Proc. Natl. Acad. Sci. USA Vol. 88, pp. 3584-3588, May 1991 Developmental Biology Cytoplasmic protein binding to highly conserved sequences in the 3' untranslated region of mouse protamine 2 mRNA, a translationally regulated transcript of male germ cells (spermatogenesis/stored mRNA/gel retardation assay/UV-crosslinklig/postmeiotic genes) YUNHEE K. KWON AND NORMAN B. HECHT* Department of Biology, Tufts University, Medford, MA 02155 Communicated by Liane B. Russell, January 22, 1991 (receivedfor review November 22, 1990)

ABSTRACT The expression of the protamines, the pre- tional control (12-14). Their genes are transcribed solely in dominant nuclear proteins of mammalian spermatozoa, is round spermatids, and their mRNAs are stored in the sper- regulated translationally during male germ-cell development. matid cytoplasm from 3 days to 7 days before being trans- The 3' untranslated region (UTR) of protamine 1 mRNA has lated. been reported to control its time of translation. To understand The studies of Braun et al. (4) have demonstrated that in the mechanisms controlling translation of the protamine transgenic mice the translation of the transcript of a prota- mRNAs, we have sought to identify cis elements of the 3' UTR mine 1 (Prm-1) fusion construct is controlled by the 3' UTR of protamine 2 mRNA that are recognized by cytoplasmic of Prm-1 mRNA. When the Prm-1-hGH (human growth factors. From gel retardation assays, two sequence elements hormone) fusion construct contains the 3' UTR of hGH, are shown to form specific RNA-protein complexes. Protein transcription and translation both occur in the round sper- binding sites of the two complexes were determined by RNase matid. Replacement of the hGH 3' UTR with that of Prm-1 T1 mapping, by blocking the putative binding sites with delays translation to the time when the endogenous prota- antisense oligonucleotides, and by competition assays. The mine mRNAs are translated in elongated spermatids. Thus, sequences of these elements, located between nucleotides +537 cis elements of the 3' UTR of Prm-1 mRNA act to delay and +572 in protamine 2 mRNA, are highly conserved among translation of the fusion construct transcript. postmeiotic translationally regulated nuclear proteins of the mammalian testis. Two closely linked protein binding sites To understand the regulatory mechanisms controlling the were detected. UV-crosslinking studies revealed that a protein translation of the protamine mRNAs during spermiogenesis, ofabout 18 kDa binds to one of the conserved sequences. These we have sought to identify essential cis-acting elements ofthe data demonstrate specific protein binding to a highly conserved 3' UTR of Prm-2 mRNA that are recognized by cytoplasmic 3' UTR of translationally regulated testicular mRNA. factors. Here, we show that conserved sequence elements in the 3' UTR of Prm-2 mRNA form specific RNA-protein The utilization of functional mRNAs in the cytoplasm of complexes, and a protein of about 18 kDa binds to one of the eukaryotic cells can be regulated by controlling the stability conserved sequences. of individual mRNAs or by altering their ability to bind ribosomes and be translated. There is growing evidence that MATERIALS AND METHODS the 5' and 3' untranslated regions (UTRs) of mRNAs play important roles in modulating mRNA translation (1-4). One Preparation of Tissue Extract. S100 cytoplasmic extracts of the best-studied examples of translational regulation me- were prepared from the testes ofadult male CD-1 mice by the diated by protein-UTR interactions involves cellular iron procedure of Dignam et al. (15). metabolism in eukaryotic cells (2, 3). Sequences called iron- Preparation of Plasmid Constructs and RNA Transcripts. responsive elements (IREs) have been identified within the The following 32P-labeled RNAs containing various lengths of UTRs of ferritin and the transferrin receptor mRNAs. The the 3' UTR of Prm-2 were transcribed from pGem plasmids: binding of a protein to an IRE represses translation when the (i) transcript a, 161 nucleotides (nt) consisting of 41 nt of IRE is located within the 5' UTR ofthe ferritin mRNA (7, 8). polylinker sequence, 20 nt of coding region, and the first 100 Binding of the same protein to the IREs in the 3' UTR of the nt of the 3' UTR of Prm-2; (ii) transcript b, 133 nt consisting transferrin receptor mRNA increases the utilization of this of83 nt of 3' UTR, 17 nt ofpoly(A)+, and 33 nt of polylinker; mRNA by inhibiting its degradation (9). (iii) transcript c, 67 nt consisting of42 nt of 3' UTR and 25 nt During spermatogenesis, male germ cells differentiate from of polylinker; and (iv) transcript d, 84 nt consisting of 48 nt a population of diploid stem cells, spermatogonia, to haploid ofthe 3' UTR, 17 nt ofpoly(A)+, and 19 nt ofpolylinker (Fig. spermatozoa. The developing male germ cell undergoes L4) . The 3' UTR of hGH mRNA consists of a 130-nt meiosis and enters spermiogenesis, the haploid phase of transcript with 92 nt of 3' UTR, 9 nt of poly(A)+, and 29 nt spermatogenesis, where there are massive changes in cell of polylinker. A control pGem RNA of 172 nt was prepared structure as the round spermatid transforms into the species- by transcribing the Riboprobe positive control template specific shaped spermatozoon (10, 11). Since transcription (Promega). Single-stranded templates containing the phage ceases during midspermiogenesis in mammals, many of the T7 promoter were used to synthesize transcripts Y and H spermatid and spermatozoan proteins are encoded by (16). Labeled and unlabeled transcripts were generated in mRNAs that are stored as ribonucleoproteins (mRNPs). The vitro from the above templates with SP6 or T7 RNA poly- protamines and transition proteins, structural DNA-binding merase by using the protocol of the supplier (Promega). proteins, are among the proteins synthesized under transla- Abbreviations: Prm-1 and Prm-2, mouse protamines 1 and 2; UTR, The publication costs of this article were defrayed in part by page charge untranslated region; hGH, human growth hormone; nt, nucleo- payment. This article must therefore be hereby marked "advertisement" tide(s); RNP, ribonucleoprotein. in accordance with 18 U.S.C. §1734 solely to indicate this fact. *To whom reprint requests should be addressed. 3584 Downloaded by guest on October 1, 2021 Developmental Biology: Kwon and Hecht Proc. Natl. Acad. Sci. USA 88 (1991) 3585 Full-length transcripts were isolated from urea/6-20% poly- isolated RNAs were digested to completion with 10 units of acrylamide gels. RNase T1, boiled in formamide buffer, and analyzed by Assays of RNA-Protein Complexes. Binding assays were electrophoresis in a urea/25% polyacrylamide gel. performed by a modified procedure of Leibold and Munro Crosslinking ofRNA-Protein Complexes. Binding reactions (7). After elution from a polyacrylamide gel, isolated RNAs were performed as described above except that the amounts were heated at 70'C for 15 min and cooled slowly to room of RNA and RNase T1 were changed to 105 cpm/0.5 ng and temperature. This produced uniform secondary structures in 0.2-0.7 unit, respectively (7). The reaction products were the RNA and yielded one major RNA band in a nondenatur- irradiated on ice in a UV Stratalinker 1800 (Stratagene) with ing polyacrylamide gel. Radiolabeled RNAs (3 x 104 cpm/0.5 a 254-nm, 8-W UV bulb (maximum intensity, 3.6 mV/cm2) ng) were incubated with 40-100 pug of S100 cytoplasmic and were resolved in a SDS/12.5% polyacrylamide gel (19). extract in 20 mM Hepes, pH 7.6/3 mM MgCl2/40 mM KCI/2 mM dithiothreitol/5% (wt/vol) glycerol in a volume of 25 ,gl for 20 min at 23TC. The samples were then digested for 10 min RESULTS at 230C with RNase T1 (0.6-1.0 unit) and incubated with RNA-Protein Binding of the 3' UTR of Prm-2. The 3' UTRs heparin (5 mg/ml) for an additional 10 min at 230C. RNA- of mRNAs encoding mammalian protamines and transition protein complexes were resolved in 4% nondenaturing poly- proteins sequenced to date contain several conserved se- acrylamide gels run at 16 V/cm for about 3 hr at 4°C (17). quences. These sequences in Prm-2 mRNA are denoted Y, Isolation of RNA-Protein Complexes and RNase T1 Map- H, and Z (Fig. L4). ping. RNase T1 mapping was performed as described by To investigate the binding of cytoplasmic trans-acting Leibold and Munro (7) with the following modifications. factors to the Y, H, and Z sequences, 32P-labeled transcripts After protein binding and RNase T1 digestion, the protected for subclones a, b, c, and d of the 3' UTR of Prm-2 mRNA RNA fragments were isolated by electroelution from the were incubated with a S100 cytoplasmic testicular extract, native gel, followed by extraction with phenol and, after and RNA-protein complexes were resolved in a nondena- addition oftRNA (2.5 ,ug/ml), precipitation with ethanol. The turing polyacrylamide gel. RNA-protein complexes were detected with transcripts from clones a, b, and c (Fig. 1B). A CTGAGCCCTGAGCTGCCAAGGAGCCACGAGATCTGA These complexes were not found when the protein extract CTGGAGCCAAGGAA5 ATAGTCACCTGCC AAAGCCACCTGCC was previously digested with proteinase K or heat-denatured +411 C613 (data not shown). No complexes were detected with tran- BanI y 9 Taq I y B 12 PIyA , zs H Z An script d, with control pGem RNA, or with the 3' UTR ofhGH TAA mRNA. To remove proteins bound nonspecifically to the a LLD RNA, heparin (Fig. 2, lane 3) or RNase T1 and heparin (Fig. c d 2, lane 4) were added to the incubation mixture. The con- centrations of MgCI2 and KCl were adjusted for maximal olioH RNA-protein binding. Two distinct complexes, U and L, were resolved when radiolabeled transcripts b or c were incubated with cytoplas- B mic extract (Fig. 1). These contain both the Y and a b c d pGem RNA hGH 3UT transcripts H homology sequences of the 3' UTR of Prm-2 mRNA. The R E R E R E R E R E R E formation of both complexes was rapid, occurring within 1 min (data not shown). A small amount of RNA-protein complex with an electrophoretic mobility similar to the U complex was also formed with transcript a. It may be a result of protein binding to Y', a sequence similar to Y (Fig. 1A). To determine the specificity of the U and L complexes, RNA competition assays were performed (Fig. 2). Protein u - binding to radiolabeled transcript c was abolished with a L - a 15-fold molar excess of unlabeled transcript c (Fig. 2, lane 6), whereas nonspecific competitors such as pGem RNA (Fig. 2, lanes 10-13) or yeast tRNA (data not shown) at concentra- tions up to 450-fold molar excess did not reduce binding. These results show that cytoplasmic proteins bind to specific sequences of the 3' UTR of Prm-2 mRNA. Identification of Protected RNA Sequences by RNase T1 Mapping. To define the regions in the 3' UTR of Prm-2 mRNA protected by cytoplasmic proteins, RNase T1 map- FIG. 1. Formation of specific RNA-protein complexes between ping was used (7). The protein-protected fragments of 32P_ the 3' UTR of Prm-2 mRNA and mouse testicular cytoplasmic extracts. (A) Map of the 3' region of the Prm-2 mRNA with specific labeled transcript b were isolated from the complexes, di- transcripts indicated (a-d). Restriction enzyme sites, the termination gested with RNase T1, which cleaves 3' of guanosine resi- codon (TAA), the polyadenylylation signal (PolyA), and the start of dues, and analyzed on 25% polyacrylamide gels. Protected polyadenylylation (A") are marked on the diagram. Y, H, and Z RNA fragments ofabout 35-45 nt were detected (Fig. 3, lane represent the conserved sequences of the 3' UTR, while Y' and Z' 2). Digestion of control full-length transcript b with RNase T1 represent sequences homologous to Y or Z. (B) Gel retardation generated oligonucleotides of the following sizes: two of 10 assays of 32P-labeled transcripts (a-d) incubated with cytoplasmic nt, one of 7 nt, seven of 5 nt, five of 4 nt, four of 3 nt, and six extract. Free transcript is seen in the left lane (R) of each binding of 2 nt (Fig. 3, lane 3). Complete RNase T1 digestion of the assay. The right lane (E) contains RNA incubated with extract. protein-protected fragments yielded a subset of these oligo- Transcript c migrates faster after annealing, probably because of a the ones not change in secondary structure. U, upper complex; L, lower complex. nucleotides, with missing presumably protected The reduction of RNA amount in the RNA-protein lanes (lanes E), by protein (Fig. 3, lane 4). Densitometric analysis revealed especially seen with the pGEM and hGH 3' UTR RNAs, is the result nine missing oligonucleotides: two of 10 nt, one of 7 nt, three of the digestion of the uncomplexed RNAs by RNase T1. The of 5 nt, one of 4 nt, and two of 2 nt. In the entire 133 nt of digested RNA fragments of the hGH 3' UTR RNA ran off the gel. transcript b, there was only one possible 7-nt fragment Downloaded by guest on October 1, 2021 3586 Developmental Biology: Kwon and Hecht Proc. Natl. Acad. Sci. USA 88 (1991)

Specific Nonspecific 1 2 3 4 0 5 15 30 90 150 15 90 150 450x Competitor

133 -_

67 N

42>0

Ni 28> a L -* ,,A L

a

1 2 3 4 5 6 7 8 9 10 11 12 13 10o 410 FIG. 2. The protein binding to the 3' UTR of Prm-2 mRNA is specific. 32P-labeled transcript c was incubated with cytoplasmic extract, followed by the sequential addition of RNase T1 and heparin. Lanes: 1, free RNA; 2, RNA and cytoplasmic extract; 3, RNA and cytoplasmic extract plus heparin; 4, RNA and cytoplasmic 47 extract plus sequential treatment with RNase T1 and heparin. Unlabeled transcript c at a molar excess of 5- to 150-fold (lanes 5-9) or unlabeled pGem RNA at a molar excess of 15- to 450-fold (lanes 10-13) was incubated with cytoplasmic extract before the labeled 13J5 transcript c was added. U, upper complex; L, lower complex. & 44 generated by RNase Ti. It is located within the Z sequence H 3 (Fig. 4). Adjacent to this sequence are one fragment of 10 nt, one of 4 nt, and several of 5 nt. These oligonucleotides were absent in the digest generated from the protein-protected RNA fragments (Fig. 4). Since the only other 10-nt fragment FIG. 3. RNase T1 mapping of Prm-2 3' untranslated RNA se- is in the polylinker region of transcript b, a region that we quences protected by protein. Protected transcript b labeled with know does not bind protein, we believe that the protected [32P]GTP was isolated from RNA-protein complexes after the bind- RNA fragments of transcript b contain the Y and H se- ing assay. The protected and intact transcripts b were digested completely with RNase T1 and resolved on a urea/25% polyacryl- quences and about 20 nt upstream of the Y sequence. RNase amide gel. Oligonucleotide size markers are indicated in bases. Ti mapping of transcript c revealed a protected region of Lanes: 1, intact transcript b; 2, protected transcript b; 3, complete about 42 nt also containing the Y and H sequences (data not RNase T1 digestion of intact transcript b; 4, complete RNase T1 shown). We were not able to determine the exact boundaries digestion of protected transcript b. ofthe protected fragment because transcripts b and c contain many guanosine residues, resulting in a large number of seen (Fig. 5B, lane 6). When antisense H and Y oligonucle- oligonucleotides of3, 4, or 5 nt after RNase Ti digestion and, otides containing the 6 nt between the Y and H sequences more importantly, because we were mapping a mixed pop- (aY29, aH28) were hybridized to transcript c, the formation of ulation of two RNA-protein complexes (U and L). We can both complexes was prevented (Fig. 5B, lanes S and 7). conclude, however, that protein binds to the conserved Y and Hybridization ofcontrol sense oligonucleotides Y and H with H elements but not the Z element. transcript c did not affect the formation of either complex Determination of RNA Elements in the U and L Complexes. (Fig. 5B, lanes 8 and 9). In the absence ofthe U complex, the To identify the precise RNA binding elements of the U and L complex often migrated slowly on native gels. This was L complexes, we utilized several 32P-labeled oligonucleotides seen when the L complex was formed with the H28 transcript for binding studies (Fig. 5A). In addition to the Y and H (Fig. SB, lane 2) or when the formation ofthe U complex was conserved sequences, we used Y and H elements (Y29 and blocked with antisense oligonucleotide aY23 (Fig. SB, lane 6). H28) that also contain the 6 nt between the Y and H regions. Additional support for two distinct complexes was pro- Gel retardation assays showed that the Y29 sequence bound vided by oligonucleotide competition assays (Fig. SC). When protein to form the U complex, whereas the H sequence unlabeled Y29 transcript was added to the binding assay, the formed the L complex (Fig. SB, lanes 1 and 2). Transcripts amount of U complex formed with transcript c was substan- containing the Y23 or H22 sequences only formed reduced tially diminished (Fig. 5C, lanes 5-7). When unlabeled tran- amounts of the complexes (data not shown). script H28 was similarly used as competitor, the L complex To confirm the RNA sequences required for the U and L disappeared (Fig. SC, lanes 2-4). These data indicate that the complex formation, we hybridized specific antisense oligo- U and L RNA-protein complexes are derived from closely nucleotides to 32P-labeled transcript c to block putative linked but distinct protein-binding sites. protein binding sites (Fig. 5B). No protein complexes formed Characterization of Binding Proteins by UV-Crossling. with RNA-DNA hybrids of the Prm-2 3' UTR. When tran- To identify the protein components ofthe complexes formed script c was hybridized with an antisense oligonucleotide to with the 3' UTR of Prm-2 mRNA, we used UV-crosslinking the H sequence (aH22), only the U complex was detected to covalently bind proteins to labeled RNAs. Using our (Fig. SB, lane 4). When an antisense oligonucleotide to the Y standard binding conditions with transcript c, we detected sequence (aY23) was hybridized, only the L complex was increasing amounts of a 32-kDa RNA-protein complex with Downloaded by guest on October 1, 2021 Developmental Biology: Kwon and Hecht Proc. Natl. Acad. Sci. USA 88 (1991) 3587

y H z +529 +613 gaatactcaagcttgcatgcctgcagGTCGATGTCTGAGCCCTGAGCTGCCAAGGAGCCACGAGATCTGAGTACTGAGCAAAGCCACCTGCCAAATAAAGCTTGACACGAG ( A 8 A A A A A AAA A AA A A A AA A A A A A A A A A A A A A aS 4 4 4 3 3 3 4 2 5 2 3 5 2 5 2 5 2 [f j EJ Erl El FE m FIG. 4. Sequence of transcript b. RNase T1 digestion sites are indicated by arrowheads. Numbers indicate the sizes of the oligonucleotides produced by RNase T1 digestion. The Y, H, and Z conserved sequences are indicated with a line above the sequences. An asterisk indicates the 7-nt oligonucleotide unique to transcript b. Boxed numbers indicate the fragments that are missing from the protected RNA. The lowercase letters represent polylinker sequence and the capital letters represent the Prm-2 sequence. UV doses up to 10 min (Fig. 6, lanes 2-6). When the crosslinked complex was detected after UV-irradiation (Fig. complexes were incubated with proteinase K before UV- 6, lanes 13 and 14). The addition of large amounts of unla- crosslinking, no RNA-protein complexes were seen (Fig. 6, beled competitor H28 also did not inhibit UV-crosslinking of lane 12). The UV-crosslinked complex was also diminished the 32-kDa RNA-protein complex formed with transcript c by prior addition of unlabeled transcript c (Fig. 6, lanes 7 and (Fig. 6, lane 11). These data indicate that a protein of about 8) or unlabeled transcript Y29 (Fig. 6, lane 10). However, a 18 kDa binds to the Y sequence but not to the H sequence. 500-fold excess of unlabeled nonspecific pGem RNA (Fig. 6, lane 9) did not substantially reduce the amount of complex detected. DISCUSSION Since we estimate a protected region of about 42 nt (about We have demonstrated that cytoplasmic testicular proteins 14 kDa) in transcript c, the contribution of protein to the bind to two conserved sequences in the 3' UTR of Prm-2 32-kDa RNA-protein complex is about 18 kDa. This is mRNA. The RNA-protein binding is specific to the 3' UTR consistent with the estimated size of the protein crosslinked sequences because a 15-fold excess of unlabeled 3' UTR to transcript Y29 forming a more rapidly migrating RNA- prevents formation of the complexes and no reduction in protein complex of about 27 kDa (Fig. 6, lanes 15 and 16). binding is seen with nonspecific competitor RNAs. The Even though transcript H28 forms the L complex, no binding protein(s) is cytoplasmic because no complexes are formed with nuclear testicular extracts (data not shown). We A H do not know whether cytoplasmic extracts from other tissues +529 contain one or more similar proteins. c The RNA-protein binding sites of the 3' UTR of Prm-2 mRNA are localized to two conserved sequence elements, Y Y29 and H. RNase Ti mapping reveals no complex formation Y23 with the Z sequence, a third highly conserved protamine H22 sequence adjacent to the polyadenylylation signal, that con- H28 tains a sequence present in an immunoglobulin enhancer (21).

B UV (min) Competitor (ng) UV (min) Y29 H28 C aH2aH aY23 aY2 SH SY 0 3 5 10 15 150 250250250 250 5 10 5 10 - . *-_ . a-. _ s VU- U* 200 o 97 o

1 2 3 4 5 6 7 8 9 67 0 4 43 C H28 V29 30 100 300 30 100 300 43 P

U_ " " st 4 30 30 o ww*~~~~~ _ *1 8 1 2 3 4 5 6 7 18> £_ 41 FIG. 5. Determination of protein-binding sites of the U and L complexes. (A) Map ofthe 3' region ofthe Prm-2 mRNA with specific 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 transcripts Y23, H22, and H28 and transcript c indicated. Y and H represent the conserved sequences. The Y and H transcripts also FIG. 6. UV-crosslinking of proteins to transcripts from the 3' contain 6 nt from the T7 promoter. (B) Control RNA-protein UTR of Prm-2. 32P-labeled RNA-protein complexes were formed complexes formed with Y29 (lane 1), H28 (lane 2), and transcript c and crosslinked with UV-irradiation and resolved by SDS/PAGE. (lane 3). Antisense and sense oligonucleotides were hybridized to Lanes: 1, free 32P-labeled transcript c; 2-6, transcript c-protein 32P-labeled transcript c at molar ratios of 1.0-1.2, and binding assays complexes irradiated with UV light for 0-15 min; 7-11, transcript c were performed. Lanes 4-9 contain antisense oligonucleotides to (0.5 ng) crosslinked for 5 min in the presence of unlabeled transcript H22, H28, Y23, and Y29 (aH22, aH28, aY23, and aY29) (lanes 4-7) and c (lanes 7 and 8), in the presence of nonspecific competitor (lane 9), sense oligonucleotides to H22 and Y29 (sH22 and sY29) (lanes 8 and 9). in the presence of unlabeled Y28 (lane 10), and in the presence of (C) Competition assays with unlabeled H28 and Y29 transcripts. unlabeled H28 (lane 11); 12, proteinase K (100 ,ug/ml) incubated with Lanes: 1, control transcript c-protein complex; 2-7, 32P-labeled the RNA-protein complex for 30 min at 37°C before UV irradiation transcript c (3 x 104 cpm; 0.5 ng) incubated with cytoplasmic extract for 5 min; 13 and 14, 32P-labeled H28 and protein UV-irradiated for in the presence of30- to 300-fold molar excess ofunlabeled H28 (lanes 5 or 10 min; 15 and 16, 32P-labeled Y29 and protein UV-irradiated for 2-4) or Y29 (lanes,5-7). 5 or 10 min. Molecular mass markers are indicated in kDa. Downloaded by guest on October 1, 2021 3588 Developmental Biology: Kwon and Hecht Proc. Natl. Acad. Sci. USA 88 (1991) Binding assays with Y or H transcripts reveal that the two 3' UTRs share great homology among many mammalian complexes U and L are derived from two distinct binding species (5, 6, 10, 20). Not only are the sequences of these elements, Y and H. The formation of the U complex is elements conserved, but their order, 5'-Y-H-Z-3', adjacent to abolished with antisense oligonucleotides to Y23, Y29, and H28 the poly(A) addition signal, is also maintained. We have but not to H22 alone. Formation of the L complex is blocked detected RNA-protein complexes that have similar mobili- with antisense oligonucleotides to H22, H28, and Y29 but not ties to the ones presented here with Prm-1 and mouse to Y23 alone. These results imply that two binding sites are transition protein 1 (data not shown). These interactions closely linked and likely overlap a common 6-nt sequence. between the 3' UTRs and cytoplasmic proteins are likely to Thus, the RNA-protein interactions of one element may control translational regulation during spermiogenesis. sterically interfere with protein binding to the adjacent RNA element. Computer predictions of RNA secondary structure We are grateful to Drs. C. Moore and S. Ernst for helpful suggest that the protein binding sites of the U and L com- discussions. We thank L. Hake and Dr. D. Bunick for encourage- plexes contain a potential stem-loop structure in which the 6 ment and careful reading ofthis manuscript and Drs. E. Leibold and nt between Y and H regions are a part of'the stem. H. Munro for helpful advice about the gel retardation assay. We also Although we know that the U and L complexes of Prm-2 thank Dr. H. Goodman forthe kind gift ofthe hGH cDNA clone. This RNA contain different elements, we do not know whether work was supported by National Institutes of Health Grant GM more than one protein binds to the two sequences. We have 29224. shown from UV-crosslinking that the Y element binds a 1. Jackson, R. J. & Standart, N. (1990) Cell 62, 15-24. protein of about 18 kDa. However, we could not detect any 2. Aziz, N. & Munro, H. N. (1987) Proc. Natl. Acad. Sci. USA protein bound to the H element after UV-irradiation. We 84, 8478-8482. postulate that specific binding conformations ofthe H RNA- 3. Hentze, M. W., Caughman, S. W., Rouault, T. A., Barrioca- protein complex may not allow UV-crosslinking or that nal, J. G., Dancis, A., Harford, J. B. & Klausner, R. D. (1987) RNA-protein interaction is sufficiently weak so that little Science 238, 1570-1573. protein crosslinks under the conditions used. Our competi- 4. Braun, R. E., Peschon, J. J., Behringer, R. R., Brinster, R. L. tion studies with unlabeled Y and H transcripts suggest that & Palmiter, R. D. (1989) Genes Dev. 3, 793-802. the U and L complexes contain different protein components, 5. Heidaran, M. A., Kozak, C. A. & Kistler, W. S. (1989) Gene since Y or H sequences only compete with the formation of 75, 39-46. 6. Krawetz, S. A., Connor, W. & Dixon, G. H. (1988) J. Biol. U or L complexes, respectively. However, we cannot ex- Chem. 263, 321-326. clude the possibility that the 18-kDa binding protein assumes 7. Leibold, E. A. & Munro, H. N. (1988) Proc. Natl. Acad. Sci. different conformations as a result of posttranslational mod- USA 85, 2171-2175. ifications or interaction with additional factors and could bind 8. Rouault, T. A., Hentze, M. W., Caughman, S. W., Harford, to the H element. J. B. & Klausner, R. D. (1988) Science 241, 1207-1210. Modulation of translation by protein binding to the 5' or 3' 9. Mullner, E. W., Neupert, B. & Kuhn, L. C. (1989) Cell 58, UTR of mRNAs has been implicated as a general cellular 373-382. regulatory mechanism for many genes including ferritin (22- 10. Hecht, N. B. (1990) J. Reprod. Fertil. 88, 679-693. 11. Hecht, N. B. (1986) in Experimental Approaches to Mamma- 24), transferrin receptor (9, 25), and creatine kinase (26). lian Embryonic Development, eds. Rossant, J. & Pedersen, R. Although the proteins and RNA elements of the ferritin and (Cambridge Univ. Press, New York), pp. 151-193. Prm-2 mRNAs differ, comparison of the RNA-protein com- 12. Kleene, K. C., Distel, R. J. & Hecht, N. B. (1984) Dev. Biol. plexes of ferritin and Prm-2 mRNAs reveals the strikingly 105, 71-79. similar interactions with cytoplasmic proteins (7, 22, 23). 13. Heidaran, M. A., Showman, R. M. & Kistler, W. S. (1988) J. Ferritin mRNA forms two complexes, B1 and B2, with Cell Biol. 106, 1427-1433. similar electrophoretic mobilities and high binding affinities 14. Yelick, P. C., Kwon, Y. K., Flynn, J. F., Borzorgzadeh, A., as we found for the U and L complexes with Prm-2 mRNA. Kleene, K. C. & Hecht, N. B. (1989) Mol. Reprod. Dev. 1, Furthermore, UV-crosslinked protein was detected only with 193-200. 15. Dignam, J. D., Lebovitz, R. M. & Roeder, R. G. (1983) Nu- the slower migrating complex for either mRNA. The protein- cleic Acids Res. 11, 1475-1489. binding elements of ferritin mRNA are also capable of 16. Milligan, J. F., Groebe, D. R., Witherell, G. W. & Uhlenbeck, forming a stem-loop structure, which appears essential for 0. C. (1987) Nucleic Acids Res. 15, 8783-8798. the RNA-protein interactions. 'Whether the 18-kDa protein 17. Konarska, M. M. & Sharp, P. A. (1986) Cell 46, 845-855. can inhibit translation of Prm-2 mRNA in a cell-free system 18. Sinclair, G. D. & Dixon, G. H. (1982) Biochemistry 21, 1869- as has been shown for the 90-kDa protein that binds to the 1877. ferritin B1 complex (24) is not known. 19. Moore, C. L., Chen, J. & Whoriskey, J. (1988) EMBO J. 7, Translational control and RNA-protein interactions are 3159-3169. particularly evident in early development (1). In oocytes 20. Maier, W. M., Adham, I., Klemm, U. & Engel, W. (1988) onto Nucleic Acids Res. 16, 11826. mRNPs are sequestered for months before moving 21. Johnson, P. A., Peschon, J. J., Yelick, P. C., Palmiter, R. D. polysomes. These stored mRNAs exist as mRNA-protein & Hecht, N. B. (1988) Biochim. Biophys. Acta 950, 45-53. complexes in which the protein component seems to act as a 22. Barton, H. A., Eisenstein, R. S., Bomford, A. & Munro, H. N. repressor of translation (27). In trout, polysomal protamine (1990) J. Biol. Chem. 265, 7000-7008. mRNAs can be readily translated in vitro while protamine 23. Leibold, E. A., Laudano, A. & Yu, Y. (1990) Nucleic Acids mRNPs do not translate in vitro unless treated with high salt Res. 18, 1819-1824. (18). The expression of the mammalian protamines and 24. Walden, W. E., Daniels-McQueen, S., Brown, P. H., Gaffield, transition proteins may be similarly regulated. Their mRNAs L., Russell, D. A., Bielser, D., Bailey, L. C. & Thach, R. E. are transcribed during spermiogenesis and stored as mRNPs (1988) Proc. Natl. Acad. Sci. USA 85, 9503-9507. later. 25. Koeller, D. M., Casey, J. L., Gerhardt, E. M., Chan, L. N., until translation days Upon translation, their polysomal Klausner, R. D. & Harford, J. B. (1989) Proc. Natl. Acad. Sci. mRNAs shorten as a result ofpartial deadenylylation (12, 28). USA 86, 3574-3578. We know from transgenic studies that the temporal expres- 26. Ch'Ng, J. L., Shoemaker, D. L., Schimmel, P. & Holmes, sion ofPrm-1 mRNA is controlled by its 3' UTR (4). Although E. W. (1990) Science 248, 1003-1006. the coding regions of the protamine and transition protein 27. Richter, J. D. (1988) Trends Biochem. Sci. 13, 483-486. mRNAs differ substantially, the Y, H, and Z elements in their 28. Kleene, K. C. (1989) Development 106, 367-373. Downloaded by guest on October 1, 2021