was among the first to apply EPL in metalloproteins, starting with the Type 1 copper protein azurin.34-37 Selenocysteine and selonomethonine have been used to replace S-containing ligands cysteine and methionine in azurin. The S to Se substitution enables us to further probe electronic structure of azurin by various spectroscopic techniques, including UV-vis, EPR, MCD and XAS.34,35,38 By replacing the axial methionine with various isostructual unnatural amino acids, the reduction potential of azurin was systematically tuned over a range of 200mV.35,36 Furthermore, by introducing a strong ligand with similar size as methionine, the thiol containing homocysteine unnatural amino acid, at the same axial position, the blue copper protein azurin is converted to red copper protein.37

Figure 1.2 Expressed protein ligation in Azurin.

1.3.3 Amber suppression and other biological methods

While NCL and EPL are very useful methods for incorporating unnatural amino acids into proteins, the ultimate tool in the field of protein engineering would be the ability to use the translation machinery of the cells to directly incorporate non- proteinogenic amino acids. The native translation machinery has evolved to produce proteins with high fidelity, however, which would normally make such incorporations impossible. Over half a century ago, it was found that the natural promiscuity of aminoacyl tRNA synthetases enables structural analogues of natural amino acids to be incorporated into proteins in vivo.39 By removing the natural amino acid that is being replaced from the growth media, supplementing it with an unnatural amino acid and using auxotrophic strains that cannot produce the natural amino acid being replaced unnatural amino acids could be efficiently incorporated. This method of amino acid replacement is relatively easy to perform, relatively inexpensive and does not require any reengineering of the translational machinery.40,41 However, only a few structural analogues of natural amino acids can be used, and using auxotrophs will result in global

7 replacement of a given amino acid. For example, Blackburn and coworkers have replaced Met in soluble domain of heme-copper oxidases with selenomethionine, and used it as a spectral probe to study CuA site formation with X-ray absorption spectroscopy. 42,43. In a cytochrome p450, all 13 Met residues were replaced by an isosteric structural analogue, norleucine using an auxotrophic strain. Despite a lower thermostability, the norluecine containing mutant displays nearly two fold peroxygenase activity compared with the wild type enzyme. This increase was attributed to removal of the easily oxidized methionine that can inactivate the enzyme during the reaction.44 Met is a relatively uncommon amino acid, however, as compared to Lys, Glu or Asp. While the example of Met replacement in the p450 protein mentioned above did result in viable protein even after 13 substitutions, replacing an amino acid more commonly found would result in dozens of individual mutations, which would likely be devastating to protein stability and make it difficult to de-convolute which mutations produce the observed phenotype even if the protein is active.

In order to provide the selectivity to make single point mutations with unnatural amino acids, tRNA for amber codon (UAG) or other natural amino acids is chemically aminoacylated,45-47 or labeled with de novo ribozymes in flexizyme system.48-50 The (mis)charged tRNA is added into in vitro translation system or injected into cells for protein translation.51,52 Such method has been used to incorporate modified backbones 53,54, fluorescent probe 55,56, and reactive moiety57. Application of the method is restricted by high cost and low protein yield due to use of chemically modifying tRNA and translation in in vitro system or stagnant cells.

To fully utilize the cell translational machinery, amber stop codon suppression methods have been developed.58 Such techniques utilize engineered aminoacyl tRNA synthetases (aaRS) that recognize an unnatural amino acid and transfer it to a tRNATAG, which incorporates the unnatural amino acid into a protein in vivo.59 As a result of the compatibility of amber suppression methods with cellular machinery during protein expression, a high level of efficiency and accuracy in unnatural amino acid incorporation can be achieved. As such, this method has become increasingly used over the past two decades with a growing list of unnatural amino acids58 and ever increasing range of

8 hosts, from bacteria like E. coli to the multicellular organism Caenorhabditis elegans.60- 63 However, due to the number of orthogonal tRNA/aaRS pairs and the lack of “empty” codons, only two orthogonal unnatural amino acids have been incorporated into a single protein so far, making incorporation of multiple different amino acids impossible at this time.64 Also, for each unnatural amino acid of interest, selection for specific tRNA and aaRS must be conducted. Furthermore, it is currently not clear how different an unnatural amino acid must be to efficiently evolve a truly orthogonal tRNA/aaRS pair.

Despite the complexities involved in selection of the proper translational machinery, about 70 different unnatural amino acids have thus far been incorporated into proteins with evolved tRNA/aaRS pairs.58 A couple of tRNA/aaRS pairs that can recognize metal binding ligands have been selected and used in metalloprotein design. Ferrocene has also been introduced into proteins to create a redox active metal center.65 (8-Hydroxiylquinolin-3-yl)alanine has been used to introduce Zn2+ binding site into protein and help phasing in X ray crystallography.66 The same unnatural amino acid has been incorporated into GFP and enhanced fluorescence due to metal chelating.67 Wang and coworkers have incorporated several metal-chelating unnatural amino acids to alter enzymatic activity.68,69 Recently, Baker and coworkers have demonstrated using Rosetta suite for computational design of metalloprotein with unnatural amino acids.70 They have designed a Co2+/Ni2+ binding site with the unnatural amino acids (2,2`- bipyridin-5yl)alanine. The protein has high metal binding affinity and its crystal structure matches well with computational model.

1.4 Summary

Compared with mutagenesis with natural amino acids, unnatural amino acids provide more flexibility and precise control of steric and other factors in order to systematically tune a certain aspect of residue. Various methods of unnatural amino acids incorporation have been developed and I would adapt different methods according to our need and their advantages and disadvantages. Combining biosynthetic approach, unnatural amino acids incorporation and biophysical characterization methods, I studied two different metalloprotein systems, as shown in the following chapters. 9

1.5 References

1. Shi, W., and Chance, M. R. (2011) Metalloproteomics: forward and reverse approaches in metalloprotein structural and functional characterization, Curr. Opin. Chem. Biol. 15, 144-148. 2. Sproviero, E. M., Gascón, J. A., McEvoy, J. P., Brudvig, G. W., and Batista, V. S. (2007) Quantum mechanics/molecular mechanics structural models of the oxygen-evolving complex of photosystem II, Curr. Opin. Struct. Biol. 17, 173-180. 3. Kawakami, K., Umena, Y., Kamiya, N., and Shen, J.-R. (2011) Structure of the catalytic, inorganic core of oxygen-evolving photosystem II at 1.9Å resolution, Journal of Photochemistry and Photobiology B: Biology 104, 9-18. 4. Blanca, J. A. G.-h., Jon, B., Ma, J., and Gennis, R. B. (1994) MINIREVIEW The Superfamily of Heme-Copper Respiratory Oxidases, J. Bacteriol. 176, 5587-5600. 5. Peters, J. W., and Szilagyi, R. K. (2006) Exploring new frontiers of nitrogenase structure and mechanism, Curr. Opin. Chem. Biol. 10, 101-108. 6. Spatzal, T., Aksoyoglu, M., Zhang, L., Andrade, S. L. A., Schleicher, E., Weber, S., Rees, D. C., and Einsle, O. (2011) Evidence for Interstitial Carbon in Nitrogenase FeMo Cofactor, Science 334, 940. 7. Lancaster, K. M., Roemelt, M., Ettenhuber, P., Hu, Y., Ribbe, M. W., Neese, F., Bergmann, U., and DeBeer, S. (2011) X-ray Emission Spectroscopy Evidences a Central Carbon in the Nitrogenase Iron-Molybdenum Cofactor, Science 334, 974- 977. 8. Gros, G., Wittenberg, B. A., and Jue, T. (2010) Myoglobin's old and new clothes: from molecular structure to function in living cells, J. Exp. Biol. 213, 2713-2725. 9. Safo, M. K., Ahmed, M. H., Ghatge, M. S., and Boyiri, T. (2011) Hemoglobin- ligand binding: understanding Hb function and allostery on atomic level, Biochim. Biophys. Acta 1814, 797-809. 10. Klug, A., and Rhodes, D. (1987) ‘Zinc fingers’: a novel protein motif for nucleic acid recognition, Trends Biochem. Sci. 12, 464-469. 11. Que, L. (1999) Physical Methods in Bioinorganic Chemistry: Spectroscopy and Magnetism, University Science Books, Sausalito.

12. Den Blaauwen, T., Van de Kamp, M., and Canters, G. W. (1991) Type I and II copper sites obtained by external addition of ligands to a His117Gly azurin mutant, J. Am. Chem. Soc. 113, 5050-5052. 13. Den Blaauwen, T., and Canters, G. W. (1993) Creation of type-1 and type-2 copper sites by addition of exogenous ligands to the Pseudomonas aeruginosa azurin His117Gly mutant, J. Am. Chem. Soc. 115, 1121. 14. Barrick, D. (1994) Replacement of the Proximal Ligand of Sperm Whale Myoglobin with Free Imidazole in the Mutant His-93.fwdarw.Gly, Biochemistry 33, 6546-6554. 15. DePillis, G. D., Decatur, S. M., Barrick, D., and Boxer, S. G. (1994) Functional cavities in proteins: A general method for proximal ligand substitution in myoglobin, J. Am. Chem. Soc. 116, 6981-6982. 16. McRee, D. E., Jensen, G. M., Fitzgerald, M. M., Siegel, H. A., and Goodin, D. B. (1994) Construction of a bisaquo heme enzyme and binding by exogenous ligands, Proc. Natl. Acad. Sci. U. S. A. 91, 12847-12851. 17. Pfister, T. D., Ohki, T., Ueno, T., Hara, I., Adachi, S., Makino, Y., Ueyama, N., Lu, Y., and Watanabe, Y. (2005) Monooxygenation of an Aromatic Ring by F43W/H64D/V68I Myoglobin Mutant and Hydrogen Peroxide, J. Biol. Chem. 280, 12858-12866. 18. Abe, S., Ueno, T., Reddy, P. A. N., Okazaki, S., Hikage, T., Suzuki, A., Yamane, T., Nakajima, H., and Watanabe, Y. (2007) Design and Structure Analysis of Artificial Metalloproteins: Selective Coordination of His64 to Copper Complexes with Square-Planar Structure in the apo-Myoglobin Scaffold, Inorg. Chem. 46, 5137. 19. Kent, S. B. H. (2009) Total chemical synthesis of proteins, Chem. Soc. Rev. 38, 338. 20. Hackenberger, C. P. R., and Schwarzer, D. (2008) Chemoselective ligation and modification strategies for peptides and proteins, Angew. Chem., Int. Ed. 47, 10030. 21. Dawson, P. E., Muir, T. W., Clark-Lewis, I., and Kent, S. B. H. (1994) Synthesis of proteins by native chemical ligation, Science 266, 776.

22. Low, D. W., and Hill, M. G. (2000) Backbone-Engineered High-Potential Iron Proteins: Effects of Active-Site Hydrogen Bonding on Reduction Potential, J. Am. Chem. Soc. 122, 11039. 23. Metanis, N., Keinan, E., and Dawson, P. E. (2010) Traceless ligation of cysteine peptides using selective deselenization, Angew. Chem., Int. Ed. 49, 7049. 24. Harpaz, Z., Siman, P., Kumar, K. S. A., and Brik, A. (2010) Protein Synthesis Assisted by Native Chemical Ligation at Leucine, ChemBioChem 11, 1232. 25. Thomas, G. L., and Payne, R. J. (2009) Phosphate-assisted peptide ligation, Chem. Commun. (Cambridge, U. K.), 4260. 26. Blanco-Canosa, J. B., and Dawson, P. E. (2008) An efficient Fmoc-SPPS approach for the generation of thioester peptide precursors for use in native chemical ligation, Angew. Chem., Int. Ed. 47, 6851. 27. Low, D. W., and Hill, M. G. (1998) Rational Fine-Tuning of the Redox Potentials in Chemically Synthesized Rubredoxins, J. Am. Chem. Soc. 120, 11536. 28. Low, D. W., Hill, M. G., Carrasco, M. R., Kent, S. B. H., and Botti, P. (2001) Total synthesis of cytochrome b562 by native chemical ligation using a removable auxiliary, Proc. Natl. Acad. Sci. U. S. A. 98, 6554. 29. Ayers, B., Blaschke, U. K., Camarero, J. A., Cotton, G. J., Holford, M., and Muir, T. W. (1999) Introduction of unnatural amino acids into proteins using expressed protein ligation, Biopolymers 51, 343. 30. Muir, T. W., Sondhi, D., and Cole, P. A. (1998) Expressed protein ligation: A general method for protein engineering, Proc. Natl. Acad. Sci. U. S. A. 95, 6705. 31. Evans, T. C., Jr., Benner, J., and Xu, M.-Q. (1998) Semisynthesis of cytotoxic proteins using a modified protein splicing element, Protein Sci. 7, 2256. 32. David, R., Richter, M. P. O., and Beck-Sickinger, A. G. (2004) Expressed protein ligation. Method and applications, Eur. J. Biochem. 271, 663. 33. Jantz, D., and Berg, J. M. (2003) Expanding the DNA-Recognition Repertoire for Zinc Finger Proteins beyond 20 Amino Acids, J. Am. Chem. Soc. 125, 4960. 34. Berry, S. M., Gieselman, M. D., Nilges, M. J., Van der Donk, W. A., and Lu, Y. (2002) An Engineered Azurin Variant Containing a Selenocysteine Copper Ligand, J. Am. Chem. Soc. 124, 2084.

35. Berry, S. M., Ralle, M., Low, D. W., Blackburn, N. J., and Lu, Y. (2003) Probing the Role of Axial Methionine in the Blue Copper Center of Azurin with Unnatural Amino Acids, J. Am. Chem. Soc. 125, 8760. 36. Garner, D. K., Vaughan, M. D., Hwang, H. J., Savelieff, M. G., Berry, S. M., Honek, J. F., and Lu, Y. (2006) Reduction Potential Tuning of the Blue Copper Center in Pseudomonas aeruginosa Azurin by the Axial Methionine as Probed by Unnatural Amino Acids, J. Am. Chem. Soc. 128, 15608. 37. Clark, K. M., Yu, Y., Marshall, N. M., Sieracki, N. A., Nilges, M. J., Blackburn, N. J., van der Donk, W. A., and Lu, Y. (2010) Transforming a Blue Copper into a Red Copper Protein: Engineering Cysteine and Homocysteine into the Axial Position of Azurin Using Site-Directed Mutagenesis and Expressed Protein Ligation, J. Am. Chem. Soc. 132, 10093. 38. Sarangi, R., Gorelsky, S. I., Basumallick, L., Hwang, H. J., Pratt, R. C., Stack, T. D. P., Lu, Y., Hodgson, K. O., Hedman, B., and Solomon, E. I. (2008) Spectroscopic and Density Functional Theory Studies of the Blue−Copper Site in M121SeM and C112SeC Azurin: Cu−Se Versus Cu−S Bonding, J. Am. Chem. Soc. 130, 3866-3877. 39. Ohno, M., Eastlake, A., Ontjes, D. A., and Anfinsen, C. B. (1969) Synthesis of the fully protected, carboxyl-terminal tetradecapeptide sequence of staphylococcal nuclease, J. Am. Chem. Soc. 91, 6842-6847. 40. Link, A. J., Mock, M. L., and Tirrell, D. A. (2003) Non-canonical amino acids in protein engineering, Curr. Opin. Biotechnol. 14, 603-609. 41. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. a., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins, Methods (San Diego, Calif.) 55, 370-378. 42. Blackburn, N. J., Ralle, M., Gomez, E., Hill, M. G., Pastuszyn, A., Sanders, D., and Fee, J. A. (1999) Selenomethionine-substituted Thermus thermophilus cytochrome ba3: characterization of the CuA site by Se and Cu K-EXAFS, Biochemistry 38, 7075-7084.

43. Chacón, K. N., and Blackburn, N. J. (2012) Stable Cu(II) and Cu(I) Mononuclear Intermediates in the Assembly of the CuA Center of Thermus thermophilus Cytochrome Oxidase, J. Am. Chem. Soc. 134, 16401-16412. 44. Cirino, P. C., Tang, Y., Takahashi, K., Tirrell, D. A., and Arnold, F. H. (2003) Global incorporation of norleucine in place of methionine in cytochrome P 450 BM-3 heme domain increases peroxygenase activity, Biotechnol. Bioeng. 83, 729. 45. Hecht, S. M., Alford, B. L., Kuroda, Y., and Kitano, S. (1978) "Chemical aminoacylation" of tRNA's, J. Biol. Chem. 253, 4517-4520. 46. Roesser, J. R., Xu, C., Payne, R. C., Surratt, C. K., and Hecht, S. M. (1989) Preparation of misacylated aminoacyl-tRNA(Phe)'s useful as probes of the ribosomal acceptor site, Biochemistry 28, 5185-5195. 47. Noren, C., Anthony-Cahill, S., Griffith, M., and Schultz, P. (1989) A general method for site-specific incorporation of unnatural amino acids into proteins, Science 244, 182-188. 48. Murakami, H., Saito, H., and Suga, H. (2003) A Versatile tRNA Aminoacylation Catalyst Based on RNA, Chem. Biol. 10, 655. 49. Ramaswamy, K., Saito, H., Murakami, H., Shiba, K., and Suga, H. (2004) Designer ribozymes: Programming the tRNA specificity into flexizyme, J. Am. Chem. Soc. 126, 11454-11455. 50. Ohuchi, M., Murakami, H., and Suga, H. (2007) The flexizyme system: a highly flexible tRNA aminoacylation tool for the translation apparatus, Curr. Opin. Chem. Biol. 11, 537-542. 51. Murakami, H., Hohsaka, T., Ashizuka, Y., Hashimoto, K., and Sisido, M. (2000) Site-directed incorporation of fluorescent nonnatural amino acids into streptavidin for highly sensitive detection of biotin, Biomacromolecules 1, 118-125. 52. Kohrer, C., Yoo, J. H., Bennett, M., Schaack, J., and RajBhandary, U. L. (2003) A possible approach to site-specific insertion of two different unnatural amino acids into proteins in mammalian cells via nonsense suppression, Chem. Biol. 10, 1095-1102.

53. Koh, J. T., Cornish, V. W., and Schultz, P. G. (1997) An experimental approach to evaluating the role of backbone interactions in proteins using unnatural amino acid mutagenesis, Biochemistry 36, 11314-11322. 54. Eisenhauer, B. M., and Hecht, S. M. (2002) Site-specific incorporation of (aminooxy)acetic acid into proteins, Biochemistry 41, 11472-11478. 55. Taki, M., Hohsaka, T., Murakami, H., Taira, K., and Sisido, M. (2001) A nonnatural amino acid for efficient incorporation into proteins as a sensitive fluorescent probe, FEBS Lett. 507, 35-38. 56. Taki, M., Hohsaka, T., Murakami, H., Taira, K., and Sisido, M. (2002) Position- specific incorporation of a fluorophore-quencher pair into a single streptavidin through orthogonal four-base codon/anticodon pairs, J. Am. Chem. Soc. 124, 14586-14590. 57. Kanamori, T., Nishikawa, S. I., Shin, I., Schultz, P. G., and Endo, T. (1997) Probing the environment along the protein import pathways in yeast mitochondria by site-specific photocrosslinking, Proc. Natl. Acad. Sci. U. S. A. 94, 485-490. 58. Liu, C. C., and Schultz, P. G. (2010) Adding new chemistries to the genetic code, Annu. Rev. Biochem. 79, 413. 59. Noren, C. J., Anthony-Cahill, S. J., Griffith, M. C., and Schultz, P. G. (1989) A general method for site-specific incorporation of unnatural amino acids into proteins, Science 244, 182. 60. Wang, L., Brock, A., Herberich, B., and Schultz, P. G. (2001) Expanding the genetic code of Escherichia coli, Science 292, 498. 61. Chin, J. W., Cropp, T. A., Anderson, J. C., Mukherji, M., Zhang, Z., and Schultz, P. G. (2003) An expanded eukaryotic genetic code, Science 301, 964. 62. Liu, W., Brock, A., Chen, S., Chen, S., and Schultz, P. G. (2007) Genetic incorporation of unnatural amino acids into proteins in mammalian cells, Nat. Methods 4, 239. 63. Greiss, S., and Chin, J. W. (2011) Expanding the Genetic Code of an Animal, J. Am. Chem. Soc. 133, 14196. 64. Wan, W., Huang, Y., Wang, Z., Russell, W. K., Pai, P.-J., Russell, D. H., and Liu, W. R. (2010) A facile system for genetic incorporation of two different

noncanonical amino acids into one protein in Escherichia coli, Angew. Chem., Int. Ed. 49, 3211. 65. Tippmann, E. M., and Schultz, P. G. (2007) A genetically encoded metallocene containing amino acid, Tetrahedron 63, 6182. 66. Lee, H. S., Spraggon, G., Schultz, P. G., and Wang, F. (2009) Genetic Incorporation of a Metal-Ion Chelating Amino Acid into Proteins as a Biophysical Probe, J. Am. Chem. Soc. 131, 2481. 67. Liu, X., Li, J., Hu, C., Zhou, Q., Zhang, W., Hu, M., Zhou, J., and Wang, J. (2013) Significant Expansion of the Fluorescent Protein Chromophore through the Genetic Incorporation of a Metal-Chelating Unnatural Amino Acid, Angew. Chem., Int. Ed. 52, 4805-4809. 68. Liu, X., Li, J., Dong, J., Hu, C., Gong, W., and Wang, J. (2012) Genetic Incorporation of a Metal-Chelating Amino Acid as a Probe for Protein Electron Transfer, Angew. Chem., Int. Ed. 51, 10261-10265. 69. Zhou, Q., Hu, M., Zhang, W., Jiang, L., Perrett, S., Zhou, J., and Wang, J. (2013) Probing the Function of the Tyr-Cys Cross-Link in Metalloenzymes by the Genetic Incorporation of 3-Methylthiotyrosine, Angew. Chem., Int. Ed. 52, 1203- 1207. 70. Mills, J. H., Khare, S. D., Bolduc, J. M., Forouhar, F., Mulligan, V. K., Lew, S., Seetharaman, J., Tong, L., Stoddard, B. L., and Baker, D. (2013) Computational design of an unnatural amino acid dependent metalloprotein with atomic level accuracy, J. Am. Chem. Soc. 135, 13393-13399.

Chapter 2 Incorporation of imiTyr in CuBMb to Mimic Post- Translational Modified His-Tyr Cross-Link for Better Oxidase Activity2

2.1 Introduction

Aerobic respiration is a process in which organic molecules are broken down and their energy is stored and eventually transferred to ATP. Heme-copper oxidases (HCOs) are the last enzyme in aerobic respiration chain and are crucial for energy metabolism and global oxygen cycle.1,2 HCOs accept electrons from upstream enzymes and reduce molecular oxygen to water. HCOs catalyze the reaction with remarkable speed (50- -1 ~1000 s )3,4 and accuracy. During this process, energy released upon O2 reduction is stored in the form of transmembrane proton gradient and is used later for ATP synthesis. Although there are other enzymes such as cytochrome bd oxidases5 and non-heme iron oxidases6 that can reduce oxygen to water, HCOs still account for 90% of biological O2 consumption on earth.7

HCOs are found in all aerobic organisms. They are in general multi-subunit membrane-bound proteins with multiple metal cofactors. HCOs from different organisms vary in number of subunits, type and number of metal cofactors, and electron donor.8 The catalytic site, containing a high-spin heme and a copper, thus named binuclear center, is conserved among different HCOs. As shown in Figure 2.1C, in the binuclear center the high-spin heme is coordinated by a proximal histidine while the copper, termed CuB, is coordinated by three histidines. One of the histidines is cross-linked to a nearby tyrosine, showing a rare post-translational modification.

His-Tyr cross-link was first revealed in high-resolution crystal structure of bovine cytochrome c oxidase, which showed that the ε-nitrogen of one of the Histidine in CuB site forms covalent linkage with C6 of a conserved tyrosine in the same helix.9-11 As more crystal structures of HCOs from different organisms were solved, the His-Tyr

2 Portions of this chapter are previously published and are here reproduced with permission from John Wiley and Sons for X. Liu, Y. Yu, C. Hu, W. Zhang, Y. Lu and J. Wang, Angew. Chem., Int. Ed., 2012, 51, 4312-4316. 17 cross-link was found to exist universally in HCOs including those from Paracoccus denitrificans aa3 oxidase12,13, Thermococcus thermophilius ba3 oxidase14, cbb3 oxidases from Vibrio cholera15 and Rhodobacter sphaeroides16. Besides X-ray crystallography, other techniques including tryptic digest coupled to mass spec and infra-red spectroscopy have verified the existence of the cross-link between His and Tyr. 17-19

A B C

Figure 2.1 Crystal structure of cytochrome c oxidase. A) Holo enzyme showing all 13 subunits in different color. B) Holo enzyme with metal cofactors including CuA, heme a and binuclear site highlighted. C) Binuclear site with ligands. PDB ID: 1OCC.11

Although the existence of His-Tyr cross-link is firmly established, its role in O2 reduction reaction is still elusive. It has been proposed that the cross-link could structurally position His for optimal geometry, or alter pKa of Tyr to accelerate electron transfer.16,17,20,21 To probe the role of the cross-link in native protein, Rousseau, Gennis and coworkers have mutated Tyr to Phe in R. sphaeroides. This mutant was designed to prevent the formation of His-Tyr crosslink, however, it resulted in an inactive enzyme, probably due to disruption of the active site.22 Varotsis and coworkers mutated Tyr to

His in P. denitrificans. Although the mutant retains O2 binding ability, the oxygenated species decays to resting form.23 Both work suggest either the cross-link, or Tyr alone, is crucial for reactivity. Besides studies in the native protein system, small molecule analogs of His-Tyr cross-link have been synthesized, spectroscopically characterized, and studied by theoretical calculation.20,23,24 Recently, a model complex has been make with three imidazole rings and a phenol around the site. This complex has shown oxidase activity when attached to electrode surface.25 Further modification of the system

18 has enabled O2 reduction to water in homogenous solution using native reduction partner cytochrome c with a rate greater than 0.1 s-1.26

Our lab has been using a simple heme protein, myoglobin, to mimic the binuclear site of heme-copper oxidases. Through introduction of two histidines by Leu29His and

Phe43His mutations, Sigman et al. were able to construct CuB site in myoglobin, so called CuB Mb.27,28 This protein could bind a single copper at CuB site28-30 but it can only perform heme oxygenation, unlike oxygen reduction to water performed by HCOs.31,32

By introducing an additional tyrosine mutation to CuBMb, Miner et al. were able to obtain a functional HCO mimic.33 He has shown that even without cross-link or copper ion,

F33Y CuB Mb showed oxidase activity, mimicking the native enzyme.33

To explore the role of cross-link in HCO, we decided to take advantage of the functional HCO model we developed.28,33-36 By incorporating the cross-link into myoglobin, we can compare activity of our model with and without cross-link. Dr. Ningyan Wang proposed that an unnatural amino acid which mimics the cross-linked

Tyr-His can be introduced into CuBMb37 using Native Chemical Ligation.38,39 This method, however, was discontinued due to technical difficulties. As an alternative to chemical ligation, amber suppression with orthogonal tRNA/aminoacyl tRNA synthetase has been developed to incorporate the unnatural amino acid in a site specific, high efficient fashion.40-42 In collaboration with Professor Jiangyun Wang from Institute of Biophysics, CAS, we incorporated imiTyr into myoglobin model of HCO and tested its activity.

Figure 2.2 A) Binuclear center of bovine CcO. PDB ID: 1OCC. B) Overlay of crystal structure of

F33Y-CuBMb (yellow, PDB ID: 4FWX) and computer model of imiTyr-CuBMb (cyan). C) Structure of His-Tyr cross-link analogue amino acid, imiTyr.

2.2 Materials and Methods

All materials mentioned here are purchased from either Sigma or Fischer unless otherwise stated.

To express mutant myoglobin protein imiTyr-CuBMb, pBAD-JYAMB-His29TAG33 plasmid was co-transformed with pBK-imiTyrRS into GeneHog®-Fis or TOP10 (Invitrogen) E. coli competent cells. Cells were amplified in LB media (5 mL) supplemented with kanamycin (50 g/mL) and tetracycline (15 g/mL). Starter culture (1 mL) was used to inoculate 100 mL of liquid LB supplemented with appropriate antibiotics and 1 mM imiTyr. Cells were then grown at 37C to OD600 of 0.5 and protein expression was induced by addition of 0.2% arabinose. After 12 hours of growth at 37C, cells were harvested by centrifugation. Wild type or mutant myoglobin was then purified by Ni-NTA affinity chromatography under native condition, and further purified by size exclusion chromatography.28 The identity and purity of the protein was verified by ESI- MS. (Calculated: 18460, observed: 18462)

Oxygen consumption was measured by using an Oxygraph Clark-type oxygen electrode (Hansatech Instruments) at 25°C in 20 mM 2-Amino-2-hydroxymethyl- propane-1, 3-diol (Tris) buffer, pH 7.4. All experiments were performed in three replicates to obtain standard deviation. The electrode was calibrated against air- saturated buffer and O2-depleted buffer prior to use. Protein was exchanged to 20 mM Tris, pH7.4. The buffer was treated with chelex beads overnight before use. The final 2+ concentration of protein was adjusted to 6 μM. For experiment with Cu , CuSO4 was added to a final concentration of 6 μM and stirred for 10 min. For experiment with catalase, catalase (Sigma-Aldrich) was added to final concentration of 7.3 U/μL. The reaction is initiated by adding N,N,N',N'-Tetramethyl-p-Phenylenediamine (TMPD) and ascorbic acid to final concentrations of 0.6 mM and 6 mM, respectively. Oxygen concentration was monitored immediately after adding reductant. O2 consumption towards H2O2 production was calculated using the equation below:

푘푅푂푆 = 2 × (푘푛표−푐푎푡푎푙푎푠푒 − 푘푐푎푡푎푙푎푠푒)

O2 consumption towards water production was calculated by subtracting rate toward H2O2 formation from total rate.

푘퐻2푂 = 푘푛표−푐푎푡푎푙푎푠푒 − 푘푅푂푆

For turnover experiments, the chamber was vented with pure O2 to boost O2 concentration to 800 μM after exhaustion of O2 in the reaction. Other steps were performed similar to above mentioned method. Ascorbic acid was added to maintain the concentration at 6 mM.

Molecular dynamics simulation was carried out using VMD/NAMD software package with CHARMM force field.43 The topology of ImiTyr unnatural amino acid was built according to Tyr-His cross-linking in native CcO structure. 10 The parameters were built empirically with reference to indole, purine and other well-parameterized biomolecule.

2.3 Results and Discussion

2.3.1 Molecular dynamics simulation of mutants with imiTyr

To construct a protein that is well folded and functional, there are two points to consider. First, there should be enough room to accommodate the bulk side chain of imiTyr. Second, the hanging imidazolyl ring should still be able to form CuB site with the other two histidines. Structure of F33Y-CuBMb showed that Phe33 is a good choice due to its desired orientation.33 To accommodate imiTyr while keeping three histidine/imidazole ligands at CuB site, His43 need to be mutated to either leucine or alanine. Leucine is the native residue in WT Mb so it should provide better stability, and alanine has a small side chain to make room for bulky side chain group of imiTyr. (Figure 2.3)

Molecular dynamics simulation was performed to access the effects of mutations.

After 5ps of simulation, the CuB center of both Phe33imiTyr/His43Leu and

Phe33imiTyr/His43Ala CuBMb resemble the CuB in native HCO site, as shown in Table 2.1. In order to get better protein expression, His43Leu mutation was used as leucine is the native amino acid in myoglobin.

Table 2.1 Distance (in Å) between Copper ion and N on imidazole ring, measured from MD simulated structure.

CcO CuB Mb F33imiTyrH43L CuBMb F33imiTyrH43A CuBMb

Cu-N1(29) 2.194 2.801 2.225 2.133

Cu-N2(43) 1.921 3.154 2.177 2.094

Cu-N3(64) 1.914 4.023 2.107 2.099

Figure 2.3 Structure of L29H/F33ImTyrF43A Mb after 5ps of equilibration, showing CuB center with side chain of imiTyr and two histidines, and heme.

2.3.2 Oxidase activity

Initial expression, purification and characterization of imiTyr CuBMb (L29HF33imiTyr myoglobin) was carried out in Professor Jiangyun Wang’s lab. They found out the protein was expressed with 5mg/L yield from inclusion body.44 UV-vis spectrum of this protein is similar to that of WT myoglobin and CuBMb, indicating proper heme incorporation and protein folding.

Since the hallmark of native HCOs is the clean catalytic reduction of O2 to water without releasing ROS, we then measured the rate at which imiTyr-CuBMb catalyzes oxygen reduction by using an O2 electrode in the presence of 1000 equivalents of ascorbic acid as the reductant and 100 equivalents of TMPD as a redox mediator. Similar method was previous used to measure enzymatic activity of native HCO.3 To differentiate between H2O2 and water production, we employed catalase, as reported by

Miner et al.,33 which selectively reacts with H2O2 to produce O2. By comparing the rates of reduction in the absence and presence of catalase, the portion of O2 conversion to water (in blue) and to H2O2 (in red) can be calculated (Figure 2.4). Similarly, addition of superoxide dismutase (SOD) can allow us to find the contribution of superoxide

23 formation. Addition of SOD did not make observable difference in O2 reduction. (Data not shown.) Not surprisingly, most of the O2 consumed by WT Mb converted to H2O2, 2+ both in the presence and absence of Cu . By contrast, imiTyr-CuBMb catalyzed O2 2+ reduction with generating less than 6% H2O2 in the presence of 1 Eq. Cu . In the 2+ absence of Cu , however, more than 30% of O2 was converted to H2O2, indicating that

CuB is important for the catalytic turnover of O2 into H2O.

Table 2.2 Rate of O2 reduction toward production of H2O and H2O2 for WT Mb, F33YCuBMb, or imiTyr-CuBMb.

WT WT F33Y- F33Y- imiTyr- imiTyr-CuB

Mb Mb+Cu CuBMb CuBMb+Cu CuB Mb Mb+Cu O2 consumption 0.52 0.32 0.56 0.25 1.83 2.07 -1 toward H2O (min ) O2 consumption 1.93 2.60 0.53 1.07 0.79 0.13 -1 toward H2O2 (min )

Fraction toward H2O 0.21 0.11 0.51 0.19 0.70 0.94 production

Standard deviation to 0.32 1.16 0.22 0.25 0.44 0.63 -1 H2O (min ) Standard deviation to 0.35 1.29 0.24 0.26 0.47 0.70 -1 H2O2 (min )

Figure 2.4 (A) Rates of oxygen reduction to form either water (blue) or H2O2 (red) catalyzed by 6

2+ μM WT Mb, F33YCuBMb, or imiTyr-CuBMb, in the presence or absence of 6 μM of Cu , with

0.6 mM TMPD and 6 mM ascorbic acid as reductants. (B) O2 reduction turnover number catalyzed by imiTyr-CuBMb or F33Y-CuBMb

The myoglobin system described here provides a unique opportunity to compare directly the effect of His and Tyr with and without the cross-link. To take advantage this unique feature, we also measured O2 consumption for the

Leu29His/Phe33Tyr/Phe43His myoglobin mutant (F33Y-CuBMb).33 This mutant harbors a CuB site consisting of residues His29, His43 and His64, as we have shown previously,28 and a Tyr residue in position 33. This Tyr however doesn’t form the cross- link. Not only the overall activity of the F33YCuBMb was less (~40%) than imiTyr-CuBMb, 2+ but also more than 50% of O2 was converted to H2O2 regardless of Cu addition,

25 confirming that the cross-linked Tyr-His ligand plays a critical role in selective reduction of O2 into H2O.

To test if imiTyr-CuBMb is a robust O2 reduction catalyst, capable of performing several turnovers without self-destruction, we then measured O2 consumption under multiple turnover conditions. To a solution containing 6 M imiTyr-CuBMb, 6 M CuSO4 and 800 μM O2, 0.6 mM TMPD and 6 mM ascorbic acid were added. O2 reduction was then monitored by using an oxygen electrode until all the oxygen was consumed.

Subsequently, a further addition of 800 M O2 was carried out by purging the solution with pure oxygen, and oxygen reduction was again measured until all the oxygen was reduced. These stepwise additions resulted in the multiple plateaus observed in the O2 reduction traces (Figure 2.4B), and were repeated until imiTyr-CuBMb achieved over 1100 turnovers (Figure 2.4B). The turnover number reported here is an underestimate as the extra turnovers occurring during oxygen addition were not included in the calculation. Notably, little decrease in O2 consumption rate was observed after the catalyst reached 1000 turnovers, indicating that up to this point the imiTyr-CuBMb catalyst remained intact. By contrast, F33Y-CuBMb underwent less than 400 turnovers under similar conditions. These results again support that the cross-linked Tyr-His ligand is required for optimal O2 reduction to H2O.

2.4 Summary

In conclusion, by directly incorporating the unnatural amino acid imiTyr on top of myoglobin model of HCO using amber suppression method, we have successfully designed a functional oxidase which catalyzes selective and efficient oxygen reduction to water. More importantly, we have shown that the cross-linked His-Tyr is ~ 2.5 fold more efficient with ~ 3 fold more turnovers than the non-cross-linked His Tyr at the same position in the same protein.

Although imiTyr-CuBMb is a good functional mimic of HCO, little is known about structure of the protein. X-ray absorption spectroscopy could elucidate the metal site structure.

Reaction mechanism of native HCO is well studied by rapid spectroscopy techniques.7,45 However, role of active site Tyr during reaction remains elusive. Building upon the protein model of HCO, we will further explore such question with unnatural amino acids, as demonstrated in Chapter 3.

-1 Turnover frequency of imiTyr-CuBMb is at 0.0087 s , only 0.02% of slowest native HCO reported.4 To improve the activity of our protein model, I explored the role of active site residue (Tyr33) and electron transfer to the active site in Chapter 3 and Chapter 4, respectively.

2.5 References

1. Wikstrom, M., and Morgan, J. E. (1992) The dioxygen cycle. Spectral, kinetic, and thermodynamic characteristics of ferryl and peroxy intermediates observed by reversal of the cytochrome oxidase reaction, J. Biol. Chem. 267, 10266-10273. 2. Babcock, G. T., and Wikstrom, M. (1992) Oxygen activation and the conservation of energy in cell respiration, Nature 356, 301-309. 3. Pawate, A. S., Morgan, J., Namslauer, A., Mills, D., Brzezinski, P., Ferguson- Miller, S., and Gennis, R. B. (2002) A mutation in subunit I of cytochrome oxidase from Rhodobacter sphaeroides results in an increase in steady-state activity but completely eliminates proton pumping, Biochemistry 41, 13417-13423. 4. Lee, H. J., Gennis, R. B., and Ädelroth, P. (2011) Entrance of the proton pathway in cbb3-type heme-copper oxidases, Proceedings of the National Academy of Sciences. 5. Borisov, V. B., Gennis, R. B., Hemp, J., and Verkhovsky, M. I. (2011) The cytochrome bd respiratory oxygen reductases, Biochim. Biophys. Acta 1807, 1398-1413. 6. Moore, A. L., Carre, J. E., Affourtit, C., Albury, M. S., Crichton, P. G., Kita, K., and Heathcote, P. (2008) Compelling EPR evidence that the alternative oxidase is a diiron carboxylate protein, Biochim. Biophys. Acta 1777, 327-330. 7. Wikstrom, M. (2012) Active site intermediates in the reduction of O(2) by cytochrome oxidase, and their derivatives, Biochim. Biophys. Acta 1817, 468-475.

8. Blanca, J. A. G.-h., Jon, B., Ma, J., and Gennis, R. B. (1994) MINIREVIEW The Superfamily of Heme-Copper Respiratory Oxidases, J. Bacteriol. 176, 5587-5600. 9. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R., and Yoshikawa, S. (1995) Structures of metal sites of oxidized bovine heart cytochrome c oxidase at 2.8 A, Science 269, 1069-1074. 10. Yoshikawa, S. (1998) Redox-Coupled Crystal Structural Changes in Bovine Heart Cytochrome c Oxidase, Science 280, 1723-1729. 11. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R., and Yoshikawa, S. (1996) The whole structure of the 13-subunit oxidized cytochrome c oxidase at 2.8 A, Science 272, 1136-1144. 12. Iwata, S., Ostermeier, C., Ludwig, B., and Michel, H. (1995) Structure at 2.8 A resolution of cytochrome c oxidase from Paracoccus denitrificans, Nature 376, 660-669. 13. Ostermeier, C., Harrenga, A., Ermler, U., and Michel, H. (1997) Structure at 2.7 A resolution of the Paracoccus denitrificans two-subunit cytochrome c oxidase complexed with an antibody FV fragment, Proc. Natl. Acad. Sci. U. S. A. 94, 10547-10553. 14. Soulimane, T., Buse, G., Bourenkov, G. P., Bartunik, H. D., Huber, R., and Than, M. E. (2000) Structure and mechanism of the aberrant ba(3)-cytochrome c oxidase from thermus thermophilus, EMBO J. 19, 1766-1776. 15. Hemp, J., Christian, C., Barquera, B., Gennis, R. B., and Martinez, T. J. (2005) Helix switching of a key active-site residue in the cytochrome cbb3 oxidases, Biochemistry 44, 10766-10775. 16. Rauhamaki, V., Baumann, M., Soliymani, R., Puustinen, A., and Wikstrom, M. (2006) Identification of a histidine-tyrosine cross-link in the active site of the cbb3-type cytochrome c oxidase from Rhodobacter sphaeroides, Proc. Natl. Acad. Sci. U. S. A. 103, 16135-16140. 17. Tomson, F., Bailey, J. A., Gennis, R. B., Unkefer, C. J., Li, Z., Silks, L. A., Martinez, R. A., Donohoe, R. J., Dyer, R. B., and Woodruff, W. H. (2002) Direct

infrared detection of the covalently ring linked His-Tyr structure in the active site of the heme-copper oxidases, Biochemistry 41, 14383-14390. 18. Mather, M. W., Springer, P., Hensel, S., Buse, G., and Fee, J. a. (1993) Cytochrome oxidase genes from Thermus thermophilus. Nucleotide sequence of the fused gene and analysis of the deduced primary structures for subunits I and III of cytochrome caa3, J. Biol. Chem. 268, 5395-5408. 19. Hemp, J., Robinson, D. E., Ganesan, K. B., Martinez, T. J., Kelleher, N. L., and Gennis, R. B. (2006) Evolutionary migration of a post-translationally modified active-site residue in the proton-pumping heme-copper oxygen reductases, Biochemistry 45, 15405-15410. 20. McCauley, K. M., Vrtis, J. M., Dupont, J., and van der Donk, W. A. (2000) Insights into the Functional Role of the Tyrosine-Histidine Linkage in Cytochrome c Oxidase, J. Am. Chem. Soc. 122, 2403-2404. 21. Blomberg, M. R., Siegbahn, P. E., and Wikstrom, M. (2003) Metal-bridging mechanism for O-O bond cleavage in cytochrome C oxidase, Inorg. Chem. 42, 5231-5243. 22. Das, T. K., Pecoraro, C., Tomson, F. L., Gennis, R. B., and Rousseau, D. L. (1998) The Post-Translational Modification in Cytochrome c Oxidase Is Required To Establish a Functional Environment of the Catalytic Siteâ€ Biochemistry 37, 14471-14476. 23. Pinakoulaki, E., Pfitzner, U., Ludwig, B., and Varotsis, C. (2002) The role of the cross-link His-Tyr in the functional properties of the binuclear center in cytochrome c oxidase, J. Biol. Chem. 277, 13563-13568. 24. Cappuccio, J. a., Ayala, I., Elliott, G. I., Szundi, I., Lewis, J., Konopelski, J. P., Barry, B. a., and Einarsdóttir, O. (2002) Modeling the active site of cytochrome oxidase: synthesis and characterization of a cross-linked histidine-phenol, J. Am. Chem. Soc. 124, 1750-1760. 25. Collman, J. P., Devaraj, N. K., Decréau, R. a., Yang, Y., Yan, Y.-L., Ebina, W., Eberspacher, T. a., and Chidsey, C. E. D. (2007) A cytochrome C oxidase model catalyzes oxygen to water reduction under rate-limiting electron flux, Science 315, 1565-1568.

26. Collman, J. P., Ghosh, S., and Dey, A. (2009) Catalytic reduction of O2 by cytochrome c using a synthetic model of cytochrome c oxidase, J. Am. Chem. Soc. 131, 5034-5035. 27. Wang, N., Zhao, X., and Lu, Y. (2005) Role of Heme Types in Heme-Copper Oxidases: Effects of Replacing a Heme b with a Heme o Mimic in an Engineered Heme-Copper Center in Myoglobin, J. Am. Chem. Soc. 127, 16541-16547. 28. Sigman, J. a., Kwok, B. C., and Lu, Y. (2000) From Myoglobin to Heme-Copper Oxidase: Design and Engineering of a Cu B Center into Sperm Whale Myoglobin, J. Am. Chem. Soc. 122, 8192-8196. 29. Zhao, X., Yeung, N., Wang, Z., Guo, Z., and Lu, Y. (2005) Effects of Metal Ions in the CuB Center on the Redox Properties of Heme in Heme-Copper Oxidases: Spectroelectrochemical Studies of an Engineered Heme-Copper Center in Myoglobin†, Biochemistry 44, 1210-1214. 30. Zhao, X., Nilges, M. J., and Lu, Y. (2005) Redox-Dependent Structural Changes in an Engineered Heme−Copper Center in Myoglobin: Insights into Chloride Binding to CuB in Heme Copper Oxidases†, Biochemistry 44, 6559-6564. 31. Sigman, J. a., Wang, X., and Lu, Y. (2001) Coupled Oxidation of Heme by Myoglobin Is Mediated by Exogenous Peroxide, J. Am. Chem. Soc. 123, 6945- 6946. 32. Sigman, J. A., Kim, H. K., Zhao, X., Carey, J. R., and Lu, Y. (2003) The role of copper and protons in heme-copper oxidases: Kinetic study of an engineered heme-copper center in myoglobin, Proc. Natl. Acad. Sci. U. S. A. 100, 3629-3634. 33. Miner, K. D., Mukherjee, A., Gao, Y. G., Null, E. L., Petrik, I. D., Zhao, X., Yeung, N., Robinson, H., and Lu, Y. (2012) A Designed Functional Metalloenzyme that Reduces O2 to H2O with Over One Thousand Turnovers, Angew. Chem., Int. Ed. 51, 5589-5592. 34. Lu, Y., Chakraborty, S., Miner, K. D., Wilson, T. D., Mukherjee, A., Yu, Y., Liu, J., and Marshall, N. M. (2013) 3.19 - Metalloprotein Design, In Comprehensive Inorganic Chemistry II (Second Edition) (Reedijk, J., and Poeppelmeier, K., Eds.), pp 565-593, Elsevier, Amsterdam.

35. Marshall, N. M., Miner, K. D., Wilson, T. D., and Lu, Y. (2013) Rational Design of Protein Cages for Alternative Enzymatic Functions, In Coordination Chemistry in Protein Cages, pp 111-147, John Wiley & Sons, Inc. 36. Yeung, N., Lin, Y.-W., Gao, Y.-G., Zhao, X., Russell, B. S., Lei, L., Miner, K. D., Robinson, H., and Lu, Y. (2009) Rational design of a structural and functional nitric oxide reductase, Nature (London, U. K.) 462, 1079-1082. 37. Wang, N. (2007) Exploring the Roles of Heme Type and Histidine-Tyrosine Cross-link in Heme-copper Oxidases Using a Myoglobin Model, In Department of biochemistry, p 129, University of Illinois at Urbana-Champaign, Urbana. 38. Dawson, P. E., Muir, T. W., Clark-Lewis, I., and Kent, S. B. H. (1994) Synthesis of proteins by native chemical ligation, Science 266, 776. 39. Dawson, P. E., Churchill, M. J., Ghadiri, M. R., and Kent, S. B. H. (1997) Modulation of reactivity in native chemical ligation through the use of thiol additives, J. Am. Chem. Soc. 119, 4325-4329. 40. Wang, L., Brock, A., Herberich, B., and Schultz, P. G. (2001) Expanding the genetic code of Escherichia coli, Science 292, 498. 41. Liu, C. C., and Schultz, P. G. (2010) Adding new chemistries to the genetic code, Annu. Rev. Biochem. 79, 413. 42. Young, T. S., and Schultz, P. G. (2010) Beyond the canonical 20 amino acids: expanding the genetic lexicon, J. Biol. Chem. 285, 11039-11044. 43. Phillips, J. C., Braun, R., Wang, W., Gumbart, J., Tajkhorshid, E., Villa, E., Chipot, C., Skeel, R. D., Kalé, L., and Schulten, K. (2005) Scalable molecular dynamics with NAMD, J. Comput. Chem. 26, 1781-1802. 44. Liu, X., Yu, Y., Hu, C., Zhang, W., Lu, Y., and Wang, J. (2012) Significant Increase of Oxidase Activity through the Genetic Incorporation of a Tyrosine- Histidine Cross-Link in a Myoglobin Model of Heme-Copper Oxidase, Angew. Chem., Int. Ed. 51, 4312-4316. 45. Brzezinski, P., and Gennis, R. B. (2008) Cytochrome c oxidase: exciting progress and remaining mysteries, J. Bioenerg. Biomembr. 40, 521-531.

Chapter 3 Tyrosine as Proton-Coupled Electron Transfer Center in Functional Heme-Copper Oxidase3

3.1 Introduction

Metal cofactors and redox-active amino acids are often involved in biological electron transfer. Concurrent with electron transfer, tyrosine is able to transfer proton, working as proton-coupled electron transfer center in water oxidation1-3, ribonucleotide reduction,4,5 and in engineered electron transfer process6,7.

The opposite process of water oxidation, oxygen reduction happens in CuB site of heme-copper oxidase. Besides heme and copper, a conserved tyrosine also present in the site. Although reaction mechanism of HCO is not fully elucidated, prevailing hypothesis suggests that the oxygen reduction process involves in a concerted four electron reduction of molecular oxygen.8 During this step, active site tyrosine is proposed to donate one proton and one electron before converting to tyrosyl radical, forming PH or PM intermediate.9,10 Yu et al. have utilized rapid freeze quench EPR to study radical generated during O2 reduction reaction. The radical they observed was assigned to reductant such as ascorbic acid and dithionite.11 Proshlyakov et al. have used iodine to trap the radical and map it to active site tyrosine in HCO, proven a radical is transiently formed.12 H2O2 has been used to get P intermediate as an alternative route to have reduced enzyme react with O2. Radical signal generated through this process has been observed, but its identity and location are under controversy.13-17 Recently, Yu et al. have used high field EPR to resolve two Tyr radical signals, one of which is from active site Tyr.8

Model complexes and small protein mimics have been developed by different groups to better understand HCO.18-20 In particular, our group has engineered myoglobin into functional HCO by mimicking structure features of native enzyme.21-23 After addition of tyrosine to active site (33 position in swMb), a previously inactive

3 Portions of this chapter are previously published and are here reproduced with permission from American Chemical Society Yu, Y.; Mukherjee, A.; Nilges, M. J.; Hosseinzadeh, P.; Miner, K. D.; Lu, Y. J. Am. Chem. Soc. 2014. 32 version of myoglobin (CuBMb) exhibits oxidase activity.22 The essential role of Tyr in HCO model indicates involvement of tyrosine in oxygen reduction reaction. To better understand role of tyrosine in the reaction, I investigated tyrosyl radical formation in reaction with hydrogen peroxide and oxygen. Our experiment reveals that active site tyrosine forms radical in our engineered myoglobin, which shed light into the reaction mechanism of engineered protein and native HCO.

Furthermore, as active site Tyr in HCO is proposed to donate an electron and a proton during oxidase reaction, the His-Tyr cross-link is proposed to tune the activity through changing properties of Tyr.24 I explored how pKa and reduction potential of active site Tyr in our protein model affect oxidase activity by incorporation of a series of unnatural amino acids.

3.2 Materials and Methods

3.2.1 General

3, 5-F2Tyr was synthesized as described before.25 3-ClTyr and β,β-D2-3-ClTyr was synthesized from Tyr and β,β-D2-Tyr as described before.26 F33Y-CuBMb was recombinantly expressed and purified from E. coli as described before.22 Myoglobin with unnatural amino acids were expressed in E. coli and purified by affinity chromatography as described before.23

ESI-MS was performed at mass spectrometry lab of School of Chemical Sciences and protein sciences facility at Carver center for Biotechnology at University of Illinois.

3.2.2 UV-vis and EPR spectroscopic studies

UV-vis spectra were taken on an HP diode array spectrometer or a Cary 5000 spectrometer.

Before react with hydrogen peroxide, protein was exchanged to 100mM potassium phosphate buffer at pH7 by a short Sephadex G-25 column and 20 % (v/v) of glycerol was added. The final concentration of protein was 250μM. One equivalent of

33 hydrogen peroxide was added into protein solution and the solution was hand-mixed before quenching in liquid nitrogen at 30 s.

Before react with oxygen, F33Y-CuBMb was reduced in glove bag by sodium dithionite. Excess dithionite was removed by a short Sephadex G-25 column. Ferrous

F33Y-CuBMb and oxygenated potassium phosphate buffer with 10% glycerol were subsequently mixed and freeze quenched in cold isopentane (-120 °C) and packed into an EPR tube. The estimated reaction time is 20 ms. Standard solution of TEMPO were prepared from solid under Ar flow. EPR spectra of TEMPO were recorded under same condition and used for spin counting.

X-band EPR spectra were collected on a Varian E-122 spectrometer at the Illinois EPR Research Center (IERC). The samples were run at ∼30 K using liquid He and an Air Products Helitran cryostat. Magnetic fields were calibrated with a Varian NMR gauss meter, and the frequencies were measured with an EIP frequency counter. EPR spectra were simulated using SIMPOW6.27 Typical X-band EPR parameters for radical signal were as followed: microwave frequency, 9.05 GHz; power, 2mW; modulation amplitude, 4 G; time constant, 32ms; scan time, 60s; number of scan averaged, 10 to 30. For both heme and radical signal, typical parameters were as followed: microwave frequency, 9.05 GHz; power, 5 mW; modulation amplitude, 10 G; time constant, 32ms; scan time, 60s; number of scan averaged, 5. Q-band EPR spectra were collected on a Bruker ElexSys E-580 spectrometer equipped with an ER 5106 QT probe.

EPR spectra of various power were recorded to determine power saturation properties of tyrosyl radical. The data were fitted with the equation28:

2/푏 푏/2 푆 = 푘 × √푃/[1 + (2 − 1)(푃/푃1/2)]

In the equation, S is the signal strength integrated from EPR spectra; k is a constant depends on experiment setup; P is the microwave power; P1/2 is the microwave power where the first-derivative amplitude is reduced to one-half of its unsaturated value; b is the relaxation factor where b equals to 1 for inhomogeneous line broadening and b equals to 3 for homogeneous line broadening. 34

3.3 Results and Discussion

3.3.1 Tyrosyl radical formed in F33Y-CuBMb after H2O2 treatment

The F33Y-CuBMb was expressed and purified as previously described.22 The 2+ protein contains no Cu at CuB site as previously we failed observe any influence of 2+ Cu on O2 reduction in CuBMb mutants.22 In X-band EPR spectrum, it displays a high spin heme signal, typical of water bounded ferric myoglobin (Figure 3.1). Upon reaction with one equivalent of H2O2 for 30 s when the reaction was stopped by flash freezing in liquid N2, the high spin heme signal decreased by 80% and a g≈2 signal grew in, accounting for 54% of the total protein concentration (Figure 3.2 and Table 3.1). To further characterize the g ≈ 2 signal, an EPR spectrum was collected in this region using smaller modulation at 2 Gauss. Under such condition, Dr. Arnab Mukherjee first observed an exquisite hyperfine structure and I further optimized condition to repeat the experiment. (Figure 3.4a) The radical is similar to that of tyrosyl radical reported in heme-copper oxidase14 and ribonucleotide reductase.25,29,30 Such signal was not observed in WT Mb or CuBMb under same treatment. (Figure 3.3) Although radical formation in Mb has been extensively studied31-34, with low concentration of H2O2 (1 equivalence or 0.25 mM), no radical formation was observed in WT Mb. CuBMb displayed a radical with peak-to peak width of 25 Gauss and unresolved hyperfine even without H2O2 treatment. The formation of radical could be due to mixing with glycerol, the glassing agent, as upon mixing with glycerol, the protein turned red, which is not seen in WT Mb or F33Y-CuBMb. The radical from CuBMb grew larger after H2O2 treatment.

Figure 3.1 A radical generated after F33Y-CuBMb reacted with H2O2. Black: F33Y-CuBMb without reaction; red: F33Y-CuBMb reacted with 1Eq of H2O2.

300

250

200

150 Standard Estimated 100

0 0 0.05 0.1 0.15 0.2

Figure 3.2 Spin quantification using TEMPO.

Table 3.1 Spin quantification using TEMPO.

Labeled Concentration/mM Actual Conc./mM Gain Area Area/Gain

1 0.903 400 6.17E+05 1542

0.2 0.181 2000 5.41E+05 271

0.1 0.090 4000 4.74E+05 119

0.05 0.045 8000 4.60E+05 58

0.025 0.023 12500 4.75E+05 38

F33Y-CuBMb+H2O2 0.108 4000 6.26E+05 156

F33Y-CuBMb+O2 freeze quenched 0.015 12500 2.29E+05 18

Figure 3.3 X-band EPR spectra of WT Mb, CuBMb and F33Y-CuBMb in absence (black line) and in presence (red line) of 1 Eq. H2O2. A) and D) are WT Mb; B) and E) are CuBMb; C) and F) are

F33Y-CuBMb. Top lane are spectra taken over 5000 Gauss. Experiment parameters: frequency: 9.05 GHz; power: 5 mW; gain: 2000; temperature: 30K; modulation: 10 Gauss. In bottom lane are spectra taken over 150 Gauss. Experiment parameters: frequency: 9.05 GHz; power: 2 mW; gain: 4000-12500; temperature: 30K; modulation: 4 Gauss.

Besides tyrosine, another redox active amino acid, tryptophan, could also generate a radical with similar shape in X-band EPR.29,35-37 To further explore the identity of the radical, we collected Q-band EPR spectrum of the same sample (Figure 3.4b). Dr. Mark Nilges performed simulation27 of both X- and Q-band spectra to extract g-values and hyperfine coupling constants (Figure 3.5, Figure 3.6 and Table 3.3).

Simulation of the X- and Q-band spectra from H2O2-reacted F33Y-CuBMb (Figure 3.4 and Figure 3.5) revealed two species. One species has well-resolved hyperfine structure and can be simulated as a radical split by four nuclei, presumably from 3, 5-1H and two β-1Hs of a tyrosine. The simulated g values of the first species, showing anisotropy as gx > gy > gz ≈ 2.0023, is typical of tyrosyl radicals but unlike the nearly

38 isotropic tryptophan radicals.29,30,38 The hyperfine coupling constants of this species are also very similar to those of a tyrosyl radical from ribonucleotide reductase (RNR) from E. coli (Table 3.2).29,30,38 The yield of pure radical species is 29%, comparable to the yield of radical in HCOs (3-20%).8,13,14

Figure 3.4 X-band (a) and Q-band (b) EPR spectra of F33Y-CuBMb after H2O2 treatment. Experiment parameters for X-band: frequency: 9.23 GHz; power: 2 mW; gain: 4000; temperature: 30K; modulation: 2 Gauss. Experiment parameters for Q-band: frequency: 34.0 GHz; power: 50 μW; temperature: 50K; modulation: 3.2 Gauss. Spectrum simulated by SIMPOW627 was in red dashed line. Simulated by Dr. Mark Nilges.

Figure 3.5 X-band (A) and Q-band (B) EPR spectra of H2O2-reacted F33Y-CuBMb, showing experimental spectra (black), simulated spectra (red), simulated tyrosyl radical species (blue) and background (magenta). Simulated by Dr. Mark Nilges using SIMPOW6.27

i Table 3.2 Simulated EPR parameters for the tyrosyl radical species in F33Y-CuBMb and tyrosyl radical in RNR

e e Nucleus Ax/MHz Ay/MHz Az/MHz

a,b,c 1 d F33Y-CuBMb 3,5- H 26 11 19 β-1H 51 60 59 β-1H 24 8 16 RNRf,g,h 3,5-1H 27 8 20 β-1H 61 55 58 β-1H <6 <6 <6 a g values of 2.0091, 2.0044 and 2.0021 were used. b Line width (peak-to-peak) of 7.5, 4.7, 3.2 Gauss were used. c g strain of 0.0005, 0.0001 and 0.0000 were used. d Euler angle of [α,β,γ] = [±22°,0°,0°]38 were used. Hyperfine for 3-H and 5-H assumed equivalent. No significant improvement if they are allowed to be inequivalent. e The assignment of x versus y is arbitrary. f from ref29. g g values of 2.0091, 2.0046 and

2.0021 were used. h Line widths of 6.0, 6.0, 6.0 Gauss were used. i Simulated by Dr. Mark Nilges using SIMPOW6.27

a Table 3.3 Simulated EPR parameters for both species in H2O2-reacted F33Y-CuBMb

species fraction gx gy gz

X-band Tyr radical 0.53 2.0091 2.0044 2.0021 background 0.47 2.0110 2.0118 1.9938 Q-band Tyr radical 0.29 2.0091 2.0044 2.0021 background 0.71 2.0060 2.0056 2.0018

species Wx/Gauss Wy/Gauss Wz/Gauss Δgx Δgy Δgz

X-band Tyr radical 7.5 4.7 3.2 0.0005 0.0001 0.0000 background 16.0 55.0 11.7 Q-band Tyr radical 7.5 4.7 3.2 0.0005 0.0001 0.0000 background 11.5 76.7 14.4 a Simulated by Dr. Mark Nilges using SIMPOW6.27

The second species has an unresolved hyperfine structure. It is considered as background species. The relative intensity and breadth of this species changes in X- and Q-band samples, as shown in Table 3.3. The variation is probably due to different tube size thus change in mixing time and kinetics. However, the uncertainty in determining background species has minimal effect on the tyrosyl radical species. As shown in Figure 3.6, the simulated second derivative spectra overlaps with experimental spectra. As the second derivatives are more sensitive to the species with well-resolved hyperfine structure (the tyrosyl radical species), the good agreement between experimental and simulated second derivative spectra indicates the Tyr radical-like species is modeled well. (Figure 3.6)

Figure 3.6 Second derivatives of X-band (A) and Q-band (B) spectra of F33Y-CuBMb after H2O2 treatment. Experimental spectra were in black solid line while simulated spectra were in red dashed line. Simulated by Dr. Mark Nilges.

3.3.2 Power saturation behavior of the observed radical

Free organic radicals are readily saturated at low power, while metal associated radicals are much harder to saturate.39-41 For example, half-saturation power (P1/2), the microwave power where the first-derivative amplitude is reduced to one-half of its unsaturated value, of the free semiquinone radical is 0.07 mW at 90 K.42 On the contrary, P1/2’s of various Fe-S proteins range from 0.4 mW to >1400 mW at 12.5 K 43, and P1/2 of radical from Tyr115 of Bacillus cereus Ribonucleotide Reductase R2 protein, which is 5.6 Å from diiron center, is 0.05 mW at 20 K.44

Figure 3.7 Plot of relative signal vs. power and fitting for power saturation experiment at 10 K (A) and 30 K (B). The half saturation power is calculated to be 10 mW at 10 K and 67 mW at 30 K.

Power saturation experiment of radical from H2O2-reacted F33Y-CuBMb were performed at 10 K and 30 K. The P1/2 of the radical is 10±1 mW at 10 K and 67±3 mW at 30 K (Figure 3.7). The value is large compared with values for metal-associated Tyr radical reported in RNR,44-47 indicating the tyrosyl radical is strongly associated with metal.

3.3.3 Tyr mutations reveal origin of radical

Through simulated EPR parameters, the radical in H2O2-reacted F33Y-CuBMb is identified as tyrosyl radical. However, besides the active site Tyr (Tyr33), there are three other Tyr (Tyr103, Tyr146, Tyr151) in the protein. CuBMb, the mutant with the same amino acid sequence except a Phe instead of Tyr at 33 position, displayed a radical signal with unresolved hyperfine splitting. With other three Tyr in place, the lack of tyrosyl radical in CuBMb (Figure 3.3E) suggests Tyr33 is the origin of radical signal.

To eliminate contribution from other tyrosine in the protein, non-active-site tyrosines (Tyr103, Tyr146 and Tyr151) were mutated to phenylalanine. The resulting protein, F33Y/Y103F/Y146F/Y151F-CuBMb displayed much weaker radical signal (Figure 3.8). As tyrosines were mutated to Phe, radical transfer could be different, resulting a weaker signal. Simulation of radical spectrum revealed a similar radical

43 species and a stronger background species. As the only remaining Tyr in this protein is

Tyr33, it is like that the tyrosyl radical observed in F33Y/Y103F/Y146F/Y151F-CuBMb is located at this residue.

Figure 3.8 Experimental (black) and simulated (red) EPR spectra of A) F33Y-CuBMband B)

F33Y/Y103/146/151F-CuBMb after H2O2 treatment. Experiment parameters: frequency: 9.05

GHz; power: 2 mW; gain: 2000 for F33Y-CuBMb and 12500 for F33Y/Y103F/Y146F/Y151F-

CuBMb; temperature: 30K; modulation: 4 Gauss. Simulated by Dr. Mark Nilges using SIMPOW6.27

3.3.4 Unnatural amino acids as probe to locate origin of radical

Multi-frequency EPR and mutagenesis study suggests the tyrosyl radical observed in H2O2-reacted F33Y-CuBMb. On the other hand, using unnatural amino acids as spectral probes could provide direct evidence of origin of the radical. As shown by Stubbe and coworkers31, fluorine substitution on phenol ring introduces unique splitting patterns for the tyrosyl radical signal. Fluorinated Tyr could serve as a spectral

44 probe to locate origin of radical. We reason chlorinated, with ring chlorine altering splitting pattern of tyrosyl radical, could also function in as probe.

In collaboration with Prof. Jiangyun Wang, we incorporated F2Tyr, ClTyr and

Cl2Tyr into 33 position of CuBMb using amber suppression method (Figure 3.9).23 Proteins were expressed and purified as described before (Figure 3.10).23 The UV-vis spectra of as-purified showed a Soret peak at 408 nm (±1 nm). Upon reduction by dithionite, the peaks were shifted to 431-433 nm (Figure 3.11 and Table 3.4). The resemblance of the spectra to that of WT Mb and F33Y-CuBMb indicates indicating that the overall environment around the heme center should also be similar.

Figure 3.9 Active site of F33Y-CuBMb and various Tyr analogs used in this study

Figure 3.10 Electrospray mass spectrometry of F33ClTyr-CuBMb (top, calculated: 18418, observed: 18413), F33Cl2Tyr-CuBMb (middle, calculated: 18453, observed: 18457) and

F33F2Tyr-CuBMb (bottom, calculated: 18421, observed: 18418). Mass spec of F33OMeTyr-

CuBMb (calculated: 18416, observed: 18417) was not shown here.

Table 3.4 UV-vis Features of myoglobin mutants with Tyr and Tyr analogs at 33 position.

Met Deoxy Soret Extinc. Co. Vis Soret Extinc. Deoxy Extinc. mM-1 feature Co. Co. mM-1 mM-1 F33Tyr 408 175 501, 533, 433 128 559 14.2

CuBMb 628 F33ClY- 407 160 501, 538, 431 122 558 14.0

CuBMb 629

F33Cl2Y- 407 193 501, 537, 432 141 557 16.4

CuBMb 629

F33F2Y- 409 147 500, 537, 431 114 559 14.3

CuBMb 630 F33OMeY- 407 177 501, 536, 431 127 556 15.1

CuBMb 628

Figure 3.11 UV-vis spectra of ferric (black trace) and deoxy (red trace) form of F33Y-CuBMb (A),

F33ClY-CuBMb (B), F33F2Y-CuBMb (C), F33F2Y-CuBMb (D) and F33OMeY-CuBMb (E) respectively.

Proteins with Tyr analogs were treated with H2O2 for 30 s, flash frozen in liquid nitrogen and EPR spectra were taken for these samples (Figure 3.8). Dr. Mark Nilges simulated the spectra with SIMPOW6.27

Compared with radical spectrum from F33Y-CuBMb, the one from F33F2Y-CuBMb showed less splitting in the middle, while there is a doublet of doublet in the wings of the spectrum (Figure 3.8). Simulation of radical from F33F2Y-CuBMb gave three species with slightly different g values (Table 3.5). The major species gave g tensor of 2.0105, 2.0072, and 2.0038. According to the simulation, the radical is split by four nuclei. Besides two with hyperfine coupling constant (hpc) similar to that of β proton, the other two have hpc of 36, 35, 152 MHz. The values are much larger than that of tyrosyl radical, but consistent with reported values for ring fluorine (15, 3, -151 MHz).30 The distinct hpc’s suggests that the radical is originated from F2Y, which at 33 position.

Figure 3.12 EPR spectrum of various myoglobin variants after reaction with H2O2. Experimental spectra were shown in black solid line while simulated spectra in red dashed line. Simulated by Dr. Mark Nilges.

Having proven that the tyrosyl radical is originated from Tyr33 using established unnatural amino acid, we moved to ClY, a halogenated Tyr. As shown in Figure 3.8, spectrum of H2O2-reacted F33ClY-CuBMb showed triplet splitting, which resembles the main part of tyrosyl radical in F33Y-CuBMb, but not the fine hyperfine features. Simulation of the spectrum revealed two nuclei contribute to the splitting. Their hpc’s are consistent with one ring proton and one β proton. However, similar to fluorine, chlorine should induce a quadruple splitting, albeit weak, to the spectrum. The discrepancy between prediction and experiment can be reconciled by taking into consideration of both 35Cl and 37Cl isotopes, of different nuclear magnetic mements, being of natural abundance. The weak hyperfine coupling, quadruple splitting and natural isotopes together contribute to line broadening and unresolvable spectra feature. As a result, contribution from Cl was not observable in this experiment. Although ClY lacks 50 distinctive spectroscopic features as F2Y, by comparing to the spectrum of F33Y-CuBMb, it is clear that the radical is originated from 33 positions.

Table 3.5 Simulated EPR parameters.b

Amino acid Species Ratio gx gy gz nucleus Ax/MHz Ay/MHz Az/MHz Tyrosine 1 0.18 2.0067 2.0048 2.0026 3,5-Ha 20 14 16 β-1H 63 53 79 2 0.82 2.0130 2.0057 1.9970 - 0 0 0

a 3,5-F2Y 1 0.30 2.0105 2.0072 2.0038 3,5-F 35 16 153 β-1H 63 53 79 β-1H 22 23 16 2 0.04 2.0067 2.0048 2.0026 3,5-Fa 20 14 16 β-1H 63 53 79 3 0.67 2.0170 2.0007 2.0040 3,5-Fa 36 35 152 β-1H 57 33 56 β-1H 15 29 13 3-ClY 1 0.23 2.0135 2.0030 2.0034 3-Cl 0 0 0 5-H 24 16 9 β-1H 56 34 84 0.77 2.0105 2.0091 1.9987 - 0 0 0

β,β-D2-3-ClY 1 0.39 2.0135 2.0030 2.0034 3-Cl 0 0 0 5-H 0 0 0 β-2H 9 5 13 β-2H 4 2 1 2 0.61 2.0105 2.0091 1.9987 - 0 0 0 a. Euler angles of α = ±22º were used.38 b Simulated by Dr. Mark Nilges.

Table 3.6 Line widths used in EPR simulation.

Amino acid Species Wx/Gauss Wy/Gauss Wz/Gauss Tyrosine 1 4 4 4 2 58 16 47 3,5 -F2Tyr 1 4 4 4 2 4 4 4 3 8 25 12 3-ClY 1 11 4 13 82 5 12 β,β-D2-3- ClY 1 11 4 13 2 82 5 12

Besides halogen atom, substitution of proton with deuteron30 could also induce change of hyperfine splitting pattern. Isotope-labelled amino acids are often used as a spectral probe. 48-50 Such amino acids are usually added in restricted medium to replace a certain type of amino acids49, thus unable to take a site-specific approach. Isotope- labelled amino acids have been incorporated into protein in a site-specific manner by methods mentioned in Chapter 1, such as native chemical ligation30,51,52, expressed protein ligation53,54, and amber codon suppression55-57. However, there is no EPR probe incorporated into protein using amber codon suppression method. As ClY can be synthesized from Tyr in one step simple transformation26,58 with high yield (~ 90 %) and incorporated into protein efficiently with evolved tRNA/aaRS, it is a good handle for site- specific incorporation of isotope-labelled amino acids.

β, β-D2, 3-ClTyr (D2ClY) was synthesized from β,β -D2Tyr in one step with 45% yield in a small scale reaction (100 mg). The unnatural amino acid was incorporated into myoglobin using tRNA/aaRS for ClY, to give F33D2ClY-CuBMb. The identity of the protein was verified by high resolution mass spectrometry.

Figure 3.13 ESI-QToF mass spectrometry of F33ClY-CuBMb (top) and F33D2ClY-CuBMb

(bottom). F33ClY-CuBMb, calculated: 18419 observed: 18419; F33D2ClY-CuBMb calculated: 18421 observed: 18421.

H2O2-reacted F33D2ClY-CuBMb showed singlet without observable feature (Figure 3.12 and Table 3.5). The drastic change compared to the spectra of F33Y-

CuBMb and F33ClY-CuBMb suggests tyrosyl radical resides on the 33 position. Simulation of the radical is consistent with existence of two deuteron at β position, which give small hpc’s. As a result, the Deuteron-label is incorporated into protein in a site- specific manner through ClY. This method can be general applied for different isotopes.

Afterall, incorporation of halogenated and/or deuterated unnatural amino acids into 33 position induced changes in radical spectra generate through reaction with H2O2. Simulation of the radical spectra is consistent with introduction of halogen/deuteron 53 substation to tyrosyl radical. The result clearly indicates tyrosyl radical observed in H2O2 reaction resides on Tyr33.

Using EPR, we have observed a tyrosyl radical in the reaction of the ferric F33Y-

CuBMb with H2O2. Simulation of the radical EPR spectra collected at both X- and Q- band showed it is consistent with a tyrosyl radical signal, while control experiments using WT Mb, CuBMb and mutations of other tyrosines in the protein suggest that Tyr33 is the active site Tyr involved in the radical formation. Spectra changes caused by replacing Tyr33 with unnatural amino acids further confirmed that the tyrosyl radical is from Tyr33. These together established that a tyrosyl radical is generated in F33Y-

CuBMB in H2O2 reaction. There are a number of reports of tyrosyl radical generation in

H2O2 reaction in native HCOs13-15,17,59,60. The total conversion of radical species is 7-20% in these studies, which is much lower than what we observed. The recent tyrosyl radical, reported by Yu et al., has much narrower spectrum (12 G) compared to the ones we got.8 The difference comes from the fact that His-Tyr cross-linking could alter the splitting pattern, as well as the orientation of Tyr are different between F33Y-CuBMB and bovine CcO. We are also very interested in the radical formation in imiTyr-CuBMb, as the imiTyr unnatural amino acid better mimics cross-linked Tyr.

3.3.5 Tyrosyl radical generated in F33Y-CuBMb after reaction with O2

After demonstrating Tyr radical formation in the “peroxide shunt” pathway, we investigated whether the Tyr radical can form during O2 reduction reaction. Deoxy-

F33Y-CuBMb was mixed with O2 saturated buffer using a rapid freeze quench apparatus to trap reaction intermediate at ~20 ms. An EPR spectrum was then collected and compared with the corresponding oxidized protein (Fe(III)-F33Y-CuBMb) treated with

H2O2. As shown in Figure 3.14 and Figure 3.15, the radical signal of the freeze- quenched sample from direct O2 reduction is similar to that from H2O2 reaction, with similar hyperfine splitting pattern. The highly specific hyperfine splitting pattern suggests the same tyrosyl radical is generated through O2 reduction reaction. The observed signal at the shortest time point (20 ms) of freeze quench represents ~ 7 % of total protein based on spin quantification (Figure 3.2 and Table 3.1).

Figure 3.14 EPR spectra of F33Y-CuBMb reacted with H2O2 and O2.

Figure 3.15 EPR spectra of ferrous F33Y-CuBMb with or without treatment of O2, ferric F33Y-

CuBMb and O2 bound WT Mb. Experiment parameters for X-band EPR: frequency: 9.05 GHz; power: 2 mW; gain: 12500; temperature: 30K; modulation: 4 Gauss.

The direct observation of tyrosyl radical under reaction condition, together with observation of tyrosyl radical under H2O2 reaction condition, indicate the active site of

F33Y-CuBMb directly involves in O2 reduction reaction, by donating an electron and a

55 proton. In native HCO, although such a radical is not directly observed11, peptide mapping has been used to trace radical generated in O2 reduction reaction to active site Tyr.12 Compared with native HCOs, which have activity from 50 s-1 to ~ 1000 s-1,61,62 the -1 model system has much lower activity (0.09 s for F33Y-CuBMb).22 The low activity may indicate the intermediate with radical is generated at a longer time scale and is not as easily quenched, helping us to capture the radical.

3.3.6 pKa and reduction potential of Tyr affect oxidase activity

Mutagenesis studies have shown that active site Tyr is essential for oxidase activity.63,64 The activity is further modulated by pKa of Tyr. Studies of model complexes have suggested that the cross-link could lower pKa of phenol to stabilize tyrosine radical and anion, increasing oxidase activity.24,65

As Tyr is directly involved in oxygen reduction reaction, it is of great interest to see if the properties of Tyr affect oxidase activity of our protein model. We successfully incorporated a series of Tyr analogues into 33 position of F33Y-CuBMb. These unnatural amino acids, as shown in Figure 3.16, Table 3.7, and Table 3.8, have24,65 a range of pKas and redox potentials.

Figure 3.16 pKa of Tyr and Tyr analogs

Table 3.7 Experimental and predicted pKa of phenols.

Experimental pKa Predicted pKa* amino acid pKa phenol 9.77±0.01 9.86±0.13 Tyr 9.81±0.03 2-chlorophenol 8.25±0.02 8.50±0.10 ClY 8.08±0.03 2, 6-dichlorophenol 6.49±0.02 7.02±0.10 Cl2Y 6.28±0.02 2-methoxyphenol 9.57±0.01 9.97±0.10 OMeY 9.90±0.03 2,6-Difluorophenol 7.45±0.10 6.8 F2Y 7.59±0.11 Im-PhOH# 8.6 * Values were calculated with the use of Advanced Chemistry Development (ACD/Labs) Software V8.14 for Solaris (© 1994–2009 ACD/Labs).

# from ref 24

Table 3.8 Peak potential (Ep in mV vs. NHE) of amino acids at different pH measured by CV or reported previously.

pH 7 pH 13 Tyr 941±5 672±1 ClY 847±1 734±3

Cl2Y 832±1 808±1 OMeY 779±14 480±1 F2Y * 782 655 * Reported in ref66

We then measured the rates of oxygen reduction catalyzed by 6 μM myoglobin mutants with an O2 electrode in 20 Tris buffer at pH 7.4. Ascorbic acid (1000 equivalents) and TMPD (100 equivalents) were used as reductant and redox mediator respectively.24 To differentiate between reactive oxygen species (ROS) and water products, we used catalase and superoxide dismutase (SOD), which catalyzed the disproportionation of hydrogen peroxide or superoxide into oxygen and water. If O2 consumption results in the formation of ROS but not water, the O2 reduction rate should decrease in the presence of catalase and SOD, because they will convert ROS to O2. By comparing the rates of reduction in the presence and absence of ROS scavenger, the portion of O2 reduction due to water formation (in blue) and due to ROS formation

(in red) can be calculated (Figure 3.17 and Table 3.9). Our results show that F33Y-

CuBMb was able to reduce O2 at a rate of 6.5 μM/min, with 51% of O2 being converted into water. In contrast, F33OMeYCuBMb exhibited significant higher oxidase activity at

15.0 μM/min for O2 reduction, 82% of which was converted to water. Since the pKa of OMeY is similar to that of Tyr, the lower redox potential of OMeY should be responsible for increased oxidase activity and O2 reduction selectivity of F33OMeYCuBMb.

Table 3.9 Rate of oxygen reduction for different proteins.

- O2 consumption (μM min to to fraction of error to error to 1 ) H2O H2O2 H2O H2O H2O2 WT Mb 3.1 11.6 0.21 1.9 2.1

Phe33Tyr-CuBMb 3.4 3.2 0.51 1.3 1.4 Phe33ClY-CuBMb 4.3 4.3 0.50 0.15 0.15

Phe33Cl2Y-CuBMb 6.8 1.9 0.78 1.0 1.1

Phe33F2Y-CuBMb 6.1 1.8 0.77 0.8 0.8

Phe33OMeY-CuBMb 12.3 2.7 0.82 1.8 2.0

20.00

15.00

10.00

1 -

5.00

M∙min μ 0.00

-5.00

-10.00

consumption rate rate consumption 2

O -15.00 to H2O2 -20.00 to H2O

-25.00

Figure 3.17 Rates of oxygen reduction to form either water (blue) or ROS (red) catalyzed by

6μM of WT Mb, Phe33Tyr-CuBMb, Phe33ClY-CuBMb, Phe33Cl2Y-CuBMb, Phe33F2Y- CuBMbor Phe33OMeY-CuBMb.

The mutants F33ClY-CuBMb, F33Cl2Y-CuBMb and F33F2Y-CuBMb displayed higher activity at 4.26 μM/min, 6.78 μM/min, and 6.12 μM/min, respectively, while

F33YCuBMb displayed rate of 3.10 μM/min for converting O2 to H2O. Since the reduction potential of Tyr, ClY, F2Y and F3Y at pH7 are similar, and that oxidase activity increases as the pKa of the side chain of residue 33 increases, these results indicate that the lower pKa and enhanced proton donation ability of residue 33 are important for

O2 reduction.

4 Activity 3

0 5 6 7 8 9 10 11 pKa

2 Figure 3.18 The oxidase activities of proteins are correlated with pKa of Tyr. (R = -0.979)

To further demonstrate the robustness of the best oxidase-mimicking enzyme,

F33OMeYCuBMb, we carried out multiple turnover experiment (Figure 3.19). The

F33OMeYCuBMb was able to catalyze O2 reduction for more than 1100 turnovers without significant reduction of catalytic rate. Under similar conditions, F33Y-CuBMb could only catalyze the reaction for less than 500 turnovers.19

Figure 3.19 O2-reduction turnover number by Phe33OMeY-CuBMb measured during the stepwise addition of O2. 61

3.4 Summary

In summary, using EPR, we have observed a tyrosyl radical not only in the reaction of the ferric F33Y-CuBMb with H2O2, but also in the reaction of the ferrous

F33Y-CuBMb with O2. Simulation of the radical EPR spectra collected at both X- and Q- band showed it is consistent with a tyrosyl radical signal, while control experiments using WT Mb, CuBMb and mutations of other tyrosines in the protein established that Tyr33 is the active site Tyr involved in the radical formation. Unnatural amino acids incorporation proved the tyrosyl radical is located at the 33 position. The direct observation of the tyrosyl radical in a functional oxidase model provides a strong support of the role of such radical in the oxidase reaction mechanism and thus fills an important missing piece in the puzzle of HCO bioenergetics.

As Tyr provides an electron and a proton in the reaction, we further explored how the properties of Tyr, such as pKa and redox potential, tune the activity of protein model.

Through incorporation of a series of Tyr analogues with different pKa and redox potential, we found lower pKa and higher redox potential of Tyr facilitate reaction. These results demonstrate that the proton and electron donating ability of a tyrosine residue in the active site is important for HCO function.

3.5 References

1. Babcock, G. T., Barry, B. A., Debus, R. J., Hoganson, C. W., Atamian, M., McIntosh, L., Sithole, I., and Yocum, C. F. (1989) Water oxidation in photosystem II: from radical chemistry to multielectron chemistry, Biochemistry 28, 9557-9565. 2. Debus, R. J., Barry, B. A., Babcock, G. T., and McIntosh, L. (1988) Site-directed mutagenesis identifies a tyrosine radical involved in the photosynthetic oxygen- evolving system, Proceedings of the National Academy of Sciences 85, 427-430. 3. McEvoy, J. P., and Brudvig, G. W. (2006) Water-Splitting Chemistry of Photosystem II, Chem. Rev. 106, 4455-4483. 4. Tomter, A. B., Zoppellaro, G., Andersen, N. H., Hersleth, H.-P., Hammerstad, M., Røhr, Å. K., Sandvik, G. K., Strand, K. R., Nilsson, G. E., Bell, C. B., Barra, A.-L., Blasco, E., Le Pape, L., Solomon, E. I., and Andersson, K. K. (2012)

Ribonucleotide reductase class I with different radical generating clusters, Coord. Chem. Rev. 257, 3-26. 5. Cotruvo, J. A., and Stubbe, J. (2011) Class I Ribonucleotide Reductases: Metallocofactor Assembly and Repair In Vitro and In Vivo, Annu. Rev. Biochem. 80, 733-767. 6. Warren, J. J., Winkler, J. R., and Gray, H. B. (2012) Redox properties of tyrosine and related molecules, FEBS Lett. 586, 596-602. 7. Hoganson, C. W., and Tommos, C. (2004) The function and characteristics of tyrosyl radical cofactors, Biochimica et Biophysica Acta (BBA) - Bioenergetics 1655, 116-122. 8. Yu, M. A., Egawa, T., Shinzawa-Itoh, K., Yoshikawa, S., Guallar, V., Yeh, S.-R., Rousseau, D. L., and Gerfen, G. J. (2012) Two Tyrosyl Radicals Stabilize High Oxidation States in Cytochrome c Oxidase for Efficient Energy Conservation and Proton Translocation, J. Am. Chem. Soc. 134, 4753-4761. 9. Proshlyakov, D. A., Pressler, M. A., and Babcock, G. T. (1998) Dioxygen activation and bond cleavage by mixed-valence cytochrome c oxidase, Proceedings of the National Academy of Sciences 95, 8020-8025. 10. Wikström, M. (2012) Active site intermediates in the reduction of O2 by cytochrome oxidase, and their derivatives, Biochimica et Biophysica Acta (BBA) - Bioenergetics 1817, 468-475. 11. Yu, M. a., Egawa, T., Shinzawa-Itoh, K., Yoshikawa, S., Yeh, S.-R., Rousseau, D. L., and Gerfen, G. J. (2011) Radical formation in cytochrome c oxidase, Biochim. Biophys. Acta 1807, 1295-1304. 12. Proshlyakov, D. A., Pressler, M. A., DeMaso, C., Leykam, J. F., DeWitt, D. L., and Babcock, G. T. (2000) Oxygen Activation and Reduction in Respiration: Involvement of Redox-Active Tyrosine 244, Science 290, 1588-1591. 13. Fabian, M., and Palmer, G. (1995) The interaction of cytochrome oxidase with hydrogen peroxide: the relationship of compounds P and F, Biochemistry 34, 13802-13810.

14. MacMillan, F., Kannt, A., Behr, J., Prisner, T., and Michel, H. (1999) Direct Evidence for a Tyrosine Radical in the Reaction of Cytochrome c Oxidase with Hydrogen Peroxide†, Biochemistry 38, 9179-9184. 15. Rigby, S. E., Junemann, S., Rich, P. R., and Heathcote, P. (2000) Reaction of bovine cytochrome c oxidase with hydrogen peroxide produces a tryptophan cation radical and a porphyrin cation radical, Biochemistry 39, 5921-5928. 16. Rich, P. R., Rigby, S. E. J., and Heathcote, P. (2002) Radicals associated with the catalytic intermediates of bovine cytochrome c oxidase, Biochimica et Biophysica Acta (BBA) - Bioenergetics 1554, 137-146. 17. Budiman, K., Kannt, A., Lyubenova, S., Richter, O. M., Ludwig, B., Michel, H., and MacMillan, F. (2004) Tyrosine 167: the origin of the radical species observed in the reaction of cytochrome c oxidase with hydrogen peroxide in Paracoccus denitrificans, Biochemistry 43, 11709-11716. 18. Kim, E., Chufán, E. E., Kamaraj, K., and Karlin, K. D. (2004) Synthetic models for heme-copper oxidases, Chem. Rev. 104, 1077-1133. 19. Collman, J. P., Devaraj, N. K., Decréau, R. a., Yang, Y., Yan, Y.-L., Ebina, W., Eberspacher, T. a., and Chidsey, C. E. D. (2007) A cytochrome C oxidase model catalyzes oxygen to water reduction under rate-limiting electron flux, Science 315, 1565-1568. 20. Kieber-Emmons, M. T., Qayyum, M. F., Li, Y., Halime, Z., Hodgson, K. O., Hedman, B., Karlin, K. D., and Solomon, E. I. (2012) Spectroscopic elucidation of a new heme/copper dioxygen structure type: implications for O···O bond rupture in cytochrome c oxidase, Angew. Chem., Int. Ed. 51, 168-172. 21. Sigman, J. a., Kwok, B. C., and Lu, Y. (2000) From Myoglobin to Heme-Copper Oxidase: Design and Engineering of a Cu B Center into Sperm Whale Myoglobin, J. Am. Chem. Soc. 122, 8192-8196. 22. Miner, K. D., Mukherjee, A., Gao, Y. G., Null, E. L., Petrik, I. D., Zhao, X., Yeung, N., Robinson, H., and Lu, Y. (2012) A Designed Functional Metalloenzyme that Reduces O2 to H2O with Over One Thousand Turnovers, Angew. Chem., Int. Ed. 51, 5589-5592.

23. Liu, X., Yu, Y., Hu, C., Zhang, W., Lu, Y., and Wang, J. (2012) Significant Increase of Oxidase Activity through the Genetic Incorporation of a Tyrosine- Histidine Cross-Link in a Myoglobin Model of Heme-Copper Oxidase, Angew. Chem., Int. Ed. 51, 4312-4316. 24. McCauley, K. M., Vrtis, J. M., Dupont, J., and van der Donk, W. A. (2000) Insights into the Functional Role of the Tyrosine-Histidine Linkage in Cytochrome c Oxidase, J. Am. Chem. Soc. 122, 2403-2404. 25. Seyedsayamdost, M. R., Reece, S. Y., Nocera, D. G., and Stubbe, J. (2006) Mono-, di-, tri-, and tetra-substituted fluorotyrosines: new probes for enzymes that use tyrosyl radicals in catalysis, J. Am. Chem. Soc. 128, 1569-1579. 26. McCubbin, J. A., Maddess, M. L., and Lautens, M. (2006) Total Synthesis of Cryptophycin Analogues via a Scaffold Approach, Org. Lett. 8, 2993-2996. 27. Nilges, M. J., Matteson, K., and Bedford, R. L. (2007) SIMPOW6: A software package for the simulation of ESR powder-type spectra., In ESR Spectroscopy in Membrane Biophysics (Hemminga, M. A., and Berliner, L., Eds.), Springer, New York. 28. Yu, Y. G., Thorgeirsson, T. E., and Shin, Y.-K. (1994) Topology of an Amphiphilic Mitochondrial Signal Sequence in the Membrane-Inserted State: A Spin Labeling Study, Biochemistry 33, 14221-14226. 29. Bleifuss, G., Kolberg, M., Pötsch, S., Hofbauer, W., Bittl, R., Lubitz, W., Gräslund, A., Lassmann, G., and Lendzian, F. (2001) Tryptophan and Tyrosine Radicals in Ribonucleotide Reductase: A Comparative High-Field EPR Study at 94 GHz†, Biochemistry 40, 15362-15368. 30. Yokoyama, K., Smith, A. a., Corzilius, B., Griffin, R. G., and Stubbe, J. (2011) Equilibration of tyrosyl radicals (Y356•, Y731•, Y730•) in the radical propagation pathway of the Escherichia coli class Ia ribonucleotide reductase, J. Am. Chem. Soc. 133, 18420-18432. 31. Wilbur, D. J., and Allerhand, A. (1976) Titration Behavior of Individual Myoglobins from Sperm Whale , Tyrosine Residues of Horse , and Red Kangaroo, J. Biol. Chem. 251, 5187-5194.

32. Uyeda, M., and Peisach, J. (1981) Ultraviolet difference spectroscopy of myoglobin: assignment of pK values of tyrosyl phenolic groups and the stability of the ferryl derivatives, Biochemistry 20, 2028-2035. 33. Miki, H., Harada, K., Yamazaki, I., Tamura, M., and Watanabe, H. (1989) Electron spin resonance spectrum of Tyr-151 free radical formed in reactions of sperm whale metmyoglobin with ethyl hydroperoxide and potassium irridate, Arch. Biochem. Biophys. 275, 354-362. 34. Wilks, A., and Ortiz de Montellano, P. (1992) Intramolecular translocation of the protein radical formed in the reaction of recombinant sperm whale myoglobin with H2O2, J. Biol. Chem. 267, 8827-8833. 35. Ivancich, A., Dorlet, P., Goodin, D. B., and Un, S. (2001) Multifrequency High- Field EPR Study of the Tryptophanyl and Tyrosyl Radical Intermediates in Wild- Type and the W191G Mutant of Cytochrome c Peroxidase, J. Am. Chem. Soc. 123, 5050-5058. 36. Di Bilio, A. J., Crane, B. R., Wehbi, W. A., Kiser, C. N., Abu-Omar, M. M., Carlos, R. M., Richards, J. H., Winkler, J. R., and Gray, H. B. (2001) Properties of Photogenerated Tryptophan and Tyrosyl Radicals in Structurally Characterized Proteins Containing Rhenium(I) Tricarbonyl Diimines, J. Am. Chem. Soc. 123, 3181-3182. 37. Shafaat, H. S., Leigh, B. S., Tauber, M. J., and Kim, J. E. (2010) Spectroscopic Comparison of Photogenerated Tryptophan Radicals in Azurin: Effects of Local Environment and Structure, J. Am. Chem. Soc. 132, 9030-9039. 38. Svistunenko, D. A., and Cooper, C. E. (2004) A new method of identifying the site of tyrosyl radicals in proteins, Biophys. J. 87, 582-595. 39. Portis, A. M. (1953) Electronic Structure of F Centers: Saturation of the Electron Spin Resonance, Physical Review 91, 1071-1078. 40. Castner Jr, T. G. (1959) Saturation of the Paramagnetic Resonance of a V Center, Physical Review 115, 1506-1515. 41. Sahlin, M., Gräslund, A., and Ehrenberg, A. (1986) Determination of relaxation times for a free radical from microwave saturation studies, Journal of Magnetic Resonance (1969) 67, 135-137.

42. Schünemann, V., Jung, C., Trautwein, A. X., Mandon, D., and Weiss, R. (2000) Intermediates in the reaction of substrate-free cytochrome P450cam with peroxy acetic acid, FEBS Lett. 479, 149-154. 43. Rupp, H., Rao, K. K., Hall, D. O., and Cammack, R. (1978) Electron spin relaxation of iron-sulphur proteins studied by microwave power saturation, Biochimica et Biophysica Acta (BBA) - Protein Structure 537, 255-269. 44. Tomter, A. B., Zoppellaro, G., Andersen, N. H., Hersleth, H. P., Hammerstad, M., Rohr, A. K., Sandvik, G. K., Strand, K. R., Nilsson, G. E., Bell, C. B., Barra, A. L., Blasco, E., Le Pape, L., Solomon, E. I., and Andersson, K. K. (2013) Ribonucleotide reductase class I with different radical generating clusters, Coord. Chem. Rev. 257, 3-26. 45. Sahlin, M., Petersson, L., Graslund, A., Ehrenberg, A., Sjoberg, B. M., and Thelander, L. (1987) Magnetic Interaction between the Tyrosyl Free Radical and the Antiferromagnetically Coupled Iron Center in Ribonucleotide Reductase, Biochemistry 26, 5541-5548. 46. Liu, A., Potsch, S., Davydov, A., Barra, A. L., Rubin, H., and Graslund, A. (1998) The tyrosyl free radical of recombinant ribonucleotide reductase from Mycobacterium tuberculosis is located in a rigid hydrophobic pocket, Biochemistry 37, 16369-16377. 47. Torrents, E., Sahlin, M., Biglino, D., Graslund, A., and Sjoberg, B. M. (2005) Efficient growth inhibition of Bacillus anthracis by knocking out the ribonucleotide reductase tyrosyl radical, Proc. Natl. Acad. Sci. U. S. A. 102, 17946-17951. 48. Lin, M. T., Samoiloya, R. I., Gennis, R. B., and Dikanov, S. A. (2008) Identification of the nitrogen donor hydrogen bonded with the semiquinone at the QH site of the cytochrome bo3 from Escherichia coli, J. Am. Chem. Soc. 130, 15768-15769. 49. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. a., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins, Methods (San Diego, Calif.) 55, 370-378.

50. Haris, P. I. (2010) Can infrared spectroscopy provide information on protein- protein interactions?, Biochem. Soc. Trans. 38, 940-946. 51. Smith, R., Brereton, I. M., Chai, R. Y., and Kent, S. B. H. (1996) Ionization states of the catalytic residues in HIV-1 protease, Nat. Struct. Mol. Biol. 3, 946-950. 52. Kent, S. B. H. (2009) Total chemical synthesis of proteins, Chem. Soc. Rev. 38, 338. 53. Hauser, P. S., Raussens, V., Yamamoto, T., Abdullahi, G. E., Weers, P. M. M., Sykes, B. D., and Ryan, R. O. (2009) Semisynthesis and segmental isotope labeling of the apoE3 N-terminal domain using expressed protein ligation, J. Lipid Res. 50, 1548-1555. 54. Cowburn, D., and Muir, T. W. (2001) Segmental isotopic labeling using expressed protein ligation, Nuclear Magnetic Resonance of Biological Macromolecules, Pt B 339, 41-54. 55. Ellman, J. A., Volkman, B. F., Mendel, D., Schulz, P. G., and Wemmer, D. E. (1992) Site-specific isotopic labeling of proteins for NMR studies, J. Am. Chem. Soc. 114, 7959-7961. 56. Shi, P., Xi, Z., Wang, H., Shi, C., Xiong, Y., and Tian, C. (2010) Site-specific protein backbone and side-chain NMR chemical shift and relaxation analysis of human vinexin SH3 domain using a genetically encoded 15N/19F-labeled unnatural amino acid, Biochem. Biophys. Res. Commun. 402, 461-466. 57. Li, F., Shi, P., Li, J., Yang, F., Wang, T., Zhang, W., Gao, F., Ding, W., Li, D., Li, J., Xiong, Y., Sun, J., Gong, W., Tian, C., and Wang, J. (2013) A Genetically Encoded F-19 NMR Probe for Tyrosine Phosphorylation, Angew. Chem., Int. Ed. 52, 3958-3962. 58. Allevi, P., Olivero, P., Anastasia, M., and Di, A. (2004) Controlled synthesis of labelled 3-L-chlorotyrosine-[ring-13C6] and of 3,5-L-dichlorotyrosine-[ring-13C6], Journal of Labelled Compounds and Radiopharmaceuticals 47, 935-945. 59. Rich, P. R., Rigby, S. E., and Heathcote, P. (2002) Radicals associated with the catalytic intermediates of bovine cytochrome c oxidase, Biochim. Biophys. Acta 1554, 137-146.

60. Svistunenko, D. A., Wilson, M. T., and Cooper, C. E. (2004) Tryptophan or tyrosine? On the nature of the amino acid radical formed following hydrogen peroxide treatment of cytochrome c oxidase, Biochimica et Biophysica Acta (BBA) - Bioenergetics 1655, 372-380. 61. Pawate, A. S., Morgan, J., Namslauer, A., Mills, D., Brzezinski, P., Ferguson- Miller, S., and Gennis, R. B. (2002) A mutation in subunit I of cytochrome oxidase from Rhodobacter sphaeroides results in an increase in steady-state activity but completely eliminates proton pumping, Biochemistry 41, 13417-13423. 62. Lee, H. J., Gennis, R. B., and Ädelroth, P. (2011) Entrance of the proton pathway in cbb3-type heme-copper oxidases, Proceedings of the National Academy of Sciences. 63. Das, T. K., Pecoraro, C., Tomson, F. L., Gennis, R. B., and Rousseau, D. L. (1998) The Post-Translational Modification in Cytochrome c Oxidase Is Required To Establish a Functional Environment of the Catalytic Siteâ€ Biochemistry 37, 14471-14476. 64. Pinakoulaki, E., Pfitzner, U., Ludwig, B., and Varotsis, C. (2002) The role of the cross-link His-Tyr in the functional properties of the binuclear center in cytochrome c oxidase, J. Biol. Chem. 277, 13563-13568. 65. Cappuccio, J. a., Ayala, I., Elliott, G. I., Szundi, I., Lewis, J., Konopelski, J. P., Barry, B. a., and Einarsdóttir, O. (2002) Modeling the active site of cytochrome oxidase: synthesis and characterization of a cross-linked histidine-phenol, J. Am. Chem. Soc. 124, 1750-1760. 66. Seyedsayamdost, M. R., Reece, S. Y., Nocera, D. G., and Stubbe, J. (2006) Mono-, di-, tri-, and tetra-substituted fluorotyrosines: new probes for enzymes that use tyrosyl radicals in catalysis, J. Am. Chem. Soc. 128, 1569-1579.

Chapter 4 Improve Oxidase Activity by Engineering Electron Transfer Pathway

4.1 Introduction

The binuclear center of heme-copper oxidases catalyzes the reaction combining protons and electrons to form water.1-3 For efficient reaction, electrons and protons are relayed to binuclear center through well-aligned cofactors or residues. On the electron transfer pathway, there are a series of metal cofactors. For mammalian A-type oxidases, electrons from cytochrome c are first transferred to CuA, then to a low spin heme 5.4 Å away (measured from heme edge to heme edge) from binuclear center, finally to the reaction center.

Figure 4.1 Cofactors involved in electron transfer in (A) aa3 oxidases from Bos taurus (PDB ID: 4 5 2OCC ), (B) cbb3 type oxidases from Pseudomonas stutzeri (PDB ID: 3MK7 ) and (C) engineered electron transfer pathway from NADH to Mb (PDB ID: NADH- cyt b5 reductase 6 7 8 1IB0; cyt b5 1CYO; F33Y-CuBMb 4FWY )

Nature evolves an efficient electron transfer process in HCO to fuel the fast O2 reduction reaction at binuclear center. Electron transfer between cyt c and CuA is the only intermolecular electron transfer process. The protein-protein interaction is mediated

70 by electrostatic interactions, via positive charge from Lys on cyt c and acidic patch on subunit II of HCO. Using Ru labeled cyt c, Geren et al. have measured the electron 4 -1 transfer rate to CuA in bimolecular complex, which stands at (6 ± 2) × 10 s 9. The rate is consistent with result from docking simulation.10 At the same time, the bimolecular rate constant of this step is (1.7 ± 0.2) × 108 M-1 s-1.9

Although heme a and heme a3 are both 12 Å away from CuA, electron from CuA preferentially relays to heme a, mainly due to the high reorganization energy associated with CuA -> heme a3 electron transfer process.11,12 The electron transfer between CuA and heme a operates at a remarkable (2-10) × 104 s-1 rate with small driving force (-50 mV).13-17 While electron transfer from heme a to heme a3 is strongly coupled to proton transfer, flash photolysis was used to determine time constant of electron transfer in reverse direction. The time constant is about 3 μs, indicating fast electron transfer.18,19

While native HCOs have efficient electron transfer system, electron transfer from ascorbic acid via TMPD to engineered Mb is slow and could be the rate limiting step in the O2 reduction reaction. A more efficient electron transfer system is needed to further

20,21 increase activity of our model protein. Cyt b5 is physiological electron donor for Mb.

20,22 The oxidized cyt b5 is reduced by NADH through NADH-cyt b5 reductase. The physiological electron transfer pathway could potential increase electron transfer rate to Mb.

As Mb is not oxidized frequently under physiological condition, interaction of cyt b5 and Mb is not strong enough for fast electron transfer. Hoffman and coworkers have converted three negative-charged amino acids to positive-charged amino acids in

23-27 myoglobin to increase interaction between cyt b5 and Mb. As a result, electron

9 -1 26 transfer between cyt b5 and Mb is greatly enhanced to ~10 s . In this work, I combined physiological relevant electron transfer pathway involving NADH-cyt b5 reductase, cyt b5, and Mb with mutations in Mb to build an electron relay to Mb model of

HCO (Figure 4.1C), in order to increase its O2 reduction activity.

4.2 Materials and Methods

4.2.1 Gene construction

Gene of soluble part of bovine cyt b5 and gene of NADH-cyt b5 reductase were provided by Dr. Jiangyun Wang. Both genes were subcloned to pET22b plasmid with C- terminal His-tag.

D44K, D65K, E80K mutations were introduced into WT Mb, CuBMb, F33Y-

CuBMb and G65Y-CuBMb by site-directed mutagenesis with following primers:

D44K-f: 5'-GAA ACT CTG GAA AAA CAC AAA CGT TTC AAA CAT CTG AAA

D44K-r: 5'-TTT CAG ATG TTT GAA ACG TTT GTG TTT TTC CAG AGT TTC

D60K-f: 5'-GAA ATG AAA GCT TCT GAA AAA CTG AAA AAA CAT GGT GTT

D60K-r: 5'-AAC ACC ATG TTT TTT CAG TTT TTC AGA AGC TTT CAT TTC

E85K-f: 5'-GGG CAT CAT GAA GCT AAA CTC AAA CCG CTT GCA C

E85K-r: 5'-GTG CAA GCG GTT TGA GTT TAG CTT CAT GAT GCC C

These protein were termed Mb(+6), CuBMb(+6), F33Y-CuBMb(+6) and G65Y-

CuBMb(+6) following Hoffman’s convention.26

4.2.2 Protein expression and purification

Plasmid with NADH-cyt b5 reductase gene was transformed into BL21 (DE3) competent cells (NEB). Cultures of E. coli BL21 (DE3) cells containing the plasmid to express NADH-cyt b5 reductase were grown in LB media for 8 h at 37 ºC and used to inoculate 2 L flasks of LB media containing 100 mg/mL ampicillin. The cells were grown at 37 ºC for 16 h with shaking at 210 rpm, following 4 h induction with 1 mM Isopropyl β- D-1-thiogalactopyranoside (IPTG, GoldBio Technology, St. Louis, MO) and harvested at 9000 x g.

The harvested cell paste was re-suspended in a lysis buffer containing 50 mM

NaH2PO4, 10 mM imidazole, pH 8.0, 300 mM NaCl (50 mL). The suspension was then

72 lysed using sonication (Misonix Sonicator 4000, 0.5 inch diameter probe) for a work time of 6 min (6 sec. on, 10 sec. rest). The crude lysate was centrifuged at 20,000 x g for 30 min. The supernatant was incubated with Ni-NTA resin (5 mL, QIAGEN) for 0.5 h. Ni-NTA resin was washed with lysis buffer (10 mL) and protein was eluted with imidazole gradient. Fractions with target protein were pooled together and loaded unto size-exclusion column with Sephacryl S-100 resin (GE lifescience) for further purification. The identity and purity of the purified protein was verified by ESI mass spectrometry (calculated: 31671, observed: 31682).

Plasmid with cyt b5 gene was transformed into BL21 (DE3) competent cells

(NEB). Cultures of E. coli BL21 (DE3) cells containing the plasmid to express cyt b5 were grown in LB media (50 mL) for 16 h at 37 ºC and used to inoculate 2 L flasks of LB media containing 100 mg/mL ampicillin. The cells were grown at 37 ºC for 8 h with shaking at 210 rpm, following 16 h induction with 1 mM IPTG and harvested at 9000 x g. cyt b5 was purified by Ni-NTA column similar to NADH-cyt b5 reductase, or using ion exchange chromatography 28,29 before final size-exclusion chromatography. Identity and purity of the purified protein was verified by ESI mass spectrometry (calculated: 12860, observed: 12862).

Plasmids with various Mb genes were transformed into BL21 (DE3) competent cells (NEB). Cultures of E. coli BL21 (DE3) cells containing the plasmids to express Mb were grown in LB media (50 mL) for 16 h at 37 ºC and used to inoculate 1 L flasks of TB media (tryptone, 12 g, yeast extract, 24 g, glycerol 0.4 mL in 1 L H2O with 0.017 M

KH2PO4, 0.072 M K2HPO4) containing 100 mg/mL ampicillin. The cells were grown at 37 ºC for 8 h with shaking at 210 rpm, following 16 h induction with 1 mM IPTG and harvested at 9000 x g.

Mb (+6) was expressed solubly. Purification of Mb (+6) was based on protocol developed by Hoffman group with modification.27 The cell pellet was resuspended in 50 mL of lysis buffer (10 mM Tris-HCl, 1 mM EDTA, 0.1% Triton X-100, and a few crystals of phenylmethylsulphonyl fluoride (PMSF), pH 8.0), and lysed by sonication. The crude lysate was centrifuged at 20,000 x g for 30 min. The supernatant was incubated with 20 mL Sepharose CM resin (GE lifescience) pre-equilibrated with 20 mM Tris, pH 8.0 for

10 min. The resin was washed on a coarse frit with 20 mM Tris, pH 7.2 (50 mL). Protein was eluted by 20 mM Tris, 200 mM KCl, pH 8.0 (50 mL). The protein was concentrated to 8 mL and exchanged to potassium phosphate buffer. It is further purified by size- exclusion chromatography (Sephacryl S-100, GE lifescience). The identity and purity of protein was verified by ESI-MS.

Other Mb mutants, including CuBMb (+6), F33Y-CuBMb (+6) and G65Y-CuBMb (+6), were purified based on a modified inclusion body protocol. 8,30 Cell pellet was lyzed as Mb (+6). After centrifugation, the pellet was collected, resuspended and washed twice with H2O to remove Triton X-100 and remaining nucleic acid. The pellet was then resuspended in 50 mL of 7M guanidine hydrochloride (GuHCl) and sonicated until complete solubilization.

After denaturation, the protein was refolded in the presence of heme. A hemin-

CN stock solution containing 25 mg KCN and 7.5 mg hemin in 5 mL H2O was added fast with stirring to 500 mL of cold H2O. The solution was allowed to stir for ~10 min. Then the protein/GuHCl solution was added dropwise to the hemin-CN solution and allowed to stir for ~1 h after the last addition. The solution was centrifuged at 9000 x g for 30 min to remove precipitant. The red/orange supernatant (~500 mL) was then dialyzed against 12 L of 20 mM Tris, pH 7.2 overnight.

The protein solution was centrifuged at 9000 x g for 30 min to remove precipitate. The supernatant was incubated with pre-equilibrated Sepharose CM resin for 10 min. The resin was filtered out by a coarse frit and washed with 20 mM Tris, pH 8.0 (50 mL). Protein was eluted by 20 mM Tris, 200 mM KCl, pH 8.0 (50 mL). The protein was concentrated to 8 mL and exchanged to potassium phosphate buffer. It is further purified by size-exclusion chromatography. The identity and purity of protein was verified by ESI-MS (F33Y-CuBMb (+6), calculated: 17386.3, observed: 17393.0; G65Y-

CuBMb(+6), calculated: 17476.4, observed: 17484.0).

4.2.3 Stopped flow UV-vis absorbance

Experiments were performed on an Applied Photophysics Ltd. (Leatherhead, U.K.) SX18.MV stopped-flow spectrometer equipped with a 256 element photodiode

74 array detector. Two-syringe mixing was employed to mix equal volumes of ferrous cyt b5 with myoglobin in 5 mM pH 6 potassium phosphate buffer anaerobically. The instrument was prepared for anaerobic stopped-flow by rinsing its lines out several times with buffer that had been degassed by bubbling argon gas through it. Special glass outer syringes fit with Teflon stoppers into which an argon line was run maintained an oxygen free environment. The proteins were degassed under Schlenk line and transferred into glovebag, where they were transferred into syringes. The syringes were sealed, transferred out and mounted unto stopped-flow instrument under argon flow. All reported data sets originally consisted of 1000 spectra collected over 1 to 500 s using logarithmic sampling. The integration period and minimum sampling period were both 1 ms. A water bath, connected to the syringe compartment and set to 25 °C, provided temperature control.

4.2.4 O2 consumption assay

O2 consumption was measured by using an Oxygraph Clark-type oxygen electrode (Hansatech Instruments) at 25°C or 37°C in 5 mM potassium phosphate buffer, pH 6.0. All experiments were performed three times to obtain standard deviation.

The electrode was calibrated against air-saturated buffer and O2-depleted buffer prior to use. Protein was exchanged to 5 mM potassium phosphate buffer, pH 6.0. The buffer was treated with chelex beads overnight before use. The final concentrations of myoglobin, cyt b5 and NADH-cyt b5 reductase were adjusted to 50 nM, 5 μM and 0.64

μM based on Soret absorption of Mb and cyt b5, and absorption of FAD in NADH-cyt b5 reductase.

4.3 Results and Discussion

4.3.1 UV-vis spectroscopy of proteins

NADH-cyt b5 reductase was purified with metal affinity and size exclusion chromatography. UV-vis spectrum of as-purified protein showed absorption at 390, 460

75 and 490 nm, corresponding to absorption of FAD. Upon reduction by dithionite, the peaks disappear with another much lower absorption peak at 420 nm.

Figure 4.2 UV-vis spectra of as-purified (black) and reduced (red) NADH-cyt b5 reductase.

Cyt b5 exhibited a Soret peak at 413 nm with visible peaks at 530 nm and 561 nm. Upon reduction, the Soret was moved to 423 nm with increased intensity. The visible peaks had increased intensity as well. The spectra are typical of cytochromes.

Figure 4.3 UV-vis spectra of ferric (black) and ferrous (red) cyt b5.

4.3.2 Size exclusion chromatography to determine protein-protein interaction

As introducing three Lys mutations in Mb are shown to increase electrostatic

26 interaction between cyt b5 and Mb , we tried to compare interaction between F33Y-

CuBMb and cyt b5, and between G65Y-CuBMb(+6) and cyt b5 by size exclusion chromatography.

Figure 4.4 Analytical size-exclusion chromatography of engineered Mb and cyt b5.

As shown in Figure 4.4, F33Y-CuBMb, G65Y-CuBMb(+6) and cyt b5 were eluted at 32 min, 37 min, and 25 min, respectively. After mixing F33Y-CuBMb, G65Y-CuBMb(+6) with cyt b5 in 1:1 ratio and passing the mixture through the same column, there were two peaks on chromatogram, corresponding to cyt b5 and Mb. The fractions corresponding to each peak were collected and submitted to mass spectrometry. Mass spec confirmed that neither F33Y-CuBMb nor G65Y-CuBMb(+6) was co-eluted with cyt b5.

The association constant between Zn-protoporphyrin substituted Mb and cyt b5 was 350 M-1, as determined by Isothermal titration calorimetry.23 After introducing three

Lys into Mb, the Ka was increased by 10-fold.25 Since the affinity between the two proteins is not high enough, it is not surprising that size exclusion chromatography cannot detect the interaction.

4.3.3 Stopped-flow for electron transfer between cyt b5 and Mb

To directly evaluate electron transfer rate between Mb and cyt b5, kinetics of reaction between ferrous cyt b5 and ferric Mb were studied by Stopped-flow spectroscopy. Stoichiometric amount of G65Y-CuBMb/ G65Y-CuBMb(+6) and cyt b5 were mixed anaerobically and the spectra were recorded.

Figure 4.5 Stopped-flow UV-vis absorption spectra of A) 5 μM ferrous cyt b5 and 5μM G65Y-

CuBMb over 50 s, B) 5μM ferrous cyt b5 and 5μM G65Y-CuBMb(+6) over 10 s. Fittings by SPECFIT gave first order rate constants of 0.032±0.009 s-1 and 5.5±0.1 s-1, respectively.

As shown in Figure 4.5, the 530 nm and 561 nm peaks lowered over time, indicating that cyt b5 was oxidized. Fitting of spectra from 500 to 1000 nm gave first -1 -1 order rate constants of 0.032±0.009 s and 5.5±0.1 s , for G65Y-CuBMb/cyt b5 and

G65Y-CuBMb(+6)/cyt b5, respectively. G65Y-CuBMb(+6)/cyt b5 exhibited more than 100- fold increase in electron transfer rate compared to G65Y-CuBMb/cyt b5, confirming introduction of three Lys into Mb facilitates the electron transfer between Mb and cyt b5.

-1 The electron transfer rate constant of G65Y-CuBMb(+6)/cyt b5 (5.5 s ) is much 4 -1 9 -1 lower compared with that in native HCO (>10 s ) and Zn-Mb/cyt b5 (10 s ). In native

HCO and Zn-Mb/cyt b5 systems, electron transfer happens intra-molecularly or in

78 preformed complex. In of G65Y-CuBMb(+6)/cyt b5, electron transfer complex is not preformed, which could explain the small rate constant measured.

4.3.4 Oxidase activity

After confirming electron transfer is fast between Mb(+6) mutants and cyt b5, we tested O2 consumption of this system. As shown in Figure 4.1C, NADH was added as electron donor. The electrons transfer to cyt b5 through NADH- cyt b5 reductase.

Ferrous cyt b5 in turn oxidizes engineered Mb. For the Mb mutant, based on previous study, G65Y-CuBMb gives better activity than F33Y-CuBMb, while WT Mb generates >95% ROS during reaction.8

100.0 90.0

) 80.0

1 - 70.0 60.0 50.0 40.0 30.0

Turnover Frequency (s Frequency Turnover 20.0 10.0 0.0

Figure 4.6 O2 consumption of F33Y-CuBMb(+6), G65Y- CuBMb(+6), and Mb(+6). Typical condition: 1 mM NADH, 0.16 μM NADH-cyt b5 reductase, 5 μM cyt b5, 0.25 μM F33Y-CuBMb(+6) and G65Y- CuBMb(+6), 0.025 μM Mb(+6).

As shown in Figure 4.6, F33Y-CuBMb(+6) displayed an oxygen consumption rate -1 -1 of 6.3 s , and G65Y- CuBMb(+6) has higher activity at 22.6 s while the mutants without three Lys had negligible activity at the same condition. For comparison, the highest O2 consumption rate from Mb mutants with ascorbic acid/TMPD as reductants is 0.078 s-1.

The large increase of O2 consumption rate indicates efficient electron transfer is important for oxidase reaction.

Surprisingly, the control, Mb(+6) gave an even higher rate of 89 s-1. As shown previously, WT Mb consumes O2 using ascorbic acid/TMPD as reductant, but the product is mostly ROS.8 We are working on determining the product of O2 reduction in the system.

Working with Cui Chang in the lab, we optimized reaction condition to further improve rate of O2 consumption. As shown in Figure 4.7, at 37 °C with higher amount of

NADH and NADH-cyt b5 reductase, G65Y-CuBMb(+6) displayed an oxygen consumption rate of 52 s-1, similar to the native enzyme.

Figure 4.7 Oxidase activity of G65Y-CuBMb(+6) under optimized condition, in comparison with that of cbb3 oxidase from Vibrio cholera at similar condition. The arrow indicates the time when the enzyme was added and the activity is determined by the slope of O2 consumption. Reaction

80 condition for G65Y-CuBMb(+6): 37 °C, 2 mM NADH, 0.64 μM NADH-cyt b5 reductase, 5 μM cyt b5, 0.05 μM G65Y- CuBMb(+6). Reaction condition for cbb3 oxidase: 37 °C, 5 mM ascorbic acid,

0.5 mM TMPD, 100 μM cyt c, 0.05 μM cbb3 oxidase. Vibrio cholera cbb3 oxidase provided by Dr. Hanlin Ouyang and Prof. Robert Gennis.

4.4 Summary

In summary, we used NADH-cyt b5 reductase and cyt b5 to relay electrons to the engineered Mb. The protein-based electron transfer enhances electron transfer rate by more than 100 fold. O2 consumption of engineered Mb, G65Y-CuBMb(+6) was shown to be close to that of native HCO. The result indicates efficient electron transfer is important for oxidase activity. We will investigate the product of reaction by the system.

4.5 References

1. Blanca, J. A. G.-h., Jon, B., Ma, J., and Gennis, R. B. (1994) MINIREVIEW The Superfamily of Heme-Copper Respiratory Oxidases, J. Bacteriol. 176, 5587-5600. 2. Brzezinski, P., and Gennis, R. B. (2008) Cytochrome c oxidase: exciting progress and remaining mysteries, J. Bioenerg. Biomembr. 40, 521-531. 3. Wikström, M. (2012) Active site intermediates in the reduction of O2 by cytochrome oxidase, and their derivatives, Biochimica et Biophysica Acta (BBA) - Bioenergetics 1817, 468-475. 4. Yoshikawa, S. (1998) Redox-Coupled Crystal Structural Changes in Bovine Heart Cytochrome c Oxidase, Science 280, 1723-1729. 5. Buschmann, S., Warkentin, E., Xie, H., Langer, J. D., Ermler, U., and Michel, H. (2010) The structure of cbb3 cytochrome oxidase provides insights into proton pumping, Science 329, 327-330. 6. Bewley, M. C., Marohnic, C. C., and Barber, M. J. (2001) The structure and biochemistry of NADH-dependent cytochrome b5 reductase are now consistent, Biochemistry 40, 13574-13582. 7. Durley, R. C., and Mathews, F. S. (1996) Refinement and structural analysis of bovine cytochrome b5 at 1.5 A resolution, Acta Crystallogr D Biol Crystallogr 52, 65-76.

8. Miner, K. D., Mukherjee, A., Gao, Y. G., Null, E. L., Petrik, I. D., Zhao, X., Yeung, N., Robinson, H., and Lu, Y. (2012) A Designed Functional Metalloenzyme that Reduces O2 to H2O with Over One Thousand Turnovers, Angew. Chem., Int. Ed. 51, 5589-5592. 9. Geren, L. M., Beasley, J. R., Fine, B. R., Saunders, A. J., Hibdon, S., Pielak, G. J., Durham, B., and Millett, F. (1995) Design of a Ruthenium-Cytochrome c Derivative to Measure Electron Transfer to the Initial Acceptor in Cytochrome c Oxidase, J. Biol. Chem. 270, 2466-2472. 10. Roberts, V. A., and Pique, M. E. (1999) Definition of the Interaction Domain for Cytochrome con Cytochrome c Oxidase: III. Prediction of the Docked Complex by a Complete Systematic Search, J. Biol. Chem. 274, 38051-38060. 11. Ramirez, B. E., Malmström, B. G., Winkler, J. R., and Gray, H. B. (1995) The currents of life: the terminal electron-transfer complex of respiration, Proceedings of the National Academy of Sciences 92, 11949-11951. 12. Brzezinski, P. (1996) Internal electron-transfer reactions in cytochrome c oxidase, Biochemistry 35, 5611-5615. 13. Winkler, J. R., Malmstrom, B. G., and Gray, H. B. (1995) Rapid electron injection into multisite metalloproteins: intramolecular electron transfer in cytochrome oxidase, Biophys. Chem. 54, 199-209. 14. Adelroth, P., Brzezinski, P., and Malmstrom, B. G. (1995) Internal electron transfer in cytochrome c oxidase from Rhodobacter sphaeroides, Biochemistry 34, 2844-2849. 15. Ruitenberg, M., Kannt, A., Bamberg, E., Ludwig, B., Michel, H., and Fendler, K. (2000) Single-electron reduction of the oxidized state is coupled to proton uptake via the K pathway in Paracoccus denitrificans cytochrome c oxidase, Proc. Natl. Acad. Sci. U. S. A. 97, 4632-4636. 16. Bloch, D., Belevich, I., Jasaitis, A., Ribacka, C., Puustinen, A., Verkhovsky, M. I., and Wikstrom, M. (2004) The catalytic cycle of cytochrome c oxidase is not the sum of its two halves, Proc. Natl. Acad. Sci. U. S. A. 101, 529-533.

17. Belevich, I., Bloch, D. A., Belevich, N., Wikstrom, M., and Verkhovsky, M. I. (2007) Exploring the proton pump mechanism of cytochrome c oxidase in real time, Proc. Natl. Acad. Sci. U. S. A. 104, 2685-2690. 18. Oliveberg, M., and Malmstrom, B. G. (1991) Internal electron transfer in cytochrome c oxidase: evidence for a rapid equilibrium between cytochrome a and the bimetallic site, Biochemistry 30, 7053-7057. 19. Verkhovsky, M. I., Morgan, J. E., and Wikstrom, M. (1992) Intramolecular electron transfer in cytochrome c oxidase: a cascade of equilibria, Biochemistry 31, 11860-11863. 20. Livingston, D. J., McLachlan, S. J., La Mar, G. N., and Brown, W. D. (1985) Myoglobin: cytochrome b5 interactions and the kinetic mechanism of metmyoglobin reductase, J. Biol. Chem. 260, 15699-15707. 21. Arihara, K., Cassens, R. G., Greaser, M. L., Luchansky, J. B., and Mozdziak, P. E. (1995) Localization of metmyoglobin-reducing enzyme (NADH-cytochrome b(5) reductase) system components in bovine skeletal muscle, Meat Sci 39, 205-213. 22. Takesue, S., and Omura, T. (1970) Purification and properties of NADH- cytochrome b5 reductase solubilized by lysosomes from rat liver microsomes, J Biochem 67, 267-276. 23. Liang, Z.-X., Jiang, M., Ning, Q., and Hoffman, B. M. (2002) Dynamic docking and electron transfer between myoglobin and cytochrome b(5), J. Biol. Inorg. Chem. 7, 580-588. 24. Wheeler, K. E., Nocek, J. M., Cull, D. A., Yatsunyk, L. A., Rosenzweig, A. C., and Hoffman, B. M. (2007) Dynamic Docking of Cytochrome b5 with Myoglobin and alpha-Hemoglobin: Heme-Neutralization “Squares” and the Binding of Electron- Transfer-Reactive Configurations, J. Am. Chem. Soc. 129, 3906-3917. 25. Nocek, J. M., Knutson, A. K., Xiong, P., Co, N. P., and Hoffman, B. M. (2010) Photoinitiated singlet and triplet electron transfer across a redesigned [myoglobin, cytochrome b5] interface, J. Am. Chem. Soc. 132, 6165-6175. 26. Xiong, P., Nocek, J. M., Vura-Weis, J., Lockard, J. V., Wasielewski, M. R., and Hoffman, B. M. (2010) Faster interprotein electron transfer in a [myoglobin, b5] complex with a redesigned interface, Science 330, 1075-1078.

27. Trana, E. N., Nocek, J. M., Knutson, A. K., and Hoffman, B. M. (2012) Evolving the [myoglobin, cytochrome b(5)] complex from dynamic toward simple docking: charging the electron transfer reactive patch, Biochemistry 51, 8542-8553. 28. Funk, W. D., Lo, T. P., Mauk, M. R., Brayer, G. D., MacGillivray, R. T. A., and Mauk, A. G. (1990) Mutagenic, electrochemical, and crystallographic investigation of the cytochrome b5 oxidation-reduction equilibrium: involvement of asparagine-57, serine-64, and heme propionate-7, Biochemistry 29, 5500- 5508. 29. Lloyd, E., Ferrer, J. C., Funk, W. D., Mauk, M. R., and Mauk, A. G. (1994) Recombinant Human Erythrocyte Cytochrome b5, Biochemistry 33, 11432-11437. 30. Yeung, N., Lin, Y.-W., Gao, Y.-G., Zhao, X., Russell, B. S., Lei, L., Miner, K. D., Robinson, H., and Lu, Y. (2009) Rational design of a structural and functional nitric oxide reductase, Nature 462, 1079-1082.

Chapter 5 Explore the Role of Equatorial His in Redox Potential Tuning of Azurin4

5.1 Introduction

5.1.1 Type 1 copper proteins

Copper is the second most abundant transition metal in biological systems, next to iron.1 As a diverse family of proteins, copper proteins could be divided into several types based on ligand sets, spectroscopic features and functions.2,3 Mononuclear Type

1 (T1) copper centers and dinuclear CuA centers are the two types mainly responsible for copper-mediated electron transfer.

There are around 20 proteins identified so far carrying T1 copper centers, including single domain proteins, multi-domain proteins with only T1 centers or in coexistence with other copper centers (Table 5.1 and Figure 5.1). These proteins transfer electrons in important biological processes such as photosynthesis4,5, respiration6, and nitrogen metabolism7. Despite variance in structure, amino acid sequence, redox potential and redox partners (Table 5.1), T1 copper proteins have unique spectroscopic properties, which differentiate them from other types of copper protein.8,9 These properties includes strong absorption at ~625 nm and small hyperfine splitting values. Besides these features, T1 copper protein also share the cupredoxin scaffold, and have a conserved ligand set. 10-13

4 Portions of this chapter are previously published and are here reproduced with permission from Elsevier for Wilson, T. D., Yu, Y., and Lu, Y. (2012) Understanding Copper-thiolate Containing Electron Transfer Centers by Incorporation of Unnatural Amino Acids and the CuA Center into the Type 1 Copper Protein Azurin, Coord. Chem. Rev. 257, 260-276. 85

Table 5.1 Properties of T1 copper proteins

Name Organism First PDB code for Ligand set Em Redox partner isolated from reporte first structure (mV d )

Single domain

Azurin Bacteria 196214 1AZU 1Cys,2His, 1Met, 3101 - 1Carbonyl oxygen 5

Amicya Mehtylotrophic 198116 1MDA 1Cys, 2His, 1Met 2601 methylamine nin bacteria 7 dehydrogenase, cytchrome c551

Plastoc Plant/algae/cya 19604 1PLC 1Cys, 2His, 1Met 3705 cytochrome f, P700+ yanin nobacteria

Peudoa Denitrifying 197318 1PAZ 1Cys, 2His, 1Met 2801 nitrite reductase zurin bacteria and 9 methylotrophs

Rusticy Acidophilic 197520 1RCY 1Cys, 2His, 1Met 6706 cytochrome c, cytochrome anin bacteria c4

Auracy Photosynthetic 199221 1QHQ 1Cys, 2His, 1Met 2402 - anin bacteria 1

Plantac Plants 197422 2CBP 1Cys, 2His, 1Met 3102 - yanin 3

Halocy Haloalkaliphilic 199324 - 1Cys, 2His, 1Met 1832 - anin archaea 4 Natronobacteri um pharaonis

Sulfocy Acidophilic 200125 - 1Cys, 2His, 1Met 3002 - anin archaea 5 Sulfolobus acidocaldarius

Nitroso Autotrophic 200126 1IBY 1Cys, 2His, 1Glu, 8527 - cyanin bacteria 1H2O

Table 5.1(continued) Properties of T1 copper proteins

Name Organism isolated First PDB Ligand set Em (mV) Redox partner from report code for ed first structure

Multidomain protein with T1 center

Stellacya Plants 19672 1JER 1Cys, 2His, 1Gln 19023 - nin 8

Uclacyani Plants 19982 - 1Cys, 2His, 1Met 32029 - n 9

Dicyanin Plants 2000 - 1Cys, 2His, 1Gln - - 30

Multidomain protein with T1 center and other copper center

Laccase fugi - 1A65 1Cys, 2His, 465- - (1Leu/Phe) 77831-33

Plants - 1Cys, 2His, 1Met 43434,35 -

Ascorbat Plants - 1AOZ 1Cys, 2His, 1Met 35036 - e oxidase

Ceruplas animals 19483 1KCW 1Cys, 2His, (1Leu) >100038(r - min 7 edox inactive)

Ceruplas 1Cys, 2His, 1Met 44839(red - min ox active)

Hephaest Mammals 19994 - in 0

Fet3p yeast 19944 1ZPU 1Cys, 2His 42742 - 1

Nitrite Plants, bacteria - 1NIA 1Cys,2His, 1Met, 2607 - reductase 1Carbonyl oxygen

Figure 5.1 Crystal structures of the T1 copper proteins. Secondary structure (α helix and β sheet) is shown in carton diagram, copper is shown as purple ball and ligands are shown in licorice diagram. Name of protein and PDB ID are below each structure.

Figure 5.2 Electronic absorption (A) and EPR (B) spectra of Azurin. The high absorption at 628 nm in electronic absorption and narrow hyperfine splitting (Az) in EPR spectrum are the hallmarks of T1 copper protein.

Even though the amino acid sequences and overall structures vary among different T1 copper proteins, the ligand composition, ligand-metal distance and geometry of T1 copper center are almost identical in different copper proteins.8,10,43 As the most conserved structural feature, T1 copper protein invariably contains two His and one Cys as equatorial copper ligands. In T1 copper proteins, His coordinates with copper through Nδ, in contrast to Nε used by T2 and other copper proteins. The Cu-His bond length is about 2.0 Å in T1 copper protein, typical for such type of bonds. On the

89 other hand, the Cu-Cys bond lengths range from 2.07 to 2.26 Å, relatively short compared to normal copper complexes and other copper proteins.13 The short Cu-S distance is key to the unique spectroscopic properties of T1 copper and is maintained through extensive hydrogen bonding and protein scaffold.13,43 The 2His/1Cys ligand set forms a pseudotrigonal plane, with average bond angles in Cu(II) protein to be (101± 2.5)°, (117± 4.1)° and (134± 2.8)°, calculated from crystal structures with 2.0 Å or higher resolution.44 The Cu–Sγ–Cβ–Cα and Sγ–Cβ–Cα–N dihedral angles are also consistently close to 180°, making Cu–Sγ bond coplanar with Cys side chain and backbone. The ligand set and geometry of T1 copper center are believed to be the source of their unique spectroscopic properties, while also contributing to the redox potential and electron transfer function in cupredoxins.

A)) B) Figure) 5.3 H-bonding around Cys112 (A) and other ligands (B) of azurin. PDB ID: 4AZU

5.1.2 Mutagenesis of copper ligands

Due to the importance of ligands in spectroscopy and reduction potential of T1 copper proteins, a myriad of site directed mutagenesis with natural or unnatural amino acids have been carried out to probe the role of individual residues in the first coordination sphere. Axial position for T1 copper center shows more variation, as Met/Gln/non- coordinating residues exist in native protein. Mutagenesis of axial ligand has been carried out in azurin,15,45-47 nitrite reductase,48-50 amicyanin,51 rusticyanin,52

90 pseudoazurin,53 laccase,54 and stellacyanin.29,55,56 Mutation of axial ligand in different T1 copper protein generally results in a protein that retains the copper binding ability, but with different reduction potential or altered spectroscopic properties. An early work replaced Met121 in azurin with all other 19 amino acids without altering T1 character of copper center.46 While changing axial ligand to hydrophobic ligands such as Ala, Val, Leu, Ile increases reduction potential by 40-160mV,15 substitution with Glu or Gln decreases reduction potential by 100-260mV.15,57 As axial ligand is changed from Gln to Met to more hydrophobic residues, reduction potential of native protein increases. It is also suggested that axial ligand involves in tuning potential from theoretical study.58,59 Dennison and coworker changed axial Met of cucumber basic protein to Gln and Val. As axial ligand changes from Gln to Met to Val, electron self-exchange rate increases by one order of magnitude and reduction potential increases by ~350 mV.60 Within T1 copper protein, there are two classes of proteins with slightly different spectroscopic features. Typical T1 copper proteins, such as plastocyanin and azurin have absorption at ~600nm and axial EPR signal, whereas “perturbed” T1 copper protein or green copper proteins have an additional ~400 nm absorption peak in their UV-vis spectra, as well as rhombic EPR signals. At the same time, the “perturbed” T1 copper proteins have longer Cu-S(Cys) distances and shorter Cu-axial ligand distances.59 A more extreme case comes from newly discovered nitrosocyanin, with a red color arising from the dominant absorption at 400 nm.12 Although the strong absorption and 1Cys/2His/1Glu ligand set resembles T1 copper protein, nitrosocyanin -4 -1 has large hyperfine splitting values (A|| ~ 150×10 cm ) in its EPR spectrum and low reduction potential (85mV), which falls into the range of T2 copper protein.12,26,61 Solomon and coworkers proposed “coupled distortion” theory based on a suite of spectroscopic studies in combination with theoretical calculations to explain the variance in electronic absorption and concomitant color change from blue to green to red in native proteins. This theory states that shorter Cu-axial ligand distances result in distortion of the T1 copper geometry toward tetragonal, which elongates the Cu-S(Cys) distance.59 This distortion renders the pσ(Cys)-Cu CT more favorable than pπ(Cys)-Cu CT, which is manifested as an increase in the ~400nm absorption over the ~600nm absorption in the UV-vis spectrum. Mutational studies on axial ligand of various T1

91 copper proteins have validated the “coupled distortion theory”. By changing a weak Met to His62-64 or Glu,65-67 the blue copper protein azurin can be converted to a green copper protein. By mutating Met to a weaker ligand such as Thr, the natively green copper protein, nitrite reductase, has been converted to a blue copper protein.68 As the Cu-S(Cys) bond defines the properties of type I copper sites,8 mutation of Cys to other natural amino acids will dramatically alter the copper site. Substitution of any other amino acid for Cys will result in loss of the intense LMCT charge transfer bands, arising from the interaction of the Cys-S with copper. So far, only Cys112Asp mutation in azurin has been characterized. Mutation of Cys to Asp makes azurin a type -4 -1 II copper protein, as evidenced by large hyperfine splitting (A|| ~ 152×10 cm ) in the EPR spectrum and slow electron transfer.69-72 Addition of another mutation on axial position, Met121Leu(Phe/Ile), results in a novel type zero copper center, which has the small parallel hyperfine splitting values and rapid electron transfer characteristic of T1 copper centers, but no longer fits the classification of T1 copper due to the loss of the copper-thiolate interaction.73-76 Moreover, there is only a slight increase of reorganization energy (0.9-1.1 eV) compared with wild type azurin, much less than type II copper protein. ET rate of type zero protein is 100-fold higher than Cys112Asp mutant, a typical T2 protein.73,74,76 Although equatorial His is highly conserved in T1 copper protein, mutation of His does not impair copper binding ability of the protein. Canters and coworkers mutated two His into Gly separately, the resulting protein still has T1 characters.77,78 As His to Gly mutation creates extra space around copper, exogenous ligands such as halides, azides and imidazoles could diffuse into His46Gly and His117Gly azurin mutants and coordinate with copper. Depending on type of external ligand, the mutants will be either T1 or T2 copper protein.77-79 His117Gly and His46Gly mutations also change solvent exposure of copper site. Without added external ligand, His117Gly azurin has a reduction potential of 670 mV, much higher than that of WT azurin (310 mV). The high reduction potential is due to loss of water ligand during reduction. Addition of external ligand will lower reduction potential.80 The open coordination site of His117Gly makes it possible to study ET using imidazole-modified complexes.81,82 The mutants generally

92 exhibit lower electron transfer rate. As properties of imidazole affects ET rate, it is implicated that His is also important in WT protein.83 5.1.3 Unnatural amino acids to probe

The use of mutagenesis to probe the properties of T1 copper centers has revealed important features of these centers. However, due to the limited number of natural amino acids, especially those capable of coordinating a metal ion, it is impossible to fine-tune the ligand set of T1 copper centers. The appealing option to accomplish such fine-tuning of the ligand set is to incorporate unnatural amino acids, consequently adding customized ligand side-chains into the T1 copper center. Among different methods discussed in chapter 1, expressed protein ligation (EPL) has been proven to be an effective approach for unnatural amino acids incorporation in azurin. Azurin has a cysteine close to its C-terminus, and 3 of the 5 ligands are in last 17 amino acids (Cys112, His117 and Met121), making them accessible to EPL. Lu group has used this method to study the electronic structure, spectroscopic properties and reduction potential of azurin through the incorporation of various unnatural amino acids, particularly at the Met121 and Cys112 positions (Figure 5.4).84-87 To test the role of axial ligand in tuning reduction potential of T1 copper protein, Berry, Garner et al. incorporated Met analogues with different hydrophobicity into axial position of azurin.85,87 Reduction potential of azurin varied from 222 to 449 mV at pH 4.0, correlated to hydrophobicity of the axial ligand. Together with results obtained from natural amino acids mutagenesis, these studies firmly established correlation between hydrophobicity and reduction potential and revealed role of axial ligand in reduction potential tuning. Clark et al. mutated axial Met to Cys, a strong ligand, then to unnatural amino acid homocysteine (Hcy), a strong ligand with longer side-chain. The resulting Met121Cys azurin has an additional ~450 nm absorption while in Met121Hcy ~410 nm dominates over ~625 nm peak. Together with EPR evidence, it was suggested that within the same scaffold, blue copper protein azurin is converted a green copper protein, then to red copper protein.88 Interestingly, the engineered red copper protein, Met121Hcy azurin, has a low reduction potential (113mV) similar to that of nitrosocyanin (85mV). 93

As an isostructual analogue of Cys, Selenocysteine (SeC) can replace Cys without major structure perturbation. This strategy has been employed by Lu and coworkers as a spectroscopic probe for T1 copper center.84,86,89 The protein, Cys112SeC azurin showed similar reduction potential as WT azurin(328 mV vs. 316mV at pH4) and red shifted LMCT band at 677 nm.84

Figure 5.4 Unnatural amino acids incorporated into azurin by EPL method.

His117, one of the planer ligand in copper center of Azurin, is conserved in blue copper protein. Site-directed mutagenesis studies have shown that His117, which is the center of a hydrophobic patch, plays an important role in the electron transfer in azurin81,90-92. Also, introducing a positive charge near His117 can increase the reduction potential.92 As a ligand to copper, the electron density of His117 position may directly influence the reduction potential of azurin. However, the limitation of replacement of histidine with natural amino acids prevents insight of the role of His117. In this study, we introduce a series of structural analogues of histidine with different pKa into 117 position

(see Figure 5.5) by EPL, to study the influence of H117 on the reduction potential of azurin.

Figure 5.5 Histidine and histidine analogues

5.2 Materials and Methods

5.2.1 General

All natural amino acids and resins were purchased from Chem-Impex Int. Co. Unnatural amino acid were purchased from Chem-Impex, Peptech or synthesized. Other chemicals were obtained from Acros or Sigma-Aldrich. Protecting groups used for Fmoc-SPPS were Cys(Trt), Ser(OtBu), Glu(OtBu), Cys(StBu), Asn(Trt), His(Trt), Lys(Boc), Thr(OtBu).

Mass spectral data was collected at the Mass Spectrometry Laboratory, School of Chemical Sciences, University of Illinois by Electrospray Ionization (ESI) mass spectrometry using either Waters Quattro II or Waters ZMD Quadrupole Instrument.

UV-vis spectra were taken on an HP diode array spectrometer or a Cary 5000 spectrometer. X-band EPR spectra were collected on a Varian E-122 spectrometer at the Illinois EPR Research Center (IERC). The samples were run at ∼30 K using liquid He and an Air Products Helitran cryostat with 20% glycerol. Magnetic fields were

95 calibrated with a Varian NMR gaussmeter, and the frequencies were measured with an EIP frequency counter.

4(5)-nitrohistidine was synthesized by nitration of L-Histidine by nitrate acid as reported.93 with yield of 62%.

5.2.2 Peptides

The C-terminal peptides with Histidine analog (H2N-CysThrPheProGlyHis(MeH, SHis, Ntr or AmH)SerAlaLeuMetLysGlyThrLeuThrLeuLys-COOH) were synthesized on a 0.175mmol scale with Advanced ChemTech Model 90 peptide synthesizer using standard Fmoc-based chemistry. Wang resin preloaded with Fmoc-Lys(Boc) was pre- swelled in DMF (6 x 10 min, 6 mL). All Fmoc-deprotections were accomplished using 20% piperidine/DMF (v/v) (3 x 3 min, 6 mL). Synthesis of the peptide was completed using a five-fold excess of amino acids pre-activated in 0.4 M N-methylmorpholine (NMM) (6 mL) and O-(1H-6-chlorobenzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium hexafluorophosphate (HCTU) (4 equiv.) for 3 min and coupled to the resin for 45 min under N2 sparging. Amino acids were doubly coupled when necessary and completion of the couplings was monitored by qualitative Kaiser test.

Peptide cleavage from the resin is achieved by incubating the resin with a cocktail with 92.5% (v/v) trifluoroacetic acid (TFA), 2.5% triisopropylsilane, 2.5% thioanisole, 2.5% H2O at 25 C for 2 h. Preparative RP-HPLC was done with a Waters Delta 600 system and a DeltaPak 300×19mm prep column. Solution A was 0.1 % TFA in H2O, and solution B was 80 % acetonitrile/20 % H2O with 0.1 % TFA. Unless otherwise stated, a linear gradient of 20% to 70% B over 23 min was used for all runs.

5.2.3 Expressed protein ligation

Expressed protein ligation is performed as described previously.94 Cultures of E. coli BL21 (DE3) cells containing the NEB pTXB1 plasmid to express the azurin(1-111)- Intein-CBD fusion protein were grown in LB media for 8 h at 37 ºC and used to inoculate eight 2 L flasks of LB media containing 100 mg/mL ampicillin. The cells were grown at

37 ºC for 16 h with shaking at 210 rpm and harvested at 9000 x g. The cell stock was then frozen stored at -20 ºC for up to 2 months. The frozen cell stock was re-suspended in a lysis buffer containing 20 mM 4-(2- Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES), pH 8.0, 250 mM NaCl, 1 mM EDTA, 1 mM PMSF, 0.1% Triton-X-100 and 1 M urea (50 mL). The suspension was then lysed using sonication (Misonix Sonicator 4000, 0.5 inch diameter probe) for a work time of 6 min (6 s on, 12 s rest). Additional urea was added to bring the final concentration to 1.5 M and the lysate was subjected to a second round of sonication for 3 min work time (6 s on, 12 s off). The crude lysate was centrifuged at 20,000 x g for 30 min. The supernatant was carefully decanted and the fusion protein bound by batch absorption to 70 mL of chitin resin pre-equilibrated with 20 mM HEPES, pH 7.2, 250 mM NaCl, and 1 mM EDTA (buffer 1) for 1-2 h at 4 º C. The chitin resin was then poured into a column and the column headspace was purged with Ar. The column was then washed with 5 column volumes of buffer 1 by cannulation under Ar pressure. Ligations were initiated by the addition of the 17-mer peptide (1.02 mM, 60 mg) and 2 Eq. tris-(2-carboxyethyl)phosphine (TCEP) (3 mM, 30 mg) in 40 mL of degassed buffer 1 (35 mL) containing ~50 mM mercaptophenyl acetic acid (MPAA) (50 mM, 350 mg) to the column under Ar pressure via cannulation. The chitin resin was resuspended in the column and the entire column was agitated gently at 4 ºC for 64 h. After ligation, the column was eluted under Ar pressure and washed with 1 column volume of buffer 1. The eluent was centrifuged at 20,000 x g for 30 min and the supernatant was concentrated using 10,000 MWCO Centricon concentration spin tubes at 3000 x g to a final volume of ~10 mL. The concentrated protein was then exchanged into 50 mM ammonium acetate buffer pH 6.35 via a short desalting column with Sephadex G-25 resin.

Cu titration and anion exchange purification. The desalted sample was titrated with 0.1 Eq. of freshly made 1 mM CuSO4 solution in H2O until the LMCT band (~625 nm) is saturated. The resulting solution was purified by anion exchange chromatography. The holo protein was eluted with Buffer 1 (40mM 3-(N- Morpholino)propanesulfonic acid (MOPS), pH=6.0), and apo protein came after washing

97 with buffer 2 (1M NaCl). The holo protein was exchanged into 50 mM ammonium acetate pH 6.35 for further study.

5.2.4 Electrochemical study

The reduction potential of each mutant was determined by cyclic voltammetry after calibration with WT azurin reduction potential using a CH Instruments 617A potentiostat equipped with a picoamp booster and a Faraday cage. A pyrolytic graphite edge (PGE) electrode was polished, and 2-3 μL of protein solution was applied directly to the electrode following previously described methods.95 After a short incubation time, the electrode was immersed in either 50 mM NaOAc, pH 4.0 with 100 mM NaCl, or 50 mM NH4OAc, pH 7.0 with 100 mM NaCl before data collection. The reduction potentials were measured against Ag/AgCl and converted to NHE.

5.3 Results and Discussion

5.3.1 Azurins with His analogues retain Type 1 characters

The unnatural amino acids were incorporated into His117 of azurin using expressed protein ligation, followed by copper titration, as described previously.95,96 The identity of apo proteins were verified by ESI-MS.

As shown in Figure 5.6, UV-Vis spectra of holo proteins with His analogues 2 2 showed absorption around 625nm (Table 5.2), assigned to S(Cys)pπ→Cu dx -y ligand to metal charge transfer. The absorption is characteristic of blue copper proteins. Besides the ~625 nm absorption, His117Ntr azurin also displayed an absorption centered at 350 nm due to the nitro group.

Figure 5.6 UV-Vis spectra of holo azurin with histidine and histidine analogues incorporated.

Table 5.2 Properties of azurin mutants with His analogues.

pKa λmax Reduction potential /nm /mV vs. NHE WT azurin 7.03b 627 352±2 (7.18)a His117MeH azurin 7.12b 630 380±4 (7.01)c His117SHis azurin 2.53b 633 313±5 (2.44)a His117Ntr azurin (0.49)a 625 276±4 a. Values calculated with the use of Advanced Chemistry Development (ACD/Labs) Software V8.14 for Solaris (© 1994–2009 ACD/Labs) are shown in parenthesis. b. Ref.97 c. Ref.98,99

As shown in Figure 5.7, X-band EPR spectra of these proteins were collected and simulated with SIMPOW6100. Spectra of all variants contain an axial Type 1-like species with Ax ≈ Ay ‹‹ Az. According to the simulation (Figure 5.7 and Table 5.3), the T1 -4 -1 species of His117MeH, His117SHis, His117Ntr azurin have A|| of 56, 59, 69×10 cm , and g|| of 2.265, 2.283, 2.268 respectively, compared with the wild type azurin value of 59×10-4 cm-1 and 2.253. There are another species with large hyperfine splitting values (177 and 181×10-4 cm-1 for H117SHis Az and His117Ntr Az, respectively), similar to free copper or type II copper centers.

The fraction of the type II-like species increases from His117MeH, His117SHis to His117Ntr. This happens to be in coincidence with binding affinity of unnatural amino acids. The existence of Type II-like species indicates the copper site is perturbed by the unnatural amino acids, , possibly duce to His-off situation originated from the flexibility of His117 and varied binding affinity of different UAA introduced to this position.

Figure 5.7 X-band EPR spectra of holo azurin with histidine and histidine analogues incorporated.

100

Table 5.3 Simulated EPR parameters

- - - Protein species fraction gx gy gz Ax /10 Ay /10 Az /10 4 cm-1 4 cm-1 4 cm-1 WT Az 1.00 2.0536 2.0296 2.2530 7 7 59 His117MeH Az 1.00 2.0567 2.0297 2.2654 8 8 56 His117SHis Az1 1 0.30 2.0449 2.0417 2.2831 17 9 59 2 0.70 2.0594 2.0580 2.2721 6 15 177 His117Ntr Az1 1 0.18 2.0578 2.0420 2.2679 12 8 69 2 0.82 2.0452 2.0654 2.2684 7 20 181

Protein species fraction Wx /Gauss Wy /Gauss Wz /Gauss

WT Az 1.00 31 31 6 His117MeH Az 1.00 22 17 9 His117SHis Az1 1 0.30 33 38 23 2 0.70 35 82 74 His117Ntr Az1 1 0.18 40 63 29 2 0.82 34 79 75 1 Simulation done by Dr. Mark Nilges.

5.3.2 Reduction potential of azurin mutants showed correlation with pKa of His

Reduction potential of azurin variants were determined by cyclic voltammetry with pyrolytic graphite edge (PGE) electrode as described previously.95,101 At pH 4, wild type azurin gave reduction potential of 352±2 mV, comparable to values reported in literature.101,102 For His117MeH, His117SHis and His117Ntr azurin, the reduction potentials are 380±4, 313±5 and 276±4 mV, respectively (Table 5.2). Although two species were shown in EPR, the major peak with low reduction potential is likely due to the T1 copper center instead of T2, as T2 with a His-off copper center usually shows much higher reduction potential(>600 mV).80

101

Figure 5.8 Reduction potential of azurin is correlated with pKa on histidine.

As shown in Figure 5.8, there is positive correlation between the reduction potential and pKa of Nδ for the type I species.

Previous studies on model complex with substituted nitrogen ligand have shown that electronic and other effects could influence reduction potential. For substituted phenanthrolines and bipyridyls coordinating with copper, given coordination number unchanged, ligand with higher pKa gave lower reduction potential. Electronic effect plays a major role as ligand with higher pKa tend to stabilize higher valence state relative to the lower, resulting a lower reduction potential.103 However, many complexes didn’t follow the pKa –reduction potential trend when other effects such as solvation of copper center are more important.104,105

We collaborated with Prof. Edward Solomon and Ryan Hadt trying to predict the reduction potential change through DFT calculation. As shown in Figure 5.9 and Table 5.4, the calculated change of adiabatic ionization energies (ΔIEs), a measure of reduction potential, are negatively correlated with pKa.

102

Table 5.4 DFT energy of deprotonation and ionization energies (PCM ε = 4.0).1

His MeH SHis Ntr ΔG(kcal/mol) 3.8 5.8 -5.5 -10.6

ΔpKa 0 1.4 -6.8 -10.6 Cu (spin density) 0.52 0.52 0.54 0.49 S (spin density) 0.32 0.33 0.36 0.39 IE (eV) 4.164 4.143 4.382 4.531 ΔIE (eV) 0 -0.021 0.218 0.367 E0 (exp, mV) 0.352 0.380 0.313 0.276 ΔE0 (exp, mV) 0 0.028 -0.039 -0.076 1 Calculated by Ryan Hadt and Dr. Edward Solomon.

Figure 5.9 Graph of calculated ΔIE versus ΔpKa. Note the negative linear correlation is opposite to what is observed experimentally. Calculated by Ryan Hadt and Dr. Edward Solomon.

As predictions from inorganic complexes and computational studies contradict with our experimental result, we reason that as a complex protein system, factors other than electronic effect of His make the major contributions. One of the factors could be solvation, such as the case in CuAAz. The axial Met affect reduction potential of T1 copper protein azurin in a large extend.87,102 However, in the same protein scaffold,

103 mutation of the axial Met caused much smaller change in reduction potential of

CuAAz.106 Recently, Solomon, Lu and coworkers have revealed that solvation of the copper site countered the effect caused by hydrophobicity change of the axial ligand.107 The overall effect makes hydrophobicity change of axial ligand less effective in reduction potential tuning in CuAAz.

To fully explain the experimental observation, we need to characterize the structure and electronic of these mutants by advance spectroscopic techniques, such as X-ray spectroscopy, resonance Raman and magnetic circular dichroism.

5.4 Summary

By replacing equatorial His with His analogues with different pKa values, the protein keeps T1 character while reduction potential of the protein is changed over 100mV range. The reduction potential of the proteins with His and His analogues are correlated with pKa of His. However, such correlation cannot be solely explained by electronic effect. To further correlate change of His and reduction potential change, structural information is needed for the system.

5.5 References

1. Underwood, E. J. (1977) Trace Elements in Human and Animal Nutrition, 4th ed., Academic Press, New York. 2. Malkin, R., and Malmstro.Bg. (1970) State and Function of Copper in Biological Systems, Advances in Enzymology and Related Subjects of Biochemistry 33, 177-&. 3. Fee, J. A. (1975) Struct. Bonding (Berlin) 33, 1-60. 4. Katoh, S. (1960) A new copper protein from Chlorella ellisoidea, Nature (London, U. K.) 186, 533-534. 5. Katoh, S., Shiratori, I., and Takamiya, A. (1962) Purification and some properties of spinach plastocyanin, J Biochem 51, 32-40.

104

6. Lappin, A. G., Lewis, C. A., and Ingledew, W. J. (1985) Kinetics and mechanisms of reduction of rusticyanin, a blue copper protein from Thiobacillus ferrooxidans, by inorganic cations, Inorg. Chem. 24, 1446-1450. 7. Masuko, M., Iwasaki, H., Sakurai, T., Suzuki, S., and Nakahara, A. (1984) Characterization of nitrite reductase from a denitrifier, Alcaligenes sp. NCIB 11015. A novel copper protein, J. Biochem. (Tokyo, Jpn.) 96, 447-454. 8. Solomon, E. I., Szilagyi, R. K., DeBeer George, S., and Basumallick, L. (2004) Electronic structures of metal sites in proteins and models: contributions to function in blue copper proteins, Chem. Rev. 104, 419-458. 9. Solomon, E. I. (2006) Spectroscopic Methods in Bioinorganic Chemistry: Blue to Green to Red Copper Sites, Inorg. Chem. 45, 8012. 10. Gray, H. B., Malmström, B. G., and Williams, R. J. P. (2000) Copper coordination in blue proteins, J. Biol. Inorg. Chem. 5, 551. 11. Dennison, C. (2005) Investigating the structure and function of cupredoxins, Coord. Chem. Rev. 249, 3025. 12. Basumallick, L., Sarangi, R., DeBeer George, S., Elmore, B., Hooper, A. B., Hedman, B., Hodgson, K. O., and Solomon, E. I. (2005) Spectroscopic and Density Functional Studies of the Red Copper Site in Nitrosocyanin: Role of the Protein in Determining Active Site Geometric and Electronic Structure, J. Am. Chem. Soc. 127, 3531. 13. Warren, J. J., Lancaster, K. M., Richards, J. H., and Gray, H. B. (2012) Inner- and outer-sphere metal coordination in blue copper proteins, J. Inorg. Biochem. 115, 119-126. 14. Sutherland, I. W., and Wilkinson, J. F. (1963) Azurin: A Copper Protein Found in Bordetella, J. Gen. Microbiol. 30, 105-112. 15. Pascher, T., Karlsson, B. G., Nordling, M., MalmstrÖM, B. G., and VÄNngÅRd, T. (1993) Reduction potentials and their pH dependence in site-directed-mutant forms of azurin from Pseudomonas aeruginosa, Eur. J. Biochem. 212, 289-296. 16. Tobari, J., and Harada, Y. (1981) Amicyanin: An electron acceptor of methylamine dehydrogenase, Biochem. Biophys. Res. Commun. 101, 502-508.

105

17. van Houwelingen, T., Canters, G. W., Stobbelaar, G., Duine, J. A., Frank, J., Jr., and Tsugita, A. (1985) Isolation and characterization of a blue copper protein from Thiobacillus versutus, Eur. J. Biochem. 153, 75-80. 18. Iwasaki, H., and Matsubara, T. (1973) Purification and some properties of Achromobacter cycloclastes azurin, J Biochem 73, 659-661. 19. Sakurai, T., Ikeda, O., and Suzuki, S. (1990) Direct electrochemistry of the blue copper proteins pseudoazurin, plantacyanin, and stellacyanin, Inorg. Chem. 29, 4715-4718. 20. Cobley, J. G., and Haddock, B. A. (1975) The respiratory chain of Thiobacillus ferrooxidans: the reduction of cytochromes by Fe2+ and the preliminary characterization of rusticyanin a novel "blue" copper protein, FEBS Lett. 60, 29- 33. 21. McManus, J. D., Brune, D. C., Han, J., Sanders-Loehr, J., Meyer, T. E., Cusanovich, M. A., Tollin, G., and Blankenship, R. E. (1992) Isolation, characterization, and amino acid sequences of auracyanins, blue copper proteins from the green photosynthetic bacterium Chloroflexus aurantiacus, J. Biol. Chem. 267, 6531-6540. 22. Markossian, K. A., Aikazyan, V. T., and Nalbandyan, R. M. (1974) Two copper- containing proteins from cucumber (Cucumis sativus), Biochim. Biophys. Acta 359, 47-54. 23. Battistuzzi, G., Borsari, M., Loschi, L., Righi, F., and Sola, M. (1999) Redox Thermodynamics of Blue Copper Proteins, J. Am. Chem. Soc. 121, 501-506. 24. Scharf, B., and Engelhard, M. (1993) Halocyanin, an archaebacterial blue copper protein (type I) from Natronobacterium pharaonis, Biochemistry 32, 12894-12900. 25. Komorowski, L., and Schafer, G. (2001) Sulfocyanin and subunit II, two copper proteins with novel features, provide new insight into the archaeal SoxM oxidase supercomplex, FEBS Lett. 487, 351-355. 26. Arciero, D. M., Hooper, A. B., and Rosenzweig, A. C. (2001) Crystal Structure of a Novel Red Copper Protein from Nitrosomonas europaea, Biochemistry 40, 5674-5681.

106

27. Arciero, D. M., Pierce, B. S., Hendrich, M. P., and Hooper, A. B. (2002) Nitrosocyanin, a Red Cupredoxin-like Protein from Nitrosomonas europaea†, Biochemistry 41, 1703-1709. 28. Peisach, J., Levine, W. G., and Blumberg, W. E. (1967) Structural properties of stellacyanin, a copper mucoprotein from Rhus vernicifera, the Japanese lac tree, J. Biol. Chem. 242, 2847-2858. 29. Nersissian, A. M., Immoos, C., Hill, M. G., Hart, P. J., Williams, G., Herrmann, R. G., and Valentine, J. S. (1998) Uclacyanins, stellacyanins, and plantacyanins are distinct subfamilies of phytocyanins: plant-specific mononuclear blue copper proteins, Protein Sci. 7, 1915-1929. 30. Nersissian, A. M., and Valentine, J. S. Dicyanin, a new class of blue copper proteins, unpublished. 31. Malmstrom, B. G., Reinhammar, B., and Vanngard, T. (1968) Two forms of copper (II) in fungal laccase, Biochim. Biophys. Acta 156, 67-76. 32. Xu, F., Shin, W., Brown, S. H., Wahleithner, J. A., Sundaram, U. M., and Solomon, E. I. (1996) A study of a series of recombinant fungal laccases and bilirubin oxidase that exhibit significant differences in redox potential, substrate specificity, and stability, Biochim. Biophys. Acta 1292, 303-311. 33. Ducros, V., Brzozowski, A. M., Wilson, K. S., Brown, S. H., Ostergaard, P., Schneider, P., Yaver, D. S., Pedersen, A. H., and Davies, G. J. (1998) Crystal structure of the type-2 Cu depleted laccase from Coprinus cinereus at 2.2 angstrom resolution, Nat. Struct. Biol. 5, 310-316. 34. Reinhammar, B. R. M. (1972) Oxidation-reduction potentials of the electron acceptors in laccases and stellacyanin, Biochimica et Biophysica Acta (BBA) - Bioenergetics 275, 245-259. 35. Reinhammar, B. R., and Vanngard, T. I. (1971) The electron-accepting sites in Rhus vernicifera laccase as studied by anaerobic oxidation-reduction titrations, Eur. J. Biochem. 18, 463-468. 36. Kroneck Peter M, H., Armstrong Fraser, A., Merkle, H., and Marchesini, A. (1982) Ascorbate Oxidase: Molecular Properties and Catalytic Activity, In Ascorbic Acid: Chemistry, Metabolism, and Uses, pp 223-248, American Chemical Society.

107

37. Holmberg, C. G., and Laurell, C. B. (1948) Investigations in Serum Copper. 2. Isolation of the Copper Containing Protein, and a Description of Some of Its Properties, Acta Chem. Scand. 2, 550-556. 38. Machonkin, T. E., Zhang, H. H., Hedman, B., Hodgson, K. O., and Solomon, E. I. (1998) Spectroscopic and Magnetic Studies of Human Ceruloplasmin: Identification of a Redox-Inactive Reduced Type 1 Copper Site†, Biochemistry 37, 9570-9578. 39. Machonkin, T. E., and Solomon, E. I. (2000) The Thermodynamics, Kinetics, and Molecular Mechanism of Intramolecular Electron Transfer in Human Ceruloplasmin, J. Am. Chem. Soc. 122, 12547-12560. 40. Vulpe, C. D., Kuo, Y.-M., Murphy, T. L., Cowley, L., Askwith, C., Libina, N., Gitschier, J., and Anderson, G. J. (1999) Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse, Nat. Genet. 21, 195-199. 41. Askwith, C., Eide, D., Van Ho, A., Bernard, P. S., Li, L., Davis-Kaplan, S., Sipe, D. M., and Kaplan, J. (1994) The FET3 gene of S. cerevisiae encodes a multicopper oxidase required for ferrous iron uptake, Cell 76, 403-410. 42. Machonkin, T. E., Quintanar, L., Palmer, A. E., Hassett, R., Severance, S., Kosman, D. J., and Solomon, E. I. (2001) Spectroscopy and Reactivity of the Type 1 Copper Site in Fet3p from Saccharomyces cerevisiae: Correlation of Structure with Reactivity in the Multicopper Oxidases, J. Am. Chem. Soc. 123, 5507-5517. 43. Adman, E. T. (1991) Copper protein structures, Adv. Protein Chem. 42, 145-197. 44. Hart, P. J., Nersissian, A. M., and George, S. D. (2006) Copper Proteins with Type 1 Sites, In Encyclopedia of Inorganic Chemistry, John Wiley & Sons, Ltd. 45. Karlsson, B. G., Aasa, R., Malmstroem, B. G., and Lundberg, L. G. (1989) Rack- induced bonding in blue copper proteins: spectroscopic properties and reduction potential of the azurin mutant Met-121 → Leu, FEBS Lett. 253, 99-102. 46. Karlsson, B. G., Nordling, M., Pascher, T., Tsai, L. C., Sjölin, L., and Lundberg, L. G. (1991) Cassette mutagenesis of Met121 in azurin from Pseudomonas aeruginosa, Protein Eng. 4, 343-349.

108

47. Murphy, L. M., Strange, R. W., Karlsson, B. G., Lundberg, L. G., Pascher, T., Reinhammar, B., and Hasnain, S. S. (1993) Structural characterization of azurin from Pseudomonas aeruginosa and some of its methionine-121 mutants, Biochemistry 32, 1965-1975. 48. Olesen, K., Veselov, A., Zhao, Y., Wang, Y., Danner, B., Scholes, C. P., and Shapleigh, J. P. (1998) Spectroscopic, Kinetic, and Electrochemical Characterization of Heterologously Expressed Wild-Type and Mutant Forms of Copper-Containing Nitrite Reductase from Rhodobacter sphaeroides 2.4.3, Biochemistry 37, 6086-6094. 49. Kataoka, K., Yamaguchi, K., Sakai, S., Takagi, K., and Suzuki, S. (2003) Characterization and function of Met150Gln mutant of copper-containing nitrite reductase from Achromobacter cycloclastes IAM1013, Biochem. Biophys. Res. Commun. 303, 519-524. 50. Hough, M. A., Ellis, M. J., Antonyuk, S., Strange, R. W., Sawers, G., Eady, R. R., and Samar, H. S. (2005) High Resolution Structural Studies of Mutants Provide Insights into Catalysis and Electron Transfer Processes in Copper Nitrite Reductase, J. Mol. Biol. 350, 300-309. 51. Diederix, R. E. M., Canters, G. W., and Dennison, C. (2000) The Met99Gln Mutant of Amicyanin from Paracoccus versutus, Biochemistry 39, 9551-9560. 52. Hall, J. F., Kanbi, L. D., Strange, R. W., and Hasnain, S. S. (1999) Role of the Axial Ligand in Type 1 Cu Centers Studied by Point Mutations of Met148 in Rusticyanin, Biochemistry 38, 12675-12680. 53. Kataoka, K., Kondo, A., Yamaguchi, K., and Suzuki, S. (2000) Spectroscopic and electrochemical properties of the Met86Gln mutant of Achromobacter cycloclastes pseudoazurin, J. Inorg. Biochem. 82, 79-84. 54. Xu, F., Palmer, A. E., Yaver, D. S., Berka, R. M., Gambetta, G. A., Brown, S. H., and Solomon, E. I. (1999) Targeted mutations in a Trametes villosa laccase, Axial perturbations of the T1 copper, J. Biol. Chem. 274, 12372-12375. 55. DeBeer George, S., Basumallick, L., Szilagyi, R. K., Randall, D. W., Hill, M. G., Nersissian, A. M., Valentine, J. S., Hedman, B., Hodgson, K. O., and Solomon, E.

109

I. (2003) Spectroscopic Investigation of Stellacyanin Mutants: Axial Ligand Interactions at the Blue Copper Site, J. Am. Chem. Soc. 125, 11314-11328. 56. Harrison, M. D., and Dennison, C. (2004) Characterization of Arabidopsis thaliana stellacyanin: a comparison with umecyanin, Proteins: Struct., Funct., Bioinf. 55, 426-435. 57. Romero, A., Hoitink, C. W. G., Nar, H., Huber, R., Messerschmidt, A., and Canters, G. W. (1993) X-ray Analysis and Spectroscopic Characterization of M121Q Azurin: A Copper Site Model for Stellacyanin, J. Mol. Biol. 229, 1007- 1021. 58. Frank, P., Licht, A., Tullius, T. D., Hodgson, K. O., and Pecht, I. (1985) A selenomethionine-containing azurin from an auxotroph of Pseudomonas aeruginosa, J. Biol. Chem. 260, 5518-5525. 59. LaCroix, L. B., Shadle, S. E., Wang, Y., Averill, B. A., Hedman, B., Hodgson, K. O., and Solomon, E. I. (1996) Electronic Structure of the Perturbed Blue Copper Site in Nitrite Reductase: Spectroscopic Properties, Bonding, and Implications for the Entatic/Rack State, J. Am. Chem. Soc. 118, 7755-7768. 60. Yanagisawa, S., and Dennison, C. (2005) Reduction Potential Tuning at a Type 1 Copper Site Does Not Compromise Electron Transfer Reactivity, J. Am. Chem. Soc. 127, 16453-16459. 61. Arciero, D. M., Pierce, B. S., Hendrich, M. P., and Hooper, A. B. (2002) Nitrosocyanin, a red cupredoxin-like protein from Nitrosomonas europaea, Biochemistry 41, 1703. 62. Kroes, S. J., Hoitink, C. W. G., Andrew, C. R., Sanders-Loehr, J., Messerschmid, A., Hagen, W. R., and Canters, G. W. (1996) The mutation Met121-->His creates a type1.5 copper site in Alcaligene denitrificans azurin, Eur. J. Biochem. 240, 342-351. 63. Messerschmidt, A., Prade, L., Kroes, S. J., Sanders-Loehr, J., Huber, R., and Canters, G. W. (1998) Rack-induced metal binding vs. flexibility: Met121His azurin crystal structures at different pH, Proc. Natl. Acad. Sci. U. S. A. 95, 3443- 3448.

110

64. van Gestel, M., Canters, G. W., Krupka, H., Messerschmid, A., de Waal, E. C., Warmerdam, G. C. M., and Groenen, E. J. J. (2000) Axial Ligation in Blue- Copper Proteins. A W-Band Electron Spin Echo Detected Electron Paramagnetic Resonance Study of the Azurin Mutant M121H, J. Am. Chem. Soc. 122, 2322- 2328. 65. Karlsson, B. G., Tsai, L. C., Nar, H., SandersLoehr, J., Bonander, N., Langer, V., and Sjolin, L. (1997) X-ray structure determination and characterization of the Pseudomonas aeruginosa azurin mutant Met121Glu, Biochemistry 36, 4089- 4095. 66. Strange, R. W., Murphy, L. M., Karlsson, B. G., Reinhammar, B., and Hasnain, S. S. (1996) Effect of pH and Ligand Binding of the Structure of the Cu Site of the Met121Glu Mutant of Azurin from Pseudomonas aeruiginosa, Biochemistry 35, 16391-16398. 67. Webb, M. A., Kiser, C. N., Richards, J. H., Di Bilio, A. J., Gray, H. B., Winkler, J. R., and Loppnow, G. R. (2000) Resonance Raman Spectroscopy of Met121Glu Azurin, J. Phys. Chem. B 104, 10915-10920. 68. Basumallick, L., Szilagyi, R. K., Zhao, Y., Shapleigh, J. P., Scholes, C. P., and Solomon, E. I. (2003) Spectroscopic Studies of the Met182Thr Mutant of Nitrite Reductase: Role of the Axial Ligand in the Geometric and Electronic Structure of Blue and Green Copper Sites, J. Am. Chem. Soc. 125, 14784-14792. 69. Mizoguchi, T. J., Di Bilio, A. J., Gray, H. B., and Richards, J. H. (1992) Blue to type 2 binding. Copper(II) and cobalt(II) derivatives of a Cys112Asp mutant of Pseudomonas aeruginosa azurin, J. Am. Chem. Soc. 114, 10076-10078. 70. Piccioli, M., Luchinat, C., Mizoguchi, T. J., Ramirez, B. E., Gray, H. B., and Richards, J. H. (1995) Paramagnetic NMR spectroscopy and coordination structure of cobalt(II) Cys112Asp azurin, Inorg. Chem. 34, 737-742. 71. Faham, S., Mizoguchi, T. J., Adman, E. T., Gray, H. B., Richards, J. H., and Rees, D. C. (1997) Role of the active-site cysteine of <i>Pseudomonas aeruginosa</i> azurin. Crystal structure analysis of the Cu<sup>II</sup>(Cys112Asp) protein, J. Biol. Inorg. Chem. 2, 464-469.

111

72. DeBeer, S., Kiser, C. N., Mines, G. A., Richards, J. H., Gray, H. B., Solomon, E. I., Hedman, B., and Hodgson, K. O. (1999) X-ray Absorption Spectra of the Oxidized and Reduced Forms of C112D Azurin from Pseudomonas aeruginosa, Inorg. Chem. 38, 433-438. 73. Lancaster, K. M., George, S. D., Yokoyama, K., Richards, J. H., and Gray, H. B. (2009) Type-zero copper proteins, Nature Chem. 1, 711. 74. Lancaster, K. M., Yokoyama, K., Richards, J. H., Winkler, J. R., and Gray, H. B. (2009) High-Potential C112D/M121X (X = M, E, H, L) Pseudomonas aeruginosa Azurins, Inorg. Chem. 48, 1278. 75. Lancaster, K. M., Sproules, S., Palmer, J. H., Richards, J. H., and Gray, H. B. (2010) Outer-Sphere Effects on Reduction Potentials of Copper Sites in Proteins: The Curious Case of High Potential Type 2 C112D/M121E Pseudomonas aeruginosa Azurin, J. Am. Chem. Soc. 132, 14590. 76. Lancaster, K. M., Roemelt, M., Ettenhuber, P., Hu, Y., Ribbe, M. W., Neese, F., Bergmann, U., and DeBeer, S. (2011) X-ray Emission Spectroscopy Evidences a Central Carbon in the Nitrogenase Iron-Molybdenum Cofactor, Science 334, 974- 977. 77. den Blaauwen, T., and Canters, G. W. (1991) Construction of novel Cu sites by site directed mutagenesis of azurin, J. Inorg. Biochem. 43, 177. 78. van Pouderoyen, G., Andrew, C. R., Loehr, T. M., Sanders-Loehr, J., Mazumdar, S., Hill, H. A., and Canters, G. W. (1996) Spectroscopic and mechanistic studies of type-1 and type-2 copper sites in Pseudomonas aeruginosa azurin as obtained by addition of external ligands to mutant His46Gly, Biochemistry 35, 1397-1407. 79. Den Blaauwen, T., and Canters, G. W. (1993) Creation of type-1 and type-2 copper sites by addition of exogenous ligands to the Pseudomonas aeruginosa azurin His117Gly mutant, J. Am. Chem. Soc. 115, 1121. 80. Jeuken, L. J. C., van Vliet, P., Verbeet, M. P., Camba, R., McEvoy, J. P., Armstrong, F. a., and Canters, G. W. (2000) Role of the Surface-Exposed and Copper-Coordinating Histidine in Blue Copper Proteins: The Electron-Transfer and Redox-Coupled Ligand Binding Properties of His117Gly Azurin, J. Am. Chem. Soc. 122, 12186-12194.

112

81. Gorren, a. C., den Blaauwen, T., Canters, G. W., Hopper, D. J., and Duine, J. a. (1996) The role of His117 in the redox reactions of azurin from Pseudomonas aeruginosa, FEBS Lett. 381, 140-142. 82. Alagaratnam, S., Meeuwenoord, N. J., Navarro, J. A., Hervas, M., De la Rosa, M. A., Hoffmann, M., Einsle, O., Ubbink, M., and Canters, G. W. (2011) Probing the reactivity of different forms of azurin by flavin photoreduction, FEBS J. 278, 1506- 1521. 83. Canters, G. W., Kolczak, U., Armstrong, F., Jeuken, L. J., Camba, R., and Sola, M. (2000) The effect of pH and ligand exchange on the redox properties of blue copper proteins, Faraday Discuss., 205-220; discussion 257-268. 84. Berry, S. M., Gieselman, M. D., Nilges, M. J., Van der Donk, W. A., and Lu, Y. (2002) An Engineered Azurin Variant Containing a Selenocysteine Copper Ligand, J. Am. Chem. Soc. 124, 2084. 85. Berry, S. M., Ralle, M., Low, D. W., Blackburn, N. J., and Lu, Y. (2003) Probing the Role of Axial Methionine in the Blue Copper Center of Azurin with Unnatural Amino Acids, J. Am. Chem. Soc. 125, 8760. 86. Ralle, M., Berry, S. M., Nilges, M. J., Gieselman, M. D., van der Donk, W. A., Lu, Y., and Blackburn, N. J. (2004) The Selenocysteine-Substituted Blue Copper Center: Spectroscopic Investigations of Cys112SeCys Pseudomonas aeruginosa Azurin, J. Am. Chem. Soc. 126, 7244-7256. 87. Garner, D. K., Vaughan, M. D., Hwang, H. J., Savelieff, M. G., Berry, S. M., Honek, J. F., and Lu, Y. (2006) Reduction Potential Tuning of the Blue Copper Center in Pseudomonas aeruginosa Azurin by the Axial Methionine as Probed by Unnatural Amino Acids, J. Am. Chem. Soc. 128, 15608. 88. Clark, K. M., Yu, Y., Marshall, N. M., Sieracki, N. A., Nilges, M. J., Blackburn, N. J., van der Donk, W. A., and Lu, Y. (2010) Transforming a Blue Copper into a Red Copper Protein: Engineering Cysteine and Homocysteine into the Axial Position of Azurin Using Site-Directed Mutagenesis and Expressed Protein Ligation, J. Am. Chem. Soc. 132, 10093. 89. Sarangi, R., Gorelsky, S. I., Basumallick, L., Hwang, H. J., Pratt, R. C., Stack, T. D. P., Lu, Y., Hodgson, K. O., Hedman, B., and Solomon, E. I. (2008)

113

Spectroscopic and Density Functional Theory Studies of the Blue−Copper Site in M121SeM and C112SeC Azurin: Cu−Se Versus Cu−S Bonding, J. Am. Chem. Soc. 130, 3866-3877. 90. van de Kamp, M., Silvestrini, M. C., Brunori, M., Van Beeumen, J., Hali, F. C., and Canters, G. W. (1990) Involvement of the hydrophobic patch of azurin in the electron-transfer reactions with cytochrome C551 and nitrite reductase, Eur. J. Biochem. 194, 109-118. 91. Den Blaauwen, T., Van de Kamp, M., and Canters, G. W. (1991) Type I and II copper sites obtained by external addition of ligands to a His117Gly azurin mutant, J. Am. Chem. Soc. 113, 5050-5052. 92. Van Pouderoyen, G., Mazumdar, S., Hunt, N. I., Hill, A. O., and Canters, G. W. (1994) The introduction of a negative charge into the hydrophobic patch of Pseudomonas aeruginosa azurin affects the electron self-exchange rate and the electrochemistry, Eur. J. Biochem. 222, 583-588. 93. Tautz, W., Teitel, S., and Brossi, a. (1973) Nitrohistidines and nitrohistamines, J. Med. Chem. 16, 705-707. 94. Clark, K. M., Yu, Y., Marshall, N. M., Sieracki, N. a., Nilges, M. J., Blackburn, N. J., van der Donk, W. a., and Lu, Y. (2010) Transforming a blue copper into a red copper protein: engineering cysteine and homocysteine into the axial position of azurin using site-directed mutagenesis and expressed protein ligation., J. Am. Chem. Soc. 132, 10093-10101. 95. Garner, D. K., Vaughan, M. D., Hwang, H. J., Savelieff, M. G., Berry, S. M., Honek, J. F., and Lu, Y. (2006) Reduction potential tuning of the blue copper center in Pseudomonas aeruginosa azurin by the axial methionine as probed by unnatural amino acids., J. Am. Chem. Soc. 128, 15608-15617. 96. Berry, S. M., Gieselman, M. D., Nilges, M. J., van der Donk, W. a., and Lu, Y. (2002) An Engineered Azurin Variant Containing a Selenocysteine Copper Ligand, J. Am. Chem. Soc. 124, 2084-2085. 97. Albert, A., Goldacre, R., and Phillips, J. (1948) The strength of heterocyclic bases, J Chem Soc (Resumed), 2240-2249.

114

98. Cassidy, C. S., Reinhardt, L. a., Cleland, W. W., and Frey, P. a. (1999) Hydrogen bonding in complexes of carboxylic acids with 1-alkylimidazoles: steric and isotopic effects on low barrier hydrogen bonding, Journal of the Chemical Society, Perkin Transactions 2, 635-642. 99. Cecchi, L., De Sarlo, F., and Machetti, F. (2006) 1,4-Diazabicyclo[2.2.2]octane (DABCO) as an Efficient Reagent for the Synthesis of Isoxazole Derivatives from Primary Nitro Compounds and Dipolarophiles: The Role of the Base, Eur. J. Org. Chem. 2006, 4852-4860. 100. Nilges, M. J., Matteson, K., and Bedford, R. L. (2007) SIMPOW6: A software package for the simulation of ESR powder-type spectra., In ESR Spectroscopy in Membrane Biophysics (Hemminga, M. A., and Berliner, L., Eds.), Springer, New York. 101. Jeuken, L. J. C., and Armstrong, F. A. (2001) Electrochemical Origin of Hysteresis in the Electron-Transfer Reactions of Adsorbed Proteins: Contrasting Behavior of the Blue• Copper Protein, Azurin, Adsorbed on Pyrolytic Graphite and Modified Gold Electrodes, J. Phys. Chem. B 105, 5271-5282. 102. Marshall, N. M., Garner, D. K., Wilson, T. D., Gao, Y. G., Robinson, H., Nilges, M. J., and Lu, Y. (2009) Rationally tuning the reduction potential of a single cupredoxin beyond the natural range, Nature 462, 113-116. 103. James, B. R., and Williams, R. J. P. (1961) 383. The oxidation-reduction potentials of some copper complexes, Journal of the Chemical Society (Resumed), 2007-2019. 104. Su, C.-C., Jan, H. C., Kuo-Yih, H., Shyh-Jiun, L., Shion-Wen, W., Sue-Lein, W., and Sheng-Nan, L. (1992) Bonding properties of Cu(II)-imidazole chromophores: spectroscopic and electrochemical properties of monosubstituted imidazole copper(II) complexes. Molecular structure of [Cu(4-methylimidazole)4(ClO4)2], Inorg. Chim. Acta 196, 231-240. 105. Prasad, J., Ukpong, E. J., and Srivastava, K. (2008) Cyclic voltammetric investigations of copper(II) complexes with various imidazoles in dimethylformamide, J. Indian Chem. Soc. 85, 32-35.

115

106. Hwang, H. J., Berry, S. M., Nilges, M. J., and Lu, Y. (2005) Axial Methionine Has Much Less Influence on Reduction Potentials in a CuA Center than in a Blue Copper Center, J. Am. Chem. Soc. 127, 7274-7275. 107. Tsai, M.-L., Hadt, R. G., Marshall, N. M., Wilson, T. D., Lu, Y., and Solomon, E. I. (2013) Axial interactions in the mixed-valent CuA active site and role of the axial methionine in electron transfer, Proceedings of the National Academy of Sciences 110, 14658-14663.

116

Chapter 6 Circular Permutation of Azurin

6.1 Introduction

Type 1 (T1) copper protein is a family of small copper containing proteins involving in electron transfer in various organisms. The T1 copper proteins share low sequence similarity besides ligands and key residues in secondary coordination sphere, yet retain Greek key β barrel fold, as elucidated by structural alignment(Figure 6.1 and Figure 6.2).1 Role of ligands and secondary coordination sphere residues in reduction potential tuning and electron transfer of the T1 copper proteins have been extensively studied by site-directed mutagenesis and unnatural amino acids incorporation. Williams, Malmström and Gray have emphasized the influence of protein structure in electron transfer function of T1 copper protein. They have proposed that the overall protein structure could position ligands properly to reduce reorganization energy in redox process, leading to rapid electron transfer rate, known as entatic or “rack-induced” state.2-4

117

Figure 6.1 Aligned structure of 8 Type-1 copper proteins using Multiseq.5 The core β strands (colored) are well aligned in T1 copper proteins, while additional α helices and loop regions (grey) vary from protein to protein. T1 copper proteins and their PDB code: Plastocyanin, 1PLC; Azurin, 4AZU; Pseudoazurin, 1PAZ; Amicyanin, 1AAC, ; Plantacyanin, 2CBP, yellow; Stellacyanin, 1JER, tan; Auracyanin, 1QHQ, purple; Rusticyanin, 1RCY, lime.

118

Figure 6.2 Sequence alignment of 8 T1 copper proteins based on structure. Alignment was done using Multiseq.5 The colored bar indicate β strands. Color-shading indicates residues with greater than 60% similarity among 8 sequences.

Despite the conserved structure of T1 copper proteins and its proposed role in electron transfer, there is no report of altering the structure of Greek key β barrel fold. Also, nature evolves T1 copper proteins that the N- and C-termini of protein is in the other side of copper binding site (Figure 6.3). There is a need to make N- and C-termini close to copper binding site in order to fuse with other protein or to study the copper binding ligands.

119

Figure 6.3 Schematic view of overall fold of azurin and circular permutation site. Chain openings are indicated by black circle and ligation is indicated by red line.

In protein engineering, circular permutation is method to alter amino acid sequence by joining original N- and C- termini together and to create new termini somewhere else in the sequence while keeping 3D structure intact.6 Circular permutation has been done in model protein like GFP7 and protein with Greek key fold like SOD8 and eye lens βB2-crystalline9 to make better sensor or study structure of protein. Here we designed new azurin mutants by circular permutation and characterized structure and spectroscopy of the new mutants.

6.2 Materials and Methods

DNA of circular permutants were constructed by overlap-extension PCR. Basically, two separate PCR were performed to get N-terminal and C-terminal part of the gene. Then a third PCR was performed using two PCR product as template and primer. NcoI and SacI recognition site were incorporated into primer and in 5’ and 3’ of the gene. The gene was cloned into pET22b plasmid and submitted for sequencing. Protein was expressed and purified as described previously10.

DNA sequence of cpAz1

atggagttcaacaccaacgccatcaccgtcgacaagagctgcaagcagttcactgttaacctgtctcacccagg taacctgccgaagaacgttatgggtcacaactgggttctgtccaccgcggctgacatgcaaggcgttgtcactgacggtat ggctagcggtctggataaagactacctgaagccggatgactctcgagttatcgcccacaccaagctgatcggatccggtg

120 aaaaagactccgttactttcgacgtttccaagcttaaagaaggtgaacagtacatgttcttctgcactttcccgggtcactccg cactgatgaaaggtaccctgactctgaaaGGAATTCCGGGTGGCgctgaatgctccgttgatatccagggtaat gatcagTAGTAA

DNA sequence of cpAz2

atgggcgttatgggtcacaactgggttctgtccaccgcggctgacatgcaaggcgttgtcactgacggtatggcta gcggtctggataaagactacctgaagccggatgactctcgagttatcgcccacaccaagctgatcggatccggtgaaaa agactccgttactttcgacgtttccaagcttaaagaaggtgaacagtacatgttcttctgcactttcccgggtcactccgcactg atgaaaggtaccctgactctgaaaggaattccgggtggcgctgaatgctccgttgatatccagggtaatgatcagatgcag ttcaacaccaacgccatcaccgtcgacaagagctgcaagcagttcactgttaacctgtctcacccaggtaacctgccgaa gtagtaa

Molecular dynamics simulation was performed using NAMD and VMD software.11 The structure was constructed starting from holo azurin structure(PDB ID:4AZU)12. PSF file was generated using PSFGEN in VMD software suite and coordinates of missing atoms and H atoms were guessed based on topology of residues in CHARMM force field13. MD simulation was performed using 1000 steps on minimization followed by 500,000 steps (1ns) of equilibration.

UV-vis spectra were taken on an HP diode array spectrometer or a Cary 5000 spectrometer. Extinction coefficient of ligand-metal charge transfer band was determined by spin counting. X-band EPR spectra were collected on a Varian E-122 spectrometer at the Illinois EPR Research Center (IERC). Proteins for EPR were exchanged to TIP7 buffer14 by a short Sephadex G-25 column and 25% of glycerol was added. The samples were run at ∼30 K using liquid He and an Air Products Helitran cryostat. Magnetic fields were calibrated with a Varian NMR gaussmeter, and the frequencies were measured with an EIP frequency counter. EPR spectra were simulated using SIMPOW6.15

EXAFS and XANES spectra were collected at beam line X3B, National Synchrotron Light Source with a sagittally focused Si (111) crystal Monochromater. Samples were cooled to 40K before scanning and kept cold during data collection. Kα fluorescence was collected by a Canberra 31-element Ge detector. A Cu foil was used

121 as reference to calibrate energy. A 6μm Ni filter was placed before detector to reduce elastic scattering. Four to six scans of each sample were collected. Data reduction and background subtraction were performed with EXAFSPAK 16 and data was fitted with EXCURVE 9.2 17-20 as previously described 21.

cpAz2 was further purified by size exclusion chromatography for crystallization. The protein was mixed with equal amount of well buffer (0.1M Tris, 0.1M LiNO3, 0.01M CuSO4, pH8 with 35% PEG 10,000) and crystallized by hanging drop method. The crystals were first soaked briefly in cryo-protectant and were flash frozen in liquid nitrogen. The diffraction data sets were collected at the National Synchrotron Light Source beamlines X12B, X26C, X29A (Upton, NY) and were processed with HKL2000 software. The crystal structure was phased by MOLREP 22 in the CCP4 package 23. Refinement was performed using PHENIX 24 and Coot 25.

6.3 Results and Discussion

6.3.1 Rational design of construct

The schematic drawing of azurin fold (Figure 6.3) showed that there are three possible positions to create new termini close to copper center. They are the loop between 1st and 2nd β strands, between 3rd and 4th β strands, between 6th and 7th β strands. However, the loop between 6th and 7th β sheets hosts 3 copper binding ligands. Perturbation to this loop is likely to disrupt copper center. As a result, I designed mutants based on opening in first two positions (Figure 6.5). The resulting mutants were named as cpaz1 and cpaz2, respectively.

In crystal structure, the original N- and C-terminus were 15 Å apart, flanked by 2nd β strand. Taking into consideration that first 3 amino acids are flexible, additional 5 amino acids were added as linker and Gly and Pro were chosen to provide enough flexibility and a kink to bend the peptide chain. Again, molecular dynamics simulation was performed to verify the hypothesis.

122

Figure 6.4 Simulation of cpAz1 and cpAz2. 1. Alignment of overall structure of cipAz1 and WT Azurin. WT Azurin was shown in trans-parent. 2. Overlay of cpAz2 and WT Azurin. WT Azurin was shown in transparent. 3. Copper center of WT Azurin. 4. Copper center of cpAz2, showing a water coordinate with Cu (II), which is artifact of MD simulation. 5. Showing water molecules within 8 Å of copper ion.

cpaz1 and cpaz2 were subjected to MD simulation. Due to restriction of computational power, simulations were performed on 1 ns scale for each mutant. At this time scale, it is not sufficient to see the influence to overall fold, but changes to the loop region should be seen. The structures after simulation were shown in figure 6.4. The overall structures were very similar to azurin. There is no significant change in position of copper ligands and geometry of copper center. In simulation of cpAz2, water enters copper center at ~0.5ns, which may indicate copper center is more exposed to outside environment. However, there is no sign of extra water from EPR and UV-vis spectra.

123

After 1ns equilibration, the 5-amino acid linker is on top of a β strand, which is rarely seen in the actual structure. This is probably an artifact due to insufficient time. From the length of linker and relative conformation during simulation, it is safe to conclude that linker of 5 amino acids is enough to connect two old termini.

6.3.2 Overall structure of circular permutated protein is not perturbed

Both cpaz1and cpaz2 mutants were constructed using overlapping PCR and cloned to pET22b for periplasmic expression with pelB leader peptide. Amino acids sequences of the two mutants were aligned with azurin in Figure 6.5. A few additional point mutation were made in each of these genes for the purposed of molecular cloning. They are all in random loop region opposite to copper center to minimize effect to protein.

Figure 6.5 Sequence alignment of azurin, cpaz1 and cpaz2. Numbers in this figure indicate actual number in each protein. Mutations were highlighted by red color.

Like WT azurin, cpaz1 and cpaz2 were recombinantly expressed into periplasmic space of E. coli with yield of ~30mg/L. Identity and purity of proteins were verified by ESI or MALDI mass spectrometry (cpAz1 calculated: 14328,observed 14327; cpAz2 calculated: 14401, observed 14393).

124

Folding free energy of WT azurin and mutants were measured by monitor tryptophan fluorescence during chemical denaturation. Guanidine concentrations at transition midpoint were reported previously.26 The number for WT azurin agrees well with reported value of 1.70 M.26 The midpoint concentration for cpAz1 and cpAz2 are no more than half of WT azurin (0.64 M for cpAz1 and 0.81 M for cpAz2). Even compared with point mutation of azurin, which ranged from 1.0 to 1.25 M. The small [Gu]1/2 and folding free energy imply perturbation of structure, which is expected for circular permutation.

Figure 6.6 Guanidine denaturation curves of all proteins (A), experimental data and fitting of WT Az (B), cpAz1 (C) and cpAz2 (D). Tryptophan fluorescence is monitored at 308nm.

125

Table 6.1 Thermodynamic stability parameter of azurin and mutants.

WT Az cpAz1 cpAz2

[Gu]1/2(M) 1.65 0.64 0.81 m -2.6×104 -2.6×104 -1.9×104 folding free energy 43.2±1.1 16.3±1.3 15.3±1.4 (kJ/mol)

Crystallization was attempted for cpAz1 and cpAz2. While cpAz1 generated polycrystals for 6 different attempts, diffraction quality crystals were obtained from cpAz227 and diffracted to 2.4 Å resolution at NSLS. While initial molecular replacement with full azurin structure failed in phasing diffraction data, phasing using structure containing coordinate of residue 42-128 of azurin succeeded.

Table 6.2 Data collection and refinement statistics.

cpAz2 Resolution range (Å) 42.84 - 2.397 (2.483 - 2.397)

Space group P 31 2 1 Unit cell 115.436 115.436 83.145 90 90 120 Unique reflections 25297 (2365) Completeness (%) 99.41 (94.60) Mean I/sigma(I) 23.17 (4.88) Wilson B-factor 61.57 R-factor 0.2312 (0.4374) R-free 0.2602 (0.4886) Number of atoms 1998 macromolecules 1966 ligands 4 water 28 Protein residues 261

126

Table 6.2 Data collection and refinement statistics. (Continued)

RMS(bonds) 0.010 RMS(angles) 1.40 Ramachandran favored (%) 92 Ramachandran outliers (%) 4.2 Clashscore 12.88 Average B-factor 55.40 macromolecules 55.80 solvent 34.70

The structure of cpAz2 was refined to Rfree of 0.26 (Table 6.2). The overall structure aligned well with that of WT Az (Figure 6.7). RMS deviation is 0.62 Å between backbone of the solved structure and that of WT Az (PDB 4AZU)28. The N- and C- termini were connected by a loop, on top of a β stand. Under crystallization condition, the new N-terminal, close to the copper site, protrudes into another unit cell. There is a new copper site formed between N-terminal amine and backbone carbonyl of Met1 of one protein and N-terminal amine and backbone amide of Met1 in another protein (Figure 6.8). Such interaction, although weak, could be the starting point for interface design and metal-mediated protein-protein recognition. 29-31

127

Figure 6.7 crystal structures of WT azurin (PDB: 4AZU in cyan) and cpAz2 (blue). (A) Overlay of the structures. (B) Comparison of Cu sites.

Figure 6.8 Copper binding site formed between two monomers of cpAz2

The T1 copper site of cpAz2 are within range of these found in T1 copper protein.4 Compared with WT azurin, the His to Cu distances are larger, which could be

128 due to X-ray reduction of copper during data collect. EXAFS in section 6.3.3 gives more accurate distance.

Table 6.3 Distances between ligands and copper for cpAz2. For comparison, corresponding distances from the previously published structures of wild type azurin (4AZU) were included.

Distance to Cu (Å) 1 2 WT azurin Cys72 2.125 2.150 2.24(5) His77 2.215 2.192 2.01(7) His6 2.151 2.063 2.08(6) Met81 3.040 2.822 3.15(7) Gly5 2.832 2.856 2.97(10)

6.3.3 Circular permutated proteins retain type I characters

Besides structural method that reveals the overall fold of circular permutated azurins, various spectroscopic techniques could provide information about structure and electronics of the T1 copper center. Electronic absorption spectra of Cu2+ incorporated cpAz1 and cpAz2 showed λmax at 623 and 618nm, slightly smaller than that of WT azurin (628 nm), which is still typical of type I copper protein. Besides ~625 nm peak which is due to pπ (Cys)-Cu(II) charge transfer, there are peaks at ~800nm and ~450nm, which is due to d-d transition and pσ(Cys)-Cu(II) charge transfer. Those peaks are higher compared with WT Azurin, suggesting changes of electronic structure of the copper sites.

129

A) B)

Figure 6.9 (A) Electronic absorption spectra of cpAz1 and cpAz2, and (B) EPR spectra of WT Azurin, cpAz1 and cpAz2 (solid black line) and simulated spectra of cpAz1 and cpAz2 (dashed red line).

EPR is a sensitive method to detect types of copper center present in protein and the covalence between metal and ligand. EPR spectra of cpAz1 and cpAz2 showed a single T1 copper center. The simulated parameters (Table 6.4) are close to those of WT Az. Especially the small hyperfine splitting values (54×10-4 cm-1 for cpAz1 and 62×10-4 cm-1 for cpAz2) are similar to that of WT Az (53×10-4 cm-1) and are within the range of typical T1 copper center (<150×10-4 cm-1)32.

Although spectroscopically cpAz1 and cpAz2 are very similar to WT Azurin, their reduction potential varies. cpAz2 has a reduction potential 70mV higher that WT Azurin at pH4, and 124mV higher at pH7. As reduction potential of T1 copper proteins are affected by multiple factors, it is not clear the reason for the change.

130

Table 6.4 Spectroscopic properties, reduction potentials of WT Azurin, cpAz1 and cpAz2.

WT Azurin cpAz1 cpAz2

a λmax (nm) 627 623 618 Extinction Coefficient(M-1 cm-1) 5.3E+03b 5.4E+03 4.4E+03 gx 2.028 2.061 2.053 gy 2.055 2.029 2.032 gz 2.262 2.266 2.247

-4 -1 c Ax (×10 cm ) 9 10 9

-4 -1 c Ay (×10 cm ) 9 10 9

-4 -1 c Az (×10 cm ) 53 54 62 reduction potential at pH4 (mV) 324±9 342±3 394±6 reduction potential at pH7 (mV) 226±1 244±6 350±2 a. From ref33. b. estimated from ref10. c. from ref10.

Similarities of UV-vis and EPR spectra of cpAzs to those of WT Az suggest similar T1 copper site. Direct information of ligand distances comes from EXAFS. We collected EXAFS data for WT azurin, cpAz1 and cpAz2 at X3B of National Synchrotron Light Source. In collaboration with Kelly Chacon and Dr. Ninian Blackburn, we analyzed the data to extract ligand type, coordination number and distances as shown in Figure 6.10 and Table 6.5.

Spectrum of WT azurin was fitted by two histidines and one cysteine at 1.93 and 2.17 Å. With only 0.02 and 0.01 Å difference from what reported before 21, the data agrees well with previous observation. Fitting of cpAz1 data gave two histidines and one cysteine at 1.93 and 2.16 Å, while fitting of cpAz2 data gave two histidine and one cysteine at 1.94 and 2.16 Å. Addition of one water at 2.5 Å didn’t result in significant improvement of both fittings and gave abnormal Debye-Waller factor. Both cpAz1 and cpAz2 showed the same ligand set and almost the same distances. The similarity directly confirms cpAz1 and cpAz2 have the same copper site structure.

131

Figure 6.10 Fourier transform and EXAFS (inset) for the WT azurin, cpAz1 and cpAz2. Experimental data are shown as solid black lines and simulation are shown as dashed red lines. Data processed by Kelly Chacon and Dr. Ninian Blackburn.

132

Table 6.5 EXAFS fitting parameters, fitted by Kelly Chacon and Dr. Ninian Blackburn.

a b Sample/fit F Cu--S Cu—N(His) E0 Nc R(Å)d DW(Å2)e Nc R(Å)d DW(Å2)e WT 1 2.17 0.003 2 1.93 0.008 -2.3 cpAz1 1 2.16 0.004 2 1.93 0.010 -4.0 cpAz2 1 2.16 0.004 2 1.94 0.010 -3.2 a F is a least-squares fitting parameter defined as

1 N F 2 = k 6( Data - Model)2 N i=1 b Fits modeled histidine coordination by an imidazole ring, which included single and multiple scattering contributions from the second shell (C2/C5) and third shell (C3/N4) atoms respectively. The Cu-N-Cx angles were as follows: Cu-N-C2 126, Cu-N-C3 - 126, Cu-N-N4 163, Cu-N-C5 -163. c Coordination numbers are generally considered accurate to ± 25% d In any one fit, the statistical error in bond-lengths is ±0.005 Å. However, when errors due to imperfect background subtraction, phase-shift calculations, and noise in the data are compounded, the actual error is probably closer to ±0.02 Å. e Debye-Waller factors are quoted as 2σ2

6.4 Summary

In conclusion, we successfully applied circular permutation to azurin. The resulting mutants, cpAz1 and cpAz2, showed similar electronic absorption and EPR spectra as wild type. The crystal structure of cpAz2 and EXAFS of both mutants indicate overall structure and the T1 copper center are similar to those of wild type, too.

133

6.5 References

1. Adman, E. T. (1991) Copper protein structures, Adv. Protein Chem. 42, 145-197. 2. Vallee, B. L., and Williams, R. J. (1968) Metalloenzymes: the entatic nature of their active sites, Proceedings of the National Academy of Sciences 59, 498-505. 3. Malmström, B. G. (1994) Rack-induced bonding in blue-copper proteins, Eur. J. Biochem. 223, 711-718. 4. Gray, H. B., Malmström, B. G., and Williams, R. J. P. (2000) Copper coordination in blue proteins, J. Biol. Inorg. Chem. 5, 551. 5. Roberts, E., Eargle, J., Wright, D., and Luthey-Schulten, Z. (2006) MultiSeq: unifying sequence and structure data for evolutionary analysis, BMC Bioinformatics 7, 382. 6. Heinemann, U., and Hahn, M. (1995) Circular permutation of polypeptide chains: implications for protein folding and stability, Prog. Biophys. Mol. Biol. 64, 121-143. 7. Baird, G. S., Zacharias, D. a., and Tsien, R. Y. (1999) Circular permutation and receptor insertion within green fluorescent proteins, Proc. Natl. Acad. Sci. U. S. A. 96, 11241-11246. 8. Boissinot, M., Karnas, S., Lepock, J. R., Cabelli, D. E., Tainer, J. a., Getzoff, E. D., and Hallewell, R. a. (1997) Function of the Greek key connection analysed using circular permutants of superoxide dismutase, The EMBO journal 16, 2171- 2178. 9. Wieligmann, K., Norledge, B., Jaenicke, R., and Mayr, E. M. (1998) Eye lens betaB2-crystallin: circular permutation does not influence the oligomerization state but enhances the conformational stability, J. Mol. Biol. 280, 721-729. 10. Marshall, N. M., Garner, D. K., Wilson, T. D., Gao, Y.-G., Robinson, H., Nilges, M. J., and Lu, Y. (2009) Rationally tuning the reduction potential of a single cupredoxin beyond the natural range, Nature 462, 113. 11. Phillips, J. C., Braun, R., Wang, W., Gumbart, J., Tajkhorshid, E., Villa, E., Chipot, C., Skeel, R. D., Kalé, L., and Schulten, K. (2005) Scalable molecular dynamics with NAMD, J. Comput. Chem. 26, 1781-1802. 12. Nar, H., Messerschmidt, A., Huber, R., Kamp, M. V. D., and Canters, G. W. (1991) Crystal Structure Analysis of Oxidized Pseudomonas A pH-induced 134

Conformational Transition Involves a Peptide Bond Flip, J. Mol. Biol. 211, 765- 772. 13. Vanommeslaeghe, K., Hatcher, E., Acharya, C., Kundu, S., Zhong, S., Shim, J., Darian, E., Guvench, O., Lopes, P., Vorobyov, I., and Mackerell, A. D. (2009) CHARMM general force field: A force field for drug-like molecules compatible with the CHARMM all-atom additive biological force fields, J. Comput. Chem. 31, 671-690. 14. Sieracki, N. A., Hwang, H. J., Lee, M. K., Garner, D. K., and Lu, Y. (2008) A temperature independent pH (TIP) buffer for biomedical biophysical applications at low temperatures, Chem. Commun. (Cambridge, U. K.), 823-825. 15. Nilges, M. J., Matteson, K., and Bedford, R. L. (2007) SIMPOW6: A software package for the simulation of ESR powder-type spectra., In ESR Spectroscopy in Membrane Biophysics (Hemminga, M. A., and Berliner, L., Eds.), Springer, New York. 16. George, G. N. (1990) EXAFSPAK, Stanford Synchrotron Radiation Labora tory, Menlo Park, CA. 17. Binsted, N., Gurman, S. J., and Campbell, J. W. (1998) EXCURVE, 9.2, Daresbury Laboratory, Warrington, England. 18. Gurman, S. J., Binsted, N., and Ross, I. (1984) A rapid, exact curved-wave theory for EXAFS calculations, Journal of Physics C: Solid State Physics 17, 143. 19. Gurman, S. J., Binsted, N., and Ross, I. (1986) A rapid, exact, curved-wave theory for EXAFS calculations. II. The multiple-scattering contributions, Journal of Physics C: Solid State Physics 19, 1845. 20. Binsted, N., and Hasnain, S. S. (1996) State-of-the-Art Analysis of Whole X-ray Absorption Spectra, J. Synchrot. Radiat. 3, 185-196. 21. Clark, K. M., Yu, Y., Marshall, N. M., Sieracki, N. A., Nilges, M. J., Blackburn, N. J., van der Donk, W. A., and Lu, Y. (2010) Transforming a Blue Copper into a Red Copper Protein: Engineering Cysteine and Homocysteine into the Axial Position of Azurin Using Site-Directed Mutagenesis and Expressed Protein Ligation, J. Am. Chem. Soc. 132, 10093.

135

22. Vagin, A., and Teplyakov, A. (1997) MOLREP: an Automated Program for Molecular Replacement, J. Appl. Crystallogr. 30, 1022-1025. 23. (1994) The CCP4 suite: programs for protein crystallography, Acta Crystallogr D Biol Crystallogr 50, 760-763. 24. Adams, P. D., Afonine, P. V., Bunkoczi, G., Chen, V. B., Davis, I. W., Echols, N., Headd, J. J., Hung, L.-W., Kapral, G. J., Grosse-Kunstleve, R. W., McCoy, A. J., Moriarty, N. W., Oeffner, R., Read, R. J., Richardson, D. C., Richardson, J. S., Terwilliger, T. C., and Zwart, P. H. (2010) PHENIX: a comprehensive Python- based system for macromolecular structure solution, Acta Crystallographica Section D 66, 213-221. 25. Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular graphics, Acta Crystallographica Section D 60, 2126-2132. 26. Garner, D. K. (2008) In Chemistry, University of Illinois at Urbana, Champaign, Urbana. 27. Lancaster, K. M., Sproules, S., Palmer, J. H., Richards, J. H., and Gray, H. B. (2010) Outer-Sphere Effects on Reduction Potentials of Copper Sites in Proteins: The Curious Case of High Potential Type 2 C112D/M121E Pseudomonas aeruginosa Azurin, J. Am. Chem. Soc. 132, 14590. 28. Nar, H., Messerschmidt, A., Huber, R., Vandekamp, M., and Canters, G. W. (1991) Crystal structure analysis of oxidized Pseudomonas aeruginosa azurin at pH 5.5 and pH 9.0. A pH-induced conformational transition involves a peptide bond flip., J. Mol. Biol. 221, 765-772. 29. Salgado, E. N., Lewis, R. A., Faraone-Mennella, J., and Tezcan, F. A. (2008) Metal-Mediated Self-Assembly of Protein Superstructures: Influence of Secondary Interactions on Protein Oligomerization and Aggregation, J. Am. Chem. Soc. 130, 6082-6084. 30. Salgado, E. N., Ambroggio, X. I., Brodin, J. D., Lewis, R. A., Kuhlman, B., and Tezcan, F. A. (2010) Metal templated design of protein interfaces, Proceedings of the National Academy of Sciences 107, 1827-1832. 31. Salgado, E. N., Radford, R. J., and Tezcan, F. A. (2010) Metal-Directed Protein Self-Assembly, Acc. Chem. Res. 43, 661-672.

136

32. Hart, P. J., Nersissian, A. M., and George, S. D. (2006) Copper Proteins with Type 1 Sites, In Encyclopedia of Inorganic Chemistry, John Wiley & Sons, Ltd. 33. Garner, D. K., Vaughan, M. D., Hwang, H. J., Savelieff, M. G., Berry, S. M., Honek, J. F., and Lu, Y. (2006) Reduction Potential Tuning of the Blue Copper Center in Pseudomonas aeruginosa Azurin by the Axial Methionine as Probed by Unnatural Amino Acids, J. Am. Chem. Soc. 128, 15608.

137